WO2013190013A1 - Cell of hepatocyte phenotype - Google Patents
Cell of hepatocyte phenotype Download PDFInfo
- Publication number
- WO2013190013A1 WO2013190013A1 PCT/EP2013/062805 EP2013062805W WO2013190013A1 WO 2013190013 A1 WO2013190013 A1 WO 2013190013A1 EP 2013062805 W EP2013062805 W EP 2013062805W WO 2013190013 A1 WO2013190013 A1 WO 2013190013A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cytochrome
- cells
- protein
- hnf
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
- C12N5/0671—Three-dimensional culture, tissue culture or organ culture; Encapsulated cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/11—Epidermal growth factor [EGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/12—Hepatocyte growth factor [HGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/30—Hormones
- C12N2501/38—Hormones with nuclear receptors
- C12N2501/39—Steroid hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/11—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells
- C12N2506/115—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells from monocytes, from macrophages
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
- C12N2506/1369—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from blood-borne mesenchymal stem cells, e.g. MSC from umbilical blood
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the present invention relates to a cell of hepatocyte phenotype, as well as to a method of generating a respective cell of hepatocyte phenotype.
- REACH Registration, Evaluation, Authorisation and Restriction of Chemical substances
- manufacturers and importers are required to evaluate the risks associated with chemical compounds and to take measures regarding their control.
- a particular challenge is assessing hepatotoxicity, since the physiological effects of many compounds only unfold once they are being degraded in the liver.
- pharmaceutically active substances need to be tested for their hepatic effects.
- Tests of xenobiotics and other compounds on their hepatic effects are currently generally based on animal models, i.e. the use of living animals or of cultured animal cells. Regardless of ethical concerns on animals, such model systems can only reflect human physiology to a limited extent. As a result, even after long and expensive test phases frequently unexpected adverse effects of pharmaceutical substances occur in humans during clinical trials or even after market entry.
- An accepted alternative to animal models is the use of primary human hepatocytes. Due to the limited availability of donor material such methods can, however, only be carried out on a small scale. Further, differences in isolation procedure and in donor parameters (gender, genetic profile, medical condition, state of health) impede a standardisation of a test system based on primary human hepatocytes. In addition, human primary hepatocytes quickly lose their functions when cultured ex vivo.
- carcinoma cell lines are being employed. Such cell lines are cost-effective, can be cultured and grown easily and are regularly available. However, liver specific functions such as the capability of detoxication are significantly reduced in these cells in comparison to hepatocytes. Hence, such cells are unsuitable for toxicological tests. In addition, the limited number of established carcinoma cell lines restricts genetic variability.
- a further alternative to primary human hepatocytes is the use of adult stem cells. Differentiation of adult stem cells has, however, so far only yielded cells with limited hepatocyte- like properties. Due to their low functionality they are also not suitable for carrying out toxicological and pharmacological tests.
- embryonic stem cells When differentiated, embryonic stem cells achieve a high degree of functionality, since these cells represent precursors of every human tissue and thus can theoretically be differentiated unlimitedly into any cell of the human body.
- ethic concerns limit the use of embryonic stem cells in European countries such as Germany, as well as in the US substantially.
- Induced pluripotent stem cells are regarded ethically uncritical.
- the most effective method of generating iPS is retrovirally mediated overexpression. Nevertheless, this method only achieves an efficiency of 0.0001 to 0.1 %; in part it achieves only a partial reprogramming. Its low efficiency and reproducibility renders this method very time and cost intensive.
- both embryonic stem cells and induced pluripotent stem cells are partially genetically unstable, and the factors used and induced, respectively, in differentiating them are associated with tumourigenesis, which affects the results of toxicological analysis.
- the invention provides an in vitro method of generating cells of hepatocyte phenotype.
- the method includes increasing in adherent adult multipotent cells the amounts of two transcription factors. These two transcription factors, the amounts of which are increased in the multipotent cells, are hepatocyte nuclear factor 6 (HNF-6) and hepatocyte nuclear factor la (HNF-la).
- HNF-6 hepatocyte nuclear factor 6
- HNF-la hepatocyte nuclear factor la
- the method includes providing such adherent adult multipotent cells.
- the method further includes increasing in the adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 4a (HNF-4a) and/or increasing in the adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 3 ⁇ ( ⁇ -3 ⁇ ).
- the adult multipotent cells are in some embodiments mesenchymal stem cells, for instance mesenchymal stem cells of cord blood.
- the invention provides a cell of hepatocyte phenotype.
- the cell is obtained by the method according to the first aspect.
- the cell according to the second aspect contains a heterologous nucleic acid sequence encoding HNF-6. In some embodiments the cell contains a heterologous nucleic acid sequence encoding HNF-la. In some embodiments the cell contains a heterologous nucleic acid sequence encoding HNF-6 and a heterologous nucleic acid sequence encoding HNF-la. In some embodiments the cell contains a heterologous nucleic acid sequence encoding HNF-6 and HNF- 1 a.
- the cell according to the second aspect expresses typically detectable amounts of albumin, glucose-6-phosphatase, arginase Type 1, asialoglycoprotein receptor 1, tyrosine aminotransferase, tryptophan 2,3-dioxygenase, and cytochrome p450 3A4.
- the cell according to the second aspect has detectable activity of one or more cytochrome P450 enzymes.
- the cell may express detectable amounts of one or more cytochrome P450 enzymes, for example the cell may contain mRNA encoding one or more cytochrome P450 enzymes.
- the cell expresses mRNA encoding one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4.
- the cell has detectable activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4.
- the activity of the one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 is controllable, i.e. can be induced and/or inhibited, using established compounds known in the art.
- the cell according to the second aspect has a detectable activity of cytochrome P450 enzymes after 28 days of cell culture. In such embodiments the activity of cytochrome P450 enzymes after 28 days of cell culture may be 85 % or more of the activity that was detectable immediately after obtaining the cell by the method according to the first aspect. In some embodiments the cell according to the second aspect has a detectable activity of cytochrome P450 enzymes after 42 days of cell culture. In such embodiments the activity of cytochrome P450 enzymes after 42 days of cell culture may be 65 % or more of the activity that was detectable immediately after obtaining the cell.
- the detectable activity of cytochrome P450 enzymes in such a cell after 28 days of culture is 80 % or higher of the activity that was detectable immediately after obtaining the cell.
- the detectable activity of cytochrome P450 enzymes in a respective cell of hepatocyte phenotype is 60 % or higher of the activity that was detectable immediately after obtaining the cell.
- the cell according to the second aspect has an activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 that is controllable.
- the activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 can be enhanced by a compound known to enhance the respective enzyme activity in a hepatocyte.
- the activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 can be decreased by a compound known to reduce the respective enzyme activity in a hepatocyte.
- the cell according to the second aspect has an mRNA level of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 that is controllable.
- the invention provides a population of cells of hepatocyte phenotype.
- the population of cells consists of, or in some embodiments includes, cells according to the second aspect.
- 80 % or more of the population of cells according to a third aspect express elevated amounts of serum albumin, asialoglycoprotein receptor 1 and/or cytochrome p450 3A4.
- the invention provides an in vitro method of testing the hepatic effect of a compound of interest.
- the method includes contacting a cell of hepatocyte phenotype according to the second aspect with the compound of interest. Generally a plurality of cells according to the second aspect is employed. Typically the method further includes assessing the viability and/or functionality of the cells of hepatocyte phenotype. In some embodiments the method further includes determining the occurrence of apoptosis in the cells of hepatocyte phenotype.
- the method further includes determining the cells' activity in generating at least one of serum albumin, fibrinogen, a clotting factor of the prothrombin group, bile, lipoprotein, transferrin, complement protein and glycoprotein.
- the method includes determining the cells' activity in metabolizing homologous and/or heterologous compounds. In some embodiments testing the hepatic effect includes determining whether drug metabolizing phase I and phase II proteins can be induced or inhibited or whether transporter and receptor proteins of the cell can be induced or inhibited.
- the invention relates to the use of cells of hepatocyte phenotype obtained by the method according to the first aspect for testing the hepatic effect of a compound of interest.
- Testing the hepatic effect includes contacting the cells of hepatocyte phenotype with the compound of interest.
- testing the hepatocyte effect further includes assessing the viability and/or functionality of the cells of hepatocyte phenotype.
- the invention provides an in vitro method of forming a liver transplant.
- the method includes allowing cells according to the first aspect to grow.
- the method further includes forming a synthetic scaffold or a bioartificial liver device with the cells.
- the method also includes culturing the cells in co-culture with at least one of endothelial cells, Kupffer cells, hepatic stellate cells, cholangiocytes, and fibroblasts.
- the invention relates to a method of using cells of hepatocyte phenotype obtained by the method according to the first aspect in organ regeneration or replacement such as liver regeneration or replacement.
- the invention relates to the use of cells of hepatocyte phenotype obtained by the method according to the first aspect for treating a hepatic disorder in a subject.
- the hepatic disorder is hepatitis, a heredity disease and liver cirrhosis or liver cancer.
- the heredity disease may for example be Wilson's disease, heamatochromatosis or alpha- 1 antitrypsin deficiency.
- Figure 1 depicts immunocytochemical analysis of human cord blood derived unrestricted somatic stem cells (USSC) after transduction with hepatic transcription factors (magnification: 20X). The transcription factors were found to be located in the nucleus and thus physiologically active.
- FIG. 2 depicts RT-PCR analysis of the expression of hepatocytic markers in transduced USSC after 4 days of expansion culture, before and after 12 days of differentiation culture.
- the depicted results are representative data of two individual experiments using two different USSC populations (day 0: undifferentiated USSC after expansion culture; day 12: differentiated USSC, Hep.: human hepatocytes).
- Hepatocyte cDNA was used as a positive control (+RT).
- the corresponding first strand synthesis reaction mixture without reverse transcriptase represents the negative control (-RT).
- Figure 3 shows the morphological changes of transduced USSC after 4 days of expansion culture and 12 days of differentiation culture (day 0: undifferentiated USSC after expansion culture; day 12: differentiated USSC).
- Cells were transduced with the respective transcription factors HNFla, HNF-3p/FOXA2, HNF4a and HNF6.
- Figure 4 depicts data on the expression of hepatocytic genes of transduced USSC.
- RT PCR analysis was carried out on transduced USSC after 12 days of differentiation culture.
- Hl-F- H4-H6 USSC transduced with HNFla, FOXA2, HNF4a, and HNF6
- H1-F-H4 USSC transduced with HNFla, FOXA2 and HNF4a
- F-H4-H6 USSC transduced with FOXA2 and HNF4a
- F-H4 USSC transduced with FOXA2 and HNF4a.
- cDNA of human hepatocytes was used as a positive control, the corresponding RT first strand synthesis reaction mixture represents the negative control.
- Figure 5 depicts the morphology of transduced USSC following expansion culture (day 0) and differentiation culture for 12 days (day 12).
- H1-F-H4-H6-USSC USSC transduced with HNFla, FOXA2, HNF4a, and HNF6
- H1-F-H4-USSC USSC transduced with HNFla, FOXA2 and HNF4a
- F-H4-H6-USSC USSC transduced with FOXA2 and HNF4a
- F-H4-USSC USSC transduced with FOXA2 and HNF4a.
- FIG. 6 shows that transduced USSC express a- 1 -Antitrypsin, a- 1 -Antitrypsin (AAT) is detected immunocytochemically in H1-F-H4-H6-USSC, H1-F-H4-USSC, F-H4-H6-USSC and F-H4-USSC after differentiation (HI : transduction with HNFla; F: transduction with FOXA2; H4: transduction with HNF4a; H6: transduction with HNF6; magnification of the lens: 20X).
- HI transduction with HNFla
- F transduction with FOXA2
- H4 transduction with HNF4a
- H6 transduction with HNF6
- magnification of the lens 20X
- nuclei/DNA are stained using DAPI.
- Fig. 6A is a greyscale representation of the image. Fig.
- FIG. 6B is a greyscale representation of the image, in which only staining of a- 1 -Antitrypsin (FITC) is shown.
- Fig. 6C is a greyscale representation of a copy of the image, in which only staining of nuclei using DAPI is shown. 20 % of the cells had a strong fluorescence staining. All other cells of the population could be weakly stained against AAT. F-H4-H6-USSC had 1 % AAT positive cells on day 12.
- FITC a- 1 -Antitrypsin
- Figure 7 depicts differences of H1-F-H4-H6-USSC, H1-F-H4-USSC, F-H4-H6- USSC and F-H4-USSC after 12 days of differentiation culture.
- Assessment of gene expression of different markers is based on RT PCR (cf. Fig. 4), ++ indicates saturated bands, + indicates bands that are not saturated, +/- represents weak bands.
- Indications on transduced USSC populations are based on cells counts of strong fluorescent cells in relation to DAPI stained nuclei following immunocytochemical analysis. In H1-F-H4-USSC cultures 12 % of strongly AAT positive cells were detected. In cultures of F-H4-USSC less than 0.5 % of cells were strongly positive for AAT.
- Figure 8 depicts the expression of hepatocyte transcription factors by transduced USSC. RT-PCR analysis of endogenous transcription factors was carried out on USSC transduced with HNFla, FOXA2, HNF4a and HNF6 (H1-F-H4-H6-USSC). cDNA of human hepatocyets and pooled vectors (each 1 pg of plasmid) were used as positive controls.
- FIG 9 shows that transduced USSC express human serum albumin (ALB).
- ALB is detected immunocytochemically in H1-F-H4-H6-USSC before (dayO) and after differentiation (dayl2).
- pUC2-USSC Mock-transduced USSC
- Rhodamine-conjugated antibodies were used to detect human serum albumin; DNA was detected by DAPI-staining.
- FIG 10 demonstrates, that a-fetoprotein (AFP) is neither expressed in Mock- transduced USSC (pUC2-USSC) nor in H1-F-H4-H6-USSC before (dayO) and after differentiation (dayl2).
- Fluorescein isothiocyanate (FITC)-conjugated antibodies were used to detect human a- fetoprotein; DNA was detected by DAPI-staining.
- HI transduction with HNFla
- F transduction with FOXA2
- H4 transduction with HNF4a
- H6 transduction with HNF6
- magnification of the lens 20X
- Figure 11 shows the sequences of primers used in the generation of data shown in the preceding Figures. SEQ ID NOs are indicated in parentheses.
- Figure 12 demonstrates performance of hepatocyte functions by H1-F-H4-H6- USSC.
- Albumin secretion and urea production were calculated by referring concentrations in supernatants to durance of medium condition and total protein amount of analyzed cells.
- Induction of CYP3A4 activity was analyzed by addition of rifampicin in to culture medium for 48 hours before measurements, (d: day, h: hour, RLU: relative light units, RIF: rifampicin).
- A Albumin secretion of H1-F-H4-H6-USSC measured by enzyme-linked immunosorbent assay (ELISA).
- the present invention provides a cell of hepatocyte phenotype as well as a method of forming a respective cell of hepatocyte phenotype.
- a method of generating a cell of hepatocyte phenotype according to the invention can be taken to define a method of forward programming an adherent adult multipotent cell.
- Forward programming refers to an alteration in the differentiation status of a cell, typically by increasing expression of one or more lineage- determining genes in the multipotent cell.
- Forward programming may differ from directed differentiation, where an increased expression of endogenous genes is induced by adding growth factors or certain low molecular weight molecules to the culture medium.
- the growth factors or low molecular weight molecules signal though cell surface proteins and surface protein- mediated signalling to activate endogenous pathways toward the lineage desired.
- expression of programming factors usually found only intra-cellularly are increased by introducing or inducing the gene expression cassette or by being added directly, for example in the form of polypeptides or RNA molecules.
- programming factor genes for differentiation are activated directly, thereby by-passing the cell surface proteins and surface protein-mediated signalling pathways.
- the word "programming" refers to a process that changes a cell to form progeny of at least one cell type different from the original cell and, either in culture or in vivo, different from it would have under the same conditions without programming. This means that after sufficient proliferation, a measurable proportion of progeny having phenotypic characteristics of the new cell type if essentially no such progeny could form before programming.
- a method of the invention is a method of differentiating adherent adult multipotent cells.
- "Differentiation" is a process known to those skilled in the art by which a less specialized cell becomes a more specialized cell type.
- the question of how adult non- hepatic stem cells are converted into hepatocyte-like cells in vivo is so far unsettled. Originally it was assumed that the so called plasticity of cells allows differentiation into hepatocyets.
- a method of the present invention provides one or more cells of a hepatocyte phenotype, namely of hepatocyte phenotype. Such cells may also be addressed as hepatocyte-like cells.
- the term phenotype is understood in the art to refer to detectable characteristics of a cell or organism. These characteristics in particular include the morphology, the development, the biochemical and/or physiological properties, phenology, and behaviour.
- the phenotype thus includes inter alia the molecules, such as proteins that are present within and on the surface of a cell.
- the term phenotype is typically contrasted to the genotype, which refers to heredity.
- the characteristics defining the phenotype are the manifestation of gene expression.
- a hepatocyte is a cell of a cell type that makes up 70-80% of the cytoplasmic mass of the liver. Hepatocytes are involved in protein synthesis, protein storage, transformation of carbohydrates, synthesis of cholesterol, bile salts and phospholipids, and the detoxification, modification and excretion of exogenous and endogenous substances. Hepatocytes generate serum albumin, fibrinogen, and the prothrombin group of clotting factors. A hepatocyte also initiates the formation and secretion of bile. Hepatocytes are also the main site for the synthesis of lipoproteins, ceruloplasmin, transferrin, complement and glycolproteins. In addition, hepatocytes have the ability to metabolize, detoxify, and inactivate exogenous compounds such as drugs and insecticides, and endogenous compounds such as steroids.
- Characteristics of a hepatocyte phenotype include the expression of cell markers, enzymatic activity, and the characterization of morphological features and intercellular signalling. Where for example a plurality of characteristics of hepatocytes is present in a single cell, the cell may be regarded as being of hepatocyte phenotype.
- Morphological features characteristic of hepatocytes include a polygonal cell shape, a binucleate phenotype, the presence of rough endoplasmic reticulum for synthesis of secreted protein, the presence of Golgi- endoplasmic reticulum lysosome complex for intracellular protein sorting, the presence of peroxisomes and glycogen granules, relatively abundant mitochondria, and the ability to form tight intercellular junctions resulting in creation of bile canalicular spaces.
- Characteristics of a hepatocyte phenotype may also be assessed on the basis of the presence of phenotypic markers (see below), i.e. particular molecules and/or moieties of molecules found in or on the cell, typically on the cell surface. Assessment of the level of expression of markers can be determined in comparison to a reference to other cells.
- phenotypic markers see below
- markers of mature hepatocytes there may be used for instance adult hepatocytes of the species of interest may be used.
- Negative controls may for example include cells of a different lineage, such as lymphocytes or fibroblasts. Protein and oligosaccharide determinants characteristic of a hepatocyte phenotype may be detected using any known methodology available, such as immunological techniques, e.g.
- Suitable techniques include Western blot analysis, for instance of a cellular extract, an enzyme-linked immunoassay, a radioimmunoassay or a fluorescence titration assay, which may for example be carried out on a cellular extract or a medium in which the cells are being cultured.
- a radioimmunoassay is based on the measurement of radioactivity associated with a complex formed between an antibody or a proteinaceous binding molecule with antibody-like functions and an antigen
- an ELISA is based on the measurement of an enzymatic reaction associated with a complex formed between an antibody or a proteinaceous binding molecule with antibody-like functions and an antigen.
- An immunological technique relies on the use of antibodies or binding molecules with antibody-like functions, typically being proteinaceous binding molecules.
- An antibody is an immunoglobulin or a fragment thereof.
- immunoglobulin fragments are Fab fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies, triabodies (Iliades, P., et al., FEBS Lett (1997) 409, 437-441), decabodies (Stone, E., et al., Journal of Immunological Methods (2007) 318, 88-94) and other domain antibodies (Holt, L.J., et al., Trends Biotechnol.
- a proteinaceous binding molecule with antibody- like functions is a mutein based on a polypeptide of the lipocalin family (WO 2003/029462; WO 2005/019254; WO 2005/019255; WO 2005/019256; Beste et al., Proc. Natl. Acad. Sci. USA (1999) 96, 1898-1903).
- Lipocalins such as the bilin binding protein, the human neutrophil gelatinase- associated lipocalin, human Apolipoprotein D, human tear lipocalin, or glycodelin, posses natural ligand-binding sites that can be modified so that they bind to selected small protein regions known as haptens.
- further proteinaceous binding molecules include, but are not limited to, the so-called glubodies (see WO 96/23879), proteins based on the ankyrin scaffold (Mosavi, L.K., et al., Protein Science (2004) 13, 6, 1435-1448) or the crystalline scaffold (WO 2001/04144), the proteins described by Skerra (J. Mol. Recognit.
- AdNectins tetranectins
- avimers contain so called A-domains that occur as strings of multiple domains in several cell surface receptors (Silverman, J, et al., Nature Biotechnology (2005) 23, 1556-1561).
- Adnectins derived from a domain of human fibronectin, contain three loops that can be engineered for immunoglobulin-like binding to targets (Gill, D.S. & Damle, N.K., Current Opinion in Biotechnology (2006) 17, 653-658).
- Tetranectins derived from the respective human homotrimeric protein, likewise contain loop regions in a C-type lectin domain that can be engineered for desired binding (ibid.).
- Peptoids which can act as protein ligands, are oligo(N-alkyl) glycines that differ from peptides in that the side chain is connected to the amide nitrogen rather than the a carbon atom. Peptoids are typically resistant to proteases and other modifying enzymes and can have a much higher cell permeability than peptides (see e.g. Kwon, Y.-U., and Kodadek, T., J. Am. Chem. Soc. (2007) 129, 1508-1509).
- an antibody or a molecule with antibody-like functions may be used that is linked to an attached label, such as for instance in Western analysis or ELISA.
- an intracellular immunoglobulin may be used for detection.
- a further technique that can also be carried out to detect the presence of a phenotypic marker is Fluorescence Microscopy, including Ratio Fluorescence Microscopy. In ratio fluorescence microscopy two fluorescence images are collected and the parameter of interest is quantified as a ratio of the fluorescence in one image to that in the other image.
- a further technique suitable for detecting the presence of phenotypic markers on the surface of cells is fluorescence resonance energy transfer (FRET). In FRET an excited fluorescent donor molecule, rather than emitting light, transfers that energy via a dipole-dipole interaction to an acceptor molecule in close proximity.
- FRET fluorescence resonance energy transfer
- a biomarker the presence, expression, level or activity of which may be assessed in order to determine a hepatocyte phenotype, may be located at the cell surface. In some embodiments a respective marker is secreted.
- such a marker is located within a cell of hepatocyte phenotype, for example in the cytoplasm, within an organelle or in the membrane surrounding an organelle.
- expressing and “expression” in reference to a biomarker are intended to be understood in the ordinary meaning as used in the art.
- a biomarker is expressed by a cell via transcription of a nucleic acid into mRNA, followed by translation into a polypeptide, which is folded and possibly further processed. Some of the biomarkers discussed in this disclosure are in addition being transported to the surface of the respective cell.
- the determination of expression may be based on the normalized expression level of the biomarkers. Expression levels are normalized by correcting the absolute expression level of a biomarker by comparing its expression to the expression of a gene that is not a biomarker in the context of the present specification. The expression level may also be provided as a relative expression level.
- the terms “expression”, “gene expression” or “expressing” refer to the entirety of regulatory pathways converting the information encoded in the nucleic acid sequence of a gene first into messenger RNA (mRNA) and then to a protein. Accordingly, the expression of a gene includes its transcription into a primary hnRNA, the processing of this hnRNA into a mature RNA and the translation of the mRNA sequence into the corresponding amino acid sequence of the protein.
- the term “gene product” refers not only to a protein, including e.g. a final protein (including a splice variant thereof) encoded by that gene and a respective precursor protein where applicable, but also to the respective mRNA, which may be regarded as the "first gene product" during the course of gene expression.
- a cell of hepatocyte phenotype expresses serum albumin.
- a cell of hepatocyte phenotype secrets serum albumin.
- Serum albumin may for example be human serum albumin, for instance the protein of the Swissprot/Uniprot accession number P02768 (version 195 as of 29 May 2013).
- Human serum albumin may also be a protein that contains the fragment of the Swissprot/Uniprot accession number Q16167 (version 34 as of 03 April 2013), or a protein that contains the fragment of the Swissprot/Uniprot accession number H0YA55 (version 9 as of 01 May 2013).
- human serum albumin may be the protein of the Swissprot/Uniprot accession number B7WNR0 (version 25 as of 29 May 2013) or the protein of the Swissprot/Uniprot accession number D6RHD5 (version 17 as of 01 May 2013).
- human serum albumin may be a protein that contains the fragment of the Swissprot/Uniprot accession number F6KPG5 (version 10 as of 01 May 2013), or a protein that contains the fragment of the Swissprot/Uniprot accession number Q14551 (version 30 as of 03 April 2013).
- Human serum albumin may in some embodiments be the protein of the Swissprot/Uniprot accession number C9JKR2 (version 26 as of 29 May 2013) or the protein of the Swissprot/Uniprot accession number D6RCE7 (version 14 as of 03 April 2013).
- albumin is the murine protein of the Swissprot/Uniprot accession number P07724 (version 138 as of 29 May 2013) or a protein containing the fragment of the Swissprot/Uniprot accession number K7R066 (version 4 as of 01 May 2013).
- albumin is the rat protein of the Swissprot/Uniprot accession number P02770 (version 125 as of 29 May 2013) or a protein containing the fragment of the Swissprot/Uniprot accession number Q63036 (version 22 as of 03 April 2013).
- a cell of hepatocyte phenotype expresses glucose-6- phosphatase.
- This enzyme is known to be located within the cell, spanning the membrane of the endoplasmic reticulum.
- Glucose-6-phosphatase may for example be the human enzyme of the Swissprot/Uniprot accession number P35575 (version 128 as of 29 May 2013).
- Glucose-6- phosphatase may also be the human enzyme of the Swissprot/Uniprot accession number K7EL82 (version 4 as of 29 May 2013) or the human enzyme of the Swissprot/Uniprot accession number K7ELS6 (version 3 as of 03 April 2013).
- glucose-6-phosphatase may be a human enzyme containing the fragment of the Swissprot/Uniprot accession number Q6LAP7 (version 21 as of 03 April 2013) or a human enzyme containing the fragment of the Swissprot/Uniprot accession number 095179 (version 28 as of 03 April 2013).
- Glucose-6- phosphatase may also be the rat enzyme of the Swissprot/Uniprot accession number P43428 (version 94 as of 29 May 2013) or a rat enzyme containing the fragment of the Swissprot/Uniprot accession number Q6LCH4 (version 24 as of 03 April 2013).
- glucose-6- phosphatase is the murine protein of the Swissprot/Uniprot accession number P35576 (version 103 as of 29 May 2013).
- a cell of hepatocyte phenotype expresses in some embodiments arginase Type 1.
- Arginase Type 1 may in some embodiments be the human protein of the Swissprot/Uniprot accession number P05089 (version 164 as of 29 May 2013). In some embodiments arginase Type 1 may be the mouse protein of the Swissprot/Uniprot accession number Q61176 (version 111 as of 29 May 2013), or a mouse protein containing the fragment of the Swissprot/Uniprot accession number Q8K3K5 (version 25 as of 06 March 2013). In some embodiments arginase Type 1 is the rat protein of the Swissprot/Uniprot accession number P07824 (version 138 as of 29 May 2013).
- a cell of hepatocyte phenotype expresses an asialoglycoprotein receptor, a protein also called Hepatic lectin.
- An asialoglycoprotein receptor is asialoglycoprotein receptor 1 (ASGP-R 1) and asialoglycoprotein receptor 2 (ASGP-R 2).
- ASGP-R 1 asialoglycoprotein receptor 1
- ASGP-R 2 asialoglycoprotein receptor 2
- An isoform of the receptor protein ASGP-R 1 termed isoform "a”
- isoform "b" is being secreted.
- Known isoforms of ASGP-R 2 appear to be located at the plasma membrane.
- the asialoglycoprotein receptor 1 is the human protein of the Swissprot/Uniprot accession number P07306 (version 138 as of 01 May 2013). In some embodiments the asialoglycoprotein receptor 1 is the human protein of the Swissprot/Uniprot accession number J3QSZ2 (version 6 as of 01 May 2013), or the human protein of the Swissprot/Uniprot accession number I3L129 (version 9 as of 03 April 2013).
- the asialoglycoprotein receptor 1 may also be a human protein containing the fragment of the Swissprot/Uniprot accession number K7EPS5 (version 3 as of 03 April 2013), or a human protein containing the fragment of the Swissprot/Uniprot accession number Q6FGQ5 (version 75 as of 29 May 2013).
- asialoglycoprotein receptor 1 may be a human enzyme containing the fragment of the Swissprot/Uniprot accession number I3L2S9 (version 7 as of 03 April 2013) or a human enzyme containing the fragment of the Swissprot/Uniprot accession number I3L1F8 (version 7 as of 03 April 2013).
- asialoglycoprotein receptor 1 is the rat protein of the Swissprot/Uniprot accession number P02706 (version 111 as of 29 May 2013). In some embodiments asialoglycoprotein receptor 1 may be the mouse protein of the Swissprot/Uniprot accession number P34927 (version 111 as of 29 May 2013). In some embodiments asialoglycoprotein receptor 1 may be the mouse protein of the Swissprot/Uniprot accession number B1AR34 (version 41 as of 01 May 2013) or a mouse protein containing the fragment of the Swissprot/Uniprot accession number J3QPT6 (version 6 as of 03 April 2013).
- the asialoglycoprotein receptor 2 is the human protein of the
- the asialoglycoprotein receptor 2 may be a human protein containing the fragment of the Swissprot/Uniprot accession number I3L1H2 (version 7 as of 03 April 2013), or the human protein of the Swissprot/Uniprot accession number I3L1N6 (version 6 as of 03 April 2013).
- the asialoglycoprotein receptor 2 may also be a mouse protein containing the fragment of the Swissprot/Uniprot accession number B1AR35 (version 42 as of 29 May 2013), or the mouse protein of the Swissprot/Uniprot accession number J3QMY0 (version 6 as of 03 April 2013).
- the asialoglycoprotein receptor 2 is the mouse protein of the Swissprot/Uniprot accession number P24721 (version 115 as of 29 May 2013). In some embodiments the asialoglycoprotein receptor 2 is the rat protein of the Swissprot/Uniprot accession number P08290 (version 109 as of 03 April 2013). In some embodiments the asialoglycoprotein receptor 2 is the rat protein of the Swissprot/Uniprot accession number Q9JKP9 (version 50 as of 03 April 2013).
- a cell of hepatocyte phenotype generally also expresses a tryptophan 2,3- dioxygenase (TO), a cytosolic hemoprotein, which is the rate-limiting enzyme in oxidative breakdown of L-tryptophan to kynurenine.
- TO tryptophan 2,3- dioxygenase
- Tryptophan 2,3-dioxygenase may for example be the human enzyme of the Swissprot/Uniprot accession number P48775 (version 115 as of 29 May 2013).
- Tryptophan 2,3-dioxygenase may also be the human protein containing the fragment of the Swissprot/Uniprot accession number D6RA50 (version 23 as of 29 May 2013), or a human protein containing the fragment of the Swissprot/Uniprot accession number D6RB68 (version 23 as of 29 May 2013). Tryptophan 2,3-dioxygenase may also be the mouse enzyme of the Swissprot/Uniprot accession number P48776 (version 94 as of 29 May 2013) or the mouse enzyme of the Swissprot/Uniprot accession number C5NSA7 (version 24 as of 29 May 2013).
- tryptophan 2,3-dioxygenase is a mouse protein containing the fragment of the Swissprot/Uniprot accession number Q80Z63 (version 26 as of 29 May 2013). In some embodiments tryptophan 2,3-dioxygenase is the rat protein of the Swissprot/Uniprot accession number P21643 (version 95 as of 29 May 2013) or the rat protein of the Swissprot/Uniprot accession number G5BLV6 (version 6 as of 29 May 2013).
- a cell of hepatocyte phenotype expresses generally tyrosine aminotransferase (TAT), a mitochondrial protein involved in tyrosine breakdown.
- Tyrosine aminotransferase may in some embodiments be the human protein of the Swissprot/Uniprot accession number PI 7735 (version 137 as of 01 May 2013).
- tyrosine aminotransferase may be the human protein of the Swissprot/Uniprot accession number A1L4G7 (version 42 as of 29 May 2013).
- Tyrosine aminotransferase may in some embodiments be the human protein of the Swissprot/Uniprot accession number Q8WW92 (version 44 as of 29 May 2013).
- tyrosine aminotransferase may also be the mouse protein of the Swissprot/Uniprot accession number P04694 (version 116 as of 03 April 2013) or a mouse protein containing the fragment of the Swissprot/Uniprot accession number D3Z307 (version 24 as of 03 April 2013).
- tyrosine aminotransferase may be the rat protein of the Swissprot/Uniprot accession number Q9QWS4 (version 74 as of 29 May 2013) or the rat protein of the Swissprot/Uniprot accession number Q9QWS4 (version 74 as of 29 May 2013).
- a cell of hepatocyte phenotype expresses cytochrome p450 3A4
- cytochrome p450 3A4 is a heme-thiolate monooxygenase of microsomes of hepatocytes. Cytochrome p450 3A4 may for example be the human enzyme of the Swissprot/Uniprot accession number P08684 (version 157 as of 01 May 2013).
- Cytochrome p450 3A4 may also be the human enzyme of the Swissprot/Uniprot accession number Q6GRK0 (version 85 as of 29 May 2013) or the human enzyme of the Swissprot/Uniprot accession number E7EVM8 (version 15 as of 03 April 2013).
- cytochrome p450 3A4 is a human protein containing the fragment of the Swissprot/Uniprot accession number C9JBD2 (version 23 as of 29 May 2013), or a human protein containing the fragment of the Swissprot/Uniprot accession number Q7Z448 (version 57 as of 29 May 2013).
- Cytochrome p450 3A4 is in some embodiments the human enzyme of the Swissprot/Uniprot accession number Q86SK3 (version 71 as of 29 May 2013). In some embodiments cytochrome p450 3A4 is the bovine protein of the Swissprot/Uniprot accession number A5D9D8 (version 44 as of 03 April 2013).
- a cell of hepatocyte phenotype obtained by increasing the amount of HNF-6 and the amount of HNF- ⁇ in adherent adult multipotent cells generally are of high homogeneity in cell culture. 75 % or more of obtained cells express detectable amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4. Compared to adherent adult multipotent cells of origin, cells obtained by increasing the amounts of HNF-6 and HNF- ⁇ in the cells contain elevated amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4.
- 85 % or more of obtained cells express elevated amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4.
- a respective elevated amount is an amount of RNA and/or protein in the cell that is at least two-fold when compared to untreated adherent adult multipotent cells - i.e. multipotent cells corresponding to cells from which the cell of a hepatocyte phenotype obtained by a method as described herein originate.
- the amount of RNA and/or protein in the cell that is at least ten- fold, including at least 100-fold when compared to untreated adherent adult multipotent cells of origin.
- no detectable amount of one or more of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4 can be detected in a cell of origin, i.e. an untreated adherent adult multipotent cell as used to obtain a cell of hepatocyte phenotype as described herein.
- an elevated amount of serum albumin, asialoglycoprotein receptor 1, and/or cytochrome p450 3A4 in cells of a hepatocyte phenotype is an amount from about 10% to about 200% of the amount detected in primary human hepatocytes. The skilled artisan will, however, be aware of differences and fluctuations in the expression of these proteins in primary human hepatocytes.
- Amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4 in cells of a hepatocyte phenotype may be about 10% or more when compared to amounts in primary human hepatocytes from one specimen and about 200% or less when compared to amounts in primary human hepatocytes from another specimen.
- the amount of a nucleic acid or a protein may be detected, or an assessment from which such an amount can be inferred, may be carried out. Any method that can be used to detect the presence of a nucleic acid or a protein in the context of the present invention. Examples of techniques that may be used in this regard include, but are not limited to, RT-PCR, RNAse protection assay, Northern analysis, Western analysis, ELISA, radioimmunoassay or fluorescence titration assay.
- Assessing the amount of a transcription factor or of a biomarker such as a cytochrome P 450 enzyme in/on a cell may include assessing the amount of a nucleic acid, e.g. RNA, in a cell encoding the respective transcription factor or biomarker.
- a nucleic acid probe may be used to probe a sample by any common hybridization method to detect the amount of nucleic acid molecules of the transcription factor or biomarker. In order to obtain nucleic acid probes chemical synthesis can be carried out.
- the synthesized nucleic acid probes may be first used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to standard PCR protocols utilizing the appropriate template, in order to obtain the probes of the present invention.
- PCR polymerase chain reaction
- the hybridization probes can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence or a nanoparticle. After hybridization, the probes may be visualized using a standard technique.
- the rate of synthesis of a protein does not equal the expression of the protein, since the degradation rate of the protein likewise contributes to the expression level. Nevertheless, a change or a deviation in the rate of synthesis can generally be taken as an indication on a change or a deviation in the expression level of a protein.
- the rate of synthesis of e.g. a cytochrome P450 enzyme or other biomarker, or of a transcription factor may also be assessed by determining the synthesis rate of the respective protein/polypeptide, including the post-translational modifications of the initial translation product. Any of these synthesis steps may be detected alone or in combination, for example based on the accumulation of products of a post-translational modification.
- a detection method used in the context of the present invention may include an amplification of the signal caused by the nucleic acid or protein, such as a polymerase chain reaction (PCR) or the use of the biotin-streptavidin system, for example in form of a conjugation to an immunoglobulin, as also explained in more detail below.
- the detection method may for example include the use of an antibody, e.g. an immunoglobulin, which may be linked to an attached label, such as for instance in Western analysis or ELISA. Where desired, an intracellular immunoglobulin may be used for detection. Some or all of the steps of detection may be part of an automated detection system.
- an antibody as used herein, is understood to include an immunoglobulin and an immunoglobulin fragment that is capable of specifically binding a selected protein, e.g. L- selectin or a protein specific for T cells, as well as a respective proteinaceous binding molecule with immunoglobulin-like functions.
- An antibody may for instance be an EGF-like domain, a Kringle- domain, a fibronectin type I domain, a fibronectin type II domain, a fibronectin type III domain, a PAN domain, a Gla domain, a SRCR domain, a Kunitz/B ovine pancreatic trypsin Inhibitor domain, tendamistat, a Kazal-type serine protease inhibitor domain, a Trefoil (P-type) domain, a von Willebrand factor type C domain, an Anaphylatoxin-like domain, a CUB domain, a thyroglobulin type I repeat, an LDL-receptor class A domain, a Sushi domain, a Link domain, a Thrombospondin type I domain, an immunoglobulin domain or a an immunoglobulin-like domain (for example a domain antibody or a camel heavy chain antibody), a C-type lectin domain, a MAM domain, a von Willebrand
- a "Janusin” (Traunecker et al., EMBO J (1991) 10, 3655-3659 or Traunecker et al., Int J Cancer (1992) Suppl 7, 51-52), a nanobody, an adnectin, a tetranectin, a microbody, an affilin, an affibody or an ankyrin, a crystallin, a knottin, ubiquitin, a zinc-finger protein, an autofluorescent protein, an ankyrin or ankyrin repeat protein or a leucine-rich repeat protein.
- a measurement of a level or amount of a nucleic acid or protein/peptide may for instance rely on spectroscopic, photochemical, photometric, fluorometric, radiological, enzymatic or thermodynamic means.
- An example of a spectroscopical detection method is fluorescence correlation spectroscopy.
- a photochemical method is for instance photochemical cross-linking.
- the use of photoactive, fluorescent, radioactive or enzymatic labels respectively are examples for photometric, fluorometric, radiological and enzymatic detection methods.
- An example of a thermodynamic detection method is isothermal titration calorimetry.
- quantum dots As an illustrative example of a label, a detailed protocol on the use of water-soluble, bio-functionalized semiconductor quantum dots has been given by Lidke et al. (Current Protocols in Cell Biology, [2007] Suppl. 36, 25.1.1- 25.1.18). Such quantum dots have a particularly high photostability, allowing monitoring their localization for minutes to hours to days. They are typically fluorescent nanoparticles. Since different types of quantum dots can be excited by a single laser line multi-colour labelling can be performed. Detection can for example conveniently be carried out in different fluorescence channels of a flow cytometer. A quantum dot can be coupled to a binding partner of e.g. a cytochrome P 450 enzyme.
- the measurement used is generally selected to be of a sensitivity that allows detection of cells expressing the transcription factor or biomarker in the range of a selected threshold value, in particular of a sensitivity that allows determining whether e.g. cytochrome P 450 or transcription factor expressing cells are below the respective threshold value.
- a binding partner of the transcription factor and/or biomarker may be used in combination with a detectable marker.
- Such a binding partner of the transcription factor or biomarker has a detectable affinity and specificity for the transcription factor and/or biomarker, respectively.
- binding is considered specific when the binding affinity is higher than 10 "6 M.
- a binding partner of the transcription factor or biomarker has in some embodiments an affinity of about 10 "8 M or higher, or of about 10 "9 M or higher.
- a respective binding partner of e.g. a transcription factor or biomarker may be an immunoglobulin, a fragment thereof or a proteinaceous binding molecule with immunoglobulin-like functions.
- An antibody fragment generally contains an antigen binding or variable region. Examples of (recombinant) antibody fragments are immunoglobulin fragments such as Fab fragments, Fab' fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies or domain antibodies (Holt, L.J., et al., Trends Biotechnol. (2003), 21 , 11, 484-490).
- a proteinaceous binding molecule with immunoglobulin-like functions is a mutein based on a polypeptide of the lipocalin family (WO 03/029462, Beste et al., Proc. Natl. Acad. Sci. USA (1999) 96, 1898-1903).
- Lipocalins such as the bilin binding protein, the human neutrophil gelatinase- associated lipocalin, human Apolipoprotein D or glycodelin, posses natural ligand-binding sites that can be modified so that they bind to selected small protein regions known as haptens.
- glubodies see e.g.
- Adnectins derived from a domain of human fibronectin, contain three loops that can be engineered for immunoglobulin-like binding to targets (Gill, D.S. & Damle, N.K., Current Opinion in Biotechnology (2006) 17, 653-658). Tetranectins, derived from the respective human homotrimeric protein, likewise contain loop regions in a C-type lectin domain that can be engineered for desired binding (ibid.).
- Peptoids which can act as protein ligands, are oligo(N-alkyl) glycines that differ from peptides in that the side chain is connected to the amide nitrogen rather than the a carbon atom.
- Peptoids are typically resistant to proteases and other modifying enzymes and can have a much higher cell permeability than peptides (see e.g. Kwon, Y.-U., and Kodadek, T., J. Am. Chem. Soc. (2007) 129, 1508-1509).
- a suitable antibody may in some embodiments also be a multispecific antibody that includes several immunoglobulin fragments.
- An immunoglobulin or a proteinaceous binding molecule with immunoglobulin-like functions may be PEGylated or hyperglycosylated if desired.
- a proteinaceous binding molecule with immunoglobulin-like functions is a fusion protein of one of the exemplary proteinaceous binding molecules above and an albumin-binding domain, for instance an albumin- binding domain of streptococcal protein G.
- a proteinaceous binding molecule with immunoglobulin-like functions is a fusion protein of an immunoglobulin fragment, such as a single-chain diabody, and an immunoglobulin binding domain, for instance a bacterial immunoglobulin binding domain.
- a single-chain diabody may be fused to domain B of staphylococcal protein A as described by Unverdorben et al. (Protein Engineering, Design & Selection [2012] 25, 81-88).
- a molecule that forms a complex with a binding partner of a transcription factor or of a biomarker such as a cytochrome P 450 enzyme may likewise be an immunoglobulin, a fragment thereof or a proteinaceous binding molecule with immunoglobulin-like functions, as explained above.
- detecting the amount of for instance the Bile Salt Export Pump e.g. on a cell surface, may carried out using a first antibody or antibody fragment capable of specifically binding the Bile Salt Export Pump, as well as a second antibody or antibody fragment capable of specifically binding the first antibody or antibody fragment.
- a binding partner can bind a nucleic acid molecule, a peptide, a protein, a saccharide, a polysaccharide or a lipid.
- the binding partner is a PNA molecule.
- a PNA molecule is a nucleic acid molecule in which the backbone is a pseudopeptide rather than a sugar. Accordingly, PNA generally has a charge neutral backbone, in contrast to DNA or RNA. Nevertheless, PNA is capable of hybridising at least complementary and substantially complementary nucleic acid strands, just as e.g. DNA or RNA (to which PNA is considered a structural mimic).
- the binding partner is an aptamer, including a Spiegelmer®, described in e.g. WO 01/92655.
- An aptamer is typically a nucleic acid molecule that can be selected from a random nucleic acid pool based on its ability to bind a selected other molecule such as a peptide, a protein, a nucleic acid molecule a or a cell.
- Aptamers, including Spiegelmers are able to bind molecules such as peptides, proteins and low molecular weight compounds.
- Spiegelmers® are composed of L-isomers of natural oligonucleotides.
- Aptamers are engineered through repeated rounds of in vitro selection or through the SELEX (systematic evolution of ligands by exponential enrichment) technology.
- the affinity of Spiegelmers to their target molecules often lies in the pico- to nanomolar range and is thus comparable to immunoglobulins.
- An aptamer may also be a peptide.
- a peptide aptamer consists of a short variable peptide domain, attached at both ends to a protein scaffold.
- the binding partner is an immunoglobulin or a proteinaceous binding molecule with immunoglobulin-like functions as defined above.
- the binding partner may be detectably labelled as explained above, for example where the binding partner is intended to be used together with a detection agent that binds to the biomarker and/or the binding partner.
- the binding partner and/or a respective detection agent may be detectably labeled by linking the same, typically covalently, to a detectable marker such as a radioactive label, a fluorescent moiety, a chemical entity of low molecular weight, an oligonucleotide, an enzyme, or a protein such as a fluorescent protein such as a Green Fluorescent Protein (cf. above).
- the method may also include any molecules which can be used to indirectly indicate the level of the target molecule of interest such as of a transcription factor or of a biomarker such as a cytochrome P 450 enzyme, HNF-3P, or HNF-4a.
- the binding partner may in some embodiments be an immunoglobulin, a portion thereof, a proteinaceous binding molecule with immunoglobulin-like functions, a receptor for the biomarker or a portion thereof or a ligand for the biomarker or a portion thereof.
- the detection agent may in some embodiments be an immunoglobulin, a portion thereof, a proteinaceous binding molecule with immunoglobulin-like functions, a receptor for the biomarker or transcription factor a portion thereof, a ligand for the biomarker or transcription factor or a portion thereof or a binding partner or a portion thereof.
- a binding partner capable of binding a particular target nucleic acid molecule such as an mRNA molecule encoding a transcription factor or a biomarker, is a nucleic acid molecule that includes a nucleotide sequence that is at least partially complementary to a portion of a strand of such a target nucleic acid molecule.
- a nucleotide sequence is the complement of another nucleotide sequence if all of the nucleotides of the first sequence are complementary to all of the nucleotides of the second sequence. Accordingly, the respective nucleotide sequence will specifically hybridise to, or undergo duplex formation with, the respective portion of the target nucleic acid molecule under suitable hybridisation assay conditions, in particular of ionic strength and temperature.
- a single-stranded nucleic acid molecule may be selected as a nucleic acid binding partner.
- Such a single-stranded nucleic acid molecule may have a nucleic acid sequence that is at least partially complementary to at least a portion of a strand of the target nucleic acid molecule.
- the respective nucleotide sequence of the nucleic acid binding partner may for example be 70, for example 80 or 85, including 100 % identical to another nucleic acid sequence. The higher the percentage to which the two sequences are complementary to each other (i.e. the lower the number of mismatches), the higher is typically the sensitivity of the method of the invention.
- the respective nucleotide sequence is substantially complementary to at least a portion of the target nucleic acid molecule.
- substantially complementary refers to the fact that a given nucleic acid sequence is at least 90 % identical to another nucleic acid sequence.
- a substantially complementary nucleic acid sequence is in some embodiments 95 %, such as 100 % identical to another nucleic acid sequence.
- complementary or “complement” refers to two nucleotides that can form multiple favourable interactions with one another. Such favourable interactions are specific association between opposing or adjacent pairs of nucleic acid (including nucleic acid analogue) strands via matched bases, and include Watson-Crick base pairing.
- nucleic acid molecules e.g. DNA molecules
- the base adenosine is complementary to thymine or uracil
- the base cytosine is complementary to guanine.
- a nucleic acid probe used in the context of the present invention may be used to probe the sample by usual hybridization methods to detect the presence of nucleic acid molecules encoding e.g. a transcription factor or a biomarker.
- Sequence driven interaction is an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner (supra). Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the respective nucleotide.
- the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those skilled in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize. For example, in some embodiments selective hybridization conditions can be defined as stringent hybridization conditions.
- stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
- conditions of hybridization that achieve selective interactions between complementary sequences may involve hybridization in high ionic strength solution (6 x SSC or 6 x SSPE) at a temperature that is in the range from about 12 to about 25 °C below the Tm, the melting temperature at which half of the molecules dissociate from their hybridization partners, followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is in the range from about 5 °C to about 20 °C below the Tm.
- hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations than for DNA-DNA hybridizations.
- nucleic acid probes having nucleotide sequences which correspond to altered portions of the amino acid sequence of the polypeptide of interest chemical synthesis can be carried out.
- the synthesized nucleic acid probes may be first used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to standard PCR protocols utilizing the appropriate template, in order to obtain the probes that can be used in the context of the present invention.
- PCR polymerase chain reaction
- a respective hybridization probe can be labeled by standard labeling techniques using a detectable marker, such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, or chemiluminescence (supra). After hybridization, the probes may be visualized using known methods.
- a nucleic acid probe may be immobilized on a solid support. Examples of such solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, and acrylic resins, such as polyacrylamide and latex beads.
- nucleic acid probes may be bound to or immobilized on a solid support.
- the solid support may be a chip, for example a DNA microchip. Techniques for coupling nucleic acid probes to such solid supports are well known in the art.
- the most frequently used methods for determining the concentration of nucleic acids include the detection by autoradiography, fluorescence, chemiluminescence or bioluminescence as well as electrochemical and electrical techniques.
- a further suitable technique is the electrical detection of a target nucleic acid molecule as disclosed in international patent applications WO 2009/041917 and WO 2008/097190, both being incorporated herein by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
- a technique for the specific detection of a selected nucleic acid well established in the art is based on the hybridisation between a nucleic acid binding partner and a target nucleic acid. Typically the respective nucleic acid binding partner is immobilised onto a solid support, and subsequently one of the above mentioned detection methods is employed.
- an immunoglobulin labeled with a fluorescence dye may for instance be used to optically detect the presence of a certain protein or polypeptide.
- Nucleic acid intercalating dyes such as YOYO, JOJO, BOBO, POPO, TOTO, LOLO, SYBR, SYTO, SYTOX, PicoGreen, or Oligreen as available from Molecular Probes, may be used for optical detection.
- determining the level of expression of the gene of interest includes determining the level of transcription into mRNA.
- RNA encoding the protein of interest in the sample such as a transcription factor or a biomarker may be amplified using any available amplification technique, such as polymerase chain reaction (PCR), including multiplex PCR, nested PCR and amplification refractory mutation specific (ARMS) PCR (also called allele-specific PCR (AS-PCR), rolling circle amplification (RCA), nucleic acid sequence based amplification (NASBA), ligase chain reaction (LCR), QB replicase chain reaction, loop-mediated isothermal amplification (LAMP), transcription mediated amplification (TMA) and strand displacement amplification (SDA), including genome strand displacement amplification (WGSDA), multiple strand displacement amplification (MSDA), and gene specific strand displacement amplification (GS-MSDA).
- PCR polymerase chain reaction
- AS-PCR allele-specific PCR
- RCA rolling circle a
- Detection of the obtained amplification products may be performed in numerous ways known in the art. Examples include, but are not limited to, electrophoretic methods such as agarose gel electrophoresis in combination with a staining such as ethidium bromide staining.
- the method of the invention is accompanied by real time detection, such as real time PCR. In these embodiments the time course of the amplification process is monitored.
- a means of real time detection commonly used in the art involves the addition of a dye before the amplification process.
- An example of such a dye is the fluorescence dye SYBR Green, which emits a fluorescence signal only when bound to double-stranded nucleic acids.
- a detectable label or marker is used.
- a marker or label may be included in a nucleic acid that includes the sequence to be amplified.
- a marker may also be included in a primer or a probe. It may also be incorporated into the amplification product in the course of the reaction.
- such a marker compound e.g. included in a nucleic acid, is an optically detectable label, a fluorophore, or a chromophore.
- An illustrative example of a marker compound is 6-carboxyfluorescein (FAM).
- An immunoglobulin may be monoclonal or polyclonal.
- polyclonal refers to immunoglobulins that are heterogenous populations of immunoglobulin molecules derived from the sera of animals immunized with an antigen or an antigenic functional derivative thereof.
- polyclonal immunoglobulins one or more of various host animals may be immunized by injection with the antigen.
- Various adjuvants may be used to increase the immunological response, depending on the host species.
- “Monoclonal immunoglobulins”, also called “monoclonal antibodies”, are substantially homogenous populations of immunoglobulins to a particular antigen.
- Monoclonal immunoglobulins may be obtained by methods well known to those skilled in the art (see for example, K5hler et al., Nature (1975) 256, 495-497, and U.S. Patent No. 4,376,110).
- An immunoglobulin or immunoglobulin fragment with specific binding affinity only for e.g. a transcription factor or of a biomarker can be isolated, enriched, or purified from a prokaryotic or eukaryotic organism.
- Routine methods known to those skilled in the art enable production of both immunoglobulins or immunoglobulin fragments and proteinaceous binding molecules with immunoglobulin-like functions, in both prokaryotic and eukaryotic organisms.
- Techniques for preparing monoclonal antibodies and hybridomas are also well known in the art.
- a detectable marker may be coupled to a binding partner of a transcription factor or of a biomarker or a molecule that forms a complex with the binding partner of a transcription factor or a biomarker.
- a respective detectable marker which may be coupled to a binding partner of a transcription factor or a biomarker, or a molecule that forms a complex therewith, may be an optically detectable label, a fluorophore, or a chromophore.
- suitable labels include, but are not limited to, an organic molecule, an enzyme, a radioactive, fluorescent, and/or chromogenic moiety, a luminescent moiety, a hapten, digoxigenin, biotin, a metal complex, a metal and colloidal gold. Accordingly an excitable fluorescent dye, a radioactive amino acid, a fluorescent protein or an enzyme may for instance be used to detect e.g. the level of a cytochrome P450 enzyme or the level of a transcription factor.
- fluorescent dyes include, but are not limited to, fluorescein isothiocyanate, 5,6-carboxymethyl fluorescein, Cascade Blue®, Oregon Green®, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl, coumarin, dansyl chloride, rhodamine, amino-methyl coumarin, DAPI, Eosin, Erythrosin, BODIPY®, pyrene, lissamine, xanthene, acridine, an oxazine, phycoerythrin, a Cy dye such as Cy3, Cy3.5, Cy5, Cy5PE, Cy5.5, Cy7, Cy7PE or Cy7APC, an Alexa dye such as Alexa 647, and NBD (Naphthol basic dye).
- fluorescein isothiocyanate 5,6-carboxymethyl fluorescein
- Cascade Blue® Oregon Green®
- Texas red nitrobenz-2-oxa
- Suitable fluorescent protein include, but are not limited to, EGFP, emerald, EYFP, a phycobiliprotein such as phycoerythrin (PE) or allophycocyanin, Monomeric Red Fluorescent Protein (mRFP), mOrange, mPlum and mCherry.
- a reversibly photoswitchable fluorescent protein such as Dronpa, bsDronpa and Padron may be employed (Andresen, M., et al., Nature Biotechnology (2008) 26, 9, 1035).
- suitable enzymes alkaline phosphatase, soybean peroxidase, or horseradish peroxidase may serve as a few illustrative examples.
- a method of detection may include electrophoresis, HPLC, flow cytometry, fluorescence correlation spectroscopy or a modified form of these techniques. Some or all of these steps may be part of an automated separation/detection system.
- a biomarker that can be used to identify a cell of a hepatocyte phenotype is secreted, such as serum albumin or isoform termed isoform b of asialoglycoprotein receptor 2. Determining the presence and/or amount of such a biomarker may be carried out by determining the amount of the biomarker that is found in the media encompassing the cell.
- An illustrative example of a suitable technique in this regard is a radiolabel assay such as a Radioimmunoassay (RIA) or an enzyme-immunoassay such as an Enzyme Linked Immunoabsorbent Assay (ELISA).
- a radiolabel assay or an enzyme-immunoassay involves one or more separation steps in which a binding partner of e.g. serum albumin or asialoglycoprotein receptor 2b that has not formed a complex with the respective biomarker is being removed, thereby leaving only binding partner of e.g. serum albumin or asialoglycoprotein receptor 2b behind, which has formed a complex with e.g. serum albumin or asialoglycoprotein receptor 2b. This allows the generation of specific signals originating from the presence of the respective biomarker.
- An ELISA or RIA test can be competitive for measuring the amount of e.g. serum albumin or asialoglycoprotein receptor 2b, i.e. the amount of antigen.
- an enzyme labeled antigen is mixed with a test sample containing antigen, which competes for a limited amount of immunoglobulin or a proteinaceous binding molecule with immunoglobulin- like functions.
- the reacted (bound) antigen is then separated from the free material, and its enzyme activity is estimated by addition of substrate.
- An alternative method for antigen measurement is the double immunoglobulin/proteinaceous binding molecule sandwich technique. In this modification a solid phase is coated with specific immunoglobulin or a proteinaceous binding molecule with immunoglobulin-like functions.
- an antigen is immobilized by passive adsorption on to the solid phase.
- test serum may then be incubated with the solid phase and any immunoglobulin in the test serum forms a complex with the antigen on the solid phase.
- a solution of a proteinaceous binding molecule with immunoglobulin-like functions may be incubated with the solid phase to allow the formation of a complex between the antigen on the solid phase and the proteinaceous binding molecule.
- an immunoglobulin or proteinaceous binding molecule with immunoglobulin-like functions, linked to an enzyme is contacted with the solid phase and incubated.
- the second reagent is selected to be a proteinaceous binding molecule with immunoglobulin-like functions
- a respective proteinaceous binding molecule that specifically binds to the proteinaceous binding molecule or the immunoglobulin directed against the antigen is used.
- a complex of the second proteinaceous binding molecule or immunoglobulin and the first proteinaceous binding molecule or immunoglobulin, bound to the antigen, is formed. Washing again removes unreacted material.
- RIA radioactivity signals are being detected.
- ELISA the enzyme substrate is added. Its colour change will be a measure of the amount of the immobilized complex involving the antigen, which is proportional to the antibody level in the test sample.
- the immunoglobulin or the proteinaceous binding molecule with immunoglobulin-like functions may be immobilized onto a surface, such as the surface of a polymer bead (supra), or coated onto the surface of a device such as a polymer plate or a glass plate.
- a surface such as the surface of a polymer bead (supra)
- a device such as a polymer plate or a glass plate.
- the immune complexes can easily be separated from other components present by simply washing the surface, e.g. the beads or plate.
- This embodiment may be particularly useful for determining the amount of a biomarker present on the surface of cells, such as the Bile Salt Export Pump.
- any embodiment of a radiolabel assay or of an enzyme-immunoassay passive adsorption to the solid phase can be used in the first step. Adsorption of other reagents can be prevented by inclusion of wetting agents in all the subsequent washing and incubation steps. It may be advantageous to perform washing to prevent carry-over of reagents from one step to the next.
- a further characteristic of a hepatocyte phenotype that may be assessed is bile secretion. Detection of biliary secretion may for instance be done using the so called fluorescein diacetate time lapse assay. In this technique the cells of interest are incubated with doxycycline and fluorescein diacetate, a non-fluorescent precursor of fluorescein. Uptake and metabolization to fluorescein is then determined. As two further examples of characteristic of a hepatocyte phenotype, glycogen synthesis and the cell's ability to store glycogen may be determined.
- the present inventors have further observed that the detectable activity of cytochrome P450 enzymes in a cell obtained by a method as described herein remains at high levels, compared to adherent adult multipotent cells from which the respective cells originate.
- the detectable activity of cytochrome P450 enzymes in such a cell after 28 days of culture is 80 % or higher of the activity that was detectable immediately after obtaining the cell.
- the detectable activity of cytochrome P450 enzymes in such a cell after 28 days of culture is 90 % or higher of the activity that was detectable immediately after obtaining the cell.
- the detectable activity of cytochrome P450 enzymes in the cell is generally 60 % or more of the activity that was detectable immediately after obtaining the cell. In some embodiments the detectable activity of cytochrome P450 enzymes a respective cell of a hepatocyte phenotype after 42 days of culture is 70 % or higher of the activity that was detectable immediately after obtaining the cell.
- a cell is termed multipotent if it has the potential to give rise to cells from multiple, but a limited number of lineages of an organism.
- multipotent cells include, but are not limited to, stem cells and progenitor cells.
- a "totipotent" cell is a cell with the potential to differentiate into any type of somatic or germ cell found in the organism.
- any desired cell may be derived, by some means, from a totipotent cell.
- unipotent cells can produce only one cell type.
- unipotent, multipotent and totipotent generally refer to an undifferentiated cell or a partially differentiated cell.
- an undifferentiated cell include, but are not limited to, a stem cell, e.g. an embryonic stem cell, including a mammalian embryonic stem cell, such as a human, a mouse, a rat or a Guinea pig embryonic stem cell, any of which may also be a cell of an embryonic stem cell line.
- a stem cell may also be a trophoblast stem cell or any extraembryonic stem cell, e.g. an adult stem cell, also called a somatic stem cell.
- an undifferentiated cell examples include a germ cell, an oocyte, a blastomer, and an inner cell mass cell.
- the adult multipotent cells have been obtained from a host organism such as a fish, an amphibian, a bird or a mammal.
- the adherent adult multipotent cell is a stem cell.
- the stem cell is a somatic stem cell. Somatic stem cells have been identified in most organ tissues.
- a somatic stem cell is a hematopoietic stem cell, which is a mesoderm-derived cell that can be purified based on cell surface markers and functional characteristics.
- the hematopoietic stem cell isolated from bone marrow, blood, cord blood, fetal liver and yolk sac, is the progenitor cell that reinitiates hematopoiesis for the life of a recipient and generates multiple hematopoietic lineages.
- hematopoietic stem cells When transplanted into lethally irradiated animals or humans, hematopoietic stem cells can repopulate the erythroid, neutrophil-macrophage, megakaryocyte and lymphoid hematopoietic cell pool. In vitro, hematopoietic stem cells can be induced to undergo at least some self-renewing cell divisions and can be induced to differentiate to the same lineages as is seen in vivo.
- the stem cell is a cord blood stem cell such as a mesenchymal stem cell (MSC) or an unrestricted somatic stem cell (USSC).
- MSC mesenchymal stem cell
- USSC unrestricted somatic stem cell
- a mesenchymal stem cell may also be of umbilical cord tissue or of entirely different origin, such as adipose tissue, muscle tissue, placenta tissue or the dental pulp of deciduous baby teeth.
- a mesenchymal stem cell has cell surface molecules such as CD73, CD90 and CD 105 that are typical mesenchymal cell surface proteins.
- a mesenchymal stem cell also has fibroblastoid morphology and shows adherent growth on plastic surfaces.
- a mesenchymal stem cell originally derived from the embryonic mesoderm and isolated from adult bone marrow, is known to be able to differentiate to form muscle, bone, cartilage, fat, marrow stroma or tendon.
- the stem cell may be one of a gastrointestinal stem cell, an epidermal stem cell, a neural stem cell or a hepatic stem cell, also termed oval cell.
- the stem cells has been isolated from umbilical cord, placenta, amniotic fluid, chorion villi, blastocysts, bone marrow, adipose tissue, brain, peripheral blood, the gastrointestinal tract, cord blood, blood vessels, skeletal muscle, skin, liver or menstrual blood.
- An example of a cell that is a partially differentiated cell is a progenitor cell.
- a progenitor cell which may be unipotent or multipotent, has a capacity to differentiate into a specific type of cell and a limited ability of self-renewal, which it cannot maintain.
- Further examples of a partially differentiated cell include, but are not limited to, a precursor cell, i.e. a stem cell that has developed to the stage where it is committed to forming a particular kind of new cell, a lineage- restricted stem cell, and a somatic stem cell.
- the cell may be obtained or derived from any host organism.
- the cell may be directly taken from a respective host organism in form of a sample such as e.g. a biopsy or a blood sample. It may also have been derived from a host organism and subsequently been cultured, grown, transformed or exposed to a selected treatment.
- the host organism from which the cell is derived or obtained may be any organism such as a microorganism, an animal, such as a fish, an amphibian, a reptile, a bird, a mammal, including a rodent species, an invertebrate species, e.g. of the subclass Lissamphibia that includes e.g.
- mammals include, but are not limited to, a rat, a mouse, a rabbit, a guinea pig, a squirrel, a hamster, a vole, a platypus, a dog, a goat, a horse, a pig, an elephant, a chicken, a macaque, a chimpanzee and a human.
- the method of the invention includes assessing the absence of undifferentiated cells or cells not entirely differentiated, for example by using an antibody that specifically binds to a polypeptide cell surface marker present in undifferentiated cells but not in cells of hepatocyte phenotype.
- the protein or polypeptide cell surface marker present on the surface of undifferentiated cells but not in cells of hepatocyte phenotype is at least one of CXCR4, CD10, CD13, CD41a (gpllbllla), CD34, CD56, CD90, CD110, CD117, CD123, CD133, CD135, CD277 and CD318, at least one of CD10, CD13, CD56, and an MHC Class-I cell surface antigen, and/or at least one of CD3, CD5, CD7, CDl lb, CD14, CD15, CD16, CD19, CD25, CD45, and CD65.
- the method of the invention includes isolating and/or identifying cells of hepatocyte phenotype by positive or negative selection using an antibody or a proteinaceous binding molecule with antibody-like functions, as indicated above.
- the cells can for instance be identified and/or isolated by fluorescent activated cell sorting (FACS) or affinity column chromatography.
- FACS fluorescent activated cell sorting
- affinity column chromatography affinity column chromatography.
- the cells can also be identified on the basis of identifying plasma membrane proteins by mass spectrometry or other suitable techniques.
- any progenitor cell may be used in this method of the invention.
- suitable progenitor cells include, but are not limited to, neuronal progenitor cells, endothelial progenitor cells, erythroid progenitor cells, cardiac progenitor cells, oligodendrocyte progenitor cells, retinal progenitor cells, or hematopoietic progenitor cells.
- the amount of two or more transcription factors in the respective cell is increased.
- the amount which may also be referred to as the level of the respective protein, indicates the absolute number of molecules of the transcription factors in the cell.
- a method according to the invention includes increasing the cellular amount of the transcription factor hepatocyte nuclear factor 6 (HNF-6), also called one cut domain family member 1 (OC-1) or one cut homeobox 1.
- HNF-6 transcription factor hepatocyte nuclear factor 6
- OC-1 cut domain family member 1
- the protein HNF-6 may be any respective variant or isoform of the respective species, e.g. human.
- the protein may for example be the human protein of the Swissprot/Uniprot accession number Q9UBC0 (version 107 as of 18 April 2012, SEQ ID NO: 59), the murine protein of the Swissprot/Uniprot accession number 008755 (version 113 as of 18 April 2012, SEQ ID NO: 60), the rat protein of the Swissprot/Uniprot accession number P70512 (version 93 as of 18 April 2012, SEQ ID NO: 61), the bovine protein represented by the fragment of the Swissprot/Uniprot accession number Q5DM44 (version 41 as of 21 March 2012, SEQ ID NO: 62), the protein of the rhesus macaque (Macaca mulatta) of the Swissprot/Uniprot accession number G7MXH6 (version 2 as of 21 March 2012, SEQ ID NO: 63) or the protein of the crab-eating macaque (Cynomolgus monkey, Macaca fascicularis) of the Swissprot/
- a natural variant of the human HNF-6 protein is named VAR 010729 in the data base entry of Swissprot/Uniprot accession number Q9UBC0, having an alanine instead of a proline at position 75 of the amino acid sequence.
- the sequence of the rat HNF-6 protein depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P70512 has the identifier P70512-1 and is also called the isoform alpha.
- a further isoform, called the isoform beta has the identifier P70512-2, also named VSP_002312, in this data base entry.
- isoform alpha it differs from isoform alpha in that it has the sequence Ala Glu Ser Ala Met Gly Gly Ser Val Pro Ser Leu Arg He Thr Ser Gly Gly Pro Gin Leu Ser Val Pro Pro Leu Pro instead of an alanine at position 368 of the sequence defining Swissprot/Uniprot accession number P70512-1.
- HNF-6 may be the protein encoded by the ONECUT1 (one cut homeobox 1) gene, also called HNF6, HNF-6 or HNF6A, for example the human gene of GenBank Gene ID No 3175 as of 06 May 2012, the mouse gene of GenBank Gene ID No 15379 as of 20 April 2012, the rat gene of GenBank Gene ID No 25231 as of 20 April 2012 or the bovine gene of GenBank Gene ID No 503584 as of 10 May 2012.
- a further transcription factor is the transcription factor hepatocyte nuclear factor la (HNF-la), also called liver-specific transcription factor LF-B1 or sometimes simply transcription factor 1 (TCF-1).
- HNF-la transcription factor hepatocyte nuclear factor la
- LF-B1 liver-specific transcription factor LF-B1
- TCF-1 transcription factor 1
- the protein HNF-la may be any respective variant or isoform of the respective species, e.g. human.
- HNF- 1 a is the human protein of the Swissprot/ Uniprot accession number P20823 (version 157 as of 18 April 2012, SEQ ID NO: 65), the mouse protein of the Swissprot/Uniprot accession number P22361 (version 126 as of 18 April 2012, SEQ ID NO: 66), the rat protein of the Swissprot/Uniprot accession number P15257 (version 129 as of 18 April 2012, SEQ ID NO: 67), the chicken protein of the Swissprot/Uniprot accession number Q90867 (version 92 as of 13 June 2012, SEQ ID NO: 68) or the salmon (Salmo salar) protein of the Swissprot/Uniprot accession number Q91474 (version 77 as of 18 April 2012, SEQ ID NO: 69).
- the sequence of the human HNF-la depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P20823 has the identifier P20823-1 and is also called the isoform A.
- Two further isoforms, called isoforms B and C, have the identifiers P20823-2 and P20823-3 in this data base entry.
- Isoform B differs from isoform A firstly in that it has the sequence Gly Glu His Pro Val Pro His Thr Ala Gly ... Ala Cys Val Ser Gly Thr Ser Val Phe Pro instead of the sequence Ala Leu Tyr Ser His Lys Pro Glu Val Ala ...
- Isoform B differs from isoform A in that it does not contain the amino acids 543 to 601 of the amino acid sequence.
- Isoform C firstly differs from isoform A in that it has the sequence Lys Leu Val Gly Met Gly Gly His Leu Gly ... Ser His Cys Ala Thr Ser Val He Pro Gly instead* of the sequence Leu Ala Ser Thr Gin Ala Gin Ser Val Pro ... Thr Gin Ser Pro Phe Met Ala Thr Met Ala at positions 438 to 494 of the amino acid sequence.
- Isoform C differs from isoform A in that it does not contain the amino acids 495 to 601 of the amino acid sequence present in isoform A.
- HNF- ⁇ may be the protein encoded by the HNF1A gene, for example the human gene of GenBank Gene ID No 6927 as of 06 May 2012, the mouse gene of GenBank Gene ID No 21405 as of 06 May 2012, the rat gene of GenBank Gene ID No 24817 as of 20 April 2012, the chicken gene of GenBank Gene ID No 416967 as of 17 March 2012 or the Xenopus laevis gene of GenBank Gene ID No 378589 as of 12 November 2012.
- HNF-4a hepatocyte nuclear factor 4a
- N 2A1 nuclear receptor subfamily 2 group A member 1
- TCF-14 simply transcription factor 14
- the protein HNF-4a may be any respective variant or isoform of the respective species, e.g. human.
- the protein may for example be the human protein of the Swissprot/Uniprot accession number P41235 (version 147 as of 18 April 2012, SEQ ID NO: 75), the mouse protein of the Swissprot/Uniprot accession number P49698 (version 117 as of 18 April 2012, SEQ ID NO: 76), the rat protein of the Swissprot/Uniprot accession number P22449 (version 123 as of 18 April 2012, SEQ ID NO: 77) or the Xenopus laevis protein of the Swissprot/Uniprot accession number Q91766 (version 90 as of 18 April 2012, SEQ ID NO: 78).
- the sequence of the human HNF-4a depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P41235 has the identifier P41235-1 and is also called HNF-4al or the isoform HNF4-B.
- Six further isoforms, called isoforms HNF-4a2 or HNF- 4A, HNF-4a3 or HNF-4C, HNF-4a4, HNF-4a7, HNF-4a8 and HNF-4a9 have the identifiers P41235-2, P41235-3, P41235-4, P41235-5, P41235-6 and P41235-7 in this data base entry.
- HNF- 4a2 differs from HNF-4al in that it has only a single serine instead of the sequence Cys Glu Trp Pro Arg Pro Arg Gly Gin Ala Ala at positions 418 to 428 of the amino acid sequence.
- HNF-4a3 differs from HNF-4al in that it has the sequence Pro Cys Gin Ala Gin Glu Gly Arg Gly Trp ... Ser Pro Leu Cys Arg Phe Gly Gin Val Ala instead of the sequence Ser Pro Ser Asp Ala Pro His Ala His His His ... Gin Pro Thr He Thr Lys Gin Glu Val He at positions 378 to 474 of the amino acid sequence.
- HNF-4a4 differs from HNF-4al in that it contains the sequence Asn Asp Leu Leu Pro Leu Arg Leu Ala Arg Leu Arg His Pro Leu Arg His His Trp Ser He Ser Gly Gly Val Asp Ser Ser Pro Gin Gly instead of the asparagine at position 38 of the amino acid sequence.
- HNF-4a7 differs from HNF- 4al in that it has the N-terminal sequence Met Val Ser Val Asn Ala Pro Leu Gly Ala Pro Val Glu Ser Ser Tyr instead of the sequence Met Arg Leu Ser Lys Thr Leu Val Asp Met Asp Met Ala Asp Tyr Ser Ala Ala Leu Asp Pro Ala Tyr Thr Thr Leu Glu Phe Glu Asn Val Gin Val Leu Thr Met Gly Asn at positions 1 to 38 of the amino acid sequence.
- HNF-4a8 differs from HNF-4al firstly in that it has the N-terminal sequence Met Val Ser Val Asn Ala Pro Leu Gly Ala Pro Val Glu Ser Ser Tyr instead of the sequence Met Arg Leu Ser Lys Thr Leu Val Asp Met Asp Met Ala Asp Tyr Ser Ala Ala Leu Asp Pro Ala Tyr Thr Thr Leu Glu Phe Glu Asn Val Gin Val Leu Thr Met Gly Asn at positions 1 to 38 of the amino acid sequence.
- HNF-4a8 differs from HNF-4al in that it contains only a serine instead of the sequence Cys Glu Trp Pro Arg Pro Arg Gly Gin Ala Ala at the sequence positions 418 to 428 of the amino acid sequence.
- HNF-4a9 differs from HNF-4al firstly in that it has the N-terminal sequence Met Val Ser Val Asn Ala Pro Leu Gly Ala Pro Val Glu Ser Ser Tyr instead of the sequence Met Arg Leu Ser Lys Thr Leu Val Asp Met Asp Met Ala Asp Tyr Ser Ala Ala Leu Asp Pro Ala Tyr Thr Thr Leu Glu Phe Glu Asn Val Gin Val Leu Thr Met Gly Asn at positions 1 to 38 of the amino acid sequence.
- HNF-4a9 differs from HNF-4al in that it has the sequence Pro Cys Gin Ala Gin Glu Gly ArgGly Trp ... Ser Pro Leu Cys Arg Phe Gly Gin Val Ala instead of the sequence Ser Pro Ser Asp Ala Pro His Ala His His His ... Gin Pro Thr He Thr Lys Gin Glu Val He at positions 378 to 474 of the amino acid sequence.
- the sequence of the mouse HNF-4a depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P49698 has the identifier P49698-1 and is also called the long isoform.
- the short isoform with the identifier P49698-2 differs from the long isoform in that it has a serine instead of the sequence Cys Glu Trp Pro Arg Pro Arg Gly Gin Ala Ala at positions 418 to 428 of the amino acid sequence.
- HNF-4a is in some embodiments the protein encoded by the HNF4A gene, for example the human gene of GenBank Gene ID No 3172 as of 06 May 2012, the mouse gene of GenBank Gene ID No 15378 as of 06 May 2012, the rat gene of GenBank Gene ID No 25735 as of 06 May 2012, the bovine gene of GenBank Gene ID No 25735 as of 06 May 2012 or the horse gene of GenBank Gene ID No 100056007 as of 16 November 2011.
- a further transcription factor is the transcription factor hepatocyte nuclear factor 3 ⁇ ( ⁇ -3 ⁇ ), also called Forkhead box protein A2 (FOXA2) or sometimes transcription factor 3B (TCF-3B).
- ⁇ -3 ⁇ transcription factor hepatocyte nuclear factor 3 ⁇
- FOXA2 Forkhead box protein A2
- TCF-3B transcription factor 3B
- the protein ⁇ -3 ⁇ may be any respective variant or isoform of the respective species, e.g. human.
- the protein may for example be the human protein of the Swissprot/Uniprot accession number Q9Y261 (version 120 as of 18 April 2012, SEQ ID NO: 70), the mouse protein of the Swissprot/Uniprot accession number P35583 (version 112 as of 18 April 2012, SEQ ID NO: 71), the rat protein of the Swissprot/Uniprot accession number P32182 (version 104 as of 18 April 2012, SEQ ID NO: 72), the protein of Medaka fish (Japanese ricefish, Oryzias latipes) of the Swissprot/Uniprot accession number 042097 (version 79 as of 18 April 2012, SEQ ID NO: 73) or the chicken protein of the Swissprot/ Uniprot accession number Q9PWP8 (version 76 as of 18 April 2012, SEQ ID NO: 74).
- the human protein of the Swissprot/Uniprot accession number Q9Y261 version 120 as of 18 April 2012, SEQ ID NO: 70
- the sequence of the human ⁇ -3 ⁇ protein depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number Q9Y261 has the identifier Q9Y261-1 and is also called isoform 1.
- a further isoform, isoform 2 has the identifier Q9Y261-2 in this data base entry. It differs from isoform 1 in that it has the sequence Met His Ser Ala Ser Ser Met instead of the N-terminal (i.e., position 1) methionine of the amino acid sequence of Swissprot/Uniprot accession number Q9Y261 - 1.
- ⁇ -3 ⁇ may be the protein encoded by the HNF3B gene, also called the foxa2 gene, for example the human gene of GenBank Gene ID No 15376 as of 20 April 2012, the zebra fish gene of GenBank Gene ID No 30126 as of 29 April 2012, the mouse gene of GenBank Gene ID No 15376 as of 20 April 2012, the rat gene of GenBank Gene ID No 25099 as of 20 April 2012 or the Xenopus laevis gene of GenBank Gene ID No 100127318 as of 24 December 2011.
- a variant of any of the above transcription factors includes a protein with a high sequence identity to a respective known form of the transcription factor.
- a corresponding sequence of a variant that has a high sequence identity to a known form of the protein has in some embodiments at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 82 %, at least 85 %, at least 87 %, at least 90% identity, including at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identity to the sequence of the known form of the protein.
- identity is meant a property of sequences that measures the similarity or relationship of the variant and the corresponding known protein. Identity is measured by dividing the number of identical residues by the total number of residues and multiplying the product by 100.
- Blast Altschul, et al. (1997) Nucleic Acids Res. 25, 3389-3402)
- Blast2 Altschul, et al. (1990) J. Mol. Biol. 215, 403-410
- Smith- Waterman Smith, et al. (1981) J. Mol. Biol. 147, 195-197.
- a variant of a known protein may include one or more mutations - relative to the sequence of the known protein form.
- a respective variant may in some embodiments have been obtained from the sequence of a known protein form by molecular biology techniques, including recombinant techniques.
- a variant has a sequence that contains a substitution (or replacement) that is a conservative substitution, not being associated with a change in biological activity. Nevertheless, any substitution - including non-conservative substitution or one or more from the exemplary substitutions listed below - is envisaged as long as the variant retains its capability of acting as a transcription factor with the same specificity as the known form of the protein, respectively, and/or it has an identity to the then substituted sequence in that it is at least 60%, such as at least 65%, at least 70%), at least 75%, at least 80%), at least 85 % or higher identical to the "original" sequence.
- Conservative substitutions are generally the following substitutions, listed according to the amino acid to be mutated, each followed by one or more replacement(s) that can be taken to be conservative: Ala ⁇ Gly, Ser, Val; Arg ⁇ Lys; Asn ⁇ Gin, His; Asp ⁇ Glu; Cys ⁇ Ser; Gin ⁇ Asn; Glu ⁇ Asp; Gly ⁇ Ala; His ⁇ Arg, Asn, Gin; He ⁇ Leu, Val; Leu ⁇ He, Val; Lys ⁇ Arg, Gin, Glu; Met ⁇ Leu, Tyr, He; Phe ⁇ Met, Leu, Tyr; Ser ⁇ Thr; Thr ⁇ Ser; Trp ⁇ Tyr; Tyr ⁇ Trp, Phe; Val— > He, Leu.
- Other substitutions are also permissible and can be determined empirically or in accord with other known conservative or non-conservative substitutions.
- the following eight groups each contain amino acids that can typically be taken to define conservative substitutions for one another:
- substitutions can be expected to increase the likelihood of a change in biological activity, representing more substantial changes: Ala— > Leu, He; Arg ⁇ Gin; Asn ⁇ Asp, Lys, Arg, His; Asp ⁇ Asn; Cys ⁇ Ala; Gin ⁇ Glu; Glu ⁇ Gin; His ⁇ Lys; He ⁇ Met, Ala, Phe; Leu ⁇ Ala, Met, Norleucine; Lys ⁇ Asn; Met ⁇ Phe; Phe ⁇ Val, He, Ala; Trp ⁇ Phe; Tyr ⁇ Thr, Ser; Val ⁇ Met, Phe, Ala.
- the amount of at least two transcription factors is increased, as already explained above.
- Increasing the amount/level of a transcription factor in a cell according to the invention may be achieved by increasing the formation and/or by reducing the degradation of the transcription factor in the cell.
- Increasing the formation of a transcription may be achieved by activating and/ or enhancing one or more homologous, i.e. endogenous, genes encoding the transcription factor.
- Increasing the formation of a transcription may also be achieved by increasing the expression of a homologous, but transcriptionally repressed transcription factor, by reversing the silencing or inhibitory effect on the expression of a transcription factor gene, for example by regulating the upstream transcription factor expression or epigenetic modulation.
- the method of the invention includes introducing into the cell a nucleic acid molecule, typically a heterologous nucleic acid molecule, encoding the respective transcription factor, capable of allowing expression of the same in the cell.
- the method in such embodiments further includes expressing the heterologous transcription factor.
- nucleic acid molecule refers to any nucleic acid in any possible configuration, such as single stranded, double stranded or a combination thereof.
- Nucleic acids include for instance DNA molecules, RNA molecules, analogues of the DNA or RNA generated using nucleotide analogues or using nucleic acid chemistry, locked nucleic acid molecules (LNA), protein nucleic acids molecules (PNA), alkylphosphonate and alkylphosphotriester nucleic acid molecules and tecto-RNA molecules (e.g. Liu, B., et al., J. Am. Chem. Soc. (2004) 126, 4076- 4077).
- LNA locked nucleic acid molecules
- PNA protein nucleic acids molecules
- alkylphosphonate and alkylphosphotriester nucleic acid molecules tecto-RNA molecules
- DNA or RNA may be of genomic or synthetic origin and may be single or double stranded.
- Such nucleic acid can be e.g. mRNA, cRNA, synthetic RNA, genomic DNA, cDNA synthetic DNA, a copolymer of DNA and RNA, oligonucleotides, etc.
- a respective nucleic acid may furthermore contain non-natural nucleotide analogues and/or be linked to an affinity tag or a label.
- a PNA molecule is a nucleic acid molecule in which the backbone is a pseudopeptide rather than a sugar. Accordingly, PNA generally has a charge neutral backbone, in contrast to DNA or RNA.
- PNA is capable of hybridising at least complementary and substantially complementary nucleic acid strands, just as e.g. DNA or RNA (to which PNA is considered a structural mimic).
- LNA has a modified RNA backbone with a methylene bridge between C4' and 02', providing the respective molecule with a higher duplex stability and nuclease resistance.
- Alkylphosphonate and alkylphosphotriester nucleic acid molecules can be viewed as a DNA or an RNA molecule, in which phosphate groups of the nucleic acid backbone are neutralized by exchanging the P-OH groups of the phosphate groups in the nucleic acid backbone to an alkyl and to an alkoxy group, respectively.
- DNA or RNA may be of genomic or synthetic origin and may be single or double stranded.
- Such nucleic acid can be e.g. mRNA, cRNA, synthetic RNA, genomic DNA, cDNA synthetic DNA, a copolymer of DNA and RNA, oligonucleotides, etc.
- a respective nucleic acid may furthermore contain non- natural nucleotide analogues and/or be linked to an affinity tag or a label.
- nucleotide analogues are known and can be used in nucleic acids used in a method of the invention, for example as a heterologous nucleic acid introduced into a cell.
- a nucleotide analogue is a nucleotide containing a modification at for instance the base, sugar, or phosphate moieties.
- a substitution of 2'-OH residues of siRNA with 2'F, 2'O-Me or 2 ⁇ residues is known to improve the in vivo stability of the respective RNA.
- Modifications at the base moiety include natural and synthetic modifications of A, C, G, and T/U, different purine or pyrimidine bases, such as uracil-5-yl, hypoxanthin-9-yl, and 2-aminoadenin-9-yl, as well as non-purine or non-pyrimidine nucleotide bases.
- Other nucleotide analogues serve as universal bases.
- Universal bases include 3-nitropyrrole and 5-nitroindole. Universal bases are able to form a base pair with any other base. Base modifications often can be combined with for example a sugar modification, such as for instance 2'-0-methoxyethyl, e.g. to achieve unique properties such as increased duplex stability.
- a heterologous sequence e.g. a gene, encoding a transcription factor, such as HNF-la or HNF-6, may be introduced into an adherent adult multipotent cell.
- the sequence which may be included in a heterologous nucleic acid molecule, may be introduced into the cell by means of recombinant technology.
- the sequence may be included in any gene delivery system such as for instance a transposon system, a viral gene delivery system, an episomal gene delivery system or a homologous recombination system such as utilizing a zinc finger nuclease, a transcription activator- like effector (TALE) nuclease, or a meganuclease.
- TALE transcription activator- like effector
- a heterologous nucleic acid molecule that has a sequence encoding a transcription factor may in some embodiments be included in a vector, typically as a vector carrying a gene of the transcription factor. It may in this regard be advantageous to further use a vector that contains a promoter effective to initiate transcription in the respective host cell (whether of endogenous or heterologous origin).
- the present invention also relates to the use of such a nucleic acid molecule, e.g. a respective vector or included therein, for increasing the absolute quantity of a transcription factor in a cell.
- vector sometimes also referred to as gene delivery system or gene transfer vehicle, relates to a macromolecule or complex of molecules that include(s) a polynucleotide to be delivered to a host cell, whether in vitro, ex vivo or in vivo.
- a vector is a single or double-stranded circular nucleic acid molecule that allows or facilitates the transfer of a nucleic acid sequence into a cell.
- a vector can generally be transfected into cells and replicated within or independently of a cell genome.
- a circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes.
- a nucleic acid molecule encoding a transcription factor, such as HNF-la or HNF-6, can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
- a vector may for instance be a viral vector, such as a retroviral vector, a Lentiviral vector, a herpes virus based vector or an adenoviral vector.
- a vector may also be a plasmid vector or a liposome-based extrachromosomal vector, also called episomal vector.
- Lymphotrophic herpes virus is a herpes virus which replicates in a lymphoblast and becomes a plasmid for a part of its natural life-cycle.
- a vector may also be based on an organically modified silicate.
- a vector may be a transposon-based system, i.e. a transposon/transposase system, such as the so called Sleeping Beauty, the Frog Prince transposon - transposase system or the TTAA-specific transposon piggyBac system.
- Transposons are mobile genetic elements in that they are sequences of DNA that can move around to different positions within the genome of a single cell, a process called transposition. In the process, a transposon can cause mutations and change the amount of DNA in the genome.
- the amount of a transcription factor, e.g. HNF-6 or HNF- ⁇ , in a cell can be increased by enhancing the expression of homologous HNF-6 and HNF-la, respectively.
- Micro-RNA molecules termed miR-495 and miR- 218 target the 3 '-untranslated region of HNF-6 (Simion, A, et al., Biochem Biophys Res Commun. (2010) 391, 1, 293-298), reducing its expression. Such micro-RNA molecules can be silenced, i.e.
- a suitable antagomir a small RNA molecule of a length of typically 20 to 25 nucleotides, directed against the micro-RNA, into the respective cell
- a suitable antagomir a small RNA molecule of a length of typically 20 to 25 nucleotides, directed against the micro-RNA
- the expression of a homologous transcription factor e.g. HNF- 6
- HNF-6 can also be decreased, for instance where different heterologous HNF-6 is being expressed in a cell.
- Such reduction of the amount of homologous HNF-6 can for instance be achieved by means of a micro-RNA or small interfering RNA (siRNA) molecule directed against the transcription factor.
- RNA interference represents a cellular mechanism that protects the genome.
- SiRNA and miRNA molecules mediate the degradation of their complementary RNA by association of the siRNA with a multiple enzyme complex to form what is called the RNA-induced silencing Complex (RISC).
- RISC RNA-induced silencing Complex
- the siRNA or miRNA becomes part of RISC and is targeted to the complementary RNA species which is then cleaved.
- siRNAs are perfectly base paired to the corresponding complementary strand, while miRNA duplexes are imperfectly paired.
- RISC Activation of RISC leads to the loss of expression of the respective gene (for a brief overview see Zamore, PD, Haley, B Science [2005], 309, 1519-1524). It has been observed that the strongest silencing occurs with sequences that do not form secondary structures (Patzel, V., et al. Nature Biotech. [2005] 23, 1440-1444). Persons skilled in the art thus typically avoid using sequences that for instance are known to form a loop. This can be done by exchanging selected bases to a base that is still able to form a wobble pairing with the target sequence (Patzel, V et al., supra).
- the siRNA/miRNA technique has for example been applied to silencing parasitic DNA sequences, such as the cleavage of HIV RNA, as disclosed in US patent application 2005/0191618.
- a respective siRNA/shRNA/miRNA molecule may be directly synthesized or expressed within a cell of interest, for example by means of a vector under the control of an inducible or constitutive promoter. It may also be introduced into a respective cell and/or delivered thereto.
- a siRNA, shRNA or miRNA molecule into selected cells in vivo is its non-covalent binding to a fusion protein of a heavy-chain antibody fragment (F a b) and the nucleic acid binding protein protamin (Song, E. et al., Nature Biotech. (2005), 23, 6, 709-717).
- Another illustrative example of delivering a siRNA molecule into selected cells in vivo is its encapsulation into a liposome.
- Morrissey et al. Nature Biotech. (2005), 23, 8, 1002-1007) for instance used a stable nucleic acid-lipid-particle, coated with a polyethylene glycol-lipid conjugate, to form liposomes for intravenous administration.
- nanoparticles for delivering siRNA or miRNA a suitable approach of their cell- specific targeting has been described by Weissleder et al. ⁇ Nature Biotech. (2005), 23, 11, 1418- 1423).
- a further example of delivering a siRNA, shRNA or miRNA molecule to a selected target cell is the use of a biological vehicle such as a bacterium or a virus that includes the respective nucleic acid molecule.
- a biological vehicle such as a bacterium or a virus that includes the respective nucleic acid molecule.
- Xiang et al ⁇ Nature Biotech. (2006), 24, 6, 697-702 have for instance used this approach by administering the bacterium E. coli, which transcribed from a plasmid inter alia both shRNA and invasin, thus permitting entry into mammalian cells and subsequent gene silencing therein.
- promoter refers to a nucleic acid sequence needed for gene sequence expression. Promoter regions vary from organism to organism, but are well known to persons skilled in the art for different organisms. For example, in prokaryotes, the promoter region contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, and the CAAT sequence.
- a nucleic acid may be introduced into the multipotent cells by any suitable technique of nucleic acid delivery for transformation of a cell available in the art.
- suitable techniques include, but are not limited to, direct delivery of DNA, e.g. via trans fection, injection, including microinjection, electroporation, calcium phosphate precipitation, by using DEAE-dextran followed by polyethylene glycol, direct sonic loading, liposome mediated trans fection, receptor-mediated trans fection, microprojectile bombardment, agitation with silicon carbide fibers, Agrobacterium-mediated transformation, desiccation/inhibition-mediated DNA uptake or any combination thereof.
- a method according to the invention may further include measuring the expression of a gene encoding the (heterologous) transcription factor. This can for instance be achieved by determining the number of RNA molecules transcribed from a gene that is under the control of the respective promoter.
- a method commonly used in the art is the subsequent copy of RNA to cDNA using reverse transcriptase and the coupling of the cDNA molecules to a fluorescent dye. The analysis may for example be performed in form of a DNA microarray. Numerous respective services and kits are commercially available, for instance GeneChip® expression arrays from Affymetrix.
- Other means of determining gene expression of a transcription factor include, but are not limited to, an oligonucleotide array, and quantitative Real-time Polymerase Chain Reaction (RT-PCR).
- a method according to the invention additionally includes the comparison of obtained results with those of one or more control measurements.
- a control measurement may include any condition that varies from the main measurement itself. It may include conditions of the method under which for example no expression of the respective gene occurs.
- a further means of a control measurement is the use of a mutated form of a respective gene, for example a gene not encoding the corresponding transcription factor, or encoding a nonfunctional transcription factor protein.
- a method according to the invention may further include a selection or enrichment step for the cells of hepatocyte phenotype obtained by forward programming or differentiation as described above.
- the adult multipotent cells employed in a method of the invention such as the pluripotent stem cells or progeny cells thereof, may have a selectable or screenable reporter expression cassette with a reporter gene.
- expression cassette is meant a combination of the respective gene, including a transcriptional termination sequence, and a suitable transcriptional promoter.
- the reporter expression cassette may include a hepatocyte-specific transcriptional regulatory element operably linked to a reporter gene.
- Non- limiting examples of hepatocyte-specific transcriptional regulatory element include a promoter of albumin, a 1 -antitrypsin (AAT), cytochrome p450 3A4 (CYP3A4), apolipoprotein A-I, or apoE.
- a mature hepatocyte-specific transcriptional regulatory element may include a promoter of albumin, a 1 -antitrypsin, asialoglycoprotein receptor, cytokeratin 8 (CK8), cytokeratin 18 (CK18), CYP3A4, fumaryl acetoacetate hydrolase (FAH), glucose-6-phosphates, tyrosine aminotransferase, phosphoenolpyruvate carboxykinase, and tryptophan 2,3-dioxygenase.
- Selection or enrichment of cells of hepatocyte phenotype may further include a step of determining whether the cell of interest expresses a hepatocyte reporter gene or one or more hepatocyte characteristics as described herein.
- Characteristics of the cells of hepatocyte phenotype include, but are not limited to one or more of the expression of one or more hepatocyte markers (cf. above), the activity of liver-specific enzymes, the production of by-products of liver specific reactions such as bile and urea or bile secretion, or xenobiotic detoxification, morphological features characteristic of hepatocytes or in vivo liver engraftment in an immunodeficient subject.
- Two illustrative examples of a liver-specific enzyme, the activity of which may be determined are glucose-6-phosphatase and CYP3A4.
- Hepatocyte markers that may be analysed include, but are not limited to, HNF-3p, HNF-4a, cytochrome p450 3 A4 (CYP3A4), cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6, Bile Salt Export Pump (BSEP), glucose-6- phosphatase (G6PC), fructose- 1 ,6-bisphosphatase (FBP1), glycogen synthase 2 (GYS2), farnesoid X receptor (FXR), arginase Type 1 (ARG1), albumin such as human serum albumin (ALB) or a combination thereof.
- CYP3A4 cytochrome p450 3 A4
- FBP1 fructose- 1 ,6-bisphosphatase
- GYS2 glycogen synthase 2
- FXR farnesoid X receptor
- ARG1 arginase Type 1
- albumin such as human serum albumin
- Suitable markers are a 1 -antitrypsin (AAT), cytokeratin 8 (CK8), cytokeratin 18 (CK18), asialoglycoprotein receptor (ASGR), alcohol dehydrogenase 1 and liver-specific organic anion transporter (LST-1).
- Fig. 2 illustrates the analysis of the expression of the hepatocyte markers HNF- ⁇ , HNF-3p, HNF-4a, HNF6, CYP3A4, BSEP, G6PC, FBP1, GYS2, FXR, ARG1, and ALB by way of RT-PCR with subsequent agarose gel electrophoresis. HNF6 expression could not be detected in samples where this transcription factor had not been heterologously introduced into the cell.
- canalicular transporter BSEP was expressed in all cells following differentiation.
- G6PC showed weak expression in all cell samples.
- FBP1 a further gene encoding an enzyme of gluconeogenesis, was strongly expressed in differentiated cells transduced with HNF6.
- expression of ARG1 could only be detected in cells transduced with HNF6 following differentiation.
- a cell of hepatocyte phenotype as obtained according to the method described above may also be characterized on the basis of controllability of the enzyme activity of cytochrome p450.
- a cell of hepatocyte phenotype as obtained according to the method described above may also be characterized on the basis of controllability of the expression, and thereby typically the total amount in the cell, of one or more cytochrome p450 enzymes.
- a cell has an expression level and an enzymatic activity level of one or more cytochrome P450 enzymes that is controllable.
- controllable in this context is used as a synonym to "alterable” and means that a respective expression level or activity is capable of being controlled or capable of being altered.
- a large variety of compounds, typically low molecular weight compounds, are known in the art that can be used to alter, e.g. reduce or increase, the expression level or activity of different cytochrome P450 enzymes.
- cytochrome p450 in a cell of hepatocyte phenotype obtained as described herein can be induced or inhibited by certain known active compounds.
- a known CYPp450 inducer may be assessed.
- Suitable inducers in this regard include, but are not limited to, omeprazole, which induces Cytochrome P450 1A2 and rifampicin, which induces cytochrome P450 2C9, Cytochrome P450 2D6 and CYP3A4.
- inducers of cytochrome p450 mRNA include, but are not limited to, nicotine, phenobarbital, and primidone.
- Levels of RNA in a cell of interest may be determined using standard techniques well established in the art.
- Two further examples of a suitable compound that causes an increase in formation of mRNA for cytochrome P450 2C9 are glutethimide and the glucocorticoid dexamethasone.
- Cytochrome P450 2C9 (CYP2C9), also known as (R)-limonene 6-monooxygenase or S-mephenytoin 4-hydroxylase, is located within the cell, namely in the endoplasmic reticulum membrane.
- the protein may be the human protein of the Swissprot/ Uniprot accession number PI 1712 (version 156 as of 29 May 2013).
- Cytochrome P450 2C9 may also be the human protein of the Swissprot/ Uniprot accession number Q6IRV8 (version 58 as of 03 April 2013).
- Cytochrome P450 2C9 may also be a protein that contains the fragment of the Swissprot/Uniprot accession number Q5EDC5 (version 36 as of 03 April 2013), or a human protein that contains the fragment of the Swissprot/Uniprot accession number Q9UEH3 (version 61 as of 29 May 2013).
- Cytochrome P450 2D6 (CYP2D6), also known as debrisoquine 4-hydroxylase, is likewise located in the endoplasmic reticulum membrane. Cytochrome P450 2D6 is in some embodiments the human protein of the Swissprot/Uniprot accession number PI 0635 (version 150 as of 29 May 2013). In some embodiments cytochrome P450 2D6 is the human protein of Swissprot/Uniprot accession number PI 0635 (version 150 as of 29 May 2013), an isozyme also named Cytochrome P450-DB1.
- Cytochrome P450 2C9 may also be the human protein of the Swissprot/Uniprot accession number Q38LG0 (version 58 as of 03 April 2013), or the human variant of Swissprot/Uniprot accession number Q2XND2 (version 57 as of 03 April 2013).
- Cytochrome P450 2D6 is in some embodiments the human protein of Swissprot/Uniprot accession number Q3KPF3 (version 54 as of 29 May 2013), or the human protein of Swissprot/Uniprot accession number Q6NWU0 (version 97 as of 29 May 2013).
- Cytochrome P450 2D6 may also be the human protein of the Swissprot/Uniprot accession number E7ENE7 (version 17 as of 03 April 2013), or a human protein that contains the fragment of the Swissprot/Uniprot accession number H7BY38 (version 09 as of 03 April 2013).
- cytochrome P450 2D6 is the human protein of Swissprot/Uniprot accession number Q2XND3 (version 57 as of 03 April 2013), or the human protein of Swissprot/Uniprot accession number C1ID54 (version 26 as of 03 April 2013).
- cytochrome P450 2D6 is the human protein of Swissprot/Uniprot accession number D5KMS0 (version 18 as of 03 April 2013), or the human protein of Swissprot/Uniprot accession number Q2XND0 (version 53 as of 29 May 2013). In some embodiments cytochrome P450 2D6 is the porcine protein of Swissprot/Uniprot accession number Q1HLQ9 (version 29 as of 29 May 2013). In some embodiments cytochrome P450 2D6 is the porcine protein of Swissprot/Uniprot accession number Q1HLR0 (version 29 as of 03 April 2013).
- Cytochrome P450 2D6 is in some embodiments the cat protein of Swissprot/Uniprot accession number E0D568 (version 16 as of 29 May 2013), or the cat protein of Swissprot/Uniprot accession number M3X978 (version 2 as of 29 May 2013).
- Cytochrome P450 1A2 (CYP1A2) is also located in the endoplasmic reticulum membrane. Cytochrome P450 1A2 is in some embodiments the human protein of the Swissprot/Uniprot accession number P05177 (version 144 as of 29 May 2013), or the human protein of the Swissprot/Uniprot accession number Q6NWU3 (version 66 as of 29 May 2013). In some embodiments cytochrome P450 1A2 is the rat protein of the Swissprot/Uniprot accession number P04799 (version 121 as of 29 May 2013), or the rat protein of the Swissprot/Uniprot accession number D3ZF33 (version 26 as of 29 May 2013).
- Cytochrome P450 1A2 may also be the mouse protein of the Swissprot/Uniprot accession number POO 186 (version 127 as of 29 May 2013), or the mouse protein of the Swissprot/Uniprot accession number B6VGH4 (version 36 as of 29 May 2013).
- cytochrome P450 1A2 is the bovine protein of the Swissprot/Uniprot accession number A6H748 (version 41 as of 29 May 2013).
- Cytochrome P450 1A2 is in some embodiments the guinea pig protein of the Swissprot/Uniprot accession number Q64391 (version 91 as of 03 April 2013).
- cytochrome P450 1A2 is the rabbit protein of the Swissprot/Uniprot accession number G1SYH2 (version 11 as of 03 April 2013).
- a respective concentration of omeprazole will induce an increase of mRNA levels for Cytochrome P450 1A2 by about 5 to about 60-fold in comparison to cells not exposed to omeprazole.
- nicotine, phenobarbital, primidone, and rifampicin cause an increase in mRNA levels for cytochrome P450 1A2 by about 2-fold or more in a cell of hepatocyte phenotype obtained as described herein, when compared to a cell not exposed to nicotine, phenobarbital, primidone, and rifampicin, respectively.
- cytochrome P450 1A2 examples include, but are not limited to, ⁇ -naphthoflavone, cholanthrene and modafinil.
- compounds that effect, in a cell of hepatocyte phenotype obtained as disclosed above, an increase in mRNA levels for cytochrome P450 1A2 by about 2-fold or more, are methylcholanthrene, modafinil, nafcillin, and beta-Naphthoflavone.
- Rifampicin also known as rifaldazine, R/AMP, rifampin, and rofact
- Rifampicin is an antibiotic of the IUPAC name 7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29- pentahydroxy- 11 -methoxy-3 ,7,12,14,16, 18,22-heptamethyl-26- ⁇ (E)-[(4-methylpiperazin- 1 - yl)imino]methyl ⁇ -6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta- l(28),2,4,9,19,21,25(29),26-octaen-13-yl acetate.
- a cell of hepatocyte phenotype obtained as described above will show an increase in cytochrome P450 2C9 mRNA formation in the range from about 2- to about 5-fold, at a concentration of rifampicin from about 1 ⁇ to about 20 ⁇ , when compared to a corresponding cell not exposed to rifampicin.
- a respective concentration of rifampicin will effect an increase of mRNA levels for Cytochrome P450 2C9 by about 2.5- to about 4-fold in comparison to cells not exposed to omeprazole.
- a further example of a compound that effects an increase in mRNA levels for cytochrome P450 2C9by about 2-fold or more in a cell of hepatocyte phenotype obtained as described above, is secobarbital.
- secobarbital also acts as an inhibitor of cytochrome P450 2B1, the activity of which is being reduced, thought to be at least in part due to alkylation of the enzyme's heme group.
- a cell of hepatocyte phenotype obtained as described above will - after having been exposed to rifampicin at a concentration from about 1 ⁇ to about 20 ⁇ - show an increase in formation of mRNA for cytochrome p450 3A4 in the range from about 20 to about 60-fold, when compared to a corresponding cell not exposed to rifampicin.
- a respective concentration of rifampicin will induce an increase of mRNA levels for Cytochrome p450 3A4 by about 30- to about 60-fold in comparison to cells not exposed to rifampicin.
- a further illustrative example of a suitable inducer of cytochrome p450 3A4 is rifabutin.
- formation of mRNA for cytochrome p450 3A4 will increase by twofold or more if the cell has been exposed to rifabutin, compared to a respective cell of hepatocyte phenotype that has not been exposed to rifabutin.
- a glucocorticoid will effect an increase in formation of mRNA for cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype obtained as described above, when compared to a cell not exposed to the respective glucocorticoid.
- a barbiturate such as phenobarbital will effect an increase in formation of mRNA for cytochrome p450 3A4 by about twofold or more in a cell of hepatocyte phenotype obtained as disclosed herein, in comparison to a cell not exposed to the respective barbiturate.
- a cell of hepatocyte phenotype obtained as described above to one or more of carbamazepine, phenytoin, and oxcarbazepine leads to an increase in mRNA for cytochrome p450 3A4 by a factor of two or more, when compared to a respective cell of hepatocyte phenotype not exposed to carbamazepine, phenytoin, and/or oxcarbazepine, respectively.
- Another example of a compound that effects an increase in formation of mRNA for cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype as described herein is propofol.
- Pioglitazone, and troglitazone are yet two further examples of compounds that induce mRNA formation for cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype as described above, compared to a respective cell not exposed to pioglitazone and troglitazone, respectively.
- a cytochrome P450 enzyme To detect induction of mRNA levels of a cytochrome P450 enzyme, standard techniques employed in the art can be used. Such techniques may include the amplification of mRNA and/or the hybridization to probes capable of hybridizing to mRNA of the respective sequence encoding the cytochrome P450 enzyme of interest.
- the inducer for instance one of the examples above, is added to the cell culture medium. The cell culture medium containing the inducer is being exchanged every 24 hours.
- mRNA of the respective cytochrome P450 enzyme may then be measured after a period of 48 hours and after 72 hours of exposing the cells of hepatocyte phenotype to the respective inducer.
- Omeprazole generally induces Cytochrome P450 1A2 enzyme activity in a cell of hepatocyte phenotype obtained as described above.
- a concentration of omeprazole of about 50 ⁇ will give rise to an increase of enzyme activity of Cytochrome P450 1A2 by about 2 to about 40-fold, when compared to cells not exposed to omeprazole.
- nicotine, phenobarbital, primidone, and rifampicin cause an increase in catalytic activity of cytochrome P450 1A2 by about 2-fold or more in a cell of hepatocyte phenotype obtained as described herein, when compared to a cell not exposed to nicotine, phenobarbital, primidone, and rifampicin, respectively.
- rifampicin induces Cytochrome P450 2C9 enzyme activity in a cell of hepatocyte phenotype obtained as described above.
- Rifampicin will give an increase in cytochrome P450 2C9 catalytic activity in the range from about 4 to about 20-fold, at a concentration of rifampicin from about 10 ⁇ to about 50 ⁇ , when compared to CYP2C9 activity of a corresponding cell not exposed to rifampicin.
- a respective concentration of rifampicin will effect an increase of enzyme activity of Cytochrome P450 2C9 by about 2- to about 15-fold in comparison to cells not exposed to rifampicin.
- a further example of a compound that effects an increase catalytic activity of cytochrome P450 1A2 by about 2-fold or more in a cell of hepatocyte phenotype obtained as described above, is secobarbital.
- a cell of hepatocyte phenotype obtained as described above will - after having been exposed to rifampicin at a concentration from about 10 ⁇ to about 50 ⁇ - show an increase in activity of cytochrome p450 3A4 enzyme in the range from about 4- to about 8-fold, when compared to a corresponding cell not exposed to rifampicin.
- a respective concentration of rifampicin will induce an increase activity levels for Cytochrome p450 3A4 by about 2- to about 15-fold in comparison to those in cells not exposed to rifampicin.
- a further example of a suitable inducer of cytochrome p450 3A4 is rifabutin.
- catalytic cytochrome p450 3A4 activity will increase by twofold or more if the cell has been exposed to rifabutin, compared to a respective cell of hepatocyte phenotype that has not been exposed to rifabutin.
- a glucocorticoid will effect an increase in activity of cytochrome p450 3A4 enzyme by twofold or more in a cell of hepatocyte phenotype obtained as described above, when compared to a cell not exposed to the respective glucocorticoid.
- a barbiturate such as phenobarbital will effect an increase in catalytic activity of cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype obtained as disclosed herein, in comparison to a cell not exposed to the respective barbiturate.
- a cell of hepatocyte phenotype obtained as described above to one or more of carbamazepine, phenytoin, and oxcarbazepine leads to an increase in activity of cytochrome p450 3A4 enzyme by a factor of two or more, when compared to a respective cell of hepatocyte phenotype not exposed to carbamazepine, phenytoin, and/or oxcarbazepine, respectively.
- Another example of a compound that effects an increase in cytochrome p450 3A4 activity by twofold or more in a cell of hepatocyte phenotype as described herein is propofol.
- Pioglitazone, and troglitazone are yet two further examples of compounds that induce enzyme activity of cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype as described above, compared to a respective cell not exposed to pioglitazone and troglitazone, respectively.
- nicotine, omeprazole, phenobarbital, primidone, and rifampicin cause an increase in cytochrome P450 1A2 activity by about 2-fold or more in a cell of hepatocyte phenotype obtained as described herein, when compared to a cell not exposed to nicotine, omeprazole, phenobarbital, primidone, and rifampicin, respectively.
- Still further examples of compounds that effect, in a cell of hepatocyte phenotype obtained as disclosed above, an increase in catalytic activity for cytochrome P450 1A2 by about 2-fold or more, are methylcholanthrene, modafinil, nafcillin, and beta-Naphthoflavone.
- cytochrome P450 enzymes In order to detect an induction of catalytic activity of a cytochrome P450 enzyme, standard techniques employed in the art can be used. Such techniques may include the measurement of metabolites from cytochrome P450 enzyme reactions by High Performance Liquid Chromatography (HPLC) or Liquid Chromatography-Mass Spectrometry (LC-MS).
- HPLC High Performance Liquid Chromatography
- LC-MS Liquid Chromatography-Mass Spectrometry
- a substrate for cytochrome P450 2C9 enzyme activity is Diclofenac, which is metabolized to 4-hydroxy Diclofenac.
- a substrate for cytochrome P450 2D6 is Dextromethorphan, which is metabolized by CYP2D6 to Dextrorphan.
- a further example of a substrate of a cytochrome P450 3A4 enzyme reaction is Testosterone, which is metabolized by CYP3A4 to 6 -hydroxytestosterone.
- the cell culture medium containing the inducer is being exchanged every 24 hours. Prior to measurement cell culture medium containing the inducer is exchanged to cell culture medium containing a substrate of cytochrome P450. After exposing the cells for 1 to 4 hours to the cell culture medium containing the inducer, substrate turnover by the respective cytochrome P450 enzyme may be measured by detecting the formation of metabolites in the culture medium of cells of hepatocyte phenotype. Further illustrative compounds that may be used as a substrate for a cytochrome P450 enzyme are named below.
- Characterizing a cell of hepatocyte phenotype, obtained as described above, may also include measuring the inhibition of Cytochrome p450 activity by a known CYPp450 inhibitor.
- Suitable inhibitors in this regard include protease inhibitors such as ritonavir, indinavir, nelfinavir, saquinavir, which inhibit formation Cytochrome P450 3A4.
- cytochrome P450 3A4 After exposure to an antibiotic such as clarithromycin, telithromycin, or chloramphenicol, a cell of hepatocyte phenotype obtained as described above, will show a reduced enzymatic activity of cytochrome P450 3A4, typically a decrease in activity to half or less of the activity of a cell of hepatocyte phenotype not exposed to clarithromycin, telithromycin, or chloramphenicol.
- Some azole antifungal compounds such as ketoconazole or itraconazole also cause a decrease of cytochrome P450 3A4 activity.
- nefazodone After exposure to nefazodone, a cell of hepatocyte phenotype obtained as described herein, will show a reduction in activity of cytochrome P450 2C9.
- Suitable compounds that cause an inhibition of enzymatic activity of cytochrome P450 3A4 include, but are not limited to, aprepitant, verapamil, diltiazem, erythromycin, fluvoxamine, fluconazole, bergamottin and Valerian.
- Examples of compounds that cause a decrease in cytochrome P450 1A2 enzymatic activity to about half or less in a cell of hepatocyte phenotype obtained as described herein - when compared to a cell not exposed to the respective compound - are, fluvoxamine, ciprofloxacin, and verapamil.
- Compounds that inhibit P450 2C9 enzymatic activity include, but are not limited to, fluconazole, miconazole, amentoflavone, sulfaphenazole, fluvoxamine, and Valproic acid.
- a cell of hepatocyte phenotype obtained as described above will show an decrease in enzymatic activity of cytochrome p450 2D6 to about half or less, when compared to a corresponding cell not exposed to the respective compound(s).
- a cytochrome P450 enzyme To detect reduction of enzymatic activity of a cytochrome P450 enzyme, one may proceed as described above for detecting an increase of enzymatic activity.
- Cells of hepatocyte phenotype may be cultured and the inhibitor, for instance one of the examples above, may be added to the cell culture medium.
- the cell culture medium containing the inhibitor The cell culture medium containing the inhibitor in a concentration from about 0.1 to about 10 ⁇ may be contacted to the cells for 0.5 to 5 hours.
- cell culture medium containing the inhibitor is exchanged to cell culture medium containing a substrate of cytochrome P450 enzyme as described above. After incubation for 1 to 4 hours substrate turnover by respective cytochrome P450 enzyme may then be measured by detection of metabolites in culture medium of cells of hepatocyte phenotype.
- the amount of reduction in enzymatic activity depends on a variety of factors, such as the compound used as an inhibitor, the substrate used for detecting enzymatic activity, the concentration of the compound, the time period of exposing the respective cell to the compound that inhibits enzymatic activity of a cytochrome P450 enzyme, as well as other conditions selected.
- suitable substrates for different cytochrome P450 enzymes are known in the art.
- substrates of cytochrome P450 1A2 amitriptyline, caffeine, clomipramine, clozapine, cyclobenzaprine, estradiol, fluvoxamine, haloperidol, mexiletine, naproxen, ondansetron, propranolol, riluzole, ropivacaine, tacrine, theophylline, verapamil, and zolmitriptan are named.
- substrates of cytochrome P450 3A4 include, but are not limited to, cyclosporine, tacrolimus, sirolimus, docetaxel, tamoxifen, paclitaxel, cyclophosphamide, doxorubicin, erlotinib, etoposide, ifosfamide, teniposide, vinblastine, vincristine, vindesine, imatinib, irinotecan, vemurafenib, temsirolimus, anastrazole, gefitinib, ketoconazole, clarithromycin, erythromycin, telithromycin, amitriptyline, clomipramine, imipramine, norfluoxetine, sertraline, mirtazapine, nefazodone, reboxetine, venlafaxine, trazodone, buspirone, haloperidol, aripiprazole, risperidone
- substrates of cytochrome P450 2C9 include, but are not limited to, celecoxib, lornoxicam, diclofenac, ibuprofen, naproxen, piroxicam, meloxicam, suprofen, tolbutamide, glipizide, losartan, irbesartan, phenytoin, fluvastatin, glipizide, glibenclamide, glimepiride, tolbutamide, glyburide, S-warfarin, sildenafil, terbinafine, amitriptyline, fluoxetine, nateglinide, rosiglitazone, tamoxifen, torasemide, and ketamine.
- substrates of cytochrome P450 2D6 include, but are not limited to, carvedilol, S-metoprolol, propafenone, timolol, amitriptyline, clomipramine, desipramine, imipramine, paroxetine, haloperidol, perphenazine, risperidone, alprenolol, amphetamine, bufuralol, chlorpheniramine, codeine, debrisoquine, dexfenfluramine, dextromethorphan, encainide, flecainide, fluoxetine, fluvoxamine, lidocaine, metoclopramide, methoxyamphetamine, mexiletine, nortriptyline, minaprine, ondansetron, perhexiline, phenacetin, phenformin, propranolol, quanoxan, sparteine, tamoxifen, tramadol, and
- a respective method may include adding the respective compound, typically a predetermined quantity thereof, to the cells of hepatocyte phenotype.
- the compound of interest is dissolved in a fluid, typically a liquid, which is then being added to the medium that encompasses the cells of hepatocyte phenotype.
- a method according to the present invention includes contacting a cell of hepatocyte phenotype with a predetermined quantity of a compound of interest.
- a predetermined quantity of a compound of interest In some embodiments at least two different predetermined quantities of a compound of interest are used. In some of these embodiments at least a first and a second cell of hepatocyte phenotype are used. The first cell is contacted with the lower of the two predetermined quantities and the second cell is contacted with the higher of the two predetermined quantities.
- Respective embodiments may for example be a screening assay, a cytotoxity test or the determination of a dose/response curve.
- any desired matter may be tested for its effect on hepatic cells based on the use of cells obtained as described above.
- the matter may include or be a low molecular weight compound, such as a pharmaceutically active compound.
- the matter may be a nutrient, a saccharide, an oligosaccharide, a polysaccharide, a vitamin, a nucleotide, an oligonucleotide, a polynucleotide or a combination of any of these examples.
- the matter may be tested may be any sample, such as, but not limited to, a soil sample, an air sample, an environmental sample, a cell culture sample, a bone marrow sample, a rainfall sample, a fallout sample, a sewage sample, a ground water sample, an abrasion sample, an archaeological sample, a food sample, an infection sample, a nosocomial infection sample, a production sample, a drug preparation sample, a biological molecule production sample, a protein preparation sample, a lipid preparation sample, a carbohydrate preparation sample, a space sample, an extraterrestrial sample or any combination thereof.
- the sample may furthermore have been prepared in form of a fluid, such as a solution.
- Examples include, but are not limited to, a solution or a slurry of a nucleotide, a polynucleotide, a nucleic acid, a peptide, a polypeptide, an amino acid, a protein, a synthetic polymer, a biochemical composition, an organic chemical composition, an inorganic chemical composition, a metal, a lipid, a carbohydrate, a combinatory chemistry product, a drug candidate molecule, a drug molecule, a drug metabolite or of any combinations thereof.
- Further examples include, but are not limited to, a suspension of a metal, a suspension of metal alloy, and a solution of a metal ion or any combination thereof, as well as a suspension of a cell, a virus, a microorganism, a pathogen, a radioactive compound or of any combinations thereof. It is understood that a sample may furthermore include any combination of the aforementioned examples.
- compounds may be used in the form of a library.
- libraries are collections of various small organic molecules, chemically synthesized as model compounds, or nucleic acid molecules containing a large number of sequence variants.
- a screening process In embodiments where a plurality of candidate compounds are analysed for their hepatic effect according to a method of the present invention such an embodiment may typically called a screening process. These candidate compounds may be analysed independent from each other, e.g. concurrently, consecutively or in any way out of phase. The candidate compounds may for example be added to a cell culture medium. In some embodiments any number of steps of analysing a plurality of candidate compounds may for example be carried out automatically - also repeatedly, using for instance commercially available robots. For such purposes any number of automation devices may be employed, for instance an automated read-out system, a pipetting robot, a rinsing robot, or a fully automated screening system.
- the process may be an in-vitro screening process, for example carried out in multiple-well microplates (e.g. conventional 48-, 96-, 384- or 1536 well plates) using one or more automated work stations.
- the invention provides a process of high-throughput screening.
- the method may also be carried out using a kit of parts, for instance designed for performing the present method.
- cells of hepatocyte phenotype of a corresponding species are provided according to the invention as described above.
- the cells of hepatocyte phenotype are contacted with the matter of interest.
- the cells are then incubated with the matter of interest, i.e. the contact of the cells with the matter is maintained.
- Testing the effect of matter on the liver i.e. the hepatic effect, generally further includes assessing the viability and/or functionality of the cells of hepatocyte phenotype.
- the effect of matter may be monitored over a certain period of time, such as over a period from about 1 hour to about a week, e.g. 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days or 6 days.
- the functionality of the cells of hepatocyte phenotype may be assessed by measuring any hepatocyte characteristic function, such as of the above illustrated functions.
- the viability of the cells may be assessed by any suitable technique.
- microscopic analysis may be carried out, for example by determining the cellular morphology.
- Microscopic analysis may for example include determining the presence of signs selected from the group consisting of cellular stress, factor toxicity, cellular viability, and cellular death.
- the level of one or more metabolites indicative of cell viability may also be assessed in this regard.
- Two illustrative examples of a metabolite the intracellular level of which may be determined are urea or ammonia.
- Three illustrative examples of a protein the expression of which may be determined are liver albumin, beta galactosidase, and cytochrome P450.
- apoptosis occurs, including is being initiated are progresses, in one or more cells of hepatocyte phenotype following contact with the compound of interest.
- Apoptosis is a programmed cell death and typically a mechanism in a multicellular organism to remove undesired cells.
- An apoptotic cell shows a characteristic morphology, by which it can be identified under a microscope.
- the occurrence and/or progress of apoptosis in a tumour cell may be monitored, for example by propodium iodide staining, Annexin V-FITC staining, flow cytometry analysis, or combinations thereof, as well as by determining mitochondrial dysfunction or caspase 3 activation.
- Testing the hepatic effect may include contacting the cells of hepatocyte phenotype with one or more selected test compounds.
- such a method may further include determining whether metabolites of the test compounds or of other compounds, whether heterologously applied or homologously present.are formed.
- the formed metabolites, including the amount of formed metabolites and the pattern of metabolites generated, may then be compared to a reference experiment.
- a reference experiment may include cells that have not been contacted with the selected test compound(s) but have been contacted with test compound carrier substances.
- testing the hepatic effect includes determining the formation, in particular determining functional characteristics of the formation, of serum albumin, of fibrinogen, and at least one of the prothrombin group of clotting factors. Testing the hepatic effect may also include determining the formation and secretion, in particular determining functional characteristics of the formation and secretion of bile, lipoprotein, transferrin or complement proteins. Testing the hepatic effect may also include determining whether the cells synthesize, in particular determining functional characteristics of the synthesis of, glycoprotein or urea.As indicated above, testing the hepatic effect may include analysis of the metabolization of homologous and/or heterologous compounds.
- the metabolization of homologous and/or heterologous compounds in hepatocyets and hepatocyte-like cells is carried out by so called drug-metabolizing enzymes, enzymes that catalyze the biotransformation of for instance drugs and xenobiotics.
- testing the hepatic effect may include determining test compound induction or inhibition of drug metabolizing phase I and phase II proteins or transporter and receptor proteins.
- drug- metabolizing enzymes can be classified into two main groups: oxidative or conjugative.
- Phase I reactions also termed nonsynthetic reactions, include, but are not limited to, oxidation, reduction, hydrolysis, cyclization and decyclization, addition of oxygen or removal of hydrogen.
- the reactions are carried out by mixed function oxidases.
- a typical reaction in a Phase I oxidation involves conversion of a C-H bond to a C-OH.
- a well known example of an oxidative group of enzymes that mediate phase I reactions are the NADPH-cytochrome P450 reductase (P450R)/cytochrome P450 (P450) electron transfer systems.
- Conjugation reactions are known as phase II reactions and are usually detoxicating in nature, typically involving the interactions of the polar functional groups of phase I metabolites.
- Conjugation may for instance occur with glucuronic acid, a sulfonate, glutathione, acetate or an amino acid.
- glucuronic acid a sulfonate
- glutathione a sulfonate
- glutathione a sulfonate
- glutathione a sulfonate
- glutathione a sulfonate
- glutathione glutathione
- acetate amino acid
- testing the hepatic effect of a compound of interest includes analysing whether phase I and/or phase II proteins of the cell can be induced or inhibited.
- phase I and/or phase II proteins of the cell can be induced or inhibited.
- Such induction or reduction of activity and or amount of enzymes in hepatocytes is well known in the art.
- the expression of CYP 1 genes can be induced via the aryl hydrocarbon receptor (AhR) which dimerizes with the AhR nuclear translocator, in response to many polycyclic aromatic hydrocarbon (PAHs).
- AhR aryl hydrocarbon receptor
- Xenobiotics such as phenobarbital-like compounds (CAR), dexamethasone and rifampin-type of compounds (PXR) are known to cause the steroid family of orphan receptors, the constitutive androstane receptor (CAR) and pregnane X receptors (PXR) to heterodimenze with the retinoid X receptor (RXR) and transcriptionally activate the promoters of CYP2B and CYP3A gene expression.
- CAR phenobarbital-like compounds
- PXR rifampin-type of compounds
- phase II gene inducers include, but are not limited to, butylated hydroxyanisol (BHA), tertbutylhydroquinone (tBHQ), green tea polyphenol (GTP), (-)-epicatechin-3-gallate (EGCG) and the isothiocyanates (PEITC, sulforaphane).
- BHA butylated hydroxyanisol
- tBHQ tertbutylhydroquinone
- GTP green tea polyphenol
- EGCG epigallate
- PEITC isothiocyanates
- MPK mitogen-activated protein kinase
- ARE / EpRE antioxidant / electrophile response element enhancers that are found in many phase II drug-metabolizing enzymes as well as many cellular defensive enzymes such as thioredoxins, GCS and HO-1, with the subsequent induction of gene expression of these genes.
- cells of hepatocyte phenotype are cultured in co- culture with at least one of endothelial cells, Kupffer cells, hepatic stellate cells, cholangiocytes and fibroblasts.
- the invention also provides a method of identifying a hepatic pathogen.
- hepatic pathogen refers to any pathogen, such as a bacterial, viral or parasitic pathogen, that is capable of infecting cells of the liver, in particular hepatocytes.
- the invention also provides a method of treating a subject in need of an increase in liver function.
- the method includes administering to the subject cells of hepatocyte phenotype obtained as described above. Thereby liver function is increased.
- cells may be grown two-dimensionally, e.g. in a monolayer, or three-dimensionally, for example in the extracellular matrix.
- Cells of hepatocyte phenotype obtained as described above may also be used for applications in spheroid and/or organoid cultures and synthetic scaffolds or bioartificial liver devices.
- the cells of hepatocyte phenotype may be used for therapeutic applications of at least one of viral or toxin mediated hepatitis, heredity diseases such as Wilson's disease, heamatochromatosis or alpha- 1 antitrypsin deficiency, and liver cirrhosis or liver cancer.
- the cells of hepatocyte phenotype are cultured in co-culture with endothelial cells, with Kupffer cells, hepatic stellate cells, cholangiocytes and/or fibroblasts (supra).
- Cord blood not suitable for clinical banking was, from a plurality of donors, applied for stromal stem cell generation in accordance with informed donor consent. Isolation of mononuclear cells (MNC), selective culture of MNC for USSC-generation and USSC-expansion were performed as described previously [Kogler, G., et al., J Exp Med (2004) 200, 2, 123-135].
- MNC mononuclear cells
- HNFla human hepatocytes nuclear factor la
- FOXA2 forkhead box A2
- HNF4a hepatocytes nuclear factor 4a
- HNF6 hepatocytes nuclear factor 6
- HNFla and FTNF4a cDNAs were inserted into ECORI and BAMHI restriction sites of pUC2CL6IN (Primer 5'- 3': HNF la-forward: AAAGAATTCGCCACCATGGTTTCTAAAC TGAGCCAG (SEQ ID NO: 31), HNF la-reverse: TTTGGATCCGGTTACTGGGAGGA AGAGG (SEQ ID NO: 32); FOXA2- forward: AAAGCTAGCGCCACCATGCTGGGAG CGGTGAAG (SEQ ID NO: 33), FOXA2- reverse: AAAGG ATCCTTTCTTCTCCCTTGCGT CTC (SEQ ID NO: 34); HNF4a-forward: AAAGAATTCGCCACCATGCGACTCTCCAAA ACCCT (SEQ ID NO: 35), HNF4a-reverse: TTTGGATCCCCCCAAGCCCCAGCGGCTTG (SEQ ID NO: 36); HNF6-forward: AAACTCGAGGCCACCATGAACGCGCAGCTGACC AT (SEQ
- FOXA2 was inserted into NHEI and BAMHI restriction sites of pUC2CL6IN.
- HNF6 was inserted into XHOI and BAMHI restriction sites of pUC2CL6IN.
- plasmids were combined with packaging plasmid pCD/NLBH and envelope plasmid pALF-GALV and integrated by FUGENE-transfection (Roche, Mannheim, Germany) into Hek293T cells for lentiviral production. After 24 hrs, supernatants containing lentiviruses were collected and passed through a 45 ⁇ syringe- filter (Fischer Scientific, Schrö, Germany).
- Antibodies applied were: mouse anti HNF4a (clone K9218, Perseus Proteomics, dilution 1 :200), mouse anti HNF6 (clone 4F12, Novus, dilution 1 :200), rabbit anti FOXA2 (#3143, Cell signalling, dilution 1 :800), rabbit anti HNFla (sc- 10791 , Santa Cruz, dilution 1 :200).
- RNA isolation and reverse transcription polymerase chain reaction (RT-PCR)
- RNA isolation from cell lines and cell populations was performed applying RNeasy Mini Kit with additional on-column DNase digestion (Qiagen, Hilden, Germany).
- Total human fetal liver RNA (MVPTM Total RNA, pooled from male donors, gestation weeks 18 - 20) was purchased from Stratagen (La Jolla, CA, USA). 0.5-1.0 ⁇ g of total RNA was reversely transcribed afterwards into cDNA using SuperScriptlll (Invitrogen, Düsseldorf, Germany), according to manufacturer's instructions.
- Quantitative real time PCR was carried out by setting up reactions in triplicates, containing SYBR® Green PCR Mastermix (Applied Biosystems, Darmstadt, Germany), 0.2 ⁇ of each primer as well as 50 ng of reverse transcribed total RNA, and subsequent analysis on ABI prism 7700 real-time PCR system (Applied Biosystems, Darmstadt, Germany). All qPCR results refer to the (housekeeping) gene Glyceraldehyde-3 -phosphate dehydrogenase (GAPDH). Analyses correspond to a minimum of 3 independently isolated RNA samples per time point of differentiation. Primer sequences are listed in Fig. 11.
- CYP3A4 activity was performed applying the P450-GloTM CYP3A4-Assay (Promega, Mannheim, Germany). Inducible CYP3A4 activity was determined by culturing differentiated cells with or without 25 ⁇ rifampicin (Sigma-Aldrich, Schnelldorf, Germany) for 48 hrs before testing. Prior to testing, cells were washed twice with PBS and incubated in HDM containing luciferin-PFBE substrate (50 ⁇ ) for 3-4 hrs. Subsequently, 50 ⁇ of supernatant were mixed in equal parts with luciferin detection reagent, incubated for 20 min and measured with a tube-luminometer (Berthold Analytical, Nashua, USA).
- Hepatocyte functions of transduced USSC were analyzed by determining the amount of human albumin and urea in cell culture supernatants or by evaluating CYP3A4 substrate metabolization by transduced USSC.
- Albumin secretion, urea production and inducible cytochrome- p450-3A4 activity as performed by transduced USSC demonstrated functional activity of transduced USSC in a hepatocyte specific manner. This designates the cells of hepatocyte phenotype described herein as suitable alternatives for hepatocyte based applications.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides an in vitromethod of generating cells of hepatocytephenotype, the method comprising increasing in adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 6 and the amount of the transcription factor hepatocytenuclear factor 1α. The invention also provides cells of hepatocytephenotype, which have been obtained by this method.
Description
CELL OF HEPATOCYTE PHENOTYPE
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of and the priority to an application for a "Method of Generating Cells of Hepatocyte Phenotype" filed on 19 June 2012 with the European Patent Office as an international patent application, assigned serial number PCT/EP2012/061679. The content of said application filed on 19 June 2012 is incorporated herein by reference for all purposes in its entirety including all tables, figures, and claims - as well as including an incorporation of any element or part of the description, claims or drawings not contained herein and referred to in Rule 20.5(a) of the PCT, pursuant to Rule 4.18 of the PCT. FIELD OF THE INVENTION
[0002] The present invention relates to a cell of hepatocyte phenotype, as well as to a method of generating a respective cell of hepatocyte phenotype.
BACKGROUND OF THE INVENTION
[0003] Under the European Community Regulation on chemicals and their safe use, termed "REACH" for Registration, Evaluation, Authorisation and Restriction of Chemical substances, manufacturers and importers are required to evaluate the risks associated with chemical compounds and to take measures regarding their control. A particular challenge is assessing hepatotoxicity, since the physiological effects of many compounds only unfold once they are being degraded in the liver. In addition, pharmaceutically active substances need to be tested for their hepatic effects.
[0004] Tests of xenobiotics and other compounds on their hepatic effects are currently generally based on animal models, i.e. the use of living animals or of cultured animal cells. Regardless of ethical concerns on animals, such model systems can only reflect human physiology to a limited extent. As a result, even after long and expensive test phases frequently unexpected adverse effects of pharmaceutical substances occur in humans during clinical trials or even after market entry. An accepted alternative to animal models is the use of primary human hepatocytes. Due to the limited availability of donor material such methods can, however, only be carried out on a small scale. Further, differences in isolation procedure and in donor parameters (gender, genetic profile, medical condition, state of health) impede a standardisation of a test system based on primary human hepatocytes. In addition, human primary hepatocytes quickly lose their functions when cultured ex vivo.
[0005] As an alternative to primary human hepatocytes, in research often carcinoma cell lines are being employed. Such cell lines are cost-effective, can be cultured and grown easily and are
regularly available. However, liver specific functions such as the capability of detoxication are significantly reduced in these cells in comparison to hepatocytes. Hence, such cells are unsuitable for toxicological tests. In addition, the limited number of established carcinoma cell lines restricts genetic variability. A further alternative to primary human hepatocytes is the use of adult stem cells. Differentiation of adult stem cells has, however, so far only yielded cells with limited hepatocyte- like properties. Due to their low functionality they are also not suitable for carrying out toxicological and pharmacological tests.
[0006] When differentiated, embryonic stem cells achieve a high degree of functionality, since these cells represent precursors of every human tissue and thus can theoretically be differentiated unlimitedly into any cell of the human body. However, ethic concerns limit the use of embryonic stem cells in European countries such as Germany, as well as in the US substantially.
[0007] Induced pluripotent stem cells (iPS) are regarded ethically uncritical. The most effective method of generating iPS is retrovirally mediated overexpression. Nevertheless, this method only achieves an efficiency of 0.0001 to 0.1 %; in part it achieves only a partial reprogramming. Its low efficiency and reproducibility renders this method very time and cost intensive.
[0008] In addition, both embryonic stem cells and induced pluripotent stem cells are partially genetically unstable, and the factors used and induced, respectively, in differentiating them are associated with tumourigenesis, which affects the results of toxicological analysis.
[0009] Thus, there remains a need for an alternative human or animal based method that can be used for testing chemical compounds on their hepatic effects. It would be advantageous if such a method could circumvent species specific particularities or allow for genetic variability, be at hand at any time and/or reduce the number of animal tests needed. Accordingly it is an object of the present invention to provide a respective method. This object is solved by the cell and the method of forming the same according to the appended claims.
SUMMARY OF THE INVENTION
[0010] According to a first aspect, the invention provides an in vitro method of generating cells of hepatocyte phenotype. The method includes increasing in adherent adult multipotent cells the amounts of two transcription factors. These two transcription factors, the amounts of which are increased in the multipotent cells, are hepatocyte nuclear factor 6 (HNF-6) and hepatocyte nuclear factor la (HNF-la). Typically the method includes providing such adherent adult multipotent cells.
[0011] In some embodiments only the amounts of these two transcription factors are being increased in the cells. According to a particular embodiment of the first aspect, the method further includes increasing in the adherent adult multipotent cells the amount of the transcription factor
hepatocyte nuclear factor 4a (HNF-4a) and/or increasing in the adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 3β (ΗΝΤ-3β). The adult multipotent cells are in some embodiments mesenchymal stem cells, for instance mesenchymal stem cells of cord blood.
[0012] According to a second aspect, the invention provides a cell of hepatocyte phenotype.
The cell is obtained by the method according to the first aspect.
[0013] In some embodiments the cell according to the second aspect contains a heterologous nucleic acid sequence encoding HNF-6. In some embodiments the cell contains a heterologous nucleic acid sequence encoding HNF-la. In some embodiments the cell contains a heterologous nucleic acid sequence encoding HNF-6 and a heterologous nucleic acid sequence encoding HNF-la. In some embodiments the cell contains a heterologous nucleic acid sequence encoding HNF-6 and HNF- 1 a.
[0014] The cell according to the second aspect expresses typically detectable amounts of albumin, glucose-6-phosphatase, arginase Type 1, asialoglycoprotein receptor 1, tyrosine aminotransferase, tryptophan 2,3-dioxygenase, and cytochrome p450 3A4.
[0015] In some embodiments the cell according to the second aspect has detectable activity of one or more cytochrome P450 enzymes. The cell may express detectable amounts of one or more cytochrome P450 enzymes, for example the cell may contain mRNA encoding one or more cytochrome P450 enzymes. In some embodiments the cell expresses mRNA encoding one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4. In some embodiments the cell has detectable activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4. In some embodiments the activity of the one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 is controllable, i.e. can be induced and/or inhibited, using established compounds known in the art.
[0016] In some embodiments the cell according to the second aspect has a detectable activity of cytochrome P450 enzymes after 28 days of cell culture. In such embodiments the activity of cytochrome P450 enzymes after 28 days of cell culture may be 85 % or more of the activity that was detectable immediately after obtaining the cell by the method according to the first aspect. In some embodiments the cell according to the second aspect has a detectable activity of cytochrome P450 enzymes after 42 days of cell culture. In such embodiments the activity of cytochrome P450 enzymes after 42 days of cell culture may be 65 % or more of the activity that was detectable immediately after obtaining the cell.
[0017] Upon culturing a cell obtained by a method as described herein, generally the detectable activity of cytochrome P450 enzymes in such a cell after 28 days of culture is 80 % or higher of the activity that was detectable immediately after obtaining the cell. After 42 days of
culture the detectable activity of cytochrome P450 enzymes in a respective cell of hepatocyte phenotype is 60 % or higher of the activity that was detectable immediately after obtaining the cell.
[0018] In some embodiments the cell according to the second aspect has an activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 that is controllable. In some embodiments the activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 can be enhanced by a compound known to enhance the respective enzyme activity in a hepatocyte. In some embodiments the activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 can be decreased by a compound known to reduce the respective enzyme activity in a hepatocyte.
[0019] In some embodiments the cell according to the second aspect has an mRNA level of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 that is controllable.
[0020] According to a third aspect, the invention provides a population of cells of hepatocyte phenotype. The population of cells consists of, or in some embodiments includes, cells according to the second aspect.
[0021] In some embodiments 80 % or more of the population of cells according to a third aspect express elevated amounts of serum albumin, asialoglycoprotein receptor 1 and/or cytochrome p450 3A4.
[0022] According to a fourth aspect, the invention provides an in vitro method of testing the hepatic effect of a compound of interest. The method includes contacting a cell of hepatocyte phenotype according to the second aspect with the compound of interest. Generally a plurality of cells according to the second aspect is employed. Typically the method further includes assessing the viability and/or functionality of the cells of hepatocyte phenotype. In some embodiments the method further includes determining the occurrence of apoptosis in the cells of hepatocyte phenotype.
[0023] According to a particular embodiment of the fourth aspect, the method further includes determining the cells' activity in generating at least one of serum albumin, fibrinogen, a clotting factor of the prothrombin group, bile, lipoprotein, transferrin, complement protein and glycoprotein. According to a further embodiment of the fourth aspect, the method includes determining the cells' activity in metabolizing homologous and/or heterologous compounds. In some embodiments testing the hepatic effect includes determining whether drug metabolizing phase I and phase II proteins can be induced or inhibited or whether transporter and receptor proteins of the cell can be induced or inhibited.
[0024] According to a related fifth aspect, the invention relates to the use of cells of
hepatocyte phenotype obtained by the method according to the first aspect for testing the hepatic effect of a compound of interest. Testing the hepatic effect includes contacting the cells of hepatocyte phenotype with the compound of interest. Typically testing the hepatocyte effect further includes assessing the viability and/or functionality of the cells of hepatocyte phenotype.
[0025] According to a sixth aspect, the invention provides an in vitro method of forming a liver transplant. The method includes allowing cells according to the first aspect to grow. In some embodiments the method further includes forming a synthetic scaffold or a bioartificial liver device with the cells. In some embodiments the method also includes culturing the cells in co-culture with at least one of endothelial cells, Kupffer cells, hepatic stellate cells, cholangiocytes, and fibroblasts.
[0026] According to a related seventh aspect, the invention relates to a method of using cells of hepatocyte phenotype obtained by the method according to the first aspect in organ regeneration or replacement such as liver regeneration or replacement.
[0027] According to an eighth aspect, the invention relates to the use of cells of hepatocyte phenotype obtained by the method according to the first aspect for treating a hepatic disorder in a subject. In some embodiments the hepatic disorder is hepatitis, a heredity disease and liver cirrhosis or liver cancer. The heredity disease may for example be Wilson's disease, heamatochromatosis or alpha- 1 antitrypsin deficiency.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 depicts immunocytochemical analysis of human cord blood derived unrestricted somatic stem cells (USSC) after transduction with hepatic transcription factors (magnification: 20X). The transcription factors were found to be located in the nucleus and thus physiologically active.
[0029] Figure 2 depicts RT-PCR analysis of the expression of hepatocytic markers in transduced USSC after 4 days of expansion culture, before and after 12 days of differentiation culture. The depicted results are representative data of two individual experiments using two different USSC populations (day 0: undifferentiated USSC after expansion culture; day 12: differentiated USSC, Hep.: human hepatocytes). Hepatocyte cDNA was used as a positive control (+RT). The corresponding first strand synthesis reaction mixture without reverse transcriptase represents the negative control (-RT).
[0030] Figure 3 shows the morphological changes of transduced USSC after 4 days of expansion culture and 12 days of differentiation culture (day 0: undifferentiated USSC after expansion culture; day 12: differentiated USSC). Cells were transduced with the respective transcription factors HNFla, HNF-3p/FOXA2, HNF4a and HNF6.
[0031] Figure 4 depicts data on the expression of hepatocytic genes of transduced USSC.
RT PCR analysis was carried out on transduced USSC after 12 days of differentiation culture. Hl-F- H4-H6: USSC transduced with HNFla, FOXA2, HNF4a, and HNF6; H1-F-H4: USSC transduced with HNFla, FOXA2 and HNF4a; F-H4-H6: USSC transduced with FOXA2 and HNF4a; F-H4: USSC transduced with FOXA2 and HNF4a. cDNA of human hepatocytes was used as a positive control, the corresponding RT first strand synthesis reaction mixture represents the negative control.
[0032] Figure 5 depicts the morphology of transduced USSC following expansion culture (day 0) and differentiation culture for 12 days (day 12). H1-F-H4-H6-USSC: USSC transduced with HNFla, FOXA2, HNF4a, and HNF6; H1-F-H4-USSC: USSC transduced with HNFla, FOXA2 and HNF4a; F-H4-H6-USSC: USSC transduced with FOXA2 and HNF4a; F-H4-USSC: USSC transduced with FOXA2 and HNF4a.
[0033] Figure 6 shows that transduced USSC express a- 1 -Antitrypsin, a- 1 -Antitrypsin (AAT) is detected immunocytochemically in H1-F-H4-H6-USSC, H1-F-H4-USSC, F-H4-H6-USSC and F-H4-USSC after differentiation (HI : transduction with HNFla; F: transduction with FOXA2; H4: transduction with HNF4a; H6: transduction with HNF6; magnification of the lens: 20X). In addition, nuclei/DNA are stained using DAPI. Fig. 6A is a greyscale representation of the image. Fig. 6B is a greyscale representation of the image, in which only staining of a- 1 -Antitrypsin (FITC) is shown. Fig. 6C is a greyscale representation of a copy of the image, in which only staining of nuclei using DAPI is shown. 20 % of the cells had a strong fluorescence staining. All other cells of the population could be weakly stained against AAT. F-H4-H6-USSC had 1 % AAT positive cells on day 12.
[0034] Figure 7 depicts differences of H1-F-H4-H6-USSC, H1-F-H4-USSC, F-H4-H6- USSC and F-H4-USSC after 12 days of differentiation culture. Assessment of gene expression of different markers is based on RT PCR (cf. Fig. 4), ++ indicates saturated bands, + indicates bands that are not saturated, +/- represents weak bands. Indications on transduced USSC populations are based on cells counts of strong fluorescent cells in relation to DAPI stained nuclei following immunocytochemical analysis. In H1-F-H4-USSC cultures 12 % of strongly AAT positive cells were detected. In cultures of F-H4-USSC less than 0.5 % of cells were strongly positive for AAT.
[0035] Figure 8 depicts the expression of hepatocyte transcription factors by transduced USSC. RT-PCR analysis of endogenous transcription factors was carried out on USSC transduced with HNFla, FOXA2, HNF4a and HNF6 (H1-F-H4-H6-USSC). cDNA of human hepatocyets and pooled vectors (each 1 pg of plasmid) were used as positive controls.
[0036] Figure 9 shows that transduced USSC express human serum albumin (ALB). ALB is detected immunocytochemically in H1-F-H4-H6-USSC before (dayO) and after differentiation (dayl2). In contrast in Mock-transduced USSC (pUC2-USSC) a weak ALB expression represented in some cells is detectable before and after differentiation (dayO and dayl2 respectively). Rhodamine-conjugated antibodies were used to detect human serum albumin; DNA was detected by
DAPI-staining. (HI : transduction with HNFla; F: transduction with FOXA2; H4: transduction with HNF4a; H6: transduction with HNF6; magnification of the lens: 20X)
[0037] Figure 10 demonstrates, that a-fetoprotein (AFP) is neither expressed in Mock- transduced USSC (pUC2-USSC) nor in H1-F-H4-H6-USSC before (dayO) and after differentiation (dayl2). Fluorescein isothiocyanate (FITC)-conjugated antibodies were used to detect human a- fetoprotein; DNA was detected by DAPI-staining. (HI : transduction with HNFla; F: transduction with FOXA2; H4: transduction with HNF4a; H6: transduction with HNF6; magnification of the lens: 20X)
[0038] Figure 11 shows the sequences of primers used in the generation of data shown in the preceding Figures. SEQ ID NOs are indicated in parentheses.
[0039] Figure 12 demonstrates performance of hepatocyte functions by H1-F-H4-H6- USSC. Albumin secretion and urea production were calculated by referring concentrations in supernatants to durance of medium condition and total protein amount of analyzed cells. Induction of CYP3A4 activity was analyzed by addition of rifampicin in to culture medium for 48 hours before measurements, (d: day, h: hour, RLU: relative light units, RIF: rifampicin). A: Albumin secretion of H1-F-H4-H6-USSC measured by enzyme-linked immunosorbent assay (ELISA). (n = 3 individual populations; data demonstrate mean ± SD) B: Urea production of iH-USSC measured by a colorimetric assay, (n = 3 individual populations; data demonstrate mean ± SD) C: CYP3A4 activity of H1-F-H4-H6-USSC was determined by a luminogenic assay. Hep G2 indicates the respective human hepatocellular carcinoma cell line. Data are indicated as mean ± SD from 4 individual cell populations.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention provides a cell of hepatocyte phenotype as well as a method of forming a respective cell of hepatocyte phenotype. A method of generating a cell of hepatocyte phenotype according to the invention can be taken to define a method of forward programming an adherent adult multipotent cell. Forward programming refers to an alteration in the differentiation status of a cell, typically by increasing expression of one or more lineage- determining genes in the multipotent cell. Forward programming may differ from directed differentiation, where an increased expression of endogenous genes is induced by adding growth factors or certain low molecular weight molecules to the culture medium. The growth factors or low molecular weight molecules signal though cell surface proteins and surface protein- mediated signalling to activate endogenous pathways toward the lineage desired. In forward programming, expression of programming factors usually found only intra-cellularly are increased by introducing or inducing the gene expression cassette or by being added directly, for example in the form of polypeptides or RNA molecules. As a result, programming factor genes
for differentiation are activated directly, thereby by-passing the cell surface proteins and surface protein-mediated signalling pathways. In this regard, the word "programming" refers to a process that changes a cell to form progeny of at least one cell type different from the original cell and, either in culture or in vivo, different from it would have under the same conditions without programming. This means that after sufficient proliferation, a measurable proportion of progeny having phenotypic characteristics of the new cell type if essentially no such progeny could form before programming.
[0041] In some embodiments a method of the invention is a method of differentiating adherent adult multipotent cells. "Differentiation" is a process known to those skilled in the art by which a less specialized cell becomes a more specialized cell type. The question of how adult non- hepatic stem cells are converted into hepatocyte-like cells in vivo is so far unsettled. Originally it was assumed that the so called plasticity of cells allows differentiation into hepatocyets. This possibility is, however, controversial since the publication of fusion incidents of transplanted stem cells with recipient cells (Vassilopoulos, G, et al., Nature (2003) 422, 901-904; Kashofer, K, et al., Stem Cells (2006) 24, 1104-1112). The discovery of the present inventors, on which the present invention is based, that increasing the amounts of HNF-6 and HNF-Ια is sufficient to cause differentiation into hepatocyte-like cells is thus surprising.
[0042] A method of the present invention provides one or more cells of a hepatocyte phenotype, namely of hepatocyte phenotype. Such cells may also be addressed as hepatocyte-like cells. The term phenotype is understood in the art to refer to detectable characteristics of a cell or organism. These characteristics in particular include the morphology, the development, the biochemical and/or physiological properties, phenology, and behaviour. The phenotype thus includes inter alia the molecules, such as proteins that are present within and on the surface of a cell. The term phenotype is typically contrasted to the genotype, which refers to heredity. The characteristics defining the phenotype are the manifestation of gene expression.
[0043] A hepatocyte is a cell of a cell type that makes up 70-80% of the cytoplasmic mass of the liver. Hepatocytes are involved in protein synthesis, protein storage, transformation of carbohydrates, synthesis of cholesterol, bile salts and phospholipids, and the detoxification, modification and excretion of exogenous and endogenous substances. Hepatocytes generate serum albumin, fibrinogen, and the prothrombin group of clotting factors. A hepatocyte also initiates the formation and secretion of bile. Hepatocytes are also the main site for the synthesis of lipoproteins, ceruloplasmin, transferrin, complement and glycolproteins. In addition, hepatocytes have the ability to metabolize, detoxify, and inactivate exogenous compounds such as drugs and insecticides, and endogenous compounds such as steroids.
[0044] Characteristics of a hepatocyte phenotype include the expression of cell markers, enzymatic activity, and the characterization of morphological features and intercellular signalling.
Where for example a plurality of characteristics of hepatocytes is present in a single cell, the cell may be regarded as being of hepatocyte phenotype. Morphological features characteristic of hepatocytes that may be assessed, include a polygonal cell shape, a binucleate phenotype, the presence of rough endoplasmic reticulum for synthesis of secreted protein, the presence of Golgi- endoplasmic reticulum lysosome complex for intracellular protein sorting, the presence of peroxisomes and glycogen granules, relatively abundant mitochondria, and the ability to form tight intercellular junctions resulting in creation of bile canalicular spaces.
[0045] Characteristics of a hepatocyte phenotype may also be assessed on the basis of the presence of phenotypic markers (see below), i.e. particular molecules and/or moieties of molecules found in or on the cell, typically on the cell surface. Assessment of the level of expression of markers can be determined in comparison to a reference to other cells. As positive controls for the markers of mature hepatocytes there may be used for instance adult hepatocytes of the species of interest may be used. Negative controls may for example include cells of a different lineage, such as lymphocytes or fibroblasts. Protein and oligosaccharide determinants characteristic of a hepatocyte phenotype may be detected using any known methodology available, such as immunological techniques, e.g. flow immunocytochemistry in the case of a cell surface marker, immunohistochemistry in the case of an intracellular or a cell surface marker. Further suitable techniques include Western blot analysis, for instance of a cellular extract, an enzyme-linked immunoassay, a radioimmunoassay or a fluorescence titration assay, which may for example be carried out on a cellular extract or a medium in which the cells are being cultured. A radioimmunoassay (RIA) is based on the measurement of radioactivity associated with a complex formed between an antibody or a proteinaceous binding molecule with antibody-like functions and an antigen, while an ELISA is based on the measurement of an enzymatic reaction associated with a complex formed between an antibody or a proteinaceous binding molecule with antibody-like functions and an antigen.
[0046] An immunological technique relies on the use of antibodies or binding molecules with antibody-like functions, typically being proteinaceous binding molecules. An antibody is an immunoglobulin or a fragment thereof. Examples of (recombinent) immunoglobulin fragments are Fab fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies, triabodies (Iliades, P., et al., FEBS Lett (1997) 409, 437-441), decabodies (Stone, E., et al., Journal of Immunological Methods (2007) 318, 88-94) and other domain antibodies (Holt, L.J., et al., Trends Biotechnol. (2003), 21, 11, 484-490). An example of a proteinaceous binding molecule with antibody- like functions is a mutein based on a polypeptide of the lipocalin family (WO 2003/029462; WO 2005/019254; WO 2005/019255; WO 2005/019256; Beste et al., Proc. Natl. Acad. Sci. USA (1999) 96, 1898-1903). Lipocalins, such as the bilin binding protein, the human neutrophil gelatinase- associated lipocalin, human Apolipoprotein D, human tear lipocalin, or glycodelin, posses natural
ligand-binding sites that can be modified so that they bind to selected small protein regions known as haptens. Other non- limiting examples of further proteinaceous binding molecules include, but are not limited to, the so-called glubodies (see WO 96/23879), proteins based on the ankyrin scaffold (Mosavi, L.K., et al., Protein Science (2004) 13, 6, 1435-1448) or the crystalline scaffold (WO 2001/04144), the proteins described by Skerra (J. Mol. Recognit. (2000) 13, 167-187), AdNectins, tetranectins, avimers and peptoids. Avimers contain so called A-domains that occur as strings of multiple domains in several cell surface receptors (Silverman, J, et al., Nature Biotechnology (2005) 23, 1556-1561). Adnectins, derived from a domain of human fibronectin, contain three loops that can be engineered for immunoglobulin-like binding to targets (Gill, D.S. & Damle, N.K., Current Opinion in Biotechnology (2006) 17, 653-658). Tetranectins, derived from the respective human homotrimeric protein, likewise contain loop regions in a C-type lectin domain that can be engineered for desired binding (ibid.). Peptoids, which can act as protein ligands, are oligo(N-alkyl) glycines that differ from peptides in that the side chain is connected to the amide nitrogen rather than the a carbon atom. Peptoids are typically resistant to proteases and other modifying enzymes and can have a much higher cell permeability than peptides (see e.g. Kwon, Y.-U., and Kodadek, T., J. Am. Chem. Soc. (2007) 129, 1508-1509).
[0047] In detecting the presence of phenotypic markers an antibody or a molecule with antibody-like functions may be used that is linked to an attached label, such as for instance in Western analysis or ELISA. Where desired, an intracellular immunoglobulin may be used for detection. Some or all of the steps of detection may be part of an automated detection system. Illustrative examples of such systems are automated real-time PCR platforms, automated nucleic acid isolation platforms, PCR product analysers and real-time detection systems.
[0048] A further technique that can also be carried out to detect the presence of a phenotypic marker is Fluorescence Microscopy, including Ratio Fluorescence Microscopy. In ratio fluorescence microscopy two fluorescence images are collected and the parameter of interest is quantified as a ratio of the fluorescence in one image to that in the other image. A further technique suitable for detecting the presence of phenotypic markers on the surface of cells is fluorescence resonance energy transfer (FRET). In FRET an excited fluorescent donor molecule, rather than emitting light, transfers that energy via a dipole-dipole interaction to an acceptor molecule in close proximity. If the acceptor is fluorescent, then the decrease in donor fluorescence due to FRET is accompanied by an increase in acceptor fluorescence (i.e., for example, sensitized emission). The amount of FRET depends strongly on distance, typically decreasing as the sixth power of the distance, so that fluorophores can directly report on phenomena occurring on the scale of a few nanometers, well below the resolution of optical microscopes. Among other purposes, FRET has been used to map distances and study aggregation states, membrane dynamics, or DNA hybridization.
[0049] In some embodiments a biomarker, the presence, expression, level or activity of which may be assessed in order to determine a hepatocyte phenotype, may be located at the cell surface. In some embodiments a respective marker is secreted. In some embodiments such a marker is located within a cell of hepatocyte phenotype, for example in the cytoplasm, within an organelle or in the membrane surrounding an organelle. The terms "expressing" and "expression" in reference to a biomarker are intended to be understood in the ordinary meaning as used in the art. A biomarker is expressed by a cell via transcription of a nucleic acid into mRNA, followed by translation into a polypeptide, which is folded and possibly further processed. Some of the biomarkers discussed in this disclosure are in addition being transported to the surface of the respective cell. The determination of expression may be based on the normalized expression level of the biomarkers. Expression levels are normalized by correcting the absolute expression level of a biomarker by comparing its expression to the expression of a gene that is not a biomarker in the context of the present specification. The expression level may also be provided as a relative expression level.
[0050] With regard to the respective biological process itself, the terms "expression", "gene expression" or "expressing" refer to the entirety of regulatory pathways converting the information encoded in the nucleic acid sequence of a gene first into messenger RNA (mRNA) and then to a protein. Accordingly, the expression of a gene includes its transcription into a primary hnRNA, the processing of this hnRNA into a mature RNA and the translation of the mRNA sequence into the corresponding amino acid sequence of the protein. In this context, it is also noted that the term "gene product" refers not only to a protein, including e.g. a final protein (including a splice variant thereof) encoded by that gene and a respective precursor protein where applicable, but also to the respective mRNA, which may be regarded as the "first gene product" during the course of gene expression.
[0051] As indicated above, in some embodiments a cell of hepatocyte phenotype expresses serum albumin. Generally a cell of hepatocyte phenotype secrets serum albumin. Serum albumin may for example be human serum albumin, for instance the protein of the Swissprot/Uniprot accession number P02768 (version 195 as of 29 May 2013). Human serum albumin may also be a protein that contains the fragment of the Swissprot/Uniprot accession number Q16167 (version 34 as of 03 April 2013), or a protein that contains the fragment of the Swissprot/Uniprot accession number H0YA55 (version 9 as of 01 May 2013). In some embodiments human serum albumin may be the protein of the Swissprot/Uniprot accession number B7WNR0 (version 25 as of 29 May 2013) or the protein of the Swissprot/Uniprot accession number D6RHD5 (version 17 as of 01 May 2013). In some embodiments human serum albumin may be a protein that contains the fragment of the Swissprot/Uniprot accession number F6KPG5 (version 10 as of 01 May 2013), or a protein that contains the fragment of the Swissprot/Uniprot accession number Q14551 (version 30 as of 03 April
2013). Human serum albumin may in some embodiments be the protein of the Swissprot/Uniprot accession number C9JKR2 (version 26 as of 29 May 2013) or the protein of the Swissprot/Uniprot accession number D6RCE7 (version 14 as of 03 April 2013).
[0052] In some embodiments albumin is the murine protein of the Swissprot/Uniprot accession number P07724 (version 138 as of 29 May 2013) or a protein containing the fragment of the Swissprot/Uniprot accession number K7R066 (version 4 as of 01 May 2013). In some embodiments albumin is the rat protein of the Swissprot/Uniprot accession number P02770 (version 125 as of 29 May 2013) or a protein containing the fragment of the Swissprot/Uniprot accession number Q63036 (version 22 as of 03 April 2013).
[0053] In typical embodiments a cell of hepatocyte phenotype expresses glucose-6- phosphatase. This enzyme is known to be located within the cell, spanning the membrane of the endoplasmic reticulum. Glucose-6-phosphatase may for example be the human enzyme of the Swissprot/Uniprot accession number P35575 (version 128 as of 29 May 2013). Glucose-6- phosphatase may also be the human enzyme of the Swissprot/Uniprot accession number K7EL82 (version 4 as of 29 May 2013) or the human enzyme of the Swissprot/Uniprot accession number K7ELS6 (version 3 as of 03 April 2013). In some embodiments glucose-6-phosphatase may be a human enzyme containing the fragment of the Swissprot/Uniprot accession number Q6LAP7 (version 21 as of 03 April 2013) or a human enzyme containing the fragment of the Swissprot/Uniprot accession number 095179 (version 28 as of 03 April 2013). Glucose-6- phosphatase may also be the rat enzyme of the Swissprot/Uniprot accession number P43428 (version 94 as of 29 May 2013) or a rat enzyme containing the fragment of the Swissprot/Uniprot accession number Q6LCH4 (version 24 as of 03 April 2013). In some embodiments glucose-6- phosphatase is the murine protein of the Swissprot/Uniprot accession number P35576 (version 103 as of 29 May 2013).
[0054] A cell of hepatocyte phenotype expresses in some embodiments arginase Type 1.
This enzyme is thought to be located in the cytoplasm. Arginase Type 1 may in some embodiments be the human protein of the Swissprot/Uniprot accession number P05089 (version 164 as of 29 May 2013). In some embodiments arginase Type 1 may be the mouse protein of the Swissprot/Uniprot accession number Q61176 (version 111 as of 29 May 2013), or a mouse protein containing the fragment of the Swissprot/Uniprot accession number Q8K3K5 (version 25 as of 06 March 2013). In some embodiments arginase Type 1 is the rat protein of the Swissprot/Uniprot accession number P07824 (version 138 as of 29 May 2013).
[0055] Generally a cell of hepatocyte phenotype expresses an asialoglycoprotein receptor, a protein also called Hepatic lectin. Two examples of an asialoglycoprotein receptor are asialoglycoprotein receptor 1 (ASGP-R 1) and asialoglycoprotein receptor 2 (ASGP-R 2). An isoform of the receptor protein ASGP-R 1 , termed isoform "a", is a cell membrane protein, whereas
another isoform termed isoform "b" is being secreted. Known isoforms of ASGP-R 2 appear to be located at the plasma membrane. In some embodiments the asialoglycoprotein receptor 1 is the human protein of the Swissprot/Uniprot accession number P07306 (version 138 as of 01 May 2013). In some embodiments the asialoglycoprotein receptor 1 is the human protein of the Swissprot/Uniprot accession number J3QSZ2 (version 6 as of 01 May 2013), or the human protein of the Swissprot/Uniprot accession number I3L129 (version 9 as of 03 April 2013). The asialoglycoprotein receptor 1 may also be a human protein containing the fragment of the Swissprot/Uniprot accession number K7EPS5 (version 3 as of 03 April 2013), or a human protein containing the fragment of the Swissprot/Uniprot accession number Q6FGQ5 (version 75 as of 29 May 2013). In some embodiments asialoglycoprotein receptor 1 may be a human enzyme containing the fragment of the Swissprot/Uniprot accession number I3L2S9 (version 7 as of 03 April 2013) or a human enzyme containing the fragment of the Swissprot/Uniprot accession number I3L1F8 (version 7 as of 03 April 2013). In some embodiments asialoglycoprotein receptor 1 is the rat protein of the Swissprot/Uniprot accession number P02706 (version 111 as of 29 May 2013). In some embodiments asialoglycoprotein receptor 1 may be the mouse protein of the Swissprot/Uniprot accession number P34927 (version 111 as of 29 May 2013). In some embodiments asialoglycoprotein receptor 1 may be the mouse protein of the Swissprot/Uniprot accession number B1AR34 (version 41 as of 01 May 2013) or a mouse protein containing the fragment of the Swissprot/Uniprot accession number J3QPT6 (version 6 as of 03 April 2013).
[0056] In some embodiments the asialoglycoprotein receptor 2 is the human protein of the
Swissprot/Uniprot accession number P07306 (version 137 as of 29 May 2013). In some embodiments the asialoglycoprotein receptor 2 may be a human protein containing the fragment of the Swissprot/Uniprot accession number I3L1H2 (version 7 as of 03 April 2013), or the human protein of the Swissprot/Uniprot accession number I3L1N6 (version 6 as of 03 April 2013). The asialoglycoprotein receptor 2 may also be a mouse protein containing the fragment of the Swissprot/Uniprot accession number B1AR35 (version 42 as of 29 May 2013), or the mouse protein of the Swissprot/Uniprot accession number J3QMY0 (version 6 as of 03 April 2013). In some embodiments the asialoglycoprotein receptor 2 is the mouse protein of the Swissprot/Uniprot accession number P24721 (version 115 as of 29 May 2013). In some embodiments the asialoglycoprotein receptor 2 is the rat protein of the Swissprot/Uniprot accession number P08290 (version 109 as of 03 April 2013). In some embodiments the asialoglycoprotein receptor 2 is the rat protein of the Swissprot/Uniprot accession number Q9JKP9 (version 50 as of 03 April 2013).
[0057] A cell of hepatocyte phenotype generally also expresses a tryptophan 2,3- dioxygenase (TO), a cytosolic hemoprotein, which is the rate-limiting enzyme in oxidative breakdown of L-tryptophan to kynurenine. Tryptophan 2,3-dioxygenase may for example be the human enzyme of the Swissprot/Uniprot accession number P48775 (version 115 as of 29 May
2013). Tryptophan 2,3-dioxygenase may also be the human protein containing the fragment of the Swissprot/Uniprot accession number D6RA50 (version 23 as of 29 May 2013), or a human protein containing the fragment of the Swissprot/Uniprot accession number D6RB68 (version 23 as of 29 May 2013). Tryptophan 2,3-dioxygenase may also be the mouse enzyme of the Swissprot/Uniprot accession number P48776 (version 94 as of 29 May 2013) or the mouse enzyme of the Swissprot/Uniprot accession number C5NSA7 (version 24 as of 29 May 2013). In some embodiments tryptophan 2,3-dioxygenase is a mouse protein containing the fragment of the Swissprot/Uniprot accession number Q80Z63 (version 26 as of 29 May 2013). In some embodiments tryptophan 2,3-dioxygenase is the rat protein of the Swissprot/Uniprot accession number P21643 (version 95 as of 29 May 2013) or the rat protein of the Swissprot/Uniprot accession number G5BLV6 (version 6 as of 29 May 2013).
[0058] A cell of hepatocyte phenotype expresses generally tyrosine aminotransferase (TAT), a mitochondrial protein involved in tyrosine breakdown. Tyrosine aminotransferase may in some embodiments be the human protein of the Swissprot/Uniprot accession number PI 7735 (version 137 as of 01 May 2013). In some embodiments tyrosine aminotransferase may be the human protein of the Swissprot/Uniprot accession number A1L4G7 (version 42 as of 29 May 2013). Tyrosine aminotransferase may in some embodiments be the human protein of the Swissprot/Uniprot accession number Q8WW92 (version 44 as of 29 May 2013). In some embodiments tyrosine aminotransferase may also be the mouse protein of the Swissprot/Uniprot accession number P04694 (version 116 as of 03 April 2013) or a mouse protein containing the fragment of the Swissprot/Uniprot accession number D3Z307 (version 24 as of 03 April 2013). In some embodiments tyrosine aminotransferase may be the rat protein of the Swissprot/Uniprot accession number Q9QWS4 (version 74 as of 29 May 2013) or the rat protein of the Swissprot/Uniprot accession number Q9QWS4 (version 74 as of 29 May 2013).
[0059] Generally a cell of hepatocyte phenotype expresses cytochrome p450 3A4
(CYP3A4), also called inter alia 1,8-cineole 2-exo-monooxygenase, albendazole monooxygenase, nifedipine oxidase or quinine 3-monooxygenase. As a cytochromes P450 enzyme, cytochrome p450 3A4 is a heme-thiolate monooxygenase of microsomes of hepatocytes. Cytochrome p450 3A4 may for example be the human enzyme of the Swissprot/Uniprot accession number P08684 (version 157 as of 01 May 2013). Cytochrome p450 3A4 may also be the human enzyme of the Swissprot/Uniprot accession number Q6GRK0 (version 85 as of 29 May 2013) or the human enzyme of the Swissprot/Uniprot accession number E7EVM8 (version 15 as of 03 April 2013). In some embodiments cytochrome p450 3A4 is a human protein containing the fragment of the Swissprot/Uniprot accession number C9JBD2 (version 23 as of 29 May 2013), or a human protein containing the fragment of the Swissprot/Uniprot accession number Q7Z448 (version 57 as of 29 May 2013). Cytochrome p450 3A4 is in some embodiments the human enzyme of the
Swissprot/Uniprot accession number Q86SK3 (version 71 as of 29 May 2013). In some embodiments cytochrome p450 3A4 is the bovine protein of the Swissprot/Uniprot accession number A5D9D8 (version 44 as of 03 April 2013).
[0060] The present inventors have furthermore observed that a cell of hepatocyte phenotype obtained by increasing the amount of HNF-6 and the amount of HNF-Ια in adherent adult multipotent cells generally are of high homogeneity in cell culture. 75 % or more of obtained cells express detectable amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4. Compared to adherent adult multipotent cells of origin, cells obtained by increasing the amounts of HNF-6 and HNF-Ια in the cells contain elevated amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4. In some embodiments 85 % or more of obtained cells express elevated amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4. A respective elevated amount is an amount of RNA and/or protein in the cell that is at least two-fold when compared to untreated adherent adult multipotent cells - i.e. multipotent cells corresponding to cells from which the cell of a hepatocyte phenotype obtained by a method as described herein originate. In some embodiments the amount of RNA and/or protein in the cell that is at least ten- fold, including at least 100-fold when compared to untreated adherent adult multipotent cells of origin. In some embodiments no detectable amount of one or more of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4 can be detected in a cell of origin, i.e. an untreated adherent adult multipotent cell as used to obtain a cell of hepatocyte phenotype as described herein. In some embodiments an elevated amount of serum albumin, asialoglycoprotein receptor 1, and/or cytochrome p450 3A4 in cells of a hepatocyte phenotype is an amount from about 10% to about 200% of the amount detected in primary human hepatocytes. The skilled artisan will, however, be aware of differences and fluctuations in the expression of these proteins in primary human hepatocytes. Amounts of serum albumin, asialoglycoprotein receptor 1, and cytochrome p450 3A4 in cells of a hepatocyte phenotype may be about 10% or more when compared to amounts in primary human hepatocytes from one specimen and about 200% or less when compared to amounts in primary human hepatocytes from another specimen.
[0061] In the context of generating and/or characterizing a cell of hepatocyte phenotype as described herein, the amount of a nucleic acid or a protein may be detected, or an assessment from which such an amount can be inferred, may be carried out. Any method that can be used to detect the presence of a nucleic acid or a protein in the context of the present invention. Examples of techniques that may be used in this regard include, but are not limited to, RT-PCR, RNAse protection assay, Northern analysis, Western analysis, ELISA, radioimmunoassay or fluorescence titration assay. Assessing the amount of a transcription factor or of a biomarker such as a cytochrome P 450 enzyme in/on a cell may include assessing the amount of a nucleic acid, e.g. RNA, in a cell encoding the respective transcription factor or biomarker. A nucleic acid probe may
be used to probe a sample by any common hybridization method to detect the amount of nucleic acid molecules of the transcription factor or biomarker. In order to obtain nucleic acid probes chemical synthesis can be carried out. The synthesized nucleic acid probes may be first used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to standard PCR protocols utilizing the appropriate template, in order to obtain the probes of the present invention. One skilled in the art will readily be able to design such probes based on the sequence available for the biomarker. The hybridization probes can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence or a nanoparticle. After hybridization, the probes may be visualized using a standard technique. As explained above, the rate of synthesis of a protein does not equal the expression of the protein, since the degradation rate of the protein likewise contributes to the expression level. Nevertheless, a change or a deviation in the rate of synthesis can generally be taken as an indication on a change or a deviation in the expression level of a protein. The rate of synthesis of e.g. a cytochrome P450 enzyme or other biomarker, or of a transcription factor, may also be assessed by determining the synthesis rate of the respective protein/polypeptide, including the post-translational modifications of the initial translation product. Any of these synthesis steps may be detected alone or in combination, for example based on the accumulation of products of a post-translational modification.
[0062] A detection method used in the context of the present invention may include an amplification of the signal caused by the nucleic acid or protein, such as a polymerase chain reaction (PCR) or the use of the biotin-streptavidin system, for example in form of a conjugation to an immunoglobulin, as also explained in more detail below. The detection method may for example include the use of an antibody, e.g. an immunoglobulin, which may be linked to an attached label, such as for instance in Western analysis or ELISA. Where desired, an intracellular immunoglobulin may be used for detection. Some or all of the steps of detection may be part of an automated detection system. Illustrative examples of such systems are automated real-time PCR platforms, automated nucleic acid isolation platforms, PCR product analysers and real-time detection systems. As indicated above, the term "antibody" as used herein, is understood to include an immunoglobulin and an immunoglobulin fragment that is capable of specifically binding a selected protein, e.g. L- selectin or a protein specific for T cells, as well as a respective proteinaceous binding molecule with immunoglobulin-like functions. An antibody may for instance be an EGF-like domain, a Kringle- domain, a fibronectin type I domain, a fibronectin type II domain, a fibronectin type III domain, a PAN domain, a Gla domain, a SRCR domain, a Kunitz/B ovine pancreatic trypsin Inhibitor domain, tendamistat, a Kazal-type serine protease inhibitor domain, a Trefoil (P-type) domain, a von Willebrand factor type C domain, an Anaphylatoxin-like domain, a CUB domain, a thyroglobulin type I repeat, an LDL-receptor class A domain, a Sushi domain, a Link domain, a Thrombospondin type I domain, an immunoglobulin domain or a an immunoglobulin-like domain (for example a
domain antibody or a camel heavy chain antibody), a C-type lectin domain, a MAM domain, a von Willebrand factor type A domain, a Somatomedin B domain, a WAP -type four disulfide core domain, a F5/8 type C domain, a Hemopexin domain, an SH2 domain, an SH3 domain, a Laminin- type EGF-like domain, a C2 domain, a "Kappabody" (111. et al., Protein Eng (1997) 10, 949-957), a "Minibody" (Martin et al., EMBO J (1994) 13, 5303-5309), a "Diabody" (Holliger et al., PNAS U.S.A. 90, 6444-6448 (1993)), a "Janusin" (Traunecker et al., EMBO J (1991) 10, 3655-3659 or Traunecker et al., Int J Cancer (1992) Suppl 7, 51-52), a nanobody, an adnectin, a tetranectin, a microbody, an affilin, an affibody or an ankyrin, a crystallin, a knottin, ubiquitin, a zinc-finger protein, an autofluorescent protein, an ankyrin or ankyrin repeat protein or a leucine-rich repeat protein.
[0063] A measurement of a level or amount of a nucleic acid or protein/peptide may for instance rely on spectroscopic, photochemical, photometric, fluorometric, radiological, enzymatic or thermodynamic means. An example of a spectroscopical detection method is fluorescence correlation spectroscopy. A photochemical method is for instance photochemical cross-linking. The use of photoactive, fluorescent, radioactive or enzymatic labels respectively are examples for photometric, fluorometric, radiological and enzymatic detection methods. An example of a thermodynamic detection method is isothermal titration calorimetry. As an illustrative example of a label, a detailed protocol on the use of water-soluble, bio-functionalized semiconductor quantum dots has been given by Lidke et al. (Current Protocols in Cell Biology, [2007] Suppl. 36, 25.1.1- 25.1.18). Such quantum dots have a particularly high photostability, allowing monitoring their localization for minutes to hours to days. They are typically fluorescent nanoparticles. Since different types of quantum dots can be excited by a single laser line multi-colour labelling can be performed. Detection can for example conveniently be carried out in different fluorescence channels of a flow cytometer. A quantum dot can be coupled to a binding partner of e.g. a cytochrome P 450 enzyme.
[0064] The measurement used is generally selected to be of a sensitivity that allows detection of cells expressing the transcription factor or biomarker in the range of a selected threshold value, in particular of a sensitivity that allows determining whether e.g. cytochrome P 450 or transcription factor expressing cells are below the respective threshold value. Typically a binding partner of the transcription factor and/or biomarker, respectively, may be used in combination with a detectable marker. Such a binding partner of the transcription factor or biomarker has a detectable affinity and specificity for the transcription factor and/or biomarker, respectively. Typically, binding is considered specific when the binding affinity is higher than 10"6 M. A binding partner of the transcription factor or biomarker has in some embodiments an affinity of about 10"8 M or higher, or of about 10"9 M or higher. A respective binding partner of e.g. a transcription factor or biomarker may be an immunoglobulin, a fragment thereof or a proteinaceous binding molecule with
immunoglobulin-like functions. An antibody fragment generally contains an antigen binding or variable region. Examples of (recombinant) antibody fragments are immunoglobulin fragments such as Fab fragments, Fab' fragments, Fv fragments, single-chain Fv fragments (scFv), diabodies or domain antibodies (Holt, L.J., et al., Trends Biotechnol. (2003), 21 , 11, 484-490). An example of a proteinaceous binding molecule with immunoglobulin-like functions is a mutein based on a polypeptide of the lipocalin family (WO 03/029462, Beste et al., Proc. Natl. Acad. Sci. USA (1999) 96, 1898-1903). Lipocalins, such as the bilin binding protein, the human neutrophil gelatinase- associated lipocalin, human Apolipoprotein D or glycodelin, posses natural ligand-binding sites that can be modified so that they bind to selected small protein regions known as haptens. Examples of other proteinaceous binding molecules are the so-called glubodies (see e.g. international patent application WO 96/23879 or Napolitano, E.W., et al., Chemistry & Biology (1996) 3, 5, 359-367), proteins based on the ankyrin scaffold (Mosavi, L.K., et al., Protein Science (2004) 13, 6, 1435- 1448) or crystalline scaffold (e.g. internation patent application WO 01/04144), the proteins described in Skerra, J. Mol. Recognit. (2000) 13, 167-187, AdNectins, tetranectins and avimers. Avimers contain so called A-domains that occur as strings of multiple domains in several cell surface receptors (Silverman, J., et al., Nature Biotechnology (2005) 23, 1556-1561). Adnectins, derived from a domain of human fibronectin, contain three loops that can be engineered for immunoglobulin-like binding to targets (Gill, D.S. & Damle, N.K., Current Opinion in Biotechnology (2006) 17, 653-658). Tetranectins, derived from the respective human homotrimeric protein, likewise contain loop regions in a C-type lectin domain that can be engineered for desired binding (ibid.). Peptoids, which can act as protein ligands, are oligo(N-alkyl) glycines that differ from peptides in that the side chain is connected to the amide nitrogen rather than the a carbon atom. Peptoids are typically resistant to proteases and other modifying enzymes and can have a much higher cell permeability than peptides (see e.g. Kwon, Y.-U., and Kodadek, T., J. Am. Chem. Soc. (2007) 129, 1508-1509). A suitable antibody may in some embodiments also be a multispecific antibody that includes several immunoglobulin fragments.
[0065] An immunoglobulin or a proteinaceous binding molecule with immunoglobulin-like functions may be PEGylated or hyperglycosylated if desired. In some embodiments a proteinaceous binding molecule with immunoglobulin-like functions is a fusion protein of one of the exemplary proteinaceous binding molecules above and an albumin-binding domain, for instance an albumin- binding domain of streptococcal protein G. In some embodiments a proteinaceous binding molecule with immunoglobulin-like functions is a fusion protein of an immunoglobulin fragment, such as a single-chain diabody, and an immunoglobulin binding domain, for instance a bacterial immunoglobulin binding domain. As an illustrative example, a single-chain diabody may be fused to domain B of staphylococcal protein A as described by Unverdorben et al. (Protein Engineering, Design & Selection [2012] 25, 81-88).
[0066] A molecule that forms a complex with a binding partner of a transcription factor or of a biomarker such as a cytochrome P 450 enzyme may likewise be an immunoglobulin, a fragment thereof or a proteinaceous binding molecule with immunoglobulin-like functions, as explained above. Thus, in an exemplary embodiment detecting the amount of for instance the Bile Salt Export Pump, e.g. on a cell surface, may carried out using a first antibody or antibody fragment capable of specifically binding the Bile Salt Export Pump, as well as a second antibody or antibody fragment capable of specifically binding the first antibody or antibody fragment.
[0067] As explained above, a binding partner can bind a nucleic acid molecule, a peptide, a protein, a saccharide, a polysaccharide or a lipid. In some embodiments the binding partner is a PNA molecule. As indicated above, a PNA molecule is a nucleic acid molecule in which the backbone is a pseudopeptide rather than a sugar. Accordingly, PNA generally has a charge neutral backbone, in contrast to DNA or RNA. Nevertheless, PNA is capable of hybridising at least complementary and substantially complementary nucleic acid strands, just as e.g. DNA or RNA (to which PNA is considered a structural mimic). In some embodiments the binding partner is an aptamer, including a Spiegelmer®, described in e.g. WO 01/92655. An aptamer is typically a nucleic acid molecule that can be selected from a random nucleic acid pool based on its ability to bind a selected other molecule such as a peptide, a protein, a nucleic acid molecule a or a cell. Aptamers, including Spiegelmers, are able to bind molecules such as peptides, proteins and low molecular weight compounds. Spiegelmers® are composed of L-isomers of natural oligonucleotides. Aptamers are engineered through repeated rounds of in vitro selection or through the SELEX (systematic evolution of ligands by exponential enrichment) technology. The affinity of Spiegelmers to their target molecules often lies in the pico- to nanomolar range and is thus comparable to immunoglobulins. An aptamer may also be a peptide. A peptide aptamer consists of a short variable peptide domain, attached at both ends to a protein scaffold.
[0068] In typical embodiments the binding partner is an immunoglobulin or a proteinaceous binding molecule with immunoglobulin-like functions as defined above. In some embodiments the binding partner may be detectably labelled as explained above, for example where the binding partner is intended to be used together with a detection agent that binds to the biomarker and/or the binding partner. The binding partner and/or a respective detection agent may be detectably labeled by linking the same, typically covalently, to a detectable marker such as a radioactive label, a fluorescent moiety, a chemical entity of low molecular weight, an oligonucleotide, an enzyme, or a protein such as a fluorescent protein such as a Green Fluorescent Protein (cf. above). It is understood that the method may also include any molecules which can be used to indirectly indicate the level of the target molecule of interest such as of a transcription factor or of a biomarker such as a cytochrome P 450 enzyme, HNF-3P, or HNF-4a. The binding partner may in some embodiments be an immunoglobulin, a portion thereof, a proteinaceous binding molecule with immunoglobulin-like
functions, a receptor for the biomarker or a portion thereof or a ligand for the biomarker or a portion thereof. The detection agent may in some embodiments be an immunoglobulin, a portion thereof, a proteinaceous binding molecule with immunoglobulin-like functions, a receptor for the biomarker or transcription factor a portion thereof, a ligand for the biomarker or transcription factor or a portion thereof or a binding partner or a portion thereof.
[0069] In some embodiments a binding partner capable of binding a particular target nucleic acid molecule such as an mRNA molecule encoding a transcription factor or a biomarker, is a nucleic acid molecule that includes a nucleotide sequence that is at least partially complementary to a portion of a strand of such a target nucleic acid molecule. A nucleotide sequence is the complement of another nucleotide sequence if all of the nucleotides of the first sequence are complementary to all of the nucleotides of the second sequence. Accordingly, the respective nucleotide sequence will specifically hybridise to, or undergo duplex formation with, the respective portion of the target nucleic acid molecule under suitable hybridisation assay conditions, in particular of ionic strength and temperature.
[0070] As an illustrative example, a single-stranded nucleic acid molecule may be selected as a nucleic acid binding partner. Such a single-stranded nucleic acid molecule may have a nucleic acid sequence that is at least partially complementary to at least a portion of a strand of the target nucleic acid molecule. The respective nucleotide sequence of the nucleic acid binding partner may for example be 70, for example 80 or 85, including 100 % identical to another nucleic acid sequence. The higher the percentage to which the two sequences are complementary to each other (i.e. the lower the number of mismatches), the higher is typically the sensitivity of the method of the invention. In typical embodiments the respective nucleotide sequence is substantially complementary to at least a portion of the target nucleic acid molecule. "Substantially complementary" as used in this document refers to the fact that a given nucleic acid sequence is at least 90 % identical to another nucleic acid sequence. A substantially complementary nucleic acid sequence is in some embodiments 95 %, such as 100 % identical to another nucleic acid sequence. The term "complementary" or "complement" refers to two nucleotides that can form multiple favourable interactions with one another. Such favourable interactions are specific association between opposing or adjacent pairs of nucleic acid (including nucleic acid analogue) strands via matched bases, and include Watson-Crick base pairing. As an illustrative example, in two given nucleic acid molecules (e.g. DNA molecules) the base adenosine is complementary to thymine or uracil, while the base cytosine is complementary to guanine. A nucleic acid probe used in the context of the present invention may be used to probe the sample by usual hybridization methods to detect the presence of nucleic acid molecules encoding e.g. a transcription factor or a biomarker.
[0071] Interactions between two or more nucleic acid molecules are generally sequence driven interactions referred to as hybridization. Sequence driven interaction is an interaction that
occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner (supra). Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the respective nucleotide. The hybridization of two nucleic acids is affected by a number of conditions and parameters known to those skilled in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize. For example, in some embodiments selective hybridization conditions can be defined as stringent hybridization conditions. For example, stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps. For example, conditions of hybridization that achieve selective interactions between complementary sequences may involve hybridization in high ionic strength solution (6 x SSC or 6 x SSPE) at a temperature that is in the range from about 12 to about 25 °C below the Tm, the melting temperature at which half of the molecules dissociate from their hybridization partners, followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is in the range from about 5 °C to about 20 °C below the Tm. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations than for DNA-DNA hybridizations.
[0072] In order to obtain nucleic acid probes having nucleotide sequences which correspond to altered portions of the amino acid sequence of the polypeptide of interest, chemical synthesis can be carried out. The synthesized nucleic acid probes may be first used as primers in a polymerase chain reaction (PCR) carried out in accordance with recognized PCR techniques, essentially according to standard PCR protocols utilizing the appropriate template, in order to obtain the probes that can be used in the context of the present invention.
[0073] One skilled in the art will readily be able to design such probes based on a sequence as referred to herein using methods of computer alignment and sequence analysis well known in the art. As explained above, a respective hybridization probe can be labeled by standard labeling techniques using a detectable marker, such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, or chemiluminescence (supra). After hybridization, the probes may be visualized using known methods. A nucleic acid probe may be immobilized on a solid support. Examples of such solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, and acrylic resins, such as polyacrylamide and latex beads. As an illustrative example one or more nucleic acid probes may be bound to or immobilized on a solid support. The solid support may be a chip, for example a DNA microchip. Techniques for coupling nucleic acid probes to such solid supports are well known in the art.
[0074] The most frequently used methods for determining the concentration of nucleic acids
include the detection by autoradiography, fluorescence, chemiluminescence or bioluminescence as well as electrochemical and electrical techniques. A further suitable technique is the electrical detection of a target nucleic acid molecule as disclosed in international patent applications WO 2009/041917 and WO 2008/097190, both being incorporated herein by reference in their entirety. In case of conflict, the present specification, including definitions, will control. A technique for the specific detection of a selected nucleic acid well established in the art is based on the hybridisation between a nucleic acid binding partner and a target nucleic acid. Typically the respective nucleic acid binding partner is immobilised onto a solid support, and subsequently one of the above mentioned detection methods is employed.
[0075] As indicated above, an immunoglobulin labeled with a fluorescence dye may for instance be used to optically detect the presence of a certain protein or polypeptide. Nucleic acid intercalating dyes, such as YOYO, JOJO, BOBO, POPO, TOTO, LOLO, SYBR, SYTO, SYTOX, PicoGreen, or Oligreen as available from Molecular Probes, may be used for optical detection.
[0076] In some embodiments determining the level of expression of the gene of interest includes determining the level of transcription into mRNA. RNA encoding the protein of interest in the sample, such as a transcription factor or a biomarker may be amplified using any available amplification technique, such as polymerase chain reaction (PCR), including multiplex PCR, nested PCR and amplification refractory mutation specific (ARMS) PCR (also called allele-specific PCR (AS-PCR), rolling circle amplification (RCA), nucleic acid sequence based amplification (NASBA), ligase chain reaction (LCR), QB replicase chain reaction, loop-mediated isothermal amplification (LAMP), transcription mediated amplification (TMA) and strand displacement amplification (SDA), including genome strand displacement amplification (WGSDA), multiple strand displacement amplification (MSDA), and gene specific strand displacement amplification (GS-MSDA). Detection of the obtained amplification products may be performed in numerous ways known in the art. Examples include, but are not limited to, electrophoretic methods such as agarose gel electrophoresis in combination with a staining such as ethidium bromide staining. In other embodiments the method of the invention is accompanied by real time detection, such as real time PCR. In these embodiments the time course of the amplification process is monitored. A means of real time detection commonly used in the art involves the addition of a dye before the amplification process. An example of such a dye is the fluorescence dye SYBR Green, which emits a fluorescence signal only when bound to double-stranded nucleic acids.
[0077] As explained above, typically a detectable label or marker is used. Such a marker or label may be included in a nucleic acid that includes the sequence to be amplified. A marker may also be included in a primer or a probe. It may also be incorporated into the amplification product in the course of the reaction. In some embodiments such a marker compound, e.g. included in a nucleic acid, is an optically detectable label, a fluorophore, or a chromophore. An illustrative
example of a marker compound is 6-carboxyfluorescein (FAM).
[0078] An immunoglobulin may be monoclonal or polyclonal. The term "polyclonal" refers to immunoglobulins that are heterogenous populations of immunoglobulin molecules derived from the sera of animals immunized with an antigen or an antigenic functional derivative thereof. For the production of polyclonal immunoglobulins, one or more of various host animals may be immunized by injection with the antigen. Various adjuvants may be used to increase the immunological response, depending on the host species. "Monoclonal immunoglobulins", also called "monoclonal antibodies", are substantially homogenous populations of immunoglobulins to a particular antigen. They may be obtained by any technique which provides for the production of immunoglobulin molecules by continuous cell lines in culture. Monoclonal immunoglobulins may be obtained by methods well known to those skilled in the art (see for example, K5hler et al., Nature (1975) 256, 495-497, and U.S. Patent No. 4,376,110). An immunoglobulin or immunoglobulin fragment with specific binding affinity only for e.g. a transcription factor or of a biomarker can be isolated, enriched, or purified from a prokaryotic or eukaryotic organism. Routine methods known to those skilled in the art enable production of both immunoglobulins or immunoglobulin fragments and proteinaceous binding molecules with immunoglobulin-like functions, in both prokaryotic and eukaryotic organisms. Techniques for preparing monoclonal antibodies and hybridomas are also well known in the art.
[0079] As indicated above, a detectable marker may be coupled to a binding partner of a transcription factor or of a biomarker or a molecule that forms a complex with the binding partner of a transcription factor or a biomarker. A respective detectable marker, which may be coupled to a binding partner of a transcription factor or a biomarker, or a molecule that forms a complex therewith, may be an optically detectable label, a fluorophore, or a chromophore. Examples of suitable labels include, but are not limited to, an organic molecule, an enzyme, a radioactive, fluorescent, and/or chromogenic moiety, a luminescent moiety, a hapten, digoxigenin, biotin, a metal complex, a metal and colloidal gold. Accordingly an excitable fluorescent dye, a radioactive amino acid, a fluorescent protein or an enzyme may for instance be used to detect e.g. the level of a cytochrome P450 enzyme or the level of a transcription factor. Examples of suitable fluorescent dyes include, but are not limited to, fluorescein isothiocyanate, 5,6-carboxymethyl fluorescein, Cascade Blue®, Oregon Green®, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl, coumarin, dansyl chloride, rhodamine, amino-methyl coumarin, DAPI, Eosin, Erythrosin, BODIPY®, pyrene, lissamine, xanthene, acridine, an oxazine, phycoerythrin, a Cy dye such as Cy3, Cy3.5, Cy5, Cy5PE, Cy5.5, Cy7, Cy7PE or Cy7APC, an Alexa dye such as Alexa 647, and NBD (Naphthol basic dye). Examples of suitable fluorescent protein include, but are not limited to, EGFP, emerald, EYFP, a phycobiliprotein such as phycoerythrin (PE) or allophycocyanin, Monomeric Red Fluorescent Protein (mRFP), mOrange, mPlum and mCherry. In some embodiments a reversibly
photoswitchable fluorescent protein such as Dronpa, bsDronpa and Padron may be employed (Andresen, M., et al., Nature Biotechnology (2008) 26, 9, 1035). Regarding suitable enzymes, alkaline phosphatase, soybean peroxidase, or horseradish peroxidase may serve as a few illustrative examples. In some embodiments a method of detection may include electrophoresis, HPLC, flow cytometry, fluorescence correlation spectroscopy or a modified form of these techniques. Some or all of these steps may be part of an automated separation/detection system.
[0080] In some embodiments a biomarker that can be used to identify a cell of a hepatocyte phenotype is secreted, such as serum albumin or isoform termed isoform b of asialoglycoprotein receptor 2. Determining the presence and/or amount of such a biomarker may be carried out by determining the amount of the biomarker that is found in the media encompassing the cell. An illustrative example of a suitable technique in this regard is a radiolabel assay such as a Radioimmunoassay (RIA) or an enzyme-immunoassay such as an Enzyme Linked Immunoabsorbent Assay (ELISA). While a RIA is based on the measurement of radioactivity associated with a complex formed between an immunoglobulin or a proteinace- ous binding molecule with immunoglobulin- like functions and an antigen, an ELISA is based on the measurement of an enzymatic reaction associated with a complex formed between an immunoglobulin or a proteinaceous binding molecule with immuneglobulin-like functions and an antigen. Typically a radiolabel assay or an enzyme-immunoassay involves one or more separation steps in which a binding partner of e.g. serum albumin or asialoglycoprotein receptor 2b that has not formed a complex with the respective biomarker is being removed, thereby leaving only binding partner of e.g. serum albumin or asialoglycoprotein receptor 2b behind, which has formed a complex with e.g. serum albumin or asialoglycoprotein receptor 2b. This allows the generation of specific signals originating from the presence of the respective biomarker.
[0081] An ELISA or RIA test can be competitive for measuring the amount of e.g. serum albumin or asialoglycoprotein receptor 2b, i.e. the amount of antigen. For example, an enzyme labeled antigen is mixed with a test sample containing antigen, which competes for a limited amount of immunoglobulin or a proteinaceous binding molecule with immunoglobulin- like functions. The reacted (bound) antigen is then separated from the free material, and its enzyme activity is estimated by addition of substrate. An alternative method for antigen measurement is the double immunoglobulin/proteinaceous binding molecule sandwich technique. In this modification a solid phase is coated with specific immunoglobulin or a proteinaceous binding molecule with immunoglobulin-like functions. This is then reacted with the sample from the subject that contains the antigen. Then enzyme labeled specific immunoglobulin/proteinaceous binding molecule is added, followed by the enzyme substrate. The 'antigen' in the test sample is thereby 'captured' and immobilized on to the sensitized solid
phase where it can itself then immobilize the enzyme labeled immunoglobulin/proteinaceous binding molecule. This technique is analogous to the immunoradiometric assays.
[0082] In an indirect ELISA method, an antigen is immobilized by passive adsorption on to the solid phase. For instance test serum may then be incubated with the solid phase and any immunoglobulin in the test serum forms a complex with the antigen on the solid phase. Similarly a solution of a proteinaceous binding molecule with immunoglobulin-like functions may be incubated with the solid phase to allow the formation of a complex between the antigen on the solid phase and the proteinaceous binding molecule. After washing to remove unreacted serum components an immunoglobulin or proteinaceous binding molecule with immunoglobulin-like functions, linked to an enzyme is contacted with the solid phase and incubated. Where the second reagent is selected to be a proteinaceous binding molecule with immunoglobulin-like functions, a respective proteinaceous binding molecule that specifically binds to the proteinaceous binding molecule or the immunoglobulin directed against the antigen is used. A complex of the second proteinaceous binding molecule or immunoglobulin and the first proteinaceous binding molecule or immunoglobulin, bound to the antigen, is formed. Washing again removes unreacted material. In the case of RIA radioactivity signals are being detected. In the case of ELISA the enzyme substrate is added. Its colour change will be a measure of the amount of the immobilized complex involving the antigen, which is proportional to the antibody level in the test sample.
[0083] In another embodiment the immunoglobulin or the proteinaceous binding molecule with immunoglobulin-like functions may be immobilized onto a surface, such as the surface of a polymer bead (supra), or coated onto the surface of a device such as a polymer plate or a glass plate. As a result the immune complexes can easily be separated from other components present by simply washing the surface, e.g. the beads or plate. This is the most common method currently used in the art and is referred to as solid phase RIA or ELISA. This embodiment may be particularly useful for determining the amount of a biomarker present on the surface of cells, such as the Bile Salt Export Pump. On a general basis, in any embodiment of a radiolabel assay or of an enzyme-immunoassay passive adsorption to the solid phase can be used in the first step. Adsorption of other reagents can be prevented by inclusion of wetting agents in all the subsequent washing and incubation steps. It may be advantageous to perform washing to prevent carry-over of reagents from one step to the next.
[0084] Various other modifications of ELISA have been used in the art. For example, a system where the second proteinaceous binding molecule or immunoglobulin used in the double antibody sandwich method is from a different species, and this is then reacted with an anti- immunoglobulin enzyme conjugate or an anti-proteinaceous binding molecule enzyme conjugate. This technique comes with the potential advantage that it avoids the labeling of the specific
immunoglobulin or proteinaceous binding molecule, which may be in short supply and of low potency. This same technique can be used to assay immunoglobulin or proteinaceous binding molecule where only an impure antigen is available; the specific reactive antigens are selected by the antibody immobilized on the solid phase.
[0085] A further characteristic of a hepatocyte phenotype that may be assessed is bile secretion. Detection of biliary secretion may for instance be done using the so called fluorescein diacetate time lapse assay. In this technique the cells of interest are incubated with doxycycline and fluorescein diacetate, a non-fluorescent precursor of fluorescein. Uptake and metabolization to fluorescein is then determined. As two further examples of characteristic of a hepatocyte phenotype, glycogen synthesis and the cell's ability to store glycogen may be determined.
[0086] The present inventors have further observed that the detectable activity of cytochrome P450 enzymes in a cell obtained by a method as described herein remains at high levels, compared to adherent adult multipotent cells from which the respective cells originate. Upon culturing a cell of a hepatocyte phenotype obtained by a method as described herein, generally the detectable activity of cytochrome P450 enzymes in such a cell after 28 days of culture is 80 % or higher of the activity that was detectable immediately after obtaining the cell. In some embodiments the detectable activity of cytochrome P450 enzymes in such a cell after 28 days of culture is 90 % or higher of the activity that was detectable immediately after obtaining the cell. In this regard, after culturing a cell of a hepatocyte phenotype obtained as described herein for 42 days, the detectable activity of cytochrome P450 enzymes in the cell is generally 60 % or more of the activity that was detectable immediately after obtaining the cell. In some embodiments the detectable activity of cytochrome P450 enzymes a respective cell of a hepatocyte phenotype after 42 days of culture is 70 % or higher of the activity that was detectable immediately after obtaining the cell.
[0087] In a method of obtaining a cell of hepatocyte phenotype as described herein adherent adult multipotent cells are used. A cell is termed multipotent if it has the potential to give rise to cells from multiple, but a limited number of lineages of an organism. Examples of multipotent cells include, but are not limited to, stem cells and progenitor cells. In contrast thereto, a "totipotent" cell is a cell with the potential to differentiate into any type of somatic or germ cell found in the organism. Thus, any desired cell may be derived, by some means, from a totipotent cell. Finally, unipotent cells can produce only one cell type. Any of the terms unipotent, multipotent and totipotent generally refer to an undifferentiated cell or a partially differentiated cell. Examples of an undifferentiated cell include, but are not limited to, a stem cell, e.g. an embryonic stem cell, including a mammalian embryonic stem cell, such as a human, a mouse, a rat or a Guinea pig embryonic stem cell, any of which may also be a cell of an embryonic stem cell line. A stem cell may also be a trophoblast stem cell or any extraembryonic stem cell, e.g. an adult stem cell, also called a somatic stem cell. Further examples of an undifferentiated cell include a germ cell, an
oocyte, a blastomer, and an inner cell mass cell. In some embodiments the adult multipotent cells have been obtained from a host organism such as a fish, an amphibian, a bird or a mammal.
[0088] In some embodiments of the present invention the adherent adult multipotent cell is a stem cell. In one embodiment the stem cell is a somatic stem cell. Somatic stem cells have been identified in most organ tissues. In one embodiment a somatic stem cell is a hematopoietic stem cell, which is a mesoderm-derived cell that can be purified based on cell surface markers and functional characteristics. The hematopoietic stem cell, isolated from bone marrow, blood, cord blood, fetal liver and yolk sac, is the progenitor cell that reinitiates hematopoiesis for the life of a recipient and generates multiple hematopoietic lineages. When transplanted into lethally irradiated animals or humans, hematopoietic stem cells can repopulate the erythroid, neutrophil-macrophage, megakaryocyte and lymphoid hematopoietic cell pool. In vitro, hematopoietic stem cells can be induced to undergo at least some self-renewing cell divisions and can be induced to differentiate to the same lineages as is seen in vivo.
[0089] In one embodiment the stem cell is a cord blood stem cell such as a mesenchymal stem cell (MSC) or an unrestricted somatic stem cell (USSC). A mesenchymal stem cell may also be of umbilical cord tissue or of entirely different origin, such as adipose tissue, muscle tissue, placenta tissue or the dental pulp of deciduous baby teeth. A mesenchymal stem cell has cell surface molecules such as CD73, CD90 and CD 105 that are typical mesenchymal cell surface proteins. A mesenchymal stem cell also has fibroblastoid morphology and shows adherent growth on plastic surfaces. A mesenchymal stem cell, originally derived from the embryonic mesoderm and isolated from adult bone marrow, is known to be able to differentiate to form muscle, bone, cartilage, fat, marrow stroma or tendon. In some embodiments the stem cell may be one of a gastrointestinal stem cell, an epidermal stem cell, a neural stem cell or a hepatic stem cell, also termed oval cell. In some embodiments the stem cells has been isolated from umbilical cord, placenta, amniotic fluid, chorion villi, blastocysts, bone marrow, adipose tissue, brain, peripheral blood, the gastrointestinal tract, cord blood, blood vessels, skeletal muscle, skin, liver or menstrual blood.
[0090] An example of a cell that is a partially differentiated cell is a progenitor cell. A progenitor cell, which may be unipotent or multipotent, has a capacity to differentiate into a specific type of cell and a limited ability of self-renewal, which it cannot maintain. Further examples of a partially differentiated cell include, but are not limited to, a precursor cell, i.e. a stem cell that has developed to the stage where it is committed to forming a particular kind of new cell, a lineage- restricted stem cell, and a somatic stem cell.
[0091] The cell may be obtained or derived from any host organism. The cell may be directly taken from a respective host organism in form of a sample such as e.g. a biopsy or a blood sample. It may also have been derived from a host organism and subsequently been cultured, grown, transformed or exposed to a selected treatment. The host organism from which the cell is derived or
obtained may be any organism such as a microorganism, an animal, such as a fish, an amphibian, a reptile, a bird, a mammal, including a rodent species, an invertebrate species, e.g. of the subclass Lissamphibia that includes e.g. frogs, toads, salamanders or newts, or a plant. Examples of mammals include, but are not limited to, a rat, a mouse, a rabbit, a guinea pig, a squirrel, a hamster, a vole, a platypus, a dog, a goat, a horse, a pig, an elephant, a chicken, a macaque, a chimpanzee and a human.
[0092] In some embodiments the method of the invention includes assessing the absence of undifferentiated cells or cells not entirely differentiated, for example by using an antibody that specifically binds to a polypeptide cell surface marker present in undifferentiated cells but not in cells of hepatocyte phenotype. In some embodiments the protein or polypeptide cell surface marker present on the surface of undifferentiated cells but not in cells of hepatocyte phenotype is at least one of CXCR4, CD10, CD13, CD41a (gpllbllla), CD34, CD56, CD90, CD110, CD117, CD123, CD133, CD135, CD277 and CD318, at least one of CD10, CD13, CD56, and an MHC Class-I cell surface antigen, and/or at least one of CD3, CD5, CD7, CDl lb, CD14, CD15, CD16, CD19, CD25, CD45, and CD65.
[0093] In some embodiments the method of the invention includes isolating and/or identifying cells of hepatocyte phenotype by positive or negative selection using an antibody or a proteinaceous binding molecule with antibody-like functions, as indicated above. The cells can for instance be identified and/or isolated by fluorescent activated cell sorting (FACS) or affinity column chromatography. The cells can also be identified on the basis of identifying plasma membrane proteins by mass spectrometry or other suitable techniques.
[0094] Where the method of the invention is intended to be used for a progenitor cell, i.e. a cell giving rise to a mature somatic cell, any progenitor cell may be used in this method of the invention. Examples of suitable progenitor cells include, but are not limited to, neuronal progenitor cells, endothelial progenitor cells, erythroid progenitor cells, cardiac progenitor cells, oligodendrocyte progenitor cells, retinal progenitor cells, or hematopoietic progenitor cells.
[0095] In a method according to the present invention the amount of two or more transcription factors in the respective cell is increased. The amount, which may also be referred to as the level of the respective protein, indicates the absolute number of molecules of the transcription factors in the cell.
[0096] A method according to the invention includes increasing the cellular amount of the transcription factor hepatocyte nuclear factor 6 (HNF-6), also called one cut domain family member 1 (OC-1) or one cut homeobox 1. The protein HNF-6 may be any respective variant or isoform of the respective species, e.g. human. The protein may for example be the human protein of the Swissprot/Uniprot accession number Q9UBC0 (version 107 as of 18 April 2012, SEQ ID NO: 59), the murine protein of the Swissprot/Uniprot accession number 008755 (version 113 as of 18 April
2012, SEQ ID NO: 60), the rat protein of the Swissprot/Uniprot accession number P70512 (version 93 as of 18 April 2012, SEQ ID NO: 61), the bovine protein represented by the fragment of the Swissprot/Uniprot accession number Q5DM44 (version 41 as of 21 March 2012, SEQ ID NO: 62), the protein of the rhesus macaque (Macaca mulatta) of the Swissprot/Uniprot accession number G7MXH6 (version 2 as of 21 March 2012, SEQ ID NO: 63) or the protein of the crab-eating macaque (Cynomolgus monkey, Macaca fascicularis) of the Swissprot/ Uniprot accession number G7PBI4 (version 2 as of 21 March 2012, SEQ ID NO: 64).
[0097] A natural variant of the human HNF-6 protein is named VAR 010729 in the data base entry of Swissprot/Uniprot accession number Q9UBC0, having an alanine instead of a proline at position 75 of the amino acid sequence. The sequence of the rat HNF-6 protein depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P70512 has the identifier P70512-1 and is also called the isoform alpha. A further isoform, called the isoform beta, has the identifier P70512-2, also named VSP_002312, in this data base entry. It differs from isoform alpha in that it has the sequence Ala Glu Ser Ala Met Gly Gly Ser Val Pro Ser Leu Arg He Thr Ser Gly Gly Pro Gin Leu Ser Val Pro Pro Leu Pro instead of an alanine at position 368 of the sequence defining Swissprot/Uniprot accession number P70512-1.
[0098] HNF-6 may be the protein encoded by the ONECUT1 (one cut homeobox 1) gene, also called HNF6, HNF-6 or HNF6A, for example the human gene of GenBank Gene ID No 3175 as of 06 May 2012, the mouse gene of GenBank Gene ID No 15379 as of 20 April 2012, the rat gene of GenBank Gene ID No 25231 as of 20 April 2012 or the bovine gene of GenBank Gene ID No 503584 as of 10 May 2012.
[0099] A further transcription factor, the cellular amount of which is increased in a method according to the invention, is the transcription factor hepatocyte nuclear factor la (HNF-la), also called liver-specific transcription factor LF-B1 or sometimes simply transcription factor 1 (TCF-1). The protein HNF-la may be any respective variant or isoform of the respective species, e.g. human. In some embodiments HNF- 1 a is the human protein of the Swissprot/ Uniprot accession number P20823 (version 157 as of 18 April 2012, SEQ ID NO: 65), the mouse protein of the Swissprot/Uniprot accession number P22361 (version 126 as of 18 April 2012, SEQ ID NO: 66), the rat protein of the Swissprot/Uniprot accession number P15257 (version 129 as of 18 April 2012, SEQ ID NO: 67), the chicken protein of the Swissprot/Uniprot accession number Q90867 (version 92 as of 13 June 2012, SEQ ID NO: 68) or the salmon (Salmo salar) protein of the Swissprot/Uniprot accession number Q91474 (version 77 as of 18 April 2012, SEQ ID NO: 69).
[0100] The sequence of the human HNF-la depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P20823 has the identifier P20823-1 and is also called the isoform A. Two further isoforms, called isoforms B and C, have the identifiers P20823-2 and P20823-3 in this data base entry. Isoform B differs from isoform A firstly in that it has the
sequence Gly Glu His Pro Val Pro His Thr Ala Gly ... Ala Cys Val Ser Gly Thr Ser Val Phe Pro instead of the sequence Ala Leu Tyr Ser His Lys Pro Glu Val Ala ... Leu Ala Ser Leu Thr Pro Thr Lys Gin Val at positions 501 to 542 of the amino acid sequence. Secondly, Isoform B differs from isoform A in that it does not contain the amino acids 543 to 601 of the amino acid sequence. Isoform C firstly differs from isoform A in that it has the sequence Lys Leu Val Gly Met Gly Gly His Leu Gly ... Ser His Cys Ala Thr Ser Val He Pro Gly instead* of the sequence Leu Ala Ser Thr Gin Ala Gin Ser Val Pro ... Thr Gin Ser Pro Phe Met Ala Thr Met Ala at positions 438 to 494 of the amino acid sequence. Secondly, Isoform C differs from isoform A in that it does not contain the amino acids 495 to 601 of the amino acid sequence present in isoform A.
[0101] HNF-Ια may be the protein encoded by the HNF1A gene, for example the human gene of GenBank Gene ID No 6927 as of 06 May 2012, the mouse gene of GenBank Gene ID No 21405 as of 06 May 2012, the rat gene of GenBank Gene ID No 24817 as of 20 April 2012, the chicken gene of GenBank Gene ID No 416967 as of 17 March 2012 or the Xenopus laevis gene of GenBank Gene ID No 378589 as of 12 November 2012.
[0102] In some embodiments of a method according to the invention the cellular amount of the hepatocyte nuclear factor 4a (HNF-4a) is being increased, which is also called nuclear receptor subfamily 2 group A member 1 (N 2A1) or sometimes simply transcription factor 14 (TCF-14). The protein HNF-4a may be any respective variant or isoform of the respective species, e.g. human. The protein may for example be the human protein of the Swissprot/Uniprot accession number P41235 (version 147 as of 18 April 2012, SEQ ID NO: 75), the mouse protein of the Swissprot/Uniprot accession number P49698 (version 117 as of 18 April 2012, SEQ ID NO: 76), the rat protein of the Swissprot/Uniprot accession number P22449 (version 123 as of 18 April 2012, SEQ ID NO: 77) or the Xenopus laevis protein of the Swissprot/Uniprot accession number Q91766 (version 90 as of 18 April 2012, SEQ ID NO: 78).
[0103] The sequence of the human HNF-4a depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P41235 has the identifier P41235-1 and is also called HNF-4al or the isoform HNF4-B. Six further isoforms, called isoforms HNF-4a2 or HNF- 4A, HNF-4a3 or HNF-4C, HNF-4a4, HNF-4a7, HNF-4a8 and HNF-4a9 have the identifiers P41235-2, P41235-3, P41235-4, P41235-5, P41235-6 and P41235-7 in this data base entry. HNF- 4a2 differs from HNF-4al in that it has only a single serine instead of the sequence Cys Glu Trp Pro Arg Pro Arg Gly Gin Ala Ala at positions 418 to 428 of the amino acid sequence. HNF-4a3 differs from HNF-4al in that it has the sequence Pro Cys Gin Ala Gin Glu Gly Arg Gly Trp ... Ser Pro Leu Cys Arg Phe Gly Gin Val Ala instead of the sequence Ser Pro Ser Asp Ala Pro His Ala His His ... Gin Pro Thr He Thr Lys Gin Glu Val He at positions 378 to 474 of the amino acid sequence. HNF-4a4 differs from HNF-4al in that it contains the sequence Asn Asp Leu Leu Pro Leu Arg Leu Ala Arg Leu Arg His Pro Leu Arg His His Trp Ser He Ser Gly Gly Val Asp Ser Ser Pro Gin Gly
instead of the asparagine at position 38 of the amino acid sequence. HNF-4a7 differs from HNF- 4al in that it has the N-terminal sequence Met Val Ser Val Asn Ala Pro Leu Gly Ala Pro Val Glu Ser Ser Tyr instead of the sequence Met Arg Leu Ser Lys Thr Leu Val Asp Met Asp Met Ala Asp Tyr Ser Ala Ala Leu Asp Pro Ala Tyr Thr Thr Leu Glu Phe Glu Asn Val Gin Val Leu Thr Met Gly Asn at positions 1 to 38 of the amino acid sequence. HNF-4a8 differs from HNF-4al firstly in that it has the N-terminal sequence Met Val Ser Val Asn Ala Pro Leu Gly Ala Pro Val Glu Ser Ser Tyr instead of the sequence Met Arg Leu Ser Lys Thr Leu Val Asp Met Asp Met Ala Asp Tyr Ser Ala Ala Leu Asp Pro Ala Tyr Thr Thr Leu Glu Phe Glu Asn Val Gin Val Leu Thr Met Gly Asn at positions 1 to 38 of the amino acid sequence. Secondly, HNF-4a8 differs from HNF-4al in that it contains only a serine instead of the sequence Cys Glu Trp Pro Arg Pro Arg Gly Gin Ala Ala at the sequence positions 418 to 428 of the amino acid sequence. HNF-4a9 differs from HNF-4al firstly in that it has the N-terminal sequence Met Val Ser Val Asn Ala Pro Leu Gly Ala Pro Val Glu Ser Ser Tyr instead of the sequence Met Arg Leu Ser Lys Thr Leu Val Asp Met Asp Met Ala Asp Tyr Ser Ala Ala Leu Asp Pro Ala Tyr Thr Thr Leu Glu Phe Glu Asn Val Gin Val Leu Thr Met Gly Asn at positions 1 to 38 of the amino acid sequence. Secondly, HNF-4a9 differs from HNF-4al in that it has the sequence Pro Cys Gin Ala Gin Glu Gly ArgGly Trp ... Ser Pro Leu Cys Arg Phe Gly Gin Val Ala instead of the sequence Ser Pro Ser Asp Ala Pro His Ala His His ... Gin Pro Thr He Thr Lys Gin Glu Val He at positions 378 to 474 of the amino acid sequence.
[0104] The sequence of the mouse HNF-4a depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number P49698 has the identifier P49698-1 and is also called the long isoform. The short isoform with the identifier P49698-2 differs from the long isoform in that it has a serine instead of the sequence Cys Glu Trp Pro Arg Pro Arg Gly Gin Ala Ala at positions 418 to 428 of the amino acid sequence.
[0105] HNF-4a is in some embodiments the protein encoded by the HNF4A gene, for example the human gene of GenBank Gene ID No 3172 as of 06 May 2012, the mouse gene of GenBank Gene ID No 15378 as of 06 May 2012, the rat gene of GenBank Gene ID No 25735 as of 06 May 2012, the bovine gene of GenBank Gene ID No 25735 as of 06 May 2012 or the horse gene of GenBank Gene ID No 100056007 as of 16 November 2011.
[0106] A further transcription factor, the cellular amount of which is increased in some embodiments of a method according to the invention, is the transcription factor hepatocyte nuclear factor 3β (ΗΝΤ-3β), also called Forkhead box protein A2 (FOXA2) or sometimes transcription factor 3B (TCF-3B). The protein ΗΝΤ-3β may be any respective variant or isoform of the respective species, e.g. human. The protein may for example be the human protein of the Swissprot/Uniprot accession number Q9Y261 (version 120 as of 18 April 2012, SEQ ID NO: 70), the mouse protein of the Swissprot/Uniprot accession number P35583 (version 112 as of 18 April 2012, SEQ ID NO: 71), the rat protein of the Swissprot/Uniprot accession number P32182 (version 104 as of 18 April 2012,
SEQ ID NO: 72), the protein of Medaka fish (Japanese ricefish, Oryzias latipes) of the Swissprot/Uniprot accession number 042097 (version 79 as of 18 April 2012, SEQ ID NO: 73) or the chicken protein of the Swissprot/ Uniprot accession number Q9PWP8 (version 76 as of 18 April 2012, SEQ ID NO: 74).
[0107] The sequence of the human ΗΝΤ-3β protein depicted as the canonical sequence in the data base entry of Swissprot/Uniprot accession number Q9Y261 has the identifier Q9Y261-1 and is also called isoform 1. A further isoform, isoform 2, has the identifier Q9Y261-2 in this data base entry. It differs from isoform 1 in that it has the sequence Met His Ser Ala Ser Ser Met instead of the N-terminal (i.e., position 1) methionine of the amino acid sequence of Swissprot/Uniprot accession number Q9Y261 - 1.
[0108] ΗΝΤ-3β may be the protein encoded by the HNF3B gene, also called the foxa2 gene, for example the human gene of GenBank Gene ID No 15376 as of 20 April 2012, the zebra fish gene of GenBank Gene ID No 30126 as of 29 April 2012, the mouse gene of GenBank Gene ID No 15376 as of 20 April 2012, the rat gene of GenBank Gene ID No 25099 as of 20 April 2012 or the Xenopus laevis gene of GenBank Gene ID No 100127318 as of 24 December 2011.
[0109] A variant of any of the above transcription factors includes a protein with a high sequence identity to a respective known form of the transcription factor. A corresponding sequence of a variant that has a high sequence identity to a known form of the protein has in some embodiments at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 82 %, at least 85 %, at least 87 %, at least 90% identity, including at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identity to the sequence of the known form of the protein. By "identity" is meant a property of sequences that measures the similarity or relationship of the variant and the corresponding known protein. Identity is measured by dividing the number of identical residues by the total number of residues and multiplying the product by 100. Those skilled in the art will be aware of the fact that several computer programs are available for determining sequence identity using standard parameters, for example Blast (Altschul, et al. (1997) Nucleic Acids Res. 25, 3389-3402), Blast2 (Altschul, et al. (1990) J. Mol. Biol. 215, 403-410), and Smith- Waterman (Smith, et al. (1981) J. Mol. Biol. 147, 195-197). A variant of a known protein may include one or more mutations - relative to the sequence of the known protein form. A respective variant may in some embodiments have been obtained from the sequence of a known protein form by molecular biology techniques, including recombinant techniques.
[0110] In some embodiments a variant has a sequence that contains a substitution (or replacement) that is a conservative substitution, not being associated with a change in biological activity. Nevertheless, any substitution - including non-conservative substitution or one or more from the exemplary substitutions listed below - is envisaged as long as the variant retains its capability of acting as a transcription factor with the same specificity as the known form of the
protein, respectively, and/or it has an identity to the then substituted sequence in that it is at least 60%, such as at least 65%, at least 70%), at least 75%, at least 80%), at least 85 % or higher identical to the "original" sequence.
[0111] Conservative substitutions are generally the following substitutions, listed according to the amino acid to be mutated, each followed by one or more replacement(s) that can be taken to be conservative: Ala→ Gly, Ser, Val; Arg→ Lys; Asn→ Gin, His; Asp→ Glu; Cys→ Ser; Gin→ Asn; Glu→ Asp; Gly→ Ala; His→ Arg, Asn, Gin; He→ Leu, Val; Leu→ He, Val; Lys→ Arg, Gin, Glu; Met→ Leu, Tyr, He; Phe→ Met, Leu, Tyr; Ser→ Thr; Thr→ Ser; Trp→ Tyr; Tyr→ Trp, Phe; Val— > He, Leu. Other substitutions are also permissible and can be determined empirically or in accord with other known conservative or non-conservative substitutions. As a further orientation, the following eight groups each contain amino acids that can typically be taken to define conservative substitutions for one another:
1) Alanine (Ala), Glycine (Gly);
2) Aspartic acid (Asp), Glutamic acid (Glu);
3) Asparagine (Asn), Glutamine (Gin);
4) Arginine (Arg), Lysine (Lys);
5) Isoleucine (He), Leucine (Leu), Methionine (Met), Valine (Val);
6) Phenylalanine (Phe), Tyrosine (Tyr), Tryptophan (Trp);
7) Serine (Ser), Threonine (Thr); and
8) Cysteine (Cys), Methionine (Met)
[0112] In contrast thereto, the following substitutions can be expected to increase the likelihood of a change in biological activity, representing more substantial changes: Ala— > Leu, He; Arg→ Gin; Asn→ Asp, Lys, Arg, His; Asp→ Asn; Cys→ Ala; Gin→ Glu; Glu→ Gin; His→ Lys; He→ Met, Ala, Phe; Leu→ Ala, Met, Norleucine; Lys→ Asn; Met→ Phe; Phe→ Val, He, Ala; Trp→ Phe; Tyr→ Thr, Ser; Val→ Met, Phe, Ala.
[0113] In a method according to the invention, the amount of at least two transcription factors is increased, as already explained above. Increasing the amount/level of a transcription factor in a cell according to the invention may be achieved by increasing the formation and/or by reducing the degradation of the transcription factor in the cell. Increasing the formation of a transcription may be achieved by activating and/ or enhancing one or more homologous, i.e. endogenous, genes encoding the transcription factor. Increasing the formation of a transcription may also be achieved by increasing the expression of a homologous, but transcriptionally repressed transcription factor, by reversing the silencing or inhibitory effect on the expression of a transcription factor gene, for example by regulating the upstream transcription factor expression or epigenetic modulation. In
some embodiments the method of the invention includes introducing into the cell a nucleic acid molecule, typically a heterologous nucleic acid molecule, encoding the respective transcription factor, capable of allowing expression of the same in the cell. The method in such embodiments further includes expressing the heterologous transcription factor.
[0114] The term "nucleic acid molecule" as used herein refers to any nucleic acid in any possible configuration, such as single stranded, double stranded or a combination thereof. Nucleic acids include for instance DNA molecules, RNA molecules, analogues of the DNA or RNA generated using nucleotide analogues or using nucleic acid chemistry, locked nucleic acid molecules (LNA), protein nucleic acids molecules (PNA), alkylphosphonate and alkylphosphotriester nucleic acid molecules and tecto-RNA molecules (e.g. Liu, B., et al., J. Am. Chem. Soc. (2004) 126, 4076- 4077). DNA or RNA may be of genomic or synthetic origin and may be single or double stranded. Such nucleic acid can be e.g. mRNA, cRNA, synthetic RNA, genomic DNA, cDNA synthetic DNA, a copolymer of DNA and RNA, oligonucleotides, etc. A respective nucleic acid may furthermore contain non-natural nucleotide analogues and/or be linked to an affinity tag or a label. A PNA molecule is a nucleic acid molecule in which the backbone is a pseudopeptide rather than a sugar. Accordingly, PNA generally has a charge neutral backbone, in contrast to DNA or RNA. Nevertheless, PNA is capable of hybridising at least complementary and substantially complementary nucleic acid strands, just as e.g. DNA or RNA (to which PNA is considered a structural mimic). LNA has a modified RNA backbone with a methylene bridge between C4' and 02', providing the respective molecule with a higher duplex stability and nuclease resistance. Alkylphosphonate and alkylphosphotriester nucleic acid molecules can be viewed as a DNA or an RNA molecule, in which phosphate groups of the nucleic acid backbone are neutralized by exchanging the P-OH groups of the phosphate groups in the nucleic acid backbone to an alkyl and to an alkoxy group, respectively. DNA or RNA may be of genomic or synthetic origin and may be single or double stranded. Such nucleic acid can be e.g. mRNA, cRNA, synthetic RNA, genomic DNA, cDNA synthetic DNA, a copolymer of DNA and RNA, oligonucleotides, etc. A respective nucleic acid may furthermore contain non- natural nucleotide analogues and/or be linked to an affinity tag or a label.
[0115] Many nucleotide analogues are known and can be used in nucleic acids used in a method of the invention, for example as a heterologous nucleic acid introduced into a cell. A nucleotide analogue is a nucleotide containing a modification at for instance the base, sugar, or phosphate moieties. As an illustrative example, a substitution of 2'-OH residues of siRNA with 2'F, 2'O-Me or 2Ή residues is known to improve the in vivo stability of the respective RNA. Modifications at the base moiety include natural and synthetic modifications of A, C, G, and T/U, different purine or pyrimidine bases, such as uracil-5-yl, hypoxanthin-9-yl, and 2-aminoadenin-9-yl, as well as non-purine or non-pyrimidine nucleotide bases. Other nucleotide analogues serve as
universal bases. Universal bases include 3-nitropyrrole and 5-nitroindole. Universal bases are able to form a base pair with any other base. Base modifications often can be combined with for example a sugar modification, such as for instance 2'-0-methoxyethyl, e.g. to achieve unique properties such as increased duplex stability.
[0116] As indicated above, a heterologous sequence, e.g. a gene, encoding a transcription factor, such as HNF-la or HNF-6, may be introduced into an adherent adult multipotent cell. The sequence, which may be included in a heterologous nucleic acid molecule, may be introduced into the cell by means of recombinant technology. The sequence may be included in any gene delivery system such as for instance a transposon system, a viral gene delivery system, an episomal gene delivery system or a homologous recombination system such as utilizing a zinc finger nuclease, a transcription activator- like effector (TALE) nuclease, or a meganuclease. A heterologous nucleic acid molecule that has a sequence encoding a transcription factor may in some embodiments be included in a vector, typically as a vector carrying a gene of the transcription factor. It may in this regard be advantageous to further use a vector that contains a promoter effective to initiate transcription in the respective host cell (whether of endogenous or heterologous origin). In this regard the present invention also relates to the use of such a nucleic acid molecule, e.g. a respective vector or included therein, for increasing the absolute quantity of a transcription factor in a cell.
[0117] The term "vector", sometimes also referred to as gene delivery system or gene transfer vehicle, relates to a macromolecule or complex of molecules that include(s) a polynucleotide to be delivered to a host cell, whether in vitro, ex vivo or in vivo. Typically a vector is a single or double-stranded circular nucleic acid molecule that allows or facilitates the transfer of a nucleic acid sequence into a cell. A vector can generally be transfected into cells and replicated within or independently of a cell genome. A circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes. An assortment of nucleic acid vectors, restriction enzymes, and the knowledge of the nucleotide sequences cut by restriction enzymes are readily available to those skilled in the art. A nucleic acid molecule encoding a transcription factor, such as HNF-la or HNF-6, can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together. A vector may for instance be a viral vector, such as a retroviral vector, a Lentiviral vector, a herpes virus based vector or an adenoviral vector. A vector may also be a plasmid vector or a liposome-based extrachromosomal vector, also called episomal vector. Two illustrative examples of an episomal vector are an oriP -based vector and a vector encoding a derivative of EBNA- 1. Lymphotrophic herpes virus is a herpes virus which replicates in a lymphoblast and becomes a plasmid for a part of its natural life-cycle. A vector may also be based on an organically modified silicate. In some embodiments a vector may be a transposon-based system, i.e. a transposon/transposase system, such as the so called Sleeping Beauty, the Frog Prince transposon - transposase system or the TTAA-specific transposon piggyBac
system. Transposons are mobile genetic elements in that they are sequences of DNA that can move around to different positions within the genome of a single cell, a process called transposition. In the process, a transposon can cause mutations and change the amount of DNA in the genome.
[0118] In some embodiments of a method according to the invention the amount of a transcription factor, e.g. HNF-6 or HNF-Ια, in a cell can be increased by enhancing the expression of homologous HNF-6 and HNF-la, respectively. Micro-RNA molecules termed miR-495 and miR- 218 target the 3 '-untranslated region of HNF-6 (Simion, A, et al., Biochem Biophys Res Commun. (2010) 391, 1, 293-298), reducing its expression. Such micro-RNA molecules can be silenced, i.e. blocked, by introducing a suitable antagomir, a small RNA molecule of a length of typically 20 to 25 nucleotides, directed against the micro-RNA, into the respective cell (Kriitzfeldt, J., et al., Nature (2005) 438, 685-689). Were desired, the expression of a homologous transcription factor, e.g. HNF- 6, can also be decreased, for instance where different heterologous HNF-6 is being expressed in a cell. Such reduction of the amount of homologous HNF-6 can for instance be achieved by means of a micro-RNA or small interfering RNA (siRNA) molecule directed against the transcription factor.
[0119] The use of small interfering RNAs, short hairpin and micro RNAs has become a tool to "knock down" specific genes. It makes use of gene silencing or gene suppression through RNA interference (RNAi), which occurs at the posttranscriptional level and involves mRNA degradation. RNA interference represents a cellular mechanism that protects the genome. SiRNA and miRNA molecules mediate the degradation of their complementary RNA by association of the siRNA with a multiple enzyme complex to form what is called the RNA-induced silencing Complex (RISC). The siRNA or miRNA becomes part of RISC and is targeted to the complementary RNA species which is then cleaved. siRNAs are perfectly base paired to the corresponding complementary strand, while miRNA duplexes are imperfectly paired. Activation of RISC leads to the loss of expression of the respective gene (for a brief overview see Zamore, PD, Haley, B Science [2005], 309, 1519-1524). It has been observed that the strongest silencing occurs with sequences that do not form secondary structures (Patzel, V., et al. Nature Biotech. [2005] 23, 1440-1444). Persons skilled in the art thus typically avoid using sequences that for instance are known to form a loop. This can be done by exchanging selected bases to a base that is still able to form a wobble pairing with the target sequence (Patzel, V et al., supra). The siRNA/miRNA technique has for example been applied to silencing parasitic DNA sequences, such as the cleavage of HIV RNA, as disclosed in US patent application 2005/0191618.
[0120] A respective siRNA/shRNA/miRNA molecule, as well as a corresponding antagomir (supra), may be directly synthesized or expressed within a cell of interest, for example by means of a vector under the control of an inducible or constitutive promoter. It may also be introduced into a respective cell and/or delivered thereto. One illustrative example of delivering a siRNA, shRNA or miRNA molecule into selected cells in vivo is its non-covalent binding to a fusion protein of a
heavy-chain antibody fragment (Fab) and the nucleic acid binding protein protamin (Song, E. et al., Nature Biotech. (2005), 23, 6, 709-717). Another illustrative example of delivering a siRNA molecule into selected cells in vivo is its encapsulation into a liposome. Morrissey et al. Nature Biotech. (2005), 23, 8, 1002-1007) for instance used a stable nucleic acid-lipid-particle, coated with a polyethylene glycol-lipid conjugate, to form liposomes for intravenous administration. Where it is desired to apply nanoparticles for delivering siRNA or miRNA, a suitable approach of their cell- specific targeting has been described by Weissleder et al. {Nature Biotech. (2005), 23, 11, 1418- 1423). Yet a further example of delivering a siRNA, shRNA or miRNA molecule to a selected target cell is the use of a biological vehicle such as a bacterium or a virus that includes the respective nucleic acid molecule. Xiang et al {Nature Biotech. (2006), 24, 6, 697-702) have for instance used this approach by administering the bacterium E. coli, which transcribed from a plasmid inter alia both shRNA and invasin, thus permitting entry into mammalian cells and subsequent gene silencing therein.
[0121] The term "promoter" as used herein, refers to a nucleic acid sequence needed for gene sequence expression. Promoter regions vary from organism to organism, but are well known to persons skilled in the art for different organisms. For example, in prokaryotes, the promoter region contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, and the CAAT sequence.
[0122] In a method of the invention a nucleic acid may be introduced into the multipotent cells by any suitable technique of nucleic acid delivery for transformation of a cell available in the art. Examples of suitable techniques include, but are not limited to, direct delivery of DNA, e.g. via trans fection, injection, including microinjection, electroporation, calcium phosphate precipitation, by using DEAE-dextran followed by polyethylene glycol, direct sonic loading, liposome mediated trans fection, receptor-mediated trans fection, microprojectile bombardment, agitation with silicon carbide fibers, Agrobacterium-mediated transformation, desiccation/inhibition-mediated DNA uptake or any combination thereof.
[0123] A method according to the invention may further include measuring the expression of a gene encoding the (heterologous) transcription factor. This can for instance be achieved by determining the number of RNA molecules transcribed from a gene that is under the control of the respective promoter. A method commonly used in the art is the subsequent copy of RNA to cDNA using reverse transcriptase and the coupling of the cDNA molecules to a fluorescent dye. The analysis may for example be performed in form of a DNA microarray. Numerous respective services and kits are commercially available, for instance GeneChip® expression arrays from Affymetrix. Other means of determining gene expression of a transcription factor include, but are not limited to,
an oligonucleotide array, and quantitative Real-time Polymerase Chain Reaction (RT-PCR).
[0124] In some embodiments it may be advantageous or desired to calibrate gene expression data or to rate them. Thus, in some embodiments a method according to the invention additionally includes the comparison of obtained results with those of one or more control measurements. Such a control measurement may include any condition that varies from the main measurement itself. It may include conditions of the method under which for example no expression of the respective gene occurs. A further means of a control measurement is the use of a mutated form of a respective gene, for example a gene not encoding the corresponding transcription factor, or encoding a nonfunctional transcription factor protein.
[0125] A method according to the invention may further include a selection or enrichment step for the cells of hepatocyte phenotype obtained by forward programming or differentiation as described above. To aid selection or enrichment, the adult multipotent cells employed in a method of the invention, such as the pluripotent stem cells or progeny cells thereof, may have a selectable or screenable reporter expression cassette with a reporter gene. By "expression cassette" is meant a combination of the respective gene, including a transcriptional termination sequence, and a suitable transcriptional promoter. In some embodiments the reporter expression cassette may include a hepatocyte-specific transcriptional regulatory element operably linked to a reporter gene. Non- limiting examples of hepatocyte-specific transcriptional regulatory element include a promoter of albumin, a 1 -antitrypsin (AAT), cytochrome p450 3A4 (CYP3A4), apolipoprotein A-I, or apoE. A mature hepatocyte-specific transcriptional regulatory element may include a promoter of albumin, a 1 -antitrypsin, asialoglycoprotein receptor, cytokeratin 8 (CK8), cytokeratin 18 (CK18), CYP3A4, fumaryl acetoacetate hydrolase (FAH), glucose-6-phosphates, tyrosine aminotransferase, phosphoenolpyruvate carboxykinase, and tryptophan 2,3-dioxygenase. Selection or enrichment of cells of hepatocyte phenotype may further include a step of determining whether the cell of interest expresses a hepatocyte reporter gene or one or more hepatocyte characteristics as described herein.
[0126] Characteristics of the cells of hepatocyte phenotype provided in certain aspects of the invention include, but are not limited to one or more of the expression of one or more hepatocyte markers (cf. above), the activity of liver-specific enzymes, the production of by-products of liver specific reactions such as bile and urea or bile secretion, or xenobiotic detoxification, morphological features characteristic of hepatocytes or in vivo liver engraftment in an immunodeficient subject. Two illustrative examples of a liver-specific enzyme, the activity of which may be determined, are glucose-6-phosphatase and CYP3A4. Hepatocyte markers that may be analysed include, but are not limited to, HNF-3p, HNF-4a, cytochrome p450 3 A4 (CYP3A4), cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6, Bile Salt Export Pump (BSEP), glucose-6- phosphatase (G6PC), fructose- 1 ,6-bisphosphatase (FBP1), glycogen synthase 2 (GYS2), farnesoid X receptor (FXR), arginase Type 1 (ARG1), albumin such as human serum albumin (ALB) or a
combination thereof. Further illustrative examples of suitable markers are a 1 -antitrypsin (AAT), cytokeratin 8 (CK8), cytokeratin 18 (CK18), asialoglycoprotein receptor (ASGR), alcohol dehydrogenase 1 and liver-specific organic anion transporter (LST-1). Fig. 2 illustrates the analysis of the expression of the hepatocyte markers HNF-Ια, HNF-3p, HNF-4a, HNF6, CYP3A4, BSEP, G6PC, FBP1, GYS2, FXR, ARG1, and ALB by way of RT-PCR with subsequent agarose gel electrophoresis. HNF6 expression could not be detected in samples where this transcription factor had not been heterologously introduced into the cell. The inventors for example observed that canalicular transporter BSEP was expressed in all cells following differentiation. G6PC showed weak expression in all cell samples. FBP1, a further gene encoding an enzyme of gluconeogenesis, was strongly expressed in differentiated cells transduced with HNF6. Likewise, expression of ARG1 could only be detected in cells transduced with HNF6 following differentiation.
[0127] A cell of hepatocyte phenotype as obtained according to the method described above may also be characterized on the basis of controllability of the enzyme activity of cytochrome p450. A cell of hepatocyte phenotype as obtained according to the method described above may also be characterized on the basis of controllability of the expression, and thereby typically the total amount in the cell, of one or more cytochrome p450 enzymes. In this regard a cell has an expression level and an enzymatic activity level of one or more cytochrome P450 enzymes that is controllable. The term "controllable" in this context is used as a synonym to "alterable" and means that a respective expression level or activity is capable of being controlled or capable of being altered. A large variety of compounds, typically low molecular weight compounds, are known in the art that can be used to alter, e.g. reduce or increase, the expression level or activity of different cytochrome P450 enzymes.
[0128] In more detail, it may be determined whether and to what extent the activity and/or the expression of cytochrome p450 in a cell of hepatocyte phenotype obtained as described herein can be induced or inhibited by certain known active compounds. To this effect, the induction of Cytochrome p450 (CYPp450) mRNA by a known CYPp450 inducer may be assessed. Suitable inducers in this regard include, but are not limited to, omeprazole, which induces Cytochrome P450 1A2 and rifampicin, which induces cytochrome P450 2C9, Cytochrome P450 2D6 and CYP3A4. Further examples of inducers of cytochrome p450 mRNA include, but are not limited to, nicotine, phenobarbital, and primidone. Levels of RNA in a cell of interest may be determined using standard techniques well established in the art. Two further examples of a suitable compound that causes an increase in formation of mRNA for cytochrome P450 2C9 are glutethimide and the glucocorticoid dexamethasone.
[0129] Cytochrome P450 2C9 (CYP2C9), also known as (R)-limonene 6-monooxygenase or S-mephenytoin 4-hydroxylase, is located within the cell, namely in the endoplasmic reticulum membrane. The protein may be the human protein of the Swissprot/ Uniprot accession number PI 1712 (version 156 as of 29 May 2013). Cytochrome P450 2C9 may also be the human protein of
the Swissprot/ Uniprot accession number Q6IRV8 (version 58 as of 03 April 2013). Cytochrome P450 2C9 may also be a protein that contains the fragment of the Swissprot/Uniprot accession number Q5EDC5 (version 36 as of 03 April 2013), or a human protein that contains the fragment of the Swissprot/Uniprot accession number Q9UEH3 (version 61 as of 29 May 2013).
[0130] Cytochrome P450 2D6 (CYP2D6), also known as debrisoquine 4-hydroxylase, is likewise located in the endoplasmic reticulum membrane. Cytochrome P450 2D6 is in some embodiments the human protein of the Swissprot/Uniprot accession number PI 0635 (version 150 as of 29 May 2013). In some embodiments cytochrome P450 2D6 is the human protein of Swissprot/Uniprot accession number PI 0635 (version 150 as of 29 May 2013), an isozyme also named Cytochrome P450-DB1. Cytochrome P450 2C9 may also be the human protein of the Swissprot/Uniprot accession number Q38LG0 (version 58 as of 03 April 2013), or the human variant of Swissprot/Uniprot accession number Q2XND2 (version 57 as of 03 April 2013). Cytochrome P450 2D6 is in some embodiments the human protein of Swissprot/Uniprot accession number Q3KPF3 (version 54 as of 29 May 2013), or the human protein of Swissprot/Uniprot accession number Q6NWU0 (version 97 as of 29 May 2013). Cytochrome P450 2D6 may also be the human protein of the Swissprot/Uniprot accession number E7ENE7 (version 17 as of 03 April 2013), or a human protein that contains the fragment of the Swissprot/Uniprot accession number H7BY38 (version 09 as of 03 April 2013). In some embodiments cytochrome P450 2D6 is the human protein of Swissprot/Uniprot accession number Q2XND3 (version 57 as of 03 April 2013), or the human protein of Swissprot/Uniprot accession number C1ID54 (version 26 as of 03 April 2013). In some embodiments cytochrome P450 2D6 is the human protein of Swissprot/Uniprot accession number D5KMS0 (version 18 as of 03 April 2013), or the human protein of Swissprot/Uniprot accession number Q2XND0 (version 53 as of 29 May 2013). In some embodiments cytochrome P450 2D6 is the porcine protein of Swissprot/Uniprot accession number Q1HLQ9 (version 29 as of 29 May 2013). In some embodiments cytochrome P450 2D6 is the porcine protein of Swissprot/Uniprot accession number Q1HLR0 (version 29 as of 03 April 2013). Cytochrome P450 2D6 is in some embodiments the cat protein of Swissprot/Uniprot accession number E0D568 (version 16 as of 29 May 2013), or the cat protein of Swissprot/Uniprot accession number M3X978 (version 2 as of 29 May 2013).
[0131] Cytochrome P450 1A2 (CYP1A2) is also located in the endoplasmic reticulum membrane. Cytochrome P450 1A2 is in some embodiments the human protein of the Swissprot/Uniprot accession number P05177 (version 144 as of 29 May 2013), or the human protein of the Swissprot/Uniprot accession number Q6NWU3 (version 66 as of 29 May 2013). In some embodiments cytochrome P450 1A2 is the rat protein of the Swissprot/Uniprot accession number P04799 (version 121 as of 29 May 2013), or the rat protein of the Swissprot/Uniprot accession number D3ZF33 (version 26 as of 29 May 2013). Cytochrome P450 1A2 may also be the mouse
protein of the Swissprot/Uniprot accession number POO 186 (version 127 as of 29 May 2013), or the mouse protein of the Swissprot/Uniprot accession number B6VGH4 (version 36 as of 29 May 2013). In some embodiments cytochrome P450 1A2 is the bovine protein of the Swissprot/Uniprot accession number A6H748 (version 41 as of 29 May 2013). Cytochrome P450 1A2 is in some embodiments the guinea pig protein of the Swissprot/Uniprot accession number Q64391 (version 91 as of 03 April 2013). In some embodiments cytochrome P450 1A2 is the rabbit protein of the Swissprot/Uniprot accession number G1SYH2 (version 11 as of 03 April 2013).
[0132] Omeprazole, (RS)-5-methoxy-2-((4-methoxy-3,5-dimethylpyridin-2-yl) methylsu- lfinyl)-lH-benzo[d]imidazole, available under the trade name Prilosec from AstraZeneca, induces the formation of mRNA encoding Cytochrome P450 1A2. Generally, in a cell of hepatocyte phenotype obtained as described above, a concentration of omeprazole in the range from about 1 μΜ to about 50 μΜ will give rise to an increase of mRNA levels for Cytochrome P450 1A2 by about 2.5 to 60-fold, when compared to cells not exposed to omeprazole. In some embodiments a respective concentration of omeprazole will induce an increase of mRNA levels for Cytochrome P450 1A2 by about 5 to about 60-fold in comparison to cells not exposed to omeprazole. As a further example, nicotine, phenobarbital, primidone, and rifampicin cause an increase in mRNA levels for cytochrome P450 1A2 by about 2-fold or more in a cell of hepatocyte phenotype obtained as described herein, when compared to a cell not exposed to nicotine, phenobarbital, primidone, and rifampicin, respectively. Further examples of compounds that cause an increase in mRNA levels for cytochrome P450 1A2 include, but are not limited to, β-naphthoflavone, cholanthrene and modafinil.Yet further examples of compounds that effect, in a cell of hepatocyte phenotype obtained as disclosed above, an increase in mRNA levels for cytochrome P450 1A2 by about 2-fold or more, are methylcholanthrene, modafinil, nafcillin, and beta-Naphthoflavone.
[0133] Rifampicin, also known as rifaldazine, R/AMP, rifampin, and rofact, is an antibiotic of the IUPAC name 7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-2,15,17,27,29- pentahydroxy- 11 -methoxy-3 ,7,12,14,16, 18,22-heptamethyl-26- {(E)-[(4-methylpiperazin- 1 - yl)imino]methyl}-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta- l(28),2,4,9,19,21,25(29),26-octaen-13-yl acetate. After exposure to rifampicin, a cell of hepatocyte phenotype obtained as described above, will show an increase in cytochrome P450 2C9 mRNA formation in the range from about 2- to about 5-fold, at a concentration of rifampicin from about 1 μΜ to about 20 μΜ, when compared to a corresponding cell not exposed to rifampicin. In some embodiments a respective concentration of rifampicin will effect an increase of mRNA levels for Cytochrome P450 2C9 by about 2.5- to about 4-fold in comparison to cells not exposed to omeprazole. A further example of a compound that effects an increase in mRNA levels for cytochrome P450 2C9by about 2-fold or more in a cell of hepatocyte phenotype obtained as described above, is secobarbital. The skilled artisan will be aware of the fact that secobarbital also
acts as an inhibitor of cytochrome P450 2B1, the activity of which is being reduced, thought to be at least in part due to alkylation of the enzyme's heme group.
[0134] After exposure to rifampicin, a cell of hepatocyte phenotype obtained as described above, will - after having been exposed to rifampicin at a concentration from about 1 μΜ to about 20 μΜ - show an increase in formation of mRNA for cytochrome p450 3A4 in the range from about 20 to about 60-fold, when compared to a corresponding cell not exposed to rifampicin. In some embodiments a respective concentration of rifampicin will induce an increase of mRNA levels for Cytochrome p450 3A4 by about 30- to about 60-fold in comparison to cells not exposed to rifampicin. A further illustrative example of a suitable inducer of cytochrome p450 3A4 is rifabutin. In a cell of hepatocyte phenotype obtained as disclosed herein formation of mRNA for cytochrome p450 3A4 will increase by twofold or more if the cell has been exposed to rifabutin, compared to a respective cell of hepatocyte phenotype that has not been exposed to rifabutin. As a further example, a glucocorticoid will effect an increase in formation of mRNA for cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype obtained as described above, when compared to a cell not exposed to the respective glucocorticoid.
[0135] As yet a further example, a barbiturate such as phenobarbital will effect an increase in formation of mRNA for cytochrome p450 3A4 by about twofold or more in a cell of hepatocyte phenotype obtained as disclosed herein, in comparison to a cell not exposed to the respective barbiturate. As further examples, exposure of a cell of hepatocyte phenotype obtained as described above, to one or more of carbamazepine, phenytoin, and oxcarbazepine leads to an increase in mRNA for cytochrome p450 3A4 by a factor of two or more, when compared to a respective cell of hepatocyte phenotype not exposed to carbamazepine, phenytoin, and/or oxcarbazepine, respectively. Another example of a compound that effects an increase in formation of mRNA for cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype as described herein is propofol. Pioglitazone, and troglitazone are yet two further examples of compounds that induce mRNA formation for cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype as described above, compared to a respective cell not exposed to pioglitazone and troglitazone, respectively.
[0136] To detect induction of mRNA levels of a cytochrome P450 enzyme, standard techniques employed in the art can be used. Such techniques may include the amplification of mRNA and/or the hybridization to probes capable of hybridizing to mRNA of the respective sequence encoding the cytochrome P450 enzyme of interest. In an exemplary measurement of induction of mRNA of a cytochrome P450 enzyme, cells of hepatocyte phenotype are cultured and the inducer, for instance one of the examples above, is added to the cell culture medium. The cell culture medium containing the inducer is being exchanged every 24 hours. mRNA of the respective cytochrome P450 enzyme may then be measured after a period of 48 hours and after 72 hours of
exposing the cells of hepatocyte phenotype to the respective inducer. Omeprazole generally induces Cytochrome P450 1A2 enzyme activity in a cell of hepatocyte phenotype obtained as described above. In a respective cell, a concentration of omeprazole of about 50 μΜ will give rise to an increase of enzyme activity of Cytochrome P450 1A2 by about 2 to about 40-fold, when compared to cells not exposed to omeprazole. As a further example, nicotine, phenobarbital, primidone, and rifampicin cause an increase in catalytic activity of cytochrome P450 1A2 by about 2-fold or more in a cell of hepatocyte phenotype obtained as described herein, when compared to a cell not exposed to nicotine, phenobarbital, primidone, and rifampicin, respectively.
[0137] In another example rifampicin induces Cytochrome P450 2C9 enzyme activity in a cell of hepatocyte phenotype obtained as described above. Rifampicin will give an increase in cytochrome P450 2C9 catalytic activity in the range from about 4 to about 20-fold, at a concentration of rifampicin from about 10 μΜ to about 50 μΜ, when compared to CYP2C9 activity of a corresponding cell not exposed to rifampicin. In some embodiments a respective concentration of rifampicin will effect an increase of enzyme activity of Cytochrome P450 2C9 by about 2- to about 15-fold in comparison to cells not exposed to rifampicin. A further example of a compound that effects an increase catalytic activity of cytochrome P450 1A2 by about 2-fold or more in a cell of hepatocyte phenotype obtained as described above, is secobarbital.
[0138] After exposure to rifampicin, a cell of hepatocyte phenotype obtained as described above, will - after having been exposed to rifampicin at a concentration from about 10 μΜ to about 50 μΜ - show an increase in activity of cytochrome p450 3A4 enzyme in the range from about 4- to about 8-fold, when compared to a corresponding cell not exposed to rifampicin. In some embodiments a respective concentration of rifampicin will induce an increase activity levels for Cytochrome p450 3A4 by about 2- to about 15-fold in comparison to those in cells not exposed to rifampicin. A further example of a suitable inducer of cytochrome p450 3A4 is rifabutin. In a cell of hepatocyte phenotype obtained as disclosed herein catalytic cytochrome p450 3A4 activity will increase by twofold or more if the cell has been exposed to rifabutin, compared to a respective cell of hepatocyte phenotype that has not been exposed to rifabutin. As a further example, a glucocorticoid will effect an increase in activity of cytochrome p450 3A4 enzyme by twofold or more in a cell of hepatocyte phenotype obtained as described above, when compared to a cell not exposed to the respective glucocorticoid.
[0139] As yet a further example, a barbiturate such as phenobarbital will effect an increase in catalytic activity of cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype obtained as disclosed herein, in comparison to a cell not exposed to the respective barbiturate. As further examples, exposure of a cell of hepatocyte phenotype obtained as described above, to one or more of carbamazepine, phenytoin, and oxcarbazepine leads to an increase in activity of cytochrome p450 3A4 enzyme by a factor of two or more, when compared to a respective cell of hepatocyte
phenotype not exposed to carbamazepine, phenytoin, and/or oxcarbazepine, respectively. Another example of a compound that effects an increase in cytochrome p450 3A4 activity by twofold or more in a cell of hepatocyte phenotype as described herein is propofol. Pioglitazone, and troglitazone are yet two further examples of compounds that induce enzyme activity of cytochrome p450 3A4 by twofold or more in a cell of hepatocyte phenotype as described above, compared to a respective cell not exposed to pioglitazone and troglitazone, respectively.
[0140] As a further example, nicotine, omeprazole, phenobarbital, primidone, and rifampicin cause an increase in cytochrome P450 1A2 activity by about 2-fold or more in a cell of hepatocyte phenotype obtained as described herein, when compared to a cell not exposed to nicotine, omeprazole, phenobarbital, primidone, and rifampicin, respectively. Yet further examples of compounds that effect, in a cell of hepatocyte phenotype obtained as disclosed above, an increase in catalytic activity for cytochrome P450 1A2 by about 2-fold or more, are methylcholanthrene, modafinil, nafcillin, and beta-Naphthoflavone.
[0141] In order to detect an induction of catalytic activity of a cytochrome P450 enzyme, standard techniques employed in the art can be used. Such techniques may include the measurement of metabolites from cytochrome P450 enzyme reactions by High Performance Liquid Chromatography (HPLC) or Liquid Chromatography-Mass Spectrometry (LC-MS). An illustrative example of a substrate of cytochrome P450 1A2, which may accordingly be used in measuring cytochrome P450 1A2 enzyme reactions, is Phenacetin. Phenacetin is metabolized by CYP1A2 to Acetaminophen. Another example of a substrate for cytochrome P450 2C9 enzyme activity is Diclofenac, which is metabolized to 4-hydroxy Diclofenac. Yet another example of a substrate for cytochrome P450 2D6 is Dextromethorphan, which is metabolized by CYP2D6 to Dextrorphan. A further example of a substrate of a cytochrome P450 3A4 enzyme reaction is Testosterone, which is metabolized by CYP3A4 to 6 -hydroxytestosterone. In an exemplary measurement of induction of a cytochrome P450 enzyme activity, cells of hepatocyte phenotype are cultured and the inducer, for instance one of the examples above, is added to the cell culture medium. The cell culture medium containing the inducer is being exchanged every 24 hours. Prior to measurement cell culture medium containing the inducer is exchanged to cell culture medium containing a substrate of cytochrome P450. After exposing the cells for 1 to 4 hours to the cell culture medium containing the inducer, substrate turnover by the respective cytochrome P450 enzyme may be measured by detecting the formation of metabolites in the culture medium of cells of hepatocyte phenotype. Further illustrative compounds that may be used as a substrate for a cytochrome P450 enzyme are named below.
[0142] Characterizing a cell of hepatocyte phenotype, obtained as described above, may also include measuring the inhibition of Cytochrome p450 activity by a known CYPp450 inhibitor. Suitable inhibitors in this regard include protease inhibitors such as ritonavir, indinavir, nelfinavir,
saquinavir, which inhibit formation Cytochrome P450 3A4.
[0143] After exposure to an antibiotic such as clarithromycin, telithromycin, or chloramphenicol, a cell of hepatocyte phenotype obtained as described above, will show a reduced enzymatic activity of cytochrome P450 3A4, typically a decrease in activity to half or less of the activity of a cell of hepatocyte phenotype not exposed to clarithromycin, telithromycin, or chloramphenicol. Some azole antifungal compounds such as ketoconazole or itraconazole also cause a decrease of cytochrome P450 3A4 activity. Yet a further example is nefazodone. After exposure to nefazodone, a cell of hepatocyte phenotype obtained as described herein, will show a reduction in activity of cytochrome P450 2C9.
[0144] Further examples of suitable compounds that cause an inhibition of enzymatic activity of cytochrome P450 3A4 include, but are not limited to, aprepitant, verapamil, diltiazem, erythromycin, fluvoxamine, fluconazole, bergamottin and Valerian.
[0145] Examples of compounds that cause a decrease in cytochrome P450 1A2 enzymatic activity to about half or less in a cell of hepatocyte phenotype obtained as described herein - when compared to a cell not exposed to the respective compound - are, fluvoxamine, ciprofloxacin, and verapamil. Compounds that inhibit P450 2C9 enzymatic activity include, but are not limited to, fluconazole, miconazole, amentoflavone, sulfaphenazole, fluvoxamine, and Valproic acid. After exposure to one or more of fluconazole, miconazole, amentoflavone, sulfaphenazole, fluvoxaminem and Valproic acid, a cell of hepatocyte phenotype obtained as described above, will show a reduction in cytochrome P450 2C9 enzymatic activity.
[0146] After exposure to one or more of fluoxetine, paroxetine, bupropion, quinidine, cinacalcet and ritonavir, a cell of hepatocyte phenotype obtained as described above, will show an decrease in enzymatic activity of cytochrome p450 2D6 to about half or less, when compared to a corresponding cell not exposed to the respective compound(s).
[0147] To detect reduction of enzymatic activity of a cytochrome P450 enzyme, one may proceed as described above for detecting an increase of enzymatic activity. Cells of hepatocyte phenotype may be cultured and the inhibitor, for instance one of the examples above, may be added to the cell culture medium. The cell culture medium containing the inhibitor The cell culture medium containing the inhibitor in a concentration from about 0.1 to about 10 μΜ may be contacted to the cells for 0.5 to 5 hours. Before measurements cell culture medium containing the inhibitor is exchanged to cell culture medium containing a substrate of cytochrome P450 enzyme as described above. After incubation for 1 to 4 hours substrate turnover by respective cytochrome P450 enzyme may then be measured by detection of metabolites in culture medium of cells of hepatocyte phenotype.
[0148] The skilled artisan is aware of the fact that the amount of reduction in enzymatic activity depends on a variety of factors, such as the compound used as an inhibitor, the substrate
used for detecting enzymatic activity, the concentration of the compound, the time period of exposing the respective cell to the compound that inhibits enzymatic activity of a cytochrome P450 enzyme, as well as other conditions selected. A large variety of suitable substrates for different cytochrome P450 enzymes are known in the art. As a few illustrative example of substrates of cytochrome P450 1A2, amitriptyline, caffeine, clomipramine, clozapine, cyclobenzaprine, estradiol, fluvoxamine, haloperidol, mexiletine, naproxen, ondansetron, propranolol, riluzole, ropivacaine, tacrine, theophylline, verapamil, and zolmitriptan are named. Examples of substrates of cytochrome P450 3A4 include, but are not limited to, cyclosporine, tacrolimus, sirolimus, docetaxel, tamoxifen, paclitaxel, cyclophosphamide, doxorubicin, erlotinib, etoposide, ifosfamide, teniposide, vinblastine, vincristine, vindesine, imatinib, irinotecan, vemurafenib, temsirolimus, anastrazole, gefitinib, ketoconazole, clarithromycin, erythromycin, telithromycin, amitriptyline, clomipramine, imipramine, norfluoxetine, sertraline, mirtazapine, nefazodone, reboxetine, venlafaxine, trazodone, buspirone, haloperidol, aripiprazole, risperidone, ziprasidone, pimozide, quetiapine, alfentanil, buprenorphine, Zolpidem, donepezil, atorvastatin, simvastatin, diltiazem, felodipine, nifedipine, indinavir, ritonavir, and lidocaine. Examples of substrates of cytochrome P450 2C9 include, but are not limited to, celecoxib, lornoxicam, diclofenac, ibuprofen, naproxen, piroxicam, meloxicam, suprofen, tolbutamide, glipizide, losartan, irbesartan, phenytoin, fluvastatin, glipizide, glibenclamide, glimepiride, tolbutamide, glyburide, S-warfarin, sildenafil, terbinafine, amitriptyline, fluoxetine, nateglinide, rosiglitazone, tamoxifen, torasemide, and ketamine. Examples of substrates of cytochrome P450 2D6 include, but are not limited to, carvedilol, S-metoprolol, propafenone, timolol, amitriptyline, clomipramine, desipramine, imipramine, paroxetine, haloperidol, perphenazine, risperidone, alprenolol, amphetamine, bufuralol, chlorpheniramine, codeine, debrisoquine, dexfenfluramine, dextromethorphan, encainide, flecainide, fluoxetine, fluvoxamine, lidocaine, metoclopramide, methoxyamphetamine, mexiletine, nortriptyline, minaprine, ondansetron, perhexiline, phenacetin, phenformin, propranolol, quanoxan, sparteine, tamoxifen, tramadol, and venlafaxine.
[0149] In a method of testing a compound for its hepatic effect one or more cells of hepatocyte phenotype obtained as described above are brought in contact with the compound of interest. A respective method may include adding the respective compound, typically a predetermined quantity thereof, to the cells of hepatocyte phenotype. In a typical embodiment the compound of interest is dissolved in a fluid, typically a liquid, which is then being added to the medium that encompasses the cells of hepatocyte phenotype.
[0150] In some embodiments a method according to the present invention includes contacting a cell of hepatocyte phenotype with a predetermined quantity of a compound of interest. In some embodiments at least two different predetermined quantities of a compound of interest are used. In some of these embodiments at least a first and a second cell of hepatocyte phenotype are
used. The first cell is contacted with the lower of the two predetermined quantities and the second cell is contacted with the higher of the two predetermined quantities. Respective embodiments may for example be a screening assay, a cytotoxity test or the determination of a dose/response curve.
[0151] Any desired matter may be tested for its effect on hepatic cells based on the use of cells obtained as described above. In some embodiments the matter may include or be a low molecular weight compound, such as a pharmaceutically active compound. In some embodiments the matter may be a nutrient, a saccharide, an oligosaccharide, a polysaccharide, a vitamin, a nucleotide, an oligonucleotide, a polynucleotide or a combination of any of these examples. The matter may be tested may be any sample, such as, but not limited to, a soil sample, an air sample, an environmental sample, a cell culture sample, a bone marrow sample, a rainfall sample, a fallout sample, a sewage sample, a ground water sample, an abrasion sample, an archaeological sample, a food sample, an infection sample, a nosocomial infection sample, a production sample, a drug preparation sample, a biological molecule production sample, a protein preparation sample, a lipid preparation sample, a carbohydrate preparation sample, a space sample, an extraterrestrial sample or any combination thereof. The sample may furthermore have been prepared in form of a fluid, such as a solution. Examples include, but are not limited to, a solution or a slurry of a nucleotide, a polynucleotide, a nucleic acid, a peptide, a polypeptide, an amino acid, a protein, a synthetic polymer, a biochemical composition, an organic chemical composition, an inorganic chemical composition, a metal, a lipid, a carbohydrate, a combinatory chemistry product, a drug candidate molecule, a drug molecule, a drug metabolite or of any combinations thereof. Further examples include, but are not limited to, a suspension of a metal, a suspension of metal alloy, and a solution of a metal ion or any combination thereof, as well as a suspension of a cell, a virus, a microorganism, a pathogen, a radioactive compound or of any combinations thereof. It is understood that a sample may furthermore include any combination of the aforementioned examples.
[0152] For some embodiments of a method of testing matter for its effect on hepatic cells, compounds may be used in the form of a library. Examples of such libraries are collections of various small organic molecules, chemically synthesized as model compounds, or nucleic acid molecules containing a large number of sequence variants.
[0153] In embodiments where a plurality of candidate compounds are analysed for their hepatic effect according to a method of the present invention such an embodiment may typically called a screening process. These candidate compounds may be analysed independent from each other, e.g. concurrently, consecutively or in any way out of phase. The candidate compounds may for example be added to a cell culture medium. In some embodiments any number of steps of analysing a plurality of candidate compounds may for example be carried out automatically - also repeatedly, using for instance commercially available robots. For such purposes any number of automation devices may be employed, for instance an automated read-out system, a pipetting robot,
a rinsing robot, or a fully automated screening system. As an illustrative example, the process may be an in-vitro screening process, for example carried out in multiple-well microplates (e.g. conventional 48-, 96-, 384- or 1536 well plates) using one or more automated work stations. Hence, in some embodiments the invention provides a process of high-throughput screening. The method may also be carried out using a kit of parts, for instance designed for performing the present method.
[0154] In embodiments of a method of the invention where the effect of matter on the liver in an organism, e.g. a compound, of interest is tested, cells of hepatocyte phenotype of a corresponding species are provided according to the invention as described above. The cells of hepatocyte phenotype are contacted with the matter of interest. The cells are then incubated with the matter of interest, i.e. the contact of the cells with the matter is maintained. Testing the effect of matter on the liver, i.e. the hepatic effect, generally further includes assessing the viability and/or functionality of the cells of hepatocyte phenotype. In some embodiments the effect of matter may be monitored over a certain period of time, such as over a period from about 1 hour to about a week, e.g. 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days or 6 days. The functionality of the cells of hepatocyte phenotype may be assessed by measuring any hepatocyte characteristic function, such as of the above illustrated functions.
[0155] The viability of the cells may be assessed by any suitable technique. In some embodiments microscopic analysis may be carried out, for example by determining the cellular morphology. Microscopic analysis may for example include determining the presence of signs selected from the group consisting of cellular stress, factor toxicity, cellular viability, and cellular death. The level of one or more metabolites indicative of cell viability may also be assessed in this regard. Two illustrative examples of a metabolite the intracellular level of which may be determined are urea or ammonia. Three illustrative examples of a protein the expression of which may be determined are liver albumin, beta galactosidase, and cytochrome P450.
[0156] In some embodiments of a method in accordance with the invention it is analysed whether apoptosis occurs, including is being initiated are progresses, in one or more cells of hepatocyte phenotype following contact with the compound of interest. Apoptosis is a programmed cell death and typically a mechanism in a multicellular organism to remove undesired cells. An apoptotic cell shows a characteristic morphology, by which it can be identified under a microscope. The occurrence and/or progress of apoptosis in a tumour cell may be monitored, for example by propodium iodide staining, Annexin V-FITC staining, flow cytometry analysis, or combinations thereof, as well as by determining mitochondrial dysfunction or caspase 3 activation.
[0157] Testing the hepatic effect may include contacting the cells of hepatocyte phenotype with one or more selected test compounds. In some embodiments such a method may further include determining whether metabolites of the test compounds or of other compounds, whether heterologously applied or homologously present.are formed. The formed metabolites, including the
amount of formed metabolites and the pattern of metabolites generated, may then be compared to a reference experiment. A reference experiment may include cells that have not been contacted with the selected test compound(s) but have been contacted with test compound carrier substances. In some embodiments testing the hepatic effect includes determining the formation, in particular determining functional characteristics of the formation, of serum albumin, of fibrinogen, and at least one of the prothrombin group of clotting factors. Testing the hepatic effect may also include determining the formation and secretion, in particular determining functional characteristics of the formation and secretion of bile, lipoprotein, transferrin or complement proteins. Testing the hepatic effect may also include determining whether the cells synthesize, in particular determining functional characteristics of the synthesis of, glycoprotein or urea.As indicated above, testing the hepatic effect may include analysis of the metabolization of homologous and/or heterologous compounds.
[0158] The metabolization of homologous and/or heterologous compounds in hepatocyets and hepatocyte-like cells is carried out by so called drug-metabolizing enzymes, enzymes that catalyze the biotransformation of for instance drugs and xenobiotics. In some embodiments testing the hepatic effect may include determining test compound induction or inhibition of drug metabolizing phase I and phase II proteins or transporter and receptor proteins. In this regard drug- metabolizing enzymes can be classified into two main groups: oxidative or conjugative.
[0159] Phase I reactions, also termed nonsynthetic reactions, include, but are not limited to, oxidation, reduction, hydrolysis, cyclization and decyclization, addition of oxygen or removal of hydrogen. The reactions are carried out by mixed function oxidases. A typical reaction in a Phase I oxidation involves conversion of a C-H bond to a C-OH. A well known example of an oxidative group of enzymes that mediate phase I reactions are the NADPH-cytochrome P450 reductase (P450R)/cytochrome P450 (P450) electron transfer systems. Conjugation reactions are known as phase II reactions and are usually detoxicating in nature, typically involving the interactions of the polar functional groups of phase I metabolites. Conjugation may for instance occur with glucuronic acid, a sulfonate, glutathione, acetate or an amino acid. A well known example of an oxidative group of conjugative enzymes that mediate phase II reactions are the UDP-glucuronosyltransferases.
[0160] In some embodiments testing the hepatic effect of a compound of interest includes analysing whether phase I and/or phase II proteins of the cell can be induced or inhibited. Such induction or reduction of activity and or amount of enzymes in hepatocytes is well known in the art. As an illustrative example, the expression of CYP 1 genes can be induced via the aryl hydrocarbon receptor (AhR) which dimerizes with the AhR nuclear translocator, in response to many polycyclic aromatic hydrocarbon (PAHs). Xenobiotics such as phenobarbital-like compounds (CAR), dexamethasone and rifampin-type of compounds (PXR) are known to cause the steroid family of orphan receptors, the constitutive androstane receptor (CAR) and pregnane X receptors (PXR) to
heterodimenze with the retinoid X receptor (RXR) and transcriptionally activate the promoters of CYP2B and CYP3A gene expression. For the phase II drug-metabolizing enzymes, known phase II gene inducers include, but are not limited to, butylated hydroxyanisol (BHA), tertbutylhydroquinone (tBHQ), green tea polyphenol (GTP), (-)-epicatechin-3-gallate (EGCG) and the isothiocyanates (PEITC, sulforaphane). These compounds can activate the mitogen-activated protein kinase (MAPK) pathway via electrophilic-mediated stress response, resulting in the activation of bZIP transcription factor Nrf2 which dimerizes with Mafs and binds to the antioxidant / electrophile response element (ARE / EpRE) enhancers that are found in many phase II drug-metabolizing enzymes as well as many cellular defensive enzymes such as thioredoxins, GCS and HO-1, with the subsequent induction of gene expression of these genes.
[0161] In some embodiments of a method of the invention, for example where candidate compounds are analysed for their hepatic effect, cells of hepatocyte phenotype are cultured in co- culture with at least one of endothelial cells, Kupffer cells, hepatic stellate cells, cholangiocytes and fibroblasts.
[0162] The invention also provides a method of identifying a hepatic pathogen. The term
"hepatic pathogen" as used herein refers to any pathogen, such as a bacterial, viral or parasitic pathogen, that is capable of infecting cells of the liver, in particular hepatocytes.
[0163] The invention also provides a method of treating a subject in need of an increase in liver function. The method includes administering to the subject cells of hepatocyte phenotype obtained as described above. Thereby liver function is increased. In such embodiments cells may be grown two-dimensionally, e.g. in a monolayer, or three-dimensionally, for example in the extracellular matrix.
[0164] Cells of hepatocyte phenotype obtained as described above may also be used for applications in spheroid and/or organoid cultures and synthetic scaffolds or bioartificial liver devices. The cells of hepatocyte phenotype may be used for therapeutic applications of at least one of viral or toxin mediated hepatitis, heredity diseases such as Wilson's disease, heamatochromatosis or alpha- 1 antitrypsin deficiency, and liver cirrhosis or liver cancer. In some embodiments, for such therapeutic applications the cells of hepatocyte phenotype are cultured in co-culture with endothelial cells, with Kupffer cells, hepatic stellate cells, cholangiocytes and/or fibroblasts (supra).
[0165] The listing or discussion of a previously published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.
[0166] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including," containing", etc. shall be read expansively and without limitation. Singular forms such as "a", "an" or "the" include plural references unless the
context clearly indicates otherwise. Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. The terms "at least one" and "at least one of include for example, one, two, three, four, or five or more elements. Slight variations above and below the stated ranges can be used to achieve substantially the same results as values within the ranges. Also, unless indicated otherwise, the disclosure of the ranges is intended as a continuous range including every value between the minimum and maximum values.
[0167] Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0168] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0169] Other embodiments are within the appending claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0170] In order that the invention may be readily understood and put into practical effect, the invention is further illustrated by the following non limiting examples and the appended figures. As one of ordinary skill in the art will readily appreciate from the disclosure of the present invention, other compositions of matter, means, uses, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding exemplary embodiments described herein may likewise be utilized according to the present invention.
EXAMPLES
Culture of primary Hepatocytes
[0171] Primary hepatocytes were obtained from PRIMACYT Cell Culture Technology (Schwerin, Germany). After receipt the culture media was replaced by HCM medium and cells
incubated at 5 % CO2 and 37 °C. The media was replaced every 24 hours. Supernatant samples of media were collected and stored at -80 °C. Cytochrome p 450 3A4 activity was determined after maximally 4 days of culture.
Generation and expansion of USSC
[0172] Cord blood not suitable for clinical banking was, from a plurality of donors, applied for stromal stem cell generation in accordance with informed donor consent. Isolation of mononuclear cells (MNC), selective culture of MNC for USSC-generation and USSC-expansion were performed as described previously [Kogler, G., et al., J Exp Med (2004) 200, 2, 123-135].
[0173] The identity of stem cells from cord blood was ensured on the basis of the immunophenotype. The multipotent character of USSC was verified by using the absence of the markers OCT4a, NANOG and SOX2.
Molecular cloning and lentiviral transduction of USSC
[0174] Sequences coding for human hepatocytes nuclear factor la (HNFla), forkhead box A2 (FOXA2), hepatocytes nuclear factor 4a (HNF4a) and hepatocytes nuclear factor 6 (HNF6) were generated by PCR amplification of hepatocyte cDNA. Primers containing specific restriction sites were used to allow cloning of cDNA into the multiple cloning site of pUC2CL6IN-plasmid. Each forward-primer contained a kozak consensus sequence (GCCACC). HNFla and FTNF4a cDNAs were inserted into ECORI and BAMHI restriction sites of pUC2CL6IN (Primer 5'- 3': HNF la-forward: AAAGAATTCGCCACCATGGTTTCTAAAC TGAGCCAG (SEQ ID NO: 31), HNF la-reverse: TTTGGATCCGGTTACTGGGAGGA AGAGG (SEQ ID NO: 32); FOXA2- forward: AAAGCTAGCGCCACCATGCTGGGAG CGGTGAAG (SEQ ID NO: 33), FOXA2- reverse: AAAGG ATCCTTTCTTCTCCCTTGCGT CTC (SEQ ID NO: 34); HNF4a-forward: AAAGAATTCGCCACCATGCGACTCTCCAAA ACCCT (SEQ ID NO: 35), HNF4a-reverse: TTTGGATCCCCCCAAGCCCCAGCGGCTTG (SEQ ID NO: 36); HNF6-forward: AAACTCGAGGCCACCATGAACGCGCAGCTGACC AT (SEQ ID NO: 37), HNF6-reverse: TTTGCTAGCGTGGTTCTTCCTTCATGCTT, SEQ ID NO: 38). FOXA2 was inserted into NHEI and BAMHI restriction sites of pUC2CL6IN. HNF6 was inserted into XHOI and BAMHI restriction sites of pUC2CL6IN. After construction, plasmids were combined with packaging plasmid pCD/NLBH and envelope plasmid pALF-GALV and integrated by FUGENE-transfection (Roche, Mannheim, Germany) into Hek293T cells for lentiviral production. After 24 hrs, supernatants containing lentiviruses were collected and passed through a 45 μηι syringe- filter (Fischer Scientific, Schwerte, Germany). Filtered and 1 :4 diluted supernatants were used for infection of 3.5Λ103 USSC per cm2. After 24 hrs, medium was changed and the cells were cultured in USSC expansion medium. To enrich transfected USSC, a neomycin-resistance cassette within pUC2CL6IN was used by addition of Geneticin sulfate (G418) (PAA, C51be, Germany) into culture media. In order to
determine transduction efficiencies, USSC were transduced with the vector pCL6IEGwo containing eGFP transgene controlled by a SFFV promoter. Transduction was accomplished as described above for constructed pUC2CL6IN-plasmids. The amounts of transduced cells were determined 5 days after lentiviral transduction by flow cytometric analysis.
Differentiation of transduced USSC
[0175] For hepatic differentiation of transduced USSC, 5Λ103 cells were plated per cm2 and cultured in expansion medium supplemented with 400 μg/ml G418. After reaching 70% confluence, cells were cultured in differentiation medium (WilliamsE Medium: 95%; FCS: 5%, 2 mM L- Glutamine; 50 U/ml Penicillin; 50 mg/ml Streptomycin, (Invitrogen, Karlsruhe, Germany); 4.5 μg/ml linoleic acid; 1 x ITS; 4.1 mM nicotinamid, (Sigma- Aldrich, Schnelldorf, Germany) 10 ng/ml EGF, 20 ng/ml HGF, and 1 μΜ retinoic acid for 5 days. Subsequently, cells were cultured in HDM with addition of 10 ng/ml EGF, 10 ng/ml HGF, 20 ng/ml OSM and 0.1 μΜ dexamethasone for 7 days.
Flow cytometry analysis
[0176] Cell cultures expressing eGFP were dissociated using 0.25% trypsin (Lonza, Cologne, Germany) for 5 min followed by addition of PBS containing 5% FCS. Resulting cell suspensions were pelleted and resuspended in PBS. Samples of 105 cells were analysed using a FACSCanto flow cytometer (BD Biosciences, Heidelberg, Germany) with FACS DIVA software. Analysis of eGFP expression (n=6) was performed in parallel to iH-USSC generation experiments with different USSC cell populations.
Immunofluorescence analysis
[0177] For immunofluorescence analysis, cells were differentiated on Chamber Slides
(Fischer Scientific, Schwerte, Germany), washed with PBS, fixed with 3.6% paraformaldehyde for 15 min at room temperature and permeabilized with methanol for 5 min at -20°C. After washing 3 times with PBS and blocking in blocking buffer (PBS: 94.97%; goat serum: 5%, (Dianova, Hamburg, Germany); TritonXlOO: 0.03%), (Sigma-Aldrich, Schnelldorf, Germany)) for 60 min, slides were stained with primary antibodies diluted in dilution buffer (PBS: 99.97%>; bovine serum albumin (BSA): 1% (Sigma-Aldrich, Schnelldorf, Germany); TritonXlOO: 0.03%) at 4 °C overnight. Antibodies applied were: mouse anti HNF4a (clone K9218, Perseus Proteomics, dilution 1 :200), mouse anti HNF6 (clone 4F12, Novus, dilution 1 :200), rabbit anti FOXA2 (#3143, Cell signalling, dilution 1 :800), rabbit anti HNFla (sc- 10791 , Santa Cruz, dilution 1 :200).
[0178] The incubation with fluorescent dye-conjugated secondary antibodies diluted in antibody dilution buffer was performed for 60 min at room temperature. Before and after incubation, slides were washed three times with PBS. Nuclei were stained with DAPI contained in the
ProLong® Gold antifade mounting-reagent (Invitrogen, Karlsruhe, Germany). All prepared slides were analyzed using Zeiss Axioplan2 microscope and Axiovision Software (Carl Zeiss Microimaging, G5ttingen, Germany) with according filter (DAPI: 365 nm; FITC: 470 nm and Rhodamin 546 nm).
[0179] Determination of total cell numbers stained positive for a defined marker was performed by counting positively stained cells versus total cells represented by DAPI staining.
RNA isolation and reverse transcription polymerase chain reaction (RT-PCR)
[0180] RNA isolation from cell lines and cell populations was performed applying RNeasy Mini Kit with additional on-column DNase digestion (Qiagen, Hilden, Germany). Total human fetal liver RNA (MVP™ Total RNA, pooled from male donors, gestation weeks 18 - 20) was purchased from Stratagen (La Jolla, CA, USA). 0.5-1.0 μg of total RNA was reversely transcribed afterwards into cDNA using SuperScriptlll (Invitrogen, Karlsruhe, Germany), according to manufacturer's instructions.
RT-PCR and real time PCR
[0181] Conventional RT-PCR was performed using 1 μΐ cDNA as template in 25 μΐ final reaction volume comprising l x PCR buffer containing 1.5 mM MgCi2, 0.2 μΜ of each primer, 0.2 mM of each dNTP and 1.25 U HotStar-Taq DNA Polymerase (Qiagen, Hilden, Germany) in a Mastercycler EP (Eppendorf, Hamburg, Germany).
[0182] Quantitative real time PCR (qPCR) was carried out by setting up reactions in triplicates, containing SYBR® Green PCR Mastermix (Applied Biosystems, Darmstadt, Germany), 0.2 μΜ of each primer as well as 50 ng of reverse transcribed total RNA, and subsequent analysis on ABI prism 7700 real-time PCR system (Applied Biosystems, Darmstadt, Germany). All qPCR results refer to the (housekeeping) gene Glyceraldehyde-3 -phosphate dehydrogenase (GAPDH). Analyses correspond to a minimum of 3 independently isolated RNA samples per time point of differentiation. Primer sequences are listed in Fig. 11.
Detection of human albumin, urea and cytochrome-p450-3A4 activity
[0183] Supernatants of differentiated cells, HepG2 cells and primary hepatocytes were collected after an incubation time for 24 hrs and stored at -80°C. Concentration of human albumin was assessed by ELISA (Bethyl Labs, Montgomery, USA) and concentration of urea was measured by the QuantiChrom™ Urea assay (BioAssay Systems, Hayward, USA). Both assays were carried out in accordance with manufacturer's instructions and analyzed in a microplate reader 680 (Biorad, Munchen, Germany). HDM supplemented with growth factors was used as negative control.
[0184] The detection of CYP3A4 activity was performed applying the P450-Glo™
CYP3A4-Assay (Promega, Mannheim, Germany). Inducible CYP3A4 activity was determined by culturing differentiated cells with or without 25 μΜ rifampicin (Sigma-Aldrich, Schnelldorf, Germany) for 48 hrs before testing. Prior to testing, cells were washed twice with PBS and incubated in HDM containing luciferin-PFBE substrate (50 μΜ) for 3-4 hrs. Subsequently, 50 μΐ of supernatant were mixed in equal parts with luciferin detection reagent, incubated for 20 min and measured with a tube-luminometer (Berthold Analytical, Nashua, USA).
[0185] Hepatocyte functions of transduced USSC were analyzed by determining the amount of human albumin and urea in cell culture supernatants or by evaluating CYP3A4 substrate metabolization by transduced USSC. Albumin secretion, urea production and inducible cytochrome- p450-3A4 activity as performed by transduced USSC demonstrated functional activity of transduced USSC in a hepatocyte specific manner. This designates the cells of hepatocyte phenotype described herein as suitable alternatives for hepatocyte based applications.
Statistical analysis
[0186] Statistical data analyses were performed applying PRISM 2.01 (GraphPad Software, Inc., La Jolla, USA). Data were compared by means of student's two sided t-test, and a P- value lower than 0.05 was considered significant.
[0187] Imunocytochemical staining showed that all neonatal stem cell populations used expressed DLK-1, thus falling under the definition of USSC. In these examples USSC have been exposed to a short differentiation culture in order to facilitate assessment of differences between transcription factor induced USSC and Mock controls.
[0188] Overexpression was carried out using the vector pUC2CL6IN (pUCC2) and constructs were analysed using PCR, restriction analysis, and subsequent sequencing. This vector contains a neomycin resistance, which allowed enriching transduced cells in culture by selection via geneticin sulphate. As a control, USSC transduced with an empty vector were subjected to a toxicity test. Transduction efficiency was assessed in parallel experiments, where USSC were transduced with a corresponding vector pCL6IEGwo (pCL6) that encodes the enhanced green fluorescent protein. Transduced factors were found to be located in the nucleus in essentially all cells. Overexpression of HNFla and HNF6, respectively, in USSC lead to an increase in gene expression of a few markers following differentiation. In transduced USSC after differentiation high expression of CYP3A4 was found. FXR expression is selectively and strongly initiated. These observations are in line with previous reports in the art on a positive regulation of the FXR promotor in HepG2 cells. After differentiation FTNF6 transduced USSC expressed FBP1, GYS2 and ARG1 in high amounts (c Fig. 2).
Claims
1. An in vitro method of generating cells of hepatocyte phenotype, the method comprising increasing in adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 6 (HNF-6) and the amount of the transcription factor hepatocyte nuclear factor la (HNF-la).
2. The method of claim 1 , further comprising increasing in the adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 4a (HNF-4a).
3. The method of claim 1 or claim 2, further comprising increasing in the adherent adult multipotent cells the amount of the transcription factor hepatocyte nuclear factor 3β (HNF- 3β).
4. The method of any one of claims 1-3, wherein the adherent adult multipotent cells are cord blood stem cells.
5. The method of any one of claims 1 - 4, wherein the adherent adult multipotent cells are mesenchymal stem cells (MSC) or unrestricted somatic stem cells (USSC).
6. The method of any one of claims 1-5, wherein increasing in adherent adult multipotent cells the amount of at least one of the respective transcription factors comprises increasing gene expression of the transcription factor.
7. The method of claim 6, wherein increasing gene expression of the transcription factor comprises expressing a heterologous nucleic acid sequence encoding the transcription factor.
8. The method of claim 7, wherein the heterologous nucleic acid sequence is comprised in a vector.
9. The method of claim 8, wherein the vector is a lentivirus vector.
10. The method of any one of claims 1-9, further comprising: culturing the cells in co-culture with at least one of endothelial cells, Kupffer cells, hepatic stellate cells, cholangiocytes, and fibroblasts, after increasing the amounts of FTNF-6 and FTNF-la.
11. The method of any one of claims 1-10, further comprising: after increasing the amounts of HNF-6 and HNF-Ια, culturing the cells in spheroid and/or organoid culture, and/or after increasing the amounts of HNF-6 and HNF- 1 a, forming a synthetic scaffold or a bioartificial liver device with the cells.
12. A cell of hepatocyte phenotype obtained by the method according to any one of claims 1-11.
13. The cell of claim 12, comprising a heterologous nucleic acid sequence encoding HNF-6 and/or HNF- la.
14. The cell of claims 12 or 13, having a detectable activity of one or more cytochrome P450 enzymes.
15. The cell of claim 14, wherein the cell has detectable activity of one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4.
16. The cell of claim 14 or 15, wherein the activity of the one or more of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4 is controllable.
17. The cell of any one of claims 14 to 16, expressing detectable amounts of one or more cytochrome P450 enzymes.
18. The cell of claim 17, wherein the P450 enzymes are selected from the group consisting of cytochrome P450 1A2, cytochrome P450 2C9, cytochrome P450 2D6 and cytochrome P450 3A4.
19. The cell of claim 17 or 18, expressing detectable amounts of mRNA encoding the one or more cytochrome P450 enzymes.
20. The cell of any one of claims 17 to 19, wherein the expression of the one or more cytochrome P450 enzymes is controllable.
21. The cell of any one of claims 14 to 20, wherein the detectable level of activity of cytochrome P450 after 28 days of cell culture is 80 % or more of the detectable level at the beginning of cell culture.
22. The cell of any one of claims 12 to 21, wherein the detectable level of activity of cytochrome P450 after 42 days of cell culture is 60 % or more of the detectable level at the beginning of cell culture.
23. The cell of any one of claims 12 to 22, expressing detectable amounts of one or more of albumin, glucose-6-phosphatase, arginase Type 1, asialoglycoprotein receptor 1, tyrosine aminotransferase, tryptophan 2,3-dioxygenase, and cytochrome p450 3A4.
24. A population of cells according to any one of claims 12 to 23.
25. The use of a cell of hepatocyte phenotype according to any one of claims 12 to 23 for testing the hepatic effect of a compound of interest, wherein testing the hepatic effect comprises contacting the cells of hepatocyte phenotype with the compound of interest.
26. The use of claim 25, wherein testing the hepatic effect comprises at least one of determining the occurrence of apoptosis and determining cell viability of the cells of hepatocyte phenotype.
27. The use of claims 25 or 26, wherein testing the hepatic effect comprises determining the cell's activity in (i) generating at least one of serum albumin, fibrinogen, a clotting factor of the prothrombin group, bile, lipoprotein, transferrin, complement protein and glycoprotein, and urea and/or in (ii) metabolizing homologous and/or a heterologous compound.
28. The use of claim 27, wherein determining the cell's activity in metabolizing heterologous compounds comprises determining the formation of metabolites of the heterologous compound.
29. The use of any one of claims 25-28, wherein testing the hepatic effect comprises determining whether drug metabolizing phase I and phase II proteins or transporter and receptor proteins of the cell can be induced or inhibited.
30. The use of cells of hepatocyte phenotype according to any one of claims 12 to 23 for therapeutic applications of at least one of hepatitis, a heredity disease, liver cirrhosis and liver cancer.
31. The use of claim 30, wherein the heredity disease is one of Wilson's disease, heamatochromatosis and alpha- 1 antitrypsin deficiency.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/EP2012/061679 WO2013189521A1 (en) | 2012-06-19 | 2012-06-19 | Method of generating cells of hepatocyte phenotype |
EPPCT/EP2012/061679 | 2012-06-19 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2013190013A1 true WO2013190013A1 (en) | 2013-12-27 |
Family
ID=48803502
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2012/061679 WO2013189521A1 (en) | 2012-06-19 | 2012-06-19 | Method of generating cells of hepatocyte phenotype |
PCT/EP2013/062805 WO2013190013A1 (en) | 2012-06-19 | 2013-06-19 | Cell of hepatocyte phenotype |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2012/061679 WO2013189521A1 (en) | 2012-06-19 | 2012-06-19 | Method of generating cells of hepatocyte phenotype |
Country Status (1)
Country | Link |
---|---|
WO (2) | WO2013189521A1 (en) |
Cited By (101)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9457023B1 (en) | 2013-11-05 | 2016-10-04 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9457025B2 (en) | 2013-11-05 | 2016-10-04 | Antecip Bioventures Ii Llc | Compositions and methods comprising bupropion or related compounds for sustained delivery of dextromethorphan |
US9474731B1 (en) | 2013-11-05 | 2016-10-25 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9486450B2 (en) | 2013-11-05 | 2016-11-08 | Antecip Bioventures Ii Llc | Hydroxybupropion and related compounds as modulators of drug plasma levels |
US9700528B2 (en) | 2013-11-05 | 2017-07-11 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9707191B2 (en) | 2013-11-05 | 2017-07-18 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
CN107034170A (en) * | 2017-01-11 | 2017-08-11 | 暨南大学 | Culture medium and method that fat mesenchymal stem cell breaks up simultaneously to HSCs and liver endothelial cell |
US9763932B2 (en) | 2013-11-05 | 2017-09-19 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9861595B2 (en) | 2013-11-05 | 2018-01-09 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9867819B2 (en) | 2013-11-05 | 2018-01-16 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9968568B2 (en) | 2013-11-05 | 2018-05-15 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10058518B2 (en) | 2013-11-05 | 2018-08-28 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10080727B2 (en) | 2013-11-05 | 2018-09-25 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10092561B2 (en) | 2013-11-05 | 2018-10-09 | Antecip Bioventures Ii Llc | Compositions and methods comprising bupropion or related compounds for sustained delivery of dextromethorphan |
US10105327B2 (en) | 2013-11-05 | 2018-10-23 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphane and related pharmacodynamic effects |
US10105361B2 (en) | 2013-11-05 | 2018-10-23 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10512643B2 (en) | 2013-11-05 | 2019-12-24 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10688066B2 (en) | 2018-03-20 | 2020-06-23 | Antecip Bioventures Ii Llc | Bupropion and dextromethorphan for treating nicotine addiction |
US10772850B2 (en) | 2013-11-05 | 2020-09-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10780064B2 (en) | 2019-01-07 | 2020-09-22 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10786469B2 (en) | 2013-11-05 | 2020-09-29 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10799497B2 (en) | 2013-11-05 | 2020-10-13 | Antecip Bioventures Ii Llc | Combination of dextromethorphan and bupropion for treating depression |
US10813924B2 (en) | 2018-03-20 | 2020-10-27 | Antecip Bioventures Ii Llc | Bupropion and dextromethorphan for treating nicotine addiction |
US10864209B2 (en) | 2013-11-05 | 2020-12-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10874664B2 (en) | 2013-11-05 | 2020-12-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10874665B2 (en) | 2013-11-05 | 2020-12-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10874663B2 (en) | 2013-11-05 | 2020-12-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10881657B2 (en) | 2013-11-05 | 2021-01-05 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10894046B2 (en) | 2013-11-05 | 2021-01-19 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10894047B2 (en) | 2013-11-05 | 2021-01-19 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10898453B2 (en) | 2013-11-05 | 2021-01-26 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10925842B2 (en) | 2019-01-07 | 2021-02-23 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10933034B2 (en) | 2013-11-05 | 2021-03-02 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10940124B2 (en) | 2019-01-07 | 2021-03-09 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10945973B2 (en) | 2013-11-05 | 2021-03-16 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10966974B2 (en) | 2013-11-05 | 2021-04-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10966942B2 (en) | 2019-01-07 | 2021-04-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10966941B2 (en) | 2013-11-05 | 2021-04-06 | Antecip Bioventures Ii Llp | Bupropion as a modulator of drug activity |
US10980800B2 (en) | 2013-11-05 | 2021-04-20 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11007189B2 (en) | 2013-11-05 | 2021-05-18 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11020389B2 (en) | 2013-11-05 | 2021-06-01 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11058648B2 (en) | 2013-11-05 | 2021-07-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11065248B2 (en) | 2013-11-05 | 2021-07-20 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11090300B2 (en) | 2013-11-05 | 2021-08-17 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11096937B2 (en) | 2013-11-05 | 2021-08-24 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11123344B2 (en) | 2013-11-05 | 2021-09-21 | Axsome Therapeutics, Inc. | Bupropion as a modulator of drug activity |
US11123343B2 (en) | 2013-11-05 | 2021-09-21 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11129826B2 (en) | 2013-11-05 | 2021-09-28 | Axsome Therapeutics, Inc. | Bupropion as a modulator of drug activity |
US11141388B2 (en) | 2013-11-05 | 2021-10-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11141416B2 (en) | 2013-11-05 | 2021-10-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11147808B2 (en) | 2013-11-05 | 2021-10-19 | Antecip Bioventures Ii Llc | Method of decreasing the fluctuation index of dextromethorphan |
US11185515B2 (en) | 2013-11-05 | 2021-11-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11191739B2 (en) | 2013-11-05 | 2021-12-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11197839B2 (en) | 2013-11-05 | 2021-12-14 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11207281B2 (en) | 2013-11-05 | 2021-12-28 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11213521B2 (en) | 2013-11-05 | 2022-01-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11229640B2 (en) | 2013-11-05 | 2022-01-25 | Antecip Bioventures Ii Llc | Combination of dextromethorphan and bupropion for treating depression |
US11234946B2 (en) | 2013-11-05 | 2022-02-01 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11253492B2 (en) | 2013-11-05 | 2022-02-22 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11253491B2 (en) | 2013-11-05 | 2022-02-22 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11273133B2 (en) | 2013-11-05 | 2022-03-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11274279B2 (en) | 2020-03-11 | 2022-03-15 | Bit Bio Limited | Method of generating hepatic cells |
US11273134B2 (en) | 2013-11-05 | 2022-03-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11285146B2 (en) | 2013-11-05 | 2022-03-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11285118B2 (en) | 2013-11-05 | 2022-03-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11291665B2 (en) | 2013-11-05 | 2022-04-05 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11291638B2 (en) | 2013-11-05 | 2022-04-05 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11298351B2 (en) | 2013-11-05 | 2022-04-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11298352B2 (en) | 2013-11-05 | 2022-04-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11311534B2 (en) | 2013-11-05 | 2022-04-26 | Antecip Bio Ventures Ii Llc | Bupropion as a modulator of drug activity |
US11344544B2 (en) | 2013-11-05 | 2022-05-31 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11357744B2 (en) | 2013-11-05 | 2022-06-14 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11364233B2 (en) | 2013-11-05 | 2022-06-21 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11382874B2 (en) | 2013-11-05 | 2022-07-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11419867B2 (en) | 2013-11-05 | 2022-08-23 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11426401B2 (en) | 2013-11-05 | 2022-08-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11426370B2 (en) | 2013-11-05 | 2022-08-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11433067B2 (en) | 2013-11-05 | 2022-09-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11439636B1 (en) | 2013-11-05 | 2022-09-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11478468B2 (en) | 2013-11-05 | 2022-10-25 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11497721B2 (en) | 2013-11-05 | 2022-11-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11510918B2 (en) | 2013-11-05 | 2022-11-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11517542B2 (en) | 2013-11-05 | 2022-12-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11517543B2 (en) | 2013-11-05 | 2022-12-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11524007B2 (en) | 2013-11-05 | 2022-12-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11534414B2 (en) | 2013-11-05 | 2022-12-27 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11541048B2 (en) | 2013-11-05 | 2023-01-03 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11541021B2 (en) | 2013-11-05 | 2023-01-03 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
AU2017217688B2 (en) * | 2016-02-10 | 2023-01-19 | Wake Forest University Health Sciences | Model system of liver fibrosis and method of making and using the same |
US11571399B2 (en) | 2013-11-05 | 2023-02-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11571417B2 (en) | 2013-11-05 | 2023-02-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11576877B2 (en) | 2013-11-05 | 2023-02-14 | Antecip Bioventures Ii Llc | Bupropion as modulator of drug activity |
US11576909B2 (en) | 2013-11-05 | 2023-02-14 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11590124B2 (en) | 2013-11-05 | 2023-02-28 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11596627B2 (en) | 2013-11-05 | 2023-03-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11617747B2 (en) | 2013-11-05 | 2023-04-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11617728B2 (en) | 2013-11-05 | 2023-04-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11717518B1 (en) | 2022-06-30 | 2023-08-08 | Antecip Bioventures Ii Llc | Bupropion dosage forms with reduced food and alcohol dosing effects |
US11732241B2 (en) | 2015-10-15 | 2023-08-22 | Wake Forest University Health Sciences | Methods of producing in vitro liver constructs and uses thereof |
US11730706B1 (en) | 2022-07-07 | 2023-08-22 | Antecip Bioventures Ii Llc | Treatment of depression in certain patient populations |
US11969421B2 (en) | 2013-11-05 | 2024-04-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110016463A (en) | 2010-11-15 | 2019-07-16 | 艾克塞利瑞提德生物技术公司 | Neural stem cell is generated by mankind's cytotrophoblast stem cells |
JP6836990B2 (en) * | 2014-11-26 | 2021-03-03 | アクセラレイテッド・バイオサイエンシズ・コーポレーション | Induced hepatocytes and their use |
EP3702449A4 (en) * | 2017-10-23 | 2021-07-28 | Kyushu University, National University Corporation | Method for producing liver stem cells or liver progenitor cells by direct reprogramming |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008002662A2 (en) * | 2006-06-28 | 2008-01-03 | The Univeristy Of Kansas | Differentiation of stem cells from umbilical cord matrix into hepatocyte lineage cells |
WO2008035169A2 (en) * | 2006-09-18 | 2008-03-27 | Universita' Degli Studi Di Torino | Process for preparing hepatic cells from progenitor cells present in umbilical cord blood |
US20090317365A1 (en) * | 2008-06-23 | 2009-12-24 | Lee Oscar Kuang-Sheng | Systems and methods for making hepatocytes from extrahepatic somatic stem cells and use thereof |
WO2010014949A2 (en) * | 2008-07-31 | 2010-02-04 | The General Hospital Corporation | Compositions comprising hepatocyte-like cells and uses thereof |
WO2011130402A2 (en) * | 2010-04-13 | 2011-10-20 | Cellular Dynamics International, Inc. | Hepatocyte production by forward programming |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU5132096A (en) | 1995-01-30 | 1996-08-21 | Terrapin Technologies, Inc. | Glubodies - multiplicities of proteins capable of binding a variety of small molecules |
DE19932688B4 (en) | 1999-07-13 | 2009-10-08 | Scil Proteins Gmbh | Design of beta-sheet proteins of gamma-II-crystalline antibody-like |
US20050191618A1 (en) | 2001-05-18 | 2005-09-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA) |
WO2003029462A1 (en) | 2001-09-27 | 2003-04-10 | Pieris Proteolab Ag | Muteins of human neutrophil gelatinase-associated lipocalin and related proteins |
AU2003275958A1 (en) | 2003-08-25 | 2005-03-10 | Pieris Proteolab Ag | Muteins of tear lipocalin |
EP1658308A1 (en) | 2003-08-25 | 2006-05-24 | Pieris ProteoLab AG | Muteins of a bilin-binding protein with affinity for a given target |
-
2012
- 2012-06-19 WO PCT/EP2012/061679 patent/WO2013189521A1/en active Application Filing
-
2013
- 2013-06-19 WO PCT/EP2013/062805 patent/WO2013190013A1/en active Application Filing
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008002662A2 (en) * | 2006-06-28 | 2008-01-03 | The Univeristy Of Kansas | Differentiation of stem cells from umbilical cord matrix into hepatocyte lineage cells |
WO2008035169A2 (en) * | 2006-09-18 | 2008-03-27 | Universita' Degli Studi Di Torino | Process for preparing hepatic cells from progenitor cells present in umbilical cord blood |
US20090317365A1 (en) * | 2008-06-23 | 2009-12-24 | Lee Oscar Kuang-Sheng | Systems and methods for making hepatocytes from extrahepatic somatic stem cells and use thereof |
WO2010014949A2 (en) * | 2008-07-31 | 2010-02-04 | The General Hospital Corporation | Compositions comprising hepatocyte-like cells and uses thereof |
WO2011130402A2 (en) * | 2010-04-13 | 2011-10-20 | Cellular Dynamics International, Inc. | Hepatocyte production by forward programming |
Non-Patent Citations (2)
Title |
---|
HONG S H ET AL: "In vitro differentiation of human umbilical cord blood-derived mesenchymal stem cells into hepatocyte-like cells", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 330, no. 4, 20 May 2005 (2005-05-20), pages 1153 - 1161, XP004844850, ISSN: 0006-291X, DOI: 10.1016/J.BBRC.2005.03.086 * |
YAMADA T ET AL: "In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green", STEM CELLS, ALPHAMED PRESS, DAYTON, OH, US, vol. 20, no. 2, 1 January 2002 (2002-01-01), pages 146 - 154, XP002321740, ISSN: 1066-5099, DOI: 10.1634/STEMCELLS.20-2-146 * |
Cited By (117)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11123343B2 (en) | 2013-11-05 | 2021-09-21 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11426370B2 (en) | 2013-11-05 | 2022-08-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US9474731B1 (en) | 2013-11-05 | 2016-10-25 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9486450B2 (en) | 2013-11-05 | 2016-11-08 | Antecip Bioventures Ii Llc | Hydroxybupropion and related compounds as modulators of drug plasma levels |
US9700553B2 (en) | 2013-11-05 | 2017-07-11 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9700528B2 (en) | 2013-11-05 | 2017-07-11 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9707191B2 (en) | 2013-11-05 | 2017-07-18 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9763932B2 (en) | 2013-11-05 | 2017-09-19 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9861595B2 (en) | 2013-11-05 | 2018-01-09 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9867819B2 (en) | 2013-11-05 | 2018-01-16 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9968568B2 (en) | 2013-11-05 | 2018-05-15 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10058518B2 (en) | 2013-11-05 | 2018-08-28 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10064857B2 (en) | 2013-11-05 | 2018-09-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10080727B2 (en) | 2013-11-05 | 2018-09-25 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10092560B2 (en) | 2013-11-05 | 2018-10-09 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10092561B2 (en) | 2013-11-05 | 2018-10-09 | Antecip Bioventures Ii Llc | Compositions and methods comprising bupropion or related compounds for sustained delivery of dextromethorphan |
US10105327B2 (en) | 2013-11-05 | 2018-10-23 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphane and related pharmacodynamic effects |
US10105361B2 (en) | 2013-11-05 | 2018-10-23 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10251879B2 (en) | 2013-11-05 | 2019-04-09 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10463634B2 (en) | 2013-11-05 | 2019-11-05 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US9457023B1 (en) | 2013-11-05 | 2016-10-04 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10548857B2 (en) | 2013-11-05 | 2020-02-04 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10596167B2 (en) | 2013-11-05 | 2020-03-24 | Antecip Bioventures Ii Llc | Compositions and methods comprising bupropion or related compounds for sustained delivery of dextromethorphan |
US10772850B2 (en) | 2013-11-05 | 2020-09-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10780066B2 (en) | 2013-11-05 | 2020-09-22 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10786496B2 (en) | 2013-11-05 | 2020-09-29 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10786469B2 (en) | 2013-11-05 | 2020-09-29 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10799497B2 (en) | 2013-11-05 | 2020-10-13 | Antecip Bioventures Ii Llc | Combination of dextromethorphan and bupropion for treating depression |
US10806710B2 (en) | 2013-11-05 | 2020-10-20 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11969421B2 (en) | 2013-11-05 | 2024-04-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11779579B2 (en) | 2013-11-05 | 2023-10-10 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11628149B2 (en) | 2013-11-05 | 2023-04-18 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11617728B2 (en) | 2013-11-05 | 2023-04-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10864209B2 (en) | 2013-11-05 | 2020-12-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10874664B2 (en) | 2013-11-05 | 2020-12-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10874665B2 (en) | 2013-11-05 | 2020-12-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10874663B2 (en) | 2013-11-05 | 2020-12-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10881624B2 (en) | 2013-11-05 | 2021-01-05 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US10881657B2 (en) | 2013-11-05 | 2021-01-05 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10894046B2 (en) | 2013-11-05 | 2021-01-19 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10894047B2 (en) | 2013-11-05 | 2021-01-19 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10898453B2 (en) | 2013-11-05 | 2021-01-26 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11617747B2 (en) | 2013-11-05 | 2023-04-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11596627B2 (en) | 2013-11-05 | 2023-03-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10933034B2 (en) | 2013-11-05 | 2021-03-02 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11590124B2 (en) | 2013-11-05 | 2023-02-28 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10945973B2 (en) | 2013-11-05 | 2021-03-16 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10966974B2 (en) | 2013-11-05 | 2021-04-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11576909B2 (en) | 2013-11-05 | 2023-02-14 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10966941B2 (en) | 2013-11-05 | 2021-04-06 | Antecip Bioventures Ii Llp | Bupropion as a modulator of drug activity |
US10980800B2 (en) | 2013-11-05 | 2021-04-20 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11007189B2 (en) | 2013-11-05 | 2021-05-18 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11020389B2 (en) | 2013-11-05 | 2021-06-01 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11058648B2 (en) | 2013-11-05 | 2021-07-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11065248B2 (en) | 2013-11-05 | 2021-07-20 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11141388B2 (en) | 2013-11-05 | 2021-10-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11096937B2 (en) | 2013-11-05 | 2021-08-24 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11123344B2 (en) | 2013-11-05 | 2021-09-21 | Axsome Therapeutics, Inc. | Bupropion as a modulator of drug activity |
US10512643B2 (en) | 2013-11-05 | 2019-12-24 | Antecip Bioventures Ii Llc | Compositions and methods for increasing the metabolic lifetime of dextromethorphan and related pharmacodynamic effects |
US11147808B2 (en) | 2013-11-05 | 2021-10-19 | Antecip Bioventures Ii Llc | Method of decreasing the fluctuation index of dextromethorphan |
US11090300B2 (en) | 2013-11-05 | 2021-08-17 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11141416B2 (en) | 2013-11-05 | 2021-10-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11129826B2 (en) | 2013-11-05 | 2021-09-28 | Axsome Therapeutics, Inc. | Bupropion as a modulator of drug activity |
US11185515B2 (en) | 2013-11-05 | 2021-11-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11191739B2 (en) | 2013-11-05 | 2021-12-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11197839B2 (en) | 2013-11-05 | 2021-12-14 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11207281B2 (en) | 2013-11-05 | 2021-12-28 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11213521B2 (en) | 2013-11-05 | 2022-01-04 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11229640B2 (en) | 2013-11-05 | 2022-01-25 | Antecip Bioventures Ii Llc | Combination of dextromethorphan and bupropion for treating depression |
US11234946B2 (en) | 2013-11-05 | 2022-02-01 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11253492B2 (en) | 2013-11-05 | 2022-02-22 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11253491B2 (en) | 2013-11-05 | 2022-02-22 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11273133B2 (en) | 2013-11-05 | 2022-03-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11576877B2 (en) | 2013-11-05 | 2023-02-14 | Antecip Bioventures Ii Llc | Bupropion as modulator of drug activity |
US11273134B2 (en) | 2013-11-05 | 2022-03-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11285146B2 (en) | 2013-11-05 | 2022-03-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11285118B2 (en) | 2013-11-05 | 2022-03-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11291665B2 (en) | 2013-11-05 | 2022-04-05 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11291638B2 (en) | 2013-11-05 | 2022-04-05 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11298351B2 (en) | 2013-11-05 | 2022-04-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11298352B2 (en) | 2013-11-05 | 2022-04-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11311534B2 (en) | 2013-11-05 | 2022-04-26 | Antecip Bio Ventures Ii Llc | Bupropion as a modulator of drug activity |
US11344544B2 (en) | 2013-11-05 | 2022-05-31 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11357744B2 (en) | 2013-11-05 | 2022-06-14 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11364233B2 (en) | 2013-11-05 | 2022-06-21 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11382874B2 (en) | 2013-11-05 | 2022-07-12 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11419867B2 (en) | 2013-11-05 | 2022-08-23 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11426401B2 (en) | 2013-11-05 | 2022-08-30 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US9457025B2 (en) | 2013-11-05 | 2016-10-04 | Antecip Bioventures Ii Llc | Compositions and methods comprising bupropion or related compounds for sustained delivery of dextromethorphan |
US11433067B2 (en) | 2013-11-05 | 2022-09-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11439636B1 (en) | 2013-11-05 | 2022-09-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11478468B2 (en) | 2013-11-05 | 2022-10-25 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11497721B2 (en) | 2013-11-05 | 2022-11-15 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11510918B2 (en) | 2013-11-05 | 2022-11-29 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11517542B2 (en) | 2013-11-05 | 2022-12-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11517543B2 (en) | 2013-11-05 | 2022-12-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11517544B2 (en) | 2013-11-05 | 2022-12-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11524007B2 (en) | 2013-11-05 | 2022-12-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11524008B2 (en) | 2013-11-05 | 2022-12-13 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11534414B2 (en) | 2013-11-05 | 2022-12-27 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11541048B2 (en) | 2013-11-05 | 2023-01-03 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11541021B2 (en) | 2013-11-05 | 2023-01-03 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11571417B2 (en) | 2013-11-05 | 2023-02-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11571399B2 (en) | 2013-11-05 | 2023-02-07 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11732241B2 (en) | 2015-10-15 | 2023-08-22 | Wake Forest University Health Sciences | Methods of producing in vitro liver constructs and uses thereof |
AU2017217688B2 (en) * | 2016-02-10 | 2023-01-19 | Wake Forest University Health Sciences | Model system of liver fibrosis and method of making and using the same |
CN107034170A (en) * | 2017-01-11 | 2017-08-11 | 暨南大学 | Culture medium and method that fat mesenchymal stem cell breaks up simultaneously to HSCs and liver endothelial cell |
CN107034170B (en) * | 2017-01-11 | 2020-10-30 | 暨南大学 | Culture medium and method for simultaneous differentiation of adipose-derived mesenchymal stem cells into hepatic stellate cells and hepatic endothelial cells |
US10688066B2 (en) | 2018-03-20 | 2020-06-23 | Antecip Bioventures Ii Llc | Bupropion and dextromethorphan for treating nicotine addiction |
US10813924B2 (en) | 2018-03-20 | 2020-10-27 | Antecip Bioventures Ii Llc | Bupropion and dextromethorphan for treating nicotine addiction |
US10940124B2 (en) | 2019-01-07 | 2021-03-09 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10780064B2 (en) | 2019-01-07 | 2020-09-22 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10925842B2 (en) | 2019-01-07 | 2021-02-23 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US10966942B2 (en) | 2019-01-07 | 2021-04-06 | Antecip Bioventures Ii Llc | Bupropion as a modulator of drug activity |
US11274279B2 (en) | 2020-03-11 | 2022-03-15 | Bit Bio Limited | Method of generating hepatic cells |
US11717518B1 (en) | 2022-06-30 | 2023-08-08 | Antecip Bioventures Ii Llc | Bupropion dosage forms with reduced food and alcohol dosing effects |
US11730706B1 (en) | 2022-07-07 | 2023-08-22 | Antecip Bioventures Ii Llc | Treatment of depression in certain patient populations |
Also Published As
Publication number | Publication date |
---|---|
WO2013189521A1 (en) | 2013-12-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2013190013A1 (en) | Cell of hepatocyte phenotype | |
Kamiya et al. | Role of the hepatocyte nuclear factor 4α in control of the pregnane X receptor during fetal liver development | |
JP4802087B2 (en) | Disruption of multiallelic expression in mammalian genes | |
Nickkholgh et al. | Enrichment of spermatogonial stem cells from long-term cultured human testicular cells | |
Chung et al. | Ascorbate promotes epigenetic activation of CD30 in human embryonic stem cells | |
Mistri et al. | Dynamic changes in Sox2 spatio-temporal expression promote the second cell fate decision through Fgf4/Fgfr2 signaling in preimplantation mouse embryos | |
US20220073589A1 (en) | GPR156 Variants And Uses Thereof | |
Leppek et al. | VELCRO-IP RNA-seq reveals ribosome expansion segment function in translation genome-wide | |
CA2627593C (en) | Dopaminergic neuron proliferative progenitor cell marker nato3 | |
Dowdle et al. | A single KH domain in Bicaudal-C links mRNA binding and translational repression functions to maternal development | |
Tsuji et al. | Dual-color fluorescence imaging to monitor CYP3A4 and CYP3A7 expression in human hepatic carcinoma HepG2 and HepaRG cells | |
Clipsham et al. | Nr0b1 and its network partners are expressed early in murine embryos prior to steroidogenic axis organogenesis | |
US11098363B2 (en) | Cornulin (CRNN) variants and uses thereof | |
Lampasona et al. | Hnrnpab regulates neural cell motility through transcription of Eps8 | |
Bertaux et al. | Runx2 regulates the expression of GNAS on SaOs-2 cells | |
CA2607963A1 (en) | Method of identifying compounds that modulate interaction of androgen receptor with beta-catenin | |
US20210230609A1 (en) | Solute Carrier Family 14 Member 1 (SLC14A1) Variants And Uses Thereof | |
JP2009045004A (en) | Method for controlling undifferentiation of stem cell with chromatin control factor | |
JP7237064B2 (en) | Single immunoglobulin interleukin-1 receptor-related (SIGIRR) variants and uses thereof | |
Maeda et al. | Isolation of CHO-K1 clones defective in cAMP-dependent proteolysis, as determined by the stability of exogenously expressed GATA-6 | |
KR20170044061A (en) | Method for determining state of differentiation of stem cells, and novel differentiation marker used therefor | |
US20210246518A1 (en) | Method for Detecting in a Cell RNA-Protein Interaction | |
WO2017141672A1 (en) | Method for determining state of differentiation of cell, and novel differentiation marker used therein | |
JP4995654B2 (en) | A method for controlling stem cell undifferentiation using a chromatin protein or a mutant thereof. | |
Cavanna | In vivo and in vitro analysis of Dll1 and Pax6 function in the adult mouse pancreas |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13739150 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 13739150 Country of ref document: EP Kind code of ref document: A1 |