WO2013078690A1

WO2013078690A1 - Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof

Info

Publication number: WO2013078690A1
Application number: PCT/CN2011/083410
Authority: WO
Inventors: 古洁若
Original assignee: Gu Jieruo
Priority date: 2011-12-03
Filing date: 2011-12-03
Publication date: 2013-06-06
Also published as: CN103502469A; CN103502469B

Abstract

Disclosed in the present invention application is an ankylosing spondylitis susceptibility detection method, the method comprising: detecting a base on the mononucleotide polymorphism site rs13198903 of a sample, the ankylosing spondylitis susceptibility noticeably increasing when the base is T. Also disclosed are a corresponding kit and use thereof.

Description

Method for detecting susceptibility single nucleotide polymorphism of ankylosing spondylitis, kit and application thereof

The invention relates to a detection method, a kit and an application thereof for a susceptibility single nucleotide polymorphism (SNP) of ankylosing spondylitis, and belongs to the technical field of medical detection.

Background technique

Ankylosing spondylitis (AS) is a subtype of spondyloarthropathies (SPA). Its main clinical manifestations are central axis manifestations such as inflammatory low back pain, morning stiffness, and restricted spinal activity, or / and concurrent peripheral arthritis, tendon end, ligament attachment point inflammation, to the advanced stage of the disease, there will be spinal rigidity or deformity. Previous studies have suggested that the role of genetic factors plays a more important role in the pathogenesis of AS, and previous twin-based studies have shown that high consistent incidence in monozygotic and fraternal twins suggests genetic factors. The role in the pathogenesis of AS exceeds 90%.

In the course of research on AS pathogenic genes, HLA-B27 is an important gene that is also thought to be related to the genetic aggregation of AS family. However, in terms of genetic risk, the study concluded that the total genetic risk of HLA-B27 in disease is only about 20-30%, and the proportion of the whole MHC is about 40-50%. MHC, also known as the major histocompatibility complex, is a tightly linked group of genes encoding major histocompatibility antigens on a chromosome of the vertebrate, associated with immune responses, immune regulation, and transplant rejection. Studies have shown that in monozygotic twins, the consistent probability of HLA-B27 is 63%, and the consistent probability of HLA-B27 in twins twins is 23%. Studies have also shown that: HLA-B27-positive first-degree relatives in AS patients are 6-16 times more likely to have a family history of HLA-B27-positive individuals, suggesting that non-HLA-B27 familial factors are present in the disease. Development also plays an important role. This opens up a whole new way of thinking about the mechanism of the occurrence and development of ankylosing spondylitis. Through the whole-genome SNP chip scanning and analysis, we can find the susceptible SNP associated with ankylosing spondylitis and explore the ankylosing spondylitis. Pathogenic or susceptible genes.

Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by single nucleotide variation at the genomic level, which is the most common type of human heritable variation. , accounting for more than 90% of all known polymorphisms. SNPs are widespread in the human genome, with an average of one in every 500 to 1000 base pairs, with an estimated total of 3 million or more. The polymorphisms exhibited by SNPs involve only a single base variation, which can be caused by a single base transition or transversion, or by the insertion or deletion of a base. In genomic DNA, any base may be mutated, so SNPs may be both within the gene sequence and possibly non-coding sequences outside the gene. In general, the SNP (coding SNP, cSNP) located in the coding region is relatively small, because in the exon, the mutation rate is only 1/5 of the surrounding sequence, but it is of great significance in the study of hereditary diseases. Therefore, the research of cSNP is more concerned. From the perspective of the influence on the genetic traits of organisms, cSNP can be further divided into two types: one is synonymous cSNP (synonymous cSNP), that is, the change of the coding sequence caused by SNP does not affect the amino acid sequence of the translated protein. The mutated base has the same meaning as the unmutated base; the other is a non-synonymous cSNP, which means that the change in the base sequence can change the protein sequence translated by the blueprint, thereby affecting the protein. The function, this change is often the direct cause of changes in biological traits, about half of cSNPs are non-synonymous cSNPs; in addition, SNPs can also be used as genetic markers to help find and identify disease susceptibility genes.

In 2007, Brown et al. performed a full scan and verification of a large sample of AS patients and healthy volunteers based on a self-made intensive SNP chip. It also pointed out that the two genes IL23R and ARTS1 may be new to AS. Sense gene, followed by the research of ARTS1 gene in Korean and Chinese research institutions, the results suggest that ARTS1 is associated with AS; Chinese research institutions have also verified IL-23R, the results No correlation was found between the two, suggesting that there may be differences between different populations. Moreover, although the above-mentioned Brown's research in 2007 used a dense SNP chip, the chip did not perform a full scan of the dense SNP for this genome, but only customized the intensive SNP chip for the location of interest, thus causing the chip. Omissions occur in other areas that are not covered or where the SNP mark is not sufficiently dense. So in 2010, Brown and other Illumina HumHap 370 chips were used to fully scan and validate the European, American and North American AS patients and healthy volunteers in the European race. The results were found in addition to the ARTS1 and IL-23R proposed in the previous study. ^Because it may be the susceptibility gene of AS, it also suggests that ANTXR may also be associated with AS, and also suggests that there are SNPs associated with AS in 2pl5 and 21q22.

With the rapid development of chip technology, the Illumina HumHap 370 chip has a new generation of Illumina Human lM-duo chips, Illumina Human 610-Quad chip and Illumina OmniExpress chip to provide more dense SNP mark, covering a wider range of areas. Considering the research background mentioned above, we designed a full-sweep and correlation analysis in the Chinese Han AS patients and healthy volunteers with Illumina Human lM-duo chip, Illumina Human 610-Quad chip and Illumina OmniExpress chip. Genome-wide association analysis (GWAS) to explore whether AS-related susceptibility genes can be found.

Because ankylosing spondylitis is a relatively common disease, the course of the disease is lingering, and it is easy to cause disability, it should be an early diagnosis and treatment, especially for young people aged 16-25. In order to strengthen the early diagnosis of ankylosing spondylitis, there is an urgent need to find SNPs that are closely related to ankylosing spondylitis, and to design methods and kits for detecting the specificity of ankylosing spondylitis.

So far, for the diagnosis of ankylosing spondylitis, in addition to the clinical judgment and imaging data to assist the judgment, there is no specific laboratory diagnostic indicators and corresponding methods and kits for the specific diagnosis of the disease. Report. Summary of the invention

The present invention provides an early and specific method for detecting susceptibility to ankylosing spondylitis in view of the deficiencies of the current detection methods and related kits in the early diagnosis of ankylosing spondylitis. And its kit.

Through intensive and extensive research, the present invention firstly discovered and proved SNP rsl3198903 and tonicity through a dense genome-wide SNP chip for genome-wide association analysis of large samples of ankylosing spondylitis patients and healthy control populations. There is a significant correlation between spondylitis (the SNP base is risky when it is τ, and it is protected when it is C, P SxlO- ³²⁴ (OR=43.63). Therefore, SNP rsl3198903 can be used as a specificity for detecting susceptibility to ankylosing spondylitis. SNP is an important auxiliary indicator for early diagnosis of ankylosing spondylitis. Rs is the abbreviation of reference SNP ID. After ncbi has classified all submitted SNPs, it will give an rs number, also called reference SNP, and Give specific information about the SNP, including the sequence before and after, location information, distribution frequency, and so on.

One of the objects of the present application is to provide a nucleotide fragment of a single nucleotide polymorphism (SNP) for detecting the susceptibility to ankylosing spondylitis, which is at the SNP rsl3198903 site, AS patient base The frequency of T is significantly higher than that of healthy controls. Conversely, the frequency of base C is significantly lower than that of healthy controls. When the base at rsl3198903 is T, the susceptibility to ankylosing spondylitis is significantly increased.

One of the objects of the present application is to provide a method for detecting susceptibility to ankylosing spondylitis by the following scheme: obtaining a nucleotide sequence from a sample to be tested, and detecting a base at a position of rsl3198903 When the base is T, the susceptibility to ankylosing spondylitis is significantly increased.

Further, the sample to be tested includes blood, body fluid or tissue.

Further, the method includes the following steps:

1. Extract DNA from the sample to be tested;

2. Using the DNA as a template, design a PCR primer for the coding region near the base of rsl3198903 Carrying out a PCR reaction to obtain a PCR reaction product;

3. Detecting the base sequence composition of the PCR reaction product;

4. Determine whether the base at the rsl3198903 locus in the obtained base sequence is T.

Further, in the above method, the method of obtaining the nucleotide sequence from the sample to be tested further comprises real-time PCR, denaturing high-performance liquid chromatography, restriction fragment length polymorphism or ligase detection or gene sequencing.

One of the objects of the present application is to provide a method for detecting a susceptibility to a single nucleotide polymorphism of ankylosing spondylitis, the method comprising the steps of:

1. Primer design:

PCR amplification primers for rsl3198903 site were designed using Primer3.0 software;

2. Tissue, cells and blood samples DNA extraction:

DNA from tissues, cells or blood samples was extracted using the TIANamp Blood DNA kit or NucleoSpin Tissue (MN), quantified by spectrophotometry, agarose gel electrophoresis, and the quality of the qualified DNA was adjusted to 5 ( ig / L, -20 ° C storage standby;

3. PCR amplification:

Using multiplex PCR amplification technology, the total volume of each reaction is 5μ1, including template DNA 10 η^, Hotstar Taq 0.5 U, amplification primers 0.5pmol each, 25mM dNTP Ο.ΐμΐ, reaction conditions are 94 °C for 4 minutes; 94 °C20 seconds, 60 °C for 30 seconds, 72 °C for 1 minute, 30 cycles; 72°C for 3 minutes; 4°C

00 ;

4. Purification of PCR products:

The PCR reaction product was treated with 0.5 U SAP (shrimp alkaline phosphatase) to remove free dNTPs from the system. The reaction system was 7 μΐ, of which the PCR product was 5 μΐ, the SAP mixture was 2 μΐ (SAP 0.5 U, buffer 0.17 μΐ), and the reaction procedure was 37. °C 20 minutes; 85 °C 5 minutes; 40 °C ∞; 5. PCR product sequencing

The purified product was detected by conventional DNA sequencing methods for base mutations. We are using the BigDye ® Terminator v3.1 kit from Applied Biosystems (CA, USA) at ABI PRISM® 3100 (Applied Biosystems, CA, USA). Sequencing on a genetic analyzer. The single base detected at the rsl3198903 locus was analyzed, and if the base of the locus was T, the susceptibility to ankylosing spondylitis was significantly increased.

One of the objects of the present application is to provide the above-mentioned ankylosing spondylitis susceptibility single nucleotide polymorphism in the preparation of a kit for detecting susceptibility to ankylosing spondylitis, the single nucleotide polymorphism It means that at the rsl3198903 site, the nucleotide changes from C to T.

Specifically, the application includes a kit for detecting a susceptibility to a single nucleotide polymorphism of ankylosing spondylitis, the kit comprising: a PCR reaction primer designed for a region near the base of rsl3198903, a DNA polymerase, Ionic water, dNTP, MgCl ₂ , PCR buffer, SAP and resin.

Further, in the kit, the PCR reaction primer comprises a sense strand primer and an antisense strand primer, wherein the sense strand primer is tggcgaagttaatccagctt, and the antisense strand primer is ttccacctcacctttcagga _0. One of the objects of the present invention is to provide the above ankylosing spine The use of susceptibility to single nucleotide polymorphisms in the early diagnosis of mandatory spondylitis.

Specifically, the application comprises obtaining a nucleotide sequence from a sample to be tested, and detecting a base located at a position of rsl3198903, and when the base is T, the susceptibility of ankylosing spondylitis is significantly increased.

One of the objects of the present application is to provide the use of the above-described ankylosing spondylitis susceptibility single nucleotide polymorphism in the treatment of mandatory spondylitis.

Further, the application includes a risk type when the base at the rsl3198903 site is T, and a protective type in the treatment of ankylosing spondylitis.

Further, the ankylosing spondylitis-specific single nucleotide polymorphism-associated susceptibility or pathogenicity Because the base at the rsl3198903 site is T.

Further, the use comprises an ankylosing spondylitis susceptibility single nucleotide polymorphism (SNP) for the preparation of a medicament for treating ankylosing spondylitis.

Specifically, the application includes the intervention of rsl3198903 related to ankylosing spondylitis susceptibility or the function of a causative gene, including translation, transcription and protein synthesis processes, preparation of therapeutic drugs, improvement of abnormal bone metabolism in patients The immune inflammatory response to achieve therapeutic goals.

detailed description

Hereinafter, the method for detecting susceptibility to ankylosing spondylitis and the kit thereof according to the present application are described in conjunction with specific embodiments, in order to better understand the technical content of the present application, but not for the public. Limitations of the technical content, in fact, on the same or similar principles, the method steps, reagents, reaction conditions, and any improvements made to the kit to achieve substantially the same effect are all Within the technical solution claimed by the present application.

Embodiment 1

Study on the relationship between SNP rsl3198903 and the pathogenesis of ankylosing spondylitis

1.1 Research object

Among the 1837 cases of sporadic AS in the study, mainly AS patients who were admitted to the outpatient clinic of the Third Affiliated Hospital of Sun Yat-sen University from 2005 to 2009, these AS patients were based on clinical manifestations and imaging studies by experienced rheumatologists. The results of the diagnosis were diagnosed in patients with AS who met the revised 1984 New York standard. For each AS patient, blood was drawn for the study and the informed consent was signed after being informed of the purpose of the study.

The control population of 4231 healthy volunteers mainly included healthy volunteers without AS symptoms or medical history in three places in China, Guangdong, Anhui and Singapore. These healthy volunteers also agreed to draw blood for the study after being informed. And signed an informed consent form. When collecting cases, the basic conditions of the case and healthy volunteers were recorded, including: gender, age and place of origin. 4 ml of whole blood was taken, placed in an EDTA tube, and brought back to the laboratory for DNA extraction. In addition, in addition to blood sampling, rheumatologists also carefully inquired and recorded the situation of each AS patient and healthy volunteers, especially the AS patients also recorded basic conditions (including: gender, age, age of onset, duration) And clinical phenotype (including: waxy fingers, hip involvement, peripheral arthritis, inflammatory low back pain). For healthy volunteers, the patient's medical history, including the respiratory system, cardiovascular system, endocrine system, blood system, digestive system, bone system, nervous system and other specialties, and the Department of Rheumatology History, ask if there is a history of low back pain and other past medical history. 1.2 Experimental methods and results

1.2.1 Extraction of DNA

In this study, we used the TIANamp Blood DNA Kit Blood Genomic DNA Extraction Kit to extract DNA from human peripheral blood samples. The composition of the kit is: Cell Lysis Night, Buffer GS, Buffer GB, Buffer Liquid GD, rinse PW, elution buffer TB, proteinase K, adsorption column CB3, collection tube (2 ml), 1.5 mL sterile collection tube.

1.2.2. Intensive whole-genome SNP chip used in the study

The study used the Illumina HuamHap 610-Quad SNP chip, the Illumina Human lM-duo chip and the Illumina OmniExpress chip to perform a full-genome SNP scan of the sample. The following are three types of Illumina chips;

1, Illumina HuamHap 610-Quad SNP chip

The chip cartridge: The chip can detect four samples in parallel on one chip, which significantly increases the amount of sample output information and reduces errors in experimental operations. The chip is widely used in the content of the HumanHap550 chip, with an additional 100,000 genetic markers. The genome-wide information covered by Human 610-quad is authoritative for both known and recently reported CNV regions. The SNPs of the Illumina HuamHap 610-Quad SNP chip are evenly distributed on the genome at a density of about 5 kb. The Illumina HuamHap 610-Quad SNP chip was designed for specific studies targeting highly polymorphic CNV regions in the genome (fragment replication regions and genomic regions without SNPs).

Illumina Human lM-duo chip.

The chip contains more than one million probe information. The chip contains probes for gene SNPs, tagged SNPs, copy number changes (CNV), and other high-value genomic regions, as well as new sites such as: increased disease-associated SNP sites Flexible selection of high-density SNP sites in some genomic coding regions.

2, Illumina Omni Express chip

The chip provides high sample throughput and comprehensive genomic content. The Omni Express accommodates up to 12 samples, and the chip interrogates more than 700,000 variations per sample, with a total of more than 8 million data points on a single chip. The marker on OmniExpress is part of Illumina's HumanOmnil-Quad content, which combines optimized SNP tag combinations from all three phases of the international HapMap program, with the highest data quality and best content, including copy number variation (CNV) ) Comprehensive support for the application.

1.2.3 Research steps

We performed a full genomic SNP typing on all sporadic AS cases and healthy volunteer controls using the above three chips. Correlation analysis is then performed, and the data for gender, age, and principal component analysis results are corrected separately to find statistically significant SNP(s), the SNP(s) that may be associated with the disease. 1.2.3.1 Sample preparation and genotyping

After DNA was extracted from whole blood samples, all DNA was normalized to a 50 ng/ml concentrate. For high-density SNP chip typing, we used the chip, we used approximately 200 ng of DNA for genotyping the sample and used Illumina Beadstudio for data reading and genotyping, according to Illumina's recommended procedure. There are 272,386 SNPs in the data results, all of which are covered by 3 chips. After statistical analysis, 1083964 SNPs were also calculated for analysis.

1.2.3.2 Quality control (QC) of data analysis

The study conducted quality control and monitoring of SNPs in AS cases and healthy volunteers, including call rate <95%, MAF (minor allele frequency) <3%, and non-conformity. Hardy-Weinberg Equilibrium (HEW, P < 10-6) to remove as much as possible SNPs; after obtaining the genotype data of the full-sweep sample, we analyze and calculate the heterozygosity The heterozygosity range is statistically analyzed from the mean of the heterozygosity mean (Mean) -3χ standard deviation (SD) to the mean heterozygosity (Mean) +3χ standard deviation (SD). Samples not in this interval Will be removed. Not included in further statistics. Then, we use PLINK software and IBS (isolated by state)-based methods to perform genetic relationship tests on these data. For those pairs of specimens based on repeated or related genetic analysis, we remove one of the read rates. low. We use the principle component analysis (PCA) method and the population data in the HapMap database to detect population stratification in the sample and remove significant outliers. Finally, we take the intersection of these independent data.

1.2.3.3 Statistical analysis

For the analysis of full-scan data, due to the existence of a certain degree of population dispersion and stratification, all component analysis (PCA) and three principal components are obtained, and whether there is sample clustering between the three components is analyzed. Is it necessary to use the population dispersion of these samples as a parameter for correction; then, we draw a Quantile-Quantile plot based on the data from these samples, and all the factors that need to be corrected need to be corrected before drawing. Factors include gender, age (if there is a statistical difference between the sporadic cases and the healthy volunteers) and the main components of the clustering phenomenon after the above PCA analysis, the results will get the value, when analyzing the data results, we use the software Distribute each The chi-square test is performed on the frequency of alleles in the case and the gene frequency of the healthy volunteer control population, and the chi-square value A is obtained.

If the QC is closer to 1, it means that the sample is more effective. If there is an offset, there are two possible situations: one is that the sample is stratified, that is, the population is more discrete; the second is the existence and disease risk. Related SNPs.

After the above analysis, if the PCA analysis results suggest that there is stratification between the main components, that is, there is a difference in the dispersion of the population, we also correct the dispersion of the difference as a covariate, in addition we will age and gender (if Differences between sporadic cases and healthy volunteers were used as covariates. Logistic regression analysis was performed using PLINK software to find SNP loci associated with disease. We use Haploview (v4.1) software to display the results of the analysis, namely the SNP chromosome location and the Manhattan map represented by -loglOP.

1.2.3.4 SNP estimation and linkage disequilibrium model analysis

The estimated SNP for analysis in the three chips is done by the IMPUTE2 software (version number: 2.1.0), which maximizes the chip's coverage of the chromosome.

1.2.4 Results

SNP rsl3198903 significant difference in 1837 cases and 4231 cases of healthy volunteers AS controls, P value ^{<10- 324 (OR = 43.63)} , i.e., significantly correlated with ankylosing spondylitis, this SNP is a T base when the risk Type, C is protected.

The above results indicated that in the SNP rsl3198903 of the 31344157 position of chromosome 6 in the 36.3 Genome Buildde human genome map, the base C→T was changed, which increased the susceptibility of AS, and the allele genotype T was significantly correlated with the occurrence of AS. Embodiment 2

SNP rs 13198903 and the incidence of ankylosing spondylitis 2.1 2205 cases of sporadic AS in the study subjects, mainly samples taken from AS patients and some other hospitals in the outpatient clinic of the Third Affiliated Hospital of Sun Yat-sen University from 2005 to 2009. These AS patients were all experienced rheumatoid. Disease patients diagnosed with AS patients based on clinical manifestations and imaging findings in accordance with the 1984 New York revised standards. For each AS patient, blood was drawn for the study and the informed consent was signed after being informed of the purpose of the study.

The 3702 healthy volunteers were mainly from the healthy volunteers collected by the Third Affiliated Hospital of Sun Yat-sen University and the Cancer Center of Sun Yat-sen University. The population were healthy volunteers without AS symptoms or medical history. These healthy volunteers Also, after being informed, agreed to draw blood for the study and signed an informed consent form. 2.2 Experimental methods and results 2.2.1 DNA extraction In this study, we used the TIANamp Blood DNA kit blood genomic DNA extraction kit to extract DNA from human peripheral blood samples. The composition of the kit is: Cell lysis night , Buffer GS, Buffer GB, Buffer GD, Rinse PW, Elution Buffer TB, Protease K, Adsorption Column CB3, Collection Tube (2 ml), 1.5 mL sterile collection tube. 2.2.2 Study steps 2.2.2.1 Primer design Primer 3.0 software was used to design the I material. The primer information of SNP rs 13198903 is as follows:

SNP ID amplification primer antisense strand amplification primer sense strand amplification fragment size dissolution temperature Rsl3198903 ttccacctcacctttcagga tggcgaagttaatccagctt 167 60 °C

2.2.2.2 Genomic DNA amplification (polymerase chain reaction PCR):

2.2.2.2.1 The reaction system is as follows:

2.2.2.2.2 PCR steps:

The template DNAlul was added to each well in a 384-well plate, and 4 ul of the above reaction system was added. The 384-well plate was centrifuged at 1000 rpm for 1 minute, and after mixing, amplification was carried out according to the following procedure: 94. C 4 minutes pre-denaturation, 94. C 20 seconds, 60 ° C 30 seconds, 72 ° C 1 minute for 30 cycles, 72 ° C 3 minutes, 4 ° C cooling. 2.2.2.3 Sequencing analysis of PCR products: The purified products were detected by conventional DNA sequencing methods for base mutations. We sequenced on the ABI PRISM © 3100 (Applied Biosystems, CA, USA) Genetic Analyzer using the BigDye © Terminator ν3·1 kit from Biosystems, Inc. (Applied Biosystems, CA, USA).

2.2.2.4 Statistical analysis The study conducted quality control and monitoring of SNPs in AS cases and healthy volunteers, including call rate <95%, minor allele frequency (MAF) <3%, and non-conformity. Samples of Hardy-Weinberg Equilibrium (HEW, P <10" ⁶ ) will not be used for further analysis. After quality control, 2,100 patients and 3,496 healthy controls passed quality control for further use. Statistical analysis. Logistic regression analysis was performed on the validated samples and all samples using PLINK software and R method to find the SNP loci associated with the disease. The linkage map of the region where the SNP locus is located was mapped by Haploview (v4.1) software.

2.2.3 Results

SNP rs 13198903 showed significant difference between 2205 AS and 3702 healthy volunteer controls, that is, there was a significant correlation with ankylosing spondylitis. The SNP base was risky when T, and protected when C.

The above results indicated that in the SNP rs 13198903 of the 44061175 position of chromosome 12 in the 36.3 Genome Buildde human genome map, the base C→T changed, increasing the susceptibility of AS, and the allele type T was significantly correlated with the occurrence of AS. . Embodiment 3

3.1.1 Research object

The subjects in the study were all AS and healthy controls in Examples 1 and 2, and these AS cases were diagnosed by experienced rheumatologists based on clinical findings and imaging findings in 1984. Revised standard AS patients. For each AS patient, blood was drawn for the study and the informed consent was signed after being informed of the study. Finally, a total of 3937 AS patients and 7727 healthy volunteers were included in the study.

3.2.2 Extraction of DNA

TIANamp Blood DNA kit blood genomic DNA extraction test for specimens to be tested Kit for extracting DNA from human peripheral blood samples. The composition of the kit is: Cell Lysis Night, Buffer GS, Buffer GB, Buffer GD, Rinse PW, Elution Buffer TB, Proteinase K, Adsorption Column CB3, collection tube (2 ml) and 1.5 mL sterile collection tube.

3.2.3 Experimental steps

We extracted the data of SNP rs 13198903 from all ASs and healthy controls in Example 1 after data quality control, and proposed relevant SNP rs for all AS and healthy controls in Example 2 after data quality control. 13198903 data; organized into the same database for analysis. Statistical analysis was performed using logistic regression analysis of SNP rsl3198903 data from all samples of PLINK software, and the interference factors such as age and gender were corrected to find out whether there was any correlation between SNP rs 13198903 data and disease.

3.3 Experimental results:

Results SNP rs 13198903 was significantly different between AS patients and healthy volunteers. The base of SNP rs 13198903 was significantly associated with ankylosing spondylitis. The SNP base was risky at T, and C was Protective type. The results were consistent with both studies. Embodiment 4

4.1.1

All patients and their families who want to test for the presence of ankylosing spondylosis susceptibility genes.

4.2.2 DNA extraction

The TIANamp Blood DNA kit is used to extract DNA from human peripheral blood samples. The composition of the kit is: Cell Lysis Night, Buffer GS, Buffer GB, Buffer GD , rinse solution PW, elution buffer TB, proteinase K, adsorption column CB3, collection tube (2 ml), 1.5 mL sterile collection tube. 4.2.3 Experimental steps

4.2.3.1 PCR steps:

The template DNAlul was added to each well of the plate to be tested, and 4 ul of the above reaction system was added, and centrifuged at 1000 rpm for 1 minute. After mixing, the amplification was carried out according to the following procedure: 94. C 4 minutes pre-denaturation, 94. C 20 seconds, 56° C 30 seconds, 60° C 1 minute for 30 cycles, 72° C 3 minutes, 4° C cooling.

4.2.3.2 Mass spectrometry:

After purification by the resin, the prepared sample analyte is co-crystallized with the chip substrate, and the crystal is placed in a vacuum tube of the grammar instrument, and then excited by a transient nanosecond (1 (T ⁹ s) strong laser, which is quick and convenient. The genotype of the SNP in the above PCR reaction product was detected.

4.3 Experimental results:

When the test result is T, it is a risk type, and when the test result is C, it is a protection type.

The kit includes: PCR reaction primers designed for the region near the base of rsl3198903, DNA polymerase, deionized water, dNTP, MgCl ₂ , PCR buffer, SAP, and resin. The amplification primers and extension primers are shown in the following table:

The steps of the detection method are as follows:

1. Primer design:

Primer3.0 software was used to design PCR amplification primers and single base extension primers for the SNP site to be tested;

2. Tissue, cells and blood samples DNA extraction:

Extraction of DNA from tissues, cells or blood samples using the TIANamp Blood DNA kit or NucleoSpin Tissue (MN), quantified by spectrophotometry, agarose gel Electrophoresis quality check, the quality of the qualified DNA will be adjusted to 5 ( ig / L, -20 ° C storage standby;

3. PCR amplification:

Using multiplex PCR amplification technology, the total volume of each reaction is 5μ1, including template DNA 10 η^, Hotstar Taq 0.5 U, amplification primers 0.5pmol each, 25mM dNTP Ο.ΐμΐ, reaction conditions are 94 °C for 4 minutes; 94 °C20 seconds, 60 °C for 30 seconds, 72 °C for 1 minute, 30 cycles; 72 °C for 3 minutes; 4 °C∞;

4. Sequencing analysis of PCR products: The purified products were detected by conventional DNA sequencing methods for base mutations. We sequenced on the ABI PRISM © 3100 (Applied Biosystems, CA, USA) Genetic Analyzer using the BigDye © Terminator ν3·1 kit from Biosystems, Inc. (Applied Biosystems, CA, USA).

5. Analyze the single base detected at the rsl3198903 locus. If the base of the locus is T, the risk of ankylosing spondylitis is significantly increased.

Claims

A nucleotide fragment of a single nucleotide polymorphism for detecting susceptibility to ankylosing spondylitis, characterized in that: the nucleotide fragment is at a SNP rsl3198903 locus, and the AS patient base is a T The frequency was significantly higher than that of healthy controls. Conversely, the frequency of base C was significantly lower than that of healthy controls, ie, the base at rsl3198903 was T, and the susceptibility to ankylosing spondylitis was significantly increased.

2. A method for detecting susceptibility to ankylosing spondylitis, characterized in that: the method comprises obtaining a nucleotide sequence from a sample to be tested, and detecting a base located at a position of rsl3198903, wherein the base is T , the susceptibility to ankylosing spondylitis is significantly increased.

3. The detecting method according to claim 2, wherein: the sample to be tested comprises blood, body fluid or tissue.

4. The detecting method according to claim 2, wherein: the method comprises the following steps:

1) extracting DNA from the sample to be tested;

2) using the DNA as a template, PCR primers are designed for the coding region near the base of rsl3198903 to obtain a PCR reaction product;

3) measuring the base sequence composition of the PCR reaction product;

4) Determine whether the base at the rsl3198903 locus in the obtained base sequence is T.

The detection method according to claim 2, wherein the method for obtaining a nucleotide sequence from the sample to be tested comprises real-time PCR, denaturing high performance liquid chromatography, restriction fragment length polymorphism or ligase Detection or gene sequencing.

6. A method for detecting a susceptibility to a single nucleotide polymorphism of ankylosing spondylitis, characterized in that: the method comprises the steps of:

1) Primer design:

The PCR amplification primers of rsl3198903 locus were designed using Primer3.0 software; 2) Tissue, cell and blood sample DNA extraction:

3) PCR amplification:

Using multiplex PCR amplification technology, the total volume of each reaction is 5μ1, including template DNA 10 η^, Hotstar Taq 0.5 U, amplification primers 0.5pmol each, 25mM dNTP Ο.ΐμΐ, reaction conditions are 94 °C for 4 minutes; 94 °C20 seconds, 60 °C for 30 seconds, 72 °C for 1 minute, 30 cycles; 72 °C for 3 minutes; 4 °C 00;

4) Purification of PCR products:

The PCR reaction product was treated with 0.5 U SAP (shrimp alkaline phosphatase) to remove free dNTP from the system, and the reaction system was 7 μΐ, including 5 μΐ PCR product, 2 μΐ SAP mixture (SAP 0.5 U, buffer 0.17 μΐ), reaction procedure 37 °C 20 minutes; 85 °C 5 minutes; 40 °C ∞;

5) PCR product sequencing:

The purified product was detected by a conventional DNA sequencing method, and the single base detected at the rsl3198903 site was analyzed. If the base of the site was T, the susceptibility to ankylosing spondylitis was significantly increased.

7. The use of a nucleotide fragment of a single nucleotide polymorphism for detecting ankylosing spondylitis susceptibility according to claim 1 for preparing a kit for detecting susceptibility to ankylosing spondylitis, said mononucleoside Acid polymorphism refers to the change of nucleotide from C to T at the rsl3198903 site.

8. The use according to claim 7, wherein: the kit comprises: a PCR reaction primer designed for a region near the base of rsl3198903, DNA polymerase, deionized water, dNTP, MgCl ₂ , PCR buffer Liquid, SAP and resin.

9. The use according to claim 8, wherein: in the kit, the PCR reaction primer comprises a sense strand? I and antisense strand primers, wherein the sense strand primer is tggcgaagttaatccagctt and the antisense strand primer is ttccacctcacctttcagga ₀

10. An application of an ankylosing spondylitis susceptibility single nucleotide polymorphism in the early diagnosis of mandatory spondylitis, wherein the application comprises obtaining a nucleotide sequence from a sample to be tested, and the detection is located at the rsl3198903 locus. The base, when the base is T, the susceptibility to ankylosing spondylitis is significantly increased.

11. An application of an ankylosing spondylitis susceptibility single nucleotide polymorphism in the treatment of mandatory spondylitis, wherein the application comprises a risk type when the base at the rsl3198903 site is T, and is a C when The application of protective type in the treatment of ankylosing spondylitis.

12. Use of an ankylosing spondylitis susceptibility single nucleotide polymorphism in the preparation of a medicament for treating ankylosing spondylitis.

13. The use according to claim 12, wherein: said application comprises the function of a susceptible or causative gene, including translation, transcription and protein synthesis, by interfering with rsl3198903 related to ankylosing spondylitis, It is prepared into a therapeutic drug to improve the abnormality of bone metabolism in the patient to achieve an immunoinflammatory reaction in the body, thereby achieving therapeutic purposes.