WO2013016441A1 - Hiv integrase inhibitory oxoisoindoline sulfonamides - Google Patents

Abstract

Novel oxoisoindoline sulfonamide integrase inhibitors are useful to inhibit HIV activity, and are therefore suitable for treatment or prophylaxis of HIV infection, for example in the treatment or prevention of AIDS. In particular embodiments, the inhibitors are oxoisoindoline-4- sulfonamides, such as 6,7- dihydroxy- 1 -oxoisomdolirie-4-sulfonamides.

Description

HIV INTEGRASE INHIBITORY OXOISOINDOLINE SULFONAMIDES

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 61/511,916, filed July 26, 2011, which is incorporated by reference in its entirety.

FIELD

Compounds and pharmaceutical compositions are disclosed for use in treating or preventing retroviral infection, particularly human immunodeficiency virus (HIV) infection.

BACKGROUND

HIV is a retrovirus that causes immunosuppression in humans, and leads to a disease complex known as acquired immunodeficiency syndrome (AIDS). HIV disease is characterized by progressive functional deterioration of the immune system. The treatment of HIV disease has been significantly advanced by the recognition that combining different drugs with specific activities against different biochemical functions of the virus can reduce the rapid development of drug resistant viruses that were seen in response to single drug treatment. However, even with combined treatments, multi-drug resistant strains of the virus have emerged. There is a continuing need for the development of new anti-retroviral drugs that act specifically at different steps of the viral infection and replication cycle.

The integrase (IN) enzyme is an example of such a specific target. This enzyme catalyzes the insertion by virally-encoded integrase of proviral DNA into the host cell genome, which is the mechanism by which HIV and other retroviruses are introduced into human T- lymphoid cells. For HIV-1, this process is mediated by a 32 kD virally encoded integrase that has conserved sequences in the HIV long terminal repeats (LTR). Viral integration is believed to be mediated by integrase in three steps: assembly, cleavage and strand transfer. Assembly produces a stable nucleoprotein complex with viral DNA sequences via reverse-transcription in the cytoplasm of infected cells. Cleavage then separates two nucleotides from each of the 3' termini of the linear viral DNA ends that contain a highly conserved CA motif. During subsequent strand transfer, the recessed 3' OH termini of the viral DNA are covalently joined at a staggered cut made at the host target site. The cleaved DNA migrates to the nucleus as a part of a large nucleoprotein complex, where the integrase catalyzes the insertion of viral DNA into a host chromosome by a direct transesterification reaction.

In vitro assays have been developed to identify integrase inhibitors (see, e.g., Mazumder et al. "Retroviral Integrase: A Novel Target in Antiviral Development; Basic In Vitro Assays with the Purified Enzyme," in: Antiviral Methods and

Protocols, Kinchington et al., Ed.; The Humana Press, Inc.: Totowa, NJ, 1999, pp. 327-335; Marchand et al., "In vitro human immunodeficiency virus type I integrase assays," Methods Enzymol. 340: 624-633, 2001; and Chow, S. A., "In vitro assays for activities of retroviral integrase," Methods 12:306-17, 1997), and have permitted the discovery of diverse classes of drugs that inhibit integrase activity (see, e.g., Pommier et al., "HIV-1 integrase as a target for antiviral drugs," Antiviral Chem Chemother 8:483-503, 1997; Neamati et al., "Design and discovery of HIV-1 integrase inhibitors," Drug Discovery Today 2:487-498, 1997). See also Pommier et al., Nature Reviews, Drug Discovery 4:236-248, 2005. However, the drugs discovered by these assays have not been highly selective and potent inhibitors of the integrase enzyme. Many of these drugs have additionally been non-selective inhibitors of reverse transcriptase or HIV protease, which limits their usefulness in combination therapy directed to different specific steps of the retroviral life cycle. Moreover, a significant number of patients fail to respond to treatments with reverse transcriptase or HIV protease inhibitors, and viral resistance remains a major problem.

During the past two decades, integrase-targeted antiviral research has led to the identification of various inhibitor types, of which the most prominent scaffolds feature a diketoacid (DKA) functionality or its heterocyclic bioisosteres. These chemotypes accommodate highly selective strand transfer inhibition and have resulted in a number of investigational drugs such as raltegravir (which is presently approved for clinical use), as well as elvitegravir and S/GSK- 1349572 (which are in clinical trials). Raltegravir and elvitegravir show high potency against integrase- catalyzed strand transfer (ST) reactions, but are less inhibitory against the integrase 3'-processing (3'-P) step.

There exists a need for additional integrase inhibitors that can be useful for treating acquired immune deficiency syndrome (AIDS).

BRIEF SUMMARY OF THE DISCLOSURE

Disclosed herein are novel compounds Z of the following formula, or a tautomer or a pharmaceutically acceptable salt or ester thereof:

wherein n= 1 or 2 (and in particular examples 1), X is halogen (such as F or CI), m=0-5 (such as m=l or 2), and Y is carbonyl or (CH₂)_r wherein r=l or 2 (and in particular examples r=l). R¹ is heterocyclic, -Ci-Cg, alkyl, aryl, heteroaryl, -C₃-C₂₄ cycloalkyl, -C₃-C₂₄ heterocycloalkyl, carboxyl, amino, or an amine; R" is H or -Ci- Cg alkyl; and R is H, OH, alkoxy or aryloxyl, alkylcarbonyl or arylcarbonyl, alkylsulfonyl or arylsulfonyl, -Ci-Cg alkyl or alkenyl, -C₃-C8 cycloalkyl, or aryl; or Rl and R3 together form a heterocyclic ring (such as a 6 to 8 member ring) that contains a nitrogen, and optionally an oxygen or a carbonyl or a sulfonyl. Each if the alkyl, aryl, heteroaryl, cycloaklyl, hetercycloalkyl, amino, amine, alkoxy, aryloxy, alkylcarbonyl, arylcarbonyl, alkylsulfonyl or arylsulfonyl or heterocyclic ring can be substituted or unsubstituted. The compound may also be or Z-L-Z wherein R¹ is amine, and L comprises a C Cio (for example C Cg) polyalkyl or polyether linker between the nitrogen of each R . In some embodiments the linker L is -NR⁸(CH₂)_nNR⁸- , or L is

-NR⁸CH₂C(=0)NH(CH₂)_pO(CH₂CH₂OCH₂CH₂)_qO(CH2)_pNH(0=)CCH₂NR₈-

8 8 wherein R is H or C_1-3 alkyl, p=l-4 and q=l-4. In particular examples R is H and/or p=3 and/or q=l . In other examples the compound is Z and not Z-L-Z.

In particularly disclosed embodiments of the compound, R¹ is -NR⁵R⁶ wherein R⁵ and R⁶ are independently H , -Ci-Cg alkyl or heteroalkyl, heterocycloalkyl, carboxyl or amino. In other embodiments, m is 2-3, Y is alkyl, R^J is H or -C C₃

2 5

alkyl, R is H or -Ci-C₃ alkyl, and R is an alkylaminyl, morpholinyl, piperizinyl, pyridinyl, carboxyl, pyrrolidinyl, or indolinyl, and R⁶ is optionally H. In more

3 2 5 particular embodiments, R is H, and R is H. In other embodiments, R is -Ci-C% alkyl amine, -C Cg dialkyl amine, or -CrCg haloamine, -C Cg morpholinoalkyl, piperazinalkyl, acetic acid, pyrrolidinyl, oxoisoindoline sulfonamide, or glycyl. In other embodiments, X is F, CI or Br, for example X is F or CI and m=2.

In other disclosed embodiments, R is a lower alkyl (such as a methyl or dimethyl) sulfonamide substituted aryl group, such as

In another embodiment the compound is of the following formula

or

1 2 3

wherein m=0-5, for example 1-3, such as 1-2; R , R and R are as defined above; Xi and X₂ are halogen, for example X₁ is F and X₂ is CI; R⁵ or R⁶ is methyl, ethyl, 3-bromopropyl, morpholinyl, morpholinoethyl, piperazinethyl, methylpiperazinyl, aminoethylpiperazinyl, dimethylaminopropyl, pyridinylmethyl, acetyl,

methylaminyl, bromopropylaminyl, pyrrolidinyl, or oxoisoindolinyl. In particular embodiments, one of R⁵ or R⁶ is H or lower alkyl, such as methyl or ethyl or propyl For example, one of R⁵ or R⁶ is H or lower alkyl, such as methyl or ethyl or propyl and R⁵ and R⁶ are not the same substituent. In some embodiments both R⁵ and R⁶ are independently hydrogen, methyl, ethyl, 3-bromopropyl, morpholinyl, morpholinoethyl, piperazinethyl, methylpiperazinyl, aminoethylpiperazinyl, dimethylaminopropyl, pyridinylmethyl, acetyl, methylaminyl, bromopropylaminyl, pyrrolidinyl, or oxoisoindolinyl. 1 3

In yet other embodiments, wherein R and R together form the heterocyclic ring, the compound is

wherein and R⁶ is H , -Ci-Cg, alkyl or heteroalkyl, heterocycloalkyl, a carboxylic acid, or an amino acid; R is carbon, nitrogen, oxygen, carbonyl or sulfonyl; and p=l-3, for example 1 or 2. In particular examples, R is oxygen.

In certain embodiments the compound is contained in a pharmaceutical composition with a pharmaceutically acceptable carrier. The compounds can also be used in a method of inhibiting retrovirus proliferation by contacting a cell that is infected with a retrovirus, or at risk of being infected with a retrovirus, with an effective amount of the compound. The method may be performed in vitro, for example as part of an experimental protocol or screening assay. In other

embodiments the cell is part of a living animal, such as a human who is at risk of being infected or known to be infected with a retrovirus such as HIV- 1, in which case the method can be a method of treatment to inhibit infection or delay progression of infection by HIV-1. When used as part of a treatment method, the compound may be administered orally, or by any other effective route, such as parenterally, sublingually, intranasally, intrathecally, topically, ophthalmically or rectally administering the compound to the subject.

In yet other embodiments, the compound is used in a method of inhibiting a retroviral integrase by exposing the HIV integrase (such as an HIV-1 integrase) to an integrase inhibiting amount of the compound. The compound can be used to inhibit strand transfer catalyzed by HIV integrase, and/or inhibit incorporation of a donor strand DNA into a receiving strand DNA. The foregoing and other objects, features, and advantages of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. DETAILED DESCRIPTION

Novel oxoisoindoline sulfonamide integrase inhibitors are disclosed that inhibit HIV activity, and are therefore suitable for treatment or prophylaxis of HIV infection, for example in the treatment or prevention of AIDS. In particular embodiments, the inhibitors are oxoisoindoline-4-sulfonamides, such as 6,7- dihydroxy-l-oxoisoindoline-4- sulfonamides among many other examples disclosed herein.

For ease of understanding, the following terms used herein are described below in more detail. To the extent that any chemical structure disclosed herein refers to a term that includes a substituent, the base chemical structure could be rewritten to include the substituent as if incorporated by reference.

The term "administration" or "administering" refers to various methods of contacting a substance with an animal, such as a mammal, especially a human.

Modes of administration may include, but are not limited to, methods that involve contacting the substance intravenously, intraperitoneally, intranasally, transdermally, topically, subcutaneously, parentally, intramuscularly, orally, or systemically, and via injection, ingestion, inhalation, implantation, or adsorption by any other means. One exemplary means of administration of a compound of this disclosure is via intravenous delivery, where the compound can be formulated as a pharmaceutical composition in the form suitable for intravenous injection, such as an aqueous solution, a suspension, or an emulsion. Other means for delivering a compound of this disclosure includes intradermal injection, subcutaneous injection, intramuscular injection, or transdermal or transmucosal application as in the form of a cream, a patch, or a suppository.

"Alkoxy" refers to an -OA radical wherein A is selected from alkyl (which includes substituted and unsubstituted alkyl), cycloalkyl (which includes substituted and unsubstituted cycloalkyl), heterocycloalkyl (which includes substituted and unsubstituted heterocycloalkyl), and combinations thereof. Illustrative alkoxy radicals include methoxy, ethoxy, benzyloxy, and t-butoxy. A related term is "aryloxy" wherein Z is selected from aryl (which includes substituted and unsubstituted aryl), heteroaryl (which includes substituted and unsubstituted heteroaryl, and combinations thereof. Illustrative alkoxy radicals include phenoxy, substituted phenoxy, 2-pyridinoxy, 8-quinalinoxy, and the like. In particular examples, the term "alkoxy" refers to an alkyl ether radical containing from 1 to 24 carbon atoms.

"Alkylamino" and "alkylthio" and "alkylsulfonyl" are used in their conventional sense, and refer to alkyl groups attached to the remainder of the molecule via an amino group, a sulfur atom, or a sulfonyl group, respectively.

"Alkylcarbonyl" refers to -C(0)OR, wherein R is an alkyl group alkyl (which includes substituted and unsubstituted alkyl), a cycloalkyl (which includes substituted and unsubstituted cycloalkyl), a heteroalkyl, an arylalkyl, a

heteroarylalkyl, as defined herein.

"Alkyl" refers to a cyclic, branched, or straight chain alkyl group containing only carbon and hydrogen, and unless otherwise mentioned typically contains one to twelve carbon atoms. This term is further exemplified by groups such as methyl, ethyl, n-propyl, isobutyl, t-butyl, pentyl, pivalyl, heptyl, adamantyl, and cyclopentyl. Alkyl groups can either be unsubstituted or substituted with one or more

substituents. A -C Cg alkyl refers to an alkyl having 1 to 8 carbon atoms, and it includes a -C -C alkyl and a -Ci-C₃ alkyl.

"Alkenyl" refers to a univalent radical derived from an alkene; an

unsaturated group containing at least one carbon to carbon double bond, such as - CH₂CH=CHCH₃. A -C Cg alkenyl refers to an alkyl having 1 to 8 carbon atoms, and it includes a -Ci-C6 alkenyl and a -C C₃ alkenyl.

The term "alkylene" by itself or as part of another substituent means a divalent radical derived from an alkane, as exemplified by -CH₂CH₂CH₂CH₂-, and further includes those groups described below as "heteroalkylene." Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present disclosure. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, generally having eight or fewer carbon atoms. Alkylene groups can either be unsubstituted or substituted with one or more substituents.

"Amine" refers to the group -NZ 1 Z2 wherein each of Z 1 and Z2 is

independently selected from hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, alkoxy, aryloxy, and

combinations thereof.

An "analog" is a molecule that differs in chemical structure from a parent compound, for example a homolog (differing by an increment in the chemical structure, such as a difference in the length of an alkyl chain), a molecular fragment, a structure that differs by one or more functional groups, or a change in ionization. Structural analogs are often found using quantitative structure activity relationships (QSAR), with techniques such as those disclosed in Remington: The Science and Practice of Pharmacology , 19^th Edition (1995), chapter 28. A derivative is a biologically active molecule derived from the base structure.

An "animal" is a living multicellular vertebrate organism, a category that includes, for example, mammals and birds. A "mammal" includes both human and non-human mammals. "Subject" includes both human and animal subjects. A "subject infected with HIV" is a subject who has clinical signs and symptoms consistent with an HIV infection, or a subject who has received a laboratory diagnosis of HIV infection. A "subject at risk of infection with HIV" is a subject who is a member of a group at high risk for HIV infection (such as an IV drug user or a sexually active individual with many sexual partners who engages in unprotected intercourse).

"Aryl" refers to an aromatic substituent that may be a single aromatic ring or multiple aromatic rings (for example up to three or four rings) that are fused together, linked covalently, or linked to a common group such as a methylene or ethylene moiety. The common linking group may also be a carbonyl as in benzophenone or oxygen as in diphenylether or nitrogen in diphenylamine. The aromatic ring(s) may include phenyl, naphthyl, biphenyl, diphenylether, diphenylamine and benzophenone among others. In particular examples, aryls have between 1 and 20 carbon atoms. The rings may be substituted or unsubstituted.

"Arylcarbonyl" refers to an aryl ring substituted with a carbonyl, such as AR-C(=0)-R (for example where R is H or lower alkyl) or in which the carbonyl can for example be a linking group between multiple aromatic rings, as in benzophenone.

"Aryloxy" refers to a univalent radical of the form AR-O- where AR is an aryl group. When used in combination with other terms (such as aryloxy, arylthioxy, arylsulfonyl, arylalkyl) the term aryl includes both aryl and heteroaryl rings. The rings may be further substituted or not.

"Arylsulfonyl" refers to an aryl ring substituted with a sulfonyl group, such as AR-S0₂R, for example wherein R is H or lower alkyl.

"Carbonyl" refers to a carbon atom double-bonded to an oxygen atom, i.e.

C=0.

"Carboxyl" refers to R(0)CO-, wherein R is a hydrogen atom, an alkyl group, a cycloalkyl, an aryl group, a heteroalkyl, a heterocycloalkyl or an heteroaryl ring, as defined herein. In particular disclosed examples, R is H or methyl.

"Cycloalkyl" refers to a saturated or unsaturated cyclic non-aromatic hydrocarbon radical having a single ring or multiple condensed rings. Illustrative cycloalkyls include cyclopentyl, cyclohexyl, bicyclooctyl, and the like. A C₃-C₈ cycloalkyl contains 3-8 carbon atoms in its ring atoms. In certain examples herein, the C₃-C₈ cycloalkyl is a C5, C₆, C₇ or Cg cycloalkyl.

An "effective amount" of a certain substance refers to an amount of the substance that is sufficient to effectuate a desired result. For instance, an effective amount of a compound of this disclosure that is intended to inhibit the activity of an integrase of a retrovirus is an amount sufficient to achieve the goal of inhibiting the integrase when administered to a cell exposed to (or at risk of being exposed to) the retrovirus. The effect to be achieved may include the prevention, correction, or inhibition of progression of the symptoms of a disease/condition caused by infection by this retrovirus and related complications to any detectable extent. The exact quantity of an "effective amount" will depend on the purpose of the administration, and can be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).

"Halogen" refers to fluoro, bromo, chloro and iodo substituents.

Additionally, terms such as "haloalkyl," are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(C₁-C4)alkyl" is mean to include trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like. "Haloalkylamine" refers to an amine substituted with a haloalkyl group, such as an amine in which one of its R groups is propylbromine. A "-C Cg haloalkylamine" refers to a haloalkylmine having 1 to 8 carbons, and includes a -C C₃

haloalkylamine within its scope.

"Heteroalkyl" refers to an alkyl as described above in which one or more hydrogen or carbon atom of the alkyl is replaced by a heteroatom such as N, O, P, B or S. An alkyl substituted with a heterocycloalkyl, substituted heterocycloalkyl, heteroaryl, substituted heteroaryl, alkoxy, aryloxy or amino is included within "heteroalkyl." Illustrative heteroalkyls include cyano, benzoyl, 2-pyridyl, 2-furyl, and the like.

"Heteroaryl" refers to aromatic rings in which one or more carbon atoms of the aromatic ring(s) are replaced by a heteroatom(s) such as N, O, P, B or S.

Heteroaryl refers to structures that may be a single aromatic ring, multiple aromatic rings or one or more aromatic rings coupled to one or more nonaromatic rings. Illustrative heteroaryls include, for example, thiophene, pyridine, isoxazole, phthalimide, pyrazole, indole, furan, and the like. In particular examples, the term "heteroaryl" refers to aryl groups (or rings) that contain from one to four

heteroatoms selected from N, O, and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1- naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2- imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5- oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5- thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2- pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1- isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6- quinolyl.

As used herein, the term "heteroatom" is meant to include oxygen (O), nitrogen (N), sulfur (S) and silicon (Si).

"Heterocycloalkyl" refers to a cycloalkyl radical as described above in which one or more of the carbon atoms of the cyclic radical is replaced by a heteroatom such as N, O, P, B or S. Illustrative hetercycloalkyls include, for example, piperazinyl, morpholinyl, tetrahydropyranyl, tetrahydrofuranyl, piperidinyl, pyrrolindinyl, oxazolinyl, and the like.

"Heterocyclyl" or "heterocyclic" refers to a cyclic compound that has atoms of at least two different elements as members of its rings, in contrast to a homocyclic compound in which the rings contain only a single element. The heterocyclic ring in some embodiments is a saturated or unsaturated non-aromatic or aromatic cyclic or multicyclic radical of 3 to 24 ring atoms in which one or two ring atoms are heteroatoms selected from O, NR (where R is independently hydrogen or alkyl) or S(0)n (where n is an integer from 0 to 2), the remaining ring atoms being C, where one or two C atoms may optionally be replaced by a carbonyl group. The heterocyclyl ring may be optionally substituted independently with one, two, or three substituents, for example substituents such as alkyl, cycloalkyl, cycloalkyl- alkyl, halo, nitro, cyano, hydroxy, alkoxy, amino, mono-alkylamino, di-alkylamino, haloalkyl, haloalkoxy, -COR (where R is hydrogen, alkyl, cycloalkyl, cycloalkyl- alkyl, phenyl or phenylalkyl), -(CR'R")_n-COOR (n is an integer from 0 to 5, R' and

R" are independently hydrogen or alkyl, and R is hydrogen, alkyl, cycloalkyl,

x y

cycloalkyl-alkyl, phenyl or phenylalkyl), or -(CR'R")n-CONR R (where n is an

x y integer from 0 to 5, R' and R" are independently hydrogen or alkyl, R and R are, independently of each other, hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, phenyl or phenylalkyl). More specifically the term heterocyclyl includes, but is not limited to morpholinyl, morpholinoethyl, piperazinethyl, methylpiperazinyl,

aminoethylpiperazinyl, pyridinylmethyl, pyrrolidinyl, or oxoisoindolinyl, and the derivatives thereof. The subscript indicating the number of carbon atoms (e.g. , C₃-

C₁₀) refers to the total number of carbon atoms in the portion of the cycloheteroalkyl or heterocyclyl group exclusive of the number of heteroatoms. A -C Cg includes within its scope a lesser number of carbons, such as a -Q-C3 group.

The term "inhibit," "inhibiting," or "inhibition," when used in the context of how the activity of a retroviral integrase, e.g., HIV- 1 integrase, is affected, refers to any detectable negative change or decrease in quantity of a parameter that reflects the activity of a retroviral integrase, compared to a standard value. The level of this decrease, for example, in the activity of HIV-1 integrase under a given condition following exposure to compounds of the present disclosure from the same enzyme under the same condition not exposed to the compound or exposed to only a control compound having no known anti-integrase activity, is preferably at least 10% or 20%, and more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90%, and most preferably 100%.

"Substituted alkyl" refers to an alkyl as described above in which one or more hydrogen or carbon atom of the alkyl is replaced by another group such as a halogen, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, and combinations thereof. Illustrative substituted alkyls include benzyl, trichloromethyl, and the like.

"Substituted aryl" refers to an aryl radical as described above in which one or more hydrogen atom is replaced by one or more functional groups such as alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, halogen, alkylhalos, hydroxy, amino, alkoxy, and thio. Illustrative substituted aryls include chlorophenyl, 3,5-dimethylphenyl, 2,6-diisopropylphenyl, and the like.

"Substituted cycloalkyl" refers to cycloalkyl as described above in which one or more hydrogen or carbon atom is replaced by another group such as a halogen, aryl, substituted aryl, alkoxy, aryloxy, amino, and combinations thereof.

"Substituted heteroaryl" refers to a heteroaryl radical as described above in which one or more hydrogen or carbon atom is replaced by one or more functional groups such as alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, halogen, alkylhalos, hydroxy, amino, alkoxy, and thio.

"Substituted heterocycloalkyl" refers to a heterocycloalkyl radical as described above in which one or more hydrogen or carbon atom is replaced by another group such as a halogen, aryl, substituted aryl, alkoxy, aryloxy, amino, and combinations thereof.

Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be a variety of groups selected from: -OR', =0, =NR', =N-OR', -NR'R", -SR', -halogen, - SiR'R"R"', -OC(0)R', -C(0)R\ -C0₂R', -CONR'R", -OC(0)NR'R", -NR"C(0)R', -NR'-C(0)NR"R"', -NR"C(0)₂R', -NH-C(NH₂)=NH, -NR' C(NH₂)=NH, -NH- C(NH₂)=NR', -S(0)R', -S(0)₂R', -S(0)₂NR'R", -CN and -N0₂ in a number ranging from zero to (2m'+l), where m' is the total number of carbon atoms in such radical. R', R" and R'" each independently refer to hydrogen, unsubstituted (C Cs) alkyl and heteroalkyl, unsubstituted aryl, aryl substituted with 1-3 halogens, unsubstituted alkyl, alkoxy or thioalkoxy groups, or aryl-(C₁-C₄)alkyl groups. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, -NR'R" is meant to include 1- pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term "alkyl" is meant to include groups such as haloalkyl (e.g., -CF₃ and -CH₂CF₃) and acyl (e.g., -C(0)CH₃, -C(0)CF₃, - C(0)CH₂OCH₃, and the like).

Similarly, substituents for the aryl and heteroaryl groups are varied and are selected from: -halogen, -OR', -OC(0)R', -NR'R", -SR', -R', -CN, -N0₂, -C0₂R', - CONR'R", -C(0)R', -OC(0)NR'R", -NR"C(0)R', -NR"C(0)₂R', ,-NR'- C(0)NR"R"', -NH-C(NH₂)=NH, -NR'C(NH₂)=NH, -NH-C(NH₂)=NR', -S(0)R', - S(0)₂R', -S(0)₂NR'R", -N₃, -CH(Ph)₂, perfluoro(C₁-C₄)alkoxy, and perfluoro(Ci- C₄) alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R', R" and R'" are independently selected from hydrogen, (C Cg) alkyl and heteroalkyl, unsubstituted aryl and heteroaryl,

(unsubstituted aryl)-(C₁-C₄) alkyl, and (unsubstituted aryl)oxy-(C₁-C₄) alkyl.

A "therapeutically effective amount" is an amount effective to reduce or lessen at least one symptom of the disease being treated or to reduce or delay onset of one or more clinical markers or symptoms of the disease.

"Thio" refers to the group -SZ 1 Z2 wherein each of Z 1 and Z2 is independently selected from hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, alkoxy, aryloxy, and combinations thereof.

The above term descriptions are provided solely to aid the reader, and should not be construed to have a scope less than that understood by a person of ordinary skill in the art.

The terms "pharmaceutically acceptable salt or ester" refers to salts or esters prepared by conventional means that include salts, e.g., of inorganic and organic acids, including but not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, malic acid, acetic acid, oxalic acid, tartaric acid, citric acid, lactic acid, fumaric acid, succinic acid, maleic acid, salicylic acid, benzoic acid, phenylacetic acid, mandelic acid and the like. "Pharmaceutically acceptable salts" of the presently disclosed compounds also include those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc, and from bases such as ammonia, ethylenediamine, N- methyl-glutamine, lysine, arginine, ornithine, choline, Ν,Ν'- dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N- benzylphenethylamine, diethylamine, piperazine,

tris(hydroxymethyl)aminomethane, and tetramethylammonium hydroxide. These salts may be prepared by standard procedures, for example by reacting the free acid with a suitable organic or inorganic base. Any chemical compound recited in this specification may alternatively be administered as a pharmaceutically acceptable salt thereof. "Pharmaceutically acceptable salts" are also inclusive of the free acid, base, and zwitterionic forms. Descriptions of suitable pharmaceutically acceptable salts can be found in Handbook of Pharmaceutical Salts, Properties, Selection and Use, Wiley VCH (2002). When compounds disclosed herein include an acidic function such as a carboxy group, then suitable pharmaceutically acceptable cation pairs for the carboxy group are well known to those skilled in the art and include alkaline, alkaline earth, ammonium, quaternary ammonium cations and the like. Such salts are known to those of skill in the art. For additional examples of

"pharmacologically acceptable salts," see Berge et al., J. Pharm. Sci. 66: 1 (1977).

"Pharmaceutically acceptable esters" includes those derived from

compounds described herein that are modified to include a hydroxy or a carboxyl group. An in vivo hydrolysable ester is an ester, which is hydrolysed in the human or animal body to produce the parent acid or alcohol. Suitable pharmaceutically acceptable esters that include a carboxyl group include C_1-6 alkoxymethyl esters for example methoxy-methyl, C_1-6 alkanoyloxymethyl esters for example

pivaloyloxymethyl, phthalidyl esters, C₃_g cycloalkoxycarbonyloxy, Ci_6 alkyl esters for example 1-cyclohexylcarbonyl-oxyethyl; l,3-dioxolen-2-onylmethyl esters for example 5-methyl-l,3-dioxolen-2-onylmethyl; and C_1-6 alkoxycarbonyloxyethyl esters for example 1-methoxycarbonyl-oxyethyl which may be formed at any carboxy group in the compounds.

An in vivo hydrolysable ester containing a hydroxy group includes inorganic esters such as phosphate esters and a-acyloxyalkyl ethers and related compounds which as a result of the in vivo hydrolysis of the ester breakdown to give the parent hydroxy group. Examples of a-acyloxyalkyl ethers include acetoxy-methoxy and 2,2-dimethylpropionyloxy-methoxy. A selection of in vivo hydrolysable ester forming groups for hydroxy include alkanoyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl, alkoxycarbonyl (to give alkyl carbonate esters), dialkylcarbamoyl and N-(dialkylaminoethyl)-N-alkylcarbamoyl (to give

carbamates), dialkylaminoacetyl and carboxyacetyl. Examples of substituents on benzoyl include morpholino and piperazino linked from a ring nitrogen atom via a methylene group to the 3- or 4-position of the benzoyl ring.

For therapeutic use, salts of the compounds are those wherein the counter-ion is pharmaceutically acceptable. However, salts of acids and bases which are non- pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.

The pharmaceutically acceptable acid and base addition salts as mentioned hereinabove are meant to comprise the therapeutically active non-toxic acid and base addition salt forms which the compounds are able to form. The pharmaceutically acceptable acid addition salts can conveniently be obtained by treating the base form with such appropriate acid. Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g. hydrochloric or hydrobromic acid, sulfuric, nitric, phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic (i.e. ethanedioic), malonic, succinic (i.e. butanedioic acid), maleic, fumaric, malic (i.e. hydroxybutanedioic acid), tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cyclamic, salicylic, p-aminosalicylic, pamoic and the like acids. Conversely said salt forms can be converted by treatment with an appropriate base into the free base form.

The compounds containing an acidic proton may also be converted into their non-toxic metal or amine addition salt forms by treatment with appropriate organic and inorganic bases. Appropriate base salt forms comprise, for example, the ammonium salts, the alkali and earth alkaline metal salts, e.g. the lithium, sodium, potassium, magnesium, calcium salts and the like, salts with organic bases, e.g. the benzathine, N-methyl-D-glucamine, hydrabamine salts, and salts with amino acids such as, for example, arginine, lysine and the like.

The term "addition salt" as used hereinabove also comprises the solvates which the compounds described herein are able to form. Such solvates are for example hydrates, alcoholates and the like.

The term "quaternary amine" defines the quaternary ammonium salts which the compounds are able to form by reaction between a basic nitrogen of a compound and an appropriate quaternizing agent, such as, for example, an optionally substituted alkylhalide, arylhalide or arylalkylhalide, e.g. methyliodide or benzyliodide. Other reactants with good leaving groups may also be used, such as alkyl trifluoromethanesulfonates, alkyl methanesulfonates, and alkyl p- toluenesulfonates. A quaternary amine has a positively charged nitrogen. Pharmaceutically acceptable counterions include chloro, bromo, iodo,

trifluoroacetate and acetate. The counterion of choice can be introduced using ion exchange resins.

A "physiologically acceptable excipient" is an inert ingredient used in the formulation of a composition of this disclosure, which contains the active ingredient(s) of a compound of this disclosure and is suitable for use, e.g., by injection into a patient in need thereof. This inert ingredient may be a substance that, when included in a composition of this disclosure, provides a desired pH, consistency, color, smell, or flavor of the composition.

The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. The word "comprises" indicates "includes." It is further to be understood that all molecular weight or molecular mass values given for compounds are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All chemical compounds disclosed herein include both the (+) and (-) stereoisomers (as well as either the (+) or (-)

stereoisomer), and any tautomers thereof.

I. Integrase inhibitors

A new class of sulfonamide integrase inhibitors is disclosed herein, such as oxoisoindoline-4-sulfonamides, for example dihydroxy-L-oxoisoindoline-4- sulfonamides that inhibit HIV-1 replication in cell culture at low nanomolar concentrations. Such agents are believed to be useful both in vitro and in vivo as HIV-1 integrase inhibitors to overcome at least some types of resistance of HIV to other integrase inhibitors such as Raltegravir-resistance. Some of the present compounds were developed using as a starting material the compound 2-(3-chloro- 4-fluorobenzyl)-6,7-dihydroxyisoindolin-l-one contained in the inventors' prior PCT WO2009/026248 (compound 27e) into which a sulfonamide functionality was introduced to form a new series of inhibitors. Tests in vitro and in vivo found that certain of the new analogs, such as 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N- dimethyl- l-oxoisoindoline-4- sulfonamide, show EC₅₀ values as low as 10 nM using a one-round HIV-1 vector in cell culture-based assays and a selectivity index (the ratio of cytotoxic CC₅₀ value to EC₅₀ value) of over 600.

Certain disclosed integrase inhibitors are a compound Z of the formula, or a tautomer or a harmaceutically acceptable salt or ester thereof:

wherein n=l or 2 (for example n=l); X is halogen and m=0-5; Y is carbonyl or (CH₂)_r wherein r=l or 2 (for example r=l); R¹ is independently heterocyclic, -Ci-Cg, alkyl (including -CrC₃ alkyl), aryl, heteroaryl, -C₃-C₂₄ cycloalkyl (including -C₃-C₁₂ or -C₃-C₆ or C₆ cycloalkyl), -C₃-C₂₄ heterocycloalkyl (including -C₃-C₁₂ or -C₃-C₆ or C heterocycloalkyl) , carboxyl, an amino acid, or an amine; R" is H or -Ci-C₈ alkyl (including -CrC₆ or -CrC₃ alkyl) ; and R is H, OH, alkoxy or aryloxyl, alkylcarbonyl or arylcarbonyl, alkylsulfonyl or arylsulfonyl, -Ci-Cg alkyl (including -Ci-C or -Q-C3 alkyl) or alkenyl (including -C -C or -Q-C3 alkenyl), -C₃-Cg cycloalkyl (including -C₃-C₆ or C₆ cycloalkyl), or aryl, and in one particular example R₃ is an alkyl or dialkyl sulfonamide substituted aryl (where the alkyl is a C_1-3 alkyl, particularly a C_1-2 or CI) such as

d R³ together form a heterocyclic ring that contains a nitrogen, and optionally an oxygen or a carbonyl or a sulfonyl. Alternatively, the compound is Z-L-Z wherein wherein R¹ is amine, and L comprises a Q-CK) polyalkyl or polyether linker between the nitrogen of each R¹. In some embodiments the linker L is -NR⁸(CH₂)_nNR⁸- , or L is -NR⁸CH₂C(=0)NH(CH₂)_pO(CH₂CH₂OCH₂CH₂)_qO(CH2)_pNH(0=)CCH₂NR₈-

8 8 wherein R is H or Ci_3 alkyl, p=l-4 and q=l-4. In particular examples R is H and/or p=3 and/or q=l . In other examples the compound is Z and not Z-L-Z.

In some embodiments R¹ is the amine -NR⁵R⁶ wherein at least one or both R⁵ and R⁶ is H ,

(including -C]_-C or -Q-C₃) alkyl, heteroalkyl, or heteroc cloalkyl, or a carboxyl, or amino.

In certain examples, one of R⁵ and R⁶ is H, for example R⁵ is H and R⁶ is -Q-C₃ alkyl, haloalkyl (such -Q-C₃ haloalkyl, such as halopropyl, for example

bromopropyl).

The number of halogen substitutions (X_m) on the ring can vary, but in certain examples m is 2-3. In some examples Y is alkyl (for example CH₂), R is H or -C -

2 5 C₃ alkyl (for example CH₃), R is H or -Q-C₃ alkyl (for example CH ), and R is an alkylaminyl, morpholinyl, piperizinyl, pyridinyl, carboxyl, pyrrolidinyl, or indolinyl.

3 2 5

In particularly illustrated examples, R is H and R is H. In other examples, R is - Ci-Cg (for example -Q-C₃) alkyl amine, or example -Q-C₃) dialkyl amine, or -C Cg (for example -Q-C₃) haloamin

morpholinyl or morpholinylalkyl, piperizinyl or piperazinalkyl, acetyl, pyrrolidinyl, oxoisoindolinyl sulfonamide, or glycyl. In particular examples the halogen X is F, CI or Br, and particularly F or CI, for example F and CI when there are only two halogen substituents on the ring (m=2). In particular examples the halogens are at the 3,4 positions on the ring. In certain examples of 3,4-halogens, the compound is of the following formulas:

wherein XI and X2 are halogen. In particular examples, the CI is at position 3 and the F is at position 4 (wherein Xi is F and X₂ is CI). R⁵ or R⁶ is methyl, ethyl, 3- bromopropyl, substituted or unsubstituted morpholinyl, morpholinoethyl, substituted or unsubstituted piperazinethyl, methylpiperazinyl, aminoethylpiperazinyl, dimethylaminopropyl, pyridinylmethyl, acetyl, methylamine, bromopropylamine, pyrrolidinyl, or oxoisoindolinyl.

-22-

wherein R⁴ is H or C_1-3 alkyl, and n=0-5.

In particular examples, the compound is 2-(3-chloro-4-fluorobenzyl)-6,7- dihydroxy-N-methyl-l-oxoisoindoline-4-sulfonamide; N-(3-bromopropyl)-2-(3- chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindoline-4-sulfonamide; 2-(3-chloro- 4-fluorobenzyl)-6,7-dihydroxy-N-(2-morpholinoethyl)-l-oxoisoindoline-4- sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxo-N-(2-(piperazin-l- yl)ethyl)isoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-N-(3- (dimethylamino)propyl)-6,7-dihydroxy-l-oxoisoindoline-4-sulfonamide; 2-(3- chloro-4-fluorobenzyl)-N-(3-(dimethylamino)propyl)-7-hydroxy-6-methoxy-l- oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxo-N- (pyridin-2-ylmethyl)isoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-7- hydroxy-6-methoxy-l-oxo-N-(pyridin-2-ylmethyl)isoindoline-4-sulfonamide; 2- (2- (3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindoline-4-sulfonamido)acetic acid; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide; 2-(3-chloro-4-fluorobenzyl)-N,N-diethyl-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-4- (morpholinosulfonyl)isoindolin-l-one; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy- 4-((4-methylpiperazin-l-yl)sulfonyl)isoindolin-l-one; 4-((4-(2- aminoethyl)piperazin-l-yl)sulfonyl)-2-(3-chloro-4-fluorobenzyl)-6,7- dihydroxyisoindolin-l-one; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonic acid; l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindolin-4-yl)sulfonyl)pyrrolidine-2-carboxylic acid; l-((2-(3-chloro-4- fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4-yl)sulfonyl)pyrrolidine-2-carboxylic acid; l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carboxylic acid; l-(l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carbonyl)pyrrolidine-2-carboxylic acid; l-(l-(l-(l-(l-((2-(3-chloro-4-fluorobenzyl)- 6,7-dihydroxy-l-oxoisoindolin-4-yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carboxylic acid; N,N'-(propane-l,3-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide); N,N'-(butane-l,4-diyl)bis(2-(3-chloro-4- fluorobenzyl)-6,7-dihydroxy- 1 -oxoisoindoline-4-sulfonamide) ; N,N'-(pentane- 1,5- diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindoline-4- sulfonamide); or N,N'-(hexane-l,6-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7- dihydroxy-l-oxoisoindoline-4- sulfonamide); 2-(3-Chloro-4-fluorobenzyl)-6,7- dihydroxy-N,N,5-trimethyl-l-oxoisoindoline-4-sulfonamide; 5-Butyl-2-(3-chloro-4- fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide; 2-(3- Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-N,N-dimethyl-l-oxoisoindoline- 4- sulfonamide; 2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-4- (morpholinosulfonyl)isoindolin-l-one; 2-(3-Chloro-4-fluorobenzyl)-5,6,7- trihydroxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide; 2-(3-Chloro-4- fluorobenzyl)-5-(4-(N,N-dimethylsulfamoyl)phenyl)-6,7-dihydroxy-N,N-dimethyl- l-oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorophenethyl)-6,7-dihydroxy- N,N-dimethyl-l-oxoisoindoline-4-sulfonamide; 2-(4-fluorophenethyl)-6,7- dihydroxy-N,N-dimethyl- l-oxoisoindoline-4-sulfonamide; 2-(3-chloro-4- fluorobenzyl)-7,8-dihydroxy-N,N-dimethyl-l-oxo-l,2,3,4-tetrahydroisoquinoline-5- sulfonamide; N,N'-(((oxybis(ethane-2,l-diyl))bis(oxy))bis(propane-3,l-diyl))bis(2- (2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl-l-oxoisoindoline-4- sulfonamido)acetamide).

In yet other examples that contain R 1 and R3 , the R3 is hydroxyl, or R 1 and R together form a heterocyclic ring. For example the compound is

wherein and R⁶ is H , -C Cg alkyl or heteroalkyl, heterocycloalkyl, a carboxyl, amino; R is carbon, nitrogen, oxygen, carbonyl or sulfonyl and p=l-3 and in particular examples 1-2. Yet other examples that have particularly good anti-integrase activity include one or more of:

II. Synthesis of 6,7-dihydroxy-l-oxoisoindoline-4-sulfonamides HIV-1 Integrase Inhibitors

This section illustrates the synthesis of some of the oxoisoindoline-4- sulfonamide compounds disclosed and claimed here, beginning with the 3-chloro-4- fluorobenzyl analogue 27e from PCT WO2009/026248.

General synthetic methods

1 13

The H and ^1JC NMR data were obtained on a Varian 400 MHz spectrometer and are reported in ppm relative to TMS and referenced to the solvent in which the spectra were collected. Solvent was removed by rotary evaporation under reduced pressure and anhydrous solvents were obtained commercially and used without further drying. Purification by silica gel chromatography was performed using EtOAc-hexanes. Preparative high pressure liquid chromatography (HPLC) was conducted using a Waters Prep LC4000 system having photodiode array detection and Phenomenex Cig columns (250 mm x 21.2 mm, 10 μιη particle size, 110 A pore) at a flow rate of 10 mL/min. A binary solvent systems consisting of A = 0.1% aqueous TFA and B = 0.1% TFA in acetonitrile was employed with gradients as indicated. Products were obtained as amorphous solids following lyophilization. Electrospray ionization-mass spectra (ESTMS) and atmospheric pressure chemical ionization-mass spectra (APCI-MS) were acquired using an Agilent LC/MSD system equipped with a multimode ion source. Matrix-assisted laser

desorption/ionization (MALDI) mass spectra were acquired on a Shimadzu Biotech Axima-CFR time-of-flight instrument using a-cyano-4-hydroxycinnamic acid as matrix. High-resolution mass spectra (HRMS) were obtained from the UCR Mass Spectrometry Facility, University of California at Riverside. General Synthesis Procedure A for compounds 1-15

Scheme 1. Synthesis of analogues

Compound 2,3-dihydro-6,7-dimethoxy-2-[(3-chloro-4-fluorophenyl)methyl]- lH-isoindol-l-one (4 mmol) was added to sulfurochloridic acid (4 ml). The dark mixture was stirred at rt for 1 hour. The mixture was diluted by chloroform (150 mL) and quenched by pouring into ice. Organic phase was separated and dried by sodium sulfate. Filtered and concentrated, the afforded brown oil was used for next step without further purification. 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-l- oxoisoindoline-4-sulfonyl chloride (2.8 mmol, 70 % yield). ¹H NMR (400 MHz, CDC1₃) δ 7.53 (s, 1H), 7.35 (dd, J = 6.9, 2.2 Hz, 1H), 7.18 (ddd, J = 8.4, 4.5, 2.2 Hz, 1H), 7.08 (t, J = 8.6 Hz, 1H), 4.67 (s, 2H), 4.51 (s, 2H), 4.24 (s, 3H), 3.94 (s, 3H). 1³C NMR (101 MHz, CDC1₃) δ 164.48, 157.76 (d, J = 249.6 Hz), 153.42, 152.61, 133.64, 133.30 (d, J = 4.0 Hz), 131.73, 130.41, 128.04 (d, J = 7.4 Hz), 125.00, 121.50 (d, J = 18.0 Hz), 117.00 (d, J = 21.3 Hz), 113.87, 63.19, 57.06, 48.34, 45.52.

The 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-l-oxoisoindoline-4-sulfonyl chloride (0.2 mmol) was dissolved in DCM (1 mL). Amine (0.4 mmol) [or Amine (0.2 mmol) with triethylamine (0.4 mmol)] was added at rt. After 30 min, the solvent was evaporated. The formed residue was pumped to dry.

The residue was dissolved in DCM (1 mL) and BBr₃ (1.6 mmol, 1.0 M in DCM) was added. After 1 hour stirring, the reaction was quenched by ice. The formed suspension was filtered and the solid was collected. The solid was further purified by HPLC. Compound 1

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl-l-oxoisoindoline-4- sulfonamide

Chemical Formula: C-ieH^CIFI^OsS

Molecular Weight: 400.81

Purification was carried out by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 22.7 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.11 (bs, 1H), 9.83 (bs, 1H), 7.50 - 7.48 (m, 1H), 7.38 - 7.34 (m, 1H), 7.30 - 7.29 (m, 1H), 7.23 (s, 1H), 4.62 (s, 2H), 4.38 (s, 2H), 2.33 (d, J= 5.1 Hz, 2H). MALDI-MS m/r. 400.92 (M+H⁺). HRMS calcd for C₁₆Hi5N₂05FSCl [MH⁺]:401.0369. Found:401.0375.

Compound 2

N-(3-bromopropyl)-2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide

Chemical Formula: C₁₈H₁₇BrCIFN₂0₅S

Molecular Weight: 507.76

Purification was carried out by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 27.8 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 7.57 (t, J = 5.8 Hz, 1H), 7.47 (dd, J = 7.1, 1.9 Hz, 1H), 7.35 (t, J = 8.9 Hz, 1H), 7.25 (s, 1H), 4.62 (s, 2H), 4.39 (s, 2H), 3.39 (t, J = 6.4 Hz, 2H), 2.78 (dd, J = 12.7, 6.6 Hz, 2H), 1.83 - 1.73 (m, 2H). ¹³C NMR (101 MHz, DMSO-d₆) δ 166.77, 156.96 (d, J = 246.1 Hz), 147.64, 145.59, 135.78 (d, J = 3.7 Hz), 131.56, 130.30, 128.93 (d, J = 7.6 Hz), 124.78, 119.98 (d, J = 17.8 Hz), 118.77, 117.67, 117.57 (d, J = 21.0 Hz), 49.26, 44.44, 41.03, 32.44, 32.19. ESI-MS m/z: 508.9 (M+H⁺).

Compound 3

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-(2-morpholinoethyl)-l- oxoisoindoline-4-sulfonamide

Chemical Formula: C2i H₂3CIFN₃0₆S

Molecular Weight: 499.94

Purification was carried out by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 20% B to 45% B over 30 minutes; retention time = 23.2 minutes).

MALDI-MS m/z: 500.48 (M+H⁺). ESI-MS m/z: 500.0 (M+H⁺).

Compound 4

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxo-N-(2-(piperazin-l- yl)ethyl)isoindoline-4-sulfonamide

Chemical Formula: C2i H₂₄CIFN₄0₅S

Molecular Weight: 498.96

Purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 20% B to 35% B over 30 minutes; retention time = 25.6 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.31 (bs, 1H), 10.04 (bs, 1H), 7.52 - 7.47 (m, 1H), 7.37 - 7.33 (m, 1H), 7.28 - 7.24 (m, 1H), 7.16 (s, 1H), 4.61 (s, 2H), 4.39 (s, 2H), 2.91 - 2.84 (m, 6H), 2.54 - 2.45 (m, 6H). MALDI-MS m/r. 499.13 (M+H⁺).

Compound 5

2-(3-chloro-4-fluorobenzyl)-N-(3-(dimethylamino)propyl)-7-hydroxy-6- methoxy-l-oxoisoindoline-4-sulfonamide

Chemical Formula: C20H23CIFN3O5S

Molecular Weight: 471.93

Purification was carried out by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 20% B to 50% B over 30 minutes; retention time = 21.3 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.15 (s, 1H), 9.88 (s, 1H), 7.60 (t, J = 6.0 Hz, 1H), 7.49 (dd, J = 7.2, 2.0 Hz, 1H), 7.37 (t, J = 8.8 Hz, 1H), 7.29 - 7.25 (m, 1H), 7.24 (s, 1H), 4.63 (s, 2H), 4.39 (s, 2H), 2.95 (m, 2H), 2.72 - 2.70 (m, 2H), 2.67 (s, 6H), 1.69 - 1.62 (m, 2H). MALDI-MS m/z: 472.13 (M+H⁺). ESI-MS m/z: 472.0 (M+H⁺), 494.0 (M+Na⁺).

Compound 6

2-(3-chloro-4-fluorobenzyl)-N-(3-(dimethylamino)propyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide

Chemical Formula: C21 H25CIFN3O5S

Molecular Weight: 485.96

Purification was carried out by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 20% B to 50% B over 30 minutes; retention time = 22.9 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.16 (s, 1H), 7.65 (t, J = 6.0 Hz, 1H), 7.49 (dd, J = 7.2, 2.0 Hz, 1H), 7.37 (t, J = 8.8 Hz, 1H), .33 (s, 1H), 7.29 - 7.27 (m, 1H), 4.63 (s, 2H), 4.42 (s, 2H), 3.84 (s, 3H), 2.95 (m, 2H), 2.75 - 2.71 (m, 2H), 2.68 (s, 6H), 1.68 - 1.64 (m, 2H). MALDI-MS m/z: 486.13 (M+H⁺). ESI-MS m/z: 486.1 (M+H⁺), 508.0 (M+Na⁺). Compound 7

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxo-N-(pyridin-2- ylmethyl)isoindoline-4-sulfonamide

Chemical Formula: C2i H ₇CIFN₃0₅S

Molecular Weight: 477.89

Purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 13.1 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.06 (bs, 1H), 9.80 (bs, 1H), 8.32 (d, J = 4.2 Hz, 1H), 8.23 (t, J = 6.4 Hz, 1H), 7.72 (t, J = 1.6 Hz, 1H), 7.48 (dd, J = 7.2, 2.2 Hz, 1H), 7.37 (t, J = 9.0 Hz, 1H), 7.29 - 7.23 (m, 3H), 7.21 (s, 1H), 4.61 (s, 2H), 4.37 (s, 2H), 4.07 (d, J = 6.2 Hz, 2H). MALDI-MS m/z: 478.13 (M+H⁺).

Compound 8

2-(3-chloro-4-fluorobenzyl)-7-hydroxy-6-methoxy-l-oxo-N-(pyridin-2- ylmethyl)isoindoline-4-sulfonamide

Chemical Formula: C22H-19CIFN3O5S

Molecular Weight: 491.92

Purification was carried out by preparative HPLC (as indicated in the

General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 14.6 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 8.27 - 8.24 (m, 2H), 7.62 (td, J = 8.0, 2.1 Hz, 1H), 7.48 (dd, J = 7.1, 2.0 Hz, 1H), 7.40 - 7.36 (m, 1H), 7.29 - 7.27 (m, 1H), 7.26 (s, 1H), 7.23 - 7.15 (m, 2H), 4.61 (s, 2H), 4.40 (s, 2H), 4.09 (d, J = 6.3 Hz, 2H), 3.79 (s, 3H). MALDI-MS m/z: (M+H⁺).

Compound 9

2-(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindoline-4- sulfonamido)acetic acid

Chemical Formula: C-iyH^CIF^OyS

Molecular Weight: 444.82

Purification was carried out by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 19.5 minutes). 1H

NMR (400 MHz, DMSO-d₆) δ 12.60 (bs, 1H), 10.04 (bs, 1H), 9.81 (bs, 1H), 7.97 (bs, 1H), 7.48 (dd, J = 7.2, 2.2 Hz, 1H), 7.37 - 7.33 (m, 1H), 7.27 - 7.25 (m, 1H), 7.24 (s, 1H), 4.62 (s, 2H), 4.42 (s, 2H), 3.50 (s, 2H). ¹³C NMR (101 MHz, DMSO- d₆) 5 170.59, 166.90, 156.94 (d, J = 244.8 Hz), 147.60, 145.31, 135.86 (d, J = 3.8 Hz), 131.86, 130.26, 128.85 (d, J = 6.9 Hz), 124.99, 119.96 (d, J = 18.3 Hz), 118.71, 117.83, 117.55 (d, J = 21.4 Hz), 49.28, 44.46, 44.01. ESI-MS m/z: 443.0 (M-H). 887.0 (M₂-H) HRMS calcd for C₁₇Hi₅N₂0₇FSCl [MH⁺]:445.0267. Found:445.0259. Compound 10

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide

Chemical Formula: C₁₇H₁₆CIFN₂0₅S

Molecular Weight: 414.84

Purification was performed by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 25.7 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.16 (bs, 2H), 7.48 (dd, J = 7.2, 2.1 Hz, 1H), 7.37 - 7.30 (m, 1H), 7.29 - 7.23 (m, 1H), 7.16 (s, 1H), 4.62 (s, 2H), 4.38 (s, 2H), 2.57 (s, 6H). ¹³C NMR (101 MHz, DMSO-d₆) δ 166.76, 156.92 (d, J = 244.1 Hz), 148.17, 145.75,

135.71 (d, J = 3.8 Hz), 132.74, 130.26, 128.83 (d, J = 7.7 Hz), 120.02, 119.94 (d, J = 17.5 Hz), 118.96, 118.01, 117.52 (d, J = 20.6 Hz), 50.01, 44.48, 37.78 (2C).

MALDI-MS m/r. 415.15 (M+H⁺). HRMS calcd for CnHnNiOsFSCl [MH⁺]:

415.0525. Found: 415.0533.

Compound 11

2-(3-chloro-4-fluorobenzyl)-N,N-diethyl-6,7-dihydroxy-l-oxoisoindoline-4- sulfonamide

Chemical Formula: C-19H20CIFN2O5S

Molecular Weight: 442.89 Purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 20.2 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.14 (bs, 1H), 9.87 (bs, 1H), 7.46 (dd, J = 7.2, 2.1 Hz, 1H), 7.37 - 7.31 (m, 1H), 7.25 (ddd, J = 8.5, 4.8, 2.2 Hz, 1H), 7.20 (s, 1H), 4.62 (s, 2H), 4.35 (s, 2H), 3.10 (q, J = 7.1 Hz, 4H), 0.94 (t, J = 7.1 Hz, 6H). ¹³C NMR (101 MHz, DMSO- d₆) 5 166.76, 156.90 (d, J = 246.0 Hz), 147.79, 145.82, 135.71 (d, J = 3.8 Hz), 131.71, 130.22, 128.84 (d, J = 7.4 Hz), 124.80, 119.93 (d, J = 17.8 Hz), 118.79, 117.53 (d, J = 21.0 Hz), 117.35, 49.64, 44.40, 41.58 (2C), 14.16 (2C). ESI-MS m/z: 443.0 (M+H⁺).

Compound 12

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-4-(morpholinosulfonyl)isoindolin-l- one

Chemical Formula: C₁₉H₁₈CIFN₂0₆S

Molecular Weight: 456.87

Purification was performed by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 25.2 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.22 (bs, 1H), 10.00 (bs, 1H), 7.48 (dd, J = 7.2, 2.1 Hz, 1H), 7.34 (dd, J = 14.5, 5.2 Hz, 1H), 7.29 - 7.18 (m, 1H), 7.15 (s, 1H), 4.61 (s, 2H), 4.38 (s, 2H), 3.57 - 3.55 (m, 2H), 3.48 - 3.45 (m, 1H), 3.40 (t, J = 6.0 Hz, 1H), 3.15 (t, J = 5.9 Hz, 1H), 2.87 - 2.85 (m, 3H). ESI-MS m/z: 457.0 (M+H⁺). HRMS calcd for C₁₉Hi₉N₂0₆FSCl [MH⁺] :457.0631. Found:457.0641. Compound 13

2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-4-((4-methylpiperazin-l- yl)sulfonyl)isoindolin-l-one

Chemical Formula: C20H21CIFN3O5S

Molecular Weight: 469.91

Purification was performed by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 45% B over 30 minutes; retention time = 16.3 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.35 (bs, 1H), 10.18 (bs, 1H), 7.48 (dd, J = 7.2, 2.1 Hz, 1H), 7.38 - 7.30 (m, 1H), 7.27 (dd, J = 4.8, 2.0 Hz, 1H), 7.17 (s, 1H), 4.62 (s, 2H), 4.40 (s, 2H), 3.67 (bs, 2H), 3.38 (bs, 2H), 3.08 (bs, 2H), 2.74 (s, 3H), 2.62 (bs, 2H). ESI- MS m/r. 470.0 (M+H⁺). HRMS calcd for C₂₀H₂₂N₃O₅FSCI [MH⁺]: 470.0947.

Found: 470.0948.

Compound 14

4-((4-(2-aminoethyl)piperazin-l-yl)sulfonyl)-2-(3-chloro-4-fluorobenzyl)-6,7- dihydroxyisoindolin- 1 -one

Chemical Formula: C21 H24CIFN4O5S

Molecular Weight: 498.96

Purification was performed by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 20% B to 35% B over 30 minutes; retention time = 20.8 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.12 (bs, 1H), 9.86 (bs, 1H), 8.51 (bs, 2H), 7.53 - 7.47 (m, 2H), 7.39 - 7.34 (m, 1H), 7.28 - 7.26 (m, 1H), 4.63 (s, 2H), 4.39 (s, 2H), 2.99 (bs, 4H), 2.84 - 2.82 (m, 4H), 2.54 (bs, 4H). MALDI-MS m/z: 499.13 (M+H⁺).

Compound 15

2-(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl-l-oxoisoindoline-4- sulfonamido)acetic acid

Chemical Formula: C₁₈H₁₆CIFN₂0₇S

Molecular Weight: 458.85

Purification was performed by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 40% B to 55% B over 30 minutes; retention time = 18.5 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 12.78 (bs, 1H), 10.14 (s, 1H), 9.90 (s, 1H), 7.49 - 7.48 (m, 1H), 7.34 (t, J = 8.9 Hz, 1H), 7.26 - 7.23 (m, 1H), 7.21 (s, 1H), 4.61 (s, 2H), 4.37 (s, 2H), 3.84 (s, 2H), 2.73 (s, 3H). ¹³C NMR (101 MHz, DMSO-d₆) δ 170.25, 166.75, 156.89 (d, J = 246.0 Hz), 148.03, 145.67, 135.70 (d, J = 3.8 Hz), 132.20, 130.26, 128.77 (d, J = 7.6 Hz), 123.01, 119.92 (d, J = 17.7 Hz), 118.79, 117.87, 117.50 (d, J = 21.0 Hz), 50.73, 49.77, 44.46, 35.72. MALDI-MS m/z: 458.98 (M+H⁺). Synthesis of analogues 16-21 was carried out as shown below.

General Synthesis Procedure B for compounds 16

n = 0, 1 , 2, 3, 4, 5 16 - 21

Scheme 2. Synthesis of analogues

The 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-l-oxoisoindoline-4-sulfonyl chloride was prepared using the same as General Procedure A from 2,3-dihydro- 6,7-dimethoxy-2-[(3-chloro-4-fluorophenyl)methyl]- lH-isoindol- 1-one.

L-Proline (108 mg, 0.935 mmol) was dissolved in the saturated sodium hydroxide/THF solution (20 mL). Then 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy- l-oxoisoindoline-4-sulfonyl chloride (406 mg, 0.935 mmol) in THF was added. The mixture was stirred at r.t. overnight. The reaction mixture was extracted by

Chloroform and the organic phase was washed by brine and dried by sodium sulfate. After filtration and concentration, crude product (267 mg) was afforded.

The residue was dissolved in DCM (2 mL) and BBr₃ (0.7 mL, 7.2 mmol) was added. After 1 hour stirring, the reaction was quenched by ice. The formed suspension was filtered and the solid was collected. The solid was purified by HPLC. Purification by preparative HPLC as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 50% B to 65% B over 30 minutes. Compound 16

2-(3-chloro-4-fluorobenz -6,7-dihydroxy-l-oxoisoindoline-4-sulfonic acid

Chemical Formula: C-isHnCIFNOeS

Molecular Weight: 387.77

Retention time: 12.4 minutes. 1H NMR (400 MHz, DMSO-d₆) δ 7.47 - 7.45 (m, 1H), 7.37 - 7.32 (m, 1H), 7.26 - 7.22 (m, 1H), 7.16 (d, J = 1.9 Hz, 1H), 4.60 (s, 2H), 4.22 (s, 2H). ¹³C NMR (101 MHz, DMSO-d₆) δ 167.98, 156.91 (d, J = 246.1 Hz), 144.12, 143.81, 136.10 (d, J = 3.8 Hz), 134.31, 130.29, 128.97, 128.93 (d, J = 8.2 Hz), 119.93 (d, J = 17.7 Hz), 117.70, 117.59, 117.59 (d, J = 21.0 Hz), 49.41, 44.24. ESI-MS m/z: 386.0 (M-H).

Compound 17

l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carboxylic acid

Chemical Formula: C₂oH-i8CIFN₂0₇S

Molecular Weight: 484.88

Retention time: 21.9 minutes. 1H NMR (400 MHz, DMSO-d₆) δ 10.16 (bs, 1H), 9.95 (bs, 1H), 7.50 - 7.47 (m, 1H), 7.36 - 7.31 (m, 1H), 7.28 - 7.24 (m, 1H), 7.27 (s, 1H), 4.62 (q, J = 15.1 Hz, 2H), 4.39 (s, 2H), 4.00 (dd, J = 8.4, 3.6 Hz, 1H), 3.31 - 3.25 (m, 1H), 3.14 - 3.08 (m, 1H), 2.02 - 1.97 (m, 1H), 1.84 - 1.76 (m, 2H), 1.69 - 1.64 (m, 1H). ^1JC NMR (101 MHz, DMSO-d₆) δ 173.48, 166.76, 156.90 (d, J = 246.0 Hz), 148.19, 145.81, 135.69 (d, J = 3.8 Hz), 132.63, 130.22, 128.79 (d, J = 7.6 Hz), 122.71, 119.94 (d, J = 17.7 Hz), 118.80, 117.64, 117.50 (d, J = 21.0 Hz), 60.49, 49.85, 48.68, 44.46, 30.94, 24.63. ESI-MS m/z: 483.0(M-H). MALDI-MS m/z: 485.02 (M+H⁺), 506.99 (M+Na⁺).

Compound 18

l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carboxylic acid

Chemical Formula: C₂5H25CIFN₃0₈S

Molecular Weight: 582.00

Retention time: 20.1 minutes. 1H NMR (400 MHz, DMSO-d₆) δ 10.12 (bs, 1H), 9.93 (bs, 1H), 7.51 - 7.48 (m, 1H), 7.36 - 7.32 (m, 1H), 7.29 - 7.26 (m, 1H), 7.28 (s, 1H), 4.61 (dd, J = 24.9, 14.7 Hz, 2H), 4.41 - 4.38 (m, 1H), 4.35 (s, 2H), 4.01 - 3.98(m, 1H), 3.44 - 3.38 (m, 2H), 3.23 - 3.20 (m, 2H), 2.04 - 1.95 (m, 2H), 1.81 - 1.71 (m, 3H), 1.69 - 1.65 (m, 3H). ¹³C NMR (101 MHz, DMSO-d₆) δ 173.38, 169.62, 166.76, 156.91 (d, J = 245.7 Hz), 148.01, 145.63, 135.73 (d, J = 3.8 Hz), 132.51, 130.27, 128.86 (d, J = 7.5 Hz), 123.41, 119.94 (d, J = 17.7 Hz), 118.74, 117.84, 117.50 (d, J = 21.1 Hz), 59.01, 58.82, 49.73, 48.67, 46.58, 44.44, 30.27, 28.68, 24.83, 24.58. ESI-MS m/z: 580.0(M-H). MALDI-MS m/z: 581.89 (M+H⁺), 603.88 (M+Na⁺). Compound 19

l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carboxylic acid

Molecular Weight: 679.1 1

Retention time: 18.2 minutes. 1H NMR (400 MHz, DMSO-d₆) δ 10.12 (bs, 1H), 9.90 (bs, 1H), 7.52 - 7.50 (m, 1H), 7.38 - 7.33 (m, 1H), 7.30 - 7.26 (m, 1H), 7.28 (s, 1H), 4.62 (dd, J = 38.7, 15.5 Hz, 2H), 4.39 - 4.43 (m, 2H), 4.35 (s, 2H), 4.14 - 4.11 (m, 1H), 3.49 - 3.40 (m, 3H), 3.23 - 3.18 (m, 2H), 2.09 - 1.95 (m, 3H), 1.87 - 1.68 (m, 10H). ¹³C NMR (101 MHz, DMSO-d₆) δ 173.62, 169.83, 169.23, 166.79, 156.90 (d, J = 246.3 Hz), 147.97, 145.62, 135.81, 132.56, 130.29, 128.89 (d, J = 7.6 Hz), 123.45, 121.60 (d, J = 5.1 Hz), 119.94 (d, J = 17.7 Hz), 118.74, 117.85, 117.49 (d, J = 20.9 Hz), 59.01, 58.75, 57.86, 48.72, 46.89, 46.59, 44.46, 30.17, 28.83, 27.76, 24.92, 24.65, 24.54. ESI-MS m/z: 677.1 (M-H). MALDI-MS m/z: 700.91 (M+Na⁺).

Compound 20

l-(l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carbonyl)pyrrolidine-2-carboxylic acid

Chemical Formula: C35H39CIFN5O-10S

Molecular Weight: 776.23

Retention time: 16.2 minutes. 1H NMR (400 MHz, DMSO-d₆) δ 10.12 (bs, 1H), 9.90 (bs, 1H), 7.52 - 7.50 (m, 1H), 7.37 - 7.33 (m, 1H), 7.29 - 7.26 (m, 1H), 7.28 (s, 1H), 4.62 (dd, J = 38.7, 15.3 Hz, 2H), 4.51 - 4.48 (m, 1H), 4.39 - 4.29 (m, 1H), 4.35 (s, 2H), 4.15 - 4.11 (m, 1H), 3.56 - 3.48 (m, 8H), 3.31 - 3.17 (m, 2H), 2.12 - 1.96 (m, 4H), 1.90 - 1.64 (m, 11H). ESI-MS m/z: 774.1 (M-H). MALDI-MS m/z 797.86 (M+Na⁺).

Compound 21

l-(l-(l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carboxylic acid

Chemical Formula: C₄oH ₆CIFN₆0-|-|S

Molecular Weight: 873.34

Retention time: 14.8 minutes. ESI-MS m/z: 871.2 (M-H). MALDI-MS m/z: 894.89 (M+Na⁺).

General Synthesis Procedure C for compounds 22-25

Scheme 3. Synthesis of analogues 22 - 25.

n = 1 , 2, 3, 4

22 - 25

The 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-l-oxoisoindoline-4-sulfonyl chloride was prepared using the same as General Procedure A from 2,3-dihydro-

6,7-dimethoxy-2-[(3-chloro-4-fluorophenyl)methyl]-lH-isoindol-l-one.

Compound 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-l-oxoisoindoline-4-sulfonyl chloride (0.1 mmol) was dissolved in DCM (0.5 mL). Diamine (0.5 mmol) was added as a solution in DCM (0.5 mL). Followed by triethylamine (0.2 mmol) was added. The suspension was stirred at rt overnight. Solvent was evaporated and pumped to dry.

The residue was mixed in DCM (1 mL) and BBr₃ (0.8 mmol, 1.0 M in DCM) was added. After 4 hour stirring, the reaction was quenched by ice. The formed suspension was filtered and washed by cold water. The solid was collected and purified by HPLC.

Compound 22

N,N'-(propane-l,3-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide)

Chemical Formula: C33H28CI2F2N4O-10S2

Molecular Weight: 813.63

Purification was performed by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 50% B to 65% B over 30 minutes; retention time = 20.5 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.08 (bs, 2H), 9.81 (bs, 2H), 7.48 - 7.46 (m, 2H), 7.44 (t, J = 6.0 Hz, 2H), 7.34 (t, J = 9.2 Hz, 2H), 7.27 - 7.23 (m, 2H), 7.21 (s, 2H), 4.61 (s, 4H), 4.36 (s, 4H), 2.65 - 2.60 (m, 4H), 1.41 (t, J = 6.8 Hz, 2H). ¹³C NMR (101 MHz, DMSO-d₆) δ 166.84 (2C), 156.95 (d, J = 244.1 Hz, 2C), 147.55 (2C), 145.51 (2C), 135.79 (d, J = 3.8 Hz, 2C), 131.49 (2C), 130.32 (2C), 128.91 (d, J = 6.9 Hz, 2C), 124.82 (2C), 119.47 (d, J = 17.3 Hz, 2C), 118.79 (2C), 117.20 (2C), 117.56 (d, J = 20.6 Hz, 2C), 49.28 (2C), 44.49 (2C), 29.70, 11.43, 10.46. MALDI-MS m/z: 812.52 (M+H⁺), 834.49(M+Na⁺).

Chemical Formula: C₃ H₃₀Cl₂F₂N₄0-ioS₂

Molecular Weight: 827.66

Compound 23

N,N'-(butane-l,4-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide)

Purification was performed by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 50% B to 65% B over 30 minutes; retention time = 21.3 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.07 (bs, 2H), 9.80 (bs, 2H), 7.47 - 7.46 (m, 2H), 7.41 (m, 2H), 7.36 - 7.31 (m, 2H), 7.25 (m, 2H), 7.22 (s, 2H), 4.61 (s, 4H), 4.37 (s, 4H), 2.59 (bs, 4H), 1.25 (s, 4H). ¹³C NMR (101 MHz, DMSO-d₆) δ 166.85 (2C), 156.95 (d, J = 245.7 Hz, 2C), 147.49 (2C), 145.50 (2C), 135.80 (d, J = 3.0 Hz, 2C), 131.44 (2C), 130.32 (2C), 128.93 (d, J = 7.7 Hz, 2C), 125.00 (2C), 119.97 (d, J = 17.6 Hz, 2C), 118.76 (2C), 117.70 (2C), 117.56 (d, J = 20.6 Hz, 2C), 49.28 (2C), 44.46 (2C), 42.24 (2C), 26.58 (2C). MALDI-MS m/z: 827.17 (M+H⁺). Compound 24

N,N'-(pentane-l,5-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide)

Chemical Formula: C35H3₂Cl2F₂N 0-ioS2

Molecular Weight: 841.68

Purification was performed by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 50% B to 60% B over 30 minutes; retention time = 24.8 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.07 (bs, 2H), 9.78 (bs, 2H), 7.47 - 7.46 (m, 2H), 7.48 - 7.45 (m, 2H), 7.40 (t, J = 5.6 Hz, 2H), 7.33 (t, J = 8.8 Hz, 2H), 7.27 - 7.24 (m, 2H), 7.22 (s, 2H), 4.62 (s, 4H), 4.37 (s, 4H), 2.60 - 2.56 (m, 4H), 1.23 - 1.14 (m, 4H), 1.13 - 1.06 (m, 2H). ¹³C NMR (101 MHz, DMSO-d₆) δ 166.85 (2C), 156.95 (d, J = 245.7 Hz, 2C), 147.48 (2C), 145.49 (2C), 135.80 (d, J = 3.8 Hz, 2C), 131.43 (2C), 130.32 (2C), 128.92 (d, J = 7.6 Hz, 2C), 125.06 (2C), 119.97 (d, J = 17.2 Hz, 2C), 118.74 (2C), 117.71 (2C), 117.56 (d, J = 20.6 Hz, 2C), 49.26 (2C), 44.46 (2C), 42.56 (2C), 28.90 (2C), 23.56 (2C). MALDI-MS m/z: 840.90 (M+H⁺), 862.83 (M+Na⁺). Compound 25

N,N'-(hexane-l,6-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide)

Chemical Formula: C36H₃ Cl2F₂N 0-ioS2

Molecular Weight: 855.71

Purification was performed by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 50% B to 60% B over 30 minutes; retention time = 26.9 minutes). 1H NMR (400 MHz, DMSO-d₆) δ 10.09 (bs, 2H), 7.48 - 7.45 (m, 2H), 7.40 (t, J = 5.6 Hz, 2H), 7.34 (t, J = 8.8 Hz, 2H), 7.27 - 7.24 (m, 2H), 7.23 (s, 2H), 4.61 (s, 4H), 4.37 (s, 4H), 2.62 - 2.57 (m, 4H), 1.28 - 1.11 (m, 4H), 1.00 (s, 4H). ¹³C NMR (101 MHz,

DMSO-d₆) δ 166.83 (2C), 156.96 (d, J = 244.9 Hz, 2C), 147.46 (2C), 145.49 (2C), 135.80 (d, J = 3.8 Hz, 2C), 131.41 (2C), 130.31 (2C), 128.93 (d, J = 7.6 Hz, 2C), 125.14 (2C), 119.97 (d, J = 17.5 Hz, 2C), 118.74 (2C), 117.72 (2C), 117.56 (d, J = 21.4 Hz, 2C), 49.25 (2C), 44.45 (2C), 42.60 (2C), 29.25 (2C), 26.01 (2C). MALDI- MS m/z: 855.38 (M+H⁺). General Synthesis for compounds 26 to 31

(II) (III) (IV)

(V) (VI) 26 to 31

Reagents and conditions: a) "BuLi, ClC0₂Me; b) AcCl, ZnCl₂, Et₂0; c) 3-Chloro-4- fluoro-benzylamine, Et₃N, CH₃CN; d) C1S0₃H; e) R³R⁴NH, Et N, CH₂C1₂; f) BBr₃, CH₂C1₂.

Scheme 4. General synthesis of dihydroxy-oxoisoindoline-sulfonamides 26 to 31.

General Procedure A for the Synthesis of Benzoic Acid Methyl Esters (II).

To a solution of benzyl methyl ether (I) (5.0 mmol) in anhydrous ether (15 mL) was added w-butyl lithium (1.6 M in hexanes, 6.0 mmol) drop wise with stirring at 0 °C (1 h). The resulting precipitate suspension was cooled to -78 °C, methyl chloroforaiate (24.0 mmol) was added, and then the reaction mixture was allowed to return to room temperature. The mixture was partitioned between H₂0 and ether, and the organic phase was dried (Na₂S0₄) and concentrated to provide a residue, which was purified by silica gel column chromatography to yield II.

General Procedure B for the Synthesis of Benzyl Chlorides (III).

Acetyl chloride (5.0 mmol) was added dropwise with stirring to a solution of methyl ether (II) (1.5 mmol) and anhydrous zinc chloride (0.05 mmol) in anhydrous ether (3 mL) at 0 °C. After 30 min, aluminum oxide (350 mg) was added and the mixture was filtered through a short pad of aluminum oxide. The eluent was evaporated and the residue was purified by silica gel column chromatography to yield III.

General Procedure C for the Synthesis of Amides IV.

Triethylamine (2.0 mmol) was added to a solution of methyl benzoate (III) (1.0 mmol), and appropriate amine (1.0 mmol) in anhydrous acetonitrile (3.0 mL) was added. The mixture was stirred at reflux until the starting material was consumed. The solvent was evaporated and the residue was partitioned between chloroform and brine. The combined organic phase was dried (Na₂S0₄) and evaporated, and the residue was purified by silica gel column chromatography to give amides IV.

General Procedure D for the Synthesis of Sulfonyl Chlorides (V)

Compound dimethoxylisoindoles (IV) (1 mmol) was added to chlorosulfonic acid (1 ml). The dark mixture was stirred at room temperature for 1 hour. The mixture was diluted by chloroform (100 mL) and quenched by pouring into ice. Organic phase was separated and dried by sodium sulfate. Filtered and concentrated the afforded sulfonyl chlorides (V) as brown oil was used in next step without further purification.

General procedure E for Dimethoxylisoindole Sulfonamides (VI)

The sulfonyl chlorides (V) (0.2 mmol) was dissolved in DCM (1 mL).

Amine (0.4 mmol) [or Amine (0.2 mmol) with triethylamine (0.4 mmol)] was added at room temperature. After 30 min, the solvent was evaporated. The formed residue was pump to dry. The crude sulfonamides VI were purified by silica gel column or used in next step without further purification.

General Procedure F for the Demethylation of Methyl Phenyl Ethers (VI).

Boron tribromide (1.0 M in dichloromethane, 8.5 mmol) was added carefully to a solution of appropriate methyl ether (VI) (1.0 mmol in 1.0 mL anhydrous dichloromethane) and the mixture was stirred at room temperature (overnight). The reaction was quenched by the addition of ice-water (1.0 mL). The resulting suspension was filtered and the collected solid was purified by preparative HPLC, dihydroxylisoindoles 26 - 31 was afforded. Compound 26

2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N,5-trimethyl-l-oxoisoindoline-4- sulfonamide

Chemical Formula: C₁₈H₁₈CIFN₂0₅S

Molecular Weight: 428.86

Step 1: 3,4-Dimethoxy-5-methylbenzaldehyde

To 4-hydroxy-3-methoxy-5-methylbenzaldehyde^! (2.04 g, 12.28 mmol) in acetone (20 ml), iodomethane (0.92 ml, 14.73 mmol) and potassium carbonate (2.54 g, 18.41 mmol) was added. The mixture was stirred and refluxed (56°C) for 8 hours. The reaction was quenched by pouring into water and extracted with ether. The organic phase was washed with diluted NaOH (aq.) and dried by sodium sulfate. After filtered and evaporated, the residue was purified by silica gel column. 3,4- Dimethoxy-5-methylbenzaldehyde (1.88 g, 85 % yield) was afforded. 1H NMR (500 MHz, CDC1₃) δ 9.84 (s, 1H), 7.29 (s, 2H), 3.90 (s, 3H), 3.88 (s, 3H), 2.31 (s, 3H). ¹³C NMR (126 MHz, CDC1₃) δ 191.34, 153.14, 152.83, 132.33, 132.07, 127.21, 108.76, 60.23, 55.81, 15.90. ESI-MS m/z: 181.1 (MH⁺).

Step 2: (3,4-Dimethoxy-5-methylphenyl)methanol

To the solution of 3,4-dimethoxy-5-methylbenzaldehyde (1.88 g, 10.43 mmol) in methanol (20 ml), sodium borohydride (0.47 g, 12.51 mmol) was added at 0 °C. After 30 minutes, the reaction was extracted by ethyl acetate and the organic phase was washed by brine and dried by sodium sulfate. After filtered and concentrated, the crude residue was purified by silica gel column. (3,4-dimethoxy-5- methylphenyl)methanol (1.75 g, 92 % yield) was afforded. 1H NMR (500 MHz, CDCI₃) δ 6.78 (d, J = 1.5 Hz, 1H), 6.73 (m, 1H), 4.57 (d, J = 4.6 Hz, 2H), 3.84 (s, 3H), 3.78 (s, 3H), 2.25 (s, 3H). ¹³C NMR (126 MHz, CDC1₃) δ 152.69, 146.60, 136.53, 131.82, 121.30, 108.79, 65.16, 60.11, 55.68, 15.79. ESI-MS m/z: 205.1 (MNa⁺).

Step 3: l,2-Dimethoxy-5-(methoxymethyl)-3-methylbenzene

To the solution of (3,4-dimethoxy-5-methylphenyl)methanol (1.71 g, 9.38 mmol) in THF (100 mL), sodium hydride (0.47 g, 18.77 mmol) was added portionwise at 0°C. After 20 min, iodomethane (1.17 ml, 18.77 mmol) was added. The resultant mixture was stirred from 0°C to rt over 1 hour. The reaction was quenched by ice and extracted by ether. The organic phase was dried by sodium sulfate. After filtered and concentrated, the crude residue was purified by silica gel column. l,2-dimethoxy-5-(methoxymethyl)-3-methylbenzene (1.75 g, 95 % yield) was afforded. 1H NMR (500 MHz, CDC1₃) δ 6.77 (d, J = 1.9 Hz, 1H), 6.74 (m, 1H), 4.36 (s, 2H), 3.86 (s, 3H), 3.79 (s, 3H), 3.39 (s, 3H), 2.27 (s, 3H). ¹³C NMR (126 MHz, CDC1₃) δ 152.68, 146.81, 133.66, 131.66, 122.24, 109.47, 74.69, 60.05, 58.07, 55.68, 15.78. ESI-MS m/z: 219.1 (MNa⁺).

Step 4: Methyl 2,3-dimethoxy-6-(methoxymethyl)-4-methylbenzoate

Starting from l,2-dimethoxy-5-(methoxymethyl)-3-methylbenzene, methyl 2,3-dimethoxy-6-(methoxymethyl)-4-methylbenzoate was afforded in 38.8 % yield using General Procedure A. 1H NMR (500 MHz, CDC1₃) δ 6.93 (s, 1H), 4.38 (s, 2H), 3.90 (s, 3H), 3.88 (s, 3H), 3.82 (s, 3H), 3.33 (s, 3H). ¹³C NMR (125 MHz, CDC1₃) δ 167.77, 150.77, 150.37, 134.08, 131.41, 125.96, 125.85, 72.12, 61.36, 60.07, 58.30, 52.14, 15.89. ESI-MS m/z: 277.1 (M+Na⁺).

Step 5: Methyl 6-(chloromethyl)-2,3-dimethoxy-4-methylbenzoate

Starting from methyl 2,3-dimethoxy-6-(methoxymethyl)-4-methylbenzoate, methyl 6-(chloromethyl)-2,3-dimethoxy-4-methylbenzoate was afforded in 89 % yield using General Procedure B. 1H NMR (500 MHz, CDC1₃) δ 6.99 (s, 1H), 4.58 (s, 2H), 3.96 (s, 3H), 3.90 (s, 3H), 3.84 (s, 3H), 2.28 (s, 3H). ¹³C NMR (125 MHz, CDC1₃) δ 167.20, 151.62, 150.76, 134.80, 130.49, 127.47, 126.54, 61.40, 60.10, 52.48, 43.51, 15.94.

Step 6: 2-(3-Chloro-4-fluorobenzyl)-6,7-dimethoxy-5-methylisoindolin-l-one Starting from methyl 6-(chloromethyl)-2,3-dimethoxy-4-methylbenzoate and

(3-chloro-4-fluorophenyl)methanamine, 2-(3-chloro-4-fluorobenzyl)-6,7- dimethoxy-5-methylisoindolin- l-one was afforded in 49.4 % yield using General Procedure C.

1H NMR (500 MHz, CDC1₃) δ 7.36 (dd, J = 6.9, 1.8 Hz, 1H), 7.21 - 7.16 (m, 1H), 7.09 (t, J = 8.6 Hz, 1H), 6.91 (s, 1H), 4.69 (s, 2H), 4.15 (s, 2H), 4.13 (s, 3H), 3.88 (s, 3H), 2.32 (s, 3H). ¹³C NMR (126 MHz, CDC1₃) δ 166.91, 155.56 (d, J = 247.1 Hz, 1C), 150.95, 150.87, 137.31 (d, J = 9.5 Hz, 1C), 134.43 (d, J = 3.8 Hz, 1C), 130.21, 127.87 (d, J = 6.8 Hz, 1C), 127.85, 122.64, 121.27 (d, J = 18.1 Hz, 1C), 119.52, 116.84 (d, J = 21.0 Hz, 1C), 62.45, 60.79, 48.63, 45.23, 16.77. ESI-MS m/z: 366.0 (MH⁺).

Step 7: 2-(3-Chloro-4-fluorobenzyl)-6,7-dimethoxy-N,N,5-trimethyl-l- oxoisoindoline-4-sulfonamide

Starting from 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-5- methylisoindolin-l-one, 2-(3-Chloro-4-fluorobenzyl)-6,7-dimethoxy-N,N,5- trimethyl-l-oxoisoindoline-4-sulfonamide was afforded in 72.4 % yield for two steps using General Procedure D and E. 1H NMR (500 MHz, CDC1₃) δ 7.38 (dd, J = 6.9, 2.1 Hz, 1H), 7.20 (ddd, J = 8.3, 4.5, 2.2 Hz, 1H), 7.09 (t, J = 8.6 Hz, 1H), 4.69 (s, 2H), 4.56 (s, 2H), 4.20 (d, J = 0.5 Hz, 3H), 3.87 (d, J = 0.4 Hz, 3H), 2.77 (s, 2H), 2.77 (s, 4H), 2.54 (s, 3H). ESI-MS m/z: 457.1 (MH⁺).

Step 8: 2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N,5-trimethyl-l- oxoisoindoline-4-sulfonamide (26)

Starting from 2-(3-Chloro-4-fluorobenzyl)-6,7-dimethoxy-N,N,5-trimethyl- l-oxoisoindoline-4- sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 40% B to 70% B over 30 minutes; retention time = 24.7 minutes), white fluffy solid 26 was afforded using General Procedure F. 1H NMR (400 MHz,

DMSO-d₆) δ 9.95 (brs, 1H), 9.42 (brs, 1H), 7.49 (dd, J = 7.2, 2.1 Hz, 1H), 7.37 - 7.33 (m, 1H), 7.28 - 7.25 (m, 1H), 4.63 (s, 2H), 4.44 (s, 2H), 2.60 (s, 6H), 2.34 (s, 3H). ¹³C NMR (101 MHz, DMSO-d₆) δ 167.26, 156.93 (d, J = 244.8 Hz, 1C), 147.01, 144.44, 135.68 (d, 1C), 134.78, 130.28, 130.15 (d, J = 16.0 Hz, 1C), 128.83 (d, J = 7.7 Hz, 1C), 121.15, 120.04 (d, 1C), 117.59 (d, J = 20.6 Hz, 1C), 1 15.97, 51.64, 44.30, 36.50 (2C), 13.56. ESI-MS m/z: 429.0 (M+H⁺). Compound 27

5-Butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide

Chemical Formula: C21 H24CIFN2O5S

Molecular Weight: 470.94

Step 1: 2-Bromo-4-(hydroxymethyl)-6-methoxyphenol

To the suspension of 5-Bromovanillin (12.07 g, 52.2 mmol) in methanol (100 ml), sodium borohydride (2.17 g, 57.5 mmol) was added portionwise at 0 °C. The resultant solution was stirred at 0 °C for 1 hour. Solvent was evaporated and the residue was extracted with ethyl acetate, washed by brine and dried by sodium sulfate. After filtered and concentrated, the crude residue was purified by silica gel column. 2-Bromo-4-(hydroxymethyl)-6-methoxyphenol (6.3 g, 53%) was afforded.

Step 2: l-Bromo-2,3-dimethoxy-5-(methoxymethyl)benzene

To the suspension of sodium hydride (0.859 g, 34.0 mmol) in THF (80 mL), 2-bromo-4-(hydroxymethyl)-6-methoxyphenol (2.59 g) was added portionwise at 0 °C. Iodomethane (2.12 ml, 34.0 mmol) was added dropwise. The resultant mixture was stirred from 0 °C to rt over 0.5 hour and then refluxed overnight. TLC show only monoprotected product was formed. The reaction mixture was cooled to rt. Acetone (100 mL), potassium carbonate (11.09 g) and iodomethane (6 mL) was added. The formed mixture was refluxed for 5 hours and cooled to rt. The reaction was quenched by ice and extracted by diethyl ether. The organic phase was washed by brine and dried by sodium sulfate. After filtered and concentrated, the crude residue was purified by silica gel column. l-bromo-2,3-dimethoxy-5- (methoxymethyl)benzene (2.42 g, 82 % yield) was afforded. 1H NMR (400 MHz, CDCI₃) δ 7.06 - 7.05 (m, 1H), 6.82 (m, 1H), 4.33 (s, 2H), 3.84 (s, 3H), 3.81 (s, 3H), 3.35 (s, 3H). ^1JC NMR (101 MHz, CDC1₃) δ 153.69, 145.80, 135.37, 123.70, 117.39, 110.83, 73.77, 60.50, 58.17, 56.02.

Step 3: l-Butyl-2,3-dimethoxy-5-(methoxymethyl)benzene

To the solution of l-bromo-2,3-dimethoxy-5-(methoxymethyl)benzene (1.86 g, 7.12 mmol) in THF (40 ml), w-Butyllithium (4.90 ml, 7.84 mmol) was added with dry ice-acetone bath. The formed orange mixture was stirred at -78°C for 1 hour. Methyl chloroformate (0.82 ml, 10.7 mmol) was added. The reaction mixture was stirred at -78°C for 1 hour and then quenched by pouring into ice. Ethyl acetate (150 mL) was added. The organic phase was washed by NH₄C1 (aq., 50 mL), brine (50 mL) and dried by sodium sulfate. After filtered and concentrated, the crude residue was purified by silica gel column. Methyl 2,3-dimethoxy-5- (methoxymethyl)benzoate (820.4 mg, 47.9 % yield) [1H NMR (500 MHz, CDC1₃) δ 7.27 (dd, J = 1.9, 0.8 Hz, 1H), 7.08 (d, J = 1.1 Hz, 1H), 4.42 (s, 2H), 3.91-3.90 (m, 9H), 3.40 (s, 3H). ¹³C NMR (126 MHz, CDC1₃) δ 166.61, 153.65, 148.63, 134.05, 125.60, 121.24, 114.94, 74.08, 61.52, 58.20, 56.09, 52.18. ESI-MS m/z: 241.1 (MH⁺).] and by-product colorless oil l-Butyl-2,3-dimethoxy-5- (methoxymethyl)benzene (74.1 mg, 4.36 % yield) were afforded. [1H NMR (400 MHz, CDC1₃) δ 6.73 (d, J = 1.9 Hz, 1H), 6.70 (d, J = 1.9 Hz, 1H), 4.34 (s, 2H), 3.83 (s, 3H), 3.77 (s, 3H), 3.36 (s, 3H), 2.60 - 2.56 (m, 2H), 1.56 - 1.51 (m, 2H), 1.37- 1.31 (m, 2H), 0.90 (t, J = 8.4, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 152.63, 146.51, 136.37, 133.51, 121.26, 109.33, 74.76, 60.54, 58.04, 55.61, 32.93, 29.49, 22.63, 13.93. ESI-MS m/z: 263.2 (MNa⁺).]

Step 4: Methyl 4-butyl-2,3-dimethoxy-6-(methoxymethyl)benzoate

Starting from l-butyl-2,3-dimethoxy-5-(methoxymethyl)benzene, methyl 4- butyl-2,3-dimethoxy-6-(methoxymethyl)benzoate was afforded in 41.8 % yield using General Procedure A. 1H NMR (400 MHz, CDC1₃) δ 7.23 (s, 1H), 6.89 (s, 2H), 4.36 (s, 2H), 3.87 (s, 3H), 3.84 (s, 3H), 3.80 (s, 3H), 3.31 (s, 3H), 2.59 - 2.55 (m, 2H), 1.55 - 1.48 (m, 2H), 1.34 (dq, J = 14.5, 7.3 Hz, 2H), 0.90 (t, J = 7.3 Hz, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 167.83, 150.49, 150.31, 138.78, 131.26, 125.84, 124.95, 72.21, 61.22, 60.45, 58.31, 52.12, 32.77, 29.59, 22.60, 13.89. Step 5: Methyl 4-butyl-6-(chloromethyl)-2,3-dimethoxybenzoate

Starting from methyl 4-butyl-2,3-dimethoxy-6-(methoxymethyl)benzoate, methyl 4-butyl-6-(chloromethyl)-2,3-dimethoxybenzoate was afforded in 48.4 % yield using General Procedure B. 1H NMR (400 MHz, CDC1₃) δ 6.93 (s, 1H), 4.54 (s, 2H), 3.91 (s, 3H), 3.84 (s, 3H), 3.80 (s, 3H), 2.56 (t, J = 7.8 Hz, 2H), 1.55-1.47 (m, 2H), 1.36-1.31 (m, 2H), 0.90 (t, J = 7.4 Hz, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 167.17, 151.31, 150.67, 139.40, 130.35, 126.54, 126.41, 61.20, 60.41, 52.39, 43.56, 32.62, 29.57, 22.57, 13.85. ESI-MS m/z: 301.10 (M+H⁺), 323.1 (M+Na⁺).

Step 6: 5-Butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxyisoindolin-l-one

Starting from methyl 4-butyl-6-(chloromethyl)-2,3-dimethoxybenzoate, 5- butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxyisoindolin-l-one was afforded in 40.2 % yield using General procedure C. 1H NMR (400 MHz, CDC1₃) δ 7.30 - 7.28 (m, 1H), 7.14 - 7.11 (m, 1H), 7.02 (t, J = 8.8 Hz, 1H), 6.60 (s, 1H), 4.61 (s, 2H), 4.11 (s, 2H), 4.09 (s, 3H), 3.83 (s, 3H), 3.82 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 166.85, 157.50 (d, J = 248.9 Hz, 1C), 150.86, 150.70, 141.89, 137.20, 134.39 (d, J = 3.9 Hz, 1C), 130.17, 127.84 (d, J = 7.3 Hz, 1C), 122.47, 121.20 (d, J = 17.8 Hz, 1C), 118.56, 116.76 (d, J = 21.3 Hz, 1C), 62.36, 61.20, 48.64, 45.18, 32.74, 30.27, 22.60, 13.88. ESI-MS m/z: 392.1 (MH⁺).

Step 7: 5-Butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide

Starting from 5-butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxyisoindolin- 1-one, 5-Butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide was afforded in 56.1 % yield for two steps using General Procedure D and E. 1H NMR (400 MHz, CDC1₃) δ 7.31 (dd, J = 7.1, 2.4 Hz, 1H), 7.13 (ddd, J = 8.7, 4.7, 2.3 Hz, 1H), 7.03 (t, J = 8.7 Hz, 1H), 4.62 (s, 2H), 4.49 (s, 2H), 4.11 (s, 3H), 3.87 (s, 3H), 2.87 - 2.83 (m, 2H), 2.69 (s, 3H), 2.69-2.66 (m, 2H), 2.66 (s, 3H), 1.43-1.38 (m, 2H), 0.92-0.88 (m, 3H). ESI-MS m/z: 499.1 (MH⁺).

Step 8: 5-Butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide (27)

Starting from 5-Butyl-2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-N,N- dimethyl-l-oxoisoindoline-4- sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 40% B to 70% B over 30 minutes; retention time = 29.1 minutes), white fluffy solid 27 was afforded using General Procedure F. 1H NMR (400 MHz, DMSO-d₆) δ 9.95 (brs, 1H), 9.37 (brs, 1H), 7.50 (d, J = 7.1 Hz, 1H), 7.37 - 7.32 (m, 1H), 7.29 - 7.25 (m, 1H), 4.63 (s, 2H), 4.44 (s, 2H), 2.79 (d, J = 8.4 Hz, 2H), 2.58 (s, 6H), 1.35 - 1.32 (m, 4H), 0.86 (t, J = 7.2 Hz, 3H). ¹³C NMR (101 MHz, DMSO-d₆) δ 167.33, 156.91 (d, J = 246.1 Hz), 146.96, 144.58, 135.64 (d, J = 3.7 Hz), 135.22, 134.73, 130.25, 128.80 (d, J = 7.5 Hz), 121.71, 119.96 (d, J = 17.7 Hz), 117.50 (d, J = 21.0 Hz), 116.07, 51.79, 44.29, 36.36, 34.43, 31.24, 27.68, 23.36, 14.19. MALDI-MS m/r. (M+H⁺).

Compound 28

2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide

Chemical Formula: C20H22CIFN2O5S

Molecular Weight: 456.92

Compound 29

2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-4- (morpholinosulfonyl)isoindolin-l-one

Molecular Weight: 498.95 Step 1: l-isopropyl-2,3-dimethoxy-5-(methoxymethyl)benzene

Compound 5-Bromo-l-isopropyl-2,3-dimethoxybenzene^~ (3.48 g, 13.4 mmol) was dissolved in THF (100 mL). w-Butyllithium (6.55 mL, 16.4 mmol) was added at -78 °C. The mixture was stirred at -78 °C for 1 hour.

Chloro(methoxy)methane (1.56 mL, 20.5 mmol) was added. The mixture was stirred from -78 °C to rt overnight. After quenched by pouring into ice and extracted by ethyl acetate, the organic phase was washed by brine and dried by sodium sulfate. The solution was filtered and concentrated. The formed residue was purified by silica gel column. Colorless oil l-isopropyl-2,3-dimethoxy-5- (methoxymethyl)benzene (2.1 g, 68.3 % yield) was afforded. 1H NMR (400 MHz, CDC1₃) δ 6.76 (d, J = 2.0 Hz, 1H), 6.73 (d, J = 2.0 Hz, 1H), 4.36 (m, 1H), 7.21 (s, 2H), 3.83 (s, 3H), 3.77 (s, 3H), 3.37 (s, 3H), 3.35 - 3.28 (m, 1H), 1.18 (d, J = 6.4 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 152.58, 145.74, 142.16, 133.82, 117.68, 109.12, 74.96, 60.81, 58.11, 55.62, 26.74, 23.45 (2C).

Step 2: Methyl 4-isopropyl-2,3-dimethoxy-6-(methoxymethyl)benzoate

Starting from l-isopropyl-2,3-dimethoxy-5-(methoxymethyl)benzene, methyl 4-isopropyl-2,3-dimethoxy-6-(methoxymethyl)benzoate was afforded in 59.8 % yield using General Procedure A. 1H NMR (400 MHz, CDC1₃) δ 6.94 (s, 1H), 4.37 (s, 2H), 3.87 (s, 3H), 3.84 (s, 3H), 3.80 (s, 3H), 3.31 (s, 3H), 3.33 - 3.24 (m, 1H), 1.17 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 167.81, 150.25,

149.79, 144.46, 131.51, 125.69, 121.56, 72.40, 61.18, 60.64, 58.33, 52.08, 26.90, 23.24 (2C).

Step 3: Methyl 6-(chloromethyl)-4-isopropyl-2,3-dimethoxybenzoate

Starting from methyl 4-isopropyl-2,3-dimethoxy-6- (methoxymethyl)benzoate, methyl 6-(chloromethyl)-4-isopropyl-2,3- dimethoxybenzoate was afforded in 85 % yield using General Procedure B. 1H NMR (400 MHz, CDCI₃) δ 7.02 (s, 1H), 4.60 (s, 2H), 3.95 (s, 3H), 3.89 (s, 3H), 3.86 (s, 3H), 3.34 - 3.30 (m, 1H), 1.22 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 167.20, 150.65, 145.10, 130.62, 127.78, 126.26, 123.24, 61.22, 60.65, 52.42, 43.77, 27.00, 23.15 (2C). Step 4: 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7-dimethoxyisoindolin-l-one

Starting from methyl 6-(chloromethyl)-4-isopropyl-2,3-dimethoxybenzoate, 2-(3-chloro-4-fluorobenzyl)-5-isopropyl-6,7-dimethoxyisoindolin-l-one was afforded in 51.7 % yield using General Procedure C. 1H NMR (400 MHz, CDC1₃) δ 7.36 (dd, J = 7.0, 2.2 Hz, 1H), 7.19 (ddd, J = 8.4, 4.5, 2.2 Hz, 1H), 7.08 (t, J = 8.6 Hz, 1H), 6.97 (s, 1H), 4.69 (s, 2H), 4.18 (s, 2H), 4.13 (s, 3H), 3.90 (s, 3H), 3.42 - 3.35 (m, 1H), 1.22 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 166.82, 157.48 (d, J = 248.8 Hz, 1C), 150.84, 150.00, 147.66, 137.48, 134.40 (d, J = 3.9 Hz, 1C), 130.17, 127.84 (d, J = 7.3 Hz, 1C), 122.18, 121.18 (d, J = 18.0 Hz, 1C), 116.75 (d, J = 21.2 Hz, 1C), 115.21, 62.36, 61.45, 48.75, 45.16, 27.36, 23.31 (2C).

Step 5: 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7-dimethoxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide

Starting from 2-(3-chloro-4-fluorobenzyl)-5-isopropyl-6,7- dimethoxyisoindolin-l-one, 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7- dimethoxy-N,N-dimethyl- l-oxoisoindoline-4-sulfonamide was afforded in 32.9 % yield for two steps using General Procedure D and E. 1H NMR (400 MHz, CDC1₃) δ 7.38 (dd, J = 6.9, 2.2 Hz, 1H), 7.20 (ddd, J = 8.4, 4.5, 2.2 Hz, 1H), 7.09 (t, J = 8.6 Hz, 1H), 4.69 (s, 2H), 4.56 (s, 2H), 4.16 (s, 3H), 3.97 (s, 3H), 3.83 - 3.76 (m, 1H), 2.77 (s, 6H), 1.34 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 164.85, 157.57 (d, J = 249.0 Hz, 1C), 155.01, 154.18, 147.15, 139.16, 133.94 (d, J = 4.0 Hz, 1C), 130.29, 127.93 (d, J = 7.3 Hz, 1C), 126.65, 123.66, 121.28 (d, J = 17.9 Hz, 1C), 116.78 (d, J = 21.3 Hz, 1C), 62.58, 61.23, 51.29, 45.09, 36.11 (2C), 29.31, 20.69 (2C). ESI-MS m/z: 485.1 (MH⁺).

Step 6: 2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide (28)

Starting from 2-(3-chloro-4-fluorobenzyl)-5-isopropyl-6,7- dimethoxyisoindolin-l-one, 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7- dimethoxy-N,N-dimethyl- l-oxoisoindoline-4-sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G- 4436-PO-AX column with a linear gradient of 50% B to 70% B over 30 minutes; retention time = 26.2 minutes), white fluffy solid 28 was afforded using General Procedure F. 1H NMR (400 MHz, DMSO-d₆) δ 9.95 (brs, IH), 9.27 (brs, IH), 7.50 (dd, J = 7.2, 2.1 Hz, IH), 7.28 - 7.24 (m, IH), 7.26 (ddd, J = 8.5, 4.8, 2.2 Hz, IH), 4.64 (s, 2H), 4.45 (s, 2H), 3.72 - 3.65 (m, IH), 2.61 (s, 6H), 1.25 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, DMSO-d₆) δ 167.32, 156.91 (d, J = 246.0 Hz, 1C), 147.40, 145.99, 138.88, 135.62 (d, J = 3.6 Hz, 1C), 134.62, 130.23, 128.77 (d, J = 7.5 Hz, 1C), 122.33, 119.96 (d, J = 17.8 Hz, 1C), 117.51 (d, J = 21.0 Hz, 1C), 115.99, 52.09, 44.26, 36.10 (2C), 28.84, 19.72 (2C). ESI-MS m/z: 457.0 (M+H⁺).

Step 7: 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7-dimethoxy-4- morpholinosulf onyl)isoindolin- 1 -one

Starting from 2-(3-chloro-4-fluorobenzyl)-5-isopropyl-6,7- dimethoxyisoindolin-l-one, 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7- dimethoxy-4-morpholinosulfonyl)isoindolin-l-one was afforded in 47.0 % yield for two steps using General Procedure D and E. 1H NMR (400 MHz, CDC1₃) δ 1H NMR (400 MHz, cdcl₃) δ 7.38 (dd, J = 6.9, 2.0 Hz, IH), 7.23 - 7.19 (m, IH), 7.10 (t, J = 8.6 Hz, IH), 4.68 (s, 2H), 4.56 (s, 2H), 4.17 (s, 3H), 3.98 (s, 3H), 3.88-3.81 (m, IH), 3.72 - 3.70 (m, 4H), 3.17 - 3.15 (m, 4H), 1.38 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 164.71, 157.62 (d, J = 249.2 Hz), 155.37, 154.30, 147.41, 139.47, 133.86 (d, J = 4.0 Hz), 130.32, 127.96 (d, J = 7.3 Hz), 125.62, 123.74, 121.34 (d, J = 18.0 Hz), 116.81 (d, J = 21.2 Hz), 66.17, 62.65, 61.26, 51.24, 45.13, 44.52, 29.32, 20.89. ESI-MS m/z: 527.1 (MH⁺).

Step 8: 2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-4- (morpholinosulfonyl)isoindolin-l-one (29)

Starting from 2-(3-Chloro-4-fluorobenzyl)-5-isopropyl-6,7-dimethoxy-4- morpholinosulfonyl)isoindolin-l-one, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 40% B to 80% B over 30 minutes; retention time = 26.3 minutes), white fluffy solid 29 was afforded using General Procedure F.1H NMR (400 MHz, DMSO-d₆) δ 10.02 (brs, IH), 9.31 (brs, IH), 7.50 (dd, J = 7.2, 2.1 Hz, IH), 7.37 - 7.32 (m, IH), 7.29 - 7.25 (m, IH), 4.63 (s, 2H), 4.46 (s, 2H), 3.76 - 3.69 (m, IH), 3.53 - 3.51 (m, 4H), 2.97 - 2.95 (m, 4H), 1.29 (d, J = 6.9 Hz, 6H). ¹³C NMR (101 MHz, DMSO-d₆) δ 167.24, 156.92 (d, J = 246.0 Hz, 1C), 147.75, 146.11, 139.10, 135.63 (d, J = 3.1 Hz, 1C), 135.16, 130.25, 128.80 (d, J = 1.5 Hz, 1C), 121.27, 119.95 (d, / = 17.8 Hz, 1C), 117.49 (d, J = 21.0 Hz), 116.05, 66.06 (2C), 52.05 (2C), 44.57, 44.29, 28.79, 19.85 (2C). ESI-MS m/z: 499.1 (M+H⁺).

Compound 30

2-(3-Chloro-4-fluorobenzyl)-5,6,7-trihydroxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide

Chemical Formula: C₁₇H₁₆CIFN₂0₆S

Molecular Weight: 430.84

Step 1: l,2,3-trimethoxy-5-(methoxymethyl)benzene

Commercial available (3,4,5-trimethoxyphenyl)methanol (25 g, 126 mmol) was dissolved in THF (150 mL). Sodium hydride (3.93 g, 164 mmol) was added portionwise at 0°C. The reaction mixture was stirred at 0°C for 10 min. Then iodomethane (10.21 ml, 164 mmol) was added drop wise. The resultant mixture was stirred from 0°C to rt for 3 hours and quenched by pouring into ice. The mixture was extracted with ethyl acetate, washed by brine and dried by anhydrous sodium sulfate. After filtered and concentrated, the afforded residue was purified by silica gel column. Colorless oil l,2,3-trimethoxy-5-(methoxymethyl)benzene (26.44 g, 125 mmol, 99 % yield) was afforded. 1H NMR (400 MHz, CDC1₃) δ 6.53 (s, 2H), 4.35 (s, 2H), 3.82 (s, 6H), 3.79 (s, 3H), 3.36 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 153.22 (2C), 137.36, 133.82, 104.53 (2C), 74.83, 60.76, 58.11, 56.02 (2C). ESI-MS m/z: 235.0 (MNa⁺).

Step 2: Methyl 2,3,4-trimethoxy-6-(methoxymethyl)benzoate

Starting from l,2,3-trimethoxy-5-(methoxymethyl)benzene, Methyl 2,3,4- trimethoxy-6-(methoxymethyl)benzoate was afforded in 54.0 % yield using General Procedure A. 1H NMR (400 MHz, CDC1₃) δ 6.72 (s, 1H), 4.40 (s, 2H), 3.87 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.82 (s, 3H), 3.33 (s, 3H). ^1JC NMR (101 MHz, CDC1₃) δ 167.47, 154.57, 151.48, 141.29, 132.41, 119.96, 107.00, 72.07, 61.70, 60.75, 58.30, 55.98, 52.02.

Step 3: 2-(3-Chloro-4-fluorobenzyl)-5,6,7-trimethoxyisoindolin-l-one

Starting from 2,3,4-trimethoxy-6-(methoxymethyl)benzoate, 2-(3-chloro-4- fluorobenzyl)-5,6,7-trimethoxyisoindolin-l-one was afforded in 36.6% yield for two steps using General Procedure B and C. 1H NMR (400 MHz, CDC1₃) δ 7.30 - 7.28 (m, 1H), 7.14 - 7.11 (m, 1H), 7.02 (t, J = 8.8 Hz, 1H), 6.60 (s, 1H), 4.61 (s, 2H), 4.11 (s, 2H), 4.09 (s, 3H), 3.83 (s, 3H), 3.82 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 166.90, 157.45 (d, J = 248.8 Hz, 1C), 157.28, 151.56, 141.72, 138.48, 134.45 (d, J = 3.9 Hz, 1C), 130.11, 127.80 (d, J = 7.3 Hz, 1C), 121.15 (d, J = 17.9 Hz, 1C), 116.88, 116.75 (d, J = 21.2 Hz, 1C), 101.27, 62.53, 61.39, 56.24, 48.92, 45.08. ESI-MS m/z: 366.0 (MH⁺).

Step 4: 2-(3-Chloro-4-fluorobenzyl)-5,6,7-trimethoxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide

Starting from methyl 6-(chloromethyl)-2,3,4-trimethoxybenzoate, 2-(3- Chloro-4-fluorobenzyl)-5,6,7-trimethoxy-N,N-dimethyl- l-oxoisoindoline-4- sulfonamide was afforded in 96% yield for two steps using General Procedure D and E. 1H NMR (500 MHz, CDC1₃) δ 7.39-7.37 (m, 1H), 7.22 - 7.19 (m, 1H), 7.10 (t, J = 8.6 Hz, 1H), 4.68 (s, 2H), 4.50 (s, 2H), 4.22 (s, 3H), 4.05 (s, 3H), 3.96 (s, 3H), 2.86 (s, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 164.98, 157.54 (d, J = 248.6 Hz, 1C), 155.65, 155.47, 146.58, 138.66, 133.98 (d, J = 4.1 Hz, 1C), 130.26, 127.93 (d, J = 7.3 Hz, 1C), 122.82, 121.24 (d, J = 17.6 Hz, 1C), 120.45, 116.75 (d, J = 21.1 Hz, 1C), 62.85, 61.76, 61.45, 50.59, 45.11, 37.42 (2C). ESI-MS m/z: 473.0 (MH⁺).

Step 5: 2-(3-Chloro-4-fluorobenzyl)-5,6,7-trihydroxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide (30)

Starting from 2-(3-Chloro-4-fluorobenzyl)-5,6,7-trimethoxy-N,N-dimethyl- l-oxoisoindoline-4- sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 30% B to 70% B over 30 minutes; retention time = 19.8 minutes), white fluffy solid 30 was afforded using General Procedure F. 1H NMR (400 MHz, DMSO-d₆) 5 10.19 (s, 1H), 9.63 (s, 1H), 9.42 (s, 1H), 7.47 (dd, J = 7.2, 2.1 Hz, 1H), 7.39 - 7.29 (m, 1H), 7.28 - 7.21 (m, 1H), 4.59 (s, 2H), 4.35 (s, 2H), 2.66 (s, 6H). ¹³C NMR (101 MHz, DMSO-d₆) δ 167.83, 156.89 (d, J = 245.7 Hz), 150.56, 147.57, 135.90 (d, J = 3.7 Hz), 134.94, 133.10, 130.26, 128.82 (d, J = 7.4 Hz), 119.91 (d, J = 17.6 Hz), 117.53 (d, J = 21.0 Hz), 112.20, 110.19, 51.35, 44.21, 37.7 (2C). MALDI- MS m/z 430.9 (M+H⁺).

Compound 31

2-(3-Chloro-4-fluorobenzyl)-5-(4-(N,N-dimethylsulfamoyl)phenyl)-6,7- dihydroxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide

Chemical Formula: C25H25CIFN3O7S2

Molecular Weight: 598.06

Step 1: 2,3-Dimethoxy-5-(methoxymethyl)-l,l'-biphenyl

Compound l-bromo-2,3-dimethoxy-5-(methoxymethyl)benzene (513 mg, 1.97 mmol) was dissolved in toluene (8 ml).

Tetrakis(triphenylphosphine)palladium(0) (2.27 g, 1.96 mmol) and phenylboronic acid (359 mg, 2.95 mmol) were added. Saturated potassium carbonate solution (8 ml) and ethanol (2 ml) were added following. The yellow mixture was stirred at 70°C for 3 days. 2,3-Dimethoxy-5-(methoxymethyl)- l,l'-biphenyl (498 mg, 1.92 mmol, 97.9 % yield) was afforded. 1H NMR (400 MHz, CDC1₃) δ 7.54 - 7.52 (m, 2H), 7.41 - 7.37 (m, 2H), 7.33 - 7.31 (m, 1H), 6.91 (dd, / = 10.7, 2.0 Hz, 2H), 4.43 (s, 2H), 3.89 (s, 3H), 3.55 (s, 3H), 3.40 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 153.10, 145.97, 133.92, 129.52, 129.19 (2C), 128.04 (2C), 127.10, 122.02, 115.27, 110.85, 74.62, 60.57, 58.14, 55.91. ESI-MS m/z: 281.1 (MNa⁺). Step 2: Methyl 2,3-dimethoxy-5-(methoxymethyl)-[l,l'-biphenyl]-4-carboxylate

Starting from methyl 2,3-dimethoxy-5-(methoxymethyl)- l,l'-biphenyl, methyl 2,3-dimethoxy-5-(methoxymethyl)-[l, l'-biphenyl]-4-carboxylate was afforded in 43.0 % yield using General Procedure A. 1H NMR (400 MHz, CDC1₃) δ 7.49 - 7.46 (m, 2H), 7.41 - 7.37 (m, 2H), 7.35 - 7.33 (m, 1H), 7.08 (s, 1H), 4.43 (s, 2H), 3.93 (s, 3H), 3.91 (s, 3H), 3.60 (s, 3H), 3.33 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 167.55, 150.86, 150.01, 137.58, 137.27, 131.67, 129.05 (2C), 128.17 (2C), 127.55, 127.32, 125.62, 72.13, 61.63, 60.55, 58.40, 52.24.

Step 3: Methyl 5-(chloromethyl)-2,3-dimethoxy-[l,l'-biphenyl]-4-carboxylate Starting from methyl 2,3-dimethoxy-5-(methoxymethyl)-[l, l'-biphenyl]-4- carboxylate, methyl 5-(chloromethyl)-2,3-dimethoxy-[l, l'-biphenyl]-4-carboxylate was afforded in 71.3 % yield using General Procedure B. 1H NMR (400 MHz, CDC1₃) δ 7.49 - 7.46 (m, 2H), 7.43 - 7.38 (m, 2H), 7.37 - 7.35 (m, 1H), 7.13 (s, 1H), 4.60 (s, 2H), 3.96 (s, 3H), 3.94 (s, 3H), 3.60 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 166.95, 151.26, 150.82, 138.12, 136.79, 130.71, 129.00 (2C), 128.27 (2C), 127.80 (2C), 127.21 , 61.66, 60.56, 52.55, 43.39.

Step 4: 2-(3-Chloro-4-fluorobenzyl)-6,7-dimethoxy-5-phenylisoindolin-l-one

Starting from methyl 5-(chloromethyl)-2,3-dimethoxy-[l,l'-biphenyl]-4- carboxylate and (3-chloro-4-fluorophenyl)methanamine, 2-(3-chloro-4- fluorobenzyl)-6,7-dimethoxy-5-phenylisoindolin- l-one was afforded in 47.5 % yield using General Procedure C. 1H NMR (400 MHz, CDC1₃) δ 7.49 - 7.45 (m, 2H), 7.42 - 7.38 (m, 2H), 7.36 - 7.32 (m, 2H), 7.17 (ddd, J = 8.4, 4.6, 2.2 Hz, 1H), 7.07 (t, J = 8.6 Hz, 1H), 7.03 (s, 1H), 4.68 (s, 2H), 4.20 (s, 2H), 4.15 (s, 3H), 3.62 (s, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 166.61, 157.55 (d, J = 248.9 Hz, 1C), 151.50, 150.21, 140.42, 137.50, 137.40, 134.26 (d, J = 4.0 Hz, 1C), 130.22, 129.08 (2C), 128.19 (2C), 127.88 (d, J = 7.3 Hz, 1C), 127.73, 123.71, 121.27 (d, J = 18.0 Hz, 1C), 119.38, 116.83 (d, J = 21.2 Hz, 1C), 62.60, 61.20, 48.74, 45.26. ESI-MS m/z: 412.0 (MH⁺). Step 5: 2-(3-Chloro-4-fluorobenzyl)-5-(4-(N,N-dimethylsulfamoyl)phenyl)-6,7- dimethoxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide

Starting from 2-(3-chloro-4-fluorobenzyl)-6,7-dimethoxy-5- phenylisoindolin-l-one, reaction with chlorosulfonic acid at room temperature overnight based on General Procedure D and followed by General Procedure E, 2- (3-Chloro-4-fluorobenzyl)-5-(4-(N,N-dimethylsulfamoyl)phenyl)-6,7-dimethoxy- N,N-dimethyl-l-oxoisoindoline-4-sulfonamide was afforded in 89.0 % yield for two steps. 1H NMR (400 MHz, CDC1₃) δ 7.85 - 7.83 (m, 2H), 7.43 - 7.41 (m, 2H), 7.38 (dd, J = 6.9, 2.1 Hz, 1H), 7.21 - 7.18 (m, 1H), 7.09 (t, J = 8.6 Hz, 1H), 4.69 (s, 2H), 4.60 (s, 2H), 4.21 (s, 3H), 3.52 (s, 3H), 2.72 (s, 6H), 2.22 (s, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 164.54, 157.68 (d, J = 249.2 Hz, 1C), 154.92, 151.42, 139.33, 138.93, 138.30, 135.28, 133.88, 133.68 (d, J = 4.1 Hz, 1C), 130.37, 130.28, 128.02 (d, J = 7.2 Hz, 1C), 127.95, 126.77, 125.54, 121.42 (d, J = 17.8 Hz, 1C), 116.89 (d, J = 21.2 Hz, 1C), 63.04, 61.29, 50.87, 45.29, 37.91 (2C), 35.33 (2C), 34.85. ESI- MS m/z 626.1 (MH⁺).

Step 6: 2-(3-Chloro-4-fluorobenzyl)-5-(4-(N,N-dimethylsulfamoyl)phenyl)-6,7- dihydroxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide (31)

Starting from 2-(3-Chloro-4-fluorobenzyl)-5-(4-(N,N- dimethylsulfamoyl)phenyl)-6,7-dimethoxy-N,N-dimethyl- l-oxoisoindoline-4- sulfonamide, purification by preparative HPLC (as indicated in the General

Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 50% B to 60% B over 30 minutes; retention time = 23.7 minutes), white fluffy solid 31 was afforded using General Procedure F. 1H NMR (400 MHz, DMSO-d₆) δ 10.28 (brs, 1H), 9.36 (brs, 1H), 7.74 - 7.72 (m, 2H), 7.53 (dd, J = 7.2, 2.1 Hz, 1H), 7.39 - 7.35 (m, 3H), 7.32 - 7.28 (m, 1H), 4.68 (s, 2H), 4.51 (s, 2H), 2.58 (s, 6H), 2.14 (s, 6H). ¹³C NMR (101 MHz, DMSO-d₆) δ 166.92, 156.95 (d, J = 245.9 Hz), 147.46, 144.62, 140.10, 135.65, 135.62 (d, J = 3.6 Hz), 134.28, 134.01, 131.64, 131.01, 130.32, 128.88 (d, J = 7.6 Hz), 128.53, 126.92, 123.38, 119.98 (d, J = 17.9 Hz), 117.70, 117.54 (d, J = 20.8 Hz), 51.54, 44.39, 38.05 (2C), 35.28 (2C). ESI-MS m/z: 598.0(M+H⁺).

Reagents and conditions: a) 2-(3-chloro-4-fluorophenyl)ethanamine or 2-(4- fluorophenyl)ethanamine, Et₃N, CH₃CN; b) i. C1S0₃H; ii. Me₂NH, Et N, CH₂C1₂; c) BBr₃, CH₂C1₂.

Scheme 5. General synthesis of dihydroxy-oxoisoindoline-sulfonamides 32 and 33.

Compound 32

2-(3-chloro-4-fluorophenethyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide

Chemical Formula: C-|₈H-|₈CIFN20₅S

Molecular Weight: 428.86

Step 1: 2-(3-chloro-4-fluorophenethyl)-6,7-dimethoxyisoindolin-l-one

Starting from methyl 6-(chloromethyl)-2,3-dimethoxybenzoate' and 2-(3-chloro-4- fluorophenyl)ethanamine, white solid 2-(3-chloro-4-fluorophenethyl)-6,7- dimethoxyisoindolin-l-one was afforded in 78 % yield using General Procedure C. 1H NMR (400 MHz, CDC1₃) δ 7.23-7.21 (m, 1H), 7.06 - 7.04 (m, 1H), 7.04-7.02 (m, 1H), 7.01 (s, 1H), 7.00 - 6.96 (m, 1H), 4.10 (s, 2H), 4.02 (s, 2H), 3.83 (s, 3H), 3.76 - 3.67 (m, 3H), 2.87 (t, / = 7.4 Hz, 3H). ¹³C NMR (101 MHz, CDC1₃) δ 166.68, 156.82 (d, / = 247.4 Hz), 152.28, 147.15, 135.78 (d, / = 3.9 Hz), 134.24, 130.62, 128.28 (d, / = 7.0 Hz), 124.81, 120.77 (d, / = 17.7 Hz), 117.67, 116.58 (d, / = 20.9 Hz), 116.38, 62.45, 56.70, 49.49, 43.82, 33.61. ESI-MS m z: 350.1 (M+H⁺). Step 2: 2-(3-chloro-4-fluorophenethyl)-6,7-dimethoxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide

Starting from 2-(3-chloro-4-fluorophenethyl)-6,7-dimethoxyisoindolin-l- one, 2-(3-chloro-4-fluorophenethyl)-6,7-dimethoxy-N,N-dimethyl-l-oxoisoindoline- 4-sulfonamide was afforded in 61.9 % yield for two steps using General Procedure D and E. 1H NMR (400 MHz, CDC1₃) δ 7.28 (s, 1H), 7.21 (dd, J = 7.0, 2.1 Hz, 1H), 7.07 (ddd, J = 6.1, 4.6, 2.1 Hz, 1H), 7.01 (t, J = 8.6 Hz, 1H), 4.33 (s, 2H), 4.13 (s, 3H), 3.90 (s, 3H), 3.74 (t, J = 7.3 Hz, 2H), 2.91 (t, J = 7.3 Hz, 2H), 2.69 (s, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 164.93, 156.88 (d, J = 247.8 Hz), 152.57, 150.97, 135.55 (d, J = 4.1 Hz), 133.75, 130.73, 128.32 (d, J = 7.0 Hz), 125.69, 125.01,

120.82 (d, J = 17.8 Hz), 116.67 (d, J = 21.0 Hz), 115.01, 62.88, 56.91, 50.41, 43.90, 37.48 (2C), 33.39. ESI-MS m/z: 457.1 (M+H⁺).

Step 3: 2-(3-chloro-4-fluorophenethyl)-6,7-dihydroxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide (32)

Starting from 2-(3-chloro-4-fluorophenethyl)-6,7-dimethoxy-N,N-dimethyl- l-oxoisoindoline-4- sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 35% B to 70% B over 30 minutes; retention time = 24.1 minutes), white fluffy solid 32 was afforded using General Procedure F. 1H NMR (500 MHz, DMSO-d₆) δ 10.19 (bs, 1H), 9.85 (bs, 1H), 7.50 (d, J = 1.2 Hz, 1H), 7.30 (t, J = 8.9 Hz, 1H), 7.27 - 7.20 (m, 1H), 7.18 (s, 1H), 4.39 (s, 2H), 3.71 (t, J = 7.0 Hz, 2H), 2.92 (t, J = 1.0 Hz, 2H), 2.60 (s, 6H). ¹³C NMR (126 MHz, DMSO-d₆) δ 166.64, 156.34 (d, J = 244.6 Hz), 147.92, 145.58, 137.54 (d, J = 4.2 Hz), 132.59, 131.13 (d, J = 10.9 Hz), 129.81, 119.78, 119.55 (d, J = 17.3 Hz), 119.16, 118.00 (d, J = 9.4 Hz), 117.23, 50.58, 43.12, 37.84, 37.76, 32.99. ESI-MS m/z: 429.0 (M+H⁺). Compound 33

2-(4-fluorophenethyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4-

Chemical Formula: C ₈H _gFN205S

sulfonamide Molecular Weight: 394.42

Step 1: 2-(3-chloro-4-fluorophenethyl)-6,7-dimethoxyisoindolin-l-one

Starting from methyl 6-(chloromethyl)-2,3-dimethoxybenzoate ^' and 2-(4- fluorophenyl)ethanamine, white solid 2-(4-fluorophenethyl)-6,7- dimethoxyisoindolin-l-one was afforded in 88 % yield using General Procedure C. 1H NMR (500 MHz, CDC1₃) δ 7.18-7.15 (m, 2H), 7.04 (d, J = 8.1 Hz, 1H), 6.99 (d, J = 8.1 Hz, 1H), 6.93 (t, J = 8.6 Hz, 2H), 4.09 (s, 2H), 4.06 (s, 3H), 3.85 (s, 3H), 3.75 (t, J = 7.3 Hz, 2H), 2.92 (t, J = 1.3 Hz, 2H). ¹³C NMR (126 MHz, CDC1₃) δ 166.65, 161.57 (d, J = 244.4 Hz), 152.26, 147.13, 134.49 (2C, d, J = 3.4 Hz), 134.41, 130.08 (2C, d, J = 8.0 Hz), 124.97, 117.68, 116.33, 115.34 (d, J = 21.3 Hz), 62.48, 56.72, 49.55, 44.10, 33.83. ESI-MS m/z: 316.1 (M+H⁺).

Step 2: 2-(4-fluorophenethyl)-6,7-dimethoxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide

Starting from 2-(4-fluorophenethyl)-6,7-dimethoxyisoindolin-l-one, 2-(4- fluorophenethyl)-6,7-dimethoxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide was afforded in 52.3 % yield for two steps using General Procedure D and E. 1H NMR (400 MHz, CDC1₃) δ 7.59 (dd, J = 6.5, 2.3 Hz, 1H), 7.41 (ddd, J = 8.3, 4.6, 2.4 Hz, 1H), 7.27 (s, 1H), 7.23 (s, 1H), 7.10 (dd, J = 9.7, 8.5 Hz, 1H), 4.36 (s, 2H), 4.09 (s, 3H), 3.88 (s, 3H), 3.78 (t, J = 7.2 Hz, 2H), 2.99 (t, J = 7.1 Hz, 2H), 2.73 (d, J = 1.9 Hz, 6H). ¹³C NMR (101 MHz, CDC1₃) δ 164.97, 157.69 (d, J = 254.6 Hz), 152.57, 150.91, 135.11 (d, J = 3.9 Hz), 135.02 (d, J = 8.3 Hz), 133.60, 131.20, 125.56, 125.20, 124.85 (d, J = 15.4 Hz), 117.51 (d, J = 22.4 Hz), 115.06, 62.83, 56.90, 50.22, 43.61, 37.34, 37.31, 33.34. Step 3: 2-(4-fluorophenethyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide (33)

Starting from 2-(4-fluorophenethyl)-6,7-dimethoxy-N,N-dimethyl-l- oxoisoindoline-4-sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 35% B to 65% B over 30 minutes; retention time = 19.6 minutes), white fluffy solid 33 was afforded using General Procedure F.

Synthesis for compound 34

(I) (II) (ill) (iv)

(V) 34

Compound 34

2-(3-chloro-4-fluorobenzyl)-7,8-dihydroxy-N,N-dimethyl-l-oxo-l,2,3,4- tetrahydroisoquinoline-5-sulfonamide

Chemical Formula: C ₈H₁₈CIFN₂0₅S

Molecular Weight: 428.86

Reagents and conditions: a) TMSCN, TBAF; b) i. H₂, Pt0₂; ii. Benzene, 80°C; c) 4- (bromomethyl)-2-chloro-l-fluorobenzene, NaH, THF; d) i. C1S0₃H; ii. Me₂NH, Et₃N, CH₂C1₂; e) BBr₃, CH₂C1₂. Scheme 6. General synthesis of dihydroxy-oxoisoquinoline-sulfonamides 34.

Step 1: methyl 6-(cyanomethyl)-2,3-dimethoxybenzoate

Trimethylsilanecarbonitrile (0.12 mL, 0.90 mmol) and tetrabutylammonium floride (1.0 M solution in THF, 0.90 mL, 0.90 mmol) was added to a solution of methyl 6-(chloromethyl)-2,3-dimethoxybenzoate^J (147 mg, 0.601 mmol) in acetonitrile (1 mL) at room temperature. The solution was stirred at room

temperature for 1 day. The reaction mixture was purified by CombiFlash. Methyl 6- (cyanomethyl)-2,3-dimethoxybenzoate (113 mg) was afforded in 80 % yield. 1H NMR (400 MHz, CDC1₃) δ 7.10 (d, J = 8.5 Hz, 1H), 6.92 (d, J = 8.5 Hz, 1H), 3.91 (s, 3H), 3.84 (s, 3H), 3.83 (s, 3H), 3.67 (s, 2H). ¹³C NMR (101 MHz, CDC1₃) δ

166.93, 152.74, 147.30, 127.85, 124.53, 119.86, 117.34, 113.98, 61.52, 55.93, 52.55, 21.18. ESI-MS m/z: 236.1 (M+H⁺).

Step 2: 7,8-dimethoxy-3,4-dihydroisoquinolin- l(2H)-one

A solution of methyl 6-(cyanomethyl)-2,3-dimethoxybenzoate (119 mg, 0.51 mmol) in MeOH (1 mL) containing sulfuric acid (0.03 mL, 0.53 mmol) was hydrogenated over platinum(IV) oxide (2.3 mg, 10 μιηοΐ) for 12 hour at rt. The reaction mixture was filtered and the filtrate was evaporated. The residue was quench by cooled NaOH (aq.) and extracted by methylenechloride. Organic phase was concentrated and the residue was dissolved in Benzene (1 mL). The mixture was heated to 80 °C for 3 hours. After evaporation, the crude residue was purified by silica gel column. White solid 7,8-dimethoxy-3,4-dihydroisoquinolin-l(2H)-one (60 mg) was afforded in 57.8 % yield. 1H NMR (500 MHz, CDC1₃) δ 7.06 (bs, 1H), 6.97 (d, J = 8.3 Hz, 1H), 6.89 (d, J = 8.3 Hz, 1H), 3.93 (s, 3H), 3.85 (s, 3H), 3.42 (td, J = 6.3, 3.5 Hz, 2H), 2.84 (t, J = 6.3 Hz, 2H). ¹³C NMR (126 MHz, CDC1₃) δ 164.89, 152.67, 150.28, 132.66, 123.22, 122.33, 115.67, 61.62, 56.31, 40.08, 29.33. ESI-MS m/z: 208.1 (M+H⁺).

Step 3: 2-(3-chloro-4-fluorobenzyl)-7,8-dimethoxy-3,4-dihydroisoquinolin- l(2H)-one

Sodium hydride (9.09 mg, 0.379 mmol) and 4-(bromomethyl)-2-chloro-l- fluorobenzene (0.04 mL, 0.32 mmol) was added to the suspension of 7,8-dimethoxy- 3,4-dihydroisoquinolin-l(2H)-one (60 mg, 0.29 mmol) in THF (2 mL) at rt. The reaction mixture was stirred at rt for 1 hour and quenched by pouring into ice. After extracted by ethyl acetate and washed by brine, the organic phase was dried by sodium sulfate. The extraction was filtered and concentrated. The residue was purified by silica gel column. 2-(3-chloro-4-fluorobenzyl)-7,8-dimethoxy-3,4- dihydroisoquinolin- l(2H)-one (82.7 mg) was afforded in 81 % yield. 1H NMR (500 MHz, CDC1₃) δ 7.39 (dd, J = 7.0, 1.9 Hz, 1H), 7.23 (ddd, J = 7.8, 4.3, 2.0 Hz, 1H), 7.09 (t, J = 8.7 Hz, 1H), 6.98 (d, J = 8.3 Hz, 1H), 6.87 (d, J = 8.3 Hz, 1H), 4.72 (s, 2H), 3.99 (s, 3H), 3.88 (s, 3H), 3.40 (t, J = 6.3 Hz, 2H), 2.80 (t, J = 6.3 Hz, 2H). ¹³C NMR (126 MHz, CDC1₃) δ 162.89, 157.43 (d, J = 248.3 Hz), 153.00, 150.23, 135.01 (d, J = 3.9 Hz), 131.70, 130.02, 127.73 (d, J = 7.2 Hz), 123.49, 122.11,

121.07 (d, J = 17.9 Hz), 116.70 (d, J = 21.1 Hz), 115.46, 61.55, 56.24, 49.13, 45.60, 28.91. ESI-MS m/z: 350.1 (M+H⁺).

Step 4: 2-(3-chloro-4-fluorobenzyl)-7,8-dimethoxy-N,N-dimethyl-l-oxo-l,2,3,4- tetrahydroisoquinoline-5-sulfonamide

Starting from 2-(3-chloro-4-fluorobenzyl)-7,8-dimethoxy-3,4- dihydroisoquinolin- l(2H)-one, 2-(3-chloro-4-fluorobenzyl)-7,8-dimethoxy-N,N- dimethyl- l-oxo-l,2,3,4-tetrahydroisoquinoline-5-sulfonamide was afforded in 83 % yield for two steps using General Procedure D and E. 1H NMR (500 MHz, CDC1₃) δ 7.58 (s, 1H), 7.40 (d, J = 6.9 Hz, 1H), 7.24 - 7.22 (m, 1H), 7.10 (td, J = 8.7, 1.3 Hz, 1H), 4.70 (s, 2H), 4.05 (s, 3H), 3.93 (s, 3H), 3.39 (t, J = 5.6 Hz, 2H), 3.17 (t, J = 5.6 Hz, 2H), 2.76 (s, 6H). ¹³C NMR (126 MHz, CDC1₃) δ 161.86, 157.59 (d, J = 250.0 Hz), 153.7, 152.30, 134.49 (d, J = 3.8 Hz), 132.14, 130.24, 128.89, 127.88 (d, J = 6.7 Hz), 125.91, 121.24 (d, J = 18.3 Hz), 116.85 (d, J = 21.2 Hz), 116.46, 61.83, 56.47, 49.09, 44.82, 36.98 (2C), 26.30. ESI-MS m/z: 457.1 (M+H⁺).

Step 5: 2-(3-chloro-4-fluorobenzyl)-7,8-dihydroxy-N,N-dimethyl-l-oxo-l,2,3,4- tetrahydroisoquinoline-5-sulfonamide (34)

Starting from 2-(3-chloro-4-fluorobenzyl)-7,8-dimethoxy-N,N-dimethyl- 1- oxo- l,2,3,4-tetrahydroisoquinoline-5-sulfonamide, purification by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 40% B to 70% B over 30 minutes; retention time = 26.7 minutes), white fluffy solid 2-(3-chloro-4-fluorobenzyl)-7,8-dihydroxy-N,N- dimethyl- l-oxo-l,2,3,4-tetrahydroisoquinoline-5-sulfonamide 34 was afforded using General Procedure F. 1H NMR (500 MHz, DMSO-d₆) δ 10.49 (s, 1H), 7.66 (dd, J = 7.0, 1.9 Hz, 1H), 7.57 (s, 1H), 7.39 (d, J = 2.6 Hz, 1H), 7.33 (t, J = 8.9 Hz, 1H), 4.94 (dd, J = 24.9, 14.9 Hz, 2H), 3.89 (dd, J = 14.6, 7.3 Hz, 2H), 3.43 (t, J = 6.8 Hz, 2H), 2.70 (s, 6H). ¹³C NMR (126 MHz, DMSO-d₆) δ 163.29, 157.52 (d, J = 248.1 Hz), 149.53, 145.92, 131.81 (d, J = 3.91 Hz), 129.71, 128.26, 125.44, 123.14, 122.71 (d, J = 11.59 Hz), 120.29 (d, J = 18.27 Hz), 117.57, 109.32, 51.47, 47.09, 37.57, 37.50, 23.30. ESI-MS m/z: 429.0 (M+H⁺). Synthesis for compound 35

Compound 35

N,N'-(((oxybis(ethane-2,l-diyl))bis(oxy))bis(propane-3,l-diyl))bis(2-(2-(3- chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl-l-oxoisoindoline-4- sulfonamido)acetamide)

Chemical Formula: C₄₆H₅2Cl2F₂N₆Oi5S2

Molecular Weight: 1101.97

2-(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl- l-oxoisoindoline-4- sulfonamido)acetic acid compound (15) (78 mg, 0.170 mmol), N-ethyl-N- isopropylpropan-2-amine (0.148 ml, 0.850 mmol) and 2-(lH-benzo[d][l,2,3]triazol- l-yl)-l, l,3,3-tetramethylisouronium hexafluorophosphate(V) (HBTU) (199 mg, 0.850 mmol) was mixed in DMF (0.5 ml).3'-((Oxybis(ethane-2, l- diyl))bis(oxy))bis(propan- l-amine) (0.015 ml, 0.068 mmol) was added at rt. The resultant mixture was stirred at rt for 2 days. Purified by preparative HPLC (as indicated in the General Synthetic Procedures using a 00G-4436-P0-AX column with a linear gradient of 40% B to 60% B over 30 minutes; retention time = 29.2 minutes), white fluffy solid N,N'-(((oxybis(ethane-2, l-diyl))bis(oxy))bis(propane- 3, l-diyl))bis(2-(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl-l- oxoisoindoline-4-sulfonamido)acetamide) (35) (0.015 ml) was afforded. 1H NMR (500 MHz, DMSO-d₆) δ 10.17 (bs, 2H), 9.96 (bs, 2H), 7.90-7.89 (m, 2H), 7.53 - 7.50 (m, 2H), 7.40 - 7.35 (m, 2H), 7.32-7.29 (m, 2H), 4.65 (s, 4H), 4.44 (s, 4H), 3.65 (s, 6H), 3.45 (bs, 10H), 3.33 (bs, 4H), 3.09 - 2.93 (m, 3H), 2.73 (s, 5H), 1.57- 1.55 (m, 4H). ESI-MS mJ . 1101.1 (M+H⁺), 1123.0 (M+Na⁺) .

III. ASSAY FOR RETROVIRAL INTEGRASE INHIBITORS

Following reverse transcription, the viral cDNA is primed for integration in the cytoplasm by integrase-mediated trimming of the 3 '-ends of the viral DNA in a step referred to as 3' processing. See Pommier et al., Integrase Inhibitors to Treat HIV/AIDS, Nature Reviews, Drug Discovery 4:236-248 (2005). It requires both fully functional integrase and the integrity of the last 10-20 base pairs at both ends of the viral cDNA to perform the cleavage of the 3 '-ends of the viral DNA. This cleavage occurs immediately 3' to a conserved CA dinucleotide motif, and any alterations of this sequence prevents integrase from catalyzing 3'-processing. This cleavage reaction generates CA-3' hydroxyl DNA ends which are the reactive intermediates required for strand transfer.

Following 3 '-processing, integrase remains bound to viral cDNA as a multimeric complex in particles called pre-integration complexes (PICs) that move into the nucleus. Once in the nucleus, integrase catalyzes the insertion of the viral cDNA ends into host chromosomes. This "strand transfer" reaction involves the ligation of the viral 3' -OH DNA ends (generated by 3 '-processing) to the 5' -DNA phosphate of a host chromosome. HIV integration-site selection shows minimal sequence selectivity with regard to the chromosomal sequence in which integration takes place.

The screening and discovery of integrase inhibitors generally relies primarily on simple assays that use recombinant integrase and short oligonucleotide substrates that mimic the viral DNA ends. Inhibitors of recombinant integrase can be subdivided according to whether they are antiviral, cytotoxic or inactive in cell culture, and whether they target other viral processes besides integration. The functionality of the integrase inhibitors of the present disclosure are illustrated by their ability to inhibit the activity of a retroviral integrase (such as HIV-l integrase). This activity can be tested using any one of the DNA binding assays or integration assays described in detail in this application or those known in the art. Once preliminarily identified, an inhibitor may be further tested with an in vitro activity assay in cultured cells, where the inhibitory effect of the compound is confirmed through a reduction in the cytopathic effect of a retrovirus on the cells.

Examples of several retroviral integrase inhibition assays are described below. The integrase assays include the DNA binding assay, the disulfide cross- linking assay, the catalytic activity assay, and the cell culture activity assay, which are described in greater detail below. Further assays are described in Pommier et al., Integrase Inhibitors to Treat HIV/AIDS, Nature Reviews, Drug Discovery 4:236-248 (2005)(particularly at page 242).

A. DNA Binding Assay

During the integration process, a retroviral integrase binds to viral DNA and catalyzes the insertion of viral DNA into the host cell DNA. Thus, the inhibitory capacity of a compound of this disclosure can be tested in a DNA binding assay, in which the compound's ability to disrupt the interaction between a retroviral integrase and viral DNA is determined.

Several methods are known to perform a DNA binding assay for this purpose. For instance, the Schiff-base assay can be used to screen for a potential HIV-l integrase inhibitor and is described in, e.g., Mazumder and Pommier, Nucleic Acids Res 23(15):2865-2871, 1995. Similar methods suitable for identifying inhibitors of other retrovirus integrase are described in, e.g., Terry et al., J. Virol., 62: 2358-2365, 1988; and Khan et al., Nucleic Acids Res., 19:851-860, 1990.

B. Disulfide Crosslinking Assay

A disulfide crosslinking assay identifies an integrase inhibitor that exerts its effect by interfering with the binding between viral DNA and the integrase. This method is described in detail both in Johnson et al., J. Biol. Chem. 281(l):461-467, 2006. C. Catalytic Activity Assay

A catalytic activity or integration assay is another method for testing the inhibitory effect of a compound on a retroviral integrase. In this assay format, the integrase activity or the inhibitory effect of candidate inhibitor is reflected by the level of viral DNA integration catalyzed by the integrase. An example of this method for measuring integrase activity of other retroviruses can be found in the literature, see, e.g., Fitzgerald et al, J. Virol., 66:6257-6263, 1992; Aiyar et al, J. Virol, 70:3571-3580, 1996; and Taganov et al, J. Virol, 78:5848-5855, 2004.

D. Cell Culture Activity Assay

In addition, in vitro assays are available for confirming the inhibitory effect a candidate inhibitor of a retroviral integrase in cell culture, usually following a positive identification of the compound in the initial screening test such as the DNA binding assay or the integration assay. In this in vitro activity assay system, cells that are susceptible to infection by a particular type of retrovirus are first established in a stable culture. Under suitable conditions, the retrovirus is then introduced into the cultured cells, some of which also receive a pre-determined amount of a candidate inhibitor compound. Cell viability is then studied and the inhibitory effect of the compound is determined. The Examples section of this application provides an example of such an assay system in which HIV-1 integrase inhibitors were tested. A person of skill in the art would recognize, however, that a similar, cell culture- based system can be readily set up to confirm the function of a potential inhibitor of an integrase from another retrovirus.

The following Examples illustrate how catalytic activity of the disclosed compounds was performed.

EXAMPLE 1

In Vitro Integrase Catalytic Assays

Expression and purification of a recombinant integrase in Escherichia coli were performed as previously reported in Zouhiri et al.,. "Structure-activity relationships and binding mode of styrylquinolines as potent inhibitors of HIV- 1 integrase and replication of HIV- 1 in cell culture" J Med Chem 43: 1533-1540 (2000); and Metifiot et al., "Resistance to integrase inhibitors," Viruses 2: 1347-1366 (2010).

Preparation of oligonucleotide substrates has been described in Marinello et al., "Comparison of Raltegravir and Elvitegravir on HIV-1 integrase catalytic reactions and on a series of drug-resistant integrase mutants," Biochemistry 47: 9345-9354 (2008).

Integrase reactions were performed in 10 \L with 400 nM of recombinant IN, 20 nM of 5 '-end [ 32 P] -labeled oligonucleotide substrate and inhibitors at various concentrations. Solutions of 10% DMSO without inhibitors were used as controls. Reactions were incubated at 37 °C (60 minutes) in buffer containing 50 mM MOPS, pH 7.2, 7.5 mM MgCl₂, and 14.3 mM 2-mercaptoethanol. Reactions were terminated by addition of 10 \L of loading dye (10 mM EDTA, 98% deionized formamide, 0.025% xylene cyanol and 0.025% bromophenol blue). Reactions were then subjected to electrophoresis in 20% polyacrylamide-7 M urea gels. Gels were dried and reaction products were visualized and quantified with a Typhoon 8600 (GE Healthcare, Little Chalfont, Buckinghamshire, UK). Densitometric analyses were performed using ImageQuant from Molecular Dynamics Inc. The

concentrations at which enzyme activity was reduced by 50% (IC₅₀) were determined using "Prism" software (GraphPad Software, San Diego, CA) for nonlinear regression to fit dose-response data to logistic curve models.

EXAMPLE 2

Cellular Cytotoxicity Assay

The human osteosarcoma cell line, HOS, was obtained from Dr. Richard Schwartz (Michigan State University, East Lansing, MI) and grown in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) supplemented with 5% (v/v) fetal bovine serum, 5% newborn calf serum, and penicillin (50 units/mL) plus streptomycin (50 μg/mL; Quality Biological, Gaithersburg, MD). On the day prior to the screen, HOS cells were seeded in a 96-well luminescence cell culture plate at a density of 4000 cells in 100 μΐ_^ per well. On the day of the screen, cells were treated with compounds at the appropriate concentration range chosen and incubated at 37°C for 48 hrs. Cytotoxicity was measured by monitoring ATP levels via a luciferase reporter assay. Cells were lysed in 50 μΐ_^ cell lysis buffer (PerkinElmer, Waltham, MA) and shaken at 700 rpm at room temperature for 5 mins. After the addition of 50 μΐ_^ of ATPlite buffer (PerkinElmer) directly onto the lysed cells and shaking at 700 rpm at room temperature for 5 mins, ATP levels were monitored by measuring luciferase activity using a microplate reader. Activity was normalized to cytotoxicity in the absence of target compounds. KaleidaGraph (Synergy Software, Reading, PA) was used to perform regression analysis on the data. CC₅₀ values were determined from the fit model. EXAMPLE 3

Vector Constructs

The pNLNgoMIVR AEnv.LUC construct has been described previously in Zhao et al., "2,3-Dihydro-6,7-dihydroxy- lH-isoindol- l-one-based HIV- 1 integrase inhibitors," J Med Chem; 51 : 251-259 (2008). The integrase codon reading frame was removed from pNLNgoMIVR^'AEnv.LUC (between Kpnl and Sail sites) and placed between the Kpnl and Sail sites of pBluescript II KS+. Using this construct as the wild- type template, the following HIV-1 integrase-resistant mutants were prepared via the QuikChange II XL (Stratagene, La Jolla, CA) site-directed mutagenesis protocol: G118R, Y143R, Q148H, Q148K, N155H, G140S + Q148H, G140A + Q148K, and E138K + Q148K. The following sense with cognate antisense (not shown) oligonucleotides (Integrated DNA Technologies, Coral ville, IA) were used in the mutagenesis: G118R, 5'-

GTAC ATAC AGACAATCGCAGC AATTTC ACC AGTAC-3 ' ; E138K, 5'- GGCGGGG ATC A AGC AG A A ATTTGGC ATTCCCTA- 3 ' ; G140A, 5'- GGGG ATC A AGC AGG A ATTTGCC ATTCCCT AC A ATC- 3 ' ; G140S, 5'- GGGGATC AAGC AGGAATTTAGCATTCCCTAC AATC-3 ' ; Y143R, 5'- GCAGGAATTTGGC ATTCCCCGC AATCCCCAAAGTCAAGGA-3 ' ; Q148H, 5'- CATTCCCTACAATCCCCAAAGTCATGGAGTAATAGAATCTA -3' ; Q148K, 5'-CATTCCCTACAATCCCCAAAGTAAAGGAGTAATAGAATCTATGAA-3'; N155H, 5'-

CCAAAGTCAAGGAGTAATAGAATCTATGCATAAAGAATTAAAGAAAATT ATAGGACA-3'. The double mutation G140S + Q148H was constructed by using the previously generated Q148H mutant and the appropriate oligonucleotide for the 2^nd mutation, G140S. The double mutation G140A + Q148K was made by using the Q148K mutant and the appropriate oligonucleotide for the 2^nd mutation, G140A. The double mutation E138K + Q148K was made by using the Q148K mutant and the appropriate oligonucleotide for the 2^nd mutation, E138K. The DNA sequence of each construct was verified independently by DNA sequence determination. The mutant integrase coding sequences from pBluescript II KS+ were then subcloned into pNLNgoMIVR AEnv.LUC (between the Kpnl and Sail sites) to produce the full- length mutant HIV-1 Integrase constructs. These DNA sequences were additionally checked independently by DNA sequence determination.

EXAMPLE 4

Determining inhibition of HIV-induced cytopathic effect in cell culture MT-2 cells were grown in RPMI- 1640 medium with GlutaM AX™, supplemented with 10% (v/v) heat- inactivated fetal bovine serum (both from Gibco, Invitrogen corporation, Carlsbad). The cells were maintained at 37°C in a humidified atmosphere of 5% C0₂ in air. Every 4-5 days, cells were spun down and seeded at 2 x 10⁵ cells/ml in new cell culture flasks. HIV (HTLV-IIIB isolate) was obtained from Advanced Biotechnology Incorporated (Columbia, MD). The virus stock [3,2 x 10⁴ CCID₅₀ (50% cell culture infective dose) per ml as determinated for MT-2 cells] was stored at - 70°C until used. Stock solutions of compounds were diluted using medium directly into 96-well assay plate (Costar, Corning inc, Corning, NY).

MT-2 cells (5 x 10⁵ cells/ml) were infected with 100 CCID₅₀ or mock- infected. Subsequently test compounds were added at various concentrations 0.15 - 111 μΜ. The cell cultures were incubated at 37°C in a humidified atmosphere of 5% C0₂ in air. Four days after infection the viability of mock- and HIV-infected cells was examined spectrophotometrically by the CellTiter 96 Non-Radioactive Cell proliferation assay (Promega, Madison, WI) and also confirmed

microscopically in a hemacytometer by the trypan blue exclusion method. The percent cell viability in drug treated uninfected and infected cells was determined based on the viability of the uninfected control drug treated cells. The concentration of drug required to inhibit approximately 50% of the HIV-1 induced cytotoxicity was calculated from the plot of compound concentration verses the percent viable cells.

Single-round HIV-1 infectivity assay. Human embryonyl kidney cell culture cell line 293 was acquired from the American type Culture Collection (ATCC). The human osteosarcoma cell line, HOS, was obtained from Dr. Richard Schwartz (Michigan State University, East Lansing, MI) and grown in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) supplemented with 5% (v/v) fetal bovine serum, 5% newborn calf serum, and penicillin (50 units/mL) plus streptomycin (50 μg/mL; Quality Biological, Gaithersburg, MD). The transfection vector, pNLNgoMIVR ALUC was made from pNLNgoMIVR AEnv.HSA by removing the HSA reporter gene and replacing it with a luciferase reporter gene between the Notl and Xhol restriction sites (Oh et al. 2007; Zhao et al. 2008).

VSV-g-pseudotyped HIV was produced by transfections of 293 cells as mentioned previously (Julius et al. 2004). On the day prior to transfection, 293 cells were plated on 100-mm-diameter dishes at a density of 1.5 X 10⁶ cells per plate. 293 cells were transfected with 16 μg of pNLNgoMIVR^'ALUC and 4 μg of pHCMV-g (obtained from Dr. Jane Burns, University of California, San Diego) using the calcium phosphate method. At approximately 6 hrs after the calcium phosphate precipitate was added, 293 cells were washed twice with phosphate-buffered saline (PBS) and incubated with fresh media for 48 hrs. The virus-containing supernatants were then harvested, clarified by low- speed centrifugation, filtrated, and diluted for preparation in infection assays. On the day prior to the screen, HOS cells were seeded in a 96- well luminescence cell culture plate at a density of 4000 cells in 100 μL· per well. On the day of the screen, cells were treated with compounds from a concentration range of 10 μΜ to 0.0005 μΜ using 11 serial dilutions and then incubated at 37°C for 3 hrs. After compound incorporation and activation in the cell, 100 μΐ_^ of virus-stock diluted to achieve a maximum luciferase signal between 0.2 and 1.5 RLUs was added to each well and further incubated at 37°C for 48 hrs. Infectivity was measured by using the Steady-lite plus luminescence reporter gene assay system (PerkinElmer, Waltham, MA). Luciferase activity was measured by adding 100 μΐ_^ of Steady-lite plus buffer (PerkinElmer) to the cells, incubating at room temperature for 20 mins, and measuring luminescence using a microplate reader. Activity was normalized to infectivity in the absence of target compounds. KaleidaGraph (Synergy Software, Reading, PA) was used to perform regression analysis on the data. EC₅₀ values were determined from the fit model.

EXAMPLE 5

In vitro integrase inhibitory potencies of synthetic analogues 1 - 15

HrV-1 integrase inhibitory activities of the disclosed compounds were determined for 3' processing (3'-P) and strand transfer (ST) using the in vitro integrase catalytic assays. The results are shown in Table 1.

Table 1

In vitro integrase inhibitory potencies of synthetic analogues 1 - 15

EXAMPLE 6

In vitro integrase inhibitory potencies of synthetic analogues 16 - 21

The in vitro integrase inhibitory activity of compounds 16-21 was determined for 3' processing(3'P) and strand transfer (ST), and the results are shown in Tables 2 and 3. Table 2

In vitro integrase inhibitory potencies of synthetic analogues 16 - 21

n = 0, 1 , 2, 3, 4, 5

EXAMPLE 7

In vitro integrase inhibitory potencies and antiviral potencies of synthetic analogues 22 - 25

The IC₅₀, CC₅₀ and EC₅₀ were determined for compounds 1 and 22-25. This data illustrates that the selectivity index (ratio of cytotoxic CC₅₀ value to EC₅₀ value) can be as high as over 500. For example compound 1 has a selectivity index of 564 (9.6/0.017). In particular embodiments, the selectivity index is greater than 10, or 50 or 100 or 200 or 300 or 400 or 500. Table 3

In vitro integrase inhibitory potencies and antiviral potencies of synthetic analogues 22 - 25

n = 1 , 2, 3, 4

¹ Preliminary data

Table 4. In Vitro Integrase inhibitory potencies of synthetic analogues 26 -35.

EXAMPLE 8

Antiviral Potencies in HIV-1 infected cells

Table 5 shows more results for certain of the oxoisoindoline sulfonamide integrase inhibitors (CC₅₀, EC₅₀ and mutants in HIV-infected cells assays). All of the oxoisoindoline sulfonamides (1, 2, 10, 12 and 13) show better results than the FDA- approved integrase inhibitor drug Raltegravir against mutant Y143R in cell-based assays. Compound 10 can reach 19 nM inhibition for Y143R in cells, which is 8- fold better than Raltegravir. The selectivity index can be calculated from the results in Table 4, and for compound 10 the selectivity index is over 600. Table 5. Cellular cytotoxicity and antiviral in cell infected with HTV-1 containing wild-type or mutant integrase enzymes.¹

"Assays were performed as described above; Cytotoxic concentration resulting in 50% cell kill using human osteosarcoma (HOS) cells; ^cValues obtained from cells transt^'ected with wild-type (WT) IN; ^dCells transfected with viral constracts as described above; ^L Double muatnt.

Some additional examples of the compound Z are:

IV. PHARMACEUTICAL COMPOSITION AND METHODS OF USE

The presently described compounds, and pharmaceutically acceptable salts thereof, are useful for treating humans or animals suffering from a condition characterized by a replication or integration of a retrovirus and for helping to prevent or delay the onset of such a condition. For example, the compounds are useful for treating infection by HIV, AIDS, or AIDS related complex (ARC). When treating or preventing these diseases, the compounds can either be used individually or in combination, as is best for the patient. Appropriate subjects can be selected for administration of the integrase inhibitors, as described in more detail below.

The compounds and pharmaceutical compositions can be used in the treatment of a variety of retroviral diseases caused by infection with retroviruses that require integrase activity for infection and viral replication. Examples of such diseases include HIV-1, HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), HTLV-1, HTLV-2, spuma virus (human foamy virus) and feline infectious leukemia.

The compounds and pharmaceutical compositions are especially useful in the inhibition of HIV integrase, the prevention or treatment of infection by human immunodeficiency virus (HIV) and the treatment of consequent pathological conditions such as AIDS. Treating AIDS or preventing or treating infection by HIV is defined as including, but not limited to, treating a wide range of stages of HIV infection: AIDS, ARC (AIDS related complex), both symptomatic and

asymptomatic, and actual or potential exposure to HIV. For example, the compounds are useful in treating infection by HIV after suspected past exposure to HIV by e.g., blood transfusion, exchange of body fluids, bites, accidental needle stick, or exposure to a patient's blood during surgery.

As used herein, the term "treating" means that the compounds can be used in humans with at least a tentative diagnosis of disease. The compounds will delay or slow the progression of the disease thereby giving the individual a more useful life span.

The term "preventing" means that the compounds are useful when administered to a patient who has not been diagnosed as possibly having the disease at the time of administration, but who would normally be expected to develop the disease or be at increased risk for the disease. The compounds will slow the development of disease symptoms, delay the onset of the disease, or prevent the individual from developing the disease at all.

In treating or preventing the above diseases, the compounds are administered in a therapeutically effective amount. The therapeutically effective amount will vary depending on the particular compound used and the route of administration, as is well known.

In treating a subject displaying any of the diagnosed above conditions a clinician may administer a compound immediately and continue administration indefinitely, as needed. Upon HIV infection or exposure, even though the patient does not have symptoms of disease, administration of the compounds may be started before symptoms appear, and treatment may be continued indefinitely to prevent or delay the onset of disease.

The compounds are useful in the preparation and execution of screening assays for antiviral compounds. For example, the compounds are useful for isolating enzyme mutants, which are excellent screening tools for more powerful antiviral compounds. Furthermore, the compounds are useful in establishing or determining the binding site of other antivirals to HIV integrase, e.g., by competitive inhibition. Also included are methods of screening for an anti-HIV integrase drug, by providing an assay of HIV integrase inhibition, and using the assay to screen for drugs that are analogs or derivatives of any of the disclosed compounds, and which inhibit HIV integrase. In particular examples, the assay detects a dihydroxy-N,N- dimethyl-l-oxoisoindoline-4- sulfonamide compound that inhibits HIV-1 integrase.

The treatment disclosed herein involves administering to a subject in need of such treatment a pharmaceutical composition that includes a pharmaceutically acceptable carrier and a therapeutically-effective amount of the presently described compound. The compounds may be administered orally, parenterally (including subcutaneous injections (SQ and depo SQ), intravenous (IV), intramuscular (IM and depo-IM), intrasternal injection or infusion techniques), sublingually, intranasally (inhalation), intrathecally, topically, ophthalmically or rectally, in dosage unit formulations containing conventional non-toxic pharmaceutically-acceptable carriers, adjuvants and vehicles. Dosage forms known to those of skill in the art are suitable for delivery of the compounds.

The terms "administration of and or "administering a" compound should be understood to mean providing a compound, a prodrug of a compound, or a pharmaceutical composition as described herein.

Pharmaceutical compositions are provided that contain therapeutically effective amounts of the presently described compounds. The compounds are preferably formulated into suitable pharmaceutical preparations such as tablets, capsules, or elixirs for oral administration or in sterile solutions or suspensions for parenteral administration. Typically the compounds described above are formulated into pharmaceutical compositions using techniques and procedures well known in the art.

In certain example, about 1 to 500 mg of a compound or mixture of compounds or a physiologically acceptable salt or ester is compounded with a physiologically acceptable vehicle, carrier, excipient, binder, preservative, stabilizer, flavor, etc., in a unit dosage form as called for by accepted pharmaceutical practice. The amount of active substance in those compositions or preparations is such that a suitable dosage in the range indicated is obtained. The compositions are preferably formulated in a unit dosage form, each dosage containing from about 2 to about 100 mg, more preferably about 10 to about 30 mg of the active ingredient. The term "unit dosage form" refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient.

To prepare compositions, one or more compounds are mixed or combined with a suitable pharmaceutically acceptable carrier. Upon mixing or addition of the compound(s), the resulting mixture may be a solution, suspension, emulsion, or the like. Liposomal suspensions may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art. The form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle. The effective concentration is sufficient for lessening or ameliorating at least one symptom of the disease, disorder, or condition treated and may be empirically determined.

Pharmaceutical carriers or vehicles suitable for administration of the compounds provided herein include any such carriers known to be suitable for the particular mode of administration. In addition, the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, or have another action. The compounds may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients.

Where the compounds exhibit insufficient solubility, methods for solubilizing may be used. Such methods are known and include, but are not limited to, using cosolvents such as dimethylsulfoxide (DMSO), using surfactants such as Tween®, and dissolution in aqueous sodium bicarbonate. Derivatives of the compounds, such as salts or prodrugs may also be used in formulating effective pharmaceutical compositions.

The compounds may be prepared with carriers that protect them against rapid elimination from the body, such as time-release formulations or coatings. Such carriers include controlled release formulations, such as, but not limited to, microencapsulated delivery systems. The active compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the subject treated. The therapeutically effective concentration may be determined empirically by testing the compounds in known in vitro and in vivo model systems for the treated disorder.

The compounds and compositions can be enclosed in multiple or single dose containers. The enclosed compounds and compositions can be provided in kits, for example, including component parts that can be assembled for use. For example, a compound inhibitor in lyophilized form and a suitable diluent may be provided as separated components for combination prior to use. A kit may include a compound inhibitor and a second therapeutic agent for co-administration. The inhibitor and second therapeutic agent may be provided as separate component parts. A kit may include a plurality of containers, each container holding one or more unit dose of the compound. The containers are preferably adapted for the desired mode of administration, including, but not limited to tablets, gel capsules, sustained-release capsules, and the like for oral administration; depot products, pre-filled syringes, ampoules, vials, and the like for parenteral administration; and patches, medipads, creams, and the like for topical administration.

The concentration of the compound is effective for delivery of an amount upon administration that lessens or ameliorates at least one symptom of the disorder for which the compound is administered. Typically, the compositions are formulated for single dosage administration. The concentration of active compound in the drug composition will depend on absorption, inactivation, and excretion rates of the active compound, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.

The active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only.

When administered orally as a suspension, these compositions are prepared according to techniques well known in the art of pharmaceutical formulation and may contain microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners/flavoring agents. As immediate release tablets, these compositions may contain microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and lactose and/or other excipients, binders, extenders, disintegrants, diluents and lubricants.

If oral administration is desired, the compound is typically provided in a composition that protects it from the acidic environment of the stomach. For example, the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine. The composition may also be formulated in combination with an antacid or other such ingredient.

Oral compositions will generally include an inert diluent or an edible carrier and may be compressed into tablets or enclosed in gelatin capsules. For the purpose of oral therapeutic administration, the active compound or compounds can be incorporated with excipients and used in the form of tablets, capsules, or troches. Pharmaceutically compatible binding agents and adjuvant materials can be included as part of the composition.

The tablets, pills, capsules, troches, and the like can contain any of the following ingredients or compounds of a similar nature: a binder such as, but not limited to, gum tragacanth, acacia, corn starch, or gelatin; an excipient such as microcrystalline cellulose, starch, or lactose; a disintegrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, magnesium stearate; a gildant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; and a flavoring agent such as peppermint, methyl salicylate, or fruit flavoring.

When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil. In addition, dosage unit forms can contain various other materials, which modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents. The compounds can also be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like. A syrup may contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings, and flavors.

The active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action. When administered orally, the compounds can be administered in usual dosage forms for oral administration. These dosage forms include the usual solid unit dosage forms of tablets and capsules as well as liquid dosage forms such as solutions, suspensions, and elixirs. When the solid dosage forms are used, it is preferred that they be of the sustained release type so that the compounds need to be administered only once or twice daily.

The oral dosage forms are administered to the subject 1, 2, 3, or 4 times daily. It is preferred that the compounds be administered either three or fewer times, more preferably once or twice daily. It is preferred that whatever oral dosage form is used, that it be designed so as to protect the compounds from the acidic environment of the stomach. Enteric coated tablets are well known to those skilled in the art. In addition, capsules filled with small spheres, each coated to protect from the acidic stomach, are also well known to those skilled in the art.

When administered orally, an administered amount therapeutically effective to inhibit retroviral integrase activity, to inhibit retroviral integrase mediated strand transfer, to inhibit retroviral mediated incorporation of a donor DNA into a receiving DNA, to inhibit HIV replication, to inhibit, prevent, or treat HIV infection, to treat or prevent AIDS is from about 0.1 mg/day to about 1,000 mg/day. In certain examples, the oral dosage is from about 1 mg/day to about 100 mg/day. In yet other examples, the oral dosage is from about 5 mg/day to about 50 mg/day. It is understood that while a subject may be started at one dose, that dose may be varied over time as the subject's condition changes.

The compounds can be administered orally to humans in a dosage range of 1 to 1000 mg/kg body weight in single or divided doses. One illustrative dosage range is 0.1 to 200 mg/kg body weight orally in single or divided doses. Another illustrative dosage range is 0.5 to 100 mg/kg body weight orally in single or divided doses. For oral administration, the compositions may be provided in the form of tablets containing 1.0 to 1000 milligrams of the active ingredient, particularly 1.0, 5,0. 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, 100.0, 150.0, 200.0, 250,0, 300.0, 400.0, 500.0, 600.0, 750.0, 800.0, 900.0, and 1000.0 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. It will be understood, however, that the specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the host undergoing therapy.

Injectable solutions or suspensions may be formulated, using suitable nontoxic, parenterally-acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.

Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include any of the following components: a sterile diluent such as water for injection, saline solution, fixed oil, a naturally occurring vegetable oil such as sesame oil, coconut oil, peanut oil, cottonseed oil, and the like, or a synthetic fatty vehicle such as ethyl oleate, and the like, polyethylene glycol, glycerine, propylene glycol, or other synthetic solvent; antimicrobial agents such as benzyl alcohol and methyl parabens; antioxidants such as ascorbic acid and sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, and phosphates; and agents for the adjustment of tonicity such as sodium chloride and dextrose. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass, plastic, or other suitable material. Buffers, preservatives, antioxidants, and the like can be incorporated as required.

Where administered intravenously, suitable carriers include physiological saline, phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents such as glucose, polyethylene glycol, polypropyleneglycol, and mixtures thereof. Liposomal suspensions including tissue-targeted liposomes may also be suitable as pharmaceutically acceptable carriers.

The compounds can be administered parenterally, for example, by IV, IM, depo-IM, SC, or depo-SC. When administered parenterally, a therapeutically effective amount of about 0.5 to about 100 mg/day, more particularly from about 5 to about 50 mg daily should be delivered. When a depot formulation is used for injection once a month or once every two weeks, the dose may be about 0.5 mg/day to about 50 mg/day, or a monthly dose of from about 15 mg to about 1,500 mg.

The compounds can be administered sublingually. When given sublingually, the compounds should be given one to four times daily in the amounts described above for IM administration.

The compounds can be administered intranasally. When given by this route, the appropriate dosage forms are a nasal spray or dry powder. The dosage of the compounds for intranasal administration is the amount described above for IM administration.

When administered by nasal aerosol or inhalation, these compositions may be prepared according to techniques well known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents.

The compounds can be administered intrathecally. When given by this route, the appropriate dosage form can be a parenteral dosage form. The dosage of the compounds for intrathecal administration is the amount described above for IM administration.

The compounds can be administered topically. When given by this route, the appropriate dosage form is a cream, ointment, or patch. When administered topically, an illustrative dosage is from about 0.5 mg/day to about 200 mg/day.

Because the amount that can be delivered by a patch is limited, two or more patches may be used. The compounds can be administered rectally by suppository. When administered by suppository, an illustrative therapeutically effective amount may range from about 0.5 mg to about 500 mg.

When rectally administered in the form of suppositories, these compositions may be prepared by mixing the drug with a suitable non-irritating excipient, such as cocoa butter, synthetic glyceride esters of polyethylene glycols, which are solid at ordinary temperatures, but liquefy and/or dissolve in the rectal cavity to release the drug.

The compounds can be administered by implants. When administering a compound by implant, the therapeutically effective amount is the amount described above for depot administration.

The compounds may be used in the same manner, by the same routes of administration, using the same pharmaceutical dosage forms, and at the same dosing schedule as described above, for preventing disease or treating subjects with HIV infection, AIDS, or ARC.

The presently described compounds may also be used in combination with a therapeutically effective amount of an AIDS treatment agent such as nucleoside analog reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, other retroviral integrase inhibitors, other antivirals, immunomodulators, anti-infectives, other antibiotics, or other medications useful against HIV infection or AIDS.

Suitable antivirals of all categories include Amprenivir, Abacavir, Acyclovir, Adefovir dipivoxil, Alpha Interferon, Retrovir, Ansamycin, beta-fluoro-ddA, Cidofovir, Curdlan sulfate, Cytovene, Ganciclovir, Delaviridine, Dideoxycytidine, Dideoxyinosine, Efavirenz, Famciclovir, Hypericin, Interferon Beta, Interferon alfa- n3, Indinavir, Lamivudine, Lobucavir, Nelfinavir, Nevirapine, Novapren,

Phosphonoformate, Probucol, Ritonavir, Saquinavir, Didehydrodeoxythymidine, Valaciclovir, Virazole, Ribavirin, Zalcitabine, and Zidovudine (AZT).

Suitable immunomodulators include Bropirimine, Acemannan, interferons such as gamma interferon and alpha interferon, tumor necrosis factor, granulocyte macrophage colony stimulating factor, interleukin-2, recombinant or soluble CD4.

Suitable anti-infectives include Clindamycin, Primaquine, Fluconazole, Pastille, Nystatin Pastille, Ornidyl, Eflornithine, Pentamidine, Isethionate,

Trimethoprim, Trimethoprim/sulfa, Piritrexim, Pentamidine, Spiramycin,

Trimetrexate.

Examples of combination therapy are simultaneous or alternating treatments with a presently described integrase inhibitor and an inhibitor of HIV protease and/or a non-nucleoside inhibitor of HIV reverse transcriptase. An optional fourth component in the combination is a nucleoside inhibitor of HIV reverse transcriptase, such as AZT, 3TC, ddC or ddl. Suitable HIV protease inhibitors include indinavir, nelfinavir, ritonavir, and saquinavir. Suitable non-nucleoside inhibitors of HIV reverse transcriptase include nevirapine and efavirenz.

In such combinations the compounds and other active agents may be administered separately or in conjunction. In addition, the administration of one element may be prior to, concurrent to, or subsequent to the administration of other agent(s).

It should be apparent to one skilled in the art that the exact dosage and frequency of administration will depend on the particular compounds administered, the particular condition being treated, the severity of the condition being treated, the age, weight, general physical condition of the particular subject, and other medication the individual may be taking as is well known to administering physicians or other clinicians who are skilled in therapy of retroviral infections, diseases, and associated disorders.

In view of the many possible embodiments to which the principles of the disclosed disclosure may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the disclosure and should not be taken as limiting the scope of the disclosure. Rather, the scope of the disclosure is defined by the following claims. We therefore claim as our disclosure all that comes within the scope and spirit of these claims.

Reference: 1. Zhao X.Z., Semenova E.A., Vu B.C., Maddali K., Marchand C, Hughes

S.H., Pommier Y., Burke T.R., Jr. (2008) 2,3-Dihydro-6,7-dihydroxy-lH- isoindol-1 -one-based HIV-1 integrase inhibitors. J Med Chem; 51: 251-259. 2. Burke, T. R., Jr.; Zhao, X. Z.; Semenova, E. A.; Pommier, Y. Phthalimides and phthalhydrazides as inhibitors of HIV-1 integrase. U.S. Provisional Patent Appl. No. 60/956,636 filed August 17, 2007. International Patent

Application PCT/US2008/073511 filed August 18, 2008. International

Publication Number WO2009/026248 A2 (February 26, 2009). Zouhiri F., Mouscadet J.-F., Mekouar K., Desmaele D., SavourrD., Leh H., Subra F., Le Bret M., Auclair C, d'Angelo J. (2000). Structure-activity relationships and binding mode of styrylquinolines as potent inhibitors of hiv-1 integrase and replication of hiv-1 in cell culture. J Med Chem; 43: 1533-1540.

Metifiot M., Marchand C, Maddali K., Pommier Y. (2010). Resistance to integrase inhibitors. Viruses; 2: 1347-1366.

Marinello J., Marchand C, Mott B.T., Bain A., Thomas C.J., Pommier Y. (2008) Comparison of Raltegravir and Elvitegravir on HIV-1 integrase catalytic reactions and on a series of drug-resistant integrase mutants.

Biochemistry; 47: 9345-9354.

Claims

We claim:

1. A compound Z of the following formula, or a tautomer or a pharmaceutically acceptable salt or ester thereof:

wherein n=l or 2;

X is halogen and m=0-5;

Y is carbonyl or (CH₂)_r and r=l or 2.

R¹ is heterocyclic, -Ci-Cg, alkyl, aryl, heteroaryl, -C₃-C₂₄ cycloalkyl, -C₃-C₂₄ heterocycloalkyl, carboxyl, an amino acid, or an amine;

R² is H or -Ci-C₈ alkyl; and

R is H, OH, alkoxy or aryloxyl, alkylcarbonyl or arylcarbonyl, alkylsulfonyl

1 3 or arylsulfonyl, -Ci-C_% alkyl or alkenyl, -C₃-C8 cycloalkyl, or aryl; or R and R together form a heterocyclic ring that contains a nitrogen, and optionally an oxygen or a carbonyl or a sulfonyl;

or Z-L-Z wherein R¹ is amine, and L comprises a Ci-Cw polyalkyl or polyether linker between the nitrogen of each R¹.

2. The compound of claim 1 wherein R¹ is amine, and the amine is - NR⁵R⁶ wherein R⁵ and R⁶ are independently H , -C Cg alkyl or heteroalkyl, heterocycloalkyl, carboxyl, or amino.

3. The compound of claim 2 wherein m is 2-3, Y is alkyl, R^J is H or -

2 5

C C₃ alkyl, R" is H or -C C₃ alkyl, and R^J is an alkylaminyl, morpholinyl, piperizinyl, pyridinyl, carboxyl, pyrrolidinyl, or indolinyl.

4. The compound of any one of claims 1-3 wherein n=l .

5. The compound of any one of claims 1-3 wherein n=2.

3 2

6. The compound of any one of claims 2-5 wherein R is H, and R is H.

7. The compound of any one of claims 2-5 wherein R is

8. The compound of any one of claims 2-5 wherein R⁵ is -Ci-Cg, alkyl amine, -C Cg dialkyl amine, or -CrCg haloamine, -C Cg morpholinalkyl, piperazinalkyl, acetyl, pyrrolidinyl, oxoisoindolinyl sulfonamide, or glycyl.

9. The compound of any one of claims 1-8 wherein X is F, CI or Br.

10. The compound of any one of claims 1-8, wherein X is F or CI and m=2.

11. The compound of any one of claims 1-10 wherein the compound is of the followin formula

wherein and X₂ are halogen.

12. The compound of any one of claims 1-11 wherein is F and X₂ is

CI.

13. The compound of any one of claims 1-12 wherein R⁵ or R⁶ is methyl, ethyl, 3-bromopropyl, morpholinyl, morpholinoethyl, piperazinethyl, methylpiperazinyl, aminoethylpiperazinyl, dimethylaminopropyl, pyridinylmethyl, acetyl, methylamine, bromopropylamine, pyrrolidinyl, or oxoisoindolinyl.

14. The compound of any one of claims 1-13 wherein R is:

- 106-

15. The compound of any one of claims 1-4 wherein the compound is Z and not Z-L-Z.

16. The compound of any one of claims 1-4 wherein the compound is Z-L-Z and L is -NR⁸(CH₂)_nNR⁸- , or L is

-NR⁸CH₂C(=0)NH(CH₂)_pO(CH₂CH₂OCH₂CH₂)_qO(CH2)_pNH(0=)CCH₂NR₈- wherein R is H or C_1-3 alkyl, p=l-4 and q=l-4.

17. The compound of any one of claims 1-11, wherein the compound is 2-(3- chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl- l-oxoisoindoline-4-sulfonamide;

N-(3-bromopropyl)-2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy- l-oxoisoindoline-4- sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-(2-morpholinoethyl)- l- oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy- l-oxo-N- (2-(piperazin-l-yl)ethyl)isoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-N- (3-(dimethylamino)propyl)-6,7-dihydroxy- l-oxoisoindoline-4-sulfonamide; 2-(3- chloro-4-fluorobenzyl)-N-(3-(dimethylamino)propyl)-7-hydroxy-6-methoxy- l- oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy- l-oxo-N- (pyridin-2-ylmethyl)isoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-7- hydroxy-6-methoxy- l-oxo-N-(pyridin-2-ylmethyl)isoindoline-4-sulfonamide; 2- (2- (3-chloro-4-fluorobenzyl)-6,7-dihydroxy- l-oxoisoindoline-4-sulfonamido)acetic acid; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4- sulfonamide; 2-(3-chloro-4-fluorobenzyl)-N,N-diethyl-6,7-dihydroxy- l- oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-4- (morpholinosulfonyl)isoindolin-l-one; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy- 4-((4-methylpiperazin- l-yl)sulfonyl)isoindolin-l-one; 4-((4-(2- aminoethyl)piperazin-l-yl)sulfonyl)-2-(3-chloro-4-fluorobenzyl)-6,7- dihydroxyisoindolin-l-one; 2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonic acid; l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindolin-4-yl)sulfonyl)pyrrolidine-2-carboxylic acid; l-((2-(3-chloro-4- fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4-yl)sulfonyl)pyrrolidine-2-carboxyli acid; l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carboxylic acid; l-(l-(l-(l-((2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindolin-4- yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carbonyl)pyrrolidine-2-carboxylic acid; l-(l-(l-(l-(l-((2-(3-chloro-4-fluorobenzyl) 6,7-dihydroxy-l-oxoisoindolin-4-yl)sulfonyl)pyrrolidine-2-carbonyl)pyrrolidine-2- carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carbonyl)pyrrolidine-2-carboxylic acid; N,N'-(propane-l,3-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l- oxoisoindoline-4-sulfonamide); N,N'-(butane-l,4-diyl)bis(2-(3-chloro-4- fluorobenzyl)-6,7-dihydroxy- 1 -oxoisoindoline-4-sulfonamide) ; N,N'-(pentane- 1,5- diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-l-oxoisoindoline-4- sulfonamide); or N,N'-(hexane-l,6-diyl)bis(2-(3-chloro-4-fluorobenzyl)-6,7- dihydroxy-l-oxoisoindoline-4- sulfonamide); 2-(3-Chloro-4-fluorobenzyl)-6,7- dihydroxy-N,N,5-trimethyl-l-oxoisoindoline-4-sulfonamide; 5-Butyl-2-(3-chloro-4 fluorobenzyl)-6,7-dihydroxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide; 2-(3- Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-N,N-dimethyl-l-oxoisoindoline 4- sulfonamide; 2-(3-Chloro-4-fluorobenzyl)-6,7-dihydroxy-5-isopropyl-4- (morpholinosulfonyl)isoindolin-l-one; 2-(3-Chloro-4-fluorobenzyl)-5,6,7- trihydroxy-N,N-dimethyl-l-oxoisoindoline-4-sulfonamide; 2-(3-Chloro-4- fluorobenzyl)-5-(4-(N,N-dimethylsulfamoyl)phenyl)-6,7-dihydroxy-N,N-dimethyl- l-oxoisoindoline-4-sulfonamide; 2-(3-chloro-4-fluorophenethyl)-6,7-dihydroxy- N,N-dimethyl-l-oxoisoindoline-4-sulfonamide; 2-(4-fluorophenethyl)-6,7- dihydroxy-N,N-dimethyl- l-oxoisoindoline-4-sulfonamide; 2-(3-chloro-4- fluorobenzyl)-7,8-dihydroxy-N,N-dimethyl-l-oxo- l,2,3,4-tetrahydroisoquinoline-5- sulfonamide; N,N'-(((oxybis(ethane-2, l-diyl))bis(oxy))bis(propane-3,l-diyl))bis(2- (2-(3-chloro-4-fluorobenzyl)-6,7-dihydroxy-N-methyl-l-oxoisoindoline-4- sulfonamido)acetamide).

1 3

18. The compound of claim 1 wherein R and R together form the heterocyclic ring, and the compound is

wherein R⁶ is H , -Ci-Cg, alkyl or heteroalkyl, heterocycloalkyl, a carboxyl, or amino; R is carbon, nitrogen, oxygen, carbonyl or sulfonyl; and p=l-2.

19. The compound of claim 1 or 18, wherein the compound is one of:

- Ill -

- 112-

21. A pharmaceutical composition comprising the compound of any one of claims 1-20, and a pharmaceutically acceptable carrier.

22. The pharmaceutical composition of claim 21 comprising any one of the compounds of claim 20.

23. A method of inhibiting retrovirus proliferation, comprising contacting a cell that is infected with a retrovirus, or at risk of being infected with a retrovirus, with an effective amount of at least one compound of any of claims 1-19 or the composition of any one of claims 21-22.

24. The method of claim 23, wherein the contacting step is performed in vitro.

25. The method of claim 23, wherein the cell is part of a living animal.

26. The method of claim 25, wherein the animal is a human.

27. The method of claim 26, wherein the retrovirus is HIV-1.

28. The method of claim 27, wherein the method of treatment is administered to delay progression of infection by HIV-1.

29. The method of claim 25, comprising orally administering the compound to a subject.

30. The method of any one of claims 25-29, comprising parenterally, sublingually, intranasally, intrathecally, topically, opthalmically or rectally administering the compound to the subject.

31. The method of any one of claims 25-29, wherein the compound comprises the compound of any one of claims 3-7.

32. The method of any of claims 25-30, wherein the compound comprises the compound of claim 11.

33. A method of inhibiting a retroviral integrase, the method comprising exposing the retroviral integrase to an integrase inhibiting amount of the compound of any one of claims 1-19.

34. The method of claim 33, comprising inhibiting a HIV integrase.

35. The method of claim 33, comprising inhibiting strand transfer catalyzed by HIV integrase.

36. The method of claim 33, comprising inhibiting incorporation of a donor strand DNA into a receiving strand DNA.

37. The method of claim 34, wherein the method comprises inhibiting a HIV-1 integrase.

38. A method of treating HIV infection in a subject, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition of claim 20.

39. The method of claim 38, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition of claim 16.

40. The method of claim 39, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition of claim 17.