WO2013103659A1 - Stabilisation d'arn par incorporation de nucléosides de terminaison à l'extrémité 3' - Google Patents

Stabilisation d'arn par incorporation de nucléosides de terminaison à l'extrémité 3' Download PDF

Info

Publication number
WO2013103659A1
WO2013103659A1 PCT/US2013/020059 US2013020059W WO2013103659A1 WO 2013103659 A1 WO2013103659 A1 WO 2013103659A1 US 2013020059 W US2013020059 W US 2013020059W WO 2013103659 A1 WO2013103659 A1 WO 2013103659A1
Authority
WO
WIPO (PCT)
Prior art keywords
mrna
luc
cordycepin
rna
cap
Prior art date
Application number
PCT/US2013/020059
Other languages
English (en)
Inventor
Robert E. Rhoads
Wei Su
William F. Marzluff
Original Assignee
Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College
University Of North Carolina At Chapel Hill
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College, University Of North Carolina At Chapel Hill filed Critical Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College
Priority to US14/363,316 priority Critical patent/US20140342402A1/en
Publication of WO2013103659A1 publication Critical patent/WO2013103659A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • This invention pertains to stabilizing RNA molecules by incorporating chain-terminating nucleosides at the 3' terminus, the use of these modified RNA molecules in peptide and protein synthesis, the use of these modified RNA molecules to promote translation, and other uses.
  • RNA Ribonucleic acid
  • RNA Ribonucleic acid
  • mRNA messenger RNA
  • mRNA messenger RNA
  • Polyadenylation also plays a role in transcription termination, export of mR A from the nucleus to the cytosol, and translation. Polyadenylation regulates intracellular molecular activities, including RNA stability and translational efficiency.
  • RNA molecules in vitro with enhanced stability in cell culture, in vitro, or in vivo is useful because it allows one to prepare RNA molecules that can function more efficiently in a variety of biological applications.
  • Such applications include both research applications and commercial production of polypeptides, e.g., producing in a cell-free translation system polypeptides containing an "unnatural" amino acid at a specific site, or producing in cultured cells polypeptides that require post-translational modification for activity or stability.
  • mRNAs with enhanced stability will result in greater production of protein, whether for cultured cells, in vivo, or in vitro.
  • Stabilization of a specific mRNA in eukaryotic cells is of both research and commercial interest because the protein encoded by the mRNA can then be produced in larger quantities, due to a longer exposure of the mRNA to translational machinery. Enhanced production of proteins has many commercial and therapeutic applications.
  • One application of particular interest is the production of cancer antigens for the purpose of immunizing patients against their own tumors.
  • Cancer immunotherapy is an emerging therapy. Several drugs to enhance cancer immunotherapy are currently approved or in clinical trials.
  • One approach to cancer immunotherapy is to introduce mRNAs encoding cancer antigens into dendritic cells, which are a type of antigen-presenting immune cells.
  • RNA Biol. 8, 35-43 Introducing genetic information through RNA rather than DNA allows transient expression of antigens, with essentially no possibility of the long-term complications that can result from the integration of exogenous DNA into the patient's chromosomes.
  • mRNA can be stabilized by incorporating a modified 7-methylguanosine- derived cap that cannot be cleaved by the intracellular pyrophosphatases that are part of the normal mRNA degradation machinery, such as Dcp2.
  • An mRNA with an "uncleavable cap” is more stable within cells. See, e.g., Grudzien-Nogalska et al., 2007, Phosphorothioate cap analogs stabilize mRNA and increase translational efficiency in mammalian cells. RNA 13, 1745-1755; and Su et al, 2011, Translation, stability, and resistance to decapping of mRNAs containing caps substituted in the triphosphate chain with BH 3 , Se, and NH.
  • RNA 17, 978-988 Such modified-cap mRNAs have produced a more robust immunological response in animal models. See, e.g., Kuhn et al, 2010, Phosphorothioate cap analogs increase stability and translational efficiency of RNA vaccines in immature dendritic cells and induce superior immune responses in vivo. Gene Then 17, 961-971. See also U.S. Patent Nos. 7,074,596 and 8,153,773
  • Cordycepin 3'-deoxyadenosine, is a chain terminator that both stops mRNA elongation by RNA polymerase and prevents polyadenylation by poly(A) polymerase after cordycepin has been incorporated at the 3' terminus of an mRNA molecule. See Beach LR, Ross J. 1978. Cordycepin, an inhibitor of newly synthesized globin messenger RNA. J Biol Chem 253: 2628-2632.
  • United States patent application publication no. 2008/020706 discloses a method of mRNA production for use in transfection that involves in vitro transcription of PCR-generated templates with specially designed primers, followed by poly(A) addition, to produce a construct containing sequences in the 3' and 5' untranslated regions ("UTR"), a 5' cap or Internal Ribosome Entry Site (IRES), the gene to be expressed, and a poly(A) tail, typically 50-200 bases in length. It was reported that RNA transfection can be effective in cells that are difficult to transfect efficiently with DNA constructs.
  • UTR 3' and 5' untranslated regions
  • IRS Internal Ribosome Entry Site
  • Histone mRNAs that encode replicative histones (those that are involved in DNA synthesis) are unusual. Histone mRNAs have significant differences from most other mRNA molecules found in eukaryotes. Histone mRNAs are transcribed from genes that do not contain introns, and they do not contain the usual 3 '-terminal poly(A) tail. Instead, these mRNAs have a unique ⁇ 25 or ⁇ 26 nucleotide 3'-terminal stem- loop (SL) secondary structure, located within the 3'-UTR at the 3' end, that both stabilizes the mRNA against intracellular degradation and promotes translational efficiency.
  • SL stem- loop
  • poly(A) mRNAs do not contain an SL but rather contain a 3'- terminal poly(A) tract of -25-300 (or longer) nucleotides. See Marzluff et al, 2008, Metabolism and regulation of canonical histone mRNAs: life without a poly(A) tail. Nat. Rev. Genet. 9, 843-854. Histone mRNAs are stabilized during DNA synthesis and are degraded once DNA synthesis ceases. An early step in histone mRNA degradation is the addition of uridyl residues to the 3 '-terminus, forming an oligo(U) tail, which in turn recruits mRNA degradation enzymes.
  • Histone mRNA is an ancient and early-evolved type of mRNA molecule in eukaryotes. Eukaryotes have developed a highly-conserved machinery to degrade SL-containing mRNAs, one that differs substantially from the machinery that is used for degrading the more common, polyadenylated mRNAs.
  • the SL is recognized by a stem-loop binding protein (SLBP) that is essential for histone pre -mRNA processing, as well as for translation and regulated stability.
  • SLBP stem-loop binding protein
  • the histone 3'-terminal stem- loop is necessary for translation in Chinese hamster ovary cells.
  • the protein that binds the 3' end of histone mRNA A novel RNA-binding protein required for histone pre-mRNA processing. Genes Dev 10: 3028-3040; Sanchez R, Marzluff WF. 2002.
  • the stem-loop binding protein is required for efficient translation of histone mRNA in vivo and in vitro. Mol Cell Biol 22: 7093-7104.
  • PABPs nuclear and cytoplasmic poly(A)-binding proteins
  • the SL-containing histone mRNAs are transcribed from genes that do not contain introns and hence do not undergo a process of precursor maturation by exon splicing.
  • poly(A)-containing mRNAs are transcribed from genes containing introns, and in eukaryotic cells (including human cells), the great majority of these poly(A)-containing mRNAs (>99% of all mRNAs) must undergo splicing for maturation and export from the nucleus.
  • SL-containing and poly(A)-containing mRNAs are quite different.
  • the stability of SL-containing mRNAs changes dramatically during the cell cycle; whereas most poly(A)-containing mRNAs are not regulated as a function of the cell cycle, and those that are sensitive to the phase of the cell cycle are instead regulated by different mechanisms.
  • SL-containing mRNAs are stable while DNA is being synthesized (during S phase), and they become unstable when DNA synthesis stops (either during other phases of the cell cycle, or when DNA synthesis is blocked during S phase by drugs such as hydroxyurea or cytosine arabinoside). See Kaygun H, Marzluff WF. 2005.
  • poly(A)-containing mRNAs undergo progressive shortening by deadenylation of the poly(A) tract until they reach a length where PABP is unable to bind (less than ⁇ 25 nt).
  • the residual oligo(A) tract forms a binding site for the Lsml-7 heptamer.
  • Deadenylation leads to decapping by the Dcpl-Dcp2 complex at the 5' end, followed by 5'-to-3' exonucleolytic digestion of the RNA by Xrnl .
  • the mRNA can be degraded from the 3' end by the exosome. See Chen CY, Shyu AB. 2011. Mechanisms of deadenylation-dependent decay. Wiley Interdiscip Rev RNA 2: 167-183.
  • microRNAs The processing and stability of microRNAs (miRNAs) are also regulated via oligouridylation-dependent pathways.
  • Lin28 recruits the TUTase Zcchcl l to inhibit let-7 maturation in mouse embryonic stem cells. Nat Struct Mol Biol 16: 1021-1025; and Lehrbach et al., 2009, LIN-28 and the poly(U) polymerase PUP -2 regulate let-7 microRNA processing in Caenorhabditis elegans. Nat Struct Mol Biol 16, 1016-1020.
  • the mRNA contains a 3' histone stem-loop (SL) sequence within the 3' UTR.
  • SL histone stem-loop
  • a chain-terminating nucleoside is incorporated, for example 3'-deoxyadenosine (cordycepin).
  • the chain-terminating nucleoside blocks the addition of a 3'-terminal oligo(U) tract to an mRNA containing the histone stem-loop.
  • the 3 '-terminal oligo(U) tract cannot be added, degradation of the mRNA is retarded.
  • the mRNA is thereby stabilized, and more protein can then be synthesized as the mRNA is available to the translational machinery for a longer time.
  • a preferred chain-terminating nucleoside is 3'-deoxyadenosine (cordycepin).
  • Other chain-terminating nucleosides may also be used, including for example 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, or 3'-deoxythymine.
  • Other modifications to the 3' end of the RNA that prevent or inhibit oligo(U) addition may also be used.
  • 2',3'-dideoxynucleosides such as 2',3'- dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'- dideoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or a -O- methylnucleoside.
  • an oligonucleotide that terminates in a 3'- deoxynucleoside or in a 2',3'-dideoxynucleoside may also be used; as may 3'-0- methylnucleosides, 3'-0-ethylnucleosides, 3'-arabinosides, and other modified nucleosides.
  • cordycepin or other modified nucleosides can also stabilize mRNAs that have an ordinary 3'-poly(A) tail. See Fig. 5. But in that case, unlike an SL-containing RNA, the stabilization also required a cap structure that is resistant to cleavage by the decapping enzyme Dcp2 (Fig. 5B and Table III). In RNAs that lacked a decapping-resistant cap structure, we observed only minimal stabilization of the 3' sequences of poly(A) mRNA, and no stabilization of 5' sequences following the 3'-addition of cordycepin (Fig. 5A and Table III). These observations further confirmed that poly(A)-containing RNA and SL-containing RNA are degraded by different mechanisms. Our observations suggest that a previously unreported mechanism is likely to be involved.
  • Stabilizing a protein-encoding mRNA leads to greater protein production in cells.
  • the novel method can thus be used to increase the synthesis of specific proteins.
  • a particularly promising example is the use of the novel method in cancer immunotherapy, to introduce mRNA that encodes cancer-specific antigens into dendritic cells.
  • the novel method may be used to stabilize mRNA in the production of any physiological or non-physiological protein.
  • Figures 1A-1B illustrate the stabilizing effect of the chain-terminator cordycepin on ARCA-Luc-SL mRNA and BTH-Luc-SL mRNA in HeLa cells.
  • Figure 1 A shows the loss of 5' and 3' sequences for ARCA-Luc-SL with (filled symbols) or without ⁇ open symbols) cordycepin modification.
  • Figure IB shows the loss of 5' and 3' sequences for BTH-Luc-SL with (filled symbols) or without ⁇ open symbols) cordycepin modification.
  • Figures 2A-2B illustrate the absence of any stabilizing effect of cordycepin on ARCA-Luc-SL and BTH-Luc-SL that contained a 10-nt oligo(U) tract prior to nucleoporation.
  • Figure 2A shows the loss of 5' and 3' sequences for ARCA-Luc-SL- Uio with (filled symbols) or without ⁇ open symbols) cordycepin modification.
  • Figure 2B shows the loss of 5' and 3' sequences for BTH-Luc-SL-Uio with (filled symbols) or without ⁇ open symbols) cordycepin modification.
  • Figures 3A-3B illustrate the stabilizing effect of cordycepin on ARCA- Luc-SL and BTH-Luc-SL that were added with hydroxyurea (HU) treatment.
  • Figure 3A shows the destabilization of ARCA-Luc-SL with the addition of HU immediately after nucleoporation ⁇ open symbols), and the stabilization of ARCA-Luc-SL with cordycepin modification prior to the addition of HU treatment (filled symbols).
  • Figure 3B shows the destabilization of BTH-Luc-SL with the addition of HU immediately after nucleoporation ⁇ open symbols), and shows the stabilization of BTH-Luc-SL with cordycepin modification prior to the addition of HU treatment (filled symbols).
  • Figures 4A-4C illustrate the effect of cordycepin incorporation and the translational efficiency of cordycepin-modified mR As.
  • Figure 4 A shows that 3'- terminal addition of cordycepin was over 95% effective in preventing further addition of ATP by poly(A) polymerase.
  • Figure 4B shows that addition of 3'-terminal cordycepin to either ARCA-Luc-SL or BTH-Luc-SL did not significantly alter their translational efficiencies in HeLa cells.
  • the results shown in Figure 4B are corrected for the amount of mRNA present; because there was more mRNA in the cordycepin samples at later times, there was greater total protein production.
  • Figure 4C shows that the addition of 3'-terminal cordycepin to either ARCA-Luc-SL-Uio or BTH-Luc- SL-Uio did not significantly alter their translational efficiencies in HeLa cells.
  • Figures 5A-5B illustrate the effect of cordycepin incorporation on polyadenylated mRNA and its rate of degradation when the mRNA contained an uncleavable cap.
  • Figure 5 A shows that the loss of 5' and 3' sequences for ARCA-Luc- A74 with (filled symbols) or without ⁇ open symbols) cordycepin modification showed no statistically significant difference.
  • Figure 5B shows that the loss of 5' and 3' sequences of BTH-Luc-A 74 was significantly slowed by cordycepin modification (filled symbols) compared to unmodified BTH-Luc-A74 ⁇ open symbols).
  • pLuc-A 6 o was constructed as previously described (Grudzien et al., 2006, Differential inhibition of mRNA degradation pathways by novel cap analogs. J Biol Chem 281 , 1857-1867).
  • pT7-Luc-SL and pT7- Luc-TL were constructed and linearized as previously described (Gallie et al., 1996, The histone 3 '-terminal stem- loop is necessary for translation in Chinese hamster ovary cells. Nucleic Acids Res 24, 1954-1962. The linearized plasmids served as templates for in vitro synthesis of mRNAs as previously described (Su et al., 2011).
  • the SL sequence used in the DNA constructs to generate the mRNA was 5' CAAAGGTCTTTTCAGAGCCAC 3 * (SEQ ID NO:7), reflecting the structure of the cytosolic histone mRNA that results from trimming three nucleotide residues from the histone mRNA after processing in the nucleus. See Mullen and Marzluff, 2008, and Fig. 1 in Su et al, 20133, mRNAs containing the histone 3' stem- loop are degraded primarily by decapping mediated by oligouridylation of the 3' end. RNA 19, 1-16.
  • Cells for synchronization (1 x 10 6 ) were seeded onto 150- mm dishes and synchronized by double-thymidine block (following the procedure of Jackman & O'Connor, 2001, Methods for synchronizing cells at specific stages of the cell cycle. Current Protocols in Cell Biology: John Wiley & Sons, Inc). Cells were released from double-thymidine block on the day of nucleoporation, detached from plates 3 h after release (middle of S-phase), and subjected to nucleoporation as described previously (Su et al., 2011).
  • Sequences from the 3'-end of Luc mRNA were amplified with 5'- ATCGTGGATTACGTCGCCAGTCAA-3 * (SEQ ID NO:3) and 5 * - TTTCCGCCCTTCTTGGCCTTTATG-3 * (SEQ ID NO:4).
  • Human 18S rRNA levels were measured by the same method and in the same RNA samples with primers 5'- CGAGCCGCCTGGATACC-3 * (SEQ ID NO:5) and 5 * - C AGTTCCG AAAACC AAC AAAATAG A-3 ' (SEQ ID NO:6).
  • Amplification and detection were performed with the iCycler IQ real time PCR detection system in 25- ⁇ 1 reaction mixtures containing 5 ⁇ 1 of the transcription reaction mixture (50 ng of cDNA), 12.5 ⁇ of IQ SYBRgreen Supermix, and 0.3 mM primers (Bio-Rad).
  • the incubation conditions were 3 min at 95°C for polymerase activation, followed by 40 cycles, of 15 s each at 95°C and 1 min each at 60°C.
  • Luciferase mRNA levels were calculated using the absolute standard curve method as described in the iCycler iQTM Real-time PCR Detection System Instruction Manual (catalog number 170-8740).
  • Luciferase mRNA was normalized for the amount of 18S rRNA in each sample, which is an indicator of total cellular RNA purified from each cell extract.
  • KaleidaGraph SaleidaGraph (Synergy Software, Reading, PA, version 3.06) was used for nonlinear least-squares fitting of decay data.
  • Cordycepin incorporation Cordycepin to produce either ARCA-Luc- SL* or BTH-Luc-SL* was incorporated via a 100- ⁇ 1 reaction mixture that contained 0.2 ⁇ ARCA-Luc-SL or BTH-Luc-SL mRNA, respectively, l x poly(A) polymerase (PAP) reaction buffer (Affymetrix), 100 ⁇ cordycepin 5 '-triphosphate (Sigma), 1 U/ ⁇ of RNase Inhibitor (Applied Biosystems), and 2400 units of yeast PAP (Affymetrix). The reaction mixture was incubated at 37°C for 1 h.
  • PAP poly(A) polymerase
  • ARCA-Luc-SL contained: i) an "anti-reverse cap analog" (ARC A) at the 5'-end, ii) the coding region of firefly luciferase mRNA, and iii) the 3 '-untranslated region of a histone mRNA at the 3 '-end, including the SL.
  • ARCAs Anti-reverse cap analogs
  • Typical ARCAs are described in U.S. Patent No. 7,074,596. They can be used to prevent the incorporation of the cap dinucleotide in the reverse orientation during the T7 RNA polymerase reaction. Typical ARCAs are described in U.S. Patent No. 7,074,596. They can be used to prevent the incorporation of the cap dinucleotide in the reverse orientation during the T7 RNA polymerase reaction. Typical ARCAs are described in U.S. Patent No. 7,074,596. They can be used to prevent the incorporation of the cap dinucleotide in the reverse orientation during the
  • RNA 9, 1108-1122 See Stepinski et al, 2001, Synthesis and properties of mRNAs containing the novel "anti-reverse” cap analogues 7-methyl(3'-0-methyl)GpppG and 7-methyl(3 * -deoxy)GpppG.
  • RNA 7, 1486-1495 and m 2 7 ' 2*" °GpppG (See Jemielity et al, 2003, Novel "anti-reverse” cap analogues with superior translational properties. RNA 9, 1108-1122).
  • mRNAs containing the natural cap do not differ substantially either in translational efficiency or in stability from mRNAs containing ARCAs, presumably because the 2'- and 3 '-positions of the guanosine moiety in m 7 GpppG are not involved in cap recognition by the translational cap- binding protein eIF4E, or by the decapping pyrophosphatase Dcp2.
  • ARCA-Luc-SL* was the same as ARCA-Luc-SL, except that a 3'-terminal cordycepin residue was incorporated, as described above.
  • BTH-Luc-SL contained an alternative cap, m 7 GppBH3pm 7 G, in which a ⁇ non-bridging oxygen atom was substituted with BH 3 .
  • the BTH cap analog (Borano Two-Headed) is described in U.S. Patent Application Publication No. 2011/0092574 and in Su et al., 2011.
  • the BH 3 modification inhibits cleavage of pyrophosphate by Dcp2, and thus stabilizes mRNA in vivo by retarding 5' ⁇ 3' degradation.
  • BTH-Luc-SL* was the same as BTH-Luc-SL, except that a 3'-terminal cordycepin residue was incorporated, as described above.
  • ARCA-Luc-SL and BTH-Luc-SL were synthesized by in vitro transcription of the plasmid pT7-Luc-SL, which contains the firefly luciferase coding region under control of the T7 promoter, and a wild-type histone mRNA 3'- untranslated region containing the SL at the 3'-end (Gallie et al., 1996, The histone 3'- terminal stem- loop is necessary for translation in Chinese hamster ovary cells. Nucleic Acids Res. 24, 1954-1962).
  • the plasmid was cut with restriction enzyme Aflll at a site immediately downstream of the SL.
  • ARCA-Luc-SL and BTH-Luc-SL were synthesized by T7 polymerase in the presence of ARCA and BTH, respectively.
  • the procedures for synthesis and purification of mRNAs were as otherwise described in Su et al., 2011. [0045]
  • Four additional mRNAs were synthesized to study the effect of pre- uridylating the mRNAs.
  • We synthesized pre-uridylated reporter mRNAs by inserting 10 T residues in the DNA template after the sequence for Luc-SL, resulting in an mRNA that contained 10 U residues located 3' to the SL.
  • Both ARCA-Luc-SL-Uio and BTH-Luc-SL-Uio were synthesized as otherwise described above. Each was modified with cordycepin to produce ARCA-Luc-SL-Uio* and BTH-Luc-SL-Uio*, respectively, as otherwise described above.
  • the mRNAs transcribed from p/wc-A 7 4 contained the coding region for firefly luciferase followed by a poly(A) tract of 74 nucleotide residues, with no heterologous (non-A) nucleotide residues downstream from the poly (A) tract.
  • the various mRNAs were introduced into HeLa cells by nucleoporation. HeLa cells were synchronized by double thymidine block, and the various mRNAs were introduced at S phase by nucleoporation. Cells were lysed at the indicated times, and Luc-SL mRNA was measured by quantitative real time PCR using primer sets that amplified sequences at either the 5'-end or the 3'-end of Luc-SL mRNA. Data were plotted as a percentage of the luciferase mRNA present immediately after nucleoporation.
  • the t 1 ⁇ 2 was calculated for the post-lag period.
  • a pre- uridylated reporter mRNA was synthesized by inserting 10 A residues in the DNA template after the sequence for Luc-SL, resulting in an mRNA that contained 10 U residues located 3' to the SL. Both ARCA-Luc-SL-Uio and BTH-Luc-SL-Uio were synthesized, and each was modified with cordycepin to produce ARCA-Luc-SL-Uio* and BTH-Luc-SL-Uio*, respectively.
  • Cordycepin-modified, pre-uridylated mRNA was expected to be destabilized by HU treatment. However, we observed the opposite result.
  • HU treatment had no effect on the rate of loss of either 5' or 3' sequences during either the lag phase or the rapid-decay phase ( Figure 3B versus IB, filled symbols, and Table II, lines 9 and 10). This observation was also true for ARCA-Luc- SL* ( Figure 3 A versus 1 A, filled symbols, and Table II, lines 3 and 4). In fact, the lag phase for decay of 3' sequences was actually lengthened by HU treatment.
  • cordycepin modification was found to have no effect on the translational efficiency of either ARCA-Luc-SL or BTH-Luc-SL (Figure 4B).
  • the observed translational efficiencies for ARCA-Luc-SL-Uio and BTH- Luc-SL-Uio were about half those of their unmodified counterparts ( Figure 4C).
  • incorporation of cordycepin did not alter translational efficiencies ( Figure 4C).
  • the diminished translation of pre-uridylated mRNAs may be due to interference in the SL-SLBP interaction by proteins that bind to oligo(U), such as Lsml-7, which are also known to recruit inhibitors of translation (Coller & Parker, 2005, General translational repression by activators of mRNA decapping. Cell 122, 875-886).
  • aData are from Figs. 1A-1B for Luc-SL mRNAs and Figs. 5A-5B for Luc-A 74 mRNAs. Values represent the % of the initial mRNA introduced into cells remaining two hours after nucleoporation.
  • the novel technique can be used to produce an mRNA encoding essentially any protein of interest.
  • the mRNA is more stable when introduced into cells, and therefore the mRNA yields a greater amount of the protein product because the mRNA is available to the translational machinery for a longer time.
  • proteins of high commercial interest There are many proteins of high commercial interest that may be produced with the novel technique.
  • One application of immediate therapeutic value is the synthesis of cancer antigens in dendritic cells in order to immunize a patient against the patient's own cancer. The dendritic cells then stimulate T-cells, to marshal the patient's own immune system against cancer cells. See, e.g., Kuhn A, Diken M, Kreiter S, Vallazza B, Tureci O, Sahin U. 2011.
  • RNA Biol 8 35-43; Kuhn et al., 2010, Phosphorothioate cap analogs increase stability and translational efficiency of RNA vaccines in immature dendritic cells and induce superior immune responses in vivo. Gene Ther 17, 961-971.
  • compositions and methods within the scope of the present invention include, but are not limited to, the following:
  • a method of synthesizing, in vitro or in vivo, an RNA molecule as described comprising reacting ATP, CTP, UTP, and GTP, a chain- terminating nucleoside triphosphate as described, and a polynucleotide template in the presence of RNA polymerase, under conditions conductive to transcription by the RNA polymerase of the polynucleotide template into an RNA copy; whereby some of the RNA copies will incorporate the composition to make an RNA molecule as described, containing both an SL region and a chain-terminating nucleoside.
  • cordycepin may be incorporated at the 3' terminus of the RNA molecule with yeast poly(A) polymerase (PAP).
  • RNA polymerase e.g., RNA polymerase
  • chain-terminating nucleosides may be incorporated by chemical condensation using methods otherwise known in the art.
  • a method for synthesizing a protein or peptide in vitro comprising translating an RNA molecule as described in a cell-free protein synthesis system, wherein the RNA molecule comprises an open reading frame, under conditions conductive to translating the open reading frame of the RNA molecule into the protein or peptide encoded by the open reading frame.
  • a method for synthesizing a protein or peptide in vivo or in cultured cells comprising translating an RNA molecule as described in vivo or in cultured cells, wherein the RNA molecule comprises an open reading frame, under conditions conductive to translating the open reading frame of the RNA molecule into the protein or peptide encoded by the open reading frame.
  • a method of synthesizing, in vitro or in vivo, an RNA molecule as described comprising reacting ATP, CTP, UTP, GTP, and a polynucleotide template in the presence of R A polymerase, under conditions conductive to transcription by the RNA polymerase of the polynucleotide template into an RNA copy, followed by the addition of a chain-terminating nucleoside at the 3' end of the RNA; whereby some of the RNA copies will incorporate the composition to make an RNA molecule as described.
  • a method for synthesizing a protein or peptide in vivo or in cultured cells from an RNA molecule as described with a 3' chain-terminating nucleoside wherein said method synthesizes the protein or polypeptide in an amount that is at least 1.25 times, 1.5 times, 2 times, 3 times, 5 times, 8 times, 10 times, 15 times, or 20 times greater than would be synthesized by an otherwise-identical method using an otherwise-identical RNA molecule that lacked a 3' chain-terminating nucleoside.
  • RNA molecule as described, wherein the RNA molecule does not comprise a 3' poly(A) tail; wherein a poly(A) tail is a tract that contains 10 or more, 15 or more, 20 or more, or 25 or more contiguous adenine residues without any intervening nucleosides other than adenine.
  • SL-containing mRNAs are expected to be more stable during S phase, so it is preferred (although not required) to use the novel method to produce proteins primarily during S phase in cultured cells.
  • S-phase cells are the only cells that contain SLBR
  • one could modify the system to work during other phases of the cell cycle by adding an mRNA (either in the same molecule or a different molecule) that expresses SLBR See, e.g., Sanchez and Marzluff, 2002, The stem-loop binding protein is required for efficient translation of histone mRNA in vivo and in vitro. Mol Cell Biol 2002. 22(20):7093-104.
  • one of several possible ways to selectively decrease poly(A)-dependent translation without affecting SL-dependent translation would be to down-regulate intracellular levels of PABP with siRNA or miRNA. Another possibility would be to place the PABP gene under the control of a less efficient promoter. Still another possibility would be to overexpress Paip2 (an inhibitor of PABP); to do this transiently, one could transfect the cells with Paip2 mRNA. See Karim MM, Svitkin YV, Kahvejian A, De Crescenzo G, Costa-Mattioli M, Sonenberg N. 2006. A mechanism of translational repression by competition of Paip2 with eIF4G for poly(A) binding protein (PABP) binding. PNAS 103: 9494-9499.
  • oncogene mRNAs are polyadenylated. For example, it has been reported that in myelomas and human T-cell leukemias, c-myc mRNA is stabilized and translated at a level seven times greater than the corresponding wild-type gene. See Hollis GF, Gazdar AF, Bertness V, Kirsch IR. 1988. Complex translocation disrupts c-myc regulation in a human plasma cell myeloma. Mol Cell Biol 8: 124-129. It could be beneficial to suppress the global translation levels of poly(A)-containing mRNA, while SL-containing anti-tumor mRNAs are expressed at unsuppressed levels.
  • our invention allows the production in cells of higher quantities of a specific protein encoded by a synthetic RNA.
  • the translational machinery engages with the mRNA longer.
  • Many mRNAs compete for available translational machinery.
  • the mRNAs with higher translational efficiencies have an advantage over other mRNAs, and their protein products are relatively more abundant (all else being equal).
  • our novel, synthetic, SL-containing mRNA has a translational advantage over all poly(A)-containing mRNAs generally. Therefore, more of the specific protein is produced.
  • the invention may also be used to stabilize microRNAs.
  • MicroRNAs can be used, for example, to silence a particular gene of interest.
  • miRNAs are vulnerable to rapid degradation following transfection into cells.
  • SL-containing mRNAs miRNAs undergo an oligouridylation-dependent breakdown pathway.
  • the novel method may therefore also be used to stabilize these miRNAs, and thus to enhance RNA interference and the knock-down effect of these molecules.
  • the novel method may also be used to stabilize any other type of RNA that undergoes a uridylation step to initiate degradation. For example, some polyadenylated mRNAs in S. pombe are also uridylated.
  • miRNAs are oligouridylated in Arabidopsis thaliana, and that the oligouridylation triggers degradation of the miRNAs.
  • Methylation protects miRNAs and siRNAs from a 3'-end uridylation activity in Arabidopsis. Current Biology 15: 1501-1507.
  • Uridylation of pre-miRNAs in the cytoplasm prevents maturation by dicer, and results in the degradation immature products. See Heo I, Joo C, Kim Y-K, Ha M, Yoon M-J, Cho J, Yeom K-H, Han J, Kim VN. 2009.
  • TUT4 in concert with Lin28 suppresses microRNA biogenesis through pre -microRNA uridylation.
  • NTA non-template additions
  • the particular 3' NTA for specific miRNAs has been observed to change following differentiation of human embryonic stem cells, suggesting that post-transcriptional nucleotide addition is a physiologically regulated process in humans. See Wyman SK, Knouf EC, Parkin RK, Fritz BR, Lin DW, Dennis LM, Krouse MA, Webster PJ, Tewari M. 2011.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne un procédé pour la stabilisation d'ARNm contenant une tige-boucle d'histone par l'addition d'un nucléoside de terminaison. Le nouvel ARNm synthétique contient une séquence de tige-boucle d'histone en 3'. A l'extrémité 3' de l'ARNm, un nucléoside de terminaison est incorporé, par exemple 3'-désoxyadénosine (cordycépine). Le nucléoside de terminaison bloque l'addition d'une oligo(U) séquence à l'extrémité 3' à l'ARNm contenant la tige-boucle d'histone. Quand l'oligo(U) séquence à l'extrémité 3' ne peut pas être ajoutée, la dégradation de l'ARNm est retardée. L'ARNm reste ensuite disponible pour la machinerie traductionnelle pendant plus longtemps, conduisant à des taux plus élevés de synthèse protéinique.
PCT/US2013/020059 2012-01-04 2013-01-03 Stabilisation d'arn par incorporation de nucléosides de terminaison à l'extrémité 3' WO2013103659A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/363,316 US20140342402A1 (en) 2012-01-04 2013-01-03 Stabilizing RNA by Incorporating Chain-Terminating Nucleosides at the 3'-Terminus

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261583043P 2012-01-04 2012-01-04
US61/583,043 2012-01-04
US201261734557P 2012-12-07 2012-12-07
US61/734,557 2012-12-07

Publications (1)

Publication Number Publication Date
WO2013103659A1 true WO2013103659A1 (fr) 2013-07-11

Family

ID=48745389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/020059 WO2013103659A1 (fr) 2012-01-04 2013-01-03 Stabilisation d'arn par incorporation de nucléosides de terminaison à l'extrémité 3'

Country Status (1)

Country Link
WO (1) WO2013103659A1 (fr)

Cited By (80)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014081507A1 (fr) 2012-11-26 2014-05-30 Moderna Therapeutics, Inc. Arn modifié à son extrémité terminale
WO2014093924A1 (fr) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Molécules d'acide nucléique modifiées et leurs utilisations
WO2014113089A2 (fr) 2013-01-17 2014-07-24 Moderna Therapeutics, Inc. Polynucléotides capteurs de signal servant à modifier les phénotypes cellulaires
WO2014152211A1 (fr) 2013-03-14 2014-09-25 Moderna Therapeutics, Inc. Formulation et administration de compositions de nucléosides, de nucléotides, et d'acides nucléiques modifiés
WO2014152540A1 (fr) 2013-03-15 2014-09-25 Moderna Therapeutics, Inc. Compositions et procédés de modification des taux de cholestérol
WO2015034925A1 (fr) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Polynucléotides circulaires
WO2015034928A1 (fr) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Polynucléotides chimériques
WO2015051214A1 (fr) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucléotides codant pour un récepteur de lipoprotéines de faible densité
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
WO2017049245A2 (fr) 2015-09-17 2017-03-23 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques
WO2017066791A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm à substitution sucre
WO2017066781A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm à liaison phosphate modifié
WO2017066789A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm avec sucre modifié
WO2017066782A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffes d'arnm hydrophobes
WO2017066793A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffes arnm et procédés de coiffage d'arnm
WO2017112865A1 (fr) 2015-12-22 2017-06-29 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques et/ou prophylactiques
WO2017127750A1 (fr) 2016-01-22 2017-07-27 Modernatx, Inc. Acides ribonucléiques messagers pour la production de polypeptides de liaison intracellulaires et leurs procédés d'utilisation
WO2017218704A1 (fr) 2016-06-14 2017-12-21 Modernatx, Inc. Formulations stabilisées de nanoparticules lipidiques
WO2018081459A1 (fr) 2016-10-26 2018-05-03 Modernatx, Inc. Acides ribonucléiques messagers pour l'amélioration de réponses immunitaires et leurs méthodes d'utilisation
WO2018089540A1 (fr) 2016-11-08 2018-05-17 Modernatx, Inc. Formulations stabilisées de nanoparticules lipidiques
WO2018144775A1 (fr) 2017-02-01 2018-08-09 Modernatx, Inc. Compositions thérapeutiques immunomodulatrices d'arnm codant pour des peptides de mutation d'activation d'oncogènes
JP2018527003A (ja) * 2015-09-17 2018-09-20 モデルナティエックス インコーポレイテッドＭｏｄｅｒｎａＴＸ，Ｉｎｃ． 安定化尾部領域を含むポリヌクレオチド
WO2018170336A1 (fr) 2017-03-15 2018-09-20 Modernatx, Inc. Formulation de nanoparticules lipidiques
WO2018170306A1 (fr) 2017-03-15 2018-09-20 Modernatx, Inc. Composés et compositions d'administration intracellulaire d'agents thérapeutiques
WO2018213789A1 (fr) 2017-05-18 2018-11-22 Modernatx, Inc. Arn messager modifié comprenant des éléments d'arn fonctionnels
WO2018232120A1 (fr) 2017-06-14 2018-12-20 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents
WO2019036638A1 (fr) 2017-08-18 2019-02-21 Modernatx, Inc. Procédés de préparation d'arn modifié
WO2019046809A1 (fr) 2017-08-31 2019-03-07 Modernatx, Inc. Procédés de fabrication de nanoparticules lipidiques
EP3461904A1 (fr) 2014-11-10 2019-04-03 ModernaTX, Inc. Molécules d'acide nucléique de remplacement contenant une quantité réduite d'uracile et leurs utilisations
WO2019152557A1 (fr) 2018-01-30 2019-08-08 Modernatx, Inc. Compositions et procédés destinés à l'administration d'agents à des cellules immunitaires
WO2019200171A1 (fr) 2018-04-11 2019-10-17 Modernatx, Inc. Arn messager comprenant des éléments d'arn fonctionnels
WO2020003006A2 (fr) 2018-06-28 2020-01-02 Crispr Therapeutics Ag Compositions et procédés d'édition génomique par insertion de polynucléotides donneurs
WO2020056304A1 (fr) 2018-09-14 2020-03-19 Modernatx, Inc. Procédés et compositions pour le traitement du cancer faisant appel à des agents thérapeutiques à base d'arnm
WO2020061367A1 (fr) 2018-09-19 2020-03-26 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques
WO2020061457A1 (fr) 2018-09-20 2020-03-26 Modernatx, Inc. Préparation de nanoparticules lipidiques et leurs méthodes d'administration
WO2020097409A2 (fr) 2018-11-08 2020-05-14 Modernatx, Inc. Utilisation d'arnm codant pour ox40l pour traiter le cancer chez des patients humains
WO2020160430A1 (fr) 2019-01-31 2020-08-06 Modernatx, Inc. Mélangeurs à tourbillon et procédés, systèmes, et appareils associés
WO2020160397A1 (fr) 2019-01-31 2020-08-06 Modernatx, Inc. Procédés de préparation de nanoparticules lipidiques
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
WO2020227510A1 (fr) 2019-05-07 2020-11-12 Modernatx, Inc. Polynucléotides servant à perturber l'activité de cellule immunitaire et procédés pour les utiliser
WO2020225606A1 (fr) 2019-05-08 2020-11-12 Crispr Therapeutics Ag Systèmes de vecteurs crispr/cas en deux parties pour le traitement de dmd
WO2020227537A1 (fr) 2019-05-07 2020-11-12 Modernatx, Inc Microarn de cellules immunitaires exprimés de manière différentielle pour la régulation de l'expression de protéines
US10849920B2 (en) 2015-10-05 2020-12-01 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
WO2020257325A1 (fr) 2019-06-17 2020-12-24 Vertex Pharmaceuticals Inc. Compositions et procédés pour l'édition de bêta-globine pour le traitement d'hémoglobinopathies
WO2020263985A1 (fr) 2019-06-24 2020-12-30 Modernatx, Inc. Arn messager comprenant des éléments d'arn fonctionnels et leurs utilisations
WO2020263883A1 (fr) 2019-06-24 2020-12-30 Modernatx, Inc. Arn messager résistant à l'endonucléase et utilisations correspondantes
US10898574B2 (en) 2011-03-31 2021-01-26 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
WO2021026358A1 (fr) 2019-08-07 2021-02-11 Moderna TX, Inc. Compositions et méthodes pour une administration améliorée d'agents
WO2021050986A1 (fr) 2019-09-11 2021-03-18 Modernatx, Inc. Agents thérapeutiques à base d'arnm à formulation lnp et leur utilisation pour le traitement de sujets humains
US11027025B2 (en) 2013-07-11 2021-06-08 Modernatx, Inc. Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use
WO2021204179A1 (fr) 2020-04-09 2021-10-14 Suzhou Abogen Biosciences Co., Ltd. Vaccins à base d'acide nucléique pour coronavirus
WO2021204175A1 (fr) 2020-04-09 2021-10-14 Suzhou Abogen Biosciences Co., Ltd. Compositions de nanoparticules lipidiques
WO2021243207A1 (fr) 2020-05-28 2021-12-02 Modernatx, Inc. Utilisation d'arnm codant pour ox40l, il-23 et il-36gamma pour le traitement du cancer
WO2022002040A1 (fr) 2020-06-30 2022-01-06 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2022020811A1 (fr) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Nanoparticule de nanoparticule lipidique comprenant des nucléotides modifiés
WO2022032154A2 (fr) 2020-08-06 2022-02-10 Modernatx, Inc. Compositions pour l'administration de molécules de charge utile à l'épithélium des voies respiratoires
WO2022037652A1 (fr) 2020-08-20 2022-02-24 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
US11377470B2 (en) 2013-03-15 2022-07-05 Modernatx, Inc. Ribonucleic acid purification
WO2022150712A1 (fr) 2021-01-08 2022-07-14 Strand Therapeutics, Inc. Constructions d'expression et leurs utilisations
WO2022152141A2 (fr) 2021-01-14 2022-07-21 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques conjugués polymères et compositions de nanoparticules lipidiques
WO2022152109A2 (fr) 2021-01-14 2022-07-21 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2022247755A1 (fr) 2021-05-24 2022-12-01 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2023009421A1 (fr) 2021-07-26 2023-02-02 Modernatx, Inc. Procédés de préparation de compositions de nanoparticules lipidiques
WO2023009422A1 (fr) 2021-07-26 2023-02-02 Modernatx, Inc. Procédés de préparation de compositions de nanoparticules lipidiques pour l'administration de molécules de charge utile à l'épithélium des voies respiratoires
EP4159741A1 (fr) 2014-07-16 2023-04-05 ModernaTX, Inc. Procédé de production d'un polynucléotide chimérique pour coder un polypeptide ayant une liaison internucléotidique contenant un triazole
EP4162950A1 (fr) 2021-10-08 2023-04-12 Suzhou Abogen Biosciences Co., Ltd. Vaccins d'acide nucléique pour coronavirus
WO2023056917A1 (fr) 2021-10-08 2023-04-13 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2023056914A1 (fr) 2021-10-08 2023-04-13 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2023064469A1 (fr) 2021-10-13 2023-04-20 Modernatx, Inc. Compositions de protéines de fusion d'il15 codées par arnm et leurs procédés d'utilisation
WO2023086465A1 (fr) 2021-11-12 2023-05-19 Modernatx, Inc. Compositions pour l'administration de molécules de charge utile à l'épithélium des voies respiratoires
WO2023092060A1 (fr) 2021-11-18 2023-05-25 Cornell University Commutateurs d'arnm dépendant de microarn pour des thérapies à base d'arnm spécifiques de tissu
WO2023154818A1 (fr) 2022-02-09 2023-08-17 Modernatx, Inc. Méthodes et formulations d'administration par voie muqueuse
WO2023196988A1 (fr) 2022-04-07 2023-10-12 Modernatx, Inc. Procédés d'utilisation d'arnm codant pour il-12
WO2023199113A1 (fr) 2022-04-15 2023-10-19 Smartcella Solutions Ab Compositions et procédés d'administration à médiation par des exosomes d'agents d'arnm
WO2023212618A1 (fr) 2022-04-26 2023-11-02 Strand Therapeutics Inc. Nanoparticules lipidiques comprenant un réplicon d'encéphalite équine du vénézuela (vee) et leurs utilisations
WO2023215498A2 (fr) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions et procédés pour un antagonisme de cd28
WO2024037578A1 (fr) 2022-08-18 2024-02-22 Suzhou Abogen Biosciences Co., Ltd. Composition de nanoparticules lipidiques
WO2024089633A1 (fr) 2022-10-27 2024-05-02 Pfizer Inc. Molécules d'arn codant pour le vrs-f et vaccins les contenant
WO2024097639A1 (fr) 2022-10-31 2024-05-10 Modernatx, Inc. Anticorps se liant à hsa et protéines de liaison et leurs utilisations

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DATABASE PUBMED accession no. 1447710 *
DATABASE PUBMED accession no. 2923259 *
GALLIE DANIEL R. ET AL.: "The histone 3'terminal stem-loop is necessary for translation in Chinese hamster ovary cells", NUCLEIC ACIDS RESEARCH, vol. 24, no. 10, 1996, pages 1954 - 1962, XP002616165 *
JEMIELITY J. ET AL.: "Novel ''anti-reverse'' cap analogs with superior translational properties", RNA, vol. 9, no. 9, 2003, pages 1108 - 1122, XP002378472 *
LI JUNJIE ET AL.: "Methylation protects miRNAs and siRNAs from a 3'-end uridylation activity in Arabidopsis", CURRENT BIOLOGY, vol. 15, 2005, pages 1501 - 1507, XP005035182 *
MULLEN THOMAS E. ET AL.: "Degradation of histone mRNA requires oligouridylation followed decapping and simultaneous degradation of the mRNA both 5'to 3'and 3'to 5'».", GENES & DEVELOPMENT, vol. 22, 2008, pages 50 - 65, XP055081240 *
SIEV MOSHE ET AL.: "The selective interruption of nucleolar RNA sythesis in HeLa cells by cordicepin.", THE JOURNAL OF CELL BIOLOGY, vol. 41, 1996, pages 510 - 520, XP003031531 *
SU W. ET AL.: "Translation, stability, and resistance to decapping ofmRNAs containing caps substituted in the triphosphate chain with BH3, Se and NH", RNA, 17 May 2011 (2011-05-17), pages 978 - 988, XP055081245 *
SU WEI ET AL.: "mRNAs containing the histone 3'stem-loop are degraded primarily by decapping mediated by oligouridylation of 3'end.", EZNA, vol. 19, no. 1, 27 November 2012 (2012-11-27), pages 1 - 16 *

Cited By (106)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10898574B2 (en) 2011-03-31 2021-01-26 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US11911474B2 (en) 2011-03-31 2024-02-27 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
JP2015535430A (ja) * 2012-11-26 2015-12-14 モデルナ セラピューティクス インコーポレイテッドＭｏ 末端修飾ｒｎａ
EP4074834A1 (fr) 2012-11-26 2022-10-19 ModernaTX, Inc. Arn à terminaison modifiée
JP2018164458A (ja) * 2012-11-26 2018-10-25 モデルナティエックス インコーポレイテッドＭｏｄｅｒｎ 末端修飾ｒｎａ
WO2014081507A1 (fr) 2012-11-26 2014-05-30 Moderna Therapeutics, Inc. Arn modifié à son extrémité terminale
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US10925935B2 (en) 2012-11-26 2021-02-23 Modernatx, Inc. Terminally Modified RNA
US10155029B2 (en) 2012-11-26 2018-12-18 Modernatx, Inc. Terminally modified RNA
JP2017140048A (ja) * 2012-11-26 2017-08-17 モデルナティエックス インコーポレイテッドＭｏｄｅｒｎ 末端修飾ｒｎａ
WO2014093924A1 (fr) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Molécules d'acide nucléique modifiées et leurs utilisations
EP3434774A1 (fr) 2013-01-17 2019-01-30 ModernaTX, Inc. Polynucléotides capteurs de signal servant à modifier les phénotypes cellulaires
US11708396B2 (en) 2013-01-17 2023-07-25 Modernatx, Inc. Signal-sensor polynucleotides for the alteration of cellular phenotypes
WO2014113089A2 (fr) 2013-01-17 2014-07-24 Moderna Therapeutics, Inc. Polynucléotides capteurs de signal servant à modifier les phénotypes cellulaires
WO2014152211A1 (fr) 2013-03-14 2014-09-25 Moderna Therapeutics, Inc. Formulation et administration de compositions de nucléosides, de nucléotides, et d'acides nucléiques modifiés
US11377470B2 (en) 2013-03-15 2022-07-05 Modernatx, Inc. Ribonucleic acid purification
US11845772B2 (en) 2013-03-15 2023-12-19 Modernatx, Inc. Ribonucleic acid purification
WO2014152540A1 (fr) 2013-03-15 2014-09-25 Moderna Therapeutics, Inc. Compositions et procédés de modification des taux de cholestérol
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US11027025B2 (en) 2013-07-11 2021-06-08 Modernatx, Inc. Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use
WO2015034925A1 (fr) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Polynucléotides circulaires
WO2015034928A1 (fr) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Polynucléotides chimériques
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
WO2015051214A1 (fr) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucléotides codant pour un récepteur de lipoprotéines de faible densité
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
EP4159741A1 (fr) 2014-07-16 2023-04-05 ModernaTX, Inc. Procédé de production d'un polynucléotide chimérique pour coder un polypeptide ayant une liaison internucléotidique contenant un triazole
EP3461904A1 (fr) 2014-11-10 2019-04-03 ModernaTX, Inc. Molécules d'acide nucléique de remplacement contenant une quantité réduite d'uracile et leurs utilisations
EP4286012A2 (fr) 2015-09-17 2023-12-06 ModernaTX, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques
EP3736261A1 (fr) 2015-09-17 2020-11-11 ModernaTX, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques
JP2018527003A (ja) * 2015-09-17 2018-09-20 モデルナティエックス インコーポレイテッドＭｏｄｅｒｎａＴＸ，Ｉｎｃ． 安定化尾部領域を含むポリヌクレオチド
EP4101930A1 (fr) 2015-09-17 2022-12-14 ModernaTX, Inc. Polynucléotides contenant une région de queue de stabilisation
WO2017049245A2 (fr) 2015-09-17 2017-03-23 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques
EP3350333A4 (fr) * 2015-09-17 2019-09-04 ModernaTX, Inc. Polynucléotides contenant une région de queue de stabilisation
US10849920B2 (en) 2015-10-05 2020-12-01 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
US11590157B2 (en) 2015-10-05 2023-02-28 Modernatx, Inc. Methods for therapeutic administration of messenger ribonucleic acid drugs
EP4086269A1 (fr) 2015-10-16 2022-11-09 ModernaTX, Inc. Analogues de capuchon d'arnm avec liaison de phosphate modifiée
WO2017066782A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffes d'arnm hydrophobes
WO2017066791A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm à substitution sucre
WO2017066789A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm avec sucre modifié
WO2017066793A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffes arnm et procédés de coiffage d'arnm
WO2017066781A1 (fr) 2015-10-16 2017-04-20 Modernatx, Inc. Analogues de coiffe d'arnm à liaison phosphate modifié
EP4036079A2 (fr) 2015-12-22 2022-08-03 ModernaTX, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques et/ou prophylactiques
WO2017112865A1 (fr) 2015-12-22 2017-06-29 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques et/ou prophylactiques
WO2017127750A1 (fr) 2016-01-22 2017-07-27 Modernatx, Inc. Acides ribonucléiques messagers pour la production de polypeptides de liaison intracellulaires et leurs procédés d'utilisation
WO2017218704A1 (fr) 2016-06-14 2017-12-21 Modernatx, Inc. Formulations stabilisées de nanoparticules lipidiques
WO2018081459A1 (fr) 2016-10-26 2018-05-03 Modernatx, Inc. Acides ribonucléiques messagers pour l'amélioration de réponses immunitaires et leurs méthodes d'utilisation
WO2018089540A1 (fr) 2016-11-08 2018-05-17 Modernatx, Inc. Formulations stabilisées de nanoparticules lipidiques
WO2018144775A1 (fr) 2017-02-01 2018-08-09 Modernatx, Inc. Compositions thérapeutiques immunomodulatrices d'arnm codant pour des peptides de mutation d'activation d'oncogènes
WO2018170306A1 (fr) 2017-03-15 2018-09-20 Modernatx, Inc. Composés et compositions d'administration intracellulaire d'agents thérapeutiques
EP4186888A1 (fr) 2017-03-15 2023-05-31 ModernaTX, Inc. Composé et compositions pour l'administration intracellulaire d'agents thérapeutiques
WO2018170336A1 (fr) 2017-03-15 2018-09-20 Modernatx, Inc. Formulation de nanoparticules lipidiques
WO2018213789A1 (fr) 2017-05-18 2018-11-22 Modernatx, Inc. Arn messager modifié comprenant des éléments d'arn fonctionnels
EP4253544A2 (fr) 2017-05-18 2023-10-04 ModernaTX, Inc. Arn messager modifié comprenant des éléments d'arn fonctionnels
WO2018232120A1 (fr) 2017-06-14 2018-12-20 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents
WO2019036638A1 (fr) 2017-08-18 2019-02-21 Modernatx, Inc. Procédés de préparation d'arn modifié
WO2019046809A1 (fr) 2017-08-31 2019-03-07 Modernatx, Inc. Procédés de fabrication de nanoparticules lipidiques
WO2019152557A1 (fr) 2018-01-30 2019-08-08 Modernatx, Inc. Compositions et procédés destinés à l'administration d'agents à des cellules immunitaires
WO2019200171A1 (fr) 2018-04-11 2019-10-17 Modernatx, Inc. Arn messager comprenant des éléments d'arn fonctionnels
WO2020003006A2 (fr) 2018-06-28 2020-01-02 Crispr Therapeutics Ag Compositions et procédés d'édition génomique par insertion de polynucléotides donneurs
US11332760B2 (en) 2018-06-28 2022-05-17 Crispr Therapeutics Ag Compositions and methods for genomic editing by insertion of donor polynucleotides
WO2020056304A1 (fr) 2018-09-14 2020-03-19 Modernatx, Inc. Procédés et compositions pour le traitement du cancer faisant appel à des agents thérapeutiques à base d'arnm
WO2020061367A1 (fr) 2018-09-19 2020-03-26 Modernatx, Inc. Composés et compositions pour l'administration intracellulaire d'agents thérapeutiques
WO2020061457A1 (fr) 2018-09-20 2020-03-26 Modernatx, Inc. Préparation de nanoparticules lipidiques et leurs méthodes d'administration
WO2020097409A2 (fr) 2018-11-08 2020-05-14 Modernatx, Inc. Utilisation d'arnm codant pour ox40l pour traiter le cancer chez des patients humains
WO2020160397A1 (fr) 2019-01-31 2020-08-06 Modernatx, Inc. Procédés de préparation de nanoparticules lipidiques
WO2020160430A1 (fr) 2019-01-31 2020-08-06 Modernatx, Inc. Mélangeurs à tourbillon et procédés, systèmes, et appareils associés
WO2020227537A1 (fr) 2019-05-07 2020-11-12 Modernatx, Inc Microarn de cellules immunitaires exprimés de manière différentielle pour la régulation de l'expression de protéines
WO2020227510A1 (fr) 2019-05-07 2020-11-12 Modernatx, Inc. Polynucléotides servant à perturber l'activité de cellule immunitaire et procédés pour les utiliser
WO2020225606A1 (fr) 2019-05-08 2020-11-12 Crispr Therapeutics Ag Systèmes de vecteurs crispr/cas en deux parties pour le traitement de dmd
WO2020257325A1 (fr) 2019-06-17 2020-12-24 Vertex Pharmaceuticals Inc. Compositions et procédés pour l'édition de bêta-globine pour le traitement d'hémoglobinopathies
WO2020263883A1 (fr) 2019-06-24 2020-12-30 Modernatx, Inc. Arn messager résistant à l'endonucléase et utilisations correspondantes
WO2020263985A1 (fr) 2019-06-24 2020-12-30 Modernatx, Inc. Arn messager comprenant des éléments d'arn fonctionnels et leurs utilisations
WO2021026358A1 (fr) 2019-08-07 2021-02-11 Moderna TX, Inc. Compositions et méthodes pour une administration améliorée d'agents
WO2021050986A1 (fr) 2019-09-11 2021-03-18 Modernatx, Inc. Agents thérapeutiques à base d'arnm à formulation lnp et leur utilisation pour le traitement de sujets humains
WO2021204179A1 (fr) 2020-04-09 2021-10-14 Suzhou Abogen Biosciences Co., Ltd. Vaccins à base d'acide nucléique pour coronavirus
WO2021204175A1 (fr) 2020-04-09 2021-10-14 Suzhou Abogen Biosciences Co., Ltd. Compositions de nanoparticules lipidiques
WO2021243207A1 (fr) 2020-05-28 2021-12-02 Modernatx, Inc. Utilisation d'arnm codant pour ox40l, il-23 et il-36gamma pour le traitement du cancer
WO2022002040A1 (fr) 2020-06-30 2022-01-06 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2022020811A1 (fr) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Nanoparticule de nanoparticule lipidique comprenant des nucléotides modifiés
WO2022032154A2 (fr) 2020-08-06 2022-02-10 Modernatx, Inc. Compositions pour l'administration de molécules de charge utile à l'épithélium des voies respiratoires
WO2022037652A1 (fr) 2020-08-20 2022-02-24 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2022150712A1 (fr) 2021-01-08 2022-07-14 Strand Therapeutics, Inc. Constructions d'expression et leurs utilisations
WO2022152141A2 (fr) 2021-01-14 2022-07-21 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques conjugués polymères et compositions de nanoparticules lipidiques
WO2022152109A2 (fr) 2021-01-14 2022-07-21 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2022247755A1 (fr) 2021-05-24 2022-12-01 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2023009422A1 (fr) 2021-07-26 2023-02-02 Modernatx, Inc. Procédés de préparation de compositions de nanoparticules lipidiques pour l'administration de molécules de charge utile à l'épithélium des voies respiratoires
WO2023009421A1 (fr) 2021-07-26 2023-02-02 Modernatx, Inc. Procédés de préparation de compositions de nanoparticules lipidiques
EP4162950A1 (fr) 2021-10-08 2023-04-12 Suzhou Abogen Biosciences Co., Ltd. Vaccins d'acide nucléique pour coronavirus
WO2023056917A1 (fr) 2021-10-08 2023-04-13 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2023056914A1 (fr) 2021-10-08 2023-04-13 Suzhou Abogen Biosciences Co., Ltd. Composés lipidiques et compositions de nanoparticules lipidiques
WO2023064469A1 (fr) 2021-10-13 2023-04-20 Modernatx, Inc. Compositions de protéines de fusion d'il15 codées par arnm et leurs procédés d'utilisation
WO2023086465A1 (fr) 2021-11-12 2023-05-19 Modernatx, Inc. Compositions pour l'administration de molécules de charge utile à l'épithélium des voies respiratoires
WO2023092060A1 (fr) 2021-11-18 2023-05-25 Cornell University Commutateurs d'arnm dépendant de microarn pour des thérapies à base d'arnm spécifiques de tissu
WO2023154818A1 (fr) 2022-02-09 2023-08-17 Modernatx, Inc. Méthodes et formulations d'administration par voie muqueuse
WO2023196988A1 (fr) 2022-04-07 2023-10-12 Modernatx, Inc. Procédés d'utilisation d'arnm codant pour il-12
WO2023199113A1 (fr) 2022-04-15 2023-10-19 Smartcella Solutions Ab Compositions et procédés d'administration à médiation par des exosomes d'agents d'arnm
WO2023212618A1 (fr) 2022-04-26 2023-11-02 Strand Therapeutics Inc. Nanoparticules lipidiques comprenant un réplicon d'encéphalite équine du vénézuela (vee) et leurs utilisations
WO2023215498A2 (fr) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions et procédés pour un antagonisme de cd28
WO2024037578A1 (fr) 2022-08-18 2024-02-22 Suzhou Abogen Biosciences Co., Ltd. Composition de nanoparticules lipidiques
WO2024089633A1 (fr) 2022-10-27 2024-05-02 Pfizer Inc. Molécules d'arn codant pour le vrs-f et vaccins les contenant
WO2024097639A1 (fr) 2022-10-31 2024-05-10 Modernatx, Inc. Anticorps se liant à hsa et protéines de liaison et leurs utilisations

Similar Documents

Publication Publication Date Title
WO2013103659A1 (fr) Stabilisation d'arn par incorporation de nucléosides de terminaison à l'extrémité 3'
US20230313268A1 (en) Methods for rna analysis
EP3317424B1 (fr) Procédé d'analyse d'une molécule d'arn
US20230295709A1 (en) Linear double stranded dna coupled to a single support or a tag and methods for producing said linear double stranded dna
EP3155129B1 (fr) Procédé d'amélioration de la production d'arn
WO2006004648A1 (fr) Methodes et compositions permettant de preparer un arn coiffe
WO2014152030A1 (fr) Elimination de fragments d'adn dans des procédés de production d'arnm
EP1021549A2 (fr) THERAPIES GENIQUES A BASE D'ARNm SENS
US20230151317A1 (en) In Vitro Manufacturing And Purification Of Therapeutic mRNA
Yu et al. The mechanism of variability in transcription start site selection
AU2019355177A1 (en) Methods and compositions for increasing capping efficiency of transcribed RNA
EP3090060B1 (fr) Procédés d'analyse d'arn
Stiefel et al. Noncoding RNAs, post-transcriptional RNA operons and Chinese hamster ovary cells
US20140342402A1 (en) Stabilizing RNA by Incorporating Chain-Terminating Nucleosides at the 3'-Terminus
CN109628442B (zh) mRNA及其制备方法和应用
EP4069843A1 (fr) Compositions d'acides nucléiques
Zheng Molecular mechanism of miRNA biogenesis and double-stranded RNA processing in RNA interference pathway
WO2019232640A1 (fr) Procédé d'identification et de conception d'agents d'interférence arn

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13733869

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13733869

Country of ref document: EP

Kind code of ref document: A1