WO2013055829A1

WO2013055829A1 - Proximity-based assays for the detection of signaling protein expression and activation

Info

Publication number: WO2013055829A1
Application number: PCT/US2012/059610
Authority: WO
Inventors: Edward Baetge; Phillip Kim; Sharat Singh
Original assignee: Nestec S.A.
Priority date: 2011-10-11
Filing date: 2012-10-10
Publication date: 2013-04-18

Abstract

The present invention provides methods for detecting or measuring the expression and/or activation levels of one or a plurality of signaling proteins in samples obtained from patients in a specific, multiplex, high-throughput assay. By detecting any alterations (e.g., dysregulated expression and/or activation) in one or more signaling proteins of interest, the present invention is particularly advantageous for aiding the prediction, diagnosis, prognosis, and/or monitoring of a pre-disease state (e.g., pre-metabolic syndrome such as pre-diabetes), a cancer, and/or a metabolic disorder (e.g., diabetes such as type 1 or type 2 diabetes).

Description

PROXIMITY-BASED ASSAYS FOR THE DETECTION OF SIGNALING

PROTEIN EXPRESSION AND ACTIVATION

CROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to U.S. Provisional Application No.

61/546,026, filed October 1 1, 201 1, the disclosure of which is hereby incorporated by reference in its entirety for all purposes.

BACKGROUND OF THE INVENTION

[0002] The process of signal transduction in cells is responsible for a variety of biological functions including, but not limited to, cell division and death, metabolism, immune cell activation, neurotransmission, and sensory perception. As a result, derangements in normal signal transduction in cells can lead to a number of disease states such as cancer, diabetes, obesity, heart disease, autoimmunity, and the like.

[0003] In the field of oncology, one well-characterized signal transduction pathway is the MAP kinase pathway, which is responsible for transducing the signal from epidermal growth factor (EGF) to the promotion of cell proliferation in cells. Given the central role that signal transduction pathways play in cell growth, many cancers arise from mutations and other alterations in signal transduction components that result in aberrant activation of cell proliferation pathways. For example, overexpression or hyperactivity of EGFR has been associated with a number of cancers including colon cancer and lung cancer. [0004] With regard to the control of energy homeostasis, the transduction of signals from metabolic, dietary, and endocrine pathways are integrated by nuclear receptors, transcription factors, and coregulators such as coactivators and corepressors. Energy homeostasis requires the coordinated regulation of energy intake, storage, and expenditure. In healthy individuals, fluctuations in any of these processes are normally counterbalanced by regulation of the other two processes. However, abnormalities in the equilibrium between energy intake, storage, and expenditure can lead to metabolic malfunctions. Diabetes (e.g., type 2 diabetes mellitus), obesity, and the metabolic syndrome are among the most frequent conditions induced by a misbalance of energy homeostasis.

[0005] The transcriptional co-activator proliferator-activated receptor gamma coactivator- 1-ct (PGC-Ια) is the master regulator of mitochondrial biogenesis and function. As a result, PGC-la plays a critical role in energy homeostasis. Two metabolic sensors, AMP-activated protein kinase (AMPK) and silent information regulator Tl (SIRTl ), directly control PGC-l a activity through phosphorylation and deacetylation, respectively. Together, PGC-la, AMPK, and SIRTl comprise an energy sensing network that controls energy intake, storage, and expenditure. Given the potential value of new preventive and therapeutic applications to target metabolic disorders by modulating the activity of coregulators such as PGC-la, it is important to detect the presence and/or extent of PGC-la activation (e.g., via phosphorylation by AMPK and/or deacetylation by SIRTl) to aid in diagnosing or predicting the likelihood of developing a pre-metabolic syndrome or a metabolic disorder. [0006] Accordingly, specific and sensitive methods are needed to detect the components of signal transduction pathways for diagnostic, prognostic, and therapeutic purposes to provide guidance on potential therapies for each individual patient to treat disorders associated with dysregulation of normal signal transduction such as cancer and metabolic disorders in a personalized manner. The present invention satisfies these needs and provides related advantages as well.

BRIEF SUMMARY OF THE INVENTION

[0007] The present invention provides methods for detecting or measuring the expression and/or activation levels of one or a plurality of signaling proteins in samples obtained from patients in a specific, multiplex, high-throughput assay. By detecting any alterations (e.g., dysregulated expression and/or activation) in one or more signaling proteins of interest, the present invention is particularly advantageous for aiding the prediction, diagnosis, prognosis, and/or monitoring of a pre-disease state (e.g., pre-metabolic syndrome such as pre-diabetes), a cancer, and/or a metabolic disorder (e.g., diabetes such as type 1 or type 2 diabetes).

[0008] In particular aspects, the present invention provides antibody- and/or aptamer-based assay platforms for detecting or measuring the presence and/or level of protein expression, post-translational modification of proteins (e.g., phosphorylation, acetylation, methylation, glycosylation, ubiquitination), protein complex formation (e.g., homodimers, heterodimers, multimeric complexes), expression and/or activation of fusion proteins (e.g., oncogenic fusion proteins), expression and/or activation of truncated proteins (e.g., truncated receptors), and combinations thereof.

[0009] In certain embodiments, the present invention provides a method for determining the expression and/or activation levels of one or more analytes in a sample comprising: (a) incubating a cellular extract with one or a plurality of dilution series of capture reagents to form a plurality of captured analytes, wherein the capture reagents are restrained on a solid support;

(b) incubating the plurality of captured analytes with first and second detection reagents comprising different labels to form a plurality of labeled captured analytes,

wherein at least one or more of the capture reagents, first detection reagents, and second detection reagents comprise aptamers when the one or more analytes comprise signaling proteins associated with cancer; and

(c) measuring the levels of the labeled captured analytes by detecting a signal that is generated from the first and second detection reagents when both of these reagents are bound to the captured analytes, thereby determining the expression and/or activation levels of the one or more analytes in the sample.

[0010] In particular embodiments, the methods of the invention can be used to determine the presence of expression and/or activation of the one or more analytes in the sample. In some embodiments, the capture reagents comprise antibodies or aptamers (e.g., nucleic acid aptamers and/or peptide aptamers as described herein). In other embodiments, the first and second detection reagents independently comprise antibodies or aptamers. In particular embodiments, the determined activation levels of the one or more analytes correspond to phosphorylation levels, acetylation levels, deacetylation levels, and/or methylation levels.

[0011] In some instances, the first and second detection reagents independently comprise first and second labeled activation state-independent reagents specific for the corresponding analytes, respectively, and the first and second labeled activation state-independent reagents can independently comprise first and second labeled activation state-independent antibodies or aptamers, respectively.

[0012] In other instances, the first and second detection reagents independently comprise labeled activation state-independent reagents and labeled activation state-dependent reagents specific for the corresponding analytes, respectively. In such instances, the labeled activation state-independent reagents can comprise labeled activation state-independent antibodies or aptamers, and the labeled activation state-dependent reagents can comprise labeled activation state-dependent antibodies or aptamers.

[0013] In certain instances, at least two or all three of the capture reagents, first detection reagents, and second detection reagents comprise aptamers when the one or more analytes comprise signaling proteins associated with cancer. Non-limiting examples of signaling proteins associated with cancer are described below.

[0014] In particular embodiments, the one or more analytes comprise signaling proteins associated with a pre-metabolic syndrome {e.g., pre-diabetes) and/or a metabolic disorder (e.g., diabetes, obesity, or metabolic syndrome). Non-limiting examples of signaling proteins that are associated with a pre-metabolic syndrome and/or a metabolic disorder are described below. In some instances, at least one, two or all three of the capture reagents, first detection reagents, and second detection reagents comprise antibodies. In other instances, at least one, two or all three of the capture reagents, first detection reagents, and second detection reagents comprise aptamers.

[0015] In some embodiments, the assay is an antibody-based assay such as a Collaborative Enzyme Enhanced Reactive Immunoassay ("CEER"), wherein antibodies are used to detect the expression and/or activation levels of one or more analytes such as signaling proteins in a sample. In other embodiments, the assay is an aptamer-based assay such as an Aptamer- CEER ("Apta-CEER"), wherein aptamers are used to detect the expression and/or activation levels of one or more analytes such as signaling proteins in a biological sample. In further embodiments, the assay is an antibody- and aptamer-based assay such as a Combination- CEER ("Combo-CEER"), wherein a combination of antibodies and aptamers are used to detect the expression and/or activation levels of one or more analytes such as signaling proteins in a biological sample.

[0016] In preferred embodiments, the signal is generated by the proximity binding of both the first and second detection reagents to the captured analytes. In certain embodiments, the generated signal is detected using tyramide signal amplification (e.g., with glucose oxidase and a peroxidase such as horseradish peroxidase) or fluorescence resonance energy transfer (FRET).

[0017] In particular embodiments, the signal generated is a chromogenic or fluorescent signal wherein the first detection reagents are labeled with a facilitating moiety, the second detection reagents are labeled with a first member of a signal amplification pair, and wherein the facilitating moiety generates an oxidizing agent which channels to and reacts with the first member of the signal amplification pair. In such embodiments, the "measuring" step comprises measuring the levels of the labeled captured analytes by: (i) incubating (e.g., contacting) the plurality of labeled captured analytes with a second member of the signal amplification pair to generate an amplified signal; and (ii) detecting the amplified signal generated from the first and second members of the signal amplification pair.

[0018] The first detection reagents may be directly labeled with the facilitating moiety or indirectly labeled with the facilitating moiety, e.g., via hybridization between an

oligonucleotide conjugated to the first detection reagents and a complementary

oligonucleotide conjugated to the facilitating moiety. Similarly, the second detection reagents may be directly labeled with the first member of the signal amplification pair or indirectly labeled with the first member of the signal amplification pair, e.g., via binding between a first member of a binding pair conjugated to the second detection reagents and a second member of the binding pair conjugated to the first member of the signal amplification pair. In certain instances, the first member of the binding pair is biotin and the second member of the binding pair is an avidin such as streptavidin or neutravidin.

[0019] In some embodiments, the facilitating moiety may be, e.g., glucose oxidase (GO). In certain instances, the glucose oxidase and the first detection reagents can be conjugated to a sulfhydryl-activated dextran molecule as described in, e.g., Examples 16-17 of PCT

Publication No. WO2009/108637, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The sulfhydryl-activated dextran molecule typically has a molecular weight of about 500kDa (e.g., about 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or 750kDa). In other embodiments, the oxidizing agent may be, for example, hydrogen peroxide (H₂0₂). In yet other embodiments, the first member of the signal amplification pair may be, e.g., a peroxidase such as horseradish peroxidase (HRP), catalase, chloroperoxidase, cytochrome c peroxidase, eosinophil peroxidase, glutathione peroxidase, lactoperoxidase, myeloperoxidase, thyroid peroxidase, deiodinase, and the like. In further embodiments, the second member of the signal amplification pair may be, for example, a tyramide reagent (e.g., biotin-tyramide). Preferably, the amplified signal is generated by peroxidase oxidization of biotin-tyramide to produce an activated tyramide (e.g., to transform the biotin-tyramide into an activated tyramide). The activated tyramide may be directly detected or indirectly detected, e.g., upon the addition of a signal-detecting reagent. Non-limiting examples of signal-detecting reagents include streptavidin-labeled fluorophores and combinations of streptavidin-labeled peroxidases and chromogenic reagents such as, e.g., 3,3', 5,5'- tetramethylbenzidine (TMB).

[0020] In certain instances, the horseradish peroxidase and the second detection reagents can be conjugated to a sulfhydryl-activated dextran molecule. The sulfhydryl-activated dextran molecule typically has a molecular weight of about 70kDa (e.g., about 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or lOOkDa).

[0021] In certain other embodiments, the signal that is generated from the first and second detection reagents is a fluorescent signal that can be detected by FRET. In some instances, a sample that is to be interrogated for the presence and/or expression level of one or more analytes of interest is incubated with first and second detection reagents comprising donor and acceptor fluorophores. If the analyte of interest is not present in the sample, the donor emission is detected upon donor excitation. On the other hand, if the analyte of interest is present in the sample, the donor and acceptor fluorophores are brought into proximity due to the interaction of both the first and second detection reagents with the analyte of interest. The intermolecular FRET from the donor fluorophore to the acceptor fluorophore results in the acceptor emission being predominantly observed.

[0022] In further embodiments, the signal is detected by another proximity-based method as described herein or known to one of skill in the art. [0023] In certain instances, the cellular extract is prepared from a sample obtained from an individual. In certain other instances, the sample is a blood, serum, plasma, or tissue sample. Non-limiting examples of tissue samples include tissues associated with pre-metabolic and/or metabolic disorders such as liver, muscle, adipose, or pancreas tissue.

[0024] In particular embodiments, the individual is suspected of having or is predisposed to having cancer, a pre-metabolic syndrome, or a metabolic disorder.

[0025] In certain aspects, the present invention provides methods for the selection of an appropriate therapy (e.g., which drug to administer, whether to administer a single drug or a combination of drags, etc. ) using the antibody-based

described herein (e.g., CEER, Apta-CEER, and/or Combo-CEER) to down-regulate or shut down a deregulated signaling pathway associated with cancer. Thus, the present invention may be used to facilitate the design of personalized therapies for cancer patients.

[0026] In certain other aspects, the present invention provides methods for the selection of an appropriate therapy (e.g., which drug to administer, whether to administer a single drug or a combination of drugs, etc.) using the antibody-based and/or aptamer-based assay platforms described herein (e.g., CEER, Apta-CEER, and/or Combo-CEER) to down-regulate or shut down a deregulated signaling pathway associated with a pre-metabolic syndrome and/or a metabolic disorder. Thus, the invention may be used to facilitate the design of personalized therapies for patients with a pre-metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes and obesity).

[0027] In further embodiments, the present invention provides a method for aiding or assisting in diagnosing, prognosing, monitoring or predicting the likelihood of developing a pre-metabolic syndrome or a metabolic disorder, the method comprising:

(a) analyzing a sample obtained from an individual to determine the presence and/or levels of expression and/or activation of one or more analytes associated with a pre- metabolic syndrome or a metabolic disorder in the sample;

(b) determining a phosphorylation index and a deacetylation index based upon the presence and/or levels of expression and/or activation of the one or more analytes determined in the sample;

(c) determining a metabolic index for the individual based upon the phosphorylation index and the deacetylation index; and

(d) analyzing the metabolic index calculated for the individual, thereby aiding or assisting in diagnosing, monitoring or predicting the likelihood of developing a pre- metabolic syndrome or a metabolic disorder in the individual.

[0028] In some instances, the pre-metabolic syndrome is pre-diabetes. In other instances, the metabolic disorder is diabetes, obesity, or metabolic syndrome. In some embodiments, the determined activation levels of the one or more analytes correspond to phosphorylation levels, acetylation levels, deacetylation levels, and/or methylation levels. Preferably, the expression and/or activation of the one or more analytes is determined using the antibody- based and/or aptamer-based assay platforms described herein (e.g., CEER, Apta-CEER, and/or Combo-CEER).

[0029] In particular embodiments, the one or more analytes comprise signaling proteins associated with a pre-metabolic syndrome (e.g., pre-diabetes) and/or a metabolic disorder (e.g., diabetes, obesity, or metabolic syndrome). In preferred embodiments, the one or more analytes comprise a peroxisome proliferator gamma co-activator- 1 protein selected from the group consisting of PGC-l , PGC-lb, PRC, and combinations thereof. Other non-limiting examples of signaling proteins that are associated with a pre-metabolic syndrome and/or a metabolic disorder are described in paragraph [0057] below.

[0030] In some embodiments, the metabolic index is determined by applying one or more algorithms and/or other statistical processes described herein to the phosphorylation index and the deacetylation index. [0031] In certain embodiments, the sample is a blood, serum, plasma, or tissue sample, or a cellular extract thereof. Non-limiting examples of tissue samples include tissues associated with pre-metabolic and/or metabolic disorders such as liver, muscle, adipose, or pancreas tissue. [0032] In particular embodiments, the individual is suspected of having or is predisposed to having a pre-metabolic syndrome or a metabolic disorder.

[0033] In certain embodiments, the methods of the present invention for prognosing a pre- metabolic syndrome or a metabolic disorder includes determining the risk or likelihood of a more severe prognosis such as, e.g., the probability of developing disease complications and/or susceptibility of developing diseases associated with the pre-metabolic syndrome or metabolic disorder.

[0034] The disclosures of the following patent documents are each herein incorporated by reference in their entirety for all purposes: PCT Publication Nos. WO 2008/036802, WO 2009/012140, WO 2009/108637, WO 2010/132723, WO 201 1/008990, WO 2011/050069; and PCT Application Nos. PCT/US 1 1 /66624, filed December 21, 201 1, PCT/US 12/27574, filed March 2, 2012, and PCT/US12/53505, filed August 31 , 2012.

[0035] Other objects, features, and advantages of the present invention will be apparent to one of skill in the art from the following detailed description and figures.

BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 illustrates exemplary embodiments of the present invention for detecting the expression and/or activation of a protein complex of interest using CEER (i.e., capture reagents and detection reagents are all antibodies), Apta-CEER (i.e., capture reagents and detection reagents are all aptamers), and Combo-CEER (i.e., capture reagents and detection reagents are a combination of antibodies and aptamers). [0037] Figure 2 illustrates additional exemplary embodiments of the present invention for detecting the expression and/or activation of small proteins (e.g., low molecular weight proteins, polypeptides, or peptides) and denatured proteins (e.g., unfolded proteins or proteins that are in an inactive conformation and do not exhibit a functional secondary, tertiary, and/or quaternary structure) using Apta-CEER (i.e., capture reagents and detection reagents are all aptamers). In some embodiments, the expression and/or activation of small proteins and denatured proteins can be detected using CEER (i.e., capture reagents and detection reagents are all antibodies) and Combo-CEER (i.e., capture reagents and detection reagents are a combination of antibodies and aptamers).

[0038] Figure 3 illustrates the amino acid sequence of human PGC-Ια protein and denotes the sites of phosphorylation by AMPK and p38 MAPK as well as the sites of acetylation and deacetylation by GCN5 and SIRT1, respectively.

[0039] Figure 4 illustrates one embodiment of the invention, wherein CEER (with capture and detection antibodies) is used to detect the presence or levels of total and activated (e.g., phosphorylated and/or deacetylated) PGC-1 protein. A metabolism (or metabolic) index can then be calculated based upon the presence or levels of total and activated PGC-1 protein via a phosphorylation index and a deacetylation index, to aid or assist in the diagnosis, prognosis, monitoring, or prediction of the likelihood of developing a pre-metabolic syndrome such as pre-diabetes or a metabolic disorder such as diabetes.

[0040] Figure 5 illustrates another embodiment of the invention, wherein Apta-CEER (with capture and detection aptamers) is used to detect the presence or levels of total and activated (e.g., phosphorylated and/or deacetylated) PGC-1 protein. A metabolism (or metabolic) index can then be calculated based upon the presence or levels of total and activated PGC-1 protein via a phosphorylation index and a deacetylation index, to aid or assist in the diagnosis, prognosis, monitoring, or prediction of the likelihood of developing a pre-metabolic syndrome such as pre-diabetes or a metabolic disorder such as diabetes. [0041] Figure 6 illustrates one exemplary embodiment of the present invention wherein an inactive aptamer complex comprising an aptamer conjugated to a therapeutic agent can be converted to an active aptamer complex in an acidic tumor environment.

DETAILED DESCRIPTION OF THE INVENTION

I. Introduction

[0042] The activation of signal transduction pathways that are involved in cell proliferation and the deactivation of pathways that are involved in cell death are non-limiting examples of molecular features that characterize many different types of cancer. In many cases, the activity of particular signal transduction pathways, and components thereof, may serve as molecular signatures for a given type of cancer. Such activated components may further provide useful targets for therapeutic intervention. Accordingly, knowledge of the activity level of a particular signal transduction system within a cancer cell prior to, during, and after treatment provides a physician with highly relevant information that may be used to select an appropriate course of treatment to adopt. Furthermore, the continued monitoring of signal transduction pathways that are active in cancer cells as treatment progresses can provide the physician with additional information on the efficacy of treatment, prompting the physician - to either continue a particular course of treatment or to switch to another line of treatment, when, e.g., cancer cells have become resistant to treatment through further aberrations that activate either the same or another signal transduction pathway.

[0043] As such, in some aspects, the present invention provides methods for detecting the expression and/or activation levels of one or a plurality of deregulated signal transduction molecules in tumor tissue or extratumoral cells such as rare circulating cells of a solid tumor in a specific, multiplex, high-throughput assay. In certain embodiments, the assay of the invention is an antibody-based array known as a Collaborative Enzyme Enhanced Reactive Immunoassay ("CEER"). In other aspects, the present invention also provides methods for the selection of an appropriate therapy (e.g., which drug to administer, whether to administer a single drug or a combination of drugs, etc.) to down-regulate or shut down a deregulated signaling pathway. Thus, the invention may be used to facilitate the design of personalized therapies for cancer patients.

[0044] Energy and metabolic homeostasis in mammals is achieved through tight regulation of tissue-specific metabolic pathways that become dysregulated in the metabolic syndrome, leading to obesity, type-2 diabetes, hypertension, cardiovascular diseases, and the like. At the molecular level, energy and metabolic homeostasis is achieved by the regulated expression of genes encoding metabolic enzymes. The major component of the transcriptional regulatory complex that controls the expression of the metabolic enzyme genes is the peroxisome proliferator gamma co-activator- 1 family of transcriptional co-activators (e.g., PGC-Ια, PGC- 1 β). Two metabolic sensors, AMP-activated protein kinase (AMPK) and silent information regulator sirtuin 1 (SIRT1) have been shown to directly upregulate PGC-Ια activity through phosphorylation and deacetylation, respectively. In addition, the histone acetyltransferase GCN5 deactivates PGC-Ια through acetylation. Thus, determination of the phosphorylation or acetylation status of PGC-Ια at the cellular level can predict the metabolic health/fitness or disease across conditions associated with an imbalance in energy and metabolic homeostasis such as diabetes and obesity. [0045] Accordingly, in other aspects, the present invention further provides methods for detecting the expression and/or activation levels of one or a plurality of deregulated signal transduction molecules such as transcriptional coregulators (e.g., PGC-Ια) in samples from patients in a specific, multiplex, high-throughput assay. In certain embodiments, the assay is an antibody-based array known as a Collaborative Enzyme Enhanced Reactive Immunoassay ("CEER"). In other aspects, the present invention also provides methods for the selection of an appropriate therapy (e.g., which drug to administer, whether to administer a single drug or a combination of drugs, etc.) to down-regulate or shut down a deregulated signaling pathway associated with a metabolic disorder. Thus, the invention may be used to facilitate the design of personalized therapies for patients with a metabolic disease or disorder such as diabetes and obesity.

[0046] The methods of the present invention are beneficially tailored to address key issues in the management of diseases such as cancer and diabetes because they (1) provide increased sensitivity (e.g., single cell detection can be achieved for detecting total and activated signal transduction molecules), (2) provide increased specificity (e.g., three-antibody proximity assays enhance specificity for detecting total and activated signal transduction molecules), (3) enable pathway profiling (e.g., activation status of specific signal transduction molecules can be detected in patient samples), and (4) eliminate any issues with obtaining patient samples (e.g., assays can be performed on a few cells). [0047] In particular embodiments, the present invention provides aptamer-based arrays for detecting the activation state and/or total amount of one or a plurality of proteins in a sample. The aptamer-based arrays of the present invention, also known as an Aptamer Collaborative Enzyme Enhanced Reactive Immunoassay ("Apta-CEER"), is advantageous for at least the following reasons: a large universe of potential aptamers can be designed and screened (e.g., about 4⁴⁰ sequence possibilities for aptamers; for 23 nucleotides the sequence possibilities are about 10¹⁵); aptamers are small molecules that display highly discriminatory binding to a specific target such as a protein; aptamers can include modified nucleic acids such as locked nucleic acids and peptide nucleic acids to confer stability and nuclease resistance thereto; and aptamers typically possess a practical length (e.g., about 40 nucleotides). In certain aspects, the aptamer-based arrays of the present invention comprise a combination of antibodies and aptamers, known as a Combination Collaborative Enzyme Enhanced Reactive Immunoassay ("Combo-CEER").

[0048] In some embodiments, the aptamer-based arrays of the present invention are useful for detecting the expression and/or activation levels of small proteins and denatured proteins. In certain other embodiments, the aptamer-based arrays of the present invention are useful for detecting targets that are generic, site-specific, unmodified, and/or modified. As non-limiting examples, the aptamers selected for use in the aptamer-based arrays described herein can be directed against targets such as native proteins, denatured proteins, phosphorylated proteins (e.g., aptamers specifically targeting phosphoserine, phosphothreonine, or phosphotyrosine residues), complexed proteins, acetylated proteins, methylated proteins, transfused proteins, truncated proteins, glycosylated proteins, transaction/translation variants, and combinations thereof.

[0049] As such, the assays of the present invention, whether antibody- and/or aptamer- based (e.g., CEER, Apta-CEER, or Combo-CEER) are useful for detecting, determining or measuring levels of protein expression, levels of post-translational modification of proteins (e.g., phosphorylation, acetylation, methylation, glycosylation, etc.), levels of protein complex formation (e.g., homodimers, heterodimers, multimeric complexes such as a PI3K complex, etc.), levels of expression and/or activation of fusion proteins (e.g., oncogenic fusion proteins such as BCR-ABL, etc.), levels of expression and/or activation of truncated proteins (e.g., truncated receptors such as p95HER2, EGFR-vIII, etc.), and combinations thereof. Accordingly, the present invention is particularly advantageous for aiding the prediction, diagnosis, prognosis, and/or monitoring of a pre-disease state (e.g., a pre- metabolic syndrome) or diseases such as cancer and metabolic disorders (e.g., diabetes) by detecting any alterations in components of signal transduction pathways which give rise to such pre-disease or disease states.

II. Definitions

[0050] As used herein, the following terms have the meanings ascribed to them unless specified otherwise. [0051] The term "cancer" includes any member of a class of diseases characterized by the uncontrolled growth of aberrant cells. The term includes all known cancers and neoplastic conditions, whether characterized as malignant, benign, soft tissue, or solid, and cancers of all stages and grades including pre- and post-metastatic cancers. Examples of different types of cancer include, but are not limited to, digestive and gastrointestinal cancers such as gastric cancer (e.g., stomach cancer), colorectal cancer, gastrointestinal stromal tumors (GIST), gastrointestinal carcinoid tumors, colon cancer, rectal cancer, anal cancer, bile duct cancer, small intestine cancer, and esophageal cancer; breast cancer; lung cancer (e.g., non-small cell lung cancer); gallbladder cancer; liver cancer; pancreatic cancer; appendix cancer; prostate cancer, ovarian cancer; renal cancer (e.g., renal cell carcinoma); cancer of the central nervous system; skin cancer; lymphomas; gliomas; choriocarcinomas; head and neck cancers;

osteogenic sarcomas; and blood cancers. As used herein, a "tumor" comprises one or more cancerous cells. [0052] The term "metabolic disorder" or "metabolic disease" includes any disorder that involves an alteration in the normal metabolism of carbohydrates, lipids, proteins, water, and/or nucleic acids. Non-limiting examples of metabolic disorders include obesity, type 1 diabetes mellitus (insulin-dependent diabetes mellitus or IDDM), type 2 diabetes mellitus (non-insulin-dependent diabetes mellitus or NIDDM), and metabolic syndrome. Metabolic syndrome is a name for a group of risk factors that occur together and increase the risk for coronary artery disease, stroke, and type 2 diabetes. Contributing factors for the metabolic syndrome include, but are not limited to, obesity and disorders of adipose tissue, insulin resistance, a constellation of independent factors (e.g., molecules of hepatic, vascular, and immunologic origin) that mediate specific components of the metabolic syndrome, aging, a pro-inflammatory state, hormonal changes, and combinations thereof.

[0053] The term "diabetes" includes a chronic disease characterized by high levels of sugar in the blood. Non-limiting examples include type 1 diabetes, type 2 diabetes, gestational diabetes, congenital diabetes, and insulin resistance. Patients with diabetes have high blood sugar because their body cannot move sugar (e.g., glucose) from the bloodstream into fat, liver and muscle where it can be used as a source of energy. Type 1 diabetes is the result of the body's failure to produce insulin. Type 2 diabetes results from insulin resistance, a condition in which cells of the body fail to use insulin properly. In the early stages of type 2 diabetes, patients predominantly exhibit reduced insulin sensitivity. Gestational diabetes occurs in pregnant women who have high blood glucose levels during pregnancy.

[0054] The term "analyte" includes any molecule of interest, typically a macromolecule such as a polypeptide, whose presence, amount (expression level), activation state, and/or identity is determined. In certain instances, the analyte comprises a signaling protein (e.g., signal transduction pathway component). [0055] The term "signaling protein" or "signal transduction molecule" as used herein includes a component of a signal transduction pathway from molecules at the cell surface to those in the nucleus of a cell. Examples include, but are not limited to, receptors (e.g., cell surface receptors), nuclear receptors, enzymes (e.g., kinases, phosphatases, acetylases, deacetylases, methylases, etc.), adaptor proteins, anchoring proteins, scaffolds, effectors, transducer proteins, second messengers, coregulators (e.g., coactivators, corepressors, etc.), and transcription factors. Signaling proteins carry out the process by which a cell converts an extracellular signal or stimulus into a response, which typically involves ordered sequences of biochemical reactions inside the cell. [0056] Examples of signaling proteins of interest for detection in cells such as cancer cells and tumor cells include, but are not limited to, receptor tyrosine kinases such as EGFR (e.g., EGFR/HER 1 /ErbB 1 , HER2/Neu/ErbB2, HER3/ErbB3, HER4/ErbB4), VEGFR1/FLT1 , VEGFR2/FLK1/KDR, VEGFR3/FLT4, FLT3/FLK2, PDGFR (e.g., PDGFRA, PDGFRB), c- KIT/SCFR, INSR (insulin receptor), IGF-IR, IGF-IIR, IRR (insulin receptor-related receptor), CSF-1R, FGFR 1 -4, HGFR 1-2, CCK4, TRK A-C, c-MET, RON, EPHA 1 -8, EPHB 1-6, AXL, MER, TYR03, TIE 1-2, TEK, RYK, DDR 1-2, RET, c-ROS, V-cadherin, LTK (leukocyte tyrosine kinase), ALK (anaplastic lymphoma kinase), ROR 1 -2, MUSK, AATYK 1-3, and RTK 106; truncated forms of receptor tyrosine kinases such as truncated HER2 receptors with missing amino-terminal extracellular domains (e.g., p95ErbB2 (p95m), pi 10, p95c, p95n, etc.); oncogenic fusion proteins such as BCR-ABL, DEK-CAN, E2A- PBX1 , RARa-PML, IREL-URG, CBFp-MYHl 1, AML1 -MTG8, EWS-FLI, LYT-10-Cal, HRX-ENL, HRX-AF4, NPM-ALK, IGH-MYC, RUNX1-ETO, TEL-TRKC, TEL-AML1, MLL-AF4, TCR-RBTN2, COL1A1-PDGF, E2A-HLF, PAX3-FKHR, ETV6-NTRK3, RET- PTC, TMRSS-ERG, and TPR-MET; receptor tyrosine kinase dimers (e.g., p95HER2/HER3, p95HER2/HER2, HER2/HER2, HER2/HER3, HER1/HER2, HER2/HER3, HER2/HER4, etc.); non-receptor tyrosine kinases such as Src, Frk, Btk, Csk, Abl, Zap70, Fes/Fps, Fak, Jak, Ack, and LIMK; tyrosine kinase signaling cascade components such as AKT (e.g., AKT1 , AKT2, AKT3), MEK (MAP2K1), ERK2 (MAPK1), ERK1 (MAPK3), PI3K (e.g., PIK3CA (pi 10), PIK3R1 (p85)), PDK1 , PDK2, phosphatase and tensin homolog (PTEN), SGK3, 4E- BP1 , P70S6K (e.g., p70 S6 kinase splice variant alpha I), protein tyrosine phosphatases (e.g., PTP1B, PTPN13, BDP1 , etc.), RAF, PLA2, MEKK, JNKK, JNK, p38, She (p66), Ras (e.g., K-Ras, N-Ras, H-Ras), Rho, Racl, Cdc42, PLC, PKC, p53, cyclin Dl, STAT1 , STAT3, phosphatidylinositol 4,5-bisphosphate (PIP2), phosphatidylinositol 3,4,5-trisphosphate (PIP3), mTOR, BAD, p21, p27, ROCK, IP3, TSP-1 , NOS, GSK-3p, RSK 1 -3, JNK, c-Jun, Rb, CREB, Ki67, and paxillin; nuclear hormone receptors such as estrogen receptor (ER), progesterone receptor (PR), androgen receptor, glucocorticoid receptor, mineralocorticoid receptor, vitamin A receptor, vitamin D receptor, retinoid receptor, thyroid hormone receptor, and orphan receptors; nuclear receptor coactivators and repressors such as amplified in breast cancer-1 (AIB1) and nuclear receptor corepressor 1 (NCOR), respectively; and combinations thereof.

[0057] Non-limiting examples of signaling proteins of interest for detection in cells such as cells in which perturbations in the expression and/or activation of signaling proteins result in metabolic disorders include transcriptional coactivators such as PGC-1 (e.g., PGC-Ια, PGC- lb, PRC), TBL1 , PRIP, Medl, p300, CBP, NCOA3 and TIF2; transcriptional corepressors such as NCoR, SMRT, and RIP 140; transcriptional coregulators with dual activity (activation and repression) such as SIRT1, TAZ, RB, NCoEX, TBL1, TBLR1 and SRC-2; kinases such as receptor tyrosine kinases (e.g., IGF1R, IGFR2, INSR), receptor serine/threonine kinases, non-receptor tyrosine kinases (e.g., SRC-2, SRC-3); non-receptor serine/threonine kinases (e.g., AMPK, p38 MAPK, AKTl , AKT2, mTOR, PDKl , PKCl , PKA, LKB l, and p70-S6K), and other kinases (e.g., PI3K, GSK3, and JNK); phosphatases such as PTP1B, PTEN, SHP2, and SHIP; adaptors or transducers such as SHC, GRB2, GRB IO, IRS-1, and IRS-2; ligands such as insulin, IGF1, IGF2 and ADIPOQ; effectors such as cAMP; deacetylases such as SIRT1, SIRT3, SIRT4, SIRT6, acetylases such as histone acetyltransferases (e.g., GCN5); chromatin binding proteins such as BAF, BRG1, and BRM; receptor s such as HNF-4 and WNT receptor; nuclear receptors such as LXR, FXR, ERRa,, PPARy, PPARa, PPARp, RXR, TR, ACTR, and NRF; transcription factors such as C/EBP, SREBP, NRF, TCF7L2, CREB, FOXOl, FOX03, FOX04, and ΝΚ-κΒ; and combinations thereof. [0058] The term "peroxisome proliferator gamma co-activator- 1," "PGC-1 transcriptional coactivator" or "PGC-1" refers to a family of transcriptional coactivators including, but not limited to, PGC-1 a, PGC-1 b, and PRC. These transcriptional coactivators interact with a broad range of transcription factors involved in a variety of biological processes, including adaptive thermogenesis, mitochondrial biogenesis, glucose oxidation, gluconeogenesis (e.g., generation of glucose from non-carbohydrate substrates), glucose uptake, lipogenesis, fatty acid synthesis and export, fiber type switching in skeletal muscle, heart development, and bone development.

[0059] The term "metabolic protein" refers to any protein involved in any biological process related to energy homeostasis. [0060] The term "activation state" refers to whether a particular signaling protein is activated. Similarly, the term "activation level" refers to what extent a particular signaling protein is activated. In certain embodiments, the activation state typically corresponds to the phosphorylation, acetylation, methylation, glycosylation, ubiquitination, and/or complexation status of one or more signaling proteins. [0061] The term "dilution series" includes a series of descending concentrations of a particular sample (e.g., cell lysate) or reagent (e.g., antibody or aptamer). A dilution series is typically produced by a process of mixing a measured amount of a starting concentration of a sample or reagent with a diluent (e.g., dilution buffer) to create a lower concentration of the sample or reagent, and repeating the process enough times to obtain the desired number of serial dilutions. The sample or reagent can be serially diluted at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 500, or 1000-fold to produce a dilution series comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 descending concentrations of the sample or reagent. As a non-limiting example, a dilution series comprising a 2-fold serial dilution of a capture antibody or aptamer at a 1 mg/ml starting concentration can be produced by mixing an amount of the starting concentration of capture antibody or aptamer with an equal amount of a dilution buffer to create a 0.5 mg/ml concentration of the capture antibody or aptamer, and repeating the process to obtain capture antibody or aptamer concentrations of 0.25 mg/ml, 0.125 mg/ml, 0.0625 mg/ml, 0.0325 mg/ml, etc.

[0062] The term "superior dynamic range" refers to the ability of an assay to detect a specific analyte in as few as one cell or in as many as thousands of cells. For example, the immunoassays described herein possess superior dynamic range because they advantageously detect a particular signaling protein of interest in about 1 -10,000 cells (e.g., about 1, 5, 10, 25, 50, 75, 100, 250, 500, 750, 1000, 2500, 5000, 7500, or 10,000 cells) using a dilution series of capture antibody or aptamer concentrations.

[0063] The term "sample" as used herein includes any biological specimen obtained from a patient. Samples include, without limitation, whole blood, plasma, serum, red blood cells, white blood cells (e.g., peripheral blood mononuclear cells), ductal lavage fluid, nipple aspirate, lymph (e.g., disseminated tumor cells of the lymph node), bone marrow aspirate, saliva, urine, stool (i.e., feces), sputum, bronchial lavage fluid, tears, fine needle aspirate (e.g., harvested by random periareolar fine needle aspiration), any other bodily fluid, a tissue sample (e.g., tumor tissue) such as a biopsy of a tumor (e.g., needle biopsy) or a lymph node (e.g., sentinel lymph node biopsy), a tissue sample (e.g., tumor tissue) such as a surgical resection of a tumor, a tissue sample (e.g., liver, (skeletal) muscle, adipose, or pancreatic tissue) from a tissue biopsy, and cellular extracts thereof. In some embodiments, the sample is whole blood or a fractional component thereof such as plasma, serum, or a cell pellet. In other embodiments, the sample is obtained by isolating circulating cells of a solid tumor from whole blood or a cellular fraction thereof using any technique known in the art. In further embodiments, the sample is a formalin fixed paraffin embedded (FFPE) tumor tissue sample, e.g., from a solid tumor. [0064] The term "subject" or "patient" or "individual" typically includes humans, but can also include other animals such as, e.g., other primates, rodents, canines, felines, equines, ovines, porcines, and the like.

[0065] An "array" or "microarray" comprises a distinct set and/or dilution series of capture antibodies and/or aptamers immobilized or restrained on a solid support such as, for example, glass (e.g., a glass slide), plastic, chips, pins, filters, beads (e.g., magnetic beads, polystyrene beads, etc.), paper, membrane (e.g., nylon, nitrocellulose, polyvinylidene fluoride (PVDF), etc.), fiber bundles, or any other suitable substrate. The capture antibodies and/or aptamers are generally immobilized or restrained on the solid support via covalent or noncovalent interactions (e.g., ionic bonds, hydrophobic interactions, hydrogen bonds, Van der Waals forces, dipole-dipole bonds). In certain instances, the capture antibodies and/or aptamers comprise capture tags which interact with capture agents bound to the solid support. The arrays used in the assays described herein typically comprise a plurality of different capture reagents (e.g., capture antibodies and/or aptamers) and/or capture reagent concentrations that are coupled to the surface of a solid support in different known/addressable locations.

[0066] The term "capture reagent" includes capture antibodies, capture aptamers, and combinations thereof.

[0067] The term "capture antibody" includes an immobilized antibody which is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample such as a cellular extract. In particular embodiments, the capture antibody is restrained on a solid support in an array. Suitable capture antibodies for immobilizing any of a variety of signaling proteins on a solid support are available from Upstate (Temecula, CA), Biosource (Camarillo, CA), Cell Signaling Technologies (Danvers, MA), R&D Systems (Minneapolis, MN), Lab Vision (Fremont, CA), Santa Cruz Biotechnology (Santa Cruz, CA), Sigma (St. Louis, MO), and BD Biosciences (San Jose, CA).

[0068] The term "capture aptamer" includes an immobilized aptamer which is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample such as a cellular extract. In particular embodiments, the capture aptamer is restrained on a solid support in an array. Suitable capture aptamers for immobilizing any of a variety of signaling proteins on a solid support are available from companies such as, but not limited to, Archemix (Cambridge, MA), SomaLogic (Boulder, CO), AM Biotechnologies (Houston, TX), Aptagen (Jacobus, PA), AptaRes (Germany), Aptamer Nanotechnologies (Boulder, CO), Euzoia Ltd. (United Kingdom), Ice Nine Biotechnologies (Houston, TX), and AptaMatrix (Syracuse, NY).

[0069] The term "detection reagent" includes detection antibodies, detection aptamers, and combinations thereof. Detection reagents include, but are not limited to, activation state- independent reagents (e.g., activation state-independent antibodies and/or activation state- independent aptamers), activation state-dependent reagents (e.g., activation state-dependent antibodies and/or activation state-dependent aptamers), and combinations thereof.

[0070] The term "detection antibody" as used herein includes an antibody comprising a detectable label which is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample. The term also encompasses an antibody which is specific for one or more analytes of interest, wherein the antibody can be bound by another species that comprises a detectable label. Examples of detectable labels include, but are not limited to, biotin/streptavidin labels, nucleic acid (e.g., oligonucleotide) labels, chemically reactive labels, fluorescent labels, enzyme labels, radioactive labels, and combinations thereof. Suitable detection antibodies for detecting the activation state and/or total amount of any of a variety of signaling proteins are available from Upstate (Temecula, CA), Biosource (Camarillo, CA), Cell Signaling Technologies (Danvers, MA), R&D Systems (Minneapolis, MN), Lab Vision (Fremont, CA), Santa Cruz Biotechnology (Santa Cruz, CA), Sigma (St. Louis, MO), and BD Biosciences (San Jose, CA). As a non-limiting example, phospho- specific antibodies against various phosphorylated forms of signal transduction molecules such as EGFR, c-KIT, c-Src, FLK-1, PDGFRA, PDGFRB, AKT, MAPK, PTEN, Raf, and MEK are available from Santa Cruz Biotechnology.

[0071] The term "detection aptamer" includes an aptamer comprising a detectable label which is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample. The term also encompasses an aptamer which is specific for one or more analytes of interest, wherein the aptamer can be bound by another species that comprises a detectable label. Examples of detectable labels include, but are not limited to, biotin/streptavidin labels, nucleic acid (e.g., oligonucleotide) labels, chemically reactive labels, fluorescent labels, enzyme labels, radioactive labels, and combinations thereof.

Suitable detection aptamers for detecting the activation state and/or total amount of any of a variety of signaling proteins are available from companies such as, but not limited to Archemix (Cambridge, MA), SomaLogic (Boulder, CO), AM Biotechnologies (Houston, TX), Aptagen (Jacobus, PA), AptaRes (Germany), Aptamer Nanotechnologies (Boulder, CO), Euzoia Ltd. (United Kingdom), Ice Nine Biotechnologies (Houston, TX), and

AptaMatrix (Syracuse, NY).

[0072] The term "activation state-dependent antibody" includes a detection antibody which is specific for (i.e., binds, is bound by, or forms a complex with) a particular activation state of one or more analytes of interest in a sample. In preferred embodiments, the activation state-dependent antibody detects the phosphorylation, acetylation, methylation, glycosylation, ubiquitination, and/or complexation state of one or more analytes of interest such as one or more signaling proteins. In some embodiments, the phosphorylation of members of the EGFR family of receptor tyrosine kinases and/or the formation of heterodimeric complexes between EGFR family members is detected using activation state-dependent antibodies. In particular embodiments, activation state-dependent antibodies are useful for detecting one or more sites of phosphorylation and/or acetylation (or deacetylation) of any signaling proteins described herein. As a non-limiting example, activation state-dependent antibodies used in the assays of the present invention can detect any of the phosphorylated serine/threonine sites or acetylated (or deacetylated) lysine sites on peroxisome proliferator gamma co-activator- la (PGC-l a). See, Figure 3, which shows the amino acid sequence of human PGC-Ια protein and denotes the sites of phosphorylation by AMPK and p38 MAPK as well as the sites of acetylation and deacetylation by GCN5 and SIRT1, respectively.

[0073] The term "activation state-dependent aptamer" includes a detection aptamer which is specific for (i.e., binds, is bound by, or forms a complex with) a particular activation state of one or more analytes of interest in a sample. In preferred embodiments, the activation state-dependent aptamer detects the phosphorylation, acetylation, methylation, glycosylation, ubiquitination, and/or complexation state of one or more analytes of interest such as one or more signaling proteins. In some embodiments, the phosphorylation of members of the EGFR family of receptor tyrosine kinases and/or the formation of heterodimeric complexes between EGFR family members is detected using activation state-dependent aptamers. In particular embodiments, activation state-dependent aptamers are useful for detecting one or more sites of phosphorylation and/or acetylation (or deacetylation) of any signaling proteins described herein. As a non-limiting example, activation state-dependent aptamers used in the assays of the present invention can detect any of the phosphorylated serine/threonine sites or acetylated (or deacetylated) lysine sites on PGC-la. See, Figure 3, which shows the amino acid sequence of human PGC-la protein and denotes the sites of phosphorylation by AMPK and p38 MAPK as well as the sites of acetylation and deacetylation by GCN5 and SIRT1, respectively. [0074] The term "activation state-independent antibody" includes a detection antibody which is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample irrespective of their activation state. For example, the activation state- independent antibody can detect both phosphorylated and unphosphorylated forms of one or more analytes such as one or more signaling proteins. As another example, the activation state-independent antibody can detect both acetylated and deacetylated forms of one or more analytes such as one or more signaling proteins.

[0075] The term "activation state-independent aptamer" includes a detection aptamer which is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample irrespective of their activation state. For example, the activation state- independent aptamer can detect both phosphorylated and unphosphorylated forms of one or more analytes such as one or more signaling proteins. As another example, the activation state-independent aptamer can detect both acetylated and deacetylated forms of one or more analytes such as one or more signaling proteins. [0076] The term "nucleic acid" or "polynucleotide" includes deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form such as, for example, DNA and RNA. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and which have similar binding properties as the reference nucleic acid. Examples of such analogs and modified backbone residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2'-0-methyl ribonucleotides, locked nucleic acids (LNAs), peptide-nucleic acids (PNAs), and mixtures thereof. The term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid. A particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof and complementary sequences as well as the sequence explicitly indicated.

[0077] The term "oligonucleotide" includes a single-stranded oligomer or polymer of RNA, DNA, RNA/DNA hybrid, and/or a mimetic thereof. In certain instances, oligonucleotides are composed of naturally-occurring (i.e., unmodified) nucleobases, sugars, and internucleoside (backbone) linkages. In other instances, oligonucleotides comprise modified nucleobases, sugars, and/or internucleoside linkages.

[0078] As used herein, the term "mismatch motif or "mismatch region" refers to a portion of an oligonucleotide that does not have 100% complementarity to its complementary sequence. An oligonucleotide may have at least one, two, three, four, five, six, or more mismatch regions. The mismatch regions may be contiguous or may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, or more nucleotides. The mismatch motifs or regions may comprise a single nucleotide or may comprise two, three, four, five, or more nucleotides. [0079] The phrase "stringent hybridization conditions" refers to conditions under which an oligonucleotide will hybridize to its complementary sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength pH. The T_m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T_m, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably at least 10 times the background hybridization. [0080] The terms "substantially identical" or "substantial identity," in the context of two or more nucleic acids, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same {i.e., at least about 60%, preferably at least about 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity over a specified region) when compared and aligned for maximum correspondence over a comparison window or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection. This definition, when the context indicates, also refers analogously to the complement of a sequence. Preferably, the substantial identity exists over a region that is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 nucleotides in length. [0081] The term "incubating" is used synonymously with "contacting" and "exposing" and does not imply any specific time or temperature requirements unless otherwise indicated. III. Description of the Embodiments

[0082] The present invention provides methods for detecting or measuring the expression and/or activation levels of one or a plurality of signaling proteins in samples obtained from patients in a specific, multiplex, high-throughput assay. In some embodiments, the assay is an antibody-based assay such as a Collaborative Enzyme Enhanced Reactive Immunoassay ("CEER"). In other embodiments, the assay is an aptamer-based assay such as an Aptamer- CEER ("Apta-CEER") or a Combination-CEER ("Combo-CEER") in which a combination of antibodies and aptamers is used.

[0083] In certain aspects, the present invention also provides methods for the selection of an appropriate therapy (e.g., which drug to administer, whether to administer a single drug or a combination of drugs, etc.) to down-regulate or shut down a deregulated signaling pathway associated with cancer. Thus, the present invention may be used to facilitate the design of personalized therapies for cancer patients.

[0084] In certain other aspects, the present invention provides methods for the selection of an appropriate therapy (e.g., which drug to administer, whether to administer a single drug or a combination of drugs, etc.) to down-regulate or shut down a deregulated signaling pathway associated with a metabolic disorder. Thus, the invention may be used to facilitate the design of personalized therapies for patients with a metabolic disorder such as diabetes and obesity.

[0085] In particular aspects, the present invention provides antibody- and/or aptamer-based platforms (e.g., CEER, Apta-CEER, Combo-CEER) useful for detecting or measuring levels of protein expression, post-translational modification (e.g., phosphorylation, acetylation, methylation, glycosylation, ubiquitination, etc.), complex formation (e.g., homodimers, heterodimers, multimeric complexes, etc.), expression and/or activation of fusion proteins (e.g., oncogenic fusion proteins, etc.), expression and/or activation of truncated proteins (e.g., truncated receptors, etc.), and combinations thereof. Accordingly, the present invention is particularly advantageous for aiding the prediction, diagnosis, prognosis, and/or monitoring of a pre-disease state (e.g., a pre-metabolic syndrome), a cancer, or a metabolic disorder (e.g., diabetes) by detecting any alterations (e.g., dysregulated expression and/or activation) in one or more signaling proteins of interest. A. Proximity-Based Detection of Protein Expression

[0086] In certain embodiments, the present invention provides a method for determining the expression (e.g., total) levels of one or more analytes in a sample comprising: (a) incubating (e.g., contacting) a cellular extract with one or a plurality of dilution series of capture reagents (e.g., capture antibodies or aptamers specific for one or more signaling proteins) to form a plurality of captured analytes, wherein the capture reagents are restrained on a solid support (e.g., to transform the analytes present in the cellular extract into complexes of captured analytes comprising the analytes and capture reagents);

(b) incubating (e.g., contacting) the plurality of captured analytes with detection reagents comprising one or a plurality of first and second labeled activation state-independent reagents specific for the corresponding analytes (e.g., first and second labeled activation state-independent antibodies or aptamers specific for the one or more signaling proteins) to form a plurality of labeled captured analytes (e.g., to transform the complexes of captured analytes into complexes of labeled captured analytes comprising the captured analytes and detection reagents),

wherein the first and second labeled activation state-independent reagents comprise different labels; and

(c) measuring the levels of the labeled captured analytes by detecting a signal that is generated from the first and second labeled activation state-independent reagents when both of these reagents are bound to the captured analytes, thereby determining the expression levels of the one or more analytes in the sample.

[0087] In other embodiments, the present invention provides a method for determining the expression (e.g., total) levels of one or more analytes that are truncated receptors in a sample comprising:

(a) incubating (e.g., contacting) a cellular extract with a plurality of beads specific for an extracellular domain (ECD) binding region of a full-length receptor;

(b) removing the plurality of beads from the cellular extract, thereby removing the full-length receptor to form a cellular extract devoid of the full-length receptor (e.g., to transform the cellular extract into a cellular extract devoid of a specific full-length receptor or family of full-length receptors);

(c) incubating (e.g., contacting) the cellular extract devoid of the full-length

receptor with one or a plurality of capture reagents (e.g., capture antibodies or aptamers) specific for an intracellular domain (ICD) binding region of the full- length receptor to form a plurality of captured truncated receptors, wherein the capture reagents are restrained on a solid support (e.g., to transform the truncated receptors present in a full-length receptor-depleted cellular extract into complexes of truncated receptors and capture reagents);

(d) incubating (e.g., contacting) the plurality of captured truncated receptors with detection reagents comprising one or a plurality of first and second labeled activation state-independent reagents specific for an ICD binding region of the full-length receptor (e.g., to transform the complexes of captured truncated receptors into complexes of labeled captured truncated receptors comprising the captured truncated receptors and detection reagents),

(e) measuring the levels of the labeled captured truncated receptors by detecting a signal that is generated from the first and second labeled activation state- independent reagents when both of these reagents are bound to the captured truncated receptors, thereby determining the expression levels of the one or more truncated receptors in the sample.

[0088] The truncated receptor is typically a fragment of the full-length receptor and shares an ICD binding region with the full-length receptor. In certain embodiments, the full-length receptor comprises an ECD binding region, a transmembrane domain, and an ICD binding region. Without being bound to any particular theory, the truncated receptor may arise through the proteolytic processing of the ECD of the full-length receptor or by alternative initiation of translation from methionine residues that are located before, within, or after the transmembrane domain, e.g., to create a truncated receptor with a shortened ECD or a truncated receptor comprising a membrane-associated or cytosolic ICD fragment. [0089] In certain preferred embodiments, the truncated receptor is p95HER2 and the corresponding full-length receptor is HER2. However, one skilled in the art will appreciate that the methods described herein for detecting truncated proteins can be applied to a number of different proteins including, but not limited to, the EGFR VIII mutant (implicated in glioblastoma, colorectal cancer, etc.), other truncated receptor tyrosine kinases, caspases, and the like. Example 12 of PCT Publication No. WO 2009/108637, the disclosure of which is herein incorporated by reference in its entirety for all purposes, provides an exemplary embodiment of the assay methods of the present invention for detecting truncated receptors such as p95HER2 in cells using CEER. [0090] In some embodiments, the plurality of beads specific for an ECD binding region comprises a streptavidin-biotin pair, wherein the streptavidin is attached to the bead and the biotin is attached to an antibody. In certain instances, the antibody is specific for the ECD binding region of the full-length receptor.

[0091] In further embodiments, the present invention provides a method for determining the expression (e.g., total) levels of one or more fusion proteins in a sample comprising:

(a) incubating (e.g., contacting) a cellular extract with a dilution series of capture reagents (e.g., capture antibodies or aptamers) specific for the fusion protein to form a plurality of captured fusion proteins, wherein the capture reagents are restrained on a solid support, wherein the fusion protein comprises a first domain corresponding to a first full-length protein and a second domain corresponding to a second, different full-length protein, and wherein the capture reagents are specific for the first domain of the fusion protein;

(b) incubating (e.g., contacting) the plurality of captured fusion proteins with at least two types of detection reagents to form a plurality of labeled captured fusion proteins,

wherein the detection reagents comprise a plurality of first and second labeled

activation state-independent reagents specific for the corresponding fusion proteins (e.g., first and second labeled activation state-independent antibodies and/or aptamers (1) that are both specific for the second domain of the fusion protein or (2) where one is specific for the first domain of the fusion protein and the other is specific for the second domain of the fusion protein) to form a plurality of labeled captured fusion proteins (e.g., to transform the complexes of captured fusion proteins into complexes of labeled captured fusion proteins comprising the captured fusion proteins and detection reagents), wherein the first and second labeled activation state-independent reagents comprise different labels; and

(c) measuring the levels of the labeled captured fusion proteins by detecting a signal that is generated from the first and second labeled activation state- independent reagents when both of these reagents are bound to the captured fusion proteins, thereby determining the expression levels of the one or more fusion proteins in the sample.

[0092] In certain instances, the cellular extract containing a fusion protein is first contacted with a binding moiety specific for a domain of the first or second full-length protein that is not present in the fusion protein under conditions suitable to transform the first or second full-length protein present in the cellular extract into a complex comprising the first or second full-length protein and the binding moiety. In other instances, the resulting complex is then removed from the cellular extract to form a cellular extract devoid of the first or second full- length protein. These steps can be performed such that one or both full-length proteins are removed from the cellular extract. Additional embodiments related to methods for detecting fusion protein expression levels is described in PCT Publication No. WO 201 1/050069, the disclosure of which is herein incorporated by reference in its entirety for all purposes.

[0093] In some embodiments, the capture reagents and first and second labeled activation state-independent reagents are all antibodies. In other embodiments, the capture reagents and first and second labeled activation state-independent reagents are all aptamers. In yet other embodiments, the capture reagents are antibodies and the first and second labeled activation state-independent reagents are both aptamers. In further embodiments, the capture reagents are aptamers and the first and second labeled activation state-independent reagents are both antibodies. In additional embodiments, the capture reagents are antibodies and one of the first and second labeled activation state-independent reagents are aptamers, while the other of the first and second labeled activation state-independent reagents are antibodies. In related embodiments, the capture reagents are aptamers and one of the first and second labeled activation state-independent reagents are aptamers, while the other of the first and second labeled activation state-independent reagents are antibodies.

[0094] The capture reagents, first labeled activation state-independent reagents, and second labeled activation state-independent reagents are preferably selected to minimize competition between them with respect to analyte binding (i.e., all reagents can simultaneously bind their corresponding signaling proteins). [0095] Non-limiting examples of labels attached to the detection reagents described herein (e.g., the first and second labeled activation state-independent reagents) include fluorescent labels, chemically reactive labels, enzyme labels, radioactive labels, and combinations thereof. The labels can be coupled directly or indirectly to the detection reagents using methods well-known in the art.

[0096] In preferred embodiments, the methods of the present invention are proximity-based such that they rely upon a signal that is generated by the proximity binding of both detection reagents to the captured analytes. [0097] The term "proximity" as used herein includes reference to the spatial nearness or closeness of a first detection reagent to a second, different detection reagent (e.g., which binds to a different epitope) when both detection reagents are bound to the same analyte (e.g., a signaling protein). In particular embodiments, the- binding of a first detection reagent to an analyte at a distance near or close to the binding of a second, different detection reagent to the same analyte is sufficient to generate a detectable signal. In some embodiments, the term "proximity" includes those distances between the labeled reagents, when bound to the same analyte, that are sufficient to generate a detectable signal. In certain other embodiments, the term "proximity" includes those distances between the detectable labels (e.g., chromogenic and/or fluorescent labels) attached to the reagents, when bound to the same analyte, that are sufficient to generate a detectable signal. In particular embodiments, the labeled reagents and/or the detectable labels attached thereto are brought into proximity of each other (e.g., from about 1 to about 300 nm or from about 1 to about 200 nm of each other, such as, for example, about 1, 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300 nm or any range thereof, or from about 1 to about 10 nm, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nm or any range thereof) due to the interaction of both the first and second labeled reagents with the analyte of interest.

[0098] In particular embodiments, the signal generated is a chromogenic or fluorescent signal wherein the first labeled activation state-independent reagents are labeled with a facilitating moiety, the second labeled activation state-independent reagents are labeled with a first member of a signal amplification pair, and wherein the facilitating moiety generates an oxidizing agent which channels to and reacts with the first member of the signal amplification pair. In such embodiments, the "measuring" step comprises measuring the levels of the labeled captured analytes by: (i) incubating (e.g., contacting) the plurality of labeled captured analytes with a second member of the signal amplification pair to generate an amplified signal; and (ii) detecting the amplified signal generated from the first and second members of the signal amplification pair.

[0099] In those embodiments of the proximity-based methods of the present invention that use a facilitating moiety, the first labeled activation state-independent reagents can be directly labeled with the facilitating moiety. The facilitating moiety can be coupled to the first labeled activation state-independent reagents using methods well-known in the art. A suitable facilitating moiety for use in the present invention includes any molecule capable of generating an oxidizing agent which channels to (i.e., is directed to) and reacts with (i.e., binds, is bound by, or forms a complex with) another molecule in proximity (i.e., spatially near or close) to the facilitating moiety. Examples of facilitating moieties include, without limitation, enzymes such as glucose oxidase (GO) or any other enzyme that catalyzes an oxidation/reduction reaction involving molecular oxygen (0₂) as the electron acceptor, and photosensitizers such as, for example, methylene blue, rose bengal, porphyrins, squarate dyes, phthalocyanines, and the like. Non-limiting examples of oxidizing agents include hydrogen peroxide (H₂0₂), a singlet oxygen, and any other compound that transfers oxygen atoms or gains electrons in an oxidation/reduction reaction. Preferably, in the presence of a suitable substrate (e.g., glucose, light, etc.), the facilitating moiety (e.g., glucose oxidase, photosensitizer, etc.) generates an oxidizing agent (e.g., hydrogen peroxide (H₂0₂), single oxygen, etc.) which channels to and reacts with the first member of the signal amplification pair (e.g., horseradish peroxidase (HRP), hapten protected by a protecting group, an enzyme inactivated by thioether linkage to an enzyme inhibitor, etc.) when the two moieties are in proximity to each other.

[0100] In certain instances, the first labeled activation state-independent reagents can be indirectly labeled with the facilitating moiety via hybridization between an oligonucleotide linker conjugated to the first labeled activation state-independent reagents and a

complementary oligonucleotide linker conjugated to the facilitating moiety. The

oligonucleotide linkers can be coupled to the facilitating moiety or to the first labeled activation state-independent reagents using methods well-known in the art. In some embodiments, the oligonucleotide linker conjugated to the facilitating moiety has 100% complementarity to the oligonucleotide linker conjugated to the first labeled activation state- independent reagents. In other embodiments, the oligonucleotide linker pair comprises at least one, two, three, four, five, six, or more mismatch regions, e.g., upon hybridization under stringent hybridization conditions. One skilled in the art will appreciate that first labeled activation state-independent reagents specific for different analytes can either be conjugated to the same oligonucleotide linker or to different oligonucleotide linkers.

[0101] The length of the oligonucleotide linkers that are conjugated to the facilitating moiety or to the first labeled activation state-independent reagents can vary. In general, the linker sequence can typically be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 nucleotides in length. Typically, random nucleic acid sequences are generated for coupling. As a non-limiting example, a library of oligonucleotide linkers can be designed to have three distinct contiguous domains: a spacer domain; signature domain; and conjugation domain. Preferably, the oligonucleotide linkers are designed for efficient coupling without destroying the function of the facilitating moiety or first labeled activation state-independent reagents to which they are conjugated.

[0102] The oligonucleotide linker sequences can be designed to prevent or minimize any secondary structure formation under a variety of assay conditions. Melting temperatures are typically carefully monitored for each segment within the linker to allow their participation in the overall assay procedures. Generally, the range of melting temperatures of the segment of the linker sequence is between about 1-10°C. Computer algorithms (e.g., OLIGO 6.0) for determining the melting temperature, secondary structure, and hairpin structure under defined ionic concentrations can be used to analyze each of the three different domains within each linker. The overall combined sequences can also be analyzed for their structural

characterization and their comparability to other conjugated oligonucleotide linker sequences, e.g., whether they will hybridize under stringent hybridization conditions to a complementary oligonucleotide linker.

[0103] The spacer region of the oligonucleotide linker provides adequate separation of the conjugation domain from the oligonucleotide cross-linking site. The conjugation domain functions to link molecules labeled with a complementary oligonucleotide linker sequence to the conjugation domain via nucleic acid hybridization. In one exemplary embodiment, the nucleic acid-mediated hybridization can be performed either before or after antibody-analyte (i.e., antigen) complex formation, providing a more flexible assay format. Unlike many direct antibody conjugation methods, linking relatively small oligonucleotides to antibodies or other molecules has minimal impact on the specific affinity of antibodies towards their target analyte or on the function of the conjugated molecules.

[0104] In some embodiments, the signature sequence domain of the oligonucleotide linker can be used in complex multiplexed protein assays. Multiple antibodies and/or aptamers can be conjugated with oligonucleotide linkers with different signature sequences. In multiplex immunoassays, reporter oligonucleotide sequences labeled with appropriate probes can be used to detect cross-reactivity between antibodies and/or aptamers and their antigens in the multiplex assay format.

[0105] Oligonucleotide linkers can be conjugated to antibodies or other molecules using several different methods. For example, oligonucleotide linkers can be synthesized with a thiol group on either the 5' or 3' end. The thiol group can be deprotected using reducing agents (e.g., TCEP-HC1) and the resulting linkers can be purified by using a desalting spin column. The resulting deprotected oligonucleotide linkers can be conjugated to the primary amines of antibodies or other types of proteins using heterobifunctional cross linkers such as SMCC. Alternatively, 5 '-phosphate groups on oligonucleotides can be treated with water- soluble carbodiimide EDC to form phosphate esters and subsequently coupled to amine- containing molecules. In certain instances, the diol on the 3'-ribose residue can be oxidized to aldehyde groups and then conjugated to the amine groups of antibodies or other types of proteins using reductive amination. In certain other instances, the oligonucleotide linker can be synthesized with a biotin modification on either the 3' or 5' end and conjugated to streptavidin-labeled molecules.

[0106] Oligonucleotide linkers can be synthesized using any of a variety of techniques known in the art, such as those described in Usman et al, J. Am. Chem. Soc, 109:7845 (1987); Scaringe et al, Nucl. Acids Res., 18:5433 (1990); Wincott et al, Nucl. Acids Res., 23:2677-2684 (1995); and Wincott et al, Methods Mol. Bio., 74:59 (1997). In general, the synthesis of oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5 '-end and phosphoramidites at the 3 '-end. Suitable reagents for oligonucleotide synthesis, methods for nucleic acid deprotection, and methods for nucleic acid purification are known to those of skill in the art.

[0107] In certain instances, the second labeled activation state-independent reagents are directly labeled with the first member of the signal amplification pair. In some instances, the signal amplification pair member can be coupled to the second labeled activation state- independent reagents using methods well-known in the art. In certain other instances, the second labeled activation state-independent reagents are indirectly labeled with the first member of the signal amplification pair via binding between a first member of a binding pair conjugated to the second labeled activation state-independent reagents and a second member of the binding pair conjugated to the first member of the signal amplification pair. The binding pair members (e.g., biotin/streptavidin) can be coupled to the signal amplification pair member or to the second labeled activation state-independent reagents using methods well-known in the art. Examples of signal amplification pair members include, but are not limited to, peroxidases such horseradish peroxidase (HRP), catalase, chloroperoxidase, cytochrome c peroxidase, eosinophil peroxidase, glutathione peroxidase, lactoperoxidase, myeloperoxidase, thyroid peroxidase, deiodinase, and the like. Other examples of signal amplification pair members include haptens protected by a protecting group and enzymes inactivated by thioether linkage to an enzyme inhibitor.

[0108] In one example of proximity channeling, the facilitating moiety is glucose oxidase (GO) and the first member of the signal amplification pair is horseradish peroxidase (HRP). When the GO is contacted with a substrate such as glucose, it generates an oxidizing agent (i.e., hydrogen peroxide (H₂0₂)). If the HRP is within channeling proximity to the GO, the ¾0₂ generated by the GO is channeled to and complexes with the HRP to form an HRP- H₂0₂ complex, which, in the presence of the second member of the signal amplification pair (e.g., a chemiluminescent substrate such as luminol or isoluminol or a fluorogenic substrate such as tyramide (e.g., biotin-tyramide), homovanillic acid, or 4-hydroxyphenyl acetic acid), generates an amplified signal. Methods of using GO and HRP in a proximity assay are described in, e.g., WO 2008/036802, the disclosure of which is herein incorporated by reference in its entirety for all purposes. When biotin-tyramide is used as the second member of the signal amplification pair, the HRP-H₂0₂ complex oxidizes the tyramide to generate a reactive tyramide radical that covalently binds nearby nucleophilic residues. The activated tyramide is either directly detected or detected upon the addition of a signal-detecting reagent such as, for example, a streptavidin-labeled fluorophore or a combination of a streptavidin- labeled peroxidase and a chromogenic reagent. Examples of fluorophores suitable for use in the present invention include, but are not limited to, any of the fluorophores described herein such as an Alexa Fluor® dye (e.g., Alexa Fluor^® 555), fluorescein, fluorescein isothiocyanate (FITC), Oregon Green™; rhodamine, Texas red, tetrarhodamine isothiocynate (TRITC), a CyDye™ fluor (e.g., Cy2, Cy3, Cy5), and the like. The streptavidin label can be coupled directly or indirectly to the fluorophore or peroxidase using methods well-known in the art. Non-limiting examples of chromogenic reagents suitable for use in the present invention include 3,3',5,5'-tetramethylbenzidine (TMB), 3,3'-diaminobenzidine (DAB), 2,2'-azino- bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), 4-chloro-l -napthol (4CN), and/or porphyrinogen.

[0109] In another example of proximity channeling, the facilitating moiety is a

photosensitizer and the first member of the signal amplification pair is a large molecule labeled with multiple haptens that are protected with protecting groups that prevent binding of the haptens to a specific binding partner (e.g., ligand, antibody, etc.). For example, the signal amplification pair member can be a dextran molecule labeled with protected biotin, coumarin, and/or fluorescein molecules. Suitable protecting groups include, but are not limited to, phenoxy-, analino-, olefin-, thioether-, and selenoether-protecting groups.

Additional photosensitizers and protected hapten molecules suitable for use in the proximity assays of the present invention are described in U.S. Patent No. 5,807,675, the disclosure of which is herein incorporated by reference in its entirety for all purposes. When the photosensitizer is excited with light, it generates an oxidizing agent (i.e., singlet oxygen). If the hapten molecules are within channeling proximity to the photosensitizer, the singlet oxygen generated by the photosensitizer is channeled to and reacts with thioethers on the protecting groups of the haptens to yield carbonyl groups (ketones or aldehydes) and sulphinic acid, releasing the protecting groups from the haptens. The unprotected haptens are then available to specifically bind to the second member of the signal amplification pair (e.g., a specific binding partner that can generate a detectable signal). For example, when the hapten is biotin, the specific binding partner can be an enzyme-labeled streptavidin.

Exemplary enzymes include alkaline phosphatase, β-galactosidase, HRP, etc. After washing to remove unbound reagents, the detectable signal can be generated by adding a detectable (e.g., fluorescent, chemiluminescent, chromogenic, etc.) substrate of the enzyme and detected using suitable methods and instrumentation known in the art. Alternatively, the detectable signal can be amplified using tyramide signal amplification and the activated tyramide either directly detected or detected upon the addition of a signal-detecting reagent as described above. [0110] In yet another example of proximity channeling, the facilitating moiety is a photosensitizer and the first member of the signal amplification pair is an enzyme-inhibitor complex. The enzyme and inhibitor (e.g., phosphonic acid-labeled dextran) are linked together by a cleavable linker (e.g., thioether). When the photosensitizer is excited with light, it generates an oxidizing agent (i.e., singlet oxygen). If the enzyme-inhibitor complex is within channeling proximity to the photosensitizer, the singlet oxygen generated by the photosensitizer is channeled to and reacts with the cleavable linker, releasing the inhibitor from the enzyme, thereby activating the enzyme. An enzyme substrate is added to generate a detectable signal, or alternatively, an amplification reagent is added to generate an amplified signal. [0111] In a further example of proximity channeling, the facilitating moiety is HRP, the first member of the signal amplification pair is a protected hapten or an enzyme-inhibitor complex as described above, and the protecting groups comprise p-alkoxy phenol. The addition of phenylenediamine and H₂0₂ generates a reactive phenylene diimine which channels to the protected hapten or the enzyme-inhibitor complex and reacts with p-alkoxy phenol protecting groups to yield exposed haptens or a reactive enzyme. The amplified signal is generated and detected as described above (see, e.g., U.S. Patent Nos. 5,532,138 and 5,445,944, the disclosures of which are herein incorporated by reference in their entirety for all purposes). [0112] In certain other embodiments, the signal that is generated from the first and second labeled activation state-independent reagents is a fluorescent signal that can be detected by fluorescence resonance energy transfer (FRET). In further embodiments, the signal is detected by another proximity-based method as described herein or known to one of skill in the art.

[0113] FRET describes an energy transfer mechanism between two fluorescent molecules. When a fluorescent donor is excited at its specific fluorescence excitation wavelength, this excited state is nonradiatively transferred to a second molecule, the acceptor, by a long-range dipole-dipole coupling mechanism. The donor then returns to the electronic ground state. See, e.g., Lakowicz, Principles of Fluorescence Spectroscopy, Plenum Publishing Corp., 2nd Ed. (1999). In the context of the invention, the first labeled activation state-independent reagents can be labeled with a donor comprising a first fluorescent dye and the second labeled activation state-independent reagents can be labeled with an acceptor comprising a second fluorescent dye that has a different excitation and emission spectra from the first fluorescent dye. Non-limiting examples of fluorescent dyes suitable for use in the present invention include fluorophores such as Alexa Fluor® dyes (e.g., Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 635, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, Alexa Fluor® 750, and/or Alexa Fluor® 790), as well as other fluorophores such as, for example, fluorescein, FITC, rhodamine, Texas Red, TRITC, Cy3, Cy5, Cy5.5, Cy7, and derivatives thereof.

[0114] In certain embodiments, a sample that is to be interrogated for the presence and/or expression level of one or more analytes of interest is incubated with first and second labeled activation state-independent reagents comprising donor and acceptor fluorophores. If the analyte of interest is not present in the sample, the donor emission is detected upon donor excitation. On the other hand, if the analyte of interest is present in the sample, the donor and acceptor fluorophores are brought into proximity (e.g., from about 1 to about 300 nm or from about 1 to about 200 nm of each other, such as, for example, about 1, 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300 nm or any range thereof, or from about 1 to about 10 nm, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nm or any range thereof) due to the interaction of both the first and second labeled activation state-independent reagents with the analyte of interest. The intermolecular FRET from the donor fluorophore to the acceptor fluorophore results in the acceptor emission being predominantly observed. For example, excitation at 480 nm for Alexa488 as the donor fluorophore on the first labeled activation state- independent reagents induces formation of singlet oxygen molecules that react with thioxene derivatives, generating chemiluminescence, which in turn excites the acceptor fluorophore Alexa532 on the second labeled activation state-independent reagents to emit at 575 nm.

B. Proximity-Based Detection of Protein Activation

[0115] In other embodiments, the present invention provides a method for determining the activation (e.g., phosphorylation, acetylation or deacetylation, methylation, etc.) levels of one or more analytes in a sample comprising:

(a) incubating (e.g., contacting) a cellular extract with one or a plurality of dilution series of a capture reagents (e.g., capture antibodies or aptamers specific for one or more signaling proteins) to form a plurality of captured analytes, wherein the capture reagents are restrained on a solid support (e.g., to transform the analytes present in the cellular extract into complexes of captured analytes comprising the analytes and capture reagents);

(b) incubating (e.g., contacting) the plurality of captured analytes with detection reagents comprising labeled activation state-independent reagents specific for the corresponding analytes (e.g., labeled activation state-independent antibodies or aptamers specific for the one or more signaling proteins) and labeled activation state-dependent reagents specific for the corresponding analytes (e.g., labeled activation state-dependent antibodies or aptamers specific for the one or more signaling proteins) to form a plurality of labeled captured analytes (e.g., to transform the complexes of captured analytes into complexes of labeled captured analytes comprising the captured analytes and detection reagents),

wherein the labeled activation state-independent reagents and labeled activation state-dependent reagents comprise different labels; and

(c) measuring the levels of the labeled captured analytes by detecting a signal that is generated from the labeled activation state-independent reagents and labeled activation state-dependent reagents when both of these reagents are bound to the captured analytes, thereby determining the activation levels of the one or more analytes in the sample.

[0116] In yet other embodiments, the present invention provides a method for determining the activation (e.g., phosphorylation, acetylation or deacetylation, methylation, etc.) levels of one or more analytes that are truncated receptors in a sample comprising: (a) incubating (e.g., contacting) a cellular extract with a plurality of beads specific for an extracellular domain (ECD) binding region of a full-length receptor;

(d) incubating (e.g., contacting) the plurality of captured truncated receptors with detection reagents comprising labeled activation state-independent reagents and labeled activation state-dependent reagents specific for an ICD binding region of the full-length receptor (e.g., labeled activation state- independent antibodies or aptamers and labeled activation state-dependent antibodies or aptamers specific for the ICD binding region of the full-length receptor) to form a plurality of labeled captured truncated receptors (e.g., to transform the complexes of captured truncated receptors into complexes of labeled captured truncated receptors comprising the captured truncated receptors and detection reagents),

wherein the labeled activation state-independent reagents and the labeled activation state-dependent reagents comprise different labels; and

(e) measuring the levels of the labeled captured truncated receptors by detecting a signal that is generated from the labeled activation state-independent reagents and labeled activation state-dependent reagents when both of these reagents are bound to the captured truncated receptors, thereby determining the activation levels of the one or more truncated receptors in the sample.

[0117] The truncated receptor is typically a fragment of the full-length receptor and shares an ICD binding region with the full-length receptor. In certain embodiments, the full-length receptor comprises an ECD binding region, a transmembrane domain, and an ICD binding region. Without being bound to any particular theory, the truncated receptor may arise through the proteolytic processing of the ECD of the full-length receptor or by alternative initiation of translation from methionine residues that are located before, within, or after the transmembrane domain, e.g., to create a truncated receptor with a shortened ECD or a truncated receptor comprising a membrane-associated or cytosolic ICD fragment. [0118] In certain preferred embodiments, the truncated receptor is p95HER2 and the corresponding full-length receptor is HER2. However, one skilled in the art will appreciate that the methods described herein for detecting truncated proteins can be applied to a number of different proteins including, but not limited to, the EGFR VIII mutant (implicated in glioblastoma, colorectal cancer, etc.), other truncated receptor tyrosine kinases, caspases, and the like. Example 12 of PCT Publication No. WO 2009/108637, the disclosure of which is herein incorporated by reference in its entirety for all purposes, provides an exemplary embodiment of the assay methods of the present invention for detecting truncated receptors such as p95HER2 in cells using CEER.

[0119] In some embodiments, the plurality of beads specific for an ECD binding region comprises a streptavidin-biotin pair, wherein the streptavidin is attached to the bead and the biotin is attached to an antibody. In certain instances, the antibody is specific for the ECD binding region of the full-length receptor.

[0120] In further embodiments, the present invention provides a method for determining the activation (e.g., phosphorylation, acetylation or deacetylation, methylation, etc.) levels of one or more fusion proteins in a sample comprising:

wherein the detection reagents comprise labeled activation state-independent

reagents and labeled activation state-dependent reagents specific for the corresponding fusion proteins (e.g., detection antibodies and/or aptamers (1) that are both specific for the second domain of the fusion protein or (2) where one is specific for the first domain of the fusion protein and the other is specific for the second domain of the fusion protein) to form a plurality of labeled captured fusion proteins (e.g., to transform the complexes of captured fusion proteins into complexes of labeled captured fusion proteins comprising the captured fusion proteins and detection reagents),

(c) measuring the levels of the labeled captured fusion proteins by detecting a signal that is generated from the labeled activation state-independent reagents and labeled activation state-dependent reagents when both of these reagents are bound to the captured fusion proteins, thereby determining the activation levels of the one or more fusion proteins in the sample.

[0121] In certain instances, the cellular extract containing a fusion protein is first contacted with a binding moiety specific for a domain of the first or second full-length protein that is not present in the fusion protein under conditions suitable to transform the first or second full-length protein present in the cellular extract into a complex comprising the first or second full-length protein and the binding moiety. In other instances, the resulting complex is then removed from the cellular extract to form a cellular extract devoid of the first or second full- length protein. These steps can be performed such that one or both full-length proteins are removed from the cellular extract. Additional embodiments related to methods for detecting fusion protein activation levels is described in PCT Publication No. WO 201 1/050069, the disclosure of which is herein incorporated by reference in its entirety for all purposes.

[0122] In some embodiments, the capture reagents, the labeled activation state-independent reagents, and the labeled activation state-dependent reagents are all antibodies. In other embodiments, the capture reagents, the labeled activation state-independent reagents, and the labeled activation state-dependent reagents are all aptamers. In yet other embodiments, the capture reagents are antibodies, and the labeled activation state-independent reagents and the labeled activation state-dependent reagents are both aptamers. In further embodiments, the capture reagents are aptamers, and the labeled activation state-independent reagents and the labeled activation state-dependent reagents are both antibodies. In additional embodiments, the capture reagents are antibodies and one of the labeled activation state-independent and activation state-dependent reagents are aptamers, while the other of the labeled activation state-independent and activation state-dependent reagents are antibodies. In related embodiments, the capture reagents are aptamers and one of the labeled activation state- independent and activation state-dependent reagents are aptamers, while the other of the labeled activation state-independent and activation state-dependent reagents are antibodies.

[0123] The capture reagents, labeled activation state-independent reagents, and labeled activation state-dependent reagents are preferably selected to minimize competition between them with respect to analyte binding (i.e., all reagents can simultaneously bind their corresponding signaling proteins).

[0124] Non-limiting examples of labels attached to the detection reagents described herein (e.g., the labeled activation state-independent reagents and the labeled activation state- dependent reagents) include fluorescent labels, chemically reactive labels, enzyme labels, radioactive labels, and combinations thereof. The labels can be coupled directly or indirectly to the detection reagents using methods well-known in the art.

[0125] In preferred embodiments, the methods of the present invention are proximity-based such that they rely upon a signal that is generated by the proximity binding of both detection reagents to the captured analytes. The meaning of the term "proximity" in the context of the present invention is described in paragraph [0097] above.

[0126] In particular embodiments, the signal generated is a chromogenic or fluorescent signal wherein the labeled activation state-independent reagents are labeled with a facilitating moiety, the labeled activation state-dependent reagents are labeled with a first member of a signal amplification pair, and wherein the facilitating moiety generates an oxidizing agent which channels to and reacts with the first member of the signal amplification pair. In such embodiments, the "measuring" step comprises measuring the levels of the labeled captured analytes by: (i) incubating (e.g., contacting) the plurality of labeled captured analytes with a second member of the signal amplification pair to generate an amplified signal; and (ii) detecting the amplified signal generated from the first and second members of the signal amplification pair.

[0127] In those embodiments of the proximity-based methods of the present invention that use a facilitating moiety, the labeled activation state-independent reagents can be directly or indirectly labeled with the facilitating moiety. Non-limiting embodiments that are directed to facilitating moieties for use in determining the activation levels of one or more analytes in accordance with the present invention are described in paragraphs [0099] to [0106] above.

[0128] In certain instances, the labeled activation state-dependent reagents are directly or indirectly labeled with the first member of the signal amplification pair. Non-limiting embodiments that are directed to signal amplification pair members for use in determining the activation levels of one or more analytes in accordance with the present invention are described in paragraph [0107] above.

[0129] One non-limiting example of proximity channeling, wherein the facilitating moiety is glucose oxidase (GO) and the first member of the signal amplification pair is horseradish peroxidase (HRP), is described in paragraph [0108] above. Another non-limiting example of proximity channeling, wherein the facilitating moiety is a photosensitizer and the first member of the signal amplification pair is a large molecule labeled with multiple haptens that are protected with protecting groups that prevent binding of the haptens to a specific binding partner, is described in paragraph [0109] above. Yet another non-limiting example of proximity channeling, wherein the facilitating moiety is a photosensitizer and the first member of the signal amplification pair is an enzyme-inhibitor complex, is described in paragraph [01 10] above. A further non-limiting example of proximity channeling, wherein the facilitating moiety is HRP, the first member of the signal amplification pair is a protected hapten or an enzyme-inhibitor complex, and the protecting groups comprise p-alkoxy phenol, is described in paragraph [011 1] above.

[0130] In other embodiments, the signal that is generated from the labeled activation state- independent reagents and the labeled activation state-dependent reagents is a fluorescent signal that can be detected by fluorescence resonance energy transfer (FRET). In further embodiments, the signal is detected by another proximity-based method as described herein or known to one of skill in the art.

[0131] In the context of the invention, the labeled activation state-independent reagents can be labeled with a donor comprising a first fluorescent dye and the labeled activation state- dependent reagents can be labeled with an acceptor comprising a second fluorescent dye that has a different excitation and emission spectra from the first fluorescent dye. Non-limiting examples of fluorescent dyes suitable for use in the present invention include fluorophores such as Alexa Fluor® dyes (e.g., Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 635, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, Alexa Fluor® 750, and/or Alexa Fluor® 790), as well as other fluorophores such as, for example, fluorescein, FITC, rhodamine, Texas Red, TRITC, Cy3, Cy5, Cy5.5, Cy7, and derivatives thereof. [0132] In certain embodiments, a sample that is to be interrogated for the activation state or level of one or more analytes of interest is incubated with detection reagents (e.g., labeled activation state-independent and activation state-dependent reagents) comprising donor and acceptor fluorophores. If the analyte of interest is not present in the sample, the donor emission is detected upon donor excitation. On the other hand, if the analyte of interest is present in the sample, the donor and acceptor fluorophores are brought into proximity (e.g., from about 1 to about 300 nm or from about 1 to about 200 nm of each other, such as, for example, about 1 , 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300 nm or any range thereof, or from about 1 to about 10 nm, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nm or any range thereof) due to the interaction of both the detection reagents with the analyte of interest. The intermolecular FRET from the donor fluorophore to the acceptor fluorophore results in the acceptor emission being predominantly observed. For example, excitation at 480 nm for Alexa488 as the donor fluorophore on the labeled activation state-independent reagents induces formation of singlet oxygen molecules that react with thioxene derivatives, generating chemiluminescence, which in turn excites the acceptor fluorophore Alexa532 on the labeled activation state-dependent reagents to emit at 575 nm.

C. Exemplary Proximity-Based Assays

[0133] Figure 1 illustrates exemplary embodiments of the present invention for detecting the expression and/or activation of a protein complex of interest using CEER (i.e., capture reagents and detection reagents are all antibodies), Apta-CEER (i.e., capture reagents and detection reagents are all aptamers), and Combo-CEER (i.e., capture reagents and detection reagents are a combination of antibodies and aptamers).

[0134] Figure 2 illustrates additional exemplary embodiments of the present invention for detecting the expression and/or activation of small proteins (e.g., low molecular weight proteins, polypeptides, or peptides) and denatured proteins (e.g., unfolded proteins or proteins that are in an inactive conformation and do not exhibit a functional secondary, tertiary, and/or quaternary structure) using Apta-CEER (i.e., capture reagents and detection reagents are all aptamers). In some embodiments, the expression and/or activation of small proteins and denatured proteins can be detected using CEER (i.e., capture reagents and detection reagents are all antibodies) and Combo-CEER (i.e., capture reagents and detection reagents are a combination of antibodies and aptamers). [0135] An exemplary protocol for performing the proximity-based assays described herein is provided in Example 4 of PCT Publication No. WO 2009/108637, the disclosure of which is herein incorporated by reference in its entirety for all purposes.

D. Kits for Proximity-Based Assays

[0136] In yet another embodiment, the present invention provides kits for performing the proximity-based assays described herein comprising: (a) a dilution series of one or a plurality of capture reagents (e.g., capture antibodies and/or aptamers) restrained on a solid support; and (b) one or a plurality of first and second detection reagents (e.g., any combination of labeled activation state-independent and labeled activation state-dependent antibodies and/or aptamers). In some instances, the kits can further contain instructions for methods of using the kit to detect the expression and/or activation status of one or a plurality of signaling proteins of cells such as tumor cells or cells associated with metabolic disorders. The kits may also contain any of the additional reagents described above with respect to performing the specific methods of the present invention such as, for example, first and second members of the signal amplification pair, tyramide signal amplification reagents, substrates for the facilitating moiety, wash buffers, etc.

E. Analysis of Proximity-Based Assays

[0137] In certain embodiments, the levels of expression (e.g., total) and/or activation (e.g., phosphorylation, acetylation/deacetylation, and/or methylation) of the one or more analytes such as one or a plurality of signaling proteins is expressed as a relative fluorescence unit (RFU) value that corresponds to the signal intensity for a particular analyte of interest that is determined using, e.g., an antibody-based assay such as a Collaborative Enzyme Enhanced Reactive Immunoassay ("CEER"), an aptamer-based assay such as an Aptamer-CEER ("Apta-CEER"), or a Combination-CEER ("Combo-CEER") in which a combination of antibodies and aptamers is used. In certain other embodiments, the expression level and/or activation level of the one or more analytes is quantitated by calibrating or normalizing the RFU value that is determined using, e.g., a proximity-based assay such as CEER, Apta- CEER, or Combo-CEER, against a standard curve generated for the particular analyte of interest. In certain instances, the RFU value can be calculated based upon a standard curve. [0138] In other embodiments, the expression level and/or activation level of the one or more analytes is expressed as "low", "medium", or "high" that corresponds to increasing signal intensity for a particular analyte of interest determined using, e.g., a proximity-based assay such as CEER, Apta-CEER, or Combo-CEER. In some instances, an undetectable or minimally detectable level of expression or activation of a particular analyte of interest that is determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo-CEER, may be expressed as "undetectable". In other instances, a low level of expression or activation of a particular analyte of interest that is determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo-CEER, may be expressed as "low". In some instances, a moderate level of expression or activation of a particular analyte of interest that is determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo-CEER, may be expressed as "medium". In yet other instances, a moderate to high level of expression or activation of a particular analyte of interest that is determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo-CEER, may be expressed as "medium to high". In still yet other instances, a very high level of expression or activation of a particular analyte of interest that is determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo-CEER, may be expressed as "high".

[0139] In certain embodiments, the expression level and/or activation level of a particular analyte of interest, when expressed as "low", "medium", or "high", may correspond to a level of expression or activation that is at least about 0; 5,000; 10,000; 15,000; 20;000; 25,000; 30,000; 35,000; 40,000; 45,000; 50,000; 60,000; 70;000; 80,000; 90,000; 100,000 RFU; or more, e.g., when compared to a negative control such as an IgG control, when compared to a standard curve generated for the analyte of interest, when compared to a positive control such as a pan-cytokeratin (CK) control, when compared to an expression level or activation level determined in the presence of a therapeutic agent, and/or when compared to an expression level or activation level determined in the absence of a therapeutic agent. In some instances, the correlation is analyte-specific. As a non-limiting example, a "low" level of expression or activation determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo- CEER, may correspond 10,000 RFUs in expression or activation for one analyte and 50,000 RFUs for another analyte when compared to a reference expression or activation level.

[0140] In certain embodiments, the expression level and/or activation level of a particular analyte of interest may correspond to a level of expression or activation referred to as "low", "medium" or "high" that is relative to a reference expression level or activation level, e.g., when compared to a negative control such as an IgG control, when compared to a standard curve generated for the analyte of interest, when compared to a positive control such as a pan-CK control, when compared to an expression or activation level determined in the presence of a therapeutic agent, and/or when compared to an expression or activation level determined in the absence of a therapeutic agent. In some instances, the correlation is analyte-specific. As a non-limiting example, a "low" level of expression or activation determined using, e.g., a proximity assay such as CEER, Apta-CEER, or Combo-CEER, may correspond to a 2-fold increase in expression or activation for one analyte and a 5-fold increase for another analyte when compared to a reference expression or activation level. [0141] In certain embodiments, the expression level and/or activation level of a particular analyte of interest may correspond to a level of expression or activation that is compared to a negative control such as an IgG control (i.e., control protein), compared to a standard curve generated for the analyte of interest, compared to a positive control such as a pan-CK or IgG control (i.e., control protein), compared to an expression or activation level determined in the presence of a therapeutic agent (i.e., control sample), and/or compared to an expression or activation level determined in the absence of a therapeutic agent (i.e., control sample). In particular embodiments, a control sample can be derived from a cell line or a tissue sample, e.g., without cancer or a metabolic disorder such as diabetes.

F. Aptamer-Directed Delivery of Therapeutic Agents

[0142] In certain embodiments, the present invention provides methods for delivering anticancer agents specifically to malignant cells such as tumor cells using aptamers. In particular embodiments, aptamers can be selected to bind to targets with high specificity, even in acidic environments, such as inside a tumor. In some embodiments, an aptamer selected to target a cell surface receptor expressed on malignant cells or a particular tumor cell can be conjugated to an anticancer therapeutic agent. Non-limiting examples of cell surface receptors are described in paragraph [0056] above.

[0143] In some instances, the aptamer is connected to the anticancer therapeutic agent by a linker. In other instances, the anticancer therapeutic agent is encapsulated by a polymeric matrix. Examples of anticancer therapeutic agents include, but are not limited to, an anti- signaling agent (e.g., a cytostatic drug) such as a monoclonal antibody or a tyrosine kinase inhibitor, an anti-proliferative agent, a chemotherapeutic agent (e.g., a cytotoxic drug), a hormonal or cytokine therapeutic agent, a radiotherapeutic agent, a vaccine, and/or any other compound with the ability to reduce or abrogate the uncontrolled growth of aberrant cells such as cancerous cells. In particular embodiments, an aptamer is conjugated to one or more functional proteins or polypeptides including, but not limited to, an IL-2 therapeutic agent (e.g., PROLEUKI ^® (aldesleukin)), to advantageously deliver the functional proteins or polypeptides to the tumor environment. [0144] In certain embodiments, an aptamer conjugated to an antibody such as a therapeutic monoclonal antibody can target a tumor cell and activate antibody-dependent cell-mediated cytotoxicity (ADCC). Without being bound to any particular theory, this cellular mechanism can kill malignant cells such as tumor cells. As a non-limiting example, aptamer-IL-2 (e.g., PROLEUKIN® (aldesleukin)) conjugates of the present invention are delivered to an acidic tumor environment, which induces a pH-dependent conformational change in the aptamer to an active form, to treat a cancer such as renal cell carcinoma (RCC) or metastatic (e.g., skin) melanoma. An acidic tumor environment typically has a pH less than about 7.0, e.g., a pH of about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, or 6.5, or any range therein. [0145] In one exemplary embodiment, an inactive aptamer complex comprising an aptamer conjugated to a therapeutic agent (e.g., an anti-signaling agent such as a monoclonal antibody or an inhibitor, an antiproliferative agent, a chemotherapeutic agent, a hormonal therapeutic agent, a radiotherapeutic agent, a vaccine, an siRNA, and/or any other compound) can be converted to an active aptamer complex in an acidic tumor environment. As a non-limiting example, an inactive therapeutic antibody-aptamer complex can undergo a conformational change at low pH (such as in an acidic tumor environment) to an active antibody-aptamer complex (e.g., wherein the aptamer adopts a functional structure) to target cancer cells and deliver the antibody payload specifically to cancer cells (such as those found in a tumor).

G. Metabolic Disorders

[0146] Metabolic adaptation is a coordinated mechanism that orchestrates the activity of multiple metabolic signaling pathways in a variety of tissues and organs to insure that the body can respond to energy demands and nutrient availability. Metabolic adaptation is essential to maintaining energy homeostasis. Disruptions to energy homeostasis ultimately lead to metabolic disease. Examples of metabolic disease include, but are not limited to, obesity, type 1 diabetes mellitus (insulin-dependent diabetes mellitus or IDDM), type 2 diabetes mellitus (non-insulin-dependent diabetes mellitus or NIDDM), and metabolic syndrome. Type 1 diabetes is caused by an absolute deficiency of insulin, usually due to an autoimmune process affecting the beta-cells of the pancreas. Type 2 diabetes, which accounts for 90-95% of the diabetic patient population, is caused by a combination of genetic and environmental factors that result from a combination of defects in insulin secretion, impaired insulin sensitivity (insulin resistance) in peripheral tissues (e.g., skeletal muscle), and pancreatic beta cell dysfunction. In patients at high risk of developing type 2 diabetes, insulin resistance in skeletal muscle is one of the earliest detectable abnormalities. It is known to those skilled in the art that insulin resistance precedes and predicts the development of type 2 diabetes (see, Patti et al, Proc. Natl. Acad. Sci., 100:8466-8471 (2003)). Recent studies have established a link between altered PGC-la signaling to glucose intolerance, insulin resistance, and diabetes (see, Finck et al, J. Clin. Invest., 1 16: 615-622 (2006)).

[0147] The PGC-1 proteins (PGC-la, PGC-l b, and PRC) are a family of transcriptional coactivators that interact with a broad range of transcription factors involved in a variety of metabolic responses including adaptive thermogenesis, mitochondrial biogenesis, glucose oxidation, gluconeogenesis (e.g., generation of glucose from non-carbohydrate substrates), glucose uptake, lipogenesis, fatty acid synthesis and export, fiber type switching in skeletal muscle, heart development, and bone development. PGC-1 coactivators functionally interact with members of the nuclear receptor superfamily, such as PPARy, PPARa, ERR, LXR, and NHF-4a, and also non-nuclear receptor transcription factors and regulatory elements including CREB, SREBP-lc, and FOXOl . The PGC-l coactivator binds to specific transcription factors and provides a platform for the recruitment of regulatory protein complexes to activate transcription of target genes, such as metabolic and mitochondrial genes.

[0148] PGC-la is a key regulator of metabolic processes, such as mitochondrial biogenesis and oxidative metabolism in muscle and gluconeogenesis in the liver. Associations between PGC-l and diabetes have been identified in human genetic studies. Some studies have shown that a polymorphism in the coding region of the PGC1A gene (Gly482Ser) and a specific promoter haplotype are associated with increased risk of developing type 2 diabetes (see, Andrulionyte et al, Diabetologia, 47:2176-2184 (2004)). Overexpression of PGC-la beyond levels induced by exercise have been shown to contribute to the development of diet- induced insulin resistance (see, Bonen, Appl. Physiol. Nutri. Metab. 34:307-14 (2009)). PGC-la activity is greatly increased in patients with diabetic liver, as in the fasted state. In addition, elevated levels of PGC-la were observed in livers of animal models of diabetes (Yoon et al, Nature, 413: 113-1 18 (2001)). This can potentially increase hepatic glucose production, which in turn contributes to developing insulin resistance. It has also been shown that PGC-la is activated in pancreatic beta cells in rodent models of obesity and type 2 diabetes (see, Yoon et al, Exp. Clin. Endocrinol. Diabetes., 112: 253-257 (2004)). In skeletal muscle, decreased PGC-1 activity leads to decreased oxidative phosphorylation, decreased lipid oxidation and accumulation of lipid, which all contribute to insulin resistance, obesity and/or diabetes. Perturbations of PGC-la activity disrupt metabolic homeostasis and eventually result in the development of insulin resistance and type 2 diabetes. [0149] PGC-1 a coordinates numerous metabolic pathways to maintain metabolic or energy homeostasis. Inducible PGC-1 a coactivator controls the transcription of metabolic genes (e.g., genes regulating energy expenditure and mitochontrial biogenesis) in various tissues. For example, in the liver, PGC-Ια regulates gluconeogenesis and fatty acid oxidation. In brown adipose tissue PGC-1 a regulates mitochondrial biogenesis, electron transport and thermogenesis. In striated skeletal muscle, PGC-1 a regulates mitochondrial biogenesis, glucose oxidation, fatty acid oxidation, and glucose uptake. Dysregulation of these coordinated metabolic pathways or networks disrupts metabolic homeostasis and can lead to diabetes, obesity, or other metabolism-related disorders. [0150] PGC-Ια is activated in response to cellular or environmental signaling cues and undergoes post-translational modifications such as reversible acetylation, phosphorylation, or methylation. Protein modifications stabilize the protein which has a relatively short half-life (see, Puigserver et al, Mol. Cell, 8:971-982 (2001)). GCN5, an acetyl transferase, acetylates PGC-1 at several lysine residues and inhibits its transcription activity. Conversely, SIRT1, a type III NAD+-dependent deacetylase, deacetylates PGC-1 a and induces transcription of metabolic and mitochondrial genes that promote fatty acid oxidation and inhibit lipogenesis. In skeletal muscle and brown adipose tissue, SIRT1 -mediated PGC-1 a activation enhances mitochondrial activity, which improves exercise performance and thermogenic activity. In the liver, through its interactions with SIRT1, PGC-1 a regulates hepatic gluconeogenesis, a metabolic pathway that results in the generation of glucose from substrates such as glucagon. Upon deacetylation by SIRT1, PGC-1 a forms a complex with the transcription factors FOXOl and HNF4a and induces the expression of gluconeogenesis genes.

[0151] In skeletal muscle, PGC-1 a is phosphorylated by both p38 MAPK and the energy- sensing enzyme, AMP-activated protein kinase (AMPK), leading to increased stability of the coactivator. AMPK is a heterotrimeric Ser/Thr kinase that functions as an energy-monitoring system of the cellular AMP:ATP ratio. AMPK is activated by cellular stress, including fasting and exercise, and is also regulated by circulating hormones and nutrients (see, Fullerton et al, Diabetes, 59:551-553 (2010)). Activated (e.g., phosphorylated) PGC-la activates the transcription of genes that promote mitochondrial biogenesis and oxidative phophorylation. It has been reported that PGC-1 activation (e.g., phosphorylation) is reduced in skeletal muscle of patients with insulin-resistance or type 2 diabetes mellitus (see, Canto et al, Cell Metabolism, 11:213-219 (2010)).

[0152] SIRT1 and AMPK are metabolic stress sensors whose functions are inextricably linked and complementary. In brown adipose tissue and skeletal muscle, the protein pi 60 myb binding protein (pl60-myb) functions as a repressor of PGC-Ι α {see, Fan et al, Genes Dev., 18:278-289 (2004)). SIRT1 , on the one hand, can dacetylate PGC-Ια to disrupt pi 60- myb binding and repression. p38 MAPK, on the other hand, can phosphorylate PGC-Ι α to disrupt pl60-myb binding and repression. [0153] In particular aspects, the activation state-dependent reagents used in the assays of the present invention can detect any of the phosphorylated serine/threonine sites or acetylated (or deacetylated) lysine sites or methylated sites on PGC-Ι . Figure 3 illustrates the amino acid sequence of human PGC-Ια protein and denotes the sites of phosphorylation by AMPK and p38 MAPK as well as the sites of acetylation and deacetylation by GCN5 and SIRT1, respectively.

[0154] Non-limiting examples of antibodies specific for PGC-1 a include H-300 (Catalog No. sc-13067), K-15 (Catalog No. sc-5816), and P-19 (Catalog No. sc-5815) from Santa Cruz Biotechnology, Inc. Non-limiting examples of antibodies specific for PGC-lb include E-9 (Catalog No. sc-373771), H-300 (Catalog No. sc-67285), and M-142 (Catalog No. sc-67286) from Santa Cruz Biotechnology, Inc. Non-limiting examples of antibodies specific for PRC include B-8 (Catalog No. sc-376431), H-164 (Catalog No. sc-292122), and Q-15 (Catalog No. sc-135516) from Santa Cruz Biotechnology, Inc. Non-limiting examples of antibodies specific for pl60-myb include S-14 (Catalog No. sc-161 122) and F-25 (Catalog No. sc- 133800) from Santa Cruz Biotechnology, Inc. [0155] Other non-limiting examples of antibodies specific for PGC-1 family members include: anti-PGC-la antibodies such as ab54481 and abl06814 from Abeam pic; anti-PGC- l a antibodies such as AB3242 from EMD Millipore Corp.; anti-PGC-la antibodies such as 2F9 (Catalog No. H00010891-M04), 2G8 (Catalog No. H00010891-M17), 4A8 (Catalog No. H00010891 -M01), 1E1 1 (Catalog No. H00010891 -M05), 2E1 1 (Catalog No. H00010891 - Mi l), 3B5 (Catalog No. H00010891-M02), 3G1 1 (Catalog No. H00010891-M12), 2F10 (Catalog No. H00010891-M18), and 1F3 (Catalog No. H00010891 -M03) from Novus Biologicals; anti-PGC-la antibodies such as 101707 from Cayman Chemical Co.; anti-PGC- lb antibodies such as ab61249 from Abeam pic; and anti-PGC-l a + beta antibodies such as ab72230 from Abeam pic. [0156] Non-limiting examples of antibodies specific for acetylated lysine (e.g., to detect acetylated PGC-1) include the monoclonal acetylated-lysine antibodies from Cell Signaling Technology, Inc (e.g., 9814, 6952, 9681, and 9441). [0157] Non-limiting examples of antibodies specific for phosphorylated PGC-Ια include anti-phospho-PGC-l a (S571) antibodies from R&D Systems (e.g., Catalog No. AF6650) and US Biological (e.g., Catalog No. P3363-03C).

[0158] Additional disclosures with regard to the energy sensing network comprising PGC- la, SIRT1 , and AMPK are described in, e.g., Canto et al, Curr. Opin. Lipidol, 20:98-105 (2009); Feige et al, Trends Cell Biol, 17:292-301 (2007); Jeninga et al, Oncogene, 29:4617- 4624 (2010); and Canto et al, Aging, 3:543-547 (201 1), the disclosures of which are herein incorporated by reference in their entirety for all purposes.

H. Calculation of Metabolic Index

[0159] In certain aspects, the present invention provides methods for the detection and/or quantification of the activation state and/or total amount of one or a plurality of biomarkers such as transcriptional coregulators of energy homeostasis in samples (e.g., tissue biopsies, blood, plasma, urine, saliva, etc.) from patients at risk of developing a metabolic disorder such as diabetes. In particular embodiments, the present methods enable the detection and/or measurement of the expression and/or activation levels of one or a plurality of biomarkers associated with diabetes and related metabolic disorders. Non-limiting examples of such biomarkers include PGC-1 (e.g., PGC-Ια, PGC-lb, PRC) as well as other markers described herein or known to those of skill in the art.

[0160] In particular embodiments, a metabolism (or metabolic) index can be calculated based upon other indexes derived using the proximity-based assays of the present invention (e.g., phosphorylation index, deacetylation index, etc.) and/or using one or more algorithms as described herein, to aid or assist in diagnosing, monitoring or predicting the likelihood of developing a pre-metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes, obesity, etc.). As such, in certain embodiments, the term "metabolism index" or "metabolic index" includes statistically derived values based on determined activity of physiological pathways involved in energy metabolism. Examples of such physiological pathways include, but are not limited to, insulin resistance, insulin sensitivity, energy expenditure, energy storage, energy intake, energy consumption, fatty acid oxidation, thermogenesis, mitochondrial biogenesis, oxidative phosphorylation, lipolysis, adipogenesis, lipogenesis, fat storage, adipocyte differentiation, fatty acid mobilization, gluconeogenesis, mitochondrial function, energy homeostasis, and combinations thereof.

[0161] Accordingly, in some aspects, the present invention provides methods for aiding or assisting in diagnosing, prognosing, monitoring or predicting the likelihood of developing a pre -metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes, obesity), the method comprising:

(a) analyzing a sample obtained from an individual to determine the presence and/or levels of expression (e.g., total) and/or activation (e.g., phosphorylation, acetylation, deacetylation, and/or methylation) of one or more analytes (e.g., signaling proteins) that are associated with a pre-metabolic syndrome or a metabolic disorder (e.g., PGC-1 such as PGC- la) in the sample;

(b) determining (e.g., calculating or deriving) a phosphorylation index and a deacetylation index based upon the presence and/or levels of expression and/or activation of the one or more analytes determined (e.g., measured or detected) in the sample;

(c) determining (e.g., calculating or deriving) a metabolism (metabolic) index for the individual based upon the phosphorylation index and the deacetylation index (e.g., by applying one or more algorithms and/or other statistical processes described herein); and

(d) analyzing (e.g., evaluating or assessing) the metabolic index calculated for the individual (e.g., by comparing the calculated metabolic index to a predetermined cutoff or reference index value, by comparing the calculated metabolic index to one or more metabolic indexes calculated from control (healthy or diseased) samples, by comparing or ranking the calculated metabolic index against a plurality of reference metabolic indexes in a database or look-up table, or by comparing the calculated metabolic index to a metabolic index calculated for the individual at an earlier time), thereby aiding or assisting in diagnosing, monitoring or predicting the likelihood of developing a pre-metabolic syndrome or a metabolic disorder in the individual.

[0162] In certain embodiments, a ratio of the levels of expression and/or activation of the analytes (e.g., signaling proteins) detected in a sample can be generated or calculated, e.g., using a statistical analysis as described herein. In particular embodiments, a phosphorylation index and a deacetylation index can be determined based on the ratios obtained. In preferred embodiments, the phosphorylation index and deacetylation index are calculated from the ratio of total protein to activated protein. In other embodiments, statistical analysis and evaluation of an individual's phosphorylation index and deacetylation index compared to those indexes from controls can be used to determine the individual's metabolic index. In preferred embodiments, the metabolic index can be used to diagnose a metabolic disorder such as diabetes, to predict an individual's risk of developing a metabolic disorder such as diabetes, or to monitor the progression or regression thereof. [0163] In response to metabolic cues such as environmental stimuli and nutritional states, the transcriptional activator PGC-1 (e.g., PGC-1 a) is phosphorylated by kinases such as p38 MAPK or AMPK and/or deacetylated by deacetylases such as SIRT1. Phosphorylated or deacetylated PGC-1 serves as a dock or platform for the recruitment of regulatory protein complexes which activate gene transcription of numerous distinct biological and metabolic pathways in different tissues. In some embodiments, the total level of PGC-1 protein (e.g., both activated and inactivated PGC-1 protein), the total level of a complex between PGC-1 protein and pl60-myb protein, and/or the level of phosphorylated PGC-1 protein is detected and/or quantitated in a sample to calculate a phosphorylation index, which can be correlated to the activation of metabolic pathways.

[0164] As a non-limiting example, the phosphorylation index can be calculated as a ratio of the total level of PGC-1 protein or PGC-l/pl60-myb protein complex to the level of phosphorylated PGC-1 protein. In other embodiments, the total level of PGC-1 protein (e.g., both activated and inactivated PGC-1 protein), the total level of PGC-1 protein that is acetylated, and/or the level of deacetylated PGC-1 protein is detected and/or quantitated in a sample to calculate a deacetylation index, which can also be correlated to the activation of metabolic pathways. As another non-limiting example, the deacetylation index is calculated as a ratio of the total level of PGC-1 protein or acetylated PGC-1 protein to the level of deacetylated PGC-1 protein. In certain instances, the presence of the PGC-l/pl60-myb protein complex and/or acetylated PGC-1 protein corresponds to inactive or inactivated PGC- 1 protein. In particular embodiments, a metabolism (or metabolic) index is calculated based upon the phosphorylation index and deacetylation index, e.g., using one or more algorithms as described herein, to aid or assist in diagnosing, prognosing, monitoring, and/or predicting the likelihood of developing a pre-metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes).

[0165] Figures 4 and 5 illustrate exemplary embodiments of the invention, wherein CEER and Apta-CEER (with capture and detection antibodies for CEER and capture and detection aptamers for Apta-CEER) are used to detect the presence or levels of total, phosphorylated, acetylated, and/or deacetylated PGC-1 (e.g., PGC- la) protein to calculate phosphorylation and deacetylation indexes. A metabolism (or metabolic) index can then be calculated based upon the phosphorylation index and deacetylation index as described herein.

[0166] In certain embodiments, any combination of antibodies and aptamers can be used to measure the presence or level of inactivated PGC-1 (e.g., PGC-l/pl60-myb protein complex or acetylated PGC-1) and/or activated PGC-1 (e.g., phosphorylated or deacetylated PGC-1) as illustrated in Figures 4 and 5. In some instances, one capture antibody and two detection aptamers are used. In certain other instances, a capture antibody, a detection antibody, and a detection aptamer are used. In yet other instances, a capture aptamer, a detection antibody, and a detection aptamer are used. In further instances, a capture aptamer and two detection aptamers are used.

IV. Statistical Analysis

[0167] In certain embodiments, the present invention provides methods for diagnosing or classifying the diagnosis of a disease state (e.g., cancer, pre-metabolic syndrome, metabolic disorder), for prognosing or classifying the prognosis of the disease state, for monitoring the disease state, for predicting the likelihood or probability of developing the disease state, for predicting the likelihood or probability of response to therapy (e.g., biologic therapy), etc. In particular embodiments, one or more algorithms such as one or more (e.g., a combination of) learning statistical classifier systems are applied to the presence or levels of expression and/or activation of the one or more analytes in its inactivated and/or inactivated state determined by any of the assays described herein to aid or assist in the diagnosis, prognosis, monitoring, or prediction of a disease state or response to therapy. In other embodiments, quantile analysis is applied to the presence or levels of expression and/or activation of the one or more analytes in its inactivated and/or inactivated state determined by any of the assays described herein to aid or assist in the diagnosis, prognosis, monitoring, or prediction of a disease state or response to therapy. As described herein, the statistical analyses of the present invention advantageously provide improved sensitivity, specificity, negative predictive value, positive predictive value, and/or overall accuracy for aiding or assisting in the diagnosis, prognosis, monitoring, or prediction of a disease state or response to therapy.

[0168] The term "statistical analysis" or "statistical algorithm" or "statistical process" includes any of a variety of statistical methods and models used to determine relationships between variables. In the present invention, the variables are the presence, level, or genotype of at least one analyte of interest. Any number of analytes can be analyzed using a statistical analysis described herein. For example, the presence or level of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, or more analytes can be included in a statistical analysis. In one embodiment, logistic regression is used. In another embodiment, linear regression is used. In certain preferred embodiments, the statistical analyses of the present invention comprise a quantile measurement of one or more analytes, e.g., within a given population, as a variable. Quantiles are a set of "cut points" that divide a sample of data into groups containing (as far as possible) equal numbers of observations. For example, quartiles are values that divide a sample of data into four groups containing (as far as possible) equal numbers of observations. The lower quartile is the data value a quarter way up through the ordered data set; the upper quartile is the data value a quarter way down through the ordered data set. Quintiles are values that divide a sample of data into five groups containing (as far as possible) equal numbers of observations. The present invention can also include the use of percentile ranges of analyte levels (e.g., tertiles, quartile, quintiles, etc.), or their cumulative indices (e.g., quartile sums of analyte levels to obtain quartile sum scores (QSS), etc.) as variables in the statistical analyses (just as with continuous variables).

[0169] In preferred embodiments, the present invention involves detecting or determining the presence and/or level (e.g., magnitude) of one or more analytes of interest using quartile analysis. In this type of statistical analysis, the level of an analyte of interest is defined as being in the first quartile (<25%), second quartile (25-50%), third quartile (51%-<75%), or fourth quartile (75-100%) in relation to a reference database of samples. These quartiles may be assigned a quartile score of 1, 2, 3, and 4, respectively. In certain instances, an analyte that is not detected in a sample is assigned a quartile score of 0 or 1, while an analyte that is detected (e.g., present) in a sample (e.g., sample is positive for the analyte) is assigned a quartile score of 4. In some embodiments, quartile 1 represents samples with the lowest analyte levels, while quartile 4 represent samples with the highest analyte levels. In some embodiments, the reference database of samples can include a large spectrum of patients with cancer and/or a metabolic disorder such as diabetes. From such a database, quartile cut-offs can be established.

[0170] In some embodiments, the statistical analyses of the present invention comprise one or more learning statistical classifier systems. As used herein, the term "learning statistical classifier system" includes a machine learning algorithmic technique capable of adapting to complex data sets (e.g., panel of analytes of interest) and making decisions based upon such data sets. In some embodiments, a single learning statistical classifier system such as a decision/classification tree (e.g., random forest (RF) or classification and regression tree (C&RT)) is used. In other embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more learning statistical classifier systems are used, preferably in tandem. Examples of learning statistical classifier systems include, but are not limited to, those using inductive learning (e.g., decision/classification trees such as random forests, classification and regression trees (C&RT), boosted trees, etc.), Probably Approximately Correct (PAC) learning, connectionist learning (e.g., neural networks (NN), artificial neural networks (ANN), neuro fuzzy networks (NFN), network structures, perceptrons such as multi-layer perceptrons, multi-layer feed- forward networks, applications of neural networks, Bayesian learning in belief networks, etc.), reinforcement learning (e.g., passive learning in a known environment such as naive learning, adaptive dynamic learning, and temporal difference learning, passive learning in an unknown environment, active learning in an unknown environment, learning action-value functions, applications of reinforcement learning, etc.), and genetic algorithms and evolutionary programming. Other learning statistical classifier systems include support vector machines (e.g., Kernel methods), multivariate adaptive regression splines (MARS), Levenberg-Marquardt algorithms, Gauss-Newton algorithms, mixtures of Gaussians, gradient descent algorithms, and learning vector quantization (LVQ). [0171] Random forests are learning statistical classifier systems that are constructed using an algorithm developed by Leo Breiman and Adele Cutler. Random forests use a large number of individual decision trees and decide the class by choosing the mode (i.e., most frequently occurring) of the classes as determined by the individual trees. Random forest analysis can be performed, e.g., using the RandomForests software available from Salford Systems (San Diego, CA). See, e.g., Breiman, Machine Learning, 45:5-32 (2001); and http://stat-www.berkeley.edu/users breiman/RandomForests/cc_home.htm, for a description of random forests.

[0172] Classification and regression trees represent a computer intensive alternative to fitting classical regression models and are typically used to determine the best possible model for a categorical or continuous response of interest based upon one or more predictors.

Classification and regression tree analysis can be performed, e.g., using the C&RT software available from Salford Systems or the Statistica data analysis software available from StatSoft, Inc. (Tulsa, OK). A description of classification and regression trees is found, e.g., in Breiman et al. "Classification and Regression Trees," Chapman and Hall, New York ( 1984); and Steinberg et al. , "CART: Tree-Structured Non-Parametric Data Analysis," Salford Systems, San Diego, (1995).

[0173] Neural networks are interconnected groups of artificial neurons that use a mathematical or computational model for information processing based on a connectionist approach to computation. Typically, neural networks are adaptive systems that change their structure based on external or internal information that flows through the network. Specific examples of neural networks include feed-forward neural networks such as perceptrons, single-layer perceptrons, multi-layer perceptrons, backpropagation networks, AD ALINE networks, MADALINE networks, Learnmatrix networks, radial basis function (RBF) networks, and self-organizing maps or Kohonen self-organizing networks; recurrent neural networks such as simple recurrent networks and Hopfield networks; stochastic neural networks such as Boltzmann machines; modular neural networks such as committee of machines and associative neural networks; and other types of networks such as

instantaneously trained neural networks, spiking neural networks, dynamic neural networks, and cascading neural networks. Neural network analysis can be performed, e.g., using the Statistica data analysis software available from StatSoft, Inc. See, e.g., Freeman et al, In "Neural Networks: Algorithms, Applications and Programming Techniques," Addison- Wesley Publishing Company (1991); Zadeh, Information and Control, 8:338-353 (1965); Zadeh, "IEEE Trans, on Systems, Man and Cybernetics," 3:28-44 (1973); Gersho et al, In "Vector Quantization and Signal Compression," Kluywer Academic Publishers, Boston, Dordrecht, London (1992); and Hassoun, "Fundamentals of Artificial Neural Networks," MIT Press, Cambridge, Massachusetts, London (1995), for a description of neural networks.

[0174] Support vector machines are a set of related supervised learning techniques used for classification and regression and are described, e.g., in Cristianini et al, "An Introduction to Support Vector Machines and Other Kernel-Based Learning Methods," Cambridge

University Press (2000). Support vector machine analysis can be performed, e.g., using the SVM ^,gfo software developed by Thorsten Joachims (Cornell University) or using the LIBSVM software developed by Chih-Chung Chang and Chih-Jen Lin (National Taiwan University). [0175] The various statistical methods and models described herein can be trained and tested using a cohort of samples {e.g., serological samples and/or tissue samples) from healthy individuals and patients with the disease state. For example, samples from patients diagnosed by a physician as having cancer or a metabolic disorder such as diabetes are suitable for use in training and testing the statistical methods and models of the present invention. Samples from healthy individuals can include those that were not identified as diseased samples. One skilled in the art will know of additional techniques and diagnostic criteria for obtaining a cohort of patient samples that can be used in training and testing the statistical methods and models of the present invention.

[0176] As used herein, the term "sensitivity" refers to the probability that a diagnostic, prognostic, or predictive method of the present invention gives a positive result when the sample is positive, e.g., having the predicted diagnosis, prognostic outcome, or response to therapy. Sensitivity is calculated as the number of true positive results divided by the sum of the true positives and false negatives. Sensitivity essentially is a measure of how well the present invention correctly identifies those who have the predicted diagnosis, prognostic outcome, or response to therapy from those who do not have the predicted diagnosis, prognosis, or therapeutic response. The statistical methods and models can be selected such that the sensitivity is at least about 60%, and can be, e.g., at least about 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0177] The term "specificity" refers to the probability that a diagnostic, prognostic, or predictive method of the present invention gives a negative result when the sample is not positive, e.g., not having the predicted diagnosis, prognostic outcome, or response to therapy. Specificity is calculated as the number of true negative results divided by the sum of the true negatives and false positives. Specificity essentially is a measure of how well the present invention excludes those who do not have the predicted diagnosis, prognostic outcome, or response to therapy from those who do have the predicted diagnosis, prognosis, or therapeutic response. The statistical methods and models can be selected such that the specificity is at least about 60%, and can be, e.g., at least about 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0178] As used herein, the term "negative predictive value" or "NPV" refers to the probability that an individual identified as not having the predicted diagnosis, prognostic outcome, or response to therapy actually does not have the predicted diagnosis, prognosis, or therapeutic response. Negative predictive value can be calculated as the number of true negatives divided by the sum of the true negatives and false negatives. Negative predictive value is determined by the characteristics of the diagnostic or prognostic method as well as the prevalence of the disease in the population analyzed. The statistical methods and models can be selected such that the negative predictive value in a population having a disease prevalence is in the range of about 70% to about 99% and can be, for example, at least about 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0179] The term "positive predictive value" or "PPV" refers to the probability that an individual identified as having the predicted diagnosis, prognostic outcome, or response to therapy actually has the predicted diagnosis, prognosis, or therapeutic response. Positive predictive value can be calculated as the number of true positives divided by the sum of the true positives and false positives. Positive predictive value is determined by the

characteristics of the diagnostic or prognostic method as well as the prevalence of the disease in the population analyzed. The statistical methods and models can be selected such that the positive predictive value in a population having a disease prevalence is in the range of about 70% to about 99% and can be, for example, at least about 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. [0180] Predictive values, including negative and positive predictive values, are influenced by the prevalence of the disease in the population analyzed. In the present invention, the statistical methods and models can be selected to produce a desired clinical parameter for a clinical population with a defined prevalence of the disease state. For example, statistical methods and models can be selected for a disease prevalence of up to about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, which can be seen, e.g., in a clinician's office such as an endocrinologist's office, an oncologist's office, or a general practitioner's office.

[0181] As used herein, the term "overall agreement" or "overall accuracy" refers to the accuracy with which a method of the present invention diagnoses a disease state, prognoses a disease state, or predicts response to a particular therapy. Overall accuracy is calculated as the sum of the true positives and true negatives divided by the total number of sample results and is affected by the prevalence of the disease in the population analyzed. For example, the statistical methods and models can be selected such that the overall accuracy in a patient population having a disease prevalence is at least about 40%, and can be, e.g., at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

V. Construction of Antibody and/or Aptamer Arrays

[0182] In certain aspects, the expression level and/or activation state of one or more (e.g., a plurality) of analytes (e.g., signaling proteins) in a cellular extract of cancer cells (e.g., tumor cells) or diabetes cells (e.g., liver, pancreas, skeletal muscle or adipose cells) is detected using an antibody- and/or aptamer-based array comprising capture reagents (e.g., capture antibodies and/or aptamers) restrained on a solid support. In some embodiments, the arrays comprise a plurality of different capture reagents (e.g., capture antibodies and/or aptamers) at a range of capture reagent concentrations that are coupled to the surface of the solid support in different addressable locations. [0183] In one particular embodiment, the present invention provides an addressable array having superior dynamic range comprising a (plurality of) dilution series of capture reagents (e.g., antibodies and/or aptamers) restrained on a solid support, in which the capture reagents in each dilution series are specific for one or more analytes corresponding to a component of a signal transduction pathway and other target proteins. In various aspects, this embodiment includes arrays that comprise components of signal transduction pathways characteristic of particular cancers and/or metabolic disorders such as diabetes. Thus, the present invention may be advantageously practiced wherein each signal transduction molecule or other protein of interest with a potential expression or activation defect causing the disease is represented on a single array or chip. In some aspects, the components of a given signal transduction pathway active in a particular cell are arrayed in a linear sequence that corresponds to the sequence in which information is relayed through a signal transduction pathway within a cell. Non-limiting examples of such arrays in the context of cancer are described herein and are also shown in Figures 5-9 of PCT Publication No. WO 2009/108637, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The capture reagents (e.g., antibodies and/or aptamers) that are specific for one or more components of a particular signal transduction pathway active in a particular cell can also be printed in a randomized fashion to minimize any surface-related artifacts.

[0184] The solid support can comprise any suitable substrate for immobilizing proteins. Examples of solid supports include, but are not limited to, glass (e.g., a glass slide), plastic, chips, pins, filters, beads, paper, membranes, fiber bundles, gels, metal, ceramics, and the like. Membranes such nylon (Biotrans™, ICN Biomedicals, Inc. (Costa Mesa, CA); Zeta- Probe^®, Bio-Rad Laboratories (Hercules, CA)), nitrocellulose (Protran^®, Whatman Inc. (Florham Park, NJ)), and PVDF (Immobilon™, Millipore Corp. (Billerica, MA)) are suitable for use as solid supports in the arrays of the present invention. Preferably, the capture reagents (e.g., antibodies and/or aptamers) are restrained on glass slides coated with a nitrocellulose polymer, e.g., FAST^® Slides, which are commercially available from Whatman Inc. (Florham Park, NJ).

[0185] Particular aspects of the solid support which are desirable include the ability to bind large amounts of capture reagents (e.g., antibodies and/or aptamers) and the ability to bind capture reagents with minimal denaturation. Another suitable aspect is that the solid support displays minimal "wicking" when capture reagent solutions containing capture antibodies and/or aptamers are applied to the support. A solid support with minimal wicking allows small aliquots of capture reagent solution applied to the support to result in small, defined spots of immobilized capture antibody and/or aptamer.

[0186] The capture reagents (e.g., antibodies and/or aptamers) are typically directly or indirectly (e.g., via capture tags) restrained on the solid support via covalent or noncovalent interactions (e.g., ionic bonds, hydrophobic interactions, hydrogen bonds, Van der Waals forces, dipole-dipole bonds). In some embodiments, the capture reagents (e.g., antibodies and/or aptamers) are covalently attached to the solid support using a homobifunctional or heterobifunctional crosslinker using standard crosslinking methods and conditions. Suitable crosslinkers are commercially available from vendors such as, e.g., Pierce Biotechnology (Rockford, IL).

[0187] Methods for generating arrays suitable for use in the present invention include, but are not limited to, any technique used to construct protein or nucleic acid arrays. In some embodiments, the capture reagents (e.g., antibodies and/or aptamers) are spotted onto an array using a microspotter, which are typically robotic printers equipped with split pins, blunt pins, or ink jet printing. Suitable robotic systems for printing the antibody/aptamer arrays described herein include the PixSys 5000 robot (Cartesian Technologies; Irvine, CA) with ChipMaker2 split pins (TeleChem International; Sunnyvale, CA) as well as other robotic printers available from BioRobics (Woburn, MA) and Packard Instrument Co. (Meriden, CT). Preferably, at least 2, 3, 4, 5, or 6 replicates of each capture antibody/aptamers dilution are spotted onto the array.

[0188] Another method for generating arrays suitable for use in the present invention comprises dispensing a known volume of a capture reagent dilution at each selected array position by contacting a capillary dispenser onto a solid support under conditions effective to draw a defined volume of liquid onto the support, wherein this process is repeated using selected capture reagent dilutions at each selected array position to create a complete array. The method may be practiced in forming a plurality of such arrays, where the solution- depositing step is applied to a selected position on each of a plurality of solid supports at each repeat cycle. A further description of such a method can be found, e.g., in U.S. Patent No. 5,807,522. [0189] In certain instances, devices for printing on paper can be used to generate the capture reagent (e.g., antibody and/or aptamer) arrays. For example, the desired capture reagent dilution can be loaded into the printhead of a desktop jet printer and printed onto a suitable solid support (see, e.g., Silzel et al, Clin. Chem., 44:2036-2043 (1998)). [0190] In some embodiments, the array generated on the solid support has a density of at least about 5 spots/cm², and preferably at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000 or 9000, or 10,000 spots/cm².

[0191] In certain instances, the spots on the solid support each represents a different capture antibody/aptamer. In certain other instances, multiple spots on the solid support represent the same capture antibody/aptamer, e.g., as a dilution series comprising a series of descending capture antibody/aptamer concentrations. [0192] Additional examples of methods for preparing and constructing antibody and/or aptamer arrays on solid supports are described in U.S. Patent Nos. 6, 197,599, 6,777,239, 6,780,582, 6,897,073, 7,179,638, and 7, 192,720; U.S. Patent Publication Nos. 200601 15810, 20060263837, 20060292680, and 20070054326; and Varnum et al, Methods Mol. Biol, 264: 161-172 (2004). [0193] Methods for scanning antibody or aptamer arrays are known in the art and include, without limitation, any technique used to scan protein or nucleic acid arrays. Microarray scanners suitable for use in the present invention are available from PerkinElmer (Boston, MA), Agilent Technologies (Palo Alto, CA), Applied Precision (Issaquah, WA), GSI Lumonics Inc. (Billerica, MA), and Axon Instruments (Union City, CA). As a non-limiting example, a GSI ScanArray3000 for fluorescence detection can be used with ImaGene software for quantitation.

VI. Aptamers

A. Overview of Aptamers

[0194] In certain aspects, aptamers are non-naturally occurring oligonucleotides that specifically bind to a particular target, and can form three-dimensional structures as dictated by their sequences. In certain other aspects, aptamers are peptides comprising short variable peptide domains, attached at both ends to a protein scaffold. Aptamers bind to proteins {e.g., signaling proteins, signal transduction pathway components, cell surface receptors, enzymes, growth factors, transcriptional coregulators, cell adhesion molecules, viral particles, etc.) and non-protein targets {e.g., carbohydrates, polysaccharides, substrates, metal ions, metabolites, transition state analogs, inhibitors, drugs, dyes, nutrients, etc.) with high affinity and specificity, analogous to antibodies. Aptamers have also been demonstrated to bind specifically to cells, tissues and organisms. [0195] Aptamers are particularly advantageous because they offer remarkable flexibility in their design. Aptamers with high specificity and affinity can be selected in vitro for any given target. Once selected, aptamers can be synthesized with high reproducibility and purity from commercial sources. Compared to antibodies, aptamers are much more stable to heat, pH, and organic solvents (see, e.g., Lee et al., Adv. Drug Delivery Rev., 62: 592-605 (2010)). Aptamers tend to have higher surface density and less steric hindrance as well. Aptamers are small in size (~ 1 -2 nm, <10kDa) and thus can bind in clefts and grooves of small proteins. Aptamers can be denatured and renatured multiple times without significant loss of binding activity (see, e.g., Liss et al., Anal. Chem., 74:4488 (2002)). They can also be chemically modified and/or linked to a variety of chemical-, molecular- and protein-based conjugates. Examples of conjugates include, but are not limited to, drugs, cytotoxins, nanomaterials (e.g., gold nanoparticles, quantum dots, carbon nanotubes, and superparamagnetic iron oxide nanoparticles), fluorophores, antibodies, beads, and combinations thereof.

[0196] The conjugation of nanomaterials and aptamers for use in biosensing and diagnostic assays can be developed to take advantage of a variety of detection techniques, including, but not limited to, fluorescence, colorimetry, surface enhanced Raman scattering (SERS), magnetic resonance imaging (MRI) and electrochemistry. Aptamer conjugates can also be used as drug delivery vehicles. For instance, cisplatin can be targeted to cancer cells by using cancer cell-targeting aptamers conjugated to liposomes encapsulating cisplatin. [0197] Aptamers can be selected and optimized based on custom-tailored properties for specific applications. Due to their unique structures, aptamers can bind regions of the target molecules that are typically inaccessible to antibodies. They possess structural stability across a wide range of temperature and storage conditions. Unlike antibodies, aptamers elicit little to no immunogenicity in therapeutic applications. Since aptamers can produced by chemical synthesis, they are more economical and less labor-intensive to make compared to antibodies.

B. Aptamer Conjugates

[0198] The aptamers of the invention can be associated with compounds to improve the stability or serum half-life of the aptamer (i.e., pharmacokinetic improving components), agents that reduce immunogenicity of the aptamer, labeling agents, therapeutic agents, and/ or nanocarriers. The association can be a direct covalent bond, an indirect attachment (e.g., using a linker), or a non-covalent bond (e.g., where the aptamer is part of a more complex composition). [0199] In some embodiments, the aptamer is attached to a detectable moiety directly or via a linker. Non-limiting examples of detectable moieties include radiolabels, enzymatic labels, fluorescent probes, crosslinking reagents, and combinations thereof (see, Lee et al, Curr. Opin. Chem. Biol., 10:282-289 (2006)). Methods of attaching a protein (e.g., an epitope, enzyme substrate, etc.) to an aptamer are described in U.S. Patent No. 6,083,696. Methods of incorporating a fluorescent nucleotide into an aptamer are described, e.g., in U.S. .Patent No. 6,458,539. Additional labeled aptamers are described, e.g., in U.S. Patent No. 7, 176,295. Radiolabeled nucleotides are known in the art and can be incorporated into an aptamer.

[0200] Typically, the aptamer is attached to an additional moiety in an area that does not interfere with binding to the target. Thus, in some cases, the additional moiety is attached to the 5' or 3' end of the aptamer. One of skill in the art will recognize that the optimal position for attachment may be located elsewhere on the aptamer, so the position of the additional moiety can be adjusted accordingly. In some embodiments, the ability of the aptamer to associate with the target is compared before and after attachment to the additional moiety to ensure that the attachment does not unduly disrupt target binding.

[0201] In some embodiments, the aptamer can be associated with an additional targeting moiety. For example, an antibody fragment, peptide, or additional aptamer that binds a different site on the target molecule can be conjugated to the aptamer to optimize target binding. C. Minimal Target Binding Sequence

[0202] As described above, small aptamers have a number of desired characteristics. Thus, it is advantageous to determine the minimum sequence required for binding to the target. This determination can be accomplished by a number of means, for example, using an array with serial truncations on the 5' and 3' end of a selected aptamer sequence. Such methods are described, e.g., by Fischer et al, PLoS ONE 3:1-9, (2008).

D. Secondary Structure

[0203] The secondary or three-dimensional structure of an aptamer or part of an aptamer can be determined using known computer modeling and prediction methods. Secondary structure prediction can be a useful guide to correct sequence alignment, e.g., to determine which positions are functionally or structurally determinative in similar sequences.

[0204] In some cases, empirical methods for determining the three dimensional structure (e.g., NMR or crystallography) can be used in conjunction with or instead of computer modeling methods. Such methods are known in the art, and are described, e.g., in Jones et a I., Spectroscopic Methods and Analyses: NMR, Mass Spectrometry, and Metalloprotein Techniques (1993); and Helliwell, Macromolecular Crystallography with Synchrotron Radiation (1992). [0205] The stability of given secondary structures can be determined using known tables of energy parameters. Although early secondary structure prediction programs attempted to simply maximize the number of base pairs formed by a sequence, most current programs seek to find structures with minimal free energy as calculated by these thermodynamic parameters. The actual secondary structure does not necessarily lie at a global energy minimum, depending on the kinetics of folding and synthesis of the sequence. Nonetheless, for short sequences, these caveats are of minor importance because there are relatively few possible structures that can form.

[0206] A brute force predictive method is a dot-plot: an N by N plot of the sequence against itself is prepared, and an X is placed in every position where a base pair is possible. Diagonal runs of X's mark the location of possible helices. Exhaustive tree-searching methods can then search for all possible arrangements of compatible (i.e., non-overlapping) helices of length L or more; energy calculations can be done for these structures to rank them as more or less likely. The advantages of this method are that all possible topologies, including pseudoknotted conformations, can be examined, and that a number of suboptimal structures are automatically generated as well.

[0207] A commonly used and elegant predictive method is the M-fold program (Zuker, Science, 244:48-52, (1989)). The M-fold program makes a major simplifying assumption that no pseudoknotted conformations will be allowed. This permits the use of a dynamic programming approach that runs in time proportional to only N3 to N4, where N is the length of the sequence, and is capable of rigorously dealing with sequences of less than a few hundred nucleotides. The secondary structures of an aptamer can be predicted according to the Zuker algorithm using M-fold (e.g., Version 3.2, using standard conditions such as 0.15M NaCl at 25°C).

[0208] Sequence covariation is commonly considered in comparative sequence analysis. A covariation is when the identity of one position depends on the identity of another position; for instance, a required Watson-Crick base pair shows strong covariation in that knowledge of one of the two positions gives absolute knowledge of the identity at the other position. Covariation analysis has been used previously to predict the secondary structure of RNAs for which a number of related sequences sharing a common structure exist, such as tRNA, rRNAs, and group I introns. Covariation analysis can be used to detect tertiary contacts as well.

[0209] An algorithm that precisely measures the amount of covariations between two positions in an aligned sequence set is described in Stormo and Gutell, Nucleic Acids Res., 29:5785-5795 (1992). The program is called "MIXY" (Mutual Information at position X and Y). If there is no covariation, M(x,y) is zero; larger values of M(x,y) indicate strong covariation. Covariation values can then be used to develop three-dimensional structural predictions. [0210] Covariation analysis can be used in combination with NMR to generate distance restraints between atoms or positions, which are readily transformed into structures through distance geometry or restrained molecular dynamics. Unlike crystallography, which in the end yields an actual electron density map, NMR yields a set of interatomic distances.

Depending on the number of interatomic distances one can get, there can be one, few, or many 3D structures with which they are consistent. Mathematical techniques have been developed to transform a matrix of interatomic distances into a structure in 3D space. The two main techniques in use are distance geometry and restrained molecular dynamics.

[0211] Three dimensional structure can also be determined using chemical and enzymatic protection experiments, which generate solvent accessibility restraints for individual atoms or positions. For example, for determining nucleic acid aptamer structure, ribonuclease or SI nuclease protection assays can be used. Kits for such assays are well known in the art and are commercially available, e.g., from Ambion®.

[0212] Other commonly used software programs for predicting oligonucleotide secondary structures include the Vienna RNA Package, Sfold, and UNAFold. The Vienna package algorithm computes equilibrium partition functions and base pair probabilities and provides all possible foldings that are close to optimal for a give sequence (Hofacker, Nucleic Acids Res., 31 : 3429-3431 , (2003)). Likewise, the Sfold package computes partition functions but does not compute base pair probabilities exactly. Rather, it uses statistical sampling from a Boltzmann distribution to give a statistically representative sampling of structures (Ding and Lawrence, Nucleic Acids Research, 32:W135-W141 (2004)). UNAFold ("Unified Nucleic Acid Folding") is a more contemporary program which combines the methods of mFold, Vienna Package, and Sfold into one package (Markham and Zuker, Methods in Molecular Biology, 453: 3-31, (2008)). It computes minimum free energies, partition functions, and also performs statistical sampling. In addition, thermodynamic parameters and melting temperature profiles can also be computed in U AFold.

E. Affinity Determination

[0213] The specificity of the binding of an aptamer for its target can be defined in terms of the comparative dissociation constants (Kd) of the aptamer for its target, as compared to the dissociation constant with respect to the aptamer and other materials in the environment or unrelated molecules in general. Typically, the Kd for the aptamer with respect to the other unrelated material will be at least 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100- fold, 200-fold or higher than the Kd about respect to the target. [0214] The desired affinity for an aptamer, e.g., high (pM to low nM), medium (low nM to 1 OOnM), or low (about 1 OOnM or higher), may differ depending upon whether it is being used as a diagnostic or therapeutic. Without being limited to theory, in one example, an aptamer with medium affinity may be more successful in localizing to a tumor as compared to an aptamer with a high affinity. Thus, aptamers having different affinities (e.g., having different primary sequence, or modified differently) can be used for diagnostic and/or therapeutic applications. In addition, aptamers having lower affinities for a given target can be used as controls.

[0215] A targeting moiety will typically bind with a Kd of less than about 1000 nM, e.g., less than about 750, 500, 250, 100, 50, 20 or lower nM. In some embodiments, the Kd of the affinity agent is less than about 15, 10, 5, or 1 nM. As explained herein, the target can be a signaling protein such as a receptor, an enzyme, a hormone, a lectin, or any natural, synthetic or recombinant polypeptide, polynucleotide, polysaccharide or a small molecule compound.

[0216] The value of the dissociation constant (Kd) can be determined by well-known methods, and can be computed even for complex mixtures by methods as disclosed, e.g., in Caceci et ah, Byte, 9:340-362 (1984). For some small oligonucleotides, direct determination of Kd can be difficult, and can lead to misleadingly high results. Under these circumstances, a competitive binding assay for the target molecule or other candidate substance can be conducted with respect to substances known to bind the target or candidate. The value of the concentration at which 50% inhibition occurs (Ki) is, under ideal conditions, equivalent to Kd. Ki cannot be less than Kd, thus, determination of Ki can be used to set a maximal value for the value of Kd. A Ki value can also be used to confirm that an aptamer binds a given target. [0217] Affinity of an aptamer, or any targeting agent, for a target can be determined according to methods known in the art, e.g., as reviewed in Ernst et al. Determination of Equilibrium Dissociation Constants, Therapeutic Monoclonal Antibodies (Wiley & Sons ed. 2009). [0218] Quantitative ELISA, and similar array-based affinity methods can be used. ELISA (Enzyme linked immunosorbent assay) is an antibody-based method, but can be adjusted to be aptamer-based. In some cases, an aptamer (or antibody) specific for a target of interest is affixed to a substrate, and contacted with a sample suspected of containing the target. The surface is then washed to remove unbound substances. Target binding can be detected in a variety of ways, e.g. , using a second step with a labeled antibody, direct labeling of the target, or labeling of the aptamer/primary antibody with a label that is detectable upon antigen binding. In some cases, the antigen is affixed to the substrate (e.g., using a substrate with high affinity for proteins, or a strepavidin-biotin interaction) and detected using a labeled aptamer or antibody. Several permutations of the original ELISA methods have been developed and are known in the art (see, Lequin (2005) Clin. Chem. 51 :2415-18 for a review).

[0219] The Kd, Kon, and Koff can also be determined using surface plasmon resonance (SPR), e.g., as measured by using a Biacore T100 system. SPR techniques are reviewed, e.g., in Hahnfeld et al. Determination of Kinetic Data Using SPR Biosensors, Molecular Diagnosis of Infectious Diseases (2004). In a typical SPR experiment, one interactant (e.g., target or targeting agent) is immobilized on an SPR-active, gold-coated glass slide in a flow cell, and a sample containing the other interactant is introduced to flow across the surface. When light of a given frequency is shined on the surface, the changes to the optical reflectivity of the gold indicate binding, and the kinetics of binding. [0220] Binding affinity can also be determined by anchoring a biotinylated interactant to a streptavidin (SA) sensor chip. The other interactant is then contacted with the chip and detected, e.g., as described in Abdessamad et al, Nuc. Acids Res., 30:e45 (2002).

F. Nucleic Acid Aptamers

[0221] Nucleic acid aptamers are short, structured RNA or DNA molecules that bind with high affinity to their target molecules, which range from small chemicals to large cell-surface transmembrane proteins or even cells. In certain aspects, a nucleic acid aptamer can be single-stranded or double-stranded. In other aspects, the nucleic acids of an aptamer can be naturally-occurring nucleic acids, non-naturally occurring nucleic acid (e.g., locked nucleic acids (LNAs) and peptide nucleic acids (PNAs)), and combinations thereof.

[0222] Nucleic acid aptamers are typically generated by an iterative screening process of complex nucleic acid libraries (e.g., routinely containing >10¹⁴ shapes per library), termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX). The SELEX process consists of iterative rounds of affinity purification and amplification over successive rounds. Briefly, a nucleic acid mixture or library comprising, e.g., a 40 nucleotide randomized chain can have 4⁴⁰ candidate possibilities. Those with higher affinity constants for the target protein are most likely to bind to the target. After partitioning, dissociation and

amplification, a second nucleic acid mixture or library is generated and enriched for the higher binding affinity candidates. After additional rounds of selection, progressively favoring the aptamer with the highest affinity for the target, the resulting nucleic acid mixture or library is predominantly composed of one or a plurality of sequences. These sequences can then be cloned, sequenced and tested for binding affinity and specificity to the target protein.

[0223] SELEX has traditionally been performed using purified proteins that can fold into their proper conformation as targets. Cell-based selection techniques have allowed selection of aptamers against cell surface proteins in their native conformation on the cell surface.

[0224] The complex nucleic acid library can comprise naturally-occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids, or nucleic acids made by a combination of the aforementioned methods. Nucleic acids include, but are not limited to DNA, RNA, single-stranded or double-stranded, locked nucleic acid (LNA), peptide nucleic acid (PNA), and any chemical modification thereof.

Modifications of nucleic acids include, but are not limited to, additional charge,

polarizability, hydrogen bonding, electrostatic interaction, 2'-position sugar modifications, 5- position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as isobases isocytidine and isoguandine, 3' modifications and 5' modifications, and combinations thereof.

[0225] Aptamers are generally small in size, e.g., less than about 100, 80, 60, 50, 40, 30, or 20 nucleotides in length, which contributes to unhindered target binding, as well as high tissue penetration. Small size also provides for ease and cost-efficiency of synthesis. In general, aptamers comprise about 10 to about 100 nucleotides, e.g., about 15 to about 60 nucleotides, about 20 to about 60 nucleotides, or about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides. Aptamers can comprise a minimum of about 5-6 nucleotides, e.g., about 8, 10, 12, 14 or 15 nucleotides, that are necessary for target-specific binding. Aptamers with target binding regions containing sequences shorter than 10, e.g., 6- mers, are feasible if the appropriate interaction with the target can be obtained in the context of the environment in which the target is placed. For example, if there is little interference from other materials or steric hindrance, a shorter aptamer sequence can be used. [0226] As explained in more detail herein, aptamers can comprise natural nucleotides (i.e., A, T, G, C, and U), non-naturally occurring nucleic acids (e.g., inverted Ts, phosphorothioate internucleoside linkages, 2' modifications (methoxy, amino, fluoro, etc.), locked nucleic acids (LNAs), peptide nucleic acids (PNAs), base modifications, etc.), modified nucleic acids (e.g., linked to a pharmacokinetic-improving component), and combinations of natural, non- naturally occurring, or modified nucleic acids in any amount. Modified and non-naturally occurring nucleic acids are commonly added to improve the stability of the aptamer. In one embodiment, inverted Ts are used at the 5' end, the 3' end, or at both positions to provide stability to the aptamer. Aptamers can be composed of naturally occurring D-RNA or D- DNA, or non-naturally occurring L-RNA or L-DNA, or any combination thereof. [0227] In certain embodiments, the invention comprises aptamers selected to bind one or more members of the ErbB family of receptor tyrosine kinases. Examples of ErbBl -binding aptamers are described, e.g., in Li et al, PLoS One, 6(6):e20299 (201 1). Examples of ErbB2-binding RNA aptamers are described, e.g., in Kim et al , Nucleic Acid Ther. , 21 : 173- 178 (201 1). Examples of ErbB3 binding aptamers are described, e.g., in Chen et al, Proc. Natl. Acad. Sci., 100: 9226-9231 (2003).

Table 1. ErbBl-binding RNA Aptamers

Aptamer

Aptamer Sequence

Name

E01 UGCCGCUAUAUCGCACGUAUUUAAUCGCCGUAGAAAAGCAUGUCCAAGCCG

E02 UGGCGCUAAAUAGCACGGAAAUAAUCGCCGUAGAAAAGCAUGUCAAAGCCG

E03 UGCUAGUAUAUCGCACGGAUUUAAUCGCCGUAGUAGAAAAGCAUGUCAAAGCCG E04 UGCCGCCAUAUCACACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCG

E05 UUCCGCUGUAUAACACGGACUUAAUCGCCGUAGUAAAGCAUGUCAAAGCCG

E06- UGUCGCUCUAUUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCG

E07 UGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAGCCG

Table 2. ErbB2-binding RNA Aptamers

[0228] The aptamers of the invention can be selected according to any method or combination of methods. Systemic Evolution of Ligands by Exponential Enrichment (SELEX™), or a variation thereof, is commonly used in the field. The basic SELEX™ process is described, e.g., in US Patent No. 5,567,588. A number of variations on the basic method can also be used, e.g., in vivo SELEX™, as described in US Pub. No. 2010015041. MONOLEX™ is another selection process described, e.g., in Nitsche et al. (2007) BMC Biotechnology 7:48 and WO02/29093. VDC-MSELEX™ is an aptamer selection process based on volume dilution, magnetic bead concentration and continuous washing in microfluidic channels {see, Oh et al., Anal. Chem. 83: 6883-9 (201 1)). Affinity libraries, e.g., chip-based libraries can also be used. In vivo selection using nucleic acid libraries injected into tumor cells can also be used {see, e.g., Mi et al, Nat. Chem. Biol. 1 :22 (2010)).

[0229] In its most basic form, the SELEX™ process comprises the following series of steps:

• A population of candidate oligonucleotides (typically between 20-200 nucleotides, e.g., 50-100 or 60-70 nucleotides in length) are prepared. The population comprises a mixture of oligonucleotides with regions of fixed sequences {i.e., identical iri all candidates) and regions of randomized sequence (different between candidates). · The candidate mixture is contacted with the target and selected based on ability to bind to the target, e.g., using chromatographic methods. The ability of the randomized sequences to interact with the target provides the basis for this selection step.

• Those candidate oligonucleotides that do not bind to the target are removed, and the remaining bound candidate oligonucleotides are retained. The washing conditions can be varied to select for those candidate oligonucleotides that bind to the target with a desired strength.

• The remaining, bound candidate oligonucleotides are amplified using PCR, resulting in an enriched candidate mixture with at least some target-binding activity.

· The enriched candidate mixture is again selected with the target, and the process is iteratively repeated until a desired number of candidate oligonucleotides are selected. The selected candidates can then be further characterized.

[0230] MONOLEX™ offers a one-step selection/amplification process. In MONOLEX™, the candidate mixture undergoes an initial separation {e.g., using chromatography) based on target affinity. Different populations of candidate oligonucleotides are then selected within the desired affinity range. The desired population is amplified, and optionally further characterized and optimized. [0231] As noted above, the basic selection method can be modified. For example, US Patent No. 5,475,096 describes additional selection of aptamers with specific structural characteristics, such as bent DNA. US Patent Nos. 6,291,184 and 6,376, 190 describe a SELEX™ based method for selecting aptamers containing photoreactive groups capable of photocrossl inking to a target molecule. Similarly, US Patent No. 5,705,337 describes methods for covalently linking a ligand to its target (Chemi- SELEX™). US Patent No. 5,567,588, describes a SELEX™-based method for partitioning between oligonucleotides having high and low affinity for a target molecule. US Patent Nos. 5,688,935, 5,864,026, and 5,874,218 describe selection using large, undefined targets such as a tissue. [0232] Aptamers obtained from the selection process can be validated by pull-down assays and/or by Western analysis (see, Tanaka et al. JPET, 329:57-63 (2009)). For example, biotinylated aptamers can be preincubated with streptavidin (SA) beads (prewashed) and incubated on a shaker, followed by washing. The bead complex can then be incubated with target-positive or target-negative cell lysates. The beads are then pelleted and the supernatant separated to a new tube. The proteins can then be resolved by SDS gel electorphoresis, transferred to nitrocellulose and probed with a monoclonal antibody specific to the target.

H. Negative Selection of Nucleic Acid Aptamers

[0233] Using a strategy of negative selection, binding to an undesired target can be selected against. Ideally, an aptamer will bind the desired target with at least 10-fold greater affinity than to an undesired binding target. To accomplish this, a candidate pool of oligonucleotides can be initially exposed to an undesired binding target before selection with the desired target. Then only those candidates that do not bind to the undesired target can progress to the positive selection process. Alternatively, one can carry out the positive selection process before exposing the candidate oligonucleotides to the undesired target. In some

embodiments, the candidate oligonucleotides can be repeatedly exposed to positive and negative selection in any order. Repeating the selection steps can be useful, e.g., where the aptamers are optimized or modified in some way after an early selection step, or if further narrowing of the target binding site is desired. For example, US Patent No. 5,580,737 describes identification of highly specific aptamers able to discriminate between closely related molecules, termed Counter- SELEX™.

[0234] One of skill in the art will understand that "undesired target" can potentially encompass a number of molecules, cells, and tissues. For example, the undesired target can comprise normal, non-cancerous tissues and cells, and normal cell surface antigens. [0235] For example, the aptamers of the invention can be selected to bind to HER3 with at least 10-fold higher affinity (e.g., at least 20, 30, 40, 50, 75, 100, 200, 500, or 1000-fold higher affinity) than to HER1 and HER2. For example, the aptamer can be selected to have an affinity for FIERI of 100 nM or stronger (i.e., lower kD), and selected to bind HER2 and HER3 with affinity of ΙΟΟΟηΜ or weaker (i.e., higher kD). Affinity can be determined and described as disclosed herein.

I. Synthetic Methods of Nucleic Acid Aptamers

[0236] Once the desired sequence has been determined, an aptamer can be synthesized according to any method known in the art for nucleic acid synthesis. In some embodiments, the aptamer comprises natural nucleic acids, or those that can be recognized and incorporated using a DNA or RNA polymerase. In these embodiments, standard molecular biology techniques can be used, including, but not limited to, polymerase chain reaction (PCR), in vitro transcription, in vitro replication, ligase-mediated amplification, rolling circle amplification, strand displacement amplification, etc. The aptamer can also be produced in a cell-based system, e.g., using high-copy plasmids in bacteria.

[0237] Aptamers can be also chemically synthesized using conventional techniques such as those described by Beaucage et at, Tetrahedr. Letters 22: 1859-1862 (1981) and Sinha et at, Nucleosides and Nucleotides 3: 157-171 (1984). The aptamer can be produced using phosphoramidite monomers, or similarly protected monomers with appropriate modifications. The standard synthesis reaction comprises iterative deprotection, coupling, capping and stabilization steps in a 3' to 5' direction (see, e.g., McBride et at (1983) Tetrahed. Letters 24:245-48, (1983)). These methods commonly rely on a solid support column. Solid supports for use in oligonucleotide synthesis are typically CPG or MPPS. Production of nucleic acids that comprise phosphorothioate linkages can use oligonucleotide

phosphorothioate (OPS) monomers, or can be incorporated during the oxidation step of the solid phase synthesis using common reagents. Such methods are described, e.g., by Iyer et at, J. Amer. Chem. Soc. 1 12:1253 (1990).

[0238] If large-scale synthesis is used, the aptamer can be made by scale-up of the solid support method or by using solution phase techniques, particularly if the desired end-product is a relatively short oligonucleotide. A starting material for the synthesis process can be a 5'- non-tritylated oligonucleotide or analog of the desired primary structure, which can have protected bases, and which can be bound to a solid-support. Any conventionally used protecting groups can be used. In some methods, N6-benzoyl is used for adenine, N4- benzoyl for cytosine, N2-isobutyryl for guanine and N2 -benzoyl for 2-amino purine. Other useful protecting groups include phenoxyacetyl (PAC) and t-butoxyacetyl (TAC). More base labile protection groups, as known in the art, can be used to prevent hydrolysis of the generated tri- or diphosphates. These groups are generally quite stable under basic conditions, but can be subject to hydrolysis.

[0239] The final protecting groups are removed from the resulting oligonucleotide. The oligonucleotide can be purified following synthesis using methods known in the art, e.g., desalting, polyacrylamide gel electrophoresis, and chromatographic methods, such as HPLC. Highly-accurate, customized nucleic acid synthesis, including modified nucleic acids, is offered commercially from a number of vendors, e.g., Integrated DNA Technologies, Inc., Biosynthesis, Inc., and Invitrogen.

J. Nucleic Acids For Use in Aptamers

[0240] Some types of aptamers are nucleic acid-based targeting agents. In the context of aptamers, nucleic acids, oligonucleotides, polynucleotides and like terms include DNA, RNA, L-DNA, L-RNA, LNA, PNA, non-naturally occurring nucleic acids, modified nucleic acids, and combinations thereof. Nucleic acids can include those with conventional bases, sugar moieties, and internucleotide linkages, or those with modifications in any of these aspects.

[0241] The term "locked nucleic acid" or "LNA" refers to a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge locks the ribose in the V-endo conformation, which enhances base stacking. Generally, LNAs are synthesized chemically and are commercially available.

[0242] The term "peptide nucleic acid" or "PNA" refers to an oligonucleotide analogue that can participate in Watson-Crick base pairing. Typically, a PNA is a chemically synthesized polymer similar to DNA and RNA. In a PNA, various purine and pyrimidine bases are linked by methylene carbonyl bonds to a backbone comprising repeating N-(2-aminoethyl)-glycine units connected by peptide bonds. PNAs are not easily recognized by nucleases or proteases, making them more resistant to enzyme degradation. It has been shown that PNAs are stable across a wide range of pH. A PNA when covalently coupled to a cell penetrating peptide, can enter the cytosol of a cell.

[0243] Modified or non-naturally occurring oligonucleotides are commonly used to confer stability and nuclease resistance to the aptamer (e.g., in serum or in vivo). In some embodiments, an aptamer comprising at least one modified or non-naturally occurring nucleic acid is at least about 1.5 times more resistant to nuclease degradation than its unmodified counterpart, e.g., at least about 2, 3, 4, 5, or 10 times more resistant than its unmodified counterpart. In some embodiments, an aptamer comprising at least one modified nucleic acid has a longer half-life in serum, e.g., at least about 1.5, 2, 4, 5, 10-times, or longer serum half- life, than its unmodified counterpart.

[0244] Non-naturally occurring nucleic acids include those with 2'-deoxy, 2'-halo

(including 2'-fluoro), 2'-amino, 2'-mono-, di- or tri-halomethyl, 2'-0-alkyl, 2'-0-halo- substituted alkyl, 2'-alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diamino purine, 2- hydroxy-6-mercaptopurine and pyrimidine bases substituted at the 6-position with sulfur or 5 position with halo or C5 alkyl groups, abasic linkers, 3'-deoxy-adenosine as well as other available "chain terminator" or "non-extendible" analogs {e.g., at the 3 '-end of the polymer).

[0245] For example, the 3' ends of aptamers can be modified with an "inverted T cap" {i.e., addition of -3'dT at the 3' end of the aptamer) to increase nuclease resistance, and the use of such an inverted T cap structure at the 5' ends of aptamers has also been described. Thus, an aptamer can incorporate 5 '-5' and 3 '-3' inverted caps in the sequence. A 5 '-5' inverted nucleotide cap refers to a first nucleotide covalently linked to the 5' end of an oligonucleotide via a phosphodiester linkage between the 5' position of the first nucleotide and the 5' terminus of the oligonucleotide. A 3 '-3' inverted nucleotide cap refers to a last nucleotide covalently linked to the 3' end of an oligonucleotide via a phosphodiester linkage between the 3' position of the last nucleotide and the 3' terminus of the oligonucleotide. Inverted nucleotide modifications and methods of introducing the same are described, e.g., in PCT Publication No. WO2005/014814. [0246] The nucleic acid can comprise nucleoside analogs {e.g., aracytidine, inosine, isoguanosine, nebularine, pseudouridine, 2,6-diaminopurine, 2-aminopurine, 2-thiothymidine, 3-deaza-5-azacytidine, 2'-deoxyuridine, 3-nitorpyrrole, 4-methyl indole, 4-thiouridine, 4- thiothymidine, 2-aminoadenosine, 2-thiothymidine, 2-thiouridine, 5-bromocytidine, 5- iodouridine, inosine, 6-azauridine, 6-chloropurine, 7-deazaadenosine, 7-deazaguanosine, 8- azaadenosine, 8-azidoadenosine, benzimidazole, Ml-methyladenosine, pyrrolo-pyrimidine, 2-amino-6-chloropurine, 3 -methyl adenosine, 5-propynylcytidine, 5-propynyluridine, 5- bromouridine, 5-fluorouridine, 5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8- oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, etc.), chemically or biologically modified bases {e.g., methylated bases), intercalated bases, modified sugars {e.g., 2'-fluororibose, 2'-aminoribose, 2'-azidoribose, 2'-0-methylribose, L-enantiomeric nucleosides arabinose, hexose, etc.), modified phosphate moieties (e.g., phosphorothioates or 5'-N-phosphoramidite linkages), and/or other naturally and non-naturally occurring bases substitutable into the polynucleotide, including substituted and unsubstituted aromatic moieties.

[0247] An aptamer can be modified with a phosphorothioate internucleoside linkage, e.g., to improve stability. Phosphorothioate-substituted oligonucleotides, other sulfur-modified nucleic acids, and methods of incorporating the same are described, e.g., in US Patent Nos. 5,864,031 and 6,867,289. [0248] One of skill in the art will understand that the above modifications are exemplary, and that additional base and/or polynucleotide modifications can be incorporated into an aptamer of the invention.

K. Peptide Aptamers

[0249] Peptide aptamers are proteins selected to interfere with protein interactions which occur on the surface or inside of a cell. Peptide aptamers typically comprise a variable peptide loop attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to those of an antibody (e.g., nanomolar range). Like nucleic acid aptamers, peptide aptamers are typically small in size and simple to design. The variable loop length is typically from about 10 to about 20 amino acids, and the protein scaffold may be any protein which has good solubility and compacity properties. In some embodiments, the protein scaffold is the bacterial protein Thioredoxin-A and the variable peptide loop is inserted within its reducing active site. Peptide aptamers can typically adopt a three-dimensional structure independent of disulfide bonds, which enables them to properly function inside cells. Similar to nucleic acid aptamers, peptide aptamers have high target binding specificity and strong affinity both in vitro and in vivo, and have high stability in a wide range of conditions (e.g., temperature and pH).

[0250] Peptide aptamers are usually selected using a screening method based on the yeast two-hybrid system and involving combinatorial expression libraries (see, e.g., Hoppe-Seyler et ah, Curr. Mol. Med., 4:529-538 (2004)). To date, peptide aptamers have been isolated to bind to various cellular, bacterial, and viral proteins. VII. Examples

[0251] The present invention will be described in greater detail by way of specific examples. The following examples are offered for illustrative purposes, and are not intended to limit the invention in any manner. Those of skill in the art will readily recognize a variety of noncritical parameters which can be changed or modified to yield essentially the same results.

Example 1. Detection and Quantification of Total Protein and Activated Protein Levels in a Sample to Monitor a Patient's Risk of Developing Diabetes.

[0252] This example demonstrates methods for the detection and/or quantification of the activation state and/or total amount of one or a plurality of biomarkers such as transcriptional coregulators of energy homeostasis in samples (e.g., tissue biopsies, blood, plasma, urine, saliva, etc.) from patients at risk of developing a metabolic disorder such as diabetes. In one particular embodiment, the present methods enable the detection and/or measurement of the expression and/or activation levels of one or a plurality of biomarkers associated with diabetes and related metabolic disorders. Non-limiting examples of such biomarkers include PGC-1 (e.g., PGC-Ια, PGC-lb, PRC), pl60-myb, p38, AMP-activated protein kinase (AMPK), silent information regulator Tl (SIRT1), SREBP-1 , ADIPOQ, TCF7L2, PPARy, FTO, KCNJ1 1, NOTCH2, WFS1, FDKAL1 , IGF2BP2, SLC30A8, JAZF1, HNF1B, CDK2NA/B, HHEX, combinations thereof, and complexes thereof (e.g., a complex of PGC-1 and pl60-myb).

[0253] In some embodiments, the methods of the present invention can advantageously be used to detect and/or quantify the levels of total (e.g., expression) and/or activated (e.g., phosphorylated, deacetylated, and/or methylated) protein in a biological sample such as a tissue sample obtained from a patient. In particular embodiments, the present methods can be used to aid or assist in diagnosing, prognosing, or monitoring a pre-metabolic syndrome (e.g., pre-diabetes) or to aid or assist in predicting the likelihood of developing a pre-metabolic syndrome. In other particular embodiments, the present methods can be used to aid or assist in diagnosing, prognosing, or monitoring a metabolic disorder (e.g., diabetes) or to aid or assist in predicting the likelihood of developing a metabolic disorder. In certain instances, the sample can be a whole blood, serum, or plasma sample. In certain other instances, the sample can be a tissue sample obtained from the liver, muscle (e.g., skeletal muscle), adipose, and/or pancreas of the patient. [0254] In response to metabolic cues such as environmental stimuli and nutritional states, the transcriptional activator PGC-1 (e.g., PGC-Ια) is phosphorylated by kinases such as p38 MAPK or AMPK and/or deacetylated by deacetylases such as SIRT1. Phosphorylated or deacetylated PGC-1 serves as a dock or platform for the recruitment of regulatory protein complexes which activate gene transcription of numerous distinct biological and metabolic pathways in different tissues. In some embodiments, the total level of PGC-1 protein (e.g., both activated and inactivated PGC-1 protein), the total level of a complex between PGC-1 protein and pl 60-myb protein, and/or the level of phosphorylated PGC-1 protein is detected and/or quantitated in a sample to calculate a phosphorylation index, which can be correlated to the activation of metabolic pathways. As one non-limiting example, the phosphorylation index is calculated as a ratio of the total level of PGC-1 protein or PGC-l/pl60-myb protein complex to the level of phosphorylated PGC-1 protein. In other embodiments, the total level of PGC-1 protein (e.g., both activated and inactivated PGC-1 protein), the total level of PGC- 1 protein that is acetylated, and/or the level of deacetylated PGC-1 protein is detected and/or quantitated in a sample to calculate a deacetylation index, which can also be correlated to the activation of metabolic pathways. As another non-limiting example, the deacetylation index is calculated as a ratio of the total level of PGC-1 protein or acetylated PGC-1 protein to the level of deacetylated PGC-1 protein. In certain instances, the presence of the PGC-1 /pi 60- myb protein complex and/or acetylated PGC-1 protein corresponds to inactive or inactivated PGC-1 protein. In particular embodiments, a metabolism (or metabolic) index is calculated based upon the phosphorylation index and deacetylation index, e.g., using the algorithms as described herein, to aid or assist in diagnosing, prognosing, monitoring, and/or predicting the likelihood (e.g., probability) of developing a pre-metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes). [0255] Figure 4 illustrates one embodiment of the invention, wherein CEER (with capture and detection antibodies) is used to detect the presence or levels of total and activated PGC-1 protein. In particular, the presence or level of the PGC-1 /pl60-myb protein complex (400) is measured with CEER using a capture antibody specific for PGC-1 that binds independent of its activation state, a first detection antibody specific for PGC-1 that binds independent of its activation state (e.g., labeled with glucose oxidase (GO) or a first fluorophore), and a second detection antibody (e.g., labeled with a peroxidase such as HRP or a second fluorophore) specific for pl60-myb. The signal generated upon the binding of all three antibodies to the PGC-1 /pl60-myb protein complex can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). Figure 4 also illustrates measuring the presence or level of phosphorylated PGC-1 protein (410) with CEER using a capture antibody specific for PGC-1 that binds independent of its activation state, a first detection antibody specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection antibody (e.g., labeled with a peroxidase such as HRP or a second fluorophore) that is specific for the phosphorylated PGC-1 protein. The signal that is generated upon the binding of all three antibodies to the phosphorylated PGC-1 protein can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). A phosphorylation index (420) can then be calculated, e.g., as a ratio of the total levels of PGC-1 /pl60-myb protein complex to the levels of phosphorylated PGC-1 protein or vice versa.

[0256] In addition, Figure 4 illustrates measuring the presence or level of acetylated PGC-1 protein (430) using CEER with a capture antibody specific for PGC-1 that binds independent of its activation state, a first detection antibody specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection antibody (e.g., labeled with a peroxidase such as HRP or a second fluorophore) specific for acetylated PGC-1 protein. The signal generated upon the binding of all three antibodies to the acetylated PGC-1 protein can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). Figure 4 also shows measuring the presence or level of deacetylated PGC- 1 protein (440) with CEER using a capture antibody specific for PGC-1 that binds independent of its activation state, a first detection antibody specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection antibody (e.g., labeled with a peroxidase such as HRP or a second fluorophore) specific for deacetylated PGC-1 protein. The signal that is generated upon the binding of all three antibodies to the deacetylated PGC- 1 protein can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). A deacetylation index (450) can then be calculated, e.g., as a ratio of the level of acetylated PGC-1 protein to the level of deacetylated PGC-1 protein or vice versa. [0257] As illustrated in Figure 4, a metabolic index (460) can be calculated based upon the phosphorylation index and deacetylation index, e.g., by applying one or more statistical algorithms described herein, to aid or assist in the diagnosis, prognosis, monitoring, and/or prediction of the likelihood (e.g., probability) of developing a pre-metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes, obesity, etc.). In some embodiments, the phosphorylation, deacetylation, and/or metabolism (or metabolic) indexes can be compared to control index values.

[0258] Figure 5 illustrates another embodiment of the invention, wherein Apta-CEER (with capture and detection aptamers) is used to detect the presence or levels of total and activated PGC-1 protein. In particular, the presence or level of the PGC-l/pl 60-myb protein complex (500) is measured with CEER using a capture aptamer specific for PGC-1 that binds independent of its activation state, a first detection aptamer specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection aptamer (e.g., labeled with a peroxidase such as HRP or a second fluorophore) specific for pl60-myb. The signal that is generated upon the binding of all three aptamers to the PGC-1 /pl60-myb protein complex can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). Figure 5 also illustrates measuring the presence or level of phosphorylated PGC-1 protein (510) with CEER using a capture aptamer specific for PGC-1 that binds independent of its activation state, a first detection aptamer specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection aptamer (e.g., labeled with a peroxidase such as HRP or a second fluorophore) that is specific for the phosphorylated PGC-1 protein. The signal that is generated upon the binding of all three aptamers to the phosphorylated PGC-1 protein can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). A phosphorylation index (520) can then be calculated, e.g., as a ratio of the total levels of PGC-1 /pl 60-myb protein complex to the levels of phosphorylated PGC-1 protein or vice versa.

[0259] In addition, Figure 5 illustrates measuring the presence or level of acetylated PGC-1 protein (530) using CEER with a capture aptamer specific for PGC-1 that binds independent of its activation state, a first detection aptamer specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection aptamer (e.g., labeled with a peroxidase such as HRP or a second fluorophore) specific for acetylated PGC-1 protein. The signal generated upon the binding of all three aptamers to the acetylated PGC-1 protein can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). Figure 5 also shows measuring the presence or level of deacetylated PGC-1 protein (540) with CEER using a capture aptamer specific for PGC-1 that binds independent of its activation state, a first detection aptamer specific for PGC-1 that binds independent of its activation state (e.g., labeled with GO or a first fluorophore), and a second detection aptamer (e.g., labeled with a peroxidase such as HRP or a second fluorophore) specific for deacetylated PGC-1 protein. The signal that is generated upon the binding of all three aptamers to the deacetylated PGC-1 protein can be detected using a tyramide reagent (e.g., when GO and HRP labels are used) or FRET (e.g., when first and second fluorophores are used). A deacetylation index (550) can then be calculated, e.g., as a ratio of the level of acetylated PGC- 1 protein to the level of deacetylated PGC-1 protein or vice versa.

[0260] As illustrated in Figure 5, a metabolic index (560) can be calculated based upon the phosphorylation index and deacetylation index, e.g., by applying one or more statistical of the algorithms described herein, to aid or assist in the diagnosis, prognosis, monitoring, and/or prediction of the likelihood (e.g., probability) of developing a pre-metabolic syndrome (e.g., pre-diabetes) or a metabolic disorder (e.g., diabetes, obesity, etc.). In some embodiments, the phosphorylation, deacetylation, and/or metabolism (or metabolic) indexes can be compared to control index values. [0261] In certain embodiments, any combination of antibodies and aptamers can be used to measure the presence or level of inactivated PGC-1 (e.g., PGC-l/pl 60-myb protein complex or acetylated PGC-1) and/or activated PGC-1 (e.g., phosphorylated or deacetylated PGC-1) as illustrated in Figures 4 and 5. In some instances, one capture antibody and two detection aptamers are used. In certain other instances, a capture antibody, a detection antibody, and a detection aptamer are used. In yet other instances, a capture aptamer, a detection antibody, and a detection aptamer are used. In further instances, a capture aptamer and two detection aptamers are used.

Example 2. Aptamer-Directed Delivery of Therapeutic Agents.

[0262] This example illustrates methods for delivering anticancer agents specifically to malignant cells such as tumor cells using aptamers. In particular embodiments, aptamers can be selected to bind to targets with high specificity, even acidic environments, such as inside a tumor. In some embodiments, an aptamer selected to target a cell surface receptor expressed on malignant cells or a particular tumor cell can be conjugated to an anticancer therapeutic agent. In some instances, the aptamer is connected to the anticancer therapeutic agent by a linker. In other instances, the anticancer therapeutic agent is encapsulated by a polymeric matrix. Examples of anticancer therapeutic agents include, but are not limited to, an anti- signaling agent (e.g., a cytostatic drug) such as a monoclonal antibody or a tyrosine kinase inhibitor, an anti-proliferative agent, a chemotherapeutic agent (e.g., a cytotoxic drug), a hormonal or cytokine therapeutic agent, a radiotherapeutic agent, a vaccine, and/or any other compound with the ability to reduce or abrogate the uncontrolled growth of aberrant cells such as cancerous cells. In particular embodiments, an aptamer can be conjugated to one or more functional proteins or polypeptides including, but not limited to, an IL-2 therapeutic agent (e.g., PROLEUKIN® (aldesleukin)), to advantageously deliver the functional proteins or polypeptides to the tumor environment.

[0263] In certain embodiments, an aptamer conjugated to an antibody such as a therapeutic monoclonal antibody can target a tumor cell and activate antibody-dependent cell-mediated cytotoxicity (ADCC). Without being bound to any particular theory, this cellular mechanism can kill malignant cells such as tumor cells. As a non-limiting example, aptamer-IL-2 (e.g., PROLEUKIN® (aldesleukin)) conjugates of the present invention are delivered to an acidic tumor environment, which induces a pH-dependent conformational change in the aptamer to an active form, to treat a cancer such as renal cell carcinoma (RCC) or metastatic (e.g., skin) melanoma.

[0264] Figure 6 illustrates one exemplary embodiment of the present invention wherein an inactive aptamer complex comprising an aptamer conjugated to a therapeutic agent (e.g., an anti-signaling agent such as a monoclonal antibody or an inhibitor, an antiproliferative agent, a chemotherapeutic agent, a hormonal therapeutic agent, a radiotherapeutic agent, a vaccine, an siRNA, and/or any other compound) can be converted to an active aptamer complex in an acidic tumor environment. As a non-limiting example, Figure 6 illustrates that an inactive therapeutic antibody (Ab)-aptamer complex can undergo a conformational change at low pH (such as in an acidic tumor environment) to an active Ab-aptamer complex (e.g., wherein the aptamer adopts a functional structure) to target cancer cells and deliver the antibody payload specifically to cancer cells (such as those found in a tumor).

[0265] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, one of skill in the art will appreciate that certain changes and modifications may be practiced within the scope of the appended claims. In addition, each reference provided herein including any patent or nonpatent literature document is incorporated by reference in its entirety to the same extent as if each reference was individually incorporated by reference.

Claims

WHAT IS CLAIMED IS: 1. A method for determining the expression or activation levels of one or more analytes in a sample comprising:

(a) incubating a cellular extract with one or a plurality of dilution series of capture reagents to form a plurality of captured analytes, wherein the capture reagents are restrained on a solid support;

(c) measuring the levels of the labeled captured analytes by detecting a signal that is generated from the first and second detection reagents when both of these reagents are bound to the captured analytes, thereby determining the expression or activation levels of the one or more analytes in the sample.

2. The method of claim 1, wherein the capture reagents comprise antibodies or aptamers.

3. The method of any one of the preceding claims, wherein the first and second detection reagents independently comprise antibodies or aptamers.

4. The method of any one of the preceding claims, wherein the first and second detection reagents, respectively, comprise first and second labeled activation state - independent reagents specific for the corresponding analytes.

5. The method of any one of the preceding claims, wherein the first and second labeled activation state-independent reagents, respectively, comprise first and second labeled activation state-independent antibodies or aptamers.

6. The method of any one of the preceding claims, wherein the first and second detection reagents, respectively, comprise labeled activation state-independent reagents and labeled activation state-dependent reagents specific for the corresponding analytes.

7. The method of any one of the preceding claims wherein the labeled activation state-independent reagents comprise labeled activation state-independent antibodies or aptamers.

8. The method of any one of the preceding claims, wherein the labeled activation state-dependent reagents comprise labeled activation state-dependent antibodies or aptamers.

9. The method of any one of the preceding claims, wherein the activation levels correspond to phosphorylation levels, acetylation levels, deacetylation levels, and/or methylation levels.

10. The method of any one of the preceding claims, wherein at least two or all three of the capture reagents, first detection reagents, and second detection reagents comprise aptamers when the one or more analytes comprise signaling proteins associated with cancer.

11. The method of any one of the preceding claims, wherein the one or more analytes comprise signaling proteins associated with a pre-metabolic syndrome and/or a metabolic disorder.

12. The method of any one of the preceding claims, wherein at least one, two or all three of the capture reagents, first detection reagents, and second detection reagents comprise antibodies.

13. The method of any one of the preceding claims, wherein at least one, two or all three of the capture reagents, first detection reagents, and second detection reagents comprise aptamers.

14. The method of any one of the preceding claims, wherein the pre- metabolic syndrome is pre-diabetes.

15. The method of any one of the preceding claims, wherein the metabolic disorder is diabetes, obesity, or metabolic syndrome.

16. The method of any one of the preceding claims, wherein the first and second detection reagents are labeled with chromogenic or fluorescent labels.

17. The method of any one of the preceding claims , wherein the signal is generated by the proximity binding of both the first and second detection reagents to the captured analytes.

18. The method of any one of the preceding claims, wherein the generated signal is detected using tyramide signal amplification or fluorescence resonance energy transfer (FRET).

19. The method of any one of the preceding claims, wherein the cellular extract is prepared from a sample obtained from an individual.

20. The method of any one of the preceding claims, wherein the sample is a blood, serum, plasma, or tissue sample.

21. The method of any one of the preceding claims, wherein the individual is suspected of having or is predisposed to having cancer, a pre-metabolic syndrome, or a metabolic disorder.

22. A method for aiding or assisting in diagnosing, prognosing, monitoring or predicting the likelihood of developing a pre-metabolic syndrome or a metabolic disorder, the method comprising:

23. The method of claim 22, wherein the pre-metabolic syndrome is pre- diabetes.

24. The method of any one of claims 22-23, wherein the metabolic disorder is diabetes, obesity, or metabolic syndrome.

25. The method of any one of claims 22-24, wherein the activation levels correspond to phosphorylation levels, acetylation levels, deacetylation levels, and/or methylation levels.

26. The method of any one of claims 22-25, wherein the expression and/or activation of the one or more analytes is determined using CEER, Apta-CEER, and/or Combo-CEER.

27. The method of any one of claims 22-26, wherein the one or more analytes comprise signaling proteins associated with a pre-metabolic syndrome and/or a metabolic disorder.

28. The method of any one of claims 22-27, wherein the one or more analytes comprise a peroxisome proliferator gamma co-activator- 1 protein selected from the group consisting of PGC- 1 a, PGC- 1 b, PRC, and combinations thereof.

29. The method of any one of claims 22-28, wherein the metabolic index is determined by applying one or more algorithms and/or other statistical processes to both the phosphorylation index and the deacetylation index.

30. The method of any one of claims 22-29, wherein the sample is a blood, serum, plasma, or tissue sample.

31. The method of claim 30, wherein the tissue sample is a liver, muscle, adipose, or pancreas sample.

32. The method of any one of claims 22-31, wherein the individual is suspected of having or is predisposed to having a pre-metabolic syndrome or a metabolic disorder.