WO2013044164A1 - Methods to treat and/or prevent relapse in notch1-driven malignancies - Google Patents

Abstract

Disclosed herein are compositions and methods for treating, preventing or ameliorating a NOTCH 1 -driven malignancy, or for reducing or significantly reducing the amount of or reducing the burden of leukemic stem cells, or a leukemia stem cell (LSC), or a CD45⁺CD34⁺CD2⁺ CD7⁺ and/or CD45⁺CD34⁺CD2⁺ CD7^- subpopulation of leukemic stem cells (LSC), or a T-ALL LSC subpopulation, comprising: inhibiting the expression of a NOTCH1 gene or gene product, or a NOTCH1 transcript (message, or mRNA); or decreasing the amount of, or activity of, or production of, a NOTCH 1 polypeptide. Also disclosed herein are methods for identifying and/or determining the presence of a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or to diagnose pediatric T-ALL, comprising identifying, determining the presence of and/or measuring a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2.

Description

METHODS TO TREAT AND/OR PREVENT RELAPSE IN NOTCH 1 -DRIVEN

MALIGNANCIES

CROSS REFERENCE TO RELATED APPLICATIONS

[001] This application claims the benefit of priority to U.S. Provisional Application Ser. No. 61/537,166 entitled, "Compositions and Methods for Identifying Leukemia Stem Cell Populations," filed September 21, 2011 and U.S. Provisional Application No. 61/537,178 entitled, "Compositions and Methods for Inhibiting Leukemia Initiating Cell (LIC) Burden, Survival and Self-Renewal in Human T-Cell Acute Lymphoblastic Leukemia," filed September 21, 2011. Both applications are incorporated by reference herein in their entireties, including all figures.

FIELD OF THE INVENTION

[002] The present disclosure relates to oncology, diagnostics, cellular and developmental biology and drug discovery. Disclosed herein are methods for treating, preventing or ameliorating a NOTCH 1 -driven malignancy, and methods for reducing or significantly reducing the amount of or reducing the burden of leukemia stem cells (LSC) associated with the NOTCHl-driven malignancy. The NOTCH1- driven malignancy can be, without limitation, a colorectal cancer, an ovarian cancer, a hematological cancer or a breast cancer. Also disclosed are methods for reducing or significantly reducing the amount of or reducing the burden of a CD45⁺CD34⁺CD2⁺ CD7⁺ or CD45⁺CD34⁺CD2⁺ CD7^" population of leukemic stem cells found in patients with T-cell acute lymphoblastic leukemia (T-ALL). The disclosure herein provides methods for identifying and/or determining the presence of a leukemic stem cell population in a pediatric T-ALL, or to diagnose pediatric T-ALL, comprising identifying, and/or determining the presence of and/or measuring a cell or a cell population or subpopulation having a specific set of biomarkers-CD45⁺, CD34⁺, CD2⁺ and CD7⁺ or CD45⁺, CD34⁺, CD2⁺ and CD7^".

BACKGROUND OF THE DISCLOSURE

[003] Notch homolog 1, translocation-associated (Drosophila), also known as NOTCH1, is a human gene encoding a single-pass transmembrane receptor. This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EOF) repeats, and an intracellular domain consisting of multiple, different domain types. NOTCH family members play a role in a variety of developmental processes by controlling cell fate decisions.

[004] Activating mutations in NOTCH1 have been found in cancers, such as breast, ovarian, colorectal and in T cell acute lymphoblastic leukemia (T-ALL). In T-ALL NOTCH 1 activating mutations have been implicated in driving therapeutic resistance. However, the role of NOTCH1 activation in human leukemia initiating cells (LIC) propagation and sensitivity to selective NOTCH 1 receptor inhibition has not been examined.

[§05] Seminal research suggests that leukemia relapse occurs because standard chemotherapy fails to eradicate self-renewing LIC [1]-[15]. While human myeloid leukemia xenograft studies demonstrate that LIC reside at the apex of a cellular hierarchy and are capable of serially transplanting leukemia [lJ-[3], [6], cellular subpopulations within diagnostic precursor B cell acute lymphoblastic leukemia (ALL) samples demonstrate greater functional and genetic heterogeneity [16], [17]. Recently, DNA copy number alteration (CNA) profiling coupled with xenograft analysis suggested that patients with BCR-ABL1 ALL harboring a predominant clone at diagnosis have increased rates of early relapse thereby linking LIC clonal dominance with a poorer prognosis [18].

[006] In another leukemia subtype that is prone to early relapse [41], pediatric T cell acute lymphoblastic leukemia (T-ALL), serially transplantable LIC were found to be enriched in CD34⁺CD4^"" and CD34⁺CD7^"' fractions of newly diagnosed patient samples [12]. However, these results were obtained after suspension culture-mediated expansion prior to transplantation potentially leading to changes in LIC functional capacity. More recently, a CD7⁺CD1 a^~ glucocorticoid resistant LIC population, capable of engrafting leukemia in NOD/SCID IL2Rynuil (NSG) mice, was identified in primarily adult T-ALL without an in vitro expansion step [10]. While the LIC population was found to be an essential driver of therapeutic resistance and relapse, the NOTCH! mutational status of the LIC population was not established; the cell surface phenotype changed during the prolonged engraftment period and niche dependence of LLC" maintenance, which could ultimately contribute to relapse, was not elucidated. The high propensity for T-ALL relapse underscores the need for LIC characterization based on functional molecular drivers of survival and self-renewal and spatiotemporal tracking of niche dependence in bioluminescent serial xenotransplantation models.

[§07] While T-ALL represents only 25% of adult and 15% of pediatric ALL cases, they share an increased risk, of early systemic and isolated central nervous system relapse often in the setting of mutational NOTCHl signaling pathway activation [19]. A recent series of studies showed that NOTCH activation is associated with improved early therapeutic response (reviewed in [42]). However, this early benefit translates into improved overall survival only in some series, most probably as a result of differences in therapy, and suggests that NOTCH- targeted therapies might represent promising therapeutic strategies. During normal hematopoiesis, NOTCHl regulates cell fate decisions, proliferation and survival following ligand binding, which triggers a conformational change in the negative regulator}' region (NRR) of the extracellular domain, enabling juxtamembrane ADAM protease cleavage [38], [39]. Subsequently, γ-secretase complex mediated intramembrane proteolysis releases an intracellular domain of NOTCHl (TCNl), which translocates to the nucleus and activates transcription of NOTCH target genes [38], [32]. In T-ALL, somatic activating mutations in the NOTCHl heterodimerization domain (HD) or PEST domain or alternatively loss-of- unction mutations in FBXW7, a NOTCHl E3 ubiquitin ligase, increase release or stability of 1CN1. This, in turn, leads to transcriptional activation of genes that promote proliferation and survival such as MYC and HES1 [38], [32].

[008] Despite reports describing mechanisms of NOTCH! activation in T-ALL, the cell type and context specific role of NOTCHl activation in the maintenance of therapeutically resistant self-renewing human LiC has not been established.

SUMMARY OF THE INVENTION

[009] Disclosed herein are methods for treating, preventing or ameliorating relapse or therapeutic resistance in a NOTCHl -driven malignancy associated with a NOTCHl activating mutation or overexpression of wild-type NOTCHl in a subject in need of such treatment comprising a) determining if said subject has a malignancy associated with a NOTCHl activating mutation or overexpression of wild-type NOTCHl ; and b) administering a composition to said subject if the malignancy is associated with a NOTCHl activating mutation wherein the composition (i) inhibits or decreases the expression of a NOTCHlgene or gene product, or a NOTCH 1 transcript (message, or mRNA); or (ii) inhibits or decreases the amount of, or activity of, or production of, a NOTCH 1 polypeptide.

[0010] Compositions for practicing the methods disclosed herein include those that inhibit or decrease the expression of a NOTCH1 gene, a NOTCH1 gene product, a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide including (a) an inhibitory nucleic acid molecule or an antisense oligonucleotide inhibitory to expression of a NOTCH1 gene or a NOTCH1 gene transcript; or (b) a polypeptide, peptide or an antibody inhibitory to the expression of the NOTCH1 gene or NOTCH1 gene transcript, or activity or expression of the NOTCH 1 polypeptide.

[0011] In some embodiments, inhibitory nucleic acid molecules or antisense oligonucleotide inhibitory to expression of the NOTCH1 gene or NOTCH1 gene transcript useful for practicing the methods disclosed herein include an RNAi inhibitory nucleic acid molecule, a double-stranded RNA (dsRNA) molecule, a small interfering RNA (siRNA), a microRNA (miRNA) and/or a short hairpin RNA (shRNA) or ribozyme.

[0012] In another embodiment, the composition that inhibits or decreases the expression of a NOTCH1 gene, a NOTCH1 gene product, a NOTCH1 transcript, and/or a NOTCH 1 polypeptide and useful for practicing the methods disclosed herein include small molecules.

[0013] In still other embodiments, compositions for practicing the methods disclosed herein can include antibodies inhibitory to the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH 1 polypeptide, including an antibody or antigen-binding fragment thereof, or a monoclonal or polyclonal antibody, that specifically binds to a NOTCH 1 protein, or specifically binds to the negative regulatory region (NRR) of the NOTCH 1 extracellular domain found on the malignancy cells being treated.

[0014] In alternative embodiments, compositions for practicing the methods disclosed herein can include polypeptides or peptides inhibitory to the expression of a NOTCHlgene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH 1 polypeptide including a peptide aptamer or a NOTCH 1 protein-binding polypeptide or peptide.

[0015] In other embodiments, compositions useful for practicing the methods disclosed herein that inhibit or decrease the expression of or the activity of: a NOTCHlgene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH1 polypeptide can be administered in vitro, ex vivo or in vivo.

[0016] In alternative embodiments, the invention provides compositions, pharmaceutical compositions or formulations comprising a composition that inhibits or slows the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a Notchl polypeptide, wherein optionally the composition or formulation is formulated for administration in vitro, ex vivo or in vivo.

[0017] In other embodiments, NOTCH1 -driven malignancies that can be treated using the methods disclosed herein include, without limitation, hematological cancers, colorectal cancers, ovarian cancers or breast cancers.

[0018] In some embodiments, the hematological cancer is T cell acute lymphoblastic leukemia (T-ALL).

[0019] In alternative embodiments, disclosed herein are compositions and methods for treating, preventing or ameliorating a NOTCH 1 -driven malignancy by inhibiting or reducing NOTCHl^Mutated T-ALL leukemia initiating cells (LIC) burden, survival and NOTCH1 driven LIC self-renewal; or, reducing or significantly reducing the amount of or reducing the burden of leukemic stem cells, a leukemia stem cell (LSC), or a T-ALL LSC subpopulation.

[0020] In other embodiments, disclosed herein are compositions and methods for treating, preventing or ameliorating a NOTCH 1 -driven malignancy by inhibiting or reducing the burden, self -renewal, or survival of leukemic initiating cells (LIC) that are CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7\

[0021] Disclosed herein are methods for reducing or inhibiting the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC in a subject comprising administering a composition that:

(a) inhibits the expression of a NOTCH1 gene or gene product, or a NOTCH 1 transcript (message, or mRNA); or

(b) decreases the amount of, or activity of, or production of, a

NOTCH 1 polypeptide.

[0022] In alternative embodiments, the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC comprises:

(a) an inhibitory nucleic acid molecule or an antisense oligonucleotide inhibitory to expression of a NOTCH1 gene or a NOTCH1 gene transcript; or

(b) a polypeptide, peptide or an antibody inhibitory to the expression of the NOTCH 1 gene or NOTCH 1 gene transcript, or activity or expression of the NOTCH 1 polypeptide.

[0023] In alternative embodiments, the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC comprises an inhibitory nucleic acid molecule or antisense oligonucleotide inhibitory to expression of the NOTCH1 gene or NOTCH1 gene transcript comprises: an RNAi inhibitory nucleic acid molecule, a double- stranded RNA (dsRNA) molecule, a small interfering RNA (siRNA), a microRNA (miRNA) and/or a short hairpin RNA (shRNA) or ribozyme.

[0024] In other embodiments, the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC comprises a small molecule that inhibits or decreases the expression of a NOTCH1 gene, a NOTCH1 gene product, a NOTCH1 transcript, and/or a NOTCH1 polypeptide or overexpressed wild-type NOTCH1.

[0025] In alternative embodiments, the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC comprises an antibody or antigen-binding fragment thereof that specifically binds to a NOTCH 1 protein and is inhibitory to the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH 1 polypeptide.

[0026] In alternative embodiments, the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC comprises a peptide aptamer or a NOTCH 1 protein- binding polypeptide or peptide that inhibits or decreases the expression of a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, or activity or expression of the NOTCH 1 polypeptide.

[0027] In other embodiments, the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC comprises a composition that inhibits or decreases the expression of or the activity of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide that is administered in vitro, ex vivo or in vivo.

[0028] In alternative embodiments, disclosed herein are methods for determining the relative robustness of a leukemia stem cell (LSC) population, or the most robust leukemia stem cell (LSC) population, comprising: determining whether a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH1 polypeptide is overexpressed; or, detecting the overexpression of a NOTCH1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide.

[0029] In other embodiments, disclosed herein are methods for identifying and/or determining the presence of a leukemic stem cell population in a pediatric T- cell acute lymphoblastic leukemia (T-ALL), or to diagnose pediatric T-ALL, comprising identifying and/or determining the presence of and/or measuring a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2, wherein identifying and/or determining the presence of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 identifies and/or determines the presence of a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or diagnoses a pediatric T- ALL.

[0030] In alternative embodiments, disclosed herein are methods for determining the effectiveness of a diet, treatment, drug or therapy for a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or a pediatric T-ALL, comprising identifying and/or determining the presence of and/or measuring or quantifying the amount of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2, wherein determining a decrease in the presence of or amount of the cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 after or during treatment identifies and/or determines the (positive) efficacy or effectiveness of a diet, treatment, drug or therapy for a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or a pediatric T-ALL.

[0031] In alternative embodiments, disclosed herein are methods for selecting a diet, a treatment, a drug or a therapy to treat or ameliorate a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or therapy to treat or ameliorate a pediatric T-ALL, comprising: (a) applying, contacting or administering a diet, a treatment, a drug or a therapy to a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2; and (b) determining and/or identifying the amount of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 after step (a), wherein determining a decrease in the presence of or amount of the cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 identifies and/or determines the (positive) efficacy or effectiveness of, and selects, the diet, treatment, drug or therapy for a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or a pediatric T-ALL.

[0032] In embodiments of the methods disclosed herein, the presence, absence and/or amount of the biomarkers CD45, CD34, CD2, and/or CD7 and/or a NOTCHl transcript and/or NOTCHl protein can be measured using a fluorescent activated cell sorter (FACS), an array, an immunoassay, an immunoprecipitation, a kit, a polymerase chain reaction (PCR), a qRT-PCR, a nanofluidic assay or device, a nanofluidic proteome assay, a chromatography, a nanoproteomics quantification, or an isoelectric focusing assay, or any combination thereof.

[0033] Disclosed herein are method of treating to prevent recurrence or therapeutic resistance of a malignancy comprising administering to a subject in need thereof a clinically employed treatment regimen for a period of time followed by an assessment of the subject for cells with a NOTCHl activating mutation or overexpression of wild-type NOTCHl, wherein if such mutation or overexpression is found the patient is treated subsequently with a composition that inhibits or decreases the expression of or the activity of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide.

[0034] In alternative embodiments, disclosed herein are methods of treating to prevent recurrence or therapeutic resistance of a malignancy associated with a NOTCH1 activating mutation or overexpression of wild-type NOTCH1 comprising administering to a subject a clinically employed treatment regimen for a period of time followed by an assessment of the subject for the presence of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 CD2 wherein if such cells are found the patient is treated with a composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide.

[0035] In yet other embodiments, disclosed herein are methods for treating to prevent recurrence or therapeutic resistance of a malignancy comprising administering to a subject a clinically employed treatment regimen for such malignancy in combination with a composition that inhibits or decreases the expression of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide wherein the composition that inhibits or decreases the expression of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide is given concurrently, prior, or subsequently to the clinically employed regimen.

[0036] In alternative embodiments, disclosed herein are methods wherein a composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH1 polypeptide is given as a maintenance dose to prevent relapse of a malignancy or development of therapeutic resistance in malignancies that are NOTCH1 -driven such as breast, ovarian, colorectal, and hematological cancers, e.g., T-ALL.

[0037] In alternative embodiments, disclosed herein are methods for treating a malignancy to prevent recurrence or therapeutic resistance comprising administering to a subject a clinically employed treatment regimen for such malignancy in combination with a composition that inhibits or decreases the expression of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide reduces or inhibits the burden, self-renewal activity or survival of (LIC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC.

[0038] Disclosed herein are methods to prevent relapse of T-ALL or other hematological cancers after a bone marrow transplant comprising administering to a subject a composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH1 polypeptide and/or by reducing or inhibiting the self-renewal activity or survival of leukemia initiating cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL leukemia initiating cells.

[0039] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0040] All publications, patents, patent applications cited herein are hereby expressly incorporated by reference for all purposes except to the extent they are inconsistent with the disclosures herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Fig. 1. NOTCHl^Mutated LIC Serially Transplant T-ALL. (A) Schema of T-ALL LIC mouse model. Equivalent numbers of human CD34⁺ and CD34^" cells derived from both NOTCH1 Mutated (_N0TCHl^Mutated and NOTCH1 wild-type (NOTCHl^) samples, as defined by DNA sequencing (Table SI), were immunomagnetic bead selected from TALL blood or marrow, transduced with lentiviral luciferase and transplanted (50,000 cells/mouse) intrahepatically into RAG2-/-yc-/- mice within 48 hours of birth. Engraftment was monitored over 10 weeks via non-invasive bioluminescent imaging system (IVIS 200). After 10 weeks, mice were sacrificed and secondary transplants were performed with 50,000 immunomagnetic bead selected human CD34⁺ or CD45⁺ cells from primary CD34⁺ and CD34^" T-ALL engrafted mouse marrow, respectively. (B) T-ALL CD34⁺ cells from 12 of 12 T-ALL samples engrafted leukemia to varying extents in the marrow, spleen and thymus in all primary but only 10 of 11 serial transplant recipients. Mice (n=76) transplanted with lentiviral luciferase transduced NOTCH l^m patient samples (Patients 4, 7, 9, 10) and mice (n=79) transplanted with _NOTCHl^Mutated patient samples (Patients 3, 5, 8, 11) were included in the bioluminescent imaging study. Representative bioluminescent images (IVIS 200) demonstrating engraftment of CD34⁺(50,000) NOTCHl^Mutated T-ALL (IB, upper) compared with an equivalent number of CD34^" cells (lb, lower). (C) Quantitative bioluminescent imaging (photons/second/cm2/sr) of CD34⁺ cell and CD34^" cell engraftment over 10 weeks following transplantation of ]\[Qj( ji^Mutated T-ALL samples (red) compared with NOTCHl^WT samples (blue) (error bars, mean + S.E.M. ** P = 0.0005, Student's litest). (D) Photographs depicting marrow, thymic and splenic infiltration following _NOTCHl^Mutated T-ALL CD34⁺ cell (upper panel) and CD34^" cell (middle panel) transplants compared with no transplant control mice (lower panel). (E) FACS analysis demonstrating human CD45⁺ and CD34⁺ leukemic engraftment in the marrow, spleen and thymus in primary transplant recipients of ^Q ( fj]^Mutated T-ALL CD34⁺ cells (CD34⁺ 1° TP, upper panel) and CD34^" cells (CD34^" 1° TP, middle panel) compared with no transplant control mice (lower panel). (F) FACS analysis demonstrating human CD34⁺CD45⁺ serial leukemic engraftment in the marrow (upper), spleen (middle) and thymus (lower) following transplantation of secondary recipients (2° TP) with 50,000 CD34⁺ cells isolated from NOTCHlMutated primary recipients.

[0042] Fig. 2 hNl mAb Treatment Inhibits NOTCHlMutated T-ALL LIC Burden. (A) Schema of T-ALL LIC mouse model treatment with a selective anti- NOTCH1-NRR (hNl) mAb. Within 10 to 12 weeks of _NOTCHl^Mutated T-ALL CD34⁺ (50,000) cell transplantation into post-natal day 2 RAG2-/-yc-/- mice, intraperitoneal treatment was instituted for 3.5 weeks with a NOTCH1 (hNl , 10 mg/kg every 4 days) mAb or control mAb for an average of 6 doses. Mice were sacrificed within one day of completion of dosing followed by further studies. (B) The average percentage of CD34+ engraftment was compared by FACS analysis in NOTCHl^Mutated patient sample (3, 5, 8, 11 ; n=21 mice) and NOTCHl^WT patient sample (4, 6, 9, 10; n=22 mice) T-ALL transplanted marrow and spleen (error bars + S.E.M.;*** P<0.0001, unequal variance Student's t-test), as well as thymus. (C) The average percentage of human CD34⁺ marrow T-ALL LIC burden (red, Patient 5; blue, Patient 8; green, Patient 11) in control mAb and hNl mAb (** P=0.003 by Wilcoxon test) treated mice was compared by FACS analysis. Marrow responses in mice transplanted with LIC from patients 5, 8 and 11 varied (Patient 5, P=0.8308; Patient 8, P=0.007; Patient 11, P=0.017, by Wilcoxon test). In addition to NOTCH1 activating mutations, patient 5 harbored both PTEN and PI3KR1 mutations and patient 11 had a PTEN frameshift mutation while patient 8 was wild- type at these loci (Table 1). (D) Average percentage of T-ALL CD34⁺ LIC burden in the spleen following control mAb and hNl treatment was also compared (*** P=0.001 by Wilcoxon test).

[0043] Fig. 3 hNl mAb Treatment Inhibits NOTCH l^Mutated LIC Survival. (A) Graph depicting average number of caspase 3 (red) and NOTCH 1 (blue) positive cells (mean + s.e.m.), measured by marrow immunohistochemistry (cell number/randomized 40X fields) following hNl versus control mAb treatment of LIC (Patient 8) engrafted mice (**P=0.005, *P=0.046, respectively by two tailed Student's t test with unequal variance). (B) Immunoperoxidase analysis of human NOTCH1, human CD45 and human Caspase 3 expression in no transplant control (left panel), compared with control mAb (middle panel) and hNl mAb (right panel) treated NOTCHl^Mutated LIC (Patient 8) engrafted mice. (C) Comparative FACS analysis human CD34⁺CD45⁺ cells and CD34⁺CD2⁺ leukemic burden the _NOTCHl^Mutated LIC (Patient 11) engrafted mice following treatment with control mAb (left panel) or hNl mAb (right panel). (D) FACS analysis of human CD34⁺ and NOTCHl⁺ cell survival in the marrow (upper panel) and spleen (lower panel) following control mAb or hNl mAb treatment of NOTCH i^Mutated LIC (Patient 11) engrafted mice.

[0044] Fig. 4. hNl mAb Treatment Inhibits NOTCH 1 Driven LIC Self- renewal. (A) Following hNl mAb treatment, immunoperoxidase staining of marrow sections was used to compare NOTCH1 intracellular domain (ICN1) expression (Patient 8) in control mAb (left) and hNl mAb (right) treated mice (40x magnification). (B) Quantitative RT21 PCR assessment of relative reduction in HPRT normalized HES1 (blue) and c-MYC transcript levels in human CD34⁺ cells derived from NOTCHlMutated LIC engrafted marrows (Patients 8, 11) following hNl mAb or control mAb treatment (P=0.08 and P=0.11 , respectively, Student's t-test). (C) Representative FACS analysis demonstrating engraftment of CD34⁺ and CD45⁺ cells in the marrow of secondary (2°) recipients following transplantation of control mAb (left panel) or hNl mAb (right panel) treated marrow (Patient 11). (D) Graph of percent human T-ALL CD34⁺CD45⁺ (red) and total CD45⁺ (blue) cells in marrows of 2° transplant recipients of control mAb (left panel) and hNl mAb (right panel) treated NOTCH1 driven LIC (Patients 2, 11) (error bars + s.e.m.; P=0.16, and P=0.086, respectively by Student's t-test). [0045] Fig. 5. Self-renewing LIC Activate N0TCH1. (A) Graph of mean thymic weight (grams, g) in primary (1°) and secondary (2°) T-ALL LIC transplant recipients compared with no transplant control mice (error bars + SEM, ** P <0.01, unequal variance two tailed Student's t test ). (B) Graph of mean splenic weight (g) in 1 ° and 2° T-ALL LIC transplant recipients compared with no transplant control mice (mean + SEM, *** P<0.001, unequal variance two-sided Student's t test). (C) Graph of mean HPRT normalized NOTCH 1. (D) HESl transcript levels in engrafted human CD34⁺ cells following transplantation of _NOTCHl^Mutated LIC patient samples (Patients 3, 5, 8, 11) compared with NOTCHl^WT T-ALL (Patient 9) (** P<0.01, unequal variance two-tailed Student's t test). Cord blood CD34⁺ cells served as a normal control.

[0046] Fig. 6 Enrichment of LIC in the CD45⁺CD34⁺CD2⁺ Population. (A) FACS analysis of pediatric T-ALL engrafted marrow revealed an expanded human CD45⁺CD34⁺CD2⁺ population in 2° transplant recipients that was more prominent in _NOTCHl^Mutated T-ALL (Patient 5, n=8; Patient 8, n=8; Patient 11, n=6; Patient 12, n=3) and NOTCHl^High TALL (Patient 2, n=10) transplanted mice than NOTCHl^WT T-ALL transplanted mice (Patient 9, n=4; Patient 10, n=3). Human cord blood CD34⁺ progenitors were used as a normal progenitor control (n=6). (B) Representative photographs of hematopoietic organs following intrahepatic transplantation of 1,000 FACS purified CD34⁺CD38⁺CD2⁺Lin^" cells from a NOTCHl^Hlgh T-ALL (Patient 2) sample demonstrate an enlarged thymus, spleen and pale marrows. (C) Graph of percent human CD34⁺CD45⁺ (red) cells (error bars + SEM, P=0.0019 by Student's t-test) and human CD45⁺CD34⁺CD2⁺ (blue) cell burden (error bars + SEM, P=0.003 by Student's t-test) in marrows (BM) following control mAb (10 mg/kg) or hNl mAb (10 mg/kg) treatment of mice transplanted with LIC from a xoTCHl^Mutated patient sample (Patient 11).

[0047] Fig. 7. Anti Notchl-NRR mAb specifically inhibits NOTCH1 receptor Signaling. (A) Human NOTCH 1 -negative regulatory region/Fc (Nl-NRR) or NOTCH2-NRR/Fc fusion protein (N2-NRR) expression plasmids were transiently transfected into Freestyle™ 293F cells (Invitrogen). The supernatants were coated in 96- well ELISA plates at 100 μΐ per well. Purified hNl mAb was added to the wells at the indicated concentrations. Graph of mean O.D. 450 value in ELISA binding assays demonstrates control mAb (blue) and anti-NOTCHl-NRR (hNl , red) mAb specificity for human NOTCH1 receptor versus NOTCH2 receptor ( human CD34⁺ cells + SEM). (B) NOTCH1 luciferase (NOTCHl+Luc) reporter assays utilized DLL4- coated plates. Graph depicts (blue bars) mean luciferase activity in BSA, DLL4, DLL4+control mAb and DLL4+hNl mAb treated wells (mean + SEM).

[0048] Fig. 8. hNl mAb treatment spares NOTCH 1^WT T-ALL (patient 4 and 10) Cells. Graph of percent human CD45⁺ cells (error bars + SEM) surviving in bone marrow (BM) of 50,000 CD34⁺ cell transplanted mice (n=6 in control group; n=5 in hNl mAb group) following intraperitoneal treatment with control mAb (10 mg/kg) or hNl mAb (10 mg/kg) every 4 days for 3.5 weeks. No significant difference in engraftment was seen between the two groups (P=0.08, Student's t test).

[0049] Fig. 9. hNl mAb Treatment Spares Normal Hematopoietic Progenitors. (A) Representative FACS plots of human CD34 and CD45 marrow engraftment in mice (n=6) transplanted with 50,000 normal human CD34⁺ cord blood cells and treated with control mAb or hNl mAb. (B) Graph of percent human CD45⁺ (blue) cells (error bars + SEM, P=0.16) and human CD34⁺CD45⁺ (red) cells (error bars + SEM., P=0.21) surviving in marrows of human cord blood CD34⁺ cell transplanted mice following intraperitoneal treatment with control mAb (10 mg/kg) or hNl mAb (10 mg/kg) every 4 days for 3.5 weeks.

[0050] Fig. 10. hNl mAb Treatment Inhibits NOTCHl^High LIC Self- renewal. (A), Graph of HPRT normalized Q-RT-PCR results demonstrating NOTCH1 transcript levels (blue bars) in normal cord blood CD34⁺ cells compared with engrafted T-ALL CD34⁺ cells from serially transplanted Patient 2 (NOTCHl^High LIC). (B) Graph of percent human CD34⁺ cell (red bars) engraftment determined by FACS analysis in marrow, spleen and thymus of 2° recipients of T-ALL NOTCHl^Hlgh LIC (2° Patient 2, Normalized NOTCH1, error bars + SEM). (C) Representative photographs depicting characteristics of serially transplanted marrow derived from control and hNl mAb treated mice. (D) FACS analysis demonstrating CD34⁺CD45⁺ LIC engraftment in marrow following serial transplantation of control mAb and hNl mAb treated NOTCHl^High LIC (Patient 2).

[0051] Fig 11. Enrichment of LSC in the CD45⁺CD34⁺CD2⁺ Population among T-ALL samples. (A) FACS analysis of pediatric T-ALL engrafted marrow revealed an expanded human CD45⁺CD34⁺CD2⁺ population in 2° transplant recipients that was more prominent in ]\[Qj( ji^Mutated T-ALL (patient 5, n=8; patient 8, n=8; patient 11, n=6; Patient 12, n=3) and NOTCHl^High T-ALL (patient 2, n=10) transplanted mice than NOTCH 1^WT T-ALL transplanted mice (patient 9, n=4; patient 10, n=3). Human cord blood CD34 progenitors were used as a normal progenitor control (n=6). (B) Representative photographs of hematopoietic organs following intrahepatic transplantation of 1 ,000 FACS purified CD34⁺CD38⁺CD2⁺Lin^" cells from a NOTCHl^Hlgh T-ALL patient 2 sample demonstrate an enlarged thymus, spleen and pale marrows. (C) Graph of percent human CD34⁺CD45⁺ (red) cells (error bars + SEM, P=0.0019 by Student's t-test) and human CD45⁺CD34⁺CD2⁺ (blue) cell burden (error bars + SEM, P=0.003 by Student's t-test) in marrows (BM) following control mAb (10 mg/kg) or Notchl mAb (10 mg/kg) treatment of mice transplanted with LSC from a NOTCHl^Mutated patient sample (patient 11).

[0052] Fig. 12. Enrichment of LSC in the CD45⁺CD34⁺CD2⁺ population sorted from T-ALL patient 5. 1 ,500 CD38⁺CD34⁺CD2⁺CD7⁺ Lin^" and CD38⁺CD34⁺CD2⁺CD7^"Lin^" cells were sorted with the aid of FACSAria from the T- ALL patient 5 and intrahepatically transplanted into Rag2^{" "}yc^{" "} neonatal mice. The transplanted mice were sacrificed 10-12 weeks after transplantation. (A) Pale bone marrow and enlarged spleen and thymus compared with no transplant control mouse (left panel). FACS analysis demonstrated that expended human progenitor cells (CD34⁺CD45⁺) in the transplanted mouse organ niches (bone marrow, spleen and thymus). (B) 50, 000 mouse bone marrow cells derived from both CD38⁺CD34⁺CD2⁺CD7⁺Lin^" and CD38⁺CD34⁺CD2⁺CD7^"Lin^" primary transplanted mice were used for serial transplantation. Pale bone marrows from were observed while compared with no transplant control. (C) Enlarged thymus and spleen were also observed from the serial transplanted mice. FACS analysis showed that human cells including small fraction of human progenitor CD34⁺CD45⁺ cells engrafted in thymus and spleen.

[0053] Fig. 13 Primary engraftment in mouse organs of LSC in the CD45⁺CD34⁺CD2⁺ population sorted from T-ALL patient 3. 1 ,000 CD38⁺CD34⁺CD2⁺CD7^"Lin^" cells were sorted with the aid of FACSAria from the T- ALL patient 3 and intrahepatically transplanted into Rag 2 ^{_ ~} jc^~'^~ neonatal mice. (A) Pale bone marrow and enlarged thymus and spleen. (B) FACS results demonstrate a very small fraction engraftment of LSC in T-ALL patient 3 transplanted mouse (1.35% in mouse bone marrow niche, 0.77% in mouse thymus and 0.79% in mouse spleen). Among the LSC in mouse bone marrow, 53.6% is CD34⁺CD2⁺CD7^" cells. (C) Secondary transplantation of 100K BM cells derived from the primary transplant of 1000 CD34⁺CD2⁺CD7^" cells sorted from patient 3. (D-F) Tertiary transplantation of 100K BM cells isolated from the secondary transplanted mouse. The characteristics of the serial transplanted mice have the enlarged spleen and thymus as well as the pale bone marrow.

[0054] Fig. 14. Human CD45⁺CD34⁺ cells infiltration was found in ventricle area of the tertiary transplanted mouse brain. 30,000 CD38⁺CD34⁺CD2⁺CD7⁺ Lin^" cells sorted with the aid of FACSAria from the T-ALL patient 11 were intrahepatically transplanted into Rag2^{~ ~}yc^{~ ~} neonatal mice on 7/20/2011. Serial transplantation including secondary and tertiary transplantations was done on 5/2/2011. The mouse brain was fixed and sectioned for immunofluorescent staining on 5/15/2011. Immunofluorescent staining was carried out by using human CD45-Alexa594 and CD34-APC. Blue stained is nuclear, green staining is human CD45 cells, and Red staining is human CD34 cells. (A) lOOx mouse image under the confocal microscope (Fluoview, FVlOi, Olympus), area within blue square is mouse ventricle. (B) lOOx H & E staining of the ventricle; (C) 200x H & E staining of the ventricle (tertiary transplanted mouse of 30K CD34⁺CD38⁺CD2⁺CD7⁺Lin^" sorted from T-ALL patient 11, slide 95); (D) 600x DAPI channel only of the ventricle area under the confocal microscope; (E) 600x Alexa594 channel only of the ventricle area under the confocal microscope; (F) 600x APC channel only of the ventricle area under the confocal microscope; (G) 600x merged DAPI, Alexa594 and APC channels of the ventricle area under the confocal microscope.

[0055] Fig. 15. Lentiviral shRNA-mediated knockdown of NOTCH 1 and its downstream genes in T-ALL. 100,000 human CD34⁺ cells selected from T-ALL patients samples (patient 2 and 5) and identical number of normal CD34⁺ cells (Cord Blood) were transduced with lentiviral Notchl-shRNA at the MOI of 60, respectively. These cells were harvested for RNA isolation and q-RT-PCR after 48 hours of transduction. NOTCH 1 and its down- stream genes including He si and C-myc were measured by q-RT-PCR. NOTCH 1, Hesl and C-myc genes were dramatically inhibited after treating with NOTCH1 -shRNA. (A) Normalized NOTCH1 level. (B) Normalized Hes 1 ; (C) Normalized C-myc.

[0056] Fig. 16 ii l mAb treatment inhibits NOTCH l^M,:iiited LiC burden. (A) Comparative FACS analysis of human CD34⁺CD45⁺ cells and CD34^"TD2⁺ leukemic burden in the bone marrows from NOTCH i ^ulatedLIC (Patient 1 1) engrafted mice following treatment with control mAb (left panel) or hNl mAb (right panel). (B) FACS analysis of human CD34⁺ and NOTCHl⁺ cell survival in the mouse spleens following control mAb (n = 9) or h l mAb treatment (n = 9) of NOTCH 1 ^M,jEatcd LIC (Patients 05, 08, 11 ) engrafted mice (upper panel). Representative FACS plots show the reduction in both CD34 ^V and NOTCHl ⁺ cell populations. (C) Representative FACS analysis demonstrating engraftment of CD34^'*'CD45⁺ ceils in the bone marrows of secondary (2°) transplant recipients following transplantation of control mAb (left panel) or h.\ I mAb (right panel) treated bone marrow (Patient 11). (D) Graph of percent human T-ALL total CD45^÷ (blue) and CD34⁺CD45^÷ (red) ceils in the bone marrows of 2° transplant recipients of control mAb (n ^~ 6) and hNl mAb (n ^~ 6) treated NOTCH 1 -driven LIC (Patients 02, 11) (error bars ± SEM; P _^ 0.16, and P = 0.086, respectively, by Student's t-test). Ail results reflect data collected from two independent experiments.

[0057] Fig. 17 An expanded CD45⁺CD34⁺CD2⁺CD7^÷population in NOTCHl^Mutaled T-ALL LIC is sensitive to hNl mAb treatment. (A) Total human CD45⁺ cells including CD34¾D45⁺and CD34^"CD45⁺ i secondary (2°) transplant recipients were summarized by graphing the results of CD45 FACS analysis. Human cord blood CD34~progenitors were used as a normal progenitor control, where the engraftment of human CD45⁺cells in bone marrow was 7.13% ±1.3 (n - 6). (B) FACS analysis of pediatric T-ALL engrafted bone marrows revealed an expanded human CD45^';'CD34⁺CD2⁺CD7⁺ population in secondary (2°) transplant recipients that was more prominent in NOTCH l^Mutetod T-ALL (Patient 05, n - 9; Patient 08, n - 8; Patient 1 1, n - 8; Patient 12, n - 3) and NOTCH1 ^High T-ALL (Patient 02, n - 10) transplanted mice than NOTCH 1 ^WT T-ALL transplanted mice (Patient 09, n == 4; Patient 10, n = 3). Human cord blood CD34'^' progenitors were used as a normal progenitor control (n = 6). The CD34^÷CD45⁺, CD34⁺CD45⁺CD2⁺CD7^÷, and

CD34~CD45⁺CD2⁺CD7^~ populations were s gnificantly higher in the bone marrows of both NOTCHl^Mttiated and NOTCH l^High T-ALL LIC transplanted mice (**, P<0.01 ; ***, P<0.001, Student's t test) when compared with NOTCH 1^WT T-ALL LIC transplanted mice. (C) FACS analysis of pediatric T-ALL LIC" (Patient 05, n - 5 in control group, n = 6 in hNl group; Patient 08, n = 5 in control group, n = 6 in hNl group; Patient 11, n = 4 in control group, n = 5 in hNl group) engrafted bone marrows showing a reduction in the human CD45⁺CD34⁺CD2^"t~CD7⁺ cell population following hNl mAb treatment compared to control IgGI mAb (***, P<0.001, Student's t test). [0058] Fig. 18 Leukemia regenerative capacity of the CD45^÷CD34⁺CD2⁺CD7⁺ population, (A) Representative photographs of hematopoietic organs following intrahepatic transplantation of 1 500 FAGS purified CD34¾D2¾.D7⁺Lin^~ cells from a NOTCH.l^Muiated T-ALL (Patient 05) sample demonstrates serial transplantation potential of this refined L1C population, as shown by the presence of an enlarged thymus, spleen and pale marrows over several transplantation generations. (B, €) FACS analysis of the tertiary (3°) transplant recipients of 30000 CD34⁺CD2⁺CD7lin^~ cells sorted .from a NOTCH1 ^{Mui ed} T-ALL (Patient 11) revealed the persistence of an expanded human CD45 !⁾34⁺CD2^÷ (including CD7⁺ and CD7^~) population in the transplanted mouse hematopoietic organs (bone marrow, spleen, thymus and liver).

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0059]

[0060]

[0061] The present disclosure relates to methods for diagnosing and treating malignancies associated with activating mutations of NOTCH! or overexpression of wild-type NOTCH!.

[0062] The disclosure also relates to diagnostics and therapy for oncogenic stems cells, such as leukemic initiating cells (LIC) associated with malignancies with activation mutations of NOTCH 1 and/or overexpression of wild-type NOTCH!. Such stem cells are associated with relapse and resistance to cancer therapy.

[0063] Disclosed herein are bioluminescent humanized T-ALL LIC mouse models which were established by intrahepatically transplanting lentiviral luciferase transduced cells from primarily pediatric T-ALL patients into neonatal immune deficient (RAG2-/-yc-/-) mice.

[0064] The therapies and diagnostics claimed herein are based on the finding that the CD34⁺ fraction of NOTCHl^{M Med} T-ALL samples had enhanced survival and self-renewal potential, characteristic of leukemia initiating cells (LIC), compared with their CD34⁴ NOTCH 1 wild-type (NOTCHl ^W!) counterparts. These NOTCH ] ^Ml"^ated LIC were found to be uniquely susceptible to targeted inhibition with a therapeutic human NOTCH 1 monoclonal antibody (hNI mAb) selective for the negative regulatory region (NRR) of the NOTCH! receptor, while normal hematopoietic progenitors were spared thereby highlighting the cell type and context specific effects of NOTCHl signaling [13], and the importance of oncogenic addiction to NOTCHl signaling in T-ALL LIC maintenance.

[0065] Leukemia initiating cells (LICs), also called leukemia stem cells (LSCs), contribute to therapeutic resistance as a result of their capacity to accumulate mutations in pathways, such as the NOTCHl receptor signaling pathway, that promote self-renewal and survival within specific niches. Activating mutations in NOTCHl occur commonly in T-ALL and have been implicated in driving therapeutic resistance. The data disclosed herein demonstrates that NOTCHl mAb treatment inhibits NOTCHl^Mutated T-ALL LIC burden, survival and NOTCHl -driven LIC self- renewal.

[0066] A novel monoclonal antibody (mAb) was developed from the negative regulatory region (NRR) of the NOTCHl extracellular domain. This NOTCHl mAb specifically inhibits NOTCHl receptor signaling (See Fig. 7).

[0067] Primary T-ALL patients' blood or bone marrow samples were used to establish humanized T-ALL LIC mouse models. Humanized T-ALL LIC mouse models were established by intrahepatic ally transplanting 50,000 CD34⁺ cells isolated from primarily pediatric T-ALL patients into neonatal immune deficient (RAG2-/-yc- /-) mice. The T-ALL LIC mouse models were dosed at 8 weeks after transplantation with either NOTCHl mAb or IgGl mAb control at 10 mg/kg intraperitoneally every 4 days for an average of 6 doses.

[0068] To test whether NOTCHl mAb could eliminate LIC in humanized T-ALL mouse models, mice were sacrificed one day after the last dose and bone marrow (BM), spleen, thymus and liver were collected for FACS analysis of human CD45, CD34, CD2, and NOTCHl expression. Immunohistochemistry analysis was performed to examine NOTCHl , CD45, activated caspase 3, as well as NOTCH intracellular domain (ICNl) expression in BM sections, following treatment with either control IgGl mAb or NOTCHl mAb. As disclosed herein the results revealed the following information:

(1) NOTCHl mAb treatment inhibits NOTCHlMutated T-ALL LIC burden (Figs. 2 A, 2B; Figs. 7A and 7B; Figs. 2C, 2D).

(2) NOTCHl mAb treatment inhibits NOTCHl^Mutated LIC survival: Following NOTCHl mAb treatment, a marked increase in levels of activated caspase 3 was observed (Fig. 3A), as well as a reduction in human NOTCH1 expression (Figs. 3B, 3C, and 3D).

(3) NOTCH 1 mAb treatment inhibits NOTCH 1 -driven LIC self-renewal. Treatment of T-ALL with the NOTCH 1 mAb was associated with a reduction in marrow ICN1 levels (Fig. 4A) and HES1 transcript levels (Fig. 4B).

[0069] Analysis of primary T-ALL engrafted mouse tissues indicated the enrichment of LSC in CD45⁺CD34⁺CD2⁺ population in all the _NOTCHl^Mutated T-ALL (T-ALL patients 5, 8, 11 , 12) and NOTCHl^High T-ALL patients (Fig. 11 A). 1500 CD34⁺CD2⁺CD7⁺Lin^" and CD34⁺CD2⁺CD7^"Lin^" cells isolated from T-ALL patient 5 can be serially transplanted (Fig. 12). 1000 CD45⁺CD34⁺CD2⁺CD7^~Lin^~ cells selected from a T-ALL patient (patient 3) were successfully transplanted and showed the same characteristics of pale BM, enlarged thymus and spleen (Fig. 13). Brain sections from a mouse that received a tertiary transplant of 30K CD45+CD34⁺CD2⁺ cells isolated from a T-ALL (patient 11) were stained with human CD45-Alexa594 and CD34-APC antibodies and human cells were found in the transplanted mouse brain (Fig. 14).

[0070] NOTCH1 monoclonal antibody which targets the NOTCH1 signaling pathway can significantly reduce the LSC burden of CD45⁺CD34⁺CD2⁺ cells (Fig. 11C). NOTCH 1 shRNA inhibits NOTCH 1 and expression of downstream target genes (Hesl and C-myc) (Fig. 15).

[0071] We thought LSC in T-ALL must be characterized by some early T cell markers based on progenitor markers, so our primary hypothesis for the T-ALL LSC were that they could be comprised of CD34⁺CD38⁺CD2⁺CD3⁺CD4^"CD7⁺Lin^" or CD34⁺CD38⁺CD2⁺CD3⁺CD4^"CD7^"Lin^" populations of cells. FACS data demonstrated that CD45⁺CD34⁺CD2⁺ CD7⁺cells and CD45⁺CD34⁺CD2⁺ CD7^"cells were enriched in bone marrow from mice that received primary xenografts from _NOTCHl^Mutated (patients 5, 8, 11, 12) and NOTCHl^Hgh (patient 2) T-ALL patients.

[0072] The putative LSC populations from T-ALL patient samples (patients 2, 3, 5, 8, 11) were sorted using the FACSAria, and transplanted into the immune-compromised neonatal Rag2^{~ ~}yc^{~ ~} mice. The engrafted mouse organs showed that our hypothesized LSC could be serially transplanted with a cell number of 1000.

[0073] These potential LSC populations in T-ALL could be used to establish LSC-based animal models of T-ALL, and screen candidate novel drugs, which act via the NOTCH 1 signaling pathway. These findings underscore the therapeutic potential of selective NOTCH 1 therapies targeting in the eradication of T- ALL LSC and set the stage for cancer stem cell elimination in other NOTCH1 -driven malignancies such as colorectal cancer, ovarian cancer and breast cancer, among others.

[0074] An embodiment based on the findings disclosed herein are methods for treating, to prevent or ameliorate relapse and/or therapeutic resistance in a NOTCH 1 -driven malignancy associated with an activating mutation of NOTCH 1 or overexpression of wild-type NOTCH1 in a subject comprising administering a therapeutically effective amount of a composition that inhibits the expression of a NOTCH 1 gene or gene product, or a NOTCH 1 transcript (message, or mRNA); or decreases the amount of, or activity of, or production of, a NOTCH 1 polypeptide.

[0075] Terms such as "treating" or "treatment" or "to treat" or "alleviating" or "to alleviate" or to "ameliorate" refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent and/or slow the development of a targeted pathologic condition or disorder. Thus those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented. A subject is successfully "treated" according to the methods of the present invention if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including, for example, the spread of cancer into soft tissue and bone; inhibition of or an absence of tumor metastasis; inhibition or an absence of tumor growth; a reduction or elimination of cancer stem cells, reduction of stem cell renewal, reduction of stem cell burden, relief of one or more symptoms associated with the specific cancer; reduced morbidity and mortality; improvement in quality of life; or some combination of effects. Treatment need not result in a complete cure of the condition; partial inhibition or reduction of the condition being treated is encompassed by this term.

[0076] "Therapeutically effective amount," or "therapeutic effect," as used herein, refers to a minimal amount or concentration of an agent, composition, compound and/or drug that, when administered alone or in combination, is sufficient to provide a therapeutic benefit in the treatment of the condition, or to delay or minimize one or more symptoms associated with the condition. The term "therapeutically effective amount" can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the condition, or enhances the therapeutic efficacy of another therapeutic agent. The therapeutic amount need not result in a complete cure of the condition; partial inhibition or reduction of the malignancy being treated is encompassed by this term.

[0077] In some embodiments, the agent, composition, or compound prevents the condition or can be used at prophylactically effective amount.

[0078] As used herein, unless otherwise specified, the terms 'prevent," "preventing" and "prevention" refers to an action that occurs before the subject begins to suffer from the condition, or relapse of such condition. The prevention need not result in a complete prevention of the condition. Partial prevention or reduction of the malignancy being treated is encompassed by this term.

[0079] As used herein, the term "subject" refers to an animal, typically a human (i.e., a male or female of any age group, e.g., a pediatric patient (e.g., infant, child, adolescent) or adult patient (e.g., young adult, middle-aged adult or senior adult) or other mammal, such as a primate (e.g., cynomolgus monkey, rhesus monkey); other mammals such as rodents (mice, rats), cattle, pigs, horses, sheep, goats, cats, dogs; and/or birds, that will be or has been the object of treatment, observation, and/or experiment. When the term is used in conjunction with administration of an, agent, composition, compound or drug, then the patient has been the object of treatment, observation, and/or administration of the composition, compound or drug.

[0080] Another embodiment disclosed herein are methods for reducing or significantly reducing the amount of or reducing the burden of leukemic stem cells (LSC), or a T-ALL LSC subpopulation, comprising: inhibiting the expression of a NOTCH 1 gene or gene product, or a NOTCH 1 transcript (message, or mRNA); or decreasing the amount of, or activity of, or production of, a NOTCH 1 polypeptide.

• The term "or" is used herein to mean, and is used interchangeably with, the term "and/or", unless context clearly indicates otherwise.

[0081] As used herein, the terms "compositions," "drug," "agent," "compound," and "therapeutic agent" are used interchangeably, and may include, without limitation, small molecule compounds, biologies (e.g., antibodies, proteins, protein fragments, fusion proteins, glycoproteins, etc.), nucleic acid agents (e.g., antisense, RNAi/siRNA, and microRNA molecules, etc.), vaccines, etc., which may be used for therapeutic and/or preventive treatment of a disease (e.g., malignancy).

[0082] "About" and "approximately" shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent ( ), typically, within 10%, and more typically, within 5% of a given value or range of values.

Treatment of NOTCH 1 -driven malignancies

[0083] The disclosure herein supports treatment of NOTCH 1 -driven malignancies with compositions that inhibit or reduce the biological activity of NOTCH1, i.e., inhibit or decrease the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH1 protein. Moreover, the data disclosed herein indicate that compositions that inhibit or reduce the biological activity of NOTCH1 can also be used to target cancer stem cells associated with NOTCHl-driven malignancies. Such treatment involves determining if a malignancy is NOTCHl-driven through an activation mutation of NOTCH 1 or overexpressed wild-type NOTCH1 (NOTCHl^Hlgh). Determination of whether a malignancy has an activating NOTCH1 mutation or overexpression of wild-type NOTCH 1 can be determined as disclosed herein or by other means known in the art (see, for example, Materials and Methods section).

[0084] In some embodiments, the NOTCHl-driven malignancy to be treated is a hematological cancer, such as T-ALL. Hematological cancers that are NOTCHl-driven can be treated using a composition that inhibits or decreases the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH 1 protein.

[0085] In another embodiment, cancers, such as hematological cancers that are determined to have cells that are CD45⁺CD34⁺CD2⁺ CD7⁺or CD7^" in a NOTCH1 activating mutation background or overexpressed wild-type NOTCH1 background can be treated using a composition that inhibits or decreases the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH 1 protein.

[0086] In still another embodiment stem cells or stem cell initiating cells which are CD45⁺CD34⁺CD2⁺ CD7⁺or CD7^" in a NOTCH1 activating mutation background can be killed, reduced or inhibited by administration of a composition that inhibits or decreases the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, or activity or expression of the NOTCH 1 polypeptide to a subject in need of treatment. Such treatment can be used to prevent relapse or the development of therapy resistance.

[0087] In another embodiment, the anti-NOTCHl composition can be administered after a bone marrow transplant in a subject with a NOTCH 1 -driven malignancy to kill, inhibit and/or reduce any rouge LIC. Such LIC may have the biomarkers CD45⁺CD34⁺CD2⁺.

[0088] In still another embodiment, successful treatment of a malignancy associated with a NOTCH1 activating mutation can be gaged by determining the amount of reduction of LIC having biomarkers CD45⁺CD34⁺CD2⁺.

Combination Therapies

[0089] Once it is determined that a malignancy is NOTCH 1 -driven and/or is associated with tumor cells that are CD45⁺CD34⁺CD2⁺ in a NOTCH1 activating mutation background, agents that inhibit or decrease the expression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, or activity or expression of the NOTCH 1 polypeptide can be given "in combination with" one or more therapeutic agents, for example, with a clinically employed chemotherapeutic regimen used for treating the specific cancer in the subject needing treatment. Clinically employed regimens would include regimens known to those of skill in the art, such as physicians specialized in the treatment of malignancies. Examples of clinically employed regimens can be found, without limitation, at the National Comprehensive Cancer Network (www.ncn.org) or at Monthly Prescribing Reference (www.empr.com/cancer -treatment-regimens/section/2112/).

[0090] By "in combination with," it is not intended to imply that the therapeutic agent and agent or compound must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope of the invention. The agent or compound can be administered concurrently with, prior to, or subsequent to, one or more other additional agents. In general, each therapeutic agent will be administered at a dose and/or on a time schedule determined for that particular agent. It will further be appreciated that the therapeutic agent utilized in this combination can be administered together in a single composition or administered separately in different compositions. Thus, compositions that inhibit or decrease the expression of a NOTCH1 gene, a NOTCH1 gene product, a NOTCH1 transcript, and/or a NOTCH 1 polypeptide and/or inhibit or decrease the biological activity of NOTCH 1 can be used in combination with one or more additional drugs such as described below. The dose of the additional drug or drugs can be appropriately selected based on a clinically employed dose. The proportion of the compound of the present invention and additional drug(s) can be appropriately determined based on the subject receiving the therapy, the administration route, the target disease, the clinical condition, the combination, and other factors.

[0091] Compositions that inhibit or decrease the expression of a NOTCH1 gene, a NOTCH1 gene product, a NOTCH1 transcript, and/or a NOTCH1 polypeptide and the additional pharmaceutically active drug(s) may be administered concurrently in a unitary pharmaceutical composition or separately and, when administered separately this may occur simultaneously or sequentially in any order. Such sequential administration may be close in time or remote in time. The anti-NOTCHl compositions and the second drug(s) and the relative timings of administration will be selected in order to achieve the desired combined therapeutic effect.

[0092] In some embodiments, the anti-NOTCHl compositions will be administered alone or in combination with other drugs to kill, inhibit, and reduce stem cells associated with the malignancy being treated. The anti-NOTCHl compositions can be given concurrently, prior to, and/or subsequently to other cancer drugs to kill, inhibit, and/or reduce stem cells associated with the malignancy being treated. In some instances, the anti-NOTCHl compositions will be used as a maintenance dose- such a dose could be given, without limitation, about 1-3 per week, or about 1-8 times a month for as long as needed as determined by a physician.

[0093] The combination therapy may provide "synergy" and prove "synergistic", i.e., the effect achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately. A synergistic effect may be attained when the active ingredients are: (1) co- formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by some other regimen. When delivered in alternation therapy, a synergistic effect may be attained when the compounds are administered or delivered sequentially, e.g., by different injections in separate syringes. In general, during alternation therapy, an effective dosage of each active ingredient is administered sequentially, i.e., serially, whereas in combination therapy effective dosages of two or more active ingredients are administered together.

[0094] A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer regardless of mechanism of action. Chemotherapeutic agents include compounds used in "targeted therapy" and conventional chemotherapy.

[0095] Examples of chemotherapeutic agents include Erlotinib (TARCEVA®., Genentech/OSI Pharm.), Bortezomib (VELCADE®., Millennium Pharm.), Fulvestrant (FASLODEX®., AstraZeneca), Sutent (SU11248, Pfizer), Letrozole (FEMARA®., Novartis), Imatinib mesylate (GLEEVEC®., Novartis), PTK787/ZK 222584 (Novartis), Oxaliplatin (Eloxatin ®., Sanofi), 5-FU (5- fluorouracil), Leucovorin, Rapamycin (Sirolimus, RAPAMUNE®., Wyeth), Lapatinib (TYKERB®., GSK572016, Glaxo Smith Kline), Lonafarnib (SCH 66336), Sorafenib (BAY43-9006, Bayer Labs), Irinotecan (CAMPTOSAR®, Pfizer) and Gefitinib (IRESSA®, AstraZeneca), AG1478, AG1571 (SU 5271 ; Sugen), alkylating agents such as thiotepa and CYTOXAN® cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analog topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogs); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogs, KW-2189 and CB 1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, chlorophosphamide, estramustine, bendamustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall (Angew Chem. Intl. Ed. Engl. (1994) 33: 183-186); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® (doxorubicin), morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6- azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PS K®poly saccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., TAXOL® (paclitaxel; Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE™. (Cremophor-free), albumin-engineered nanoparticle formulations of paclitaxel (American Pharmaceutical Partners, Schaumberg, 111.), and TAXOTERE® (doxetaxel; Rhone-Poulenc Rorer, Antony, France); chloranmbucil; GEMZAR® (gemcitabine); 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® (vinorelbine); novantrone; teniposide; edatrexate; daunomycin; aminopterin; capecitabine (XELODA®); ibandronate; CPT- 11; topoisomerase inhibitor RFS 2000; difluoromethylorni thine (DMFO); retinoids such as retinoic acid; and pharmaceutically acceptable salts, acids and derivatives of any of the above

[0096] Also included in the definition of "chemotherapeutic agent" are: (i) anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX®; tamoxifen citrate), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LYl 17018, onapristone, and FARESTON® (toremifine citrate); (ii) aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, MEGASE® (megestrol acetate), AROMASIN® (exemestane; Pfizer), formestanie, fadrozole, RIVISOR® (vorozole), FEMARA® (letrozole; Novartis), and ARIMIDEX® (anastrozole; AstraZeneca); (iii) anti- androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); (iv) protein kinase inhibitors; (v) lipid kinase inhibitors; (vi) antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; (vii) ribozymes such as VEGF expression inhibitors (e.g., ANGIOZYME®) and HER2 expression inhibitors; (viii) vaccines such as gene therapy vaccines, for example, ALLOVECTIN®, LEUVECTIN®, and VAXID®; PROLEUKIN® rIL-2; a topoisomerase 1 inhibitor such as LURTOTECAN®; ABARELIX® rmRH; (ix) anti- angiogenic agents such as bevacizumab (AVASTIN®, Genentech); and (x) pharmaceutically acceptable salts, acids and derivatives of any of the above.

[0097] Also included in the definition of "chemotherapeutic agent" are therapeutic antibodies such as alemtuzumab (Campath), bevacizumab (AVASTIN®, Genentech); cetuximab (ERBITUX®, Imclone); panitumumab (VECTIBIX®, Amgen), rituximab (RITUXAN®, Genentech/Biogen Idee), pertuzumab (OMNITARG®, 2C4, Genentech), trastuzumab (HERCEPTIN®, Genentech), tositumomab (Bexxar, Corixia), and the antibody drug conjugate, gemtuzumab ozogamicin (MYLOTARG®, Wyeth).

[0098] Humanized monoclonal antibodies with therapeutic potential as chemotherapeutic agents in combination with the anti-NOTCHl compositions include: alemtuzumab, apolizumab, aselizumab, atlizumab, bapineuzumab, bevacizumab, bivatuzumab mertansine, cantuzumab mertansine, cedelizumab, certolizumab pegol, cidfusituzumab, cidtuzumab, daclizumab, eculizumab, efalizumab, epratuzumab, erlizumab, felvizumab, fontolizumab, gemtuzumab ozogamicin, inotuzumab ozogamicin, ipilimumab, labetuzumab, lintuzumab, matuzumab, mepolizumab, motavizumab, motovizumab, natalizumab, nimotuzumab, nolovizumab, numavizumab, ocrelizumab, omalizumab, palivizumab, pascolizumab, pecfusituzumab, pectuzumab, pertuzumab, pexelizumab, ralivizumab, ranibizumab, reslivizumab, reslizumab, resyvizumab, rovelizumab, ruplizumab, sibrotuzumab, siplizumab, sontuzumab, tacatuzumab tetraxetan, tadocizumab, talizumab, tefibazumab, tocilizumab, toralizumab, trastuzumab, tucotuzumab celmoleukin, tucusituzumab, umavizumab, urtoxazumab, and visilizumab.

[0099] Also considered a combination therapy is the administration of the NOTCH 1 compositions in combination with radiation treatments and radioactively labeled cancer agents.

[00100] Steroids used alone or in combination with a clinically employed cancer regimen are also considered drugs that can be combined with the NOTCH 1 compositions to treat, prevent or ameliorate NOTCH 1 -driven malignancies and/or to kill, inhibit and/or reduce cancer stem cells associated with the malignancy being treated

[00101] A clinically employed regimen for acute lymphoblastic leukemia (ALL) and T-ALL can include, without limitation, treatment based on the Dana- Farber protocol which includes therapy with doxorubicin, vincristine, corticosteroid, mercaptopurine and weekly high-dose asparaginase, and cranial radiation. Another clinically employed regimen for ALL includes high dose methotrexate added to the Dana Farber protocol. Thus, a composition that inhibits or decreases the expression of a NOTCH1 gene, a NOTCH1 gene product, a NOTCH1 transcript, and/or a NOTCH 1 polypeptide can be combined with a clinically employed regimen for the treatment of ALL or T-ALL. The composition that inhibits or decreases NOTCH1 expression or activity can be given concurrently, prior, and/or subsequently to the clinical regimen.

[00102] The anti-NOTCHl composition can be used as maintenance dose to prevent relapse and to ensure the killing, reduction or inhibition of stem cells associated with a malignancy.

Diagnostics [00103] In alternative embodiments, biomarkers of the invention can be detected using arrays, microarrays, proteomic arrays and the like, e.g., as described by: Oehler, et al., (2009) Blood, "The derivation of diagnostic markers of chronic myeloid leukemia progression from microarray data", Oct 8; 114(15):3292-8. Epub 2009 Aug 4; Fan, et al., Nature Medicine, May 2009, "Nanofluidic proteomic assay for serial analysis of oncoprotein activation in clinical specimens," Volume 15, Number 5: 566-571 ; O'Neill, et al., Proc. Natl. Acad. Sci. USA, Oct 2006, "Isoelectric focusing technology quantifies protein signaling in 25 cells", Volume 103, Number 44: 16153-16158.

Antisense inhibitory nucleic acid molecules

[00104] In alternative embodiments, the invention provides compositions and methods for: treating, preventing or ameliorating a NOTCH 1 -driven malignancy such as colorectal cancer, ovarian cancer and breast cancer, etc., and for reducing the amount of or reducing the burden of leukemic stem cells, or an T-ALL LSC subpopulation, comprising: (a) inhibiting the expression of a NOTCH1 gene or gene product, or a NOTCH1 transcript (message, or mRNA); or (b) decreasing the amount of, or activity of, or production of, a NOTCH 1 polypeptide.

[00105] In alternative embodiments, compositions and methods of the invention comprise use of an inhibitory nucleic acid molecule or an antisense oligonucleotide inhibitory to expression of the NOTCH1 or a NOTCH1 gene transcript. In alternative embodiments, compositions and methods of the invention comprise use of an inhibitory nucleic acid molecule or antisense oligonucleotide inhibitory to expression of the NOTCH 1 gene or NOTCH 1 gene transcript comprises: an RNAi inhibitory nucleic acid molecule, a double-stranded RNA (dsRNA) molecule, a small interfering RNA (siRNA), a microRNA (miRNA) and/or a short hairpin RNA (shRNA), or a ribozyme.

[00106] Naturally occurring or synthetic nucleic acids can be used as antisense oligonucleotides. The antisense oligonucleotides can be of any length; for example, in alternative aspects, the antisense oligonucleotides are between about 5 to 100, about 10 to 80, about 15 to 60, about 18 to 40. The optimal length can be determined by routine screening. The antisense oligonucleotides can be present at any concentration. The optimal concentration can be determined by routine screening. A wide variety of synthetic, non-naturally occurring nucleotide and nucleic acid analogues are known which can address this potential problem. For example, peptide nucleic acids (PNAs) containing non-ionic backbones, such as N-(2- aminoethyl) glycine units can be used. Antisense oligonucleotides having phosphorothioate linkages can also be used, as described in WO 97/03211 ; WO 96/39154; Mata (1997) Toxicol. Appl. Pharmacol. 144: 189-197; Antisense Therapeutics, ed. Agrawal (Humana Press, Totowa, N.J., 1996). Antisense oligonucleotides having synthetic DNA backbone analogues provided by the invention can also include phosphoro-dithioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate, and morpholino carbamate nucleic acids.

RNA interference (RNAi)

[00107] In one aspect, the invention provides RNAi inhibitory nucleic acid molecules capable of decreasing or inhibiting expression of one or a set of NOTCH1 transcripts or proteins, e.g., the transcript (mRNA, message) or isoform or isoforms thereof. In one aspect, the RNAi molecule comprises a double- stranded RNA (dsRNA) molecule. The RNAi molecule can comprise a double- stranded RNA (dsRNA) molecule, e.g., siRNA, miRNA (microRNA) and/or short hairpin RNA (shRNA) molecules.

[00108] In alternative aspects, the RNAi is about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length. While the invention is not limited by any particular mechanism of action, the RNAi can enter a cell and cause the degradation of a single- stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to double-stranded RNA (dsRNA), mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi). A possible basic mechanism behind RNAi, e.g., siRNA for inhibiting transcription and/or miRNA to inhibit translation, is the breaking of a double-stranded RNA (dsRNA) matching a specific gene sequence into short pieces called short interfering RNA, which trigger the degradation of mRNA that matches its sequence.

[00109] In one aspect, intracellular introduction of the RNAi (e.g., miRNA or siRNA) is by internalization of a target cell specific ligand bonded to an RNA binding protein comprising an RNAi (e.g., microRNA) is adsorbed. The ligand can be specific to a unique target cell surface antigen. The ligand can be spontaneously internalized after binding to the cell surface antigen. If the unique cell surface antigen is not naturally internalized after binding to its ligand, internalization can be promoted by the incorporation of an arginine-rich peptide, or other membrane permeable peptide, into the structure of the ligand or RNA binding protein or attachment of such a peptide to the ligand or RNA binding protein. See, e.g., U.S. Patent App. Pub. Nos. 20060030003; 20060025361 ; 20060019286; 20060019258. In one aspect, the invention provides lipid-based formulations for delivering, e.g., introducing nucleic acids of the invention as nucleic acid-lipid particles comprising an RNAi molecule to a cell, see .g., U.S. Patent App. Pub. No. 20060008910.

[00110] Methods for making and using RNAi molecules, e.g., siRNA and/or miRNA, for selectively degrade RNA are well known in the art, see, e.g., U.S. Patent No. 6,506,559; 6,511,824; 6,515,109; 6,489,127.

[00111] Methods for making expression constructs, e.g., vectors or plasmids, from which an inhibitory polynucleotide (e.g., a duplex siRNA of the invention) is transcribed are well known and routine. A regulatory region (e.g., promoter, enhancer, silencer, splice donor, acceptor, etc.) can be used to transcribe an RNA strand or RNA strands of an inhibitory polynucleotide from an expression construct. When making a duplex siRNA inhibitory molecule, the sense and antisense strands of the targeted portion of the targeted IRES can be transcribed as two separate RNA strands that will anneal together, or as a single RNA strand that will form a hairpin loop and anneal with itself. For example, a construct targeting a portion of a gene, e.g., a NOTCH1 coding sequence or transcriptional activation sequence, is inserted between two promoters (e.g., mammalian, viral, human, tissue specific, constitutive or other type of promoter) such that transcription occurs bidirectionally and will result in complementary RNA strands that may subsequently anneal to form an inhibitory siRNA of the invention.

[00112] Alternatively, a targeted portion of a gene, coding sequence, promoter or transcript can be designed as a first and second antisense binding region together on a single expression vector; for example, comprising a first coding region of a targeted gene in sense orientation relative to its controlling promoter, and wherein the second coding region of the gene is in antisense orientation relative to its controlling promoter. If transcription of the sense and antisense coding regions of the targeted portion of the targeted gene occurs from two separate promoters, the result may be two separate RNA strands that may subsequently anneal to form a gene- inhibitory siRNA used to practice this invention.

[00113] In another aspect, transcription of the sense and antisense targeted portion of the targeted gene is controlled by a single promoter, and the resulting transcript will be a single hairpin RNA strand that is self-complementary, i.e., forms a duplex by folding back on itself to create a gene-inhibitory siRNA molecule. In this configuration, a spacer, e.g., of nucleotides, between the sense and antisense coding regions of the targeted portion of the targeted gene can improve the ability of the single strand RNA to form a hairpin loop, wherein the hairpin loop comprises the spacer. In one embodiment, the spacer comprises a length of nucleotides of between about 5 to 50 nucleotides. In one aspect, the sense and antisense coding regions of the siRNA can each be on a separate expression vector and under the control of its own promoter.

Inhibitory Ribozymes

[00114] In alternative embodiment, compositions and methods of the invention comprise use of ribozymes capable of binding and inhibiting, e.g., decreasing or inhibiting, expression of one or a set of Notchl transcripts or proteins, or isoform or isoforms thereof.

[00115] These ribozymes can inhibit a gene's activity by, e.g., targeting a genomic DNA or an mRNA (a message, a transcript). Strategies for designing ribozymes and selecting a gene-specific antisense sequence for targeting are well described in the scientific and patent literature, and the skilled artisan can design such ribozymes using the novel reagents of the invention. Ribozymes act by binding to a target RNA through the target RNA binding portion of a ribozyme which is held in close proximity to an enzymatic portion of the RNA that cleaves the target RNA. Thus, the ribozyme recognizes and binds a target RNA through complementary base- pairing, and once bound to the correct site, acts enzymatically to cleave and inactivate the target RNA. Cleavage of a target RNA in such a manner will destroy its ability to direct synthesis of an encoded protein if the cleavage occurs in the coding sequence. After a ribozyme has bound and cleaved its RNA target, it can be released from that RNA to bind and cleave new targets repeatedly.

Antibodies [00116] Anti-NOTCHl antibodies can be generated using methods well known and routinely practiced in the art, e.g., Monoclonal Antibodies-Production, Engineering And Clinical Applications, Ritter et al., Eds., Cambridge University Press, Cambridge, UK, 1995; and Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, 3rd ed., 2000. Anti-NOTCHl antibodies and methods of generating them are known in the art (see U.S. Publication Nos. 2008/0131434 and 2009/0081238, each of which is incorporated by reference herein in its entirety.)

Kits and Instructions

[00117] The invention provides kits comprising compositions and/or instructions for practicing methods of the invention. As such, kits, cells, vectors and the like can also be provided. In alternative embodiments, the invention provides kits comprising: a composition used to practice a method of any of the invention, or a composition, a pharmaceutical composition or a formulation of the invention, and optionally comprising instructions for use thereof.

EXAMPLES

Material and Methods

[00118] Patients Samples. T-ALL patient samples were obtained from Moores Cancer Center, University of California San Diego and Dana-Farber Cancer Institute, Harvard Medical Schools. Peripheral blood mononuclear cells (PBMC) were purified by Ficoll-Hypaque centrifugation prior to fluorescence- activated cell sorting (FACS) analysis and viable cryopreservation in liquid nitrogen. Patient age range was 2-23 and mean age was 11.3 years. Diagnostic samples include patients 1-11 while sample 12 was donated by a patient with relapsed T-ALL. Diagnostic blast immunophenotypes were not available (NA) for 2 of 12 patients. Treatment was performed according to protocol COG 05-01 for 01 to 07; protocol COG 9404 for patients 8 to 10; the Larson protocol for patient 11 and patient 12 received COG- ALL043 treatment.

[00119] Bioluminescent LIC Models. Methods required for establishment of bioluminescent LIC models in neonatal RAG2-/-yc-/- mice were described earlier (6). All animal experiments were approved by the Animal Experimental Committee of the University of California San Diego.

[00120] Human CD34 Initiating Cell Isolation and Immunophenotypic Analysis. Immunophenotypic analysis was performed on all samples (FACSAria II system, BD Biosciences). Human CD34+ cells were purified from T-ALL peripheral blood using a CD34 MicroBead Kit (Miltenyi Biotec, Auburn, CA) and CD34⁺ cell purity was assessed by FACS. For FACS sorting, mouse IgGls conjugated to PE, FITC, or APC were used as isotype controls (BD Biosciences). Human CD45, CD34, CD38, CD2, and CD7 expression was assessed using anti-CD45-V450, anti-CD34- APC, anti-CD38-PE-Cy7, anti-CD2-FITC and anti-CD7-PE, respectively, together with a lineage cocktail including PE-Cy5.5-conjugated antibodies against human CD4, CD8, CD14, CD19 and CD56. Propidium iodide (PI) was used to exclude dead cells and at least 10,000 events were acquired for each sample.

[00121] Lentiviral Transduction and Transplantation. Approximately 50,000 human CD34+ and CD34- cells derived from both NOTCHl Mutated and NOTCH1WT samples (defined by DNA sequencing) were selected from T-ALL blood or marrow with the aid of immunomagnetic beads or FACSAria, transduced with lentiviral luciferase and transplanted intrahepatically into RAG2-/-yc-/- mice within 48 hours of birth (6).

[00122] Establishment, Treatment and Analysis of LIC Mouse Model. Humanized LIC and normal hematopoietic progenitor mouse models were established by intrahepatic transplantation of neonatal RAG2-/-yc -/- mice with lentiviral luciferase transduced CD34+ progenitor cells from 12 T-ALL samples or normal cord blood samples. Engraftment was monitored with the aid of IVIS 200 system (Caliper Life Sciences, Inc.). LIC mouse models were dosed with either NOTCHl mAb or IgGl mAb control at 10 mg/kg intraperitoneally every 4 days for an average of 6 doses. To test whether hNl mAb could eliminate LIC in humanized T-ALL mouse models, mice were sacrificed one day after the last dose and bone marrow (BM), spleen, thymus and liver were collected for FACS analysis of human CD45, CD34, CD2, and NOTCHl expression. Immuno-histochemistry was performed to examine NOTCHl, CD45, activated caspase 3, as well as NOTCH intracellular domain (ICN1) expression in BM sections, following treatment with either control IgGl mAb or hNl mAb. [00123] Statistical Analysis. All statistical tests were performed for two sided p values. Continuous variables for each comparison group were assessed for distribution through univariate statistics. If the assumption of normal distribution could be supported, then the Student's t-test was performed for comparison of two samples with assessment of equality of variance with an F statistic. If the assumption of normal distribution was not supported, nonparametric testing was performed with the two sample Wilcoxon test using the t approximation for samples with N of less than 20.

[00124] DNA extraction: Genomic DNA was extracted with the QIAamp DNA blood mini kit according to the manufacturer's instructions (Qiagen Inc, Valencia, CA) for the DNA sequencing assay.

[00125] RNA extraction and Quantitative RT-PCR Analyses: Total RNA was extracted using the RNeasy Micro Kit (Qiagen) from human CD34 MicroBead selected (CD34 MicroBead Kit, Miltenyi Biotec, Auburn, CA) progenitor cells according to the manufacturer's specifications. A SYBR Greener two-Step Q-RT- PCR Kit for the iCycler (Invitrogen) was then used to synthesize cDNA and assess NOTCHl, HES-1 and c-MYC relative transcript quantities according to the manufacturer' s protocol.

[00126] Briefly, 8 μΐ of 20 to 200 ng/μΐ of RNA were mixed with RT Reaction Mix and RT Enzyme Mix, and then incubated at 25°C for 10 min, followed by 50°C for 30 min and finally 85°C for 5 min. The tubes were then chilled and 1 μΐ of RNase H was added to the reaction followed by 20 min incubation at 37°C. The quantitative PCR (Q-PCR) reaction was performed in duplicate using 2 μΐ of the template in 25 μΐ reaction volume containing SYBR Greener Super Mix and 0.4 μΜ of each forward and reverse primer.

[00127] The following human primers were used:

NOTCH 1-FW: GCACTGCGAGGTCAACAC (SEQ ID NO: l)

NOTCHl-Rev: AGGCACTTGGCACCATTC (SEQ ID NO:2)

HES1-FW: CGGACATTCTGGAAATGACA (SEQ ID NO: 3)

HESl-Rev: CATTGATCTGGGTCATGCAG (SEQ ID NO:4)

c-MYC-FW: ACGTCTCCACACATCAGCAC (SEQ ID NO:5)

c-MYC-Rev: CGCCTCTTGACATTCTCCTC (SEQ ID NO: 6)

HPRT FW: CGTCTTGCTCGAGATGTGATG (SEQ ID NO:7)

HPRT Rev: TTTATAGCCCCCCTTGAGCAC (SEQ ID NO:8) [00128] DNA Sequence Scanning: Genomic DNA was obtained from human CD34+ cells derived from either original T-ALL patients or engrafted mouse bone marrow with human specific PCR primers. Sequence analysis of NOTCH1 HD domain, PEST domain, SNP/silent mutations as well as PIK3CA, PIK3R1 , PTEN, AKT1, FBXW7 were conducted by GENEWIZ, Inc. (South Plainfield, NJ) as previously described.

[00129] Human CD34 Progenitor Cell Isolation and Immunophenotypic Analysis. Immunophenotypic analysis was performed on all samples (FACSAria II system, BD Biosciences). Human CD34⁺ cells were purified from T-ALL peripheral blood using a CD34 MicroBead Kit (Miltenyi Biotec, Auburn, CA) and CD34⁺ cell purity was assessed by FACS. For FACS sorting, mouse IgGls conjugated to PE, FITC, or APC were used as isotype controls (BD Biosciences). Human CD45, CD34, CD38, CD2, and CD7 expression was assessed using anti-CD45-V450, anti-CD34- APC, anti-CD38-PE-Cy7, anti-CD2-FITC and anti-CD7-PE, respectively, together with a lineage cocktail including PE-Cy5.5-conjugated antibodies against human CD4, CD8, CD14, CD19 and CD56. Propidium iodide (PI) was used to exclude dead cells and at least 10,000 events were acquired for each sample.

[00130] Lentiviral Production and Transduction: Lentiviral production and titer was determined by infection of 293T cells with several dilutions of the virus (MOI approximately 100) and FACS analysis of GFP+ cells at 48 hours after transduction. Equal numbers (103-5x104) T-ALL CD34 progenitors and CD34- depleted cells were purified with the aid of a FACSAria or immunomagnetic bead selection (CD34 MicroBeads kit) and incubated in 100 ml of StemPro-34® SFM complete medium (Invitrogen Inc.) supplemented with cytokines (R&D Systems) including SCF (50 ng/ml), TPO (10 ng/ml), Flt3 ligand (50 ng/ml), and IL-6 (10 ng/ml). Cells were incubated in a 7% C02, 37°C humidified incubator for 48 hours and transduction efficiency was assessed by fluorescence microscopy-mediated and FACS-based GFP quantification. Cells were centrifuged for 5 min at 300 x g and resuspended in 15 μΐ of StemPro® medium before transplantation.

[00131] Transplantation of human T-ALL LIC into immunocompromised mice: Immunocompromised (RAG2-/-gc-/-) mice deficient in T, B, and NK cells were bred and maintained in the Moores Cancer Center vivarium, University of California San Diego. Neonatal RAG2-/-gc-/- mice were transplanted within 48 hours of birth intrahepatically with equal numbers (50,000 cells/mouse) of cord blood or T- ALL CD34⁺ cells or Lineage+ cells in 15 μΐ HBSS with 10% FBS volume with the aid of a Hamilton syringe. Mice were sacrificed 8 -10 weeks post- transplantation or upon completion of hNl or control mAb dosing and human hematopoietic engraftment was quantified using a FACSAria II (BD Biosciences).

[00132] Immunohistochemistry: Mouse bone marrows were processed in Cal-Ex II fixative decalcifier (Fisher Scientific, Fair Lawn, NJ) for 48 h, followed by paraffin-embedding and tissue sectioning (5 mM; Leica CM1800) at the Moores Cancer Center Histology and Immunohistochemistry Shared Resource (HISR), UC San Diego. Paraffin tissue sections were deparaffinized, rehydrated and boiled in antigen retrieval solution (BD Biosciences) (pH 6.0) for 10 min to retrieve antigen. Tissues were blocked with 5% bovine serum albumin (BSA) and 0.25% Triton X-100 in PBS for 30 min and incubated with primary antibody in PBS with 1 % BSA at 4°C for 16 hours. Primary antibodies used were NOTCH1 (Pfizer Inc., La Jolla CA), human CD45 (Abeam, Cambridge, MA) and anti-Caspase 3 (Cell Signaling, Danvers, MA). Immunohistochemical staining was then carried out with a LSAB System-HRP Kit (Dako Cytomation, Hamburg, Germany) according to the manufacturer's protocol using methyl green (Sigma Aldrich, St. Louis, MO) as a counter stain. Secondary antibody staining only was used as a negative control. All sections were visualized and photomicrographs obtained with a Nikon Eclipse E600 microscope.

Example 1 : Treating, preventing or ameliorating a NOTCH 1 -driven malignancy

[00133] This example provides data demonstrating that the methods and compositions of the invention are effective for treating, preventing or ameliorating a NOTCHl-driven malignancy.

[00134] As described herein bioluminescent humanized T-ALL LIC mouse models were established by intrahepatically transplanting lentiviral luciferase transduced cells from primarily pediatric T-ALL patients (Table 1) into neonatal immune deficient (RAG2-/-yc-/-) mice.

[00135] The in vivo survival and self-renewal potential of six human T- ALL samples with NOTCH1 mutational activation (_NOTCHl^Mutated) and six NOTCH1 wild-type (NOTCH 1^WT) samples were compared. Quantitative bioluminescent imaging revealed that CD34⁺ cells from _NOTCHl^Mutated T-ALL samples had significantly higher leukemic engraftment potential than their CD34^" counterparts. Moreover, _NOTCHl^Mutated T-ALL CD34⁺ cells had higher primary and serial leukemic engraftment capacity than N0TCH1 CD34 cells suggesting that self -renewing LIC were enriched within the CD34⁺ fraction of NOTCH l^Mutated samples.

[00136] Treatment of _NOTCHl^Mutated T-ALL LIC engrafted mice with a human NOTCH 1 specific monoclonal antibody (hNl mAb) significantly reduced T- ALL LIC survival and impaired self -renewal potential.

[00137] These findings underscore and demonstrate the therapeutic potential of selective NOTCH 1 targeting in the eradication of T-ALL LIC and demonstrate the efficacy of the compositions and methods disclosed herein for cancer stem cell elimination in T-ALL and in other NOTCH1 -driven malignancies.

[00138] In this study, the CD34⁺ fraction of pediatric _NOTCHl^Mutated T- ALL samples had enhanced survival and self-renewal potential, characteristic of LIC, compared with CD34⁺ NOTCH1 wild-type (NOTCHl^WT) counterparts. These NOTCHl^Mutated LIC were uniquely susceptible to targeted inhibition with a therapeutic human NOTCH1 negative regulatory region selective monoclonal antibody (hNl mAb) while normal hematopoietic progenitors were spared thereby highlighting the cell type and context specific effects of NOTCH signaling (13, 20-25) and the importance of oncogenic addiction to NOTCH 1 signaling in T-ALL LIC maintenance.

Results

[00139] T-ALL Molecular Characterization. Molecular characterization of CD34⁺ cells from 12 T-ALL patient samples was performed by DNA sequencing analysis and focused on genes commonly mutated in T-ALL, including NOTCH 1, PTEN, PIK3R1 and FBXW7 (Table 1). Selective NOTCH1 DNA sequencing revealed activating mutations in six of eleven newly diagnosed pediatric T-ALL samples and in one relapsed young adult TALL sample (Table 1). In addition, CD34⁺ T-ALL cells derived from these 12 samples were further sequenced to identify PI3K, PTEN and FBXW7 pathway mutations common to pediatric T-ALL. Some cases harbored mutations in PTEN (patients 1, 5, 6, 11) or PIK3R1 (patient 5) genes (Table 1) (26- 30). These data demonstrate that mutations in NOTCH1 and other genes capable of promoting LIC survival co-exist in the CD34⁺ fraction of T-ALL samples. Table 1. Patient Characteristics

02 CD45(low), CDl, CD2, wt wt wt wt wt

CD3, CD4, CD5, CD7,

04 CD45(dim), TdT, wt wt wt wt wt

CD34(bright), CD2,

sCD3(dim), CD5(dim),

CD7(dim),

CD13/CD33(dim),

CD4(-), CD8(-), CD IO(-),

CD17(-), HLA-DR(-)

CD5, CD7, CD8, CD IO, insertion

HLA-DR(-), CD34(-), after bp

CD56(-) 699/Arg233*

07 CD45(DIM), TdT, CD2, wt wt wt wt wt

CD4, CD5, CD7(bright),

CD8, CD34(-), HLA- DR(-), sCD3(-), CDIO(-),

CD 13(-), CD 15(-),

T-ALL Age Diagnostic N0TCH1 HD Domain NOTCH 1 PEST PTEN exonl PIK3R1 FBXW7 Code Immunophenotype (exons 26,27) Domain (exon 34) (exons 12, (exons 9, 10)

13)

NOTCH 1 Mutated LIC Serially Transplant T-ALL.

[00140] To determine if lentiviral luciferase transduced CD34⁺ and CD34^" cells from _NOTCHl^Mutated and NOTCH 1^WT pediatric T-ALL samples differed in their capacity to propagate disease, quantitative non-invasive bioluminescent imaging was performed within 10 weeks of intrahepatic transplantation of neonatal RAG2-/-yc-/- mice (Fig. 1A). Mice transplanted with CD34^"enriched _NOTCHl^Mutated T-ALL cells (patients 3, 5, 8, 11) demonstrated consistently greater leukemic engraftment than mice transplanted with CD34^" cells (Fig. IB and 1C; n=79 mice, P=0.0005, Student's t-test). Conversely, both CD34⁺ and CD34^" fractions from NOTCHl^WT T-ALL samples (patients 4, 7, 9, 10) exhibited an equal capacity to engraft in primary transplant recipients (Fig. lC; n=76 mice). Hence, CD34⁺ cells from xoTCHl^Mutated samples gave rise to higher levels of bioluminescent engraftment in primary transplant recipients than their CD34^" counterparts indicative of LIC enrichment in the CD34⁺ fraction in _NOTCHl^Mutated but not NOTCHl^WT samples.

[00141] The predilection of _NOTCHl^Mutated T-ALL LIC for specific hematopoietic niches was determined in primary and serial transplants. Primary human _NOTCHl^Mutated T-ALL CD34+ LIC engraftment was typified by thymic (Fig. ID) and splenic (Fig. ID) enlargement as well as pale marrow due to replacement by leukemic cells (Fig. ID).

[00142] Further analysis revealed that thymic (P<0.01 ; Student's t-test) and splenic (P<0.001, Student's t-test) weights were significantly greater in both primary and secondary ^Q Hl^Mutated T-ALL LIC transplant recipients than in no transplant control mice (Fig. 5A, 5B). Moreover, FACS analysis revealed robust CD34⁺ cell engraftment in marrow, spleen and thymus of primary and secondary ^Q (fj]^Mutated T-ALL LIC transplanted mice (Fig. ID, IE and IF). Notably, serially transplantable CD34⁺ cells from _NOTCHl^Mutated T-ALL samples had higher human NOTCH1 (P<0.01) and HES1 (p<0.001) transcript levels than marrow engrafted with NOTCH 1^WT CD34⁺ T-ALL cells (Fig. 5C and 5D). Following serial transplantation of NOTCHl-activated LIC, FACS analysis revealed a CD45⁺CD34⁺CD2⁺ population, undetectable in normal cord blood (Fig. 6A), with serial leukemic transplantation potential at limiting doses (Fig. 6B). Taken together these results suggest that NOTCH 1 -driven LIC have enhanced survival and self-renewal potential in supportive hematopoietic microenvironments. [00143] hNl mAb Treatment Inhibits NOTCHl Mutated T-ALL LIC Burden. The relative leukemic regenerative potential of NOTCHl^Mutated (Patients 3, 5, 8, 11), and NOTCHl^WT (Patients 4, 7, 9, 10) samples was determined in serial transplantation studies. FACS analysis of cells from marrow, spleen and thymus showed that while the levels of thymic engraftment were equivalent, NOTCH l^Mutated T-ALL LIC gave rise to a significantly higher CD34⁺ leukemic burden in the marrow and spleen of primary transplant recipients than NOTCHl^WT T-ALL samples (Fig. 2 A, 2B; P<0.001 ; Student's t-test). To determine if 1) selective NOTCHl inhibition reduced LIC burden, 2) if NOTCHl^Mutated TALL LIC survival depended on activated NOTCHl receptor signaling, and 3) if selective NOTCHl inhibition spared NOTCH 1^WT or normal cord blood CD34⁺ cell engrafted mice. These mice were then treated with a selective NOTCH 1-NRR/Fc mAb (hNl mAb; 10 mg/kg) or a control mouse IgGl mAb every 4 days for 3.5 weeks (Fig. 7A and 7B). Upon completion of hNl mAb treatment of NOTCH l^Mutated T-ALL LIC (n=4 patients) transplanted mice, FACS analysis revealed a significant reduction in leukemic CD34⁺ cell burden in both the marrow and spleen (Fig. 2C; P=0.003 and Fig. 2D, P=0.001, respectively, Wilcoxon test). Although engraftment rates were low, neither the leukemic burden in NOTCH 1^WT T-ALL (patients 4 and 10) transplanted mice (Figs. 9A and 8) nor normal human cord blood progenitor survival were significantly reduced by targeted NOTCHl inhibition (Figs. 9A and 9B). These results suggest a greater functional dependence of NOTCH l^Mutated T-ALL LIC on NOTCHl signaling.

[00144] hNl mAb Treatment Inhibits NOTCHl Mutated LIC Survival. Following hNl mAb treatment, immunohistochemical analysis revealed a marked increase in levels of activated caspase 3 compared with control IgGl mAb treated control marrow (Fig. 3A, P=0.005, Student's t-test). Immunohistochemical and FACS analysis also showed a corresponding reduction in human NOTCHl expression (Fig. 3B, 3C, 3D; P=0.046; Student's t-test) in _NOTCHl^Mutated LIC engrafted marrow following hNl compared with control IgGl mAb treatment. Notably, LIC from one T-ALL _NOTCH l^Mutated patient sample (patient 11), with a PTEN frame-shift mutation, retained sensitivity to hNl inhibition. While survival of LIC from a sample (patient 5) with both PTEN and PIK3R1 mutations was not significantly inhibited in the marrow, LIC were significantly inhibited in the spleen by hNl mAb treatment highlighting the influence of additional mutations and microenvironmental context in responses to selective NOTCHl inhibitory strategies. [00145] Although _NOTCHl^Mutated T-ALL LIC demonstrated enhanced leukemic engraftment capacity compared with NOTCHl^WT T-ALL CD34⁺ cells, the survival of _NOTCHl^Mutated T-ALL LIC appeared to be reliant on NOTCH1 signaling thereby leading to enhanced sensitivity to hNl mAb inhibition in a niche dependent manner.

[00146] hNl mAb Treatment Inhibits NOTCH1 Driven LIC Self-renewal. To assess whether hNl mAb treatment could inhibit the formation of transcriptionally active NOTCH1 (ICNl), which may be involved in promoting therapeutic resistance through induction of self-renewal, marrows of _NOTCHl^Mutated LIC engrafted mice ICNl immunohistochemical analysis was performed after treatment with hNl mAb or IgGl control mAb. Treatment with the hNl mAb was associated with a reduction in both marrow ICNl levels (Fig. 4A), and HESl (P=0.08, Student's t-test) transcript levels (Fig. 4B). Of note, one patient sample (patient 2) did not harbor a NOTCH1 mutation, as determined by DNA sequencing (Table 1), but had increased NOTCH1 transcript levels (NOTCHl^Hlgh), compared with cord blood progenitors (Fig. 10A), as well as marrow, splenic and thymic serial transplantation potential (Fig. 10B). To determine whether hNl mAb treatment inhibited NOTCH 1 -driven LIC self -renewal, human CD34⁺ cells from hNl mAb and IgGl mAb treated mouse marrows were transplanted into untreated secondary recipients. After 12 weeks, FACS analysis showed that mice transplanted with human CD34⁺ T-ALL cells obtained from mlgGl control mAb treated mice had a high CD34⁺45⁺ leukemic burden (Fig. 4C and 4D; Fig. IOC and 10D). Conversely, hNl mAb treated human T-ALL LIC engrafted mice showed a reduction in CD45⁺ leukemic cell burden in secondary transplant recipients (Fig. 4C and 4D; P=0.08, unequal variance two tailed Student's T-test) indicating that NOTCH 1 inhibition abrogates LIC self -renewal.

Example 2: Biomarkers for Assessing Cancer Stem Cell Populations

[00147] This example provides data demonstrating that the methods and compositions of the invention are effective for reducing the amount of or reducing the burden of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺ subpopulation of leukemic stem cells (LSC), or a T-ALL LSC subpopulation. The data also demonstrates the effectiveness of the methods disclosed herein for identifying and/or determining the presence of a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or to diagnose pediatric T-ALL, comprising identifying and/or determining the presence of and/or measuring a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2.

[00148] Following NOTCH 1 mAB treatment of the humanized LIC mouse models, FACS analysis showed a reduction in both the populations of CD45⁺CD34⁺ cells (Fig. 16 A, upper panel) and immature T cells identified by CD34⁺CD2⁺ immunoreactivity (Fig. 16 A, lower panel) in _NOTCHl^Mutated LIC (Patient 11) engrafted mouse bone marrows, as well as a reduction of the CD34⁺N0TCH1⁺ cell population in bone marrow and spleen (Fig. 16B).

[00149] To determine whether hNl mAb treatment inhibited NOTCH1- driven LIC self-renewal, human CD34⁺ cells selected from the bone marrows of hNl mAb (n = 4) and IgGl mAb (n = 3) treated mice were serially transplanted into untreated secondary (2°) recipients.

[00150] After 12 weeks, FACS analysis showed that mice transplanted with human CD34⁺ T-ALL cells obtained from control IgGl mAb-treated mice exhibited higher CD45⁺CD34⁺ leukemic burden compared to mice transplanted with CD34⁺ cells obtained from hNl mAb-treated mice (Fig. 16C). Conversely, hNl mAb-treated human T-ALL LIC engrafted mice showed a significant reduction in both CD45⁺ cell burden (Fig. 16D; **, P = 0.01 , unequal variance two tailed Student's t-test) and the CD45⁺CD34⁺ leukemic cell population (Fig. 16D; *, P = 0.05) in the 2° transplant recipients, indicating that NOTCH1 inhibition abrogates T-ALL LIC self-renewal. Although _NOTCHl^Mutated T-ALL LIC demonstrated enhanced leukemic engraftment capacity compared with NOTCHl^WT T-ALL CD34⁺ cells, the survival of NOTCH l^Mutated T-ALL LIC appeared to be reliant on NOTCH 1 signaling, thereby leading to enhanced sensitivity to hNl mAb inhibition in a niche-dependent manner.

Example 3- Enrichment of LIC in the CD45⁺CD34⁺CD⁺CD7⁺ Population and Depletion Following hNl mAB Antibody Treatment

[00151] Studies have highlighted the importance of CD7 expression in discriminating the LIC population in T-ALL [10], [40]. Without being bound to any particular mechanism or theory, we hypothesized that early T-cell markers such as CD7 and CD2 might be enriched, and these populations might be serially transplantable, in NOTCH 1 -driven T-ALL LIC xenografted mice. While overall engraftment was similar between NOTCHl^High and _NOTCHl^Mutated transplanted samples (Fig. 17A), FACS analyses revealed an expansion of CD45⁺CD34⁺CD2⁺CD7⁺ and CD45⁺CD34⁺CD2⁺CD7^" populations in _NOTCHl^Mutated (patients 05, 08, 11, 12) and NOTCHl^High (patient 02) T-ALL samples when compared with NOTCHl^WT (patients 04, 09, 10) T-ALL samples and cord blood (Fig. 17B). Following serial transplantation of NOTCH 1 -activated LIC, FACS analyses revealed that the CD45⁺CD34⁺CD2⁺CD7⁺ population harbored serial leukemic transplantation potential at limiting doses (Table 2 and Figs 18A-C). To test that the CD2⁺CD7⁺ subset of the CD34⁺ human progenitor population identifies a LIC- enriched population in _NOTCHl^Mutated T-ALL samples, CD34⁺CD2⁺CD7⁺Lin^" cells from NOTCHl^Mutated T-ALL samples (Patients 05 and 11) were FACS Aria purified and serial transplantations were performed. Serial transplantation of 1 500 CD34⁺CD2⁺CD7⁺Lin^" cells sorted from a _NOTCHl^Mutated T-ALL (Patient 05) sample resulted in marked thymic enlargement, splenomegaly and pale marrows indicative of robust leukemic engraftment (Table 2 and Fig. 18A). Tertiary transplant experiments revealed that the human CD45⁺CD34⁺CD2⁺CD7⁺ population propagated leukemia and seeded hematopoietic niches, which was demonstrative of LIC self-renewal capacity (Figs. 18B and 18C). As further evidence that this model recapitulates features of the human disease, infiltration of human CD45⁺ cells was detected in the brains of mice that received 3° transplants of the enriched LIC population (CD34⁺CD2⁺CD7⁺) from patient 11 (Fig. 14).

[00152] Surprisingly this LIC-enriched population was sensitive to hNl antibody treatment. Compared to control mAb-treated animals transplanted with the bulk CD34⁺ population, in hNl mAb-treated T-ALL LIC engrafted mice, there was a significant reduction in the CD34⁺CD2⁺CD7⁺ population, but not the CD34⁺CD2⁺CD7^" population (Fig. 17C). Taken together, in _NOTCHl^Mutated T-ALL samples, a CD45⁺CD34⁺CD2⁺CD7⁺ population is enriched for LIC that demonstrate serial leukemic transplantation capacity and these cells are selectively targeted and depleted by hNl antibody therapy. Table 2 Niche-dependent LIC leukemic transplantation potential

1° Transplant Engraftment 2° Transplant Engraftment 3° Transplant Engraftment

( Ί ⁾34 CD4 Ce l ls ( Ί ⁾34 CD4 ( VI K ( 1 ⁾34 CD45 ( VI N

Cell #

T ALL Transplant

T ALL LIC Code (n) BM Spleen Thymus BM Spleen Thymus BM Spleen Thymus

(1°) transplant experiment are indicated in the table, and results are reported as mean percentages + SEM. Serial transplantations performed using 50000 bone marrow cells derived from the engrafted mice. For secondary (2°) transplants, five experiments were performed with an average of 4.0+0.32 mice transplanted per experiment. For tertiary (3°) transplants, three experiments were performed with an average of 4.0+0.58 mice transplanted per experiment.

Discussion

[00153] Cumulative reports reveal the protean nature of NOTCH signaling in the maintenance of normal and malignant hematopoiesis (13, 20-22, 31-33). While Notch2 signaling regulates regeneration of mouse long-term hematopoietic stem cells (HSC), ligand driven NOTCH1 activation induces human hematopoietic progenitor expansion and cell fate determination (23, 34). Ligand binding to the NOTCH1 extracellular domain activates ADAM family metalloprotease and γ-secretase complex mediated cleavage and intracellular release of the NOTCH 1 intracellular domain (ICN1). Subsequently, nuclear translocation of ICN1 followed by engagement of transcriptional activators CSL and MAML sets the stage for NOTCH 1 target gene transcription. Conversely, NOTCH1 signaling pathway activation through gain-of- function mutations in NOTCH1, first described in T-ALL (32), or loss-of-function mutations in NOTCH 1 regulators, such as FBXW7 and NUMB, has been linked to therapeutic recalcitrance of hematologic malignancies (35, 36). Chronic antagonism of both NOTCH 1 and NOTCH2 processing with small molecule inhibitors of the gamma secretase complex has been associated with loss of intestinal crypt progenitor cells thereby providing the impetus for development of selective NOTCH 1 inhibitors (37). Recent pre-clinical studies demonstrate that both stapled peptide and monoclonal antibody-mediated inhibition of NOTCH 1 signaling effectively decrease TALL cell line growth (38, 39). However, the consequences of selective NOTCH1 inhibition for normal hematopoietic progenitor and LIC survival and self-renewal were not established.

[00154] In this study, CD34⁺ cells from 6 of 12 T-ALL samples harbored NOTCH1 activating mutations. In these patients, xoTCHl^Mutated CD34⁺ LIC had greater bioluminescent engraftment and serial transplantation potential than their CD34^" counterparts. Conversely, both CD34⁺ and CD34^" subpopulations from NOTCH 1 wild- type (NOTCH 1^WT) samples harbored bioluminescent engraftment potential, albeit at lower levels than _NOTCHl^Mutated LIC and with lower serial transplantation capacity. With the exception of one sample (patient 2) that harbored high NOTCH1 target gene expression, in the absence of identifiable NOTCH1 mutations, bioluminescent imaging and FACS analyses of leukemic engraftment suggest that phenotypic markers other than CD34 will be needed to identify LIC in the NOTCH! samples. In contrast to experiments with NOTCH! and normal cord blood CD34⁺ samples, NOTCHl^Mumei LIC survival was significantly impaired by NOTCH 1 (hNl) mAb inhibition commensurate with reductions in ICNl and NOTCH1 mRNA and protein levels. Furthermore, serial transplantation was also reduced by hNl mAb treatment of mice transplanted with NOTCH1 -driven T-ALL samples. Thus, _NOTCHl^Mutated CD34⁺ cells from these pediatric T-ALL patients constitute the apex of a leukemic hierarchy.

[00155] Notably, patient samples with NOTCH! activation, conferred either by mutation or elevated WT NOTCH 1 expression levels, show enrichment of a subset of the CD34⁺ human progenitor cell population distinguished by co-expression of CD2 and CD7. Seminal studies reveal that CD7 expression enriches for a therapeutically recalcitrant LIC population [10], [40], Our analyses of the serial transplantation capacity of the CD34^÷CD2⁺CD7⁺ population reveal that this population is maintained over multiple generations of T-ALL LIC transplantation, and these ceils harbor robust leukemic initiating potential in medullary and extrai.aedu1.lary reservoirs of resistance. In experiments aimed at elucidating the fate of these cells in mice treated with hNl mAb, we observed a significant reduction in this population compared to animals that received control IgGl antibody. Taken together, these data further refine the markers thai identify LIC in NOTCH l^Mutated T-ALL samples, and demonstrate that the CD34⁺CD2^':CD7^f population is sensitive to and depleted following hNl mAb treatment. While in the present studies, our analyses of the refined LIC marker were focused on the NOTCH l^Mutaitd samples, additional markers, or activation of other receptor-mediated signaling pathways such as insulin-like growth factor 1 receptor [43], may also be informative to determine the leukemic potential of LIC in non-NOTCHl^Mutated T-ALL patients.

[00156] While mutations in tumor suppressor genes co-exist in some samples, xoTCH^Mutated T-ALL LIC appear to be oncogenically addicted to NOTCH1 activation rendering them uniquely susceptible to inhibition with a NOTCH 1 targeted mAb, hNl. In contrast, NOTCH1 mAb treatment did not significantly impair the survival of normal hematopoietic progenitor cells. This favorable therapeutic index may be explained, at least in part, by mouse models of hematopoiesis, which demonstrate that Notch2, rather than Notch 1, regulates mouse hematopoietic stem cell regeneration (25). In summary, characterization of LIC based on functional molecular drivers provides a useful paradigm for identification and selective elimination of malignant stem cells. Moreover, these findings provide a compelling rationale for clinical evaluation of anti-NOTCHl therapy in clinical trials aimed at eliminating self-renewing LIC that promote therapeutic resistance and relapse in T- ALL and potentially in other NOTCH1 driven malignancies.

[00157] References

1. Lapidot T, et al. (1994) A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367(6464):645-648.

2. Bonnet D & Dick JE (1997) Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med

3(7):730-737.

3. Jamieson CH, et al. (2004) Granulocyte-macrophage progenitors as

candidate leukemic stem cells in blast-crisis CML. N Engl J Med 351(7):657- 667.

4. Barabe F, Kennedy JA, Hope KJ, & Dick JE (2007) Modeling the initiation and progression of human acute leukemia in mice. Science 316(5824): 600- 604.

5. Jaiswal S, et al. (2009) CD47 is upregulated on circulating hematopoietic stem cells and leukemia cells to avoid phagocytosis. Cell 138(2):271-285.

6. Abrahamsson AE, et al. (2009) Glycogen synthase kinase 3beta missplicing contributes to leukemia stem cell generation. Proc Natl Acad Sci U S A

106(10):3925-3929.

7. Geron I, et al. (2008) Selective inhibition of JAK2-driven erythroid

differentiation of polycythemia vera progenitors. Cancer Cell 13(4):321-330.

8. Raaijmakers MH, et al. (2010) Bone progenitor dysfunction induces

myelodysplasia and secondary leukaemia. Nature 464(7290):852-857.

9. Somervaille TC, et al. (2009) Hierarchical maintenance of MLL myeloid leukemia stem cells employs a transcriptional program shared with

embryonic rather than adult stem cells. Cell Stem Cell 4(2): 129-140.

10. Chiu PP, Jiang H, & Dick JE (2010) Leukemia- initiating cells in human

Tlymphoblastic leukemia exhibit glucocorticoid resistance. Blood

116(24):5268-5279.

11. Majeti R, et al. (2009) Dysregulated gene expression networks in human acute myelogenous leukemia stem cells. Proc Natl Acad Sci U S A

106(9):3396-3401.

12. Cox CV, et al. (2007) Characterization of a progenitor cell population in childhood T-cell acute lymphoblastic leukemia. Blood 109(2):674-682.

13. Duncan AW, et al. (2005) Integration of Notch and Wnt signaling in

hematopoietic stem cell maintenance. Nat Immunol 6(3):314-322.

14. Zhao C, et al. (2009) Hedgehog signalling is essential for maintenance of cancer stem cells in myeloid leukaemia. Nature 458(7239):776-779. 15. Zhao C, et al. (2007) Loss of beta-catenin impairs the renewal of normal and CML stem cells in vivo. Cancer Cell 12(6):528-541.

16. van Delft FW, et al. (2011) Clonal origins of relapse in ETV6-RUNX1 acute lymphoblastic leukemia. Blood.

17. Anderson K, et al. (2011) Genetic variegation of clonal architecture and propagating cells in leukemia. Nature 469(7330):356-361.

18. Notta F, et al. (2011) Evolution of human BCR-ABL1 lymphoblastic leukaemia-initiating cells. Nature 469(7330):362-367.

19. Clappier E, et al. (2010) NOTCH1 and FBXW7 mutations have a favorable impact on early response to treatment, but not on outcome, in children with T-cell acute lymphoblastic leukemia (T-ALL) treated on EORTC trials 58881 and 58951. Leukemia 24(12): 2023 -2031.

20. Liu J, Sato C, Cerletti M, & Wagers A (2010) Notch signaling in the regulation of stem cell self -renewal and differentiation. Curr Top Dev Biol 92:367-409.

21. Conboy IM, et al. (2005) Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature 433(7027):760-764.

22. Reya T, et al. (2003) A role for Wnt signalling in self-renewal of hematopoietic stem cells. Nature 423(6938):409-414.

23. Haddad R, et al. (2004) Molecular characterization of early human T/NK and B-lymphoid progenitor cells in umbilical cord blood. Blood 104(13):3918- 3926.

24. Butler JM, et al. (2010) Endothelial cells are essential for the self -renewal and repopulation of Notch-dependent hematopoietic stem cells. Cell Stem Cell 6(3) :251-264.

25. Varnum- Finney B, et al. (2011) Notch2 governs the rate of generation of mouse long- and short-term repopulating stem cells. J Clin Invest

121(3):1207-1216.

26. Gutierrez A, et al. (2010) Absence of biallelic TCRgamma deletion predicts early treatment failure in pediatric T-cell acute lymphoblastic leukemia. J Clin Oncol 28(24):3816-3823.

27. Feng H, et al. (2010) T-lymphoblastic lymphoma cells express high levels of BCL2, S1P1, and ICAM1, leading to a blockade of tumor cell intravasation. Cancer Cell 18(4):353-366.

28. Gutierrez A, et al. (2010) Inactivation of LEFl in T-cell acute lymphoblastic leukemia. Blood 115(14):2845-2851.

29. Sanda T, et al. (2010) Interconnecting molecular pathways in the pathogenesis and drug sensitivity of T-cell acute lymphoblastic leukemia.

Blood 115(9):1735-1745.

30. Gutierrez A, et al. (2009) High frequency of PTEN, PI3K, and AKT abnormalities in T-cell acute lymphoblastic leukemia. Blood 114(3):647-650.

31. Inuzuka H, et al. (2011) SCF(FBW7) regulates cellular apoptosis by targeting MCL1 for ubiquitylation and destruction. Nature 471(7336):104- 109.

32. Weng AP, et al. (2004) Activating mutations of NOTCH 1 in human T cell acute lymphoblastic leukemia. Science 306(5694):269-271.

33. Klinakis A, et al. (2011) A novel tumour-suppressor function for the Notch pathway in myeloid leukemia. Nature 473(7346):230-233.

34. Delaney C, et al. (2010) Notch-mediated expansion of human cord blood progenitor cells capable of rapid myeloid reconstitution. Nat Med 16(2):232- 236.

35. O'Neil J, et al. (2007) FBW7 mutations in leukemic cells mediate NOTCH pathway activation and resistance to gamma-secretase inhibitors. J Exp

Med 204(8): 1813-1824.

36. Ito T, et al. (2010) Regulation of myeloid leukemia by the cell-fate

determinant Musashi. Nature 466(7307) :765-768.

37. Riccio O, et al. (2008) Loss of intestinal crypt progenitor cells owing to inactivation of both Notchl and Notch2 is accompanied by derepression of

CDK inhibitors p27Kipl and p57Kip2. EMBO Rep 9(4):377-383.

38. Moellering RE, et al. (2009) Direct inhibition of the NOTCH transcription factor complex. Nature 462(7270): 182- 188.

39. Wu Y, et al. (2010) Therapeutic antibody targeting of individual Notch receptors. Nature 464(7291): 1052-1057.

40. Gerby B, Clappier E, Armstrong F, Deswarte C, Calvo J, et al. (2011) Expression of CD34 and CD7 on human T-cell acute lymphoblastic leukemia discriminates functionally heterogeneous cell populations. Leukemia 25: 1249-1258.

41. Chessells JM, Veys P, Kempski H, Henley P, Leiper A, et al. (2003) Long-term follow-up of relapsed childhood acute lymphoblastic leukemia. Br J Haematol 123: 396-405.

42. Ferrando A (2010) NOTCH mutations as prognostic markers in T-ALL. Leukemia 24: 2003-2004.

43. Medyouf H, Gusscott S, Wang H, Tseng JC, Wai C, et al. (2011) High-level IGF1R expression is required for leukemia-initiating cell activity in T-ALL and is supported by Notch signaling. J Exp Med 208: 1809-1822.

[00158] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method for treating, preventing or ameliorating relapse or therapeutic resistance in a NOTCHl -driven malignancy associated with a NOTCHl activating mutation or overexpression of wild-type NOTCHl in a subject in need of such treatment comprising:

a. determining if said subject has a malignancy associated with a NOTCHl activating mutation or overexpression of wild-type NOTCHl; and b. administering a composition to said subject if step(a) is positive, wherein the composition

(i) inhibits or decreases the expression of a NOTCHl gene or gene product, or a NOTCHl transcript (message, or mRNA); or

(ii) inhibits or decreases the amount of, or activity of, or production of, a NOTCHl polypeptide.

2. The method of claim 1, wherein the composition that inhibits or decreases the expression of a NOTCHl gene, a NOTCHl gene product, a NOTCHl transcript, and/or a NOTCHl polypeptide comprises:

(a) an inhibitory nucleic acid molecule or an antisense oligonucleotide inhibitory to expression of a NOTCHl gene or a NOTCHl gene transcript; or

(b) a polypeptide, peptide or an antibody inhibitory to the expression of the NOTCHl gene or NOTCHl gene transcript, or activity or expression of the NOTCHl polypeptide.

3. The method of claim 2, wherein the inhibitory nucleic acid molecule or antisense oligonucleotide inhibitory to expression of the NOTCHl gene or NOTCHl gene transcript comprises: an RNAi inhibitory nucleic acid molecule, a double- stranded RNA (dsRNA) molecule, a small interfering RNA (siRNA), a microRNA (miRNA) and/or a short hairpin RNA (shRNA) or ribozyme.

4. The method of claim 1, wherein the composition that inhibits or decreases the expression of a NOTCHl gene, a NOTCHl gene product, a NOTCHl transcript, and/or a NOTCHl polypeptide comprises a small molecule.

5. The method of claim 2, wherein the antibody inhibitory to the expression of a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, or activity or expression of the NOTCHl polypeptide, comprises an antibody or antigen- binding fragment thereof, or a monoclonal or polyclonal antibody, that specifically binds to a NOTCHl protein, or specifically binds to the negative regulatory region (NRR) of the NOTCHl extracellular domain found on the malignancy cells being treated.

6. The method of claim 2, wherein the polypeptide or peptide inhibitory to the expression of a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, or activity or expression of the NOTCHl polypeptide comprises a peptide aptamer or a NOTCHl protein-binding polypeptide or peptide.

7. The method of any of claims 1 to 6, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, and/or a NOTCHl polypeptide is administered in vitro, ex vivo or in vivo.

8. The method of claim 1, wherein the NOTCH-driven malignancy is a hematological cancer, colorectal cancer, ovarian cancer or breast cancer.

9. The method of claim 8, wherein the NOTCH-driven malignancy is a hematological cancer.

10. The method of claim 9, wherein the hematological cancer is T cell acute lymphoblastic leukemia (T-ALL).

11. The method of claim 1, wherein administration of the composition inhibits or reduces the burden, self -renewal, or survival of cancer stem cells related to the malignancy.

12. The method of claim 9, wherein administration of the composition inhibits or reduces the burden, self -renewal, or survival of leukemic stem cells (LSC) related to the malignancy.

13. The method of claim 10, wherein administration of the composition inhibits or reduces the burden, self-renewal, or survival of leukemic initiating cells (LIC) that are CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^".

14. The composition of claim 1, wherein the composition is a pharmaceutical composition comprising a composition that inhibits or decreases the expression of or the activity of: a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, and/or a NOTCHl polypeptide, wherein the composition is formulated for administration in vitro, ex vivo or in vivo.

15. A method for reducing or inhibiting the burden, self -renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^~ subpopulation of T-ALL LIC in a subject comprising administering a composition that:

(a) inhibits the expression of a NOTCHl gene or gene product, or a NOTCHl transcript (message, or mRNA); or

(b) decreases the amount of, or activity of, or production of, a NOTCHl polypeptide.

16. The method of claim 15, wherein the composition that reduces or inhibits the burden, self-renewal activity or survival of leukemic stem cells, or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of leukemic stem cells (LSC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^~ subpopulation of T-ALL LIC comprises:

(a) an inhibitory nucleic acid molecule or an antisense oligonucleotide inhibitory to expression of a NOTCHl gene or a NOTCHl gene transcript; or

(b) a polypeptide, peptide or an antibody inhibitory to the expression of the NOTCHl gene or NOTCHl gene transcript, or activity or expression of the NOTCHl polypeptide.

17. The method of claim 16, wherein the inhibitory nucleic acid molecule or antisense oligonucleotide inhibitory to expression of the NOTCHl gene or NOTCHl gene transcript comprises: an RNAi inhibitory nucleic acid molecule, a double-stranded RNA (dsRNA) molecule, a small interfering RNA (siRNA), a microRNA (miRNA) and/or a short hairpin RNA (shRNA) or ribozyme.

18. The method of claim 15, wherein the composition that inhibits or decreases the expression of a NOTCHl gene, a NOTCHl gene product, a NOTCHl transcript, and/or a NOTCHl polypeptide or overexpressed wild-type NOTCHl comprises a small molecule.

19. The method of claim 16, wherein the antibody inhibitory to the expression of a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, or activity or expression of the NOTCHl polypeptide, comprises an antibody or antigen- binding fragment thereof that specifically binds to a NOTCHl protein.

20. The method of claim 16, wherein the polypeptide or peptide inhibitory to the expression of a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, or activity or expression of the NOTCHl polypeptide comprises a peptide aptamer or a NOTCHl protein-binding polypeptide or peptide.

21. The method of any of claims 15 to 20, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide is administered in vitro, ex vivo or in vivo.

22. A method for determining the relative robustness of a leukemia stem cell (LSC) population, or the most robust leukemia stem cell (LSC) population, comprising: determining whether a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH1 polypeptide is overexpressed; or, detecting the overexpression of a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH 1 polypeptide.

23. A method for identifying and/or determining the presence of a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T- ALL), or to diagnose pediatric T-ALL, comprising:

identifying and/or determining the presence of and/or measuring a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2,

wherein identifying and/or determining the presence of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 identifies and/or determines the presence of a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or diagnoses a pediatric T-ALL.

24. A method for determining the effectiveness of a diet, treatment, drug or therapy for a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or a pediatric T-ALL, comprising:

identifying and/or determining the presence of and/or measuring or quantifying the amount of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2,

wherein determining a decrease in the presence of or amount of the cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 after or during treatment identifies and/or determines the (positive) efficacy or effectiveness of a diet, treatment, drug or therapy for a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T- ALL), or a pediatric T-ALL.

25. A method for selecting a diet, a treatment, a drug or a therapy to treat or ameliorate a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or therapy to treat or ameliorate a pediatric T-ALL, comprising:

(a) applying, contacting or administering a diet, a treatment, a drug or a therapy to a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2; and

(b) determining and/or identifying the amount of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 after step (a),

wherein determining a decrease in the presence of or amount of the cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 identifies and/or determines the (positive) efficacy or effectiveness of, and selects, the diet, treatment, drug or therapy for a leukemic stem cell population in a pediatric T-cell acute lymphoblastic leukemia (T-ALL), or a pediatric T-ALL.

26. The method of any of claims 15 to 24, wherein the presence, absence and/or amount of the biomarkers CD45, CD34 and/or CD2, and/or a NOTCHl transcript and/or NOTCHl protein is measured using a fluorescent activated cell sorter (FACS), an array, an immunoassay, an immunoprecipitation, a kit, a polymerase chain reaction (PCR), a qRT-PCR, a nanofluidic assay or device, a nanofluidic proteome assay, a chromatography, a nanoproteomics quantification, or an isoelectric focusing assay, or any combination thereof.

27. A method of treating to prevent recurrence or therapeutic resistance of a malignancy comprising administering to a subject in need thereof a clinically employed treatment regimen for a period of time followed by an assessment of the subject for cells with a NOTCHl activating mutation or overexpression of wild-type NOTCHl, wherein if such mutation or overexpression is found the patient is treated subsequently with a composition that inhibits or decreases the expression of or the activity of: a NOTCHl gene, a NOTCHl gene product or a NOTCHl transcript, and/or a NOTCHl polypeptide.

28. A method of treating to prevent recurrence or therapeutic resistance of a malignancy associated with a NOTCHl activating mutation or overexpression of wild-type NOTCHl comprising administering to a subject a clinically employed treatment regimen for a period of time followed by an assessment of the subject for the presence of a cell or a cell population or subpopulation having a specific set of biomarkers CD45, CD34 and CD2 wherein if such cells are found the patient is treated with a composition that inhibits or decreases the expression of or the activity of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide.

29. A method to prevent recurrence or therapeutic resistance of a malignancy comprising administering to a subject a clinically employed treatment regimen for such malignancy in combination with a composition that inhibits or decreases the expression of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH 1 polypeptide wherein the composition that inhibits or decreases the expression of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH 1 polypeptide reduces stem cell survival and self -renewal and thereby reduces rates of therapeutic resistance and relapse.

30. The method of claim 29, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide is administered concurrently with the treatment regimen.

31. The method of claim 29, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide is administered prior to the treatment regimen.

32. The method of claim 29, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide is administered subsequently to the treatment regimen.

33. The method of claim 27, further comprising administration of the composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH1 transcript, and/or a NOTCH1 polypeptide as a maintenance dose.

34. The method of claim 27 wherein the malignancy treated is acute lymphoblastic leukemia.

35. The method of claim 34, wherein the malignancy treated is T cell acute lymphoblastic leukemia.

36. The method of claim 34, wherein the composition that inhibits or decreases the expression of or the activity of: a NOTCH1 gene, a NOTCH1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide reduces or inhibits the burden, self-renewal activity or survival of (LIC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T- ALL LIC.

37. A method to prevent relapse of T-ALL after a bone marrow transplant comprising administering to a subject in a composition that inhibits or decreases the expression of or the activity of: a NOTCH 1 gene, a NOTCH 1 gene product or a NOTCH 1 transcript, and/or a NOTCH 1 polypeptide by reducing or inhibiting the self- renewal activity or survival of (LIC), or a CD45⁺CD34⁺CD2⁺CD7⁺ and/or CD45⁺CD34⁺CD2⁺CD7^" subpopulation of T-ALL LIC.