WO2013173693A1 - Nanoparticules ayant une entrée améliorée dans des cellules cancéreuses - Google Patents

Nanoparticules ayant une entrée améliorée dans des cellules cancéreuses Download PDF

Info

Publication number
WO2013173693A1
WO2013173693A1 PCT/US2013/041542 US2013041542W WO2013173693A1 WO 2013173693 A1 WO2013173693 A1 WO 2013173693A1 US 2013041542 W US2013041542 W US 2013041542W WO 2013173693 A1 WO2013173693 A1 WO 2013173693A1
Authority
WO
WIPO (PCT)
Prior art keywords
nanoparticle
shell
cancer
endocytosis
agent
Prior art date
Application number
PCT/US2013/041542
Other languages
English (en)
Inventor
King Fung KWONG
Lisa Ann TOBIN
Original Assignee
The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, As Represented By The Secretary, Department Of Health And Human Services filed Critical The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Publication of WO2013173693A1 publication Critical patent/WO2013173693A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5115—Inorganic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides

Definitions

  • nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 1 ,237 Byte ASCII (Text) file named "713414_ST25.TXT,” created on
  • Controlled delivery of a therapeutic agent provides a number of benefits over conventional drug delivery methods, including targeted delivery of the therapeutic agent, reduced dosage amount or number of doses, and reduced severity of side effects.
  • Various technologies have been explored to provide controlled drug delivery formulations, including microparticles and nanoparticles.
  • Nanoparticles are versatile delivery vehicles for administering anti-cancer treatments.
  • the small size of nanoparticles conveys unique physical properties which result in their localization to the tumor vasculature, due to what has been described as the enhanced permeability and retention (EPR) effect (Matsumura et al., Cancer Res., 46(12): 6387-6392 (1986)).
  • EPR enhanced permeability and retention
  • the "leaky” nature of tumor vasculature represented by the loss of tight endothelial junctions, allows for increased vascular extravasation of macromolecules into the tumor interstitium and microenvironment (Weis et al., Nature, 437: 497-504 (2005)).
  • nanoparticles have a distinct advantage over freely-delivered intravascular therapeutics in that nanoparticles can be modified to incorporate a variety of anti-cancer therapeutics into a single delivery system.
  • nanoparticles are known to affect their ability to function as a drug delivery vehicle, including the materials used to make the nanoparticle, the means by which a nanoparticle is targeted to the cells or tissues of interest, and the therapeutic agent itself (referred to as the payload).
  • the payload a wide range of different materials have been explored for their potential in nanomedicine applications, including branched polymers, colloidal gold, and mesoporous silicon, among others.
  • nanomaterial or nanoparticle configuration represents a superior construct for the delivery of therapeutics in humans, and it is believed that the nanomaterial of choice will be dependent on the target cell of interest and the nature of the therapeutic agent to be delivered.
  • the fate of a nanoparticle and its payload remains largely dependent on the rate of nanoparticle internalization into the target cell.
  • RNA small interfering RNA
  • RNA interference pathway RNA interference pathway
  • compositions and methods for delivering siRNA and other therapeutic agents via nanoparticle vehicles in the treatment cancer are also important achievements.
  • This invention provides such compositions and methods, which can be useful for the treatment of cancer.
  • the invention provides a nanoparticle which is efficiently taken up into cancer cells and which effectively delivers a therapeutic agent to the cancer cells.
  • the nanoparticle of the invention contains (a) a first shell comprising a first shell substance, (b) a therapeutic agent, and (c) an endocytosis-enhancing agent which is different from the therapeutic agent.
  • the invention further provides a composition comprising the nanoparticle and a carrier, as well as a method of treating cancer by administering the nanoparticle to a cancer patient.
  • the invention also provides a method for preparing a nanoparticle.
  • the method involves the steps of assembling a first shell comprising a first shell substance and a therapeutic agent, and incorporating an endocytosis-enhancing agent which is different from the therapeutic agent into the nanoparticle during or after assembly of the first shell.
  • FIGs. 1A-1C are schematic diagrams which depict exemplary nanoparticles of the invention and delivery of a therapeutic agent via a nanoparticle according to the invention.
  • FIG. 1 A depicts a single-shell nanoparticle (left nanoparticle), a double-shell nanoparticle (middle nanoparticle), and a triple-shell nanoparticle (right nanoparticle) of the invention.
  • FIG. IB depicts a triple-shell nanoparticle of the invention in cross-sectional view.
  • FIG. 1 C depicts entry of nanoparticles into a cell by endocytosis, disaggregation of the nanoparticles in endosomes, and release of the payload into the cytoplasm.
  • FIG. 2A is a graphical depiction of the rate of entry of Cy3-labeled nanoparticles lacking an endocytosis-enhancing agent into a panel of diverse cancer cells.
  • FIG. 2B is a graphical depiction of the rate of entry of Cy3 -labeled nanoparticles into three normal epithelial cell types.
  • FIG. 2C is a graphical depiction of the entry of Dy550-labeled triple- shell nanoparticles lacking an endocytosis-enhancing agent into cancer and normal cells after 0.5, 1 , or 4 hour incubation at 37° C.
  • Data are means ⁇ S.E.M. (n>30 cells per time point).
  • FIG. 3A is a graphical depiction of baseline clathrin and caveolin expression in a panel of cancer cell lines as assessed by fluorescence confocal microscopy. Bars represent mean ⁇ S.E.M. (n>30 cells).
  • FIG. 3B is a graphical depiction of the effects of the clathrin inhibitor, chlorpromazine (CPZ), or the caveolin inhibitor, genestein (GEN), on the entry of Dy550-labeled triple-shell nanoparticles into cancer lines after a 30 minute incubation at 37° C. Data are means ⁇ S.E.M. (n>30 cells, **p ⁇ 0.01 for treatment compared to untreated control using Student's t test).
  • FIGs. 4A-D are graphical depictions of caveolin-1 expression (FIGs. 4A, 4C) and Dy550-labeled triple-shell nanoparticle uptake (FIGs. 4B, 4D) following pre-treatment with the indicated chemotherapeutic agent at 30 minutes (FIGs. 4A, 4B) or 4 hours (FIGs. 4C, 4D) after application of the nanoparticles. Bars represent means ⁇ S.E.M. (n>30 cells, *p ⁇ 0.05, **p ⁇ 0.01 for pre-treatment compared to control using Student's t test).
  • FIG. 5 is a graphical depiction of caveolin-1 expression and Dy550-labeled triple- shell nanoparticle uptake following treatment of H292 cells for a 0.5 or 4 hour period with the indicated nanoparticle (NP): siCTRL, scrambled control siRNA; DOX, doxorubicin; Dy550, DyLight 550. Bars represent means ⁇ S.E.M. (n > 25 cells, *p ⁇ 0.05 for NP-DOX- Dy550 compared to NP-siCTRL-Dy550 using Student's t test).
  • FIG. 6A is a graphical depiction of the expression of mRNAs encoding x-linked inhibitor of apoptosis (XIAP), poly (ADP-ribose) polymerase- 1 (PARP1 ), vascular endothelial growth factor (VEGF), and epidermal growth factor receptor (EGFR) in human H292 cancer cells following treatment with the indicated nanoparticle (NP): siCTRL, scrambled control siRNA; DOX, doxorubicin; Dy550, DyLight 550.
  • XIAP x-linked inhibitor of apoptosis
  • PARP1 poly (ADP-ribose) polymerase- 1
  • VEGF vascular endothelial growth factor
  • EGFR epidermal growth factor receptor
  • FIG. 6B is a graphical depiction of the expression of mRNA encoding XIAP following treatment of H292 cells for 24 hours with the unassembled components of NP-DOX-siXIAP-Dy550, i.e., calcium phosphate (CaP), DOX, and/or siRNA targeting XIAP (siXIAP).
  • FIGs. 6C, 6E, 6G, and 61 are Western blots depicting XIAP, PARP1, VEGF, and EGFR expression, respectively, in H292 cancer cells following treatment with the indicated nanoparticle. The expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is depicted for normalization purposes.
  • FIG. 7A is a graphical depiction of tumor growth in H292 tumor-bearing mice as determined by serial imaging for near infrared (NIR) fluorescence (Dy755) in untreated mice, and in mice treated biweekly with intravenous injection of the indicated nanoparticles. Data are means ⁇ S.E.M. (n>7 mice in each group, *p ⁇ 0.05, **p ⁇ 0.005 for treatment compared to the other control groups using a Krushkal-Wallis test with post-testing).
  • FIG. 7B is a graphical depiction of tumor size in individual mice at 22 days following initiation of biweekly intravenous injection of the indicated nanoparticles.
  • FIG. 7A is a graphical depiction of tumor growth in H292 tumor-bearing mice as determined by serial imaging for near infrared (NIR) fluorescence (Dy755) in untreated mice, and in mice treated biweekly with intravenous injection of the indicated nanoparticles. Data are means ⁇ S.E
  • 7C is a Western blot depicting XIAP and GAPDH expression levels in H292 tumors excised from mice 21 days after the initiation of biweekly treatment with the indicated nanoparticles as compared to XIAP expression in H292 tumors from untreated mice.
  • FIG. 8 is a graphical depiction of nanoparticle localization in various tissues at 48, 72, and 96 hours after a single intravenous injection of NP-DOX-siXIAP-Dy755
  • Endocytosis is considered to be an important mechanism by which nanoparticles are internalized by cells (Olton et al., Biomaterials, 32(30): 7662-70 (201 1), and Khalil et al., Pharmacol. Rev., 58: 32-45 (2006)).
  • the invention is based, at least in part, upon the discovery that nanoparticles containing an agent which enhances the cellular endocytosis process are readily taken up by cancer cells and are capable of delivering a therapeutic agent with a greater effectiveness as compared to nanoparticles which do not contain the endocytosis-enhancing agent.
  • the invention provides a nanoparticle that contains (a) a first shell comprising a first shell substance, (b) a therapeutic agent, and (c) an endocytosis-enhancing agent which is different from the therapeutic agent.
  • the first shell also is referred to herein as the "primary shell” or “inner shell” of a nanoparticle.
  • the first shell substance can be any biocompatible substance which is capable of forming nanoparticles.
  • the first shell substance can be, for example, an inorganic element, an inorganic compound, a lipid, a polymer, a natural macromolecule, or a combination thereof.
  • the first shell substance is an inorganic element, such as calcium, phosphorus, silicon, gold, or iron. In other embodiments, the first shell substance is an inorganic compound, such as calcium phosphate or calcium phosphosilicate.
  • the first shell substance is calcium phosphate.
  • Calcium phosphates regardless of calcium to phosphate ratio, crystallinity, or phase, are sparingly soluble at pH 7.4 and become increasingly soluble below pH 6.2.
  • nanoparticles with a calcium phosphate first shell will remain intact at physiological pH conditions and dissolve during delivery to cells where nanoparticles encounter a rapid decrease in pH during transit through the endolysosomal compartment (pH 4.6-5).
  • nanoparticles with a calcium phosphate first shell can preferentially deliver a therapeutic payload to tumors, which often are characterized by a low pH environment (Tabakovic et al., WIREs Nanomed. Nanobiotechnol, 4: 96-1 12 (2012)).
  • Calcium phosphate nanoparticles can be formed by wet precipitation methods known in the art using calcium salts and ammonium salts. For example, solutions of calcium nitrate and diammonium hydrogen phosphate can be combined under rapid stirring to provide a calcium phosphate precipitate, which can be isolated and optionally lyophilized (Sokolova et al., Biomaterials, 27: 3147-3153 (2006)). The ratio of calcium to phosphate can be varied to produce hydroxyapatite or amorphous nanoparticle forms.
  • a dispersing agent can be added to the reaction system.
  • Suitable dispersing agents include, for example, polyelectrolytes (e.g., poly (allylamine hydrochloride)), surfactants, polysaccharides or carbohydrates (e.g., heparin), amino acids (e.g., L-aspartic acid, lysine, glycine), polyamino acids (e.g., poly-L-lysine), poloxamers, gelatin, polyethylene glycols, acrylic-based polymeric salts, or combinations thereof.
  • polyelectrolytes e.g., poly (allylamine hydrochloride)
  • surfactants e.g., poly (allylamine hydrochloride)
  • polysaccharides or carbohydrates e.g., heparin
  • amino acids e.g., L-aspartic acid, lysine, glycine
  • polyamino acids e.g., poly-L-lysine
  • Exemplary acrylic based polymeric salts include polyacrylic acid salts and polymethacrylic acid salts, such as sodium polyacrylates.
  • the therapeutic agent can be incorporated into a nanoparticle first shell by including the therapeutic agent during assembly of the first shell.
  • a therapeutic agent can be added to a calcium or ammonium salt solution prior to precipitation, thereby encapsulating the therapeutic agent in the first shell of the calcium phosphate nanoparticle.
  • the therapeutic agent also can be incorporated into a nanoparticle by adsorbing the therapeutic agent onto the surface of the first shell.
  • a therapeutic agent can be mixed with a population of calcium phosphate nanoparticles and incubated, thereby allowing the therapeutic agent to adsorb onto the first shell surface.
  • a wide variety of therapeutic agents can be adsorbed onto the surface of a calcium phosphate nanoparticle due to the ability of the calcium phosphate surface to bind to both positively and negatively charged molecules.
  • a requisite feature of the nanoparticle of the invention is an agent which enhances the entry of the nanoparticle into a cell via endocytosis, which is referred to herein as an "endocytosis-enhancing agent.”
  • the endocytosis-enhancing agent is a different molecule than the therapeutic agent.
  • a nanoparticle of the invention which comprises a first shell, a therapeutic agent incorporated into the first shell, and an endocytosis-enhancing agent incorporated into the first shell is referred to herein as a "single-shell" nanoparticle.
  • a single-shell nanoparticle is encompassed by a second shell which surrounds the first shell.
  • the second shell comprises a second shell substance which may be the same as the first shell substance, or different from the first shell substance.
  • the second shell substance is the same as the first shell substance.
  • a second shell can be added to a single-shell nanoparticle by suspending the single-shell nanoparticle in a solution containing a second shell substance, such as calcium and phosphate.
  • the second shell is sometimes referred to as the "secondary shell” or the "middle shell” when there is yet another shell as described hereinbelow.
  • the endocytosis-enhancing agent can be encapsulated into the first shell of the nanoparticle, or the endocytosis-enhancing agent can be adsorbed onto the surface of the first shell.
  • the endocytosis-enhancing agent is incorporated into the second shell which surrounds the first shell and the therapeutic agent. Without wishing to be bound by any particular theory, it is believed that this spatial arrangement allows the endocytosis-enhancing agent to be released from the second shell prior to or during nanoparticle uptake into a cell or tissue, resulting in the upregulation of caveolin expression and/or activity, thereby leading to enhanced nanoparticle endocytosis.
  • a nanoparticle comprising a first shell, a therapeutic agent, an endocytosis-enhancing agent, and a second shell is referred to herein as a "double-shell" nanoparticle.
  • the second shell of a double-shell nanoparticle is surrounded by a third shell, which functions to protect the therapeutic agent and/or endocytosis-enhancing agent from release and/or degradation prior to cellular uptake.
  • the third shell comprises a third shell substance which may be the same as the first shell substance and/or second shell substance, or different from the first shell substance and/or second shell substance. In certain preferred embodiments, the third shell substance is the same as the first shell substance and the second shell substance.
  • a third shell can be added to a double-shell nanoparticle by suspending the double-shell nanoparticle in a solution containing a third shell substance, such as calcium and phosphate.
  • the third shell is sometimes referred to as the "tertiary shell” or the “outer shell” when there are three shells as described herein.
  • a nanoparticle comprising a first shell, a therapeutic agent, an endocytosis- enhancing agent, a second shell, and a third shell is referred to herein as a "triple-shell” nanoparticle.
  • Double-shell and triple-shell nanoparticles are collectively referred to herein as "multi-shell” nanoparticles.
  • FIG. 1A depicts (i) a single-shell nanoparticle comprising a first (primary or inner) shell comprising a therapeutic agent (siRNA) and a detection moiety (DyLight) (left nanoparticle), (ii) a double- shell nanoparticle wherein the single-shell nanoparticle is encapsulated by a second
  • FIG. I B depicts a cross- sectional view of a triple-shell nanoparticle of the invention.
  • FIG. 1 C A schematic diagram depicting entry of an exemplary triple-shell nanoparticle of the invention into a cell by endocytosis, disaggregation of the nanoparticle in endosomes, and release of the siRNA, DOX, and DyLight into the cytoplasm is provided as FIG. 1 C.
  • the endocytosis-enhancing agent can be any agent which enhances the entry of the nanoparticle into a cell via endocytosis.
  • endocytosis There are multiple endocytic pathways, including phagocytosis, clathrin-dependent endocytosis, caveolae-dependent endocytosis, macropinocytosis, and clathrin-/caveolae-independent endocytosis.
  • the endocytosis-enhancing agent is an agent which enhances caveolae-dependent endocytosis by increasing the amount of a caveolin protein (i.e., caveolin-1, -2, or -3) when the endocytosis-enhancing agent is provided to a cell.
  • a caveolin protein i.e., caveolin-1, -2, or -3
  • An increase in the amount of a caveolin protein can result from, for example, increased expression of a gene encoding a caveolin protein, increased translation of a nucleic acid encoding a caveolin protein, increased activation and/or post-translational processing from stored protein, decreased degradation of a nucleic acid encoding a caveolin protein, decreased degradation of a caveolin protein, or a combination thereof.
  • the endocytosis-enhancing agent is doxorubicin or a pharmaceutically acceptable salt thereof.
  • the endocytosis-enhancing agent is a distinct anthracycline antibiotic, such as epirubicin, daunorubicin, idarubicin, valrubicin, or mitoxantrone, or a pharmaceutically acceptable salt thereof.
  • the endocytosis-enhancing agent is paclitaxel or a pharmaceutically acceptable salt thereof.
  • the endocytosis-enhancing agent is a derivative of paclitaxel, such as paclitaxel linked to docosahexaenoic acid (DHA- paclitaxel) or paclitaxel linked to a polyglutamate polymer (PG-paclitaxel).
  • the endocytosis-enhancing agent is a distinct taxane, such as docetaxel or a pharmaceutically acceptable salt thereof.
  • the endocytosis-enhancing agent is etoposide or a pharmaceutically acceptable salt thereof.
  • the endocytosis-enhancing agent is podophyllotoxin, or another derivative of podophyllotoxin, such as teniposide or a pharmaceutically acceptable salt thereof.
  • the amount of endocytosis-enhancing agent incorporated into a nanoparticle of the invention can be determined empirically by one of ordinary skill in the art.
  • One of ordinary skill in the art will appreciate that the amount of endocytosis-enhancing agent necessary to elicit the desired effect, i.e., enhancement of nanoparticle uptake upon contact with a cell, will depend upon the endocytosis-enhancing agent per se, the nanoparticle first shell substance, the presence or absence of one or more shells surrounding the first shell, and the target cell or tumor.
  • the amount of endocytosis-enhancing agent incorporated into a nanoparticle of the invention will be less than the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a cell in vitro or a tumor in vivo.
  • the amount of endocytosis-enhancing agent incorporated into a nanoparticle can be 50% or less, e.g., 40% or less, 30% or less, 20% or less, 10% or less, or 1 % or less than the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a cell in vitro or a tumor in vivo.
  • the amount of endocytosis-enhancing agent incorporated into a nanoparticle can be 0.005%) or more, e.g., 0.01 %) or more, 0.5% or more, 1%> or more, 2% or more, 5% or more, or 15% or more than the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a cell in vitro or a tumor in vivo.
  • the amount of endocytosis-enhancing agent incorporated into a nanoparticle can be bounded by any two of the above endpoints.
  • the amount of endocytosis-enhancing agent incorporated into a nanoparticle can be 0.01-10%, 1-20%, 0.5-30%, 15-50%, 5-50%, or 2-20% of the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a cell in vitro or a tumor in vivo.
  • the amount of doxorubicin when preparing a nanoparticle comprising doxorubicin as the endocytosis-enhancing agent intended for delivery to a tumor in mice, can be such that as little as 8 ⁇ g is delivered per nanoparticle dosage (see FIGs. 7 A and 7B and Example 7).
  • the amount of doxorubicin administered to inhibit tumor growth in mice can be in the range of 4.5 mg/kg - 18 mg/kg, or approximately 90 ⁇ g - 360 ⁇ g per dosage (Charrois et al., J. Pharmacol. Exp. Ther., 306(3): 1058-1067 (2003)).
  • the invention also provides a method for preparing a nanoparticle.
  • the method involves the steps of assembling a first shell comprising a first shell substance and a therapeutic agent, and incorporating an endocytosis-enhancing agent which is different from the therapeutic agent into the nanoparticle during or after assembly of the first shell.
  • the endocytosis-enhancing agent is incorporated after assembly of the first shell.
  • the endocytosis-enhancing agent is incorporated into a second shell which encompasses the first shell and which comprises a second shell substance.
  • the first shell substance and the second shell substance may be the same, or they may be different.
  • the first shell substance and the second shell substance are the same.
  • the method further comprises applying a third shell, which comprises a third shell substance, onto the second shell.
  • the third shell substance may be the same as the first shell substance and/or the second shell substance, or it may be different.
  • the first shell substance, the second shell substance, and the third shell substance are the same.
  • the first shell substance, the second shell substance, and the third shell substance are calcium phosphate or calcium phosphosilicate.
  • the invention has been described in detail with respect to a nanoparticle comprising a calcium phosphate shell, the invention is not limited to any particular shell type. Rather, any type of nanoparticle whose entry into a cell is regulated by endocytosis can be modified by the method of the invention to provide a nanoparticle with enhanced cellular uptake capabilities.
  • the first, second, and/or third shell substance is a lipid, and the nanoparticle so formed may be referred to as a liposome.
  • Liposomes are completely closed lipid bilayer membranes containing an entrapped aqueous volume. Liposomes may be unilamellar vesicles (possessing a single membrane bilayer) or multilamellar vesicles (onionlike structures characterized by multiple membrane bilayers, each separated from the next by an aqueous layer).
  • Lipids which can be used to prepare a liposomal nanoparticle of the invention include phospholipids such as phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidylglycerol (PG), phosphatidic acid (PA), phosphatidylinositol (PI), sphingomyelin (SPM), and the like, alone or in combination.
  • the phospholipids can be synthetic or derived from natural sources such as egg or soy.
  • the phospholipids dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylglycerol (DMPG) also can be used.
  • distearoylphosphatidyl choline DSPC
  • dipalmitoylphosphatidylcholine DPPC
  • hydrogenated soy phosphatidylcholine HSPC
  • dimyristoylphosphatidylcholine DMPC
  • diarachidonoyl phosphatidylcholine DAPC
  • the first, second, and/or third shell substance can be a commercially available lipidic formulation, such as LIPOFECTAMINETM (Life
  • a liposomal nanoparticle also can contain other steroid components such as cholesterol, polyethylene glycol derivatives of cholesterol (PEG-cholesterols), coprostanol, cholestanol, cholestane, or alpha-tocopherol.
  • a liposomal nanoparticle also can contain organic acid derivatives of sterols, such as cholesterol hemisuccinate (CHS), and the like.
  • Organic acid derivatives of tocopherols also can be used as liposome-forming ingredients, such as alpha-tocopherol hemisuccinate (THS).
  • a liposomal nanoparticle comprising a therapeutic agent and an endocytosis- enhancing agent can be prepared according to any suitable method of preparing liposomes (see, e.g., U.S. Patents 4,145,410; 5,356,633; and 6,132,763).
  • the first, second, and/or third shell substance is a biocompatible polymer.
  • polymers suitable for use in a nanoparticle of the invention include, but are not limited to, polylactic acid (PLA), polyglycolic acid (PLG), poly(lactic-co-glycolic acid) (PLGA), polycyanoacrylate (PCA), polycaprolactone (PCL), polyhydroxybutyrate (PHB), polyacrylic acid (PAA), polymethacrylic acid (PMA), polyvinyl alcohol (PVA), polyanhydride, polyorthoester, and combinations thereof.
  • One of ordinary skill in the art can select a suitable first, second, and/or third shell substance polymer based upon the desired features of the nanoparticle, such as nanoparticle size, therapeutic agent physical properties (aqueous solubility, stability, etc.), surface functionality, degree of biodegradability, and therapeutic agent release profile.
  • a suitable first, second, and/or third shell substance polymer based upon the desired features of the nanoparticle, such as nanoparticle size, therapeutic agent physical properties (aqueous solubility, stability, etc.), surface functionality, degree of biodegradability, and therapeutic agent release profile.
  • nanoparticle comprising a polymer first shell substance, a therapeutic agent, and an endocytosis-enhancing agent
  • a polymer first shell substance such as polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, polyethylene glycol dimethacrylate, poly(ethylene glycol)-co-propylene glycol dimethacrylate, poly(ethylene glycol) emulsilyl) emulsification/solvent diffusion, or salting out (see, e.g., Mahapatro et al., J.
  • known methods such as polymerization of monomers, or dispersion of preformed polymers by solvent evaporation, emulsification/solvent diffusion, or salting out (see, e.g., Mahapatro et al., J.
  • the first, second, and/or third shell substance is a natural macromolecule, such as cellulose, gelatin, alginate, chitosan, hyaluronic acid, guar gum, or agarose.
  • a nanoparticle comprising a natural macromolecule first shell substance substance, a therapeutic agent, and an endocytosis-enhancing agent can be prepared according to known methods, such as ionic gelation, desolvation/coacervation, or
  • microemulsion methods see, e.g., Mahapatro et al., supra.
  • a nanoparticle of the invention also can contain a surface modification agent attached to the external surface (i.e., outermost shell) of the nanoparticle which functions, for example, to inhibit nanoparticle aggregation during storage and to extend nanoparticle half- life in vivo.
  • the surface modification agent is a hydrophilic biocompatible polymer.
  • the surface modification agent is a poly(ethylene glycol) (PEG) molecule, which may be a linear PEG or a branched PEG.
  • the surface modification agent is polypropylene glycol (PPG), a copolymer of PEG and PPG, polyglycolic acid (PGA), polylactic acid (PLA), a copolymer of PGA and PLA, polyvinyl alcohol, or polyethyleneimine (PEI).
  • PPG polypropylene glycol
  • PGA polyglycolic acid
  • PLA polylactic acid
  • PLA polylactic acid
  • PLA polylactic acid
  • PLA polyvinyl alcohol
  • PEI polyethyleneimine
  • the surface modification agent may have any suitable molecular weight, such as a molecular weight between about 300 and about 5,000 daltons, e.g., about 300 to about 1,000 daltons, about 400 to about 800 daltons, about 500 to about 1 ,500 daltons, or about 1,000 to about 2,500 daltons.
  • a surface modification agent can be attached to the external surface of a nanoparticle using any suitable surface modification method.
  • a surface modification agent is adsorbed onto the surface of a nanoparticle.
  • a surface modification agent is covalently conjugated to the surface of a nanoparticle.
  • One of ordinary skill in the art will understand that the particular method used to attach a surface modification agent to a nanoparticle of the invention will depend upon the surface properties of the nanoparticle, e.g., hydrophobicity/hydrophilicity, ionic charge, and availability of one or more functional groups suitable for covalent conjugation.
  • a nanoparticle of the invention also can contain a detection moiety.
  • the detection moiety can be, for example, any molecule that facilitates detection, either directly or indirectly, preferably by a non-invasive and/or in vivo visualization technique.
  • the detection moiety may be an image contrast agent, a fluorophore, or a radionuclide.
  • the detection moiety may be present in the first shell, the second shell, and/or the third shell of a nanoparticle.
  • the detection moiety can be incorporated into a nanoparticle by any suitable means, such as entrapment, adsorption, or covalent coupling.
  • Nanoparticles of the invention can have any suitable particle sizes, such as mean particle size diameters of 0.1 nm or more, e.g., 1 nm or more, 10 nm or more, e.g., 25 nm or more, 50 nm or more, 100 nm or more, 125 nm or more, 150 nm or more, 175 nm or more, 200 nm or more, or 500 nm or more.
  • mean particle size diameters of 0.1 nm or more e.g., 1 nm or more, 10 nm or more, e.g., 25 nm or more, 50 nm or more, 100 nm or more, 125 nm or more, 150 nm or more, 175 nm or more, 200 nm or more, or 500 nm or more.
  • the nanoparticles can have mean diameters of 1 ,000 nm or less, e.g., 800 nm or less, 600 nm or less, 400 nm or less, 200 nm or less, 150 nm or less, 100 nm or less, 75 nm or less, or 50 nm or less.
  • the nanoparticles can have mean diameters in an amount bounded by any two of the above endpoints.
  • the nanoparticles can have mean diameters of 1 -50 nm, 10-100 nm, 25-75 nm, 50-400 nm, 150-300 nm, or 100-200 nm.
  • the size of the nanoparticles can be determined using known techniques in the art, such as laser light scattering techniques, dynamic light scattering techniques, transmission electron microscopy, atomic force microscopy, or scanning electron microscopy.
  • Nanoparticles of the invention can be prepared to have a narrow particle size distribution.
  • the nanoparticle diameter has a standard deviation of 30% or less of the mean diameter, e.g., 25% or less, 20% or less, 15% or less, 10% or less, 8% or less, or 5% or less of the mean diameter.
  • the nanoparticle diameter has a standard deviation of 1 % or more of the mean diameter, e.g., 3% or more, 5% or more, 7% or more, 12% or more, or 16% or more of the mean diameter.
  • the nanoparticle diameter can have a standard deviation in an amount bounded by any two of the above endpoints.
  • the nanoparticle diameter can have a standard deviation of 1-10%, 3-8%, 7-15%, 5- 20%, or 12-25% of the mean diameter.
  • Nanoparticles which have a narrow particle size distribution can be referred to as monodisperse.
  • Nanoparticle size can be regulated according to methods known in the art, such as varying the nanoparticle assembly reaction conditions, filtration techniques, or a combination thereof.
  • the invention provides a method for enhancing entry into a cell of a nanoparticle which comprises providing a nanoparticle according to the invention to the cell under conditions suitable for entry of the nanoparticle into the cell, wherein the entry into the cell is enhanced as compared to entry into the same cell of the same nanoparticle except lacking the endocytosis-enhancing agent under identical conditions.
  • the cell is a cancer cell.
  • the invention provides a method for enhancing entry into a tissue of a
  • nanoparticle which comprises providing a nanoparticle according to the invention to the tissue under conditions suitable for entry of the nanoparticle into the tissue, wherein the entry into the tissue is enhanced as compared to entry into the same tissue of the same nanoparticle except lacking the endocytosis-enhancing agent under identical conditions.
  • the tissue is a cancer tissue.
  • a nanoparticle whose entry is “enhanced” can refer to a nanoparticle whose rate of entry into a cell or tissue is increased as compared to the rate of entry into the same cell or tissue of the same nanoparticle except lacking the endocytosis-enhancing agent under identical conditions.
  • “enhanced” entry can refer to a population of nanoparticles whose ability to accumulate in a cell or tissue is increased as compared to the ability to accumulate in the same cell or tissue of the same population of nanoparticles except lacking the endocytosis-enhancing agent under identical conditions.
  • the rate by which a nanoparticle enters into a cell or tissue or the overall accumulation of a population of nanoparticles in a cell or tissue can be assessed using techniques known in the art, such as fluorescence microscopy, fluorescence spectroscopy, photon detection, or a scintillation counter, depending upon the detection moiety incorporated into the nanoparticle.
  • the therapeutic agent present in a nanoparticle of the invention can be any suitable therapeutic agent, e.g., any compound capable of treating or preventing tumor growth.
  • the therapeutic agent can be, for example, a small molecule drug, polynucleotide, polypeptide, peptidomimetic, polysaccharide, phospholipid, or radioactive moiety.
  • the therapeutic agent is a polynucleotide
  • the polynucleotide is a double stranded RNA (dsRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), antisense oligonucleotide, messenger RNA (mRNA), plasmid, ribozyme, or aptamer.
  • dsRNA double stranded RNA
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • miRNA micro RNA
  • antisense oligonucleotide messenger RNA (mRNA), plasmid, ribozyme, or aptamer.
  • polynucleotide and “nucleic acid” as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule, and thus include double- and single-stranded DNA, double- and single-stranded RNA, and double-stranded DNA- RNA hybrids.
  • the terns include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited to methylated and/or capped polynucleotides.
  • Suitable nucleotide analogs are known and are described in, e.g., U.S. Patent 6,107,094, U.S. Patent Application Publication 2012/0101148, and references cited therein.
  • nucleotide refers to a monomeric unit of a
  • polynucleotide that consists of a heterocyclic base, a sugar, and one or more phosphate groups.
  • the naturally occurring bases (guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)) are typically derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included.
  • the naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included.
  • Nucleic acids are typically linked via phosphate bonds to form nucleic acids or polynucleotides, though many other linkages are known in the art (e.g., phosphorothioates, boranophosphates and the like). Methods of preparing polynucleotides are within the ordinary skill in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (2001)).
  • the polynucleotide is a siRNA, shRNA, or miRNA.
  • siRNA, shRNA, and miRNA are double-stranded RNA molecules which down-regulate intracellular levels of specific proteins through a process known as RNA interference
  • RNAi RNAi
  • shRNA shRNA constructs
  • miRNA constructs can be synthesized to have a nucleotide sequence which specifically hybridizes to, or is complementary to, a target mRNA which encodes for any target protein.
  • Specifically hybridizable and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between two nucleic acid molecules.
  • a polynucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable.
  • a polynucleotide is
  • a double-stranded RNA molecule is formed by the complementary pairing between a first RNA portion and a second RNA portion.
  • the length of each portion generally is less than 30 nucleotides (e.g., 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , or 10 nucleotides). In some embodiments, the length of each portion of the double-stranded region is 19 to 25 nucleotides.
  • the length of each portion of the double-stranded region is 19 to 25 nucleotides.
  • first and second portions of the RNA molecule are the "stems" of a hairpin structure which are joined by a linking sequence, thereby forming a "loop" in the hairpin structure.
  • the linking sequence can vary in length. In some embodiments, the linking sequence can be 5, 6, 7, 8, 9, 10, 1 1 , 12, or 13 nucleotides in length.
  • a representative linking sequence is 5'-TTCAGAAGG-3' (SEQ ID NO: 1), but any of a number of sequences can be used to join the first and second portions.
  • the first and second portions are complementary but may not be completely symmetrical, as the hairpin structure may contain 3 ' or 5' overhanging nucleotides (e.g., a 1 , 2, 3, 4, or 5 nucleotide overhang).
  • siRNAs or shRNAs There are well-established criteria for designing siRNAs or shRNAs (see, e.g., Elbashir et al., Nature, 411 : 494-8 (2001); Amarzguioui et al., Biochem. Biophys. Res.
  • siRNA or shRNA The sequence of any candidate siRNA or shRNA is generally checked for the possibility of cross-reactivity with other nucleic acid sequences using a suitable program to align the siRNA or shRNA with the nucleic acid sequences contained in a genomic database such as GenBank or Ensembl. Typically, a number of siRNAs or shRNAs will be generated and screened in order to compare their effectivenesses.
  • MicroRNAs are a highly conserved class of double-stranded RNA molecules about 21-25 nucleotides in length that are transcribed from DNA in the genomes of plants and animals, but are not translated into protein. To date, thousands of miRNAs have been identified in various organisms through random cloning and sequencing or
  • the miRBase hosted by the Sanger Institute, provides miRNA nomenclature, sequence data, annotation and target prediction information
  • a siRNA, shRNA, or miRNA can be generated by any method including, without limitation in vitro transcription, recombinant production in a host cell, or synthetic chemical means.
  • the siRNA, shRNA, or miRNA is generated by in vitro transcription of a DNA oligonucleotide template using a recombinant enzyme, such as T7 RNA polymerase.
  • the siRNA, shRNA, or miRNA is prepared recombinantly in cultured cells, which may be prokaryotic or eukaryotic.
  • siRNA, shRNA, or miRNA are known (see, for example, Elbashir et al., Nature, 411: 494-8 (2001); Brummelkamp et al., Science, 296: 550-553 (2002); and Lee et al., Nat. Biotech., 20: 500-5 (2002)).
  • the therapeutic agent present in a nanoparticle of the invention can target any molecule involved in tumorigenesis, including oncogenes and tumor suppressor genes.
  • a therapeutic agent can target, for example, a caspase inhibitor, a growth factor, receptor tyrosine kinase, cytoplasmic kinase, regulatory GTPase, or a transcription factor.
  • the target molecule can be involved in any aspect of tumorigenesis, including cell proliferation, cell survival, cell death, angiogenesis, immunogenicity, and/or inflammation.
  • the therapeutic agent inhibits the activity of an inhibitor of apoptosis (IAP) protein.
  • the IAP is x-linked inhibitor of apoptosis (XIAP).
  • the IAP is baculoviral IAP repeat-containing protein 1 (NAIP), baculoviral IAP repeat-containing protein 2 (c-IAPl ), baculoviral IAP repeat- containing protein 3 (c-IAP2), or survivin.
  • the therapeutic agent is a siRNA, shRNA, or miRNA which targets a nucleic acid sequence encoding XIAP.
  • the XIAP target sequence is CATGCAGCTGTAGATAGATGGCA (SEQ ID NO: 2).
  • the therapeutic agent is a siRNA, shRNA, or miRNA which targets a nucleic acid sequence encoding PARP1.
  • the PARP1 target sequence is AAGCCTCCGCTCCTGAACAAT (SEQ ID NO: 3).
  • the therapeutic agent is a siRNA, shRNA, or miRNA which targets a nucleic acid sequence encoding VEGF.
  • the VEGF target sequence is CGATGAAGCCCTGGAGTGC (SEQ ID NO: 4).
  • the therapeutic agent is a siRNA, shRNA, or miRNA which targets a nucleic acid sequence encoding EGFR.
  • the EGFR target sequence is AACACAGTGGAGCGAATTCCT (SEQ ID NO: 5).
  • the invention also provides a composition comprising a nanoparticle of the invention and a carrier therefor.
  • the carrier typically will be liquid, but also can be solid, a combination of liquid and solid components, or a combination of liquid and/or solid components in a gas (e.g. an aerosol).
  • the earner desirably is physiologically acceptable (e.g., a pharmaceutically, pharmacologically, or cosmetically acceptable) carrier. Any suitable physiologically acceptable carrier can be used within the context of the invention, and such carriers are well known in the art.
  • the choice of carrier will be determined, at least in part, by the location of the target tissue and/or cells, and the particular method used to administer the composition.
  • composition can contain additional components, such as, for example, diluents, adjuvants, excipients, preservatives, pH adjusting agents, and the like, as well as additional therapeutic agents, such as, for example, a chemotherapeutic agent or a biological agent suitable for treating cancer.
  • additional therapeutic agents such as, for example, a chemotherapeutic agent or a biological agent suitable for treating cancer.
  • suitable pharmaceutically acceptable carriers and components are further described in A.R. Gennaro, ed., Remington: The Science and Practice of Pharmacy (19th ed.), Mack Publishing Company, Easton, PA (1995).
  • composition can be formulated for administration by any suitable route, such as, for example, an administration route selected from the group consisting of intravenous, intratumoral, intraarterial, intramuscular, intraperitoneal, intrathecal, epidural, topical, percutaneous, subcutaneous, transmucosal, intranasal, and oral administration routes.
  • an administration route selected from the group consisting of intravenous, intratumoral, intraarterial, intramuscular, intraperitoneal, intrathecal, epidural, topical, percutaneous, subcutaneous, transmucosal, intranasal, and oral administration routes.
  • the composition is formulated for a parenteral route of administration.
  • a composition suitable for parenteral administration can be an aqueous or nonaqueous, isotonic sterile injection solution, which can contain anti-oxidants, buffers, bacteriostats, and solutes, for example, that render the composition isotonic with the blood of the intended recipient.
  • An aqueous or nonaqueous sterile suspension can contain one or more suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • composition can be presented in a unit-dose or multi-dose sealed container, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water, for injection, immediately prior to use.
  • a sterile liquid carrier for example, water
  • An extemporaneous injection solution or suspension can be prepared from sterile powders, granules, or tablets.
  • a composition for parenteral administration can be prepared in any suitable manner.
  • a sterile injectable solution can be prepared by any suitable method, for example, by incorporating a nanoparticle of the invention in a suitable amount in an appropriate solvent with one or a combination of the components enumerated above followed by filtered sterilization.
  • a solution for injection preferably is essentially free of endotoxin, e.g., in an amount equal or lower than 0.5 EU/ml, which is the level that the U. S. Food and Drug Administration allows in sterile water.
  • a dispersion of the nanoparticle of the invention generally can be prepared by incorporating the nanoparticle into a sterile vehicle which contains a basic dispersion medium and other suitable components as described above.
  • the preferred method of preparation is vacuum drying or freeze-drying which yields a powder of the nanoparticle plus any additional desired components resulting from a previously sterile-filtered solution thereof.
  • the composition can be formulated for administration into the airways to provide either systemic or local administration of the nanoparticle, for example, to the trachea and/or the lungs.
  • administration can be made via inhalation or via physical application, using aerosols, solutions, and devices such as a bronchoscope.
  • the composition can be delivered from an insufflator, a nebulizer, a pump, a pressurized pack, or other convenient means of delivering an aerosol, non-aerosol spray of a powder, or non-aerosol spray of a liquid.
  • Pressurized packs can comprise a suitable propellant such as a liquefied gas or a compressed gas.
  • Liquefied gases include, for example, hydrochlorofluorocarbons, hydrochlorocarbons, hydrocarbons, and hydrocarbon ethers.
  • Compressed gases include, for example, nitrogen, nitrous oxide, and carbon dioxide.
  • the dosage unit can be determined by providing a valve to deliver a controlled amount.
  • the powder mix can include a suitable powder base such as lactose or starch.
  • the powder composition can be presented in unit dosage form such as, for example, capsules, cartridges, or blister packs from which the powder can be administered with the aid of an inhalator or insufflator.
  • composition can be formulated for transmucosal or transdermal
  • the nanoparticle can be formulated into a nasal spray, inhaled aerosol, suppository, mouthwash, rapidly dissolving tablet, or lozenge.
  • the nanoparticle can be formulated into an ointment, salve, gel, foam, or cream as generally known in the art.
  • compositions suitable for enteric administration are formulated using
  • compositions suitable for oral administration Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for ingestion by the patient.
  • Pharmaceutical preparations for oral use can be obtained through combining active compounds with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, and sorbitol; starch from corn, wheat, rice, potato, and other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethyl cellulose; and gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • the invention also provides a method of treating cancer in a mammal comprising administering to the mammal an effective amount of a nanoparticle of the invention thereby treating the cancer in the mammal.
  • an "effective amount” or “therapeutically effective amount” refers to an amount that relieves (to at least some extent, as judged by a skilled medical practitioner) one or more symptoms of cancer in a human or other mammalian subject. Additionally, an “effective amount” or “therapeutically effective amount” refers to an amount that returns to normal, either partially or completely, physiological or biochemical parameters associated with or causative of the cancer. A clinician skilled in the art can determine the therapeutically effective amount of a composition to be administered to a human or other mammalian subject in order to treat or prevent a particular cancer.
  • compositions required to be therapeutically effective will depend upon numerous factors, e.g., such as the specific activity of the therapeutic agent, the type of nanoparticle shell substance, and the route of administration, in addition to many patient-specific considerations.
  • General considerations to be taken into account in determining the "effective amount" are known to those of skill in the art and are described in, for example, Gilman et al., eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences, 17th Ed., Mack Publishing Co., Easton, Pa., 1990.
  • the amount of endocytosis-enhancing agent provided in a dose of a nanoparticle of the invention can be determined empirically by one of ordinary skill in the art.
  • One of ordinary skill in the art will appreciate that the amount of endocytosis-enhancing agent necessary to elicit the desired effect, i.e., enhancement of nanoparticle uptake upon contact with a cancer tissue, will depend upon the endocytosis-enhancing agent per se, the nanoparticle first shell substance, the presence or absence of one or more shells surrounding the first shell, and the target cell or tumor.
  • the amount of endocytosis-enhancing agent provided in a dose of a nanoparticle of the invention will be less than the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a human or other mammalian subject bearing a tumor.
  • the amount of endocytosis-enhancing agent provided in a dose of a nanoparticle of the invention can be 50% or less, e.g., 40% or less, 30% or less, 20% or less, 10% or less, or 1 % or less than the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a human or other mammalian subject bearing a tumor.
  • the amount of endocytosis-enhancing agent provided in a dose of a nanoparticle can be 0.005% or more, e.g., 0.01 % or more, 0.5% or more, 1 % or more, 2% or more, 5% or more, or 15% or more than the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a human or other mammalian subject bearing a tumor.
  • the amount of endocytosis-enhancing agent provided in a dose of a nanoparticle of the invention can be bounded by any two of the above endpoints.
  • the amount of endocytosis-enhancing agent provided in a dose of a nanoparticle of the invention can be 0.01-10%, 1-20%, 0.5-30%, 15-50%, 5-50%, or 2-20% of the amount necessary to elicit a cytotoxic response when a population of the nanoparticles is provided to a human or other mammalian subject bearing a tumor.
  • the amount of doxorubicin can be such that as little as 8 ⁇ g is delivered per nanoparticle dosage (see FIGs. 7 A and 7B and
  • the amount of doxorubicin administered to inhibit tumor growth in mice can be in the range of 4.5 mg/kg - 18 mg/kg, or approximately 90 ⁇ g - 360 ⁇ g per dosage (Charrois et al., J. Pharmacol. Exp. Then, 306(3): 1058-1067 (2003)).
  • a suitable dose of a siRNA, shRNA, or miRNA can be 0.01 milligrams per kilogram of the body weight of the mammal (mg/kg) or more, e.g., 0.05 mg/kg or more, 0.1 mg/kg or more, 0.5 mg/kg or more, 1 mg/kg or more, 3 mg/kg or more, or 5 mg/kg or more.
  • a suitable dose of a siRNA, shRNA, or miRNA can be 50 mg/kg or less, e.g., 25 mg/kg or less, 20 mg/kg or less, 15 mg/kg or less, 10 mg/kg or less, 5 mg/kg or less, 1 mg/kg or less, or 0.75 mg/kg or less.
  • a suitable dose of a siRNA, shRNA, or miRNA can be bounded by any two of the above endpoints.
  • a suitable dose of a siRNA, shRNA, or miRNA can be 0.01-1 mg/kg, 0.05-5 mg/kg, 0.1- 10 mg/kg, 0.05-0.75 mg/kg, 1-20 mg/kg, or 3-15 mg/kg.
  • a dose of the nanoparticle of the invention can be administered to the mammal at one time or in a series of subdoses administered over a suitable period of time, e.g., on a daily, semi-weekly, weekly, bi-weekly, semi-monthly, bi-monthly, semi-annual, or annual basis, as needed.
  • a dosage unit comprising an effective amount of a nanoparticle of the invention may be administered in a single daily dose, or the total daily dosage may be administered in two, three, four, or more divided doses administered daily, as needed.
  • Cancers treatable with a nanoparticle of the invention include tumors associated with the oral cavity (e.g., the tongue and tissues of the mouth) and pharynx, the digestive system (e.g., the esophagus, stomach, small intestine, colon, rectum, anus, liver, gall bladder, and pancreas), the respiratory system (e.g., the larynx, lung, and bronchus), bones and joints (e.g., bony metastases), soft tissue, the skin (e.g., melanoma and squamous cell carcinoma), breast, the genital system (e.g., the uterine cervix, uterine corpus, ovary, vulva, vagina, prostate, testis, and penis), the urinary system (e.g., the urinary bladder, kidney, renal pelvis, and ureter), the eye and orbit, the brain and nervous system (e.g., glioma), and the endocrine
  • the target tissue also can be located in lymphatic or hematopoietic tissues.
  • the tumor can be associated with lymphoma (e.g., Hodgkin's disease and Non-Hodgkin's lymphoma), multiple myeloma, or leukemia (e.g., acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and the like).
  • lymphoma e.g., Hodgkin's disease and Non-Hodgkin's lymphoma
  • multiple myeloma e.g., multiple myeloma
  • leukemia e.g., acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and the like.
  • the tumor to be treated is not necessarily the primary tumor. Indeed, the tumor can be a metastasis of a primary tumor located
  • cancers treatable with a nanoparticle of the invention include, without limitation, acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related lymphoma, AIDS-related malignancies, anal cancer, cerebellar astrocytoma, extrahepatic bile duct cancer, bladder cancer, osteosarcoma/malignant fibrous histiocytoma, brain stem glioma, ependymoma, visual pathway and hypothalamic gliomas, breast cancer, bronchial adenomas/carcinoids, carcinoid tumors, gastrointestinal carcinoid tumors, carcinoma, adrenocortical, islet cell carcinoma, primary central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, clear cell sarcoma of tendon sheaths, colon cancer,
  • retinoblastoma retinoblastoma
  • rhabdomyosarcoma salivary gland cancer
  • malignant fibrous histiocytoma of bone malignant fibrous histiocytoma of bone
  • soft tissue sarcoma sezary syndrome
  • skin cancer small intestine cancer, stomach (gastric) cancer
  • supratentorial primitive neuroectodermal and pineal tumors cutaneous T- cell lymphoma, testicular cancer, malignant thymoma, thyroid cancer, gestational
  • trophoblastic tumor urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, and Wilms' tumor.
  • the cancer is lung cancer, breast cancer, prostate cancer, or cervical cancer.
  • the lung cancer is non-small cell lung cancer (NSCLC).
  • the nanoparticle is administered simultaneously with a cancer therapeutic agent, sequentially with a cancer therapeutic agent, or cyclically with a cancer therapeutic agent.
  • the cancer therapeutic agent can be a chemotherapeutic agent, a biological agent, or radiation treatment.
  • chemotherapeutic agents include platinum compounds (e.g., cisplatin, carboplatin, and oxaliplatin), alkylating agents (e.g., cyclophosphamide, ifosfamide, chlorambucil, nitrogen mustard, thiotepa, melphalan, busulfan, procarbazine, streptozocin, temozolomide, dacarbazine, and bendamustine), antitumor antibiotics (e.g., daunorubicin, doxorubicin, idarubicin, epirubicin, mitoxantrone, bleomycin, mytomycin C, plicamycin, and dactinomycin), taxanes (e.g., paclitaxel and docetaxel), antimetabolites (e.g., 5-fluorouracil, cytarabine, premetrexed, thioguanine, floxuridine, cap
  • Examples of biological agents include monoclonal antibodies (e.g., rituximab, cetuximab, panetumumab, tositumomab, trastuzumab, alemtuzumab, gemtuzumab ozogamicin, and bevacizumab), enzymes (e.g., L-asparaginase), cytokines (e.g., interferons and interleukins), growth factors (e.g., colony stimulating factors and erythropoietin), cancer vaccines, gene therapy vectors, or any combination thereof.
  • monoclonal antibodies e.g., rituximab, cetuximab, panetumumab, tositumomab, trastuzumab, alemtuzumab, gemtuzumab ozogamicin, and bevacizumab
  • enzymes e.g., L-asparaginase
  • This example demonstrates a method for preparing single- and multi-shell calcium phosphate nanoparticles.
  • a target-specific siRNA (XIAP, PARP1 , VEGF, or EGFR) or a siRNA scramble control (Thermo Scientific/Dharmacon, Lafayette, CO) was added to the Ca(N0 3 ) 2 '4H 2 0 solution, and DyLight550 or DyLight775 fluorophore (Thermo Scientific/Pierce, Rockford, IL) was added to the (NH 4 ) 2 HP0 4 solution.
  • the siRNA target sequences were as follows:
  • VEGF (5'-CGATGAAGCCCTGGAGTGC-3') (SEQ ID NO: 4), and
  • Nanoparticles which contained a calcium phosphate first shell with encapsulation of siRNA are denoted as "single-shell" nanoparticles.
  • Single-shell nanoparticles a Ca(N0 3 ) 2 « 4H20 solution (6.25 mM) and a (NH 4 ) 2 HP0 4 solution (3.74 roM) containing doxorubicin (DOX) and a fluorophore were added to the dispersed single-shell nanoparticles, thereby creating "double-shell” nanoparticles.
  • DOX doxorubicin
  • fluorophore fluorophore
  • triple-shell nanoparticles were filtered through an Amicon Ultra- 15 centrifugal filter unit with an Ultracel-100 membrane (EMD Millipore, Billerica, MA) and washed twice with 4-(dimethylamino)pyridine (DMAP; 1 mg/niL) (Thermo Scientific/Pierce, Rockford, IL). The nanoparticles were then incubated in a solution of DMAP (1 mg/niL) and N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC; 25 mg/mL) (Thermo Scientific/Pierce, Rockford, IL) at 4° C for 1 hour.
  • DMAP dimethylamino)pyridine
  • EDC N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride
  • nanoparticles were then washed twice in phosphate buffered saline (PBS) and re-suspended in a 25 mg/mL solution of ⁇ , ⁇ '- bis(2-aminopropyl) polypropylene glycol-block-polyethylene glycol-block-polypropylene glycol 1,900 (Sigma- Aldrich, St. Louis, MO) overnight at 4° C with constant shaking.
  • PBS phosphate buffered saline
  • ⁇ , ⁇ '- bis(2-aminopropyl) polypropylene glycol-block-polyethylene glycol-block-polypropylene glycol 1,900 Sigma- Aldrich, St. Louis, MO
  • the nanoparticles were filtered through an Amicon Ultra- 15 centrifugal filter unit with an Ultracel-100 membrane, washed twice with PBS, and stored at 4° C until use.
  • RNA, DOX, and DyLight550 into the nanoparticles were measured spectrophotometrically at 230 nm, 479 nm, and 550 nm, respectively, using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE).
  • Nanoparticle size distribution was measured by dynamic light scattering using a DynaPro Nanostar machine (Wyatt Technology Corporation, Santa Barbara, CA).
  • the average particle diameters and polydispersity (Pd) indices of single-, double-, and triple-shell nanoparticles incorporating DyLight 550, DOX, and/or negative control siRNA (siCTRL) or siRNA against XIAP (siXIAP) as measured by dynamic light scattering are provided in the following table. Table. Particle diameters and polydispersity (Pd) indices of single-, double-, and triple- shell nanoparticles.
  • NP-DOX-siXIAP-Dy550 triple-shell nanoparticles were assessed by measuring the release of siRNA over a range of pH and temperature.
  • the triple-shell nanoparticles remained stable over the range of pH 4 to pH 10 for up to 45 minutes.
  • the triple-shell nanoparticles also remained stable over the range of 4° C to 42° C for up to 45 minutes.
  • This example demonstrates methods to prepare fluorescently-labeled single-shell nanoparticles comprising a calcium phosphate first shell and a layer of siRNA, double-shell nanoparticles further comprising an endocytosis-enhancing agent, and triple-shell nanoparticles further comprising an additional layer of calcium phosphate and PEG.
  • the cancer cells included four NSCLC cell lines (A549, H292, H520, and SKLU-1 ), a breast cancer cell line (MDA-MB-231), a prostate cancer cell line (PC3), and a cervical cancer cell line (HeLa).
  • the non-cancer cells included normal small airway epithelial cells (SAEC), human mammary epithelial cells (HMEC), and prostate epithelial cells (PrEC). Each cell type was cultured under routine conditions.
  • endocytosis or genestein (GEN), an inhibitor of caveolin-mediated endocytosis, was assessed by pre-treating cells with 10 ⁇ g/mL CPZ, 200 ⁇ GEN, or 400 ⁇ GEN, and then incubating the cells with NP-Dy550 for 30 minutes.
  • Pre-treatment with CPZ had no effect on NP-Dy550 entry into A549, H292, H520, or MDA-MB-231 cancer cells (FIG. 3B).
  • pretreatment with GEN significantly inhibited NP-Dy550 entry into A549, H292, H520, and MDA-MB-231 cancer cells.
  • chemotherapeutic agents including doxorubicin, paclitaxel, and etoposide
  • SAEC, A549, H292, H520, HMEC, MDA-MB- 231, and HeLa cells were pre-treated with non-cytotoxic levels of paclitaxel, doxorubicin (DOX), or etoposide, and then incubated with NP-Dy550 nanoparticles.
  • DOX doxorubicin
  • NP-Dy550 After 30 minutes of incubation with NP-Dy550, the levels of caveolin-1, as assessed by confocal microscopy using Dy633 -labeled anti-caveolin-1 antibodies, were significantly increased in the cancer cells pre-treated with any of the three chemotherapeutics, with the greatest effect observed following pre-treatment with DOX (FIG. 4A). In contrast, caveolin-1 expression levels remained unchanged in non-cancer SAEC and HMEC treated with each of the chemotherapeutics (FIG. 4A). Notably, NP- Dy550 uptake correlated with caveolin-1 expression levels in each of the tested cells (FIG. 4B).
  • Multi-shell calcium phosphate nanoparticles loaded with Dy550 and either DOX (NP-DOX-Dy550) or a scrambled control siRNA (NP-siCTRL-Dy550) were prepared as described in Example 1.
  • H292 cells were incubated with NP-siCTRL-Dy550 or NP-DOX- Dy550 for a 0.5 or 4 hour period. After 0.5 hours, both caveolin-1 levels and the number of internalized nanoparticles were significantly higher in cells treated with NP-DOX-Dy550, as assessed by confocal microscopy using Dy633-labeled anti-caveolin-1 antibodies and Dy550 fluorescence, respectively (FIG. 5).
  • Multi-shell calcium phosphate nanoparticles loaded with Dy550 and DOX (NP- DOX-Dy550), Dy550 and a scrambled control siRNA (NP-siCTRL-Dy550), Dy550 and an siRNA which targets XIAP (NP-siXIAP-Dy550), or Dy550, DOX, and siXIAP (NP-DOX- siXIAP-Dy550) were prepared as described in Example 1.
  • Multi-shell calcium phosphate nanoparticles loaded with siRNA which targets PARP, VEGF, or EGFR, with and without DOX also were prepared as described in Example 1.
  • Hs01076078_ml Hs02758991_gl
  • GAPDH Hs02758991_gl
  • the expression levels of XIAP, PARP, VEGF, and EGFR were normalized to the expression level of GAPDH.
  • H292 cells treated with NP-DOX-siXIAP-Dy550 nanoparticles demonstrated reduced levels of mRNA encoding siXIAP, as assessed by quantitative RT-PCR, as compared to H292 cells treated with NP-siCTRL-Dy550, NP-DOX-Dy550, or NP-siXIAP-Dy550 nanoparticles (FIG. 6A).
  • the levels of mRNAs encoding PARPl , VEGF, and EGFR were not reduced by treatment with NP-DOX-siXIAP-Dy550 nanoparticles (FIG. 6A).
  • NP-DOX-siPARP-Dy550 Target specific reduction of mRNAs encoding PARPl, VEGF, and EGFR was observed by treatment of H292 cells with NP-DOX-siPARP-Dy550, NP-DOX-siVEGF-Dy550, and NP- DOX-siEGFR-Dy550, respectively (FIG. 6A).
  • NP-DOX-siPARP-Dy550 NP-DOX-siVEGF-Dy550
  • NP- DOX-siEGFR-Dy550 NP- DOX-siEGFR-Dy550
  • H292 cells treated with NP-DOX-siXIAP-Dy550 nanoparticles demonstrated reduced levels of XIAP protein expression, as assessed by Western blotting, as compared to untreated H292 cells and H292 cells treated with NP-siCTRL-Dy550, NP-DOX-Dy550, or NP-siXIAP-Dy550 nanoparticles (FIG. 6C).
  • H292 cells treated with NP-DOX-siPARP, NP-DOX-siVEGF, and NP-DOX- siEGFR nanoparticles demonstrated reduced levels of PARP, VEGF, and EGFR protein expression, respectively, as assessed by Western blotting, as compared to H292 cells treated with control nanoparticles containing scrambled siRNA, DOX alone, or target-specific siRNA alone (FIGs. 6E, 6G, 61).
  • SAEC, H292, MDA-MB-231 , and PC3 cells were treated with NP-DOX-siRNA- Dy550 nanoparticles containing siRNA against PARP1, VEGF, or EGFR, and cell viability was determined using the MTT assay.
  • Treatment with NP-DOX-siPARP-Dy550, NP-DOX- siVEGF-Dy550, and NP-DOX-siEGFR-Dy550 nanoparticles resulted in a significant reduction in the viability of H292, MDA-MB-231 , and PC3 cancer cells (FIGs. 6F, 6H, 6 J).
  • mice When tumor volume reached 40-70 mm , the mice were randomized and received either no treatment, or treatment with multi-shell calcium phosphate nanoparticles containing DOX and XIAP siRNA (NP-DOX-siXIAP-Dy755), DOX without siRNA (NP-DOX-Dy755), or siXIAP without DOX (NP-siXIAP-Dy755) administered via tail vein injections twice weekly for 6 total injections.
  • NIR Near-infrared
  • mice were euthanized, and the tumors and organs were harvested and then either snap-frozen in liquid nitrogen for Western blot analysis or embedding into OCT, or fixed in 4% paraformaldehyde for embedding into paraffin.
  • H292 tumor-bearing mice were randomly sorted into 4 treatment groups: (i) untreated, (ii) NP-DOX-Dy755 nanoparticles (8 ⁇ g DOX/dose), (iii) NP-siXIAP-Dy755 nanoparticles (5.8 ⁇ g siRNA/dose), and (iv) NP-DOX-siXIAP-Dy755 nanoparticles (8 ⁇ g DOX/dose and 5.8 ⁇ g siRNA/dose). NIR imaging confirmed that the nanoparticles localized to the tumors following intravenous administrations, and the Dylight755 signal increased in the tumors over successive administrations of nanoparticles.
  • Tumor growth proceeded at similar rates in untreated mice and in mice treated with NP-DOX-Dy755 or NP-siXIAP- Dy755 nanoparticles (FIG. 7A). In contrast, tumor growth was significantly attenuated at days 3, 7, 10, 14, 17, and 21 in mice treated with NP-DOX-siXIAP-Dy755 nanoparticles (FIG. 7A).
  • Tumor-bearing mice treated twice-weekly with NP-DOX-siXIAP-Dy755 were the only group to exhibit tumor-growth arrest over the 22-day treatment period (FIG. 7B).
  • control mice exhibited unchecked tumor growth, resulting in tumors approximately 6-fold larger than those in the NP-DOX-siXIAP-Dy755 group at day 22 (FIG. 7B).
  • Nanoparticle biodistribution was examined in the H292 xenograft model by providing a single tail- vein injection with multi-shell calcium phosphate XIAP siRNA- doxorubicin nanoparticles, and euthanizing a cohort of mice at 48, 72, and 96 hours after injection. Upon euthanasia, tumors and organs were harvested and snap-frozen in liquid nitrogen. Tissues were homogenized in cold homogenization buffer (20 mM tris
  • Tris-HCl (hydroxymethyl) aminomethane hydrochloride
  • 5 mM sodium azide 50 mM sodium chloride, 10 mM 3-mercaptoethanol, and 2 mM phenylmethylsulfonyl fluoride, pH 7.4
  • IX RIP A lysis buffer (Millipore) and IX protease inhibitor (Crystal gen, Inc.) was then centrifuged at 14,000 rpm for 15 minutes at 4° C to obtain the supernatant fraction.
  • 2 HCl (1 1.6 M) was added to 10 of the tissue-derived supernatant and then analyzed at 740 nm using a Nanodrop ND-1000 spectrophotometer.
  • FIG. 8 processing by the intestinal tract.
  • FIG. 8 At 72 hours after injection and thereafter, marked accumulation of nanoparticles was observed in the tumor, which thereafter represented the anatomic site with the highest levels of nanoparticle accumulation (FIG. 8). Renal localization of nanoparticles dramatically diminished by 72 hours, which likely indicated that clearance of the nanoparticles from the vascular compartment had been completed (FIG. 8).
  • Nanoparticle distribution also was assessed in mice that had undergone twice- weekly dosing of NP-DOX-siXIAP-Dy755 nanoparticles for 21 days.
  • the anatomic biodistribution profile of nanoparticles demonstrated that the tumor represented the anatomic site with the highest levels of nanoparticle accumulation (FIG. 8).
  • FIG. 8 There was no significant accumulation of multi-shell nanoparticles in the heart and other bystander organs. 8).
  • the results of this example demonstrate that multi-shell calcium phosphate nanoparticles localize primarily to tumors 72 hours after intravenous injection, and at all timepoints thereafter.

Abstract

L'invention concerne une nanoparticule qui est absorbée efficacement dans des cellules cancéreuses et qui administre efficacement un agent thérapeutique aux cellules cancéreuses. La nanoparticule de l'invention contient une première coquille comportant une première substance de coquille, un agent thérapeutique et un agent favorisant l'endocytose qui est différent de l'agent thérapeutique. L'invention concerne également une composition comportant la nanoparticule et un porteur, ainsi qu'une méthode de traitement du cancer par administration de la nanoparticule à un patient atteint de cancer. L'invention concerne en outre un procédé de préparation d'une nanoparticule à coquilles multiples, ledit procédé entraînant les étapes d'assemblage d'une première coquille comportant une première substance de coquille et un agent thérapeutique, et d'incorporation d'un agent favorisant l'endocytose, qui est différent de l'agent thérapeutique, dans la nanoparticule durant ou après l'assemblage de la première coquille.
PCT/US2013/041542 2012-05-18 2013-05-17 Nanoparticules ayant une entrée améliorée dans des cellules cancéreuses WO2013173693A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261648735P 2012-05-18 2012-05-18
US61/648,735 2012-05-18

Publications (1)

Publication Number Publication Date
WO2013173693A1 true WO2013173693A1 (fr) 2013-11-21

Family

ID=48539404

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/041542 WO2013173693A1 (fr) 2012-05-18 2013-05-17 Nanoparticules ayant une entrée améliorée dans des cellules cancéreuses

Country Status (1)

Country Link
WO (1) WO2013173693A1 (fr)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8822663B2 (en) 2010-08-06 2014-09-02 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US20140255502A1 (en) * 2013-03-06 2014-09-11 National Chiao Tung University Nanoparticle drug carrier, pharmaceutical composition and manufacturing method thereof
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
CN105832702A (zh) * 2015-01-13 2016-08-10 胡尚秀 用于药物传递的蛋白质纳米磁性壳核胶囊及其应用
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US9968688B2 (en) 2014-11-12 2018-05-15 Verily Life Sciences Llc Shielded targeting agents, methods, and in vivo diagnostic system
US10195156B2 (en) 2015-12-22 2019-02-05 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10207010B2 (en) 2015-12-10 2019-02-19 Modernatx, Inc. Compositions and methods for delivery of agents
US10266485B2 (en) 2015-09-17 2019-04-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10857105B2 (en) 2017-03-15 2020-12-08 MordernaTX, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11066355B2 (en) 2019-09-19 2021-07-20 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US11203569B2 (en) 2017-03-15 2021-12-21 Modernatx, Inc. Crystal forms of amino lipids
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US11583504B2 (en) 2016-11-08 2023-02-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US11744801B2 (en) 2017-08-31 2023-09-05 Modernatx, Inc. Methods of making lipid nanoparticles
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations
US11969506B2 (en) 2017-03-15 2024-04-30 Modernatx, Inc. Lipid nanoparticle formulation

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4145410A (en) 1976-10-12 1979-03-20 Sears Barry D Method of preparing a controlled-release pharmaceutical preparation, and resulting composition
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
US6107094A (en) 1996-06-06 2000-08-22 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US6132763A (en) 1988-10-20 2000-10-17 Polymasc Pharmaceuticals Plc Liposomes
WO2007137117A2 (fr) * 2006-05-17 2007-11-29 Massachusetts Institute Of Technology Administration de médicaments dirigée par aptamères
WO2011046934A1 (fr) * 2009-10-12 2011-04-21 Au Jessie L-S Procédés et compositions pour une administration, une expression ou une activité améliorées d'agents d'interférence arn
US20120101148A1 (en) 2009-01-29 2012-04-26 Alnylam Pharmaceuticals, Inc. lipid formulation

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4145410A (en) 1976-10-12 1979-03-20 Sears Barry D Method of preparing a controlled-release pharmaceutical preparation, and resulting composition
US6132763A (en) 1988-10-20 2000-10-17 Polymasc Pharmaceuticals Plc Liposomes
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
US6107094A (en) 1996-06-06 2000-08-22 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
WO2007137117A2 (fr) * 2006-05-17 2007-11-29 Massachusetts Institute Of Technology Administration de médicaments dirigée par aptamères
US20120101148A1 (en) 2009-01-29 2012-04-26 Alnylam Pharmaceuticals, Inc. lipid formulation
WO2011046934A1 (fr) * 2009-10-12 2011-04-21 Au Jessie L-S Procédés et compositions pour une administration, une expression ou une activité améliorées d'agents d'interférence arn

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences, 17th Ed.,", 1990, MACK PUBLISHING CO.
A.R. GENNARO,: "Remington: The Science and Practice ofPharmacy (19th ed.)", 1995, MACK PUBLISHING COMPANY
AMARZGUIOUI ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 316, no. 4, 2004, pages 1050 - 8
BARTH ET AL., ACS NANO, vol. 4, no. 3, 2010, pages 1279 - 1287
BELANGER ET AL., ANTICANCER DRUGS, vol. 14, no. 4, 2003, pages 281 - 287
BRUMMELKAMP ET AL., SCIENCE, vol. 296, 2002, pages 550 - 553
CHARROIS ET AL., J. PHARMACOL. EXP. THER., vol. 306, no. 3, 2003, pages 1058 - 1067
DAVIS ET AL., NATURE, vol. 464, 2010, pages 1067 - 1070
ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 8
GOODMAN; GILMAN'S ET AL.: "The Pharmacological Bases qf Therapeutics, 8th ed.", 1990, PERGAMON PRESS
HUAN MENG ET AL: "Engineered Design of Mesoporous Silica Nanoparticles to Deliver Doxorubicin and P-Glycoprotein siRNA to Overcome Drug Resistance in a Cancer Cell Line", ACS NANO, vol. 4, no. 8, 24 August 2010 (2010-08-24), pages 4539 - 4550, XP055000463, ISSN: 1936-0851, DOI: 10.1021/nn100690m *
KHALIL ET AL., PHARMACOL. REV., vol. 58, 2006, pages 32 - 45
LEE ET AL., NAT. BIOTECH., vol. 20, 2002, pages 500 - 5
LI J ET AL: "Biodegradable calcium phosphate nanoparticle with lipid coating for systemic siRNA delivery", JOURNAL OF CONTROLLED RELEASE, ELSEVIER, AMSTERDAM, NL, vol. 142, no. 3, 19 March 2010 (2010-03-19), pages 416 - 421, XP026930163, ISSN: 0168-3659, [retrieved on 20091115], DOI: 10.1016/J.JCONREL.2009.11.008 *
LI W -M; CHEN S -Y; LIU D -M: "In situ doxorubicin-CaP shell formation on amphiphilic gelatin-iron oxide core as a multifunctional drug delivery system with improved cytocompatibility, pH-responsive drug release and MR imaging", ACTA BIOMATERIALIA, vol. 9, no. 2, 2013, pages 5360 - 5368, XP002711409 *
MAHAPATRO ET AL., J. NANOBIOTECHNOL., vol. 9, 2011, pages 55
MATSUMURA ET AL., CANCER RES., vol. 46, no. 12, 1986, pages 6387 - 6392
MORGAN ET AL., NANO LETT., vol. 8, no. 12, 2008, pages 4108 - 4115
OLTON ET AL., BIOMATERIALS, vol. 32, no. 30, 2011, pages 7662 - 70
REYNOLDS ET AL., NAT. BIOTECH., vol. 22, no. 3, 2004, pages 326 - 30
SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SEUNG KOO LEE; MYUNG SHIN HAN; ASOKAN S; CHING-HSUAN TUNG: "Effective Gene Silencing by Multilayered siRNA-coated Gold Nanoparticles", SMALL, vol. 7, no. 3, 7 February 2011 (2011-02-07), pages 364 - 370, XP002711340 *
SOKOLOVA ET AL., L3IOMATERIAL.S, vol. 27, 2006, pages 3147 - 3153
TABAKOVIC A; KESTER M; ADAIR J H: "Calcium phosphate-based composite nanoparticles in bioimaging and therapeutic delivery applications", WILEY INTERDISCIPLINARY REVIEWS: NANOMEDICINE AND NANOBIOTECHNOLOGY, vol. 4, no. 1, January 2012 (2012-01-01) - February 2012 (2012-02-01), pages 96 - 112, XP002711339 *
TABAKOVIC ET AL., WIRES NANOMED. NANOBIOTECHNOL., vol. 4, 2012, pages 96 - 112
TOBIN LISA A; XIE YILI; TSOKOS MARIA; CHUNG SU I; MERZ ALLISON A; ARNOLD MICHAEL A; LI GUANG; MALECH HARRY L; KWONG KING F: "Pegylated siRNA-loaded calcium phosphate nanoparticle-driven amplification of cancer cell internalization in vivo", BIOMATERIALS, vol. 34, no. 12, April 2013 (2013-04-01), pages 2980 - 2990, XP002711342 *
TOMAYKO ET AL., CANCER CHEMOTHER. PHARMACOL., vol. 24, no. 3, 1989, pages 148 - 154
WEIS ET AL., NATURE, vol. 437, 2005, pages 497 - 504
XU ZHI-XUE; ZHANG RAN; WANG YOU-XIANG; HU QIAO-LING: "A facile approach to construct hybrid multi-shell calcium phosphate gene particles", JOURNAL OF ZHEJIANG UNIVERSITY-SCIENCE B, vol. 11, no. 4, April 2010 (2010-04-01), pages 292 - 297, XP002711341 *
YU YONG HEE; KIM EUNJOONG; PARK DAI EUI; SHIM GAYONG; LEE SANGBIN; KIM YOUNG BONG; KIM CHAN-WHA; OH YU-KYOUNG: "Cationic solid lipid nanoparticles for co-delivery of paclitaxel and siRNA", EUROPEAN JOURNAL OF PHARMACEUTICS AND BIOPHARMACEUTICS, vol. 80, no. 2, February 2012 (2012-02-01), pages 268 - 273, XP002711337 *
ZHANG ET AL., BIOMATERIALS, vol. 23, 2010, pages 6013 - 6018
ZHANG XUE-QING; XU XIAOYANG; LAM ROBERT; GILJOHANN DAVID; HO DEAN; MIRKIN CHAD A: "Strategy for increasing drug solubility and efficacy through covalent attachment to polyvalent DNA-nanoparticle conjugates", ACS NANO, vol. 5, no. 9, 27 September 2011 (2011-09-27), pages 6962 - 6970, XP002711338 *

Cited By (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8822663B2 (en) 2010-08-06 2014-09-02 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9447164B2 (en) 2010-08-06 2016-09-20 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US10064959B2 (en) 2010-10-01 2018-09-04 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9271996B2 (en) 2011-12-16 2016-03-01 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9295689B2 (en) 2011-12-16 2016-03-29 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9050297B2 (en) 2012-04-02 2015-06-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator
US9233141B2 (en) 2012-04-02 2016-01-12 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9220792B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides encoding aquaporin-5
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9220755B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9303079B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9301993B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides encoding apoptosis inducing factor 1
US9216205B2 (en) 2012-04-02 2015-12-22 Moderna Therapeutics, Inc. Modified polynucleotides encoding granulysin
US10501512B2 (en) 2012-04-02 2019-12-10 Modernatx, Inc. Modified polynucleotides
US9192651B2 (en) 2012-04-02 2015-11-24 Moderna Therapeutics, Inc. Modified polynucleotides for the production of secreted proteins
US9149506B2 (en) 2012-04-02 2015-10-06 Moderna Therapeutics, Inc. Modified polynucleotides encoding septin-4
US9114113B2 (en) 2012-04-02 2015-08-25 Moderna Therapeutics, Inc. Modified polynucleotides encoding citeD4
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9089604B2 (en) 2012-04-02 2015-07-28 Moderna Therapeutics, Inc. Modified polynucleotides for treating galactosylceramidase protein deficiency
US9675668B2 (en) 2012-04-02 2017-06-13 Moderna Therapeutics, Inc. Modified polynucleotides encoding hepatitis A virus cellular receptor 2
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9061059B2 (en) 2012-04-02 2015-06-23 Moderna Therapeutics, Inc. Modified polynucleotides for treating protein deficiency
US9221891B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. In vivo production of proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US20140255502A1 (en) * 2013-03-06 2014-09-11 National Chiao Tung University Nanoparticle drug carrier, pharmaceutical composition and manufacturing method thereof
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US9968688B2 (en) 2014-11-12 2018-05-15 Verily Life Sciences Llc Shielded targeting agents, methods, and in vivo diagnostic system
CN105832702A (zh) * 2015-01-13 2016-08-10 胡尚秀 用于药物传递的蛋白质纳米磁性壳核胶囊及其应用
US11220476B2 (en) 2015-09-17 2022-01-11 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10392341B2 (en) 2015-09-17 2019-08-27 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10442756B2 (en) 2015-09-17 2019-10-15 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10266485B2 (en) 2015-09-17 2019-04-23 Modernatx, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US10556018B2 (en) 2015-12-10 2020-02-11 Modernatx, Inc. Compositions and methods for delivery of agents
US10207010B2 (en) 2015-12-10 2019-02-19 Modernatx, Inc. Compositions and methods for delivery of agents
US10485885B2 (en) 2015-12-10 2019-11-26 Modernatx, Inc. Compositions and methods for delivery of agents
US11285222B2 (en) 2015-12-10 2022-03-29 Modernatx, Inc. Compositions and methods for delivery of agents
US10799463B2 (en) 2015-12-22 2020-10-13 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US10195156B2 (en) 2015-12-22 2019-02-05 Modernatx, Inc. Compounds and compositions for intracellular delivery of agents
US11583504B2 (en) 2016-11-08 2023-02-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
US10857105B2 (en) 2017-03-15 2020-12-08 MordernaTX, Inc. Compounds and compositions for intracellular delivery of therapeutic agents
US11203569B2 (en) 2017-03-15 2021-12-21 Modernatx, Inc. Crystal forms of amino lipids
US11969506B2 (en) 2017-03-15 2024-04-30 Modernatx, Inc. Lipid nanoparticle formulation
US11786607B2 (en) 2017-06-15 2023-10-17 Modernatx, Inc. RNA formulations
US11744801B2 (en) 2017-08-31 2023-09-05 Modernatx, Inc. Methods of making lipid nanoparticles
US11066355B2 (en) 2019-09-19 2021-07-20 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US11597698B2 (en) 2019-09-19 2023-03-07 Modernatx, Inc. Branched tail lipid compounds and compositions for intracellular delivery of therapeutic agents
US11524023B2 (en) 2021-02-19 2022-12-13 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same
US11622972B2 (en) 2021-02-19 2023-04-11 Modernatx, Inc. Lipid nanoparticle compositions and methods of formulating the same

Similar Documents

Publication Publication Date Title
WO2013173693A1 (fr) Nanoparticules ayant une entrée améliorée dans des cellules cancéreuses
Norouzi et al. Clinical applications of nanomedicine in cancer therapy
Gu et al. A combination RNAi-chemotherapy layer-by-layer nanoparticle for systemic targeting of KRAS/P53 with cisplatin to treat non–small cell lung cancer
Rui et al. Simultaneous delivery of anti-miR21 with doxorubicin prodrug by mimetic lipoprotein nanoparticles for synergistic effect against drug resistance in cancer cells
Zhang et al. Non-viral nanocarriers for siRNA delivery in breast cancer
AU2013266232B2 (en) Lipid nanoparticle compositions for antisense oligonucleotides delivery
Jing et al. Novel cell-penetrating peptide-loaded nanobubbles synergized with ultrasound irradiation enhance EGFR siRNA delivery for triple negative Breast cancer therapy
Boulikas Molecular mechanisms of cisplatin and its liposomally encapsulated form, Lipoplatin™. Lipoplatin™ as a chemotherapy and antiangiogenesis drug
Dai et al. Aptamer-guided DNA tetrahedron as a novel targeted drug delivery system for MUC1-expressing breast cancer cells in vitro
Wu et al. Nanoparticle-based targeted therapeutics in head-and-neck cancer
Allahou et al. Investigating the application of liposomes as drug delivery systems for the diagnosis and treatment of cancer
Sheikh et al. Recent development of aptamer conjugated chitosan nanoparticles as cancer therapeutics
US20100015050A1 (en) Peg and targeting ligands on nanoparticle surface
JP2008536874A (ja) 中性脂質組成物によるｓｉＲＮＡの送達
Di Filippo et al. Improving temozolomide biopharmaceutical properties in glioblastoma multiforme (GBM) treatment using GBM-targeting nanocarriers
US20210244826A1 (en) Short interfering rna templated lipoprotein particles (sirna-tlp)
Joshi et al. Silencing STAT3 enhances sensitivity of cancer cells to doxorubicin and inhibits tumor progression
WO2018089688A1 (fr) Restauration de la fonction de suppression tumorale au moyen d'un système d'administration à base d'arnm
JP2018534361A (ja) リポソーム製剤のためのｐ−エトキシ核酸
CN102711454B (zh) 用于提高rna干扰剂的递送、表达或活性的方法和组合物
Liu et al. Folate-targeted star-shaped cationic copolymer co-delivering docetaxel and MMP-9 siRNA for nasopharyngeal carcinoma therapy
Sempkowski et al. Liposome-based approaches for delivery of mainstream chemotherapeutics: preparation methods, liposome designs, therapeutic efficacy
Silva‑Cázares et al. Lipid‑based nanoparticles for the therapeutic delivery of non‑coding RNAs in breast cancer
CN103655475B (zh) 靶向的脂质体
Behl et al. Nano-based drug delivery of anticancer chemotherapeutic drugs targeting breast cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13726354

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13726354

Country of ref document: EP

Kind code of ref document: A1