WO2014059381A1 - Mll3 germline breast cancer biomarkers and uses thereof - Google Patents

Abstract

A germline mutation located at human chromosome 7 is identified that provides a biomarker for human familial breast cancer. The biomarker is an MLL3 gene single point mutation located at an exon region, one of the single point mutation sites being located at exon 15 (position 2645, T to C) and a second single point mutation site being located at exon 16 (position 2726, G to A). The MLL3 gene mutations are Exon 15 c.T2645Cp.I882T and Exon 16 c.G2726Ap.R909K. The biomarkers are demonstrated to have a higher incidence in familial breast cancer patients compared to BRCA1 and BRCA2. Methods of identifying and treating a patient having familial breast cancer using the MLL3 gene exon mutations germline biomarker are also provided, as well as methods for identifying pharmaceutical agents for use in treating familial forms of human breast cancer.

Description

MLL3 Germline Breast Cancer Biomarkers and Uses Thereof

Cross-Reference to Related Applications

[0001] Priority is claimed to U.S. Provisional Application 61/712,523, filed October 11, 2012 which is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

Technical Field

[0002] The present invention relates to the field of the MLL3 gene, and mutations thereto, that are responsible for familial breast cancer. In particular, the present invention relates to germline mutations of the MLL3 gene at chromosome 7 that provide a biomarker for familial breast cancer. The present invention also relates to genetic screening methods and kits for identifying MLL3 mutations, and further relates to familial breast cancer diagnosis, screening and therapies of familial breast cancers associated with mutations of the MLL3 gene.

Background Art

[0003] Women whose relatives have had breast cancer are reported to be more prone to developing breast cancer (familial breast cancer). Familial breast cancer has been reported to constitute only 10-15% of total breast cancer cases. The genes BRCA1, BRCA2, tumor protein 53 (TP53), antaxia telangiectasia mutated gene (ATM), P65, RAB11FIP1, PTEN, rs4973768, r6504950 and RAD51C have been directly linked to familial breast cancer.

[0004] The most commonly used diagnostic tests for breast cancer include X-ray

(mammogram), breast ultrasound, biopsy, and breast MRI (magnetic resonance imaging) scan. However, the diagnosis of breast cancer based on genetic testing has become an integral part of the medical management of patients suspected or at risk of developing breast cancer. [0005] In the case of familial breast cancer, genetic analysis or genome studies are considered the most effective diagnostic tool. These genetic analysis/genome studies include somatic mutation and germline mutation analysis.

[0006] Somatic cell genome mutations are non-inheritable, and provide relatively little value as a biomarker for familial forms of breast cancer.

[0007] Germline mutations are heritable, and therefore are more valuable in providing a biomarker for familial forms of breast cancer. Germline mutations have been identified for the BRCAl and BRCA2 genes, and studied as a target for familial breast cancer detection. However, only 10% of familial breast cancer has been identified as carrying the BRCAl/2 mutation. BRCAl and BRCAl are currently the only high-penetrance genes for familial breast cancer, although numerous novel single-nucleotide polymorphisms and genetic loci conferring low-to-moderate risk or effect size (odds ratio <1.5) have been identified by genome- wide association studies of polygenic breast cancer. (Fanale et al. (Sept. 2011), Oncogene; Ghoussaine et al. (2012). Nat. Genet., 44: 312-318). Some of these common alleles have been reported to modify risk in BRCAl and BRCA2 mutations carriers. (Antoniou et al. (2011). Hum. Mil. Genet., 20:3304-3321). Unfortunately, the results from genome- wide association studies with the BRCAl and BRCAl mutation have proven to provide only limited value for individual risk prediction (Jostins, et al. (2011), Hum. Moil. Genet., 20: R182-R188), compared with the high-penetrance inherited mutations in causal genes for familial breast cancer. An analysis to evaluate the potential for individualized disease risk stratification based on common single-nucleotide polymorphisms identified by genome-wide association studies in breast cancer came to the conclusion that the clinical utility of single, common, low-penetrance genes for breast cancer risk prediction is currently quite limited (Hartman et al. (2011), Breast Cancer Res Treat., 127: 805-812). In order to progress and develop new and improved diagnostic tests for human breast cancer, a need for more predictive specific germline mutations in familial human breast cancer continues to exist.

[0008] The MLL3 gene is a member of a mixed -lineage leukemia (MLL) gene family. This family of genes plays an important role in histone methylation and transcription activation. Somatic mutations of the MLL3 gene have also been linked to prostate cancer (U.S. Pub. 20130225433, Chinnaiyan et al.), colorectal cancer, and breast cancer (U.S. Pub. 20100316995, Sjoblom). However, germline mutations of the MLL3 gene for familial breast cancer have not been identified.

[0009] Exom sequencing has recently been used to identify an MLL3 germ line mutation in a pedigree of colorectal cancer and acute myeloid leukemia (Wei-Dorg Li et al. (2013) Blood: 121: 1478- 1479.). However, a germline mutation of the MLL3 gene to be associated with familial breast cancer has not been reported.

[0010] The currently known mutation spectrum of breast cancer predisposition accounts for only -30% of high-risk breast cancer families, and no known predisposition information exists for the remaining 70% in spite of the apparent autosomal dominant pattern of inheritance seen in many affected families (16). Different approaches have been developed to address this enigma. Focusing on specific functional categories of the potential predisposition genes, e.g., searching for the genes interacting with BRCA1 or BRCA2, has resulted in limited success (9). Another approach is to use large sample sizes for association analysis, which often means enrolling over 10,000 cases per study, to enhance the statistical power of identifying the potential predisposition (11-14). Such an approach has detected 20-

30 new variants, but overall, they contribute only a small percentage of the disease burden

(17), and are unlikely to explain families with four or more cases of early onset disease.

Furthermore, many variants identified by association studies are located in either noncoding or intron regions, and their significance is difficult to interpret under current biologic knowledge. In order to achieve the long felt need for improved familial breast cancer detection methods, new concepts, new approaches and new technologies must be developed.

SUMMARY OF THE INVENTION

[0011] It is in view of the above problems that the present invention was developed.

[0012] The invention relates generally to germline mutations of the MLL3 gene that are indicative of breast cancer among a family group. In particular embodiments, the invention provides the disclosure of a germline mutation located at chromosome 7, and in particular, a point mutation at the MLL3 gene at chromosome 7, within a defined exon region of an exon 15 and an exon 16 region. These exon mutations have been found to provide predictive and robust biomarkers for familial breast cancer. In addition, and because the present invention has identified the predictive mutations within a specific exon region of the MLL3, analysis of a patient DNA sample does not require the sequencing of an entire patient DNA sequence, but rather a much shorter length corresponding to 1/1000 genome DNA content.

Conventional exon DNA extraction may be performed with a patient DNA sample as part of the claimed invention. As a consequence, analysis of a patient DNA sample using the herein described MLL3 exon mutant, may be performed for a fraction of the cost of whole genome sequence analysis and screening.

[0013] In particular embodiments, the two germline mutations of the MLL3 gene are located in the exon regions at exon 15 and exon 16, specifically described here as the exon 15 c.T2645Cp.I882T mutation and the Exon 16 c.G2726Ap.R909K mutation. These biomarkers were identified in 85% of familial breast cancer patients analyzed (48 patient samples).

[0014] The pool of familial breast cancer patients examined in identifying the MLL3 germline mutations included BRCAx families (3 families), BRCAx probands (17), and a BRCA1 + family. Using a number of analytic programs (5 programs), it was determined that the protein encoded by the MLL3 gene where the exon mutations were present would result in an altered MLL3 protein, with this MLL3 mutant protein having damaged properties compared to the MLL3 encoded protein from a sequence of the native MLL3 gene that was absent these specific mutations at exon 15 and exon 16.

[0015] The MLL3 exon-associated biomarkers of the present invention provide an alternative and improved genetic screening tool to BRCA1 and BRCA2 as an indicator of familial breast cancer. The more diagnostic and predictive MLL3 gene germline mutations identified in the present invention have been found to be present at much high frequency (85%) in familial breast cancer patients as compared to the frequency of the BRCA1 and BRCA2 (10%) germline mutations in a group of familial breast cancer patients. The advantages of the MLL3 germline familial breast cancer markers presented here include the finding that these specific MLL3 mutations are present at much higher frequencies than currently known breast cancer biomarkers for familial breast cancer diagnosis. The advantages of the MLL3 mutant biomarker include a much lower incidence of false-positive and false negative results for a patient suspected to have or at risk or having a predisposition for familial breast cancer. In addition, an added level of certainty of diagnosis aids in a reduction of patient associated anxieties associated with a false positive test result, in addition the expense of additional testing and/or surgeries and other treatments that may otherwise be pursued by the attending clinician. In addition, the present tests are much more economical to perform compared to other genetic tests for breast cancer, as only a much smaller sequence of DNA corresponding to the exon regions of the MLL3 gene need be sequenced to identify the presence or absence of the MLL3 mutation. [0016] In another aspect, the present invention provides a method for identifying potential breast cancer therapeutics and treatment methods employing the MLL3 gene exon mutations described herein as a target.

[0017] According to another aspect of the invention, a method is provided for diagnosing familial breast cancer in a human. In one embodiment, the method comprises obtaining a tissue sample from a patient, extracting a DNA sample from the tissue sample, and performing an analysis of the sample DNA to determine the presence of the exon 15 or exon 16 mutation of the MLL3 gene, its encoded mutant cDNA, or encoded mutant MLL3 protein, in the patient DNA sample. The presence or absence of the mutation in the patient DNA sample will be determined by comparison of the patient DNA sample sequence to a control MLL3 gene sequence corresponding to the exon regions of the MLL3 gene sequence.

[0018] Exon sequence of non-mutated MLL3 gene - 59 exons coding for 4,911 amino acid residues (Figure 9).

[0019] The particular MLL3 germ line mutation may comprise a mutation of the MLL3 gene at exon 15 c.T2645Cp.I882T, Exon 16 c.G2726Ap.R909K, or both. A patient sample identified to possess the MLL3 germ line mutation will be identified as having familial breast cancer, and an appropriate breast cancer clinical treatment (chemotherapy, radiation, surgical removal of tissue, a combination thereof, or other breast cancer treatment and/or therapeutic regimen, etc) may be provided to the patient. A patient sample identified as not having (absent) the MLL3 germline mutation will not be prescribed a breast cancer clinical treatment.

[0020] According to the described methods herein, the MLL3 germline mutation, its encoded cDNA, or protein, may be examined and compared to a control sample from a patient or patient population determined not to demonstrate the presence of the germline mutation of the MLL3 gene, the cDNA corresponding to the mutated MLL3 gene, or the protein encoded by the mutated MLL3 gene. In particular embodiments, the MLL3 germ line mutation are a mutation of the MLL3 gene at exon 15 c.T2645Cp.I882T, Exon 16

c.G2726Ap.R909K, or both.

[0021] In another embodiment, there is provided a method for treating familial breast cancer, comprising: providing an antibody directed against a mutant MLL3 protein sequence or peptide product; and delivering the antibody to affected tissues or cells in a patient having familial breast cancer as identified by the presence of the MLL3 gene at exon 15, exon 16 or both exon 15 and 16 as defined herein.

[0022] In accordance with another aspect of the present invention, a kit for carrying out the methods of the invention for the detection of MLL3 gene familial breast cancer. These kits may include nucleic acids having a sequence corresponding to the mutated MLL3 sequence, an instruction manual, polypeptides, and other reagents that may be needed in the

performance of the test.

[0023] In one aspect, the invention provides for a germline genetic biomarker for familial breast cancer in humans, said germline genetic biomarker comprising a mutated MLL3 exon 15 sequence, a mutated MLL3 exon 16 sequence, a cDNA sequence corresponding thereto, or an expression product thereof. The germline genetic biomarker has been demonstrated to be present at a higher incidence in an affected family member having breast cancer, than the incidence of a BRCA1 or BRCA2 germline mutation in familial breast cancer patients. The germline biomarker MLL3 mutation may be described as being present in over 80% of human familial breast cancer patients.

[0024] In particular embodiments, the germline biomarker is a single point mutation of exon

15 (exon 15 c.T2645Cp.I882T), exon Exon 16 (c.G2726Ap.R909K), or both. The MLL3 germ line mutation may be further described as a member of the mixed - lineage leukemia

(MLL) family, as an oncogene in leukemia, to possess 59 exons coding for 4,911 amino acid residues, as containing an AT-hook DNA binding domain, a DHHC-type zinc finger, 6-PHD- type fingers, a SET domain, a post -SET domain and an RING-type zinc finger.

[0025] In another aspect, a method for providing a treatment regimen for a human breast cancer patient having an MLL3 gene familial germline mutation is provided. In some embodiments, the method comprises obtaining a patient tissue sample and extracting DNA from said patient tissue sample to provide a test DNA, determining the presence or absence of a germline mutation of a mutant MLL3 exon 15 or exon 16 sequence, or corresponding cDNA sequence or expression product, in the test DNA, and providing a breast cancer treatment regimen to a patient where the test tissue DNA sample is identified to possess the MLL3 germ line mutation or not providing a breast cancer treatment to a patient having a test sample that is absent the MLL3 germline mutation. The breast cancer treatment may comprise chemotherapy, radiation, surgical removal of tissue, a combination thereof. The method provides for the use of a sequence that corresponds to an MLL3 exon sequence that includes a mutation at exon 15 c.T2645Cp.I882T, Exon 16 c.G2726Ap.R909K, or both of these mutations.

[0026] In some embodiments of the method, the step of determining the presence of the mutant MLL3 gene sequence is a step of measuring the amount of mRNA, cRNA, or cDNA of the mutant MLL3 gene having a mutant exon 15 or exon 16. The patient tissue may be a fresh frozen tissue, a whole blood tissue or a tumor tissue. Where the patient sample is a tumor tissue, the tumor tissue is a breast tumor tissue. In some embodiments, the patient test tissue is an FFPE preserved tissue.

[0027] In yet another aspect, a method for preparing a therapeutic agent for a human patient having a familial breast cancer characterized by an MLL3 exon gene mutation at exon 15 c.T2645Cp.I882T, Exon 16 c.G2726Ap.R909K, or both, is provided.

[0001] In yet another aspect, the invention comprises a DNA sequence comprising a nucleotide sequence ACCACTTTGGTGCTCCAAAT, AGCTTTGACTTGCCTCGGCC, or both, and further comprising a detectable label covalently linked thereto. Thus, the present invention provides for nucleic acid molecules that can further comprise a detectable label or provide for incorporation of a detectable label. This detectable label can be selected from the group consisting of an isotope, a fluorophore, an oxidant, a reductant, a nucleotide and a hapten. Detectable labels can be added to the nucleic acid by a chemical reaction or incorporated by an enzymatic reaction. The detectable label can be a radioactive element or a dye. In some aspects of the invention, the nucleic acid sequence may comprise a hybridization probe that further comprises a fluorescent label and a quencher, e.g. for use hybridization probe assays of the type known as Taqman® assays, available from AB Biosystems.

[0028] It will be appreciated by a skilled worker in the art that the identification of the genetic defect in a genetic disease, coupled with the provision of the DNA sequences of both normal and disease-causing alleles, provides the full scope of diagnostic and therapeutic aspects of such an invention as can be envisaged using current technology. Further features and advantages of the present invention, as well as the structure and operation of various embodiments of the present invention, are described in detail below with reference to the accompanying drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings, which are incorporated in and form a part of the specification, illustrate the embodiments of the present invention and together with the description, serve to explain the principles of the invention. In the drawings:

[0030] Figure 1 - Exome sequencing flow chart showing process by which an exome specification mutation may be identified out of a targeted genome sequence.

[0031] Figure 2 - Exome comparison of T cell (solid circle), B cell (hatched circle) and neutrophils (dotted circle) in the same individual; [0032] Figure 3 - Comparison of mutation data between FFPE and fresh frozen tumor. The diagram shows that there is a 90% overlap in detectable MLL3 mutations in genome material derived from a preserved FFPE tissue and genome material derived from fresh frozen tissue;

[0033] Figure 4 - illustrates two germline mutations in MLL3, a member of MLL family involved in early development and hematopoiesis.

[0034] Figure 5 - TCGA human breast cancer project detected only somatic mutations in MLL3 (6.9% in 500 Breast Cancer cases); MLL3: [Somatic Mutations Rate: 6.9%] arrows depict site of germline mutations. The two arrows identify the points on the MLL3 gene where the two germline mutations for MLL3 gene were found to occur.

[0035] Figure 6 - demonstrates that the BCRAl/2 is present in only 10% of familial breast cancer (arrows). In contrast, the MLL3 germline mutations in exon 15 and exon 16 are present in 85% of familial breast cancer.

[0036] Figure 7 - diagram depicts a BRCAx breast cancer family that was used in an exome sequencing analysis. The arrows depict those individuals within the family whose DNA was sequenced in the exome sequence analysis.

[0037] Figure 8 - figure demonstrates that the Wild-type BRCA1 in the family examined was confirmed by exome sequencing.

[0038] Figure 9a through 9j - complete exon sequence of non-mutated MLL3 gene.

[0039] Figure 1 OA - is the full native nucleotide sequence of the exon 15 of the MLL3 gene; Figure 10B - is the full length nucleotide sequence of the mutant exon 15 sequence; Figure IOC - is the full native nucleotide sequence of exon 16 of the MLL3 gene; Figure 10D - is the full length nucleotide sequencing the mutant exon 16 sequence; Figure 10E - is the mutated sequence of exonl5 C.T2645C p.I882T (20 nucleotides); Figure 1 OF - is the mutated sequence of Exon 16 C.G2726A p.R909K. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

[0040] The embodiments were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated.

[0041] As various modifications could be made in the constructions and methods herein described and illustrated without departing from the scope of the invention, it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting. Thus, the breadth and scope of the present invention should not be limited by any of the above-described exemplary

embodiments, but should be defined only in accordance with the following claims appended hereto and their equivalents.

[0042] All references disclosed herein are expressly incorporated by reference. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention.

Definitions:

[0043] The following definitions are used throughout the Specification and in the description of the present invention.

[0044] As used herein, the term "nucleic acid molecule" refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4-acetyl cytosine, 8-hydroxy-N-6-methyl adenosine, aziridinyl cytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-miouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1 -methyl guanine, 1-methylinosine, 2,2-dimethyl guanine, 2-methyladenine, 2-methyl guanine, 3- methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N- uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2- thiocytosine, and 2,6-diaminopurine.

[0045] The term "gene" refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA). The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length or fragments are retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full- length mRNA. Sequences located 5' of the coding region and present on the mR A are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript;

introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.

[0046] As used herein, the term "oligonucleotide," refers to a short length of single-stranded polynucleotide chain. Oligonucleotides are typically less than 200 residues long (e.g., between and 100), however, as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example a 24 residue oligonucleotide is referred to as a "24-mer". Oligonucleotides can form secondary and tertiary structures by self-hybridizing or by hybridizing to other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, cruciformis, bends, and triplexes.

[0047] As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules.

For example, the sequence "5'-A-G-T-3'," is complementary to the sequence "3'-T-C-A-5\"

Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids.

[0048] The term "homology" refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence is a nucleic acid molecule that at least partially inhibits a completely complementary nucleic acid molecule from hybridizing to a target nucleic acid is "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous nucleic acid molecule to a target under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target that is substantially non-complementary (e.g., less than about 30% identity); in the absence of non-specific binding the probe will not hybridize to the second non-complementary target.

[0049] As used herein, the term "hybridization" is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the T.sub.m of the formed hybrid, and the G:C ratio within the nucleic acids. A single molecule that contains pairing of complementary nucleic acids within its structure is said to be "self-hybridized."

[0050] As used herein the term "stringency" is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. Under "low stringency conditions" a nucleic acid sequence of interest will hybridize to its exact complement, sequences with single base mismatches, closely related sequences (e.g., sequences with 90% or greater homology), and sequences having only partial homology (e.g., sequences with 50-90% homology). Under medium stringency conditions," a nucleic acid sequence of interest will hybridize only to its exact complement, sequences with single base mismatches, and closely relation sequences (e.g., 90% or greater homology). Under "high stringency conditions," a nucleic acid sequence of interest will hybridize only to its exact complement, and (depending on conditions such a temperature) sequences with single base mismatches. In other words, under conditions of high stringency the temperature can be raised so as to exclude hybridization to sequences with single base mismatches.

[0051] The term "isolated" when used in relation to a nucleic acid, as in "an isolated oligonucleotide" or "isolated polynucleotide" refers to a nucleic acid sequence that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids as nucleic acids such as DNA and RNA found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. However, isolated nucleic acid encoding a given protein includes, by way of example, such nucleic acid in cells ordinarily expressing the given protein where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double-stranded form. When an isolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to express a protein, the oligonucleotide or polynucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide or

polynucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double-stranded). [0052] As used herein, the term "purified" or "to purify" refers to the removal of components (e.g., contaminants) from a sample. For example, antibodies are purified by removal of contaminating non-immunoglobulin proteins; they are also purified by the removal of immunoglobulin that does not bind to the target molecule. The removal of non- immunoglobulin proteins and/or the removal of immunoglobulins that do not bind to the target molecule results in an increase in the percent of target-reactive immunoglobulins in the sample. In another example, recombinant polypeptides are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.

[0053] As used herein, the term "sample" is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Such examples are not however to be construed as limiting the sample types applicable to the present invention.

[0054] The following abbreviations/nucleotide designations/amino acid designations are used throughout the present description of the invention:

Nucleotide codes Amino acid codes

S Strong (G or C) lie 1 Isoleucine

M Amino (A or C) Leu L Leucine

K Keto (G or T) Lys K Lysine

B Not A (G or C or T) Met M Methionine

H Not G (A or C or T) Phe F Phenylalanine

D Not C (A or G or T) Pro P Proline

V Not T (A or G or C) Ser s Serine

Thr T Threonine

Trp w Tryptophan

Tyr Y Tyrosine

Val V Valine

Asx B Asn or Asp

Glx z Gin or Glu

Xle J Leu or lie

Selenocvsteine

Sec u

(UGA)

Pyl 0 Pvrrolvsine (UAG)

Unk X Unknown

Standard genetic code

1st 2nd position 3rd

position position cue Leu CCC Pro CAC His CGC Arg C

CUA Leu CCA Pro CAA Gin CGA Arg A

CUG Leu CCG Pro CAG Gin CGG Arg G

AUU He ACU Thr AAU Asn AGU Ser U

AUC He ACC Thr AAC Asn AGC Ser C

AUA He ACA Thr AAA Lys AGA Arg A

AUG Met ACG Thr AAG Lys AGG Arg G

GUU Val GCU Ala GAU Asp GGU Gly U

GUC Val GCC Ala GAC Asp GGC Gly C

GUA Val GCA Ala GAA Glu GGA Gly A

GUG Val GCG Ala GAG Glu GGG Gly G

Special genetic codes

T1 12 T3 T4 T5 T6 T9 T10 T12 T13 T14 T15 T16 T21 T22 T23

UUA Leu - - - - - - - - - - - - - - Stop

CUU Leu - Thr - - - - - - - - - - - - - cue Leu - Thr - - - - - - - - - - - - -

CUA Leu - Thr - - - - - - - - - - - - -

CUG Leu - Thr - - - - - Ser - - - - - - -

AUA He Met Met - Met - - - - Met - - - Met - -

UCA Ser - - - - - - - - - - - - - Stop -

UAA Stop - - - - Gin - - - - Tyr - - - - - Special genetic codes

UAG Stop - - - - Gin - - - - - Gin Leu - Leu -

As

AAA Lys - - - - - - - - Asn - - - - - n

Tr

UGA Stop Trp Trp Trp Trp - Cys - Trp Trp - - Trp - - P

Se

AGA Arg Stop - - Ser - - - Gly Ser - - Ser - - r

Se

AGG Arg Stop - - Ser - - - Gly Ser - - Ser - - r

Experimental:

[0055] The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Example 1 - Materials and Methods

[0056] The present example is provided to describe the population of samples that were analyzed in the identification and characterization of the germline MLL3 mutations present in human breast cancer tissues.

Patient Populations:

Breast tissue DNA:

[0057] Two resources of familial breast cancer samples were utilized in the studies described herein. One of these resource groups was BRCA mutation family. There were 1,201 DNA samples available for analysis from this group of women (320 patients from this group were breast cancer patients, of which 279 were BRCA1+ and 41 were BRCA2+; 881 of the patients from this group were not breast cancer patients, of which 253 were BRAC1+ and 628 were BRCA2+). The second resource group was a non-BRCA mutation family. There were 601 DNA samples available for analysis from this group of women. (243 patients from this group were breast cancer patients, and 314 patients from this group were not breast cancer patients and were BRCA2+).

Blood Tissue DNA: The Eppley's Breast Cancer Collaborative registry (BCCR)

[0058] Samples were collected from a joint registry of nine breast cancer centers. Over 1,300 blood samples from breast cancer patients were collected. Among these, there was an incidence of 137 cases of familial breast cancer. Tissues preserved in FFPE blocks for each of the patients were also collected. Over 900 whole blood samples without Ficoll separation were collected. Neutrophils accounted for 40% to 60% of the blood nuclear cells.

Exome Sequencing and Data Analysis

[0059] Genomic DNA was extracted from blood cells using a DNA extraction kit (QiaGen, Valencia, CA). Exome DNA was captured using NimbleGen Seq-Cap EX Human Exome Library v2.0. Exome library was prepared following the standard Illumine exome library preparation protocol, and the paired-end sequences (2 x 100) were collected at 3 Ox exome coverage using and Illumina HiSeq2000 sequencer.

[0060] Primary sequence mapping to hgl9 was performed using DNAnexus service with maximal 3-base mismatches per sequence. The mapping data were used for in-house fine mapping analysis. The conditions set to identify the germline variations were as follows: the calling score for each mutated base should be >40, a mutated base should be detected by >10 individual sequences, the sequences containing the mutated based should be >20% of the total sequences mapped to the same location, a mutated base should cause a non-synonymous coding change in the affected gene, and a mutated base should not be present in dbSNP134. Validation:

[0061] PCR and Sanger sequencing were used to validate the germline variants identified by exome sequence analysis. Sense and antisense primers were designed using the sequences around each candidate by Primer 3. Primer 3 is described at Steve Rozen and Helen J.

Skaletsky (2000) Primer3 on the www for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bionformatics Methods and Protocols: Methods in Molecular Biology Human Press, Totowa, NJ, pp 365-386. PCR was performed with the same DNA used in exome sequencing (50 ng/reaction), sense and antisense primers (10 pmol), and Taq polymerase (1.25 unit, Promega, Madison, WI) at the conditions of denaturing at 95°C 7 minutes, 38 cycles at 95°C 30 seconds, 56°C 30 seconds, 72°C 30 seconds, then final extension at 72°C 7 minutes. The amplified DNA products were checked on 2% agarose gels, purified using Illustra GFX 96PCR Purification kit (GE Healthcare Life Science, Pittsburgh, PA), and used for the standard Big-Dye sequencing reactions. Sequences were collected in an ABI3730 DNA sequencer (Applied Bio Systems, Carlsbad, CA). The resulting sequences were analyzed using Genetyz program GENETYX, Shibuya, Tokyo, Japan).

Prediction of Functional Consequence:

[0062] The SIFT program was used to predict functional consequences of the detected germline variants (22, http://sift.icvi.orgA. A score of 0.05 was used as the cut-off for the significance of damage caused by the variants in the affected gene.

[0063] Stringent conditions were set to ensure that the mutations identified are true genetic changes rather than experimental artifacts. For example, a mutation must be present in multiple family members across different generations, variants representing normal variations in human population were filtered, and a mutation identified by exome sequencing must be validated by Sanger sequencing in the same DNA samples used by exome sequencing. Preparation of Formalin-Fixed, Paraffin-Embedded (tissue) (FFPE)

[0064] A piece of human tissue prepared by a certified medical pathologist is submerged in 10% neutral-buffered formalin for maximum of 24 hours and embedded in IHC-grade paraffin. The target FFPE specimen size is 0.5 x 1 x 1 cm, but it can vary significantly depending on the nature of the disease and tissue type. The fixation agent and the embedding media can be customized upon request. DNA will be extracted from the cancer part in each section using the BioOstic FFPE tissue DNA isolation kit (MO BIO Carlsbad, CA).

[0065] Individuals carrying mutations in the MLL3 gene may be detected at either the DNA or RNA level using a variety of techniques that are well known in the art. The genomic DNA used for the diagnosis may be obtained from an individual's cells, such as those present in peripheral blood, urine, saliva, bucca, surgical specimen, and autopsy specimens. The DNA may be used directly or may be amplified enzymatically in vitro through use of PCR (Saiki et al. Science 239:487-491 (1988)) or other in vitro amplification methods such as the ligase chain reaction (LCR) (Wu and Wallace Genomics 4:560-569 (1989)), strand displacement amplification (SDA) (Walker et al. PNAS USA 89:392-396 (1992)), self-sustained sequence replication (3SR) (Fahy et al. PCR Methods Appl. 1 :25-33 (1992)), prior to mutation analysis, in situ hybridization may also be used to detect the mutated MLL3 gene from an exon sequence that includes the mutation 15 c.T2645Cp.I882T, Exon 16 c.G2726Ap.R909K, or both of these.

[0066] The methodology for preparing nucleic acids in a form that is suitable for mutation detection is well known in the art. For example, suitable probes for detecting a given mutation include the nucleotide sequence at the mutation site and encompass a sufficient number of nucleotides to provide a means of differentiating a normal from a mutant allele.

Any probe or combination of probes capable of detecting any one of the MLL3 mutations herein described are suitable for use in this invention. Examples of suitable probes include those complementary to the coding strand of the DNA. Similarly, suitable PCR primers are complementary to sequences flanking the mutation site. Production of these primers and probes can be carried out in accordance with any one of the many routine methods, e.g., as disclosed in Sambrook et al. sup. 45, and those disclosed in WO 93/06244 for assays for Goucher disease.

[0067] The primers used in the present disclosure include:

[0068] Primers:

Chromosome position mutation(reference/variant) Left primer Right primer

chr7 151932945 C/T GCCTCACCCCAGGTAATACA TCTCAGTGGCATTTGGATTT chr7 151935799 A/G CATCCAGTAGGGCAAAACAA ATCCTAGGGGGCTTGGAGT

[0069] Probes for use with this invention should be long enough to specifically identify or amplify the relevant MLL3 mutations with sufficient accuracy to be useful in evaluating the risk of an individual to be a carrier or having MLL3 familial breast cancer. In general, suitable probes and primers will comprise, preferably at a minimum, an oligomer of at least 16 to 28 nucleotides in length. Since calculations for mammalian genomes indicate that for an oligonucleotide 16 to 28 nucleotides in length, there is only one chance in ten that a typical cDNA library will fortuitously contain a sequence that exactly matches the sequence of the nucleotide. Therefore, suitable probes and primers are preferably 18 to 20 nucleotides long, which is the next larger oligonucleotide fully encoding an amino acid sequence (i.e., 6 amino acids in length).

[0070] Many versions of conventional genetic screening tests are known in the art. Several are disclosed in detail in WO 91/02796 for cystic fibrosis, in U.S. Pat. No. 5,217,865 for Tay-

Sachs disease, in U.S. Pat. No. 5,227,292 for neurofibromatosis and in WO 93/06244 for

Goucher disease. Thus, in accordance with the state of the art regarding assays for such genetic disorders, several types of assays are conventionally prepared using the nucleotides, polypeptides and antibodies of the present invention. For example: the detection of mutations in specific DNA sequences, such as the MLL3 gene, can be accomplished by a variety of methods including, but not limited to, restriction-fragment-length-polymorphism detection based on allele-specific restriction-endonuclease cleavage (Kan and Dozy Lancet ii:910-912 (1978)), hybridization with allele-specific oligonucleotide probes (Wallace et al. Nucl Acids Res 6:3543-3557 (1978)), including immobilized oligonucleotides (Saiki et al. PNAS USA 86:6230-6234 (1989)) or oligonucleotide arrays (Maskos and Southern Nucl Acids Res 21:2269-2270 (1993)), allele-specific PCR (Newton et al. Nucl Acids Res 17:2503-25 16 (1989)), mismatch-repair detection (MRD) (Faham and Cox Genome Res 5:474-482 (1995)), binding of MutS protein (Wagner et al. Nucl Acids Res 23:394.4-3948 (1995), denaturing- gradient gel electrophoresis (DGGE) (Fisher and Lerman et al. PNAS USA 80:1579-1583 (1983)), single-strand-conformation-polymorphism detection (Orita et al. Genomics 5:874- 879 (1983)), RNAase cleavage at mismatched base-pairs (Myers et al. Science 230:1242 (1985)), chemical (Cotton et al. PNAS USA 85:4397-4401 (1988)) or enzymatic (Youil et al. PNAS USA 92:87-91 (1995)) cleavage of heteroduplex DNA, methods based on allele specific primer extension (Syvanen et al. Genomics 8:684-692 (1990)), genetic bit analysis (GBA) (Nikiforov et al. Nuci Acids Res 22:4167-4175 (1994)), the oligonucleotide-ligation assay (OLA) (Landegren et al. Science 241:1077 (1988)), the allele-specific ligation chain reaction (LCR) (Barrany PNAS USA 88:189-193 (1991)), gap-LCR (Abravaya et al. Nucl Acids Res 23:675-682 (1995)), and radioactive and/or fluorescent DNA sequencing using standard procedures well known in the art.

[0071] As will be appreciated, the mutation analysis may also be performed on samples of RNA by reverse transcription into cDNA therefrom. Furthermore, mutations may also be detected at the protein level using, for example, antibodies specific for the mutant and normal MLL3 protein, respectively. It may also be possible to base an MLL3 mutation assay on altered cellular or subcellular localization of the mutant form of the MLL3 protein.

Example 2 - Whole Blood and Exome Sequencing

[0072] The present example is provided to demonstrate that whole blood can be used to perform exome sequencing.

[0073] In this study, 3 B CAx families and 1 BRCA1+ family (24 patient samples), 17 BRCAx probands from BCCR. 1 FFPE tumor was paired with a proband. 2 fresh-frozen surgical tumors paired with probands. A total number of 48 samples were sequenced. [0074] As shown in Figure 2, no significant difference was observed between T cells, neutrophils and B cells. This data demonstrates that DNA from whole blood can be used for exome sequencing.

Example 3 - Extracation of DNA from Breast Tissue preserved in an FFPE Block and Exome Sequencing Thereof

[0075] The present example is provided to demonstrate that preserved tissue, such as FFPE preserved tissue, can be used to perform exome sequencing.

[0076] In this study, surgical breast tissues preserved in FFPE block (greater than 3 years) were used to extract DNA for exom sequence analysis. The DNA extracted from the FFLP blocks were compared to the DNA extracted from fresh frozen tissues from the same surgical origin.

[0077] The extracted DNA were directly used for exome sequencing following the standard exome protocol. The resulting sequences were analyzed by informatics programs as for regular DNA samples used for exome sequencing study. [0078] As demonstrated in Figure 3, 90% of the DNA mutations observed in the fresh- frozen tissue extracted DNA were also present in the FFPE preserved tissue.

[0079] The present example demonstrates that preserved FFLP tissue may be used as a source of extracted DNA for accurate exome sequencing analysis, having about 90% correlation with fresh-frozen tissue extracted DNA.

Example 4 -Exome Sequence Data generated from 48 Breast Cancer Tissue

[0080] The present example is provided to demonstrate the utility of MLL3 germline biomarker for analyzing a DNA sample extracted from a patient tissue for familail breast cancer.

[0081] Paired-end sequencing (2x1 OObp). A 30-100 x exome coverage.

354, 169, 534, 400 bases were collected, which equals to 18 human genome sizes. Greater than 97% of the sequences mapped to human reference genome. In the present study, focus was on identifying non-synonymous mutations with damaging consequences.

Example 5 - The MLL3 Germline Mutation at Exon 15 and Exon 16

[0082] The present example details the structural characteristics of the MLL3 germline mutation sequence associated with familial human breast cancer.

[0083] The two germline mutations in MLL3 were mapped at exonl5 C.T2645C p.I882T and Exonl6 C.G2726A p.R909K as shown in Figure 4. The mapping of these mutations of the MLL3 demonstrate that the mutation was within a region of chromosome 7 that links it to a mixed-lineage leukemia (MLL) family. This gene region corresponds to a region that is linked to histone methylation and transcriptional activation. This region has also been linked to be an oncogene in leukemia. [0084] Fifty nine (59) exons coding for 4,911 amino acids residues are located within these identified regions the sequence at Figure 9 corresponds to the coding exons of MLL3.

[0085] The chromosomal region where the MLL3 mutation is located contains an AT-hook DNA binding domain, a DHHC-type zinc finger, 6 PHD-type zinc fingers, a SET domain, a post-SET domain and an RING-type zinc finger.

The Exon 15 Mutation:

[0086] The Exon mutation for exon 15 is Exonl5 C.T2645C p.I882T. This mutation constituted a single nucleotide replacement on Chromosome 15, C terminal, at position 2645. The single nucleotide replacement here was from a native "T" nucleotide to a "C" nucleotide. This single point mutation resulted in a protein having a protein mutation of amino acid "I" to amino acid "T".

The Exon 16 Mutation:

[0087] The Exon mutation for exon 16 is Exonl6 C.G2726A p.R909K. This mutation constituted a single nucleotide point replacement on chromosome 16, C terminal, at position 2726. The single nucleotide replacement here was from the native "G" nucleotide to a "A" nucleotide. This single nucleotide point mutation resulted in a protein having a protein mutation of the corresponding amino acid.

[0088] These are the two mutations on MLL3 and the primer sequences. Please note that MLL3 is an alias of KMT2C gene. The official gene symbol is 'KMT2C and the gene's full name is 'lysine (K)-specific methyltransferase 2C

[0089] Chromosome position mutation(reference/variant) Left primer Right primer

Chr7 151932945 C/T GCCTCACCCCAGGTAATACA TCTCAGTGGCATTTGGATTT chr7 151935799 A/G CATCCAGTAGGGCAAAACAA ATCCTAGGGGGCTTGGAGT Table 1

Example 6 - MLL3 germline Mutation - Blood and Tumor Tissue of Human Breast Cancer Tissue

[0090] The present example demonstrates the utility of the present germ line biomarkers for detection and use in blood tissue and in tumor tissue.

[0091] Paired blood (representative for detection of a germline mutation of MLL3) and tumor (representative for detection of a somatic cell mutation of MLL3) tissues were obtained from two patients (Case 762 and Case 2282). The tissues were tested for the detectable presence of the MLL3 mutations at exon 15 and exon 16 as described above. DNA samples from breast cancer and blood of a human female previously determined to have familial breast cancer were used for the study.

Table 2- MLL3 Germline mutations detected in two paired blood and tumors

Example 7 - MLL3 Germline mutations and the Germline MLL3 Protein Encoded Thereby

[0092] The present example is demonstrated to illustrate the utility of the present invention for detection, characterization and correlation between the germ cell mutation of MLL3 gene at the exon 15 and exon 16 region, and the protein encoded by an MLL3 gene having these mutations. [0093] Five predicting programs (SIFT, Polyphen2, LRT, MutationTaster, PhyloP) were used in the present analysis. All of these tests revealed that the presence of the MLL3 germ cell mutation in the gene resulted in the production of a mutated MLL3 protein. Deleterious effects were noted in the mutated MLL3 protein compared to native MLL3 protein. "Deleterious" refers to a major mutation that causes a loss of function in the protein by changing its structure.

Example 8 - Somatic MLL3 Mutations and Familial Human Breast Cancer

[0094] The present example is provided to demonstrate that the MLL3 mutations for the exon 15 and exon 16 are also detectable in somatic cells.

[0095] The present studies revealed a somatic mutation rate of 6.9% (See Figure 5)(6.9% of 500 breast cancer cases examined).

Figure 5 presents a diagram of the MLL3 depicting the location of the amino acid mutation.

Prophetic Example 9 - Method for Screening a Patient sample for MLL3 mutation using DNA exon analysis

[0096] The present example is provided to demonstrate the utility of the invention for providing a method of screening a breast cancer patient having a family incidence of breast cancer for a germline MLL3 -linked familial breast cancer mutation, and providing a treatment regimen to a patient identified to have one or both of the germline MLL3 -linked familial breast cancer mutations at exon regions 15 and/or 16 as described herein. A patient having a DNA sample demonstrating the presence of the exon 15, exon 16 or both MLL3 mutations as identified here will be treated with an aggressive breast cancer clinical regimen, while a patient not having the presence of the MLL3 mutations as identified here will not be administered an aggressive breast cancer clinical regimen. [0097] To the extent that any reference (including books, articles, papers, patents, and patent applications) cited herein is not already incorporated by reference, they are hereby expressly incorporated by reference in their entirety.

BIBLIOGRAPHY

The following references are hereby expressly incorporated herein by reference in their entirety.

1. U.S. Preventive Services Task Force. Genetic risk assessment and BRCA mutation testing for breast and ovarian cancer susceptibility; recommendation statement. Ann Intern Med 2005;143:355-61.

2. Lichtenstein P, Holm NV, Verkasalo PK, et al. Environmental and heritable factors in the causation of cancer-analysis of cohorts of twins from Sweden, Denmark, and Finland. N EngJ. Med 2000;343:78-85.

3. Peto J. Mack Tm. High constant incidence in twins and other relatives of women with breast cancer. Nat Genet 2000;26:411-4.

4. Hall JM, Lee MK, Newman B, et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-9.

5. Wooster R. Neuhausen SL, Mangion J, et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13ql2-13, Science 1994:265:2088-90.

6. Birth JM, Alston RD, McNally RJ, et al. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001;20:4621-8.

7. Nelen MR, van Stavern WC, Peeters EA, et al. Germline mutations in the

PTEN/MMAC1 gene in patients with Cowden disease Hum Mol Genet 1997;6:1383-7.

8. Renwick A, Thompson D. Seal S. et al. ATM mutations that cause

ataxiatelangiectasia are breast cancer susceptibility alleles. Nat Genet 2006;38:873-5.

9. Xia B, Sheng Q, Nakanishi K, et al. Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol Cell 206;22:719-29. 10. Brocks A, Schmidt MK, Sherman ME, et al. Low penetrance breast cancer susceptibility loci are associated with specific breast tumor sybtypes: findings from the Breast Cancer Association Consortium. Hum Mol Genet 2011;20:3289-303.

11. Stevens KN, Vachon Cm, Lee AM et al. Common breast cancer susceptibility loci are associated with triple-negative breast cancer. Cancer Res 2011 ;71 :6240-9.

12. Figueroa JD, Garcia-Closas M. Humphreys M, et al. Associations of common variants at lpl 1.2 and 14q24.1 (RAD51L1) with breast cancer risk and heterogeneity by tumor subtype: findings from the Breast Cancer Association Consortium. Hum Mol Genet 2011;20:4693-706.

13. Haiman CA, Chen GK, Vachon CM, et al. A common variant at the TERT- CLPTM1L locus is associated with estrogen receptor-negative breast cancer. Nat Genet 2011;43:1210-4.

14. Antoniou AC, Kuchenbaechker KB, Soucy P, et al. Common variants at 12pl 1, 12q24, 9p21, 9q31.2 and in ZNF365 are associated with breast cancer risk for BRCAl and/or BRCA2 mutation carriers. Breast Cancer Res 2012;14:R33.

15. Stratton MR, Rhman N. The emerging landscape of breast cancer susceptibility. Nat Genet 2008;40:17-22.

16. US Pub 20130066060 - Slaugenhaupt et al.

Claims

What is Claimed Is:

1. A germline genetic biomarker for familial breast cancer in humans, said germline genetic biomarker consisting essentially of a mutated MLL3 gene sequence, a cDNA sequence, or expression product thereof, wherein said mutated MLL3 gene sequence contains a single nucleotide point mutation at an exon 15 region, an exon 16 region or both.

2. The germline genetic biomarker of claim 1 wherein the mutated MLL3 gene has a single nucleotide point mutation at position 2645 of exon 15, said single nucleotide point mutation being a substitution of a T (Thymine) nucleotide to a C (Cytosine) nucleotide.

3. The germline genetic biomarker of claim 1 wherein the mutated MLL3 gene has a single nucleotide point mutation at position 2726 of exon 16, said single nucleotide point mutation being a substitution of a G (Guanine) nucleotide to an A (Adenine) nucleotide.

4. The germline genetic biomarker of claim 1 wherein the presence of the

biomarker indicates a genetic predisposition for breast cancer in an affected family.

5. The germline biomarker of claim 1 wherein the mutated MLL3 is present at a higher incidence in familial breast cancer patients than the incidence of a BRCA1 or BRCA2 germline mutation in familial breast cancer patients.

6. The germline biomarker of claim 1 wherein the presence of the MLL3 gene mutation in a test DNA sample indicates a predisposition for breast cancer.

7. The germline biomarker of claim 1 wherein the mutated MLL3 gene includes a mutation exon 15 c.T2645Cp.I882T , a mutation exon Exon 16 c.G2726Ap.R909K, or both.

8. The germline biomarker of claim 1 wherein the MLL3 germ line mutation is in a region of the MLL3 gene that is associated with a mixed - lineage leukemia (MLL) family, is an oncogene in leukemia, posses 59 exons coding for 4,911 amino acid residues, contains an AT-hook DNA binding domain, a DHHC-type zinc finger, 6-PHD-type fingers, a SET domain, a post -SET domain and an RING-type zinc finger.

9. The germline biomarker of claim 1 having a nucleotide length of 16 to 24 nucleotides.

10. A method for providing a treatment regimen for a human breast cancer patient having an MLL3 gene familial germline mutation comprising:

obtaining a patient tissue sample and extracting DNA from said patient tissue sample to provide a test DNA;

determining the presence or absence of a mutant MLL3 exon 15, exon 16 or both exon 15 and exon 16 mutant sequence, or corresponding cDNA sequence or expression product, in the test DNA; and

providing a breast cancer treatment regimen to a patient where the test tissue DNA sample is identified to possess the MLL3 germ line mutation for the MLL3 exon 15 or exon 16 sequence, or not providing a breast cancer treatment to a patient having a test sample that is absent the MLL3 germline mutation.

11. The method of claim 10 wherein the breast cancer treatment may comprise chemotherapy, radiation, surgical removal of tissue, a combination thereof.

12. The method of claim 10 wherein the MLL3 germ line mutation is a mutation at exon 15 c.T2645Cp.I882T, Exon 16 c.G2726Ap.R909K, or both of these mutations.

13. The method of claim 10, wherein the step of determining the presence of the mutant MLL3 gene sequence is a step of analyzing the test DNA for the presence of an mRNA, cRNA, or cDNA corresponding to the mutant MLL3 exon 15 or exon 16 MLL3 gene sequence.

14. The method of claim 10 wherein the patient tissue is a fresh frozen tissue.

15. The method of claim 10 wherem the patient tissue is a whole blood tissue or a tumor tissue.

16. The method of claim 14 wherein the tumor tissue is breast tumor tissue.

17. The method of claim 14 wherein the patient test tissue is an FFPE preserved tissue.

18. A nucleic acid sequence comprising a sequence corresponding to the exon regions of the MLL3 gene comprising the exon 15 and exon 16 sequences covalently linked to a detectable label.

19. A nucleic acid sequence comprising a sequence corresponding to the exon regions of a mutant MLL3 gene, said mutant MLL3 sequence comprising a mutant exon 15 sequence and a mutant exon 16 sequence covalently linked to a detectable label.

20. The nucleic acid sequence of claim 19 wherein the mutant exon 15 sequence includes a point mutation at nucleotide 2645 of a T to a C residue and the mutant exon 16 sequence includes a point mutation at nucleotide 2726 of a G to an A residue.

21. A nucleotide sequence consisting essentially of GCCTCACCCCAGGTAATACA;

TCTCAGTGGCATTTGGATTT, CATCCAGTAGGGCAAAACAA or

ATCCTAGGGGGCTTGGAGT

22. A nucleotide sequence of exon regions of the MLL3 gene, said nucleotide sequence encoding 59 exons of the MLL3 gene sequence of Figure 9.

23. A nucleotide sequence corresponding to a exon 15 of a mutant MLL3 gene consisting essentially of a sequence ACCACTTTGGTGCTCCAAAT.

24. A nucleotide sequence corresponding to an exon 16 of a mutant MLL3 gene consisting essentially of a sequence AGCTTTGACTTGCCTCGGCC.

25. A DNA sequence comprising a nucleotide sequence

ACCACTTTGGTGCTCCAAAT, AGCTTTGACTTGCCTCGGCC, or both, and further comprising a detectable label covalently linked thereto.