WO2013004668A1 - Root preferred promoters derived from rice and methods of use - Google Patents
Root preferred promoters derived from rice and methods of use Download PDFInfo
- Publication number
- WO2013004668A1 WO2013004668A1 PCT/EP2012/062855 EP2012062855W WO2013004668A1 WO 2013004668 A1 WO2013004668 A1 WO 2013004668A1 EP 2012062855 W EP2012062855 W EP 2012062855W WO 2013004668 A1 WO2013004668 A1 WO 2013004668A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- seq
- sequence
- nucleic acid
- expression
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8225—Leaf-specific, e.g. including petioles, stomata
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
Definitions
- the presently disclosed subject matter is closely related to the fields of molecular biology and biotechnology.
- the presently disclosed subject matter is additionally closely related to the field of plant biotechnology.
- An objective of crop trait functional genomics is to identify crop trait genes of interest, for example, genes capable of conferring useful agronomic traits in crop plants.
- agronomic traits include, but are not limited to, enhanced yield, whether in quantity or quality; enhanced nutrient acquisition and metabolic efficiency; enhanced or altered nutrient composition of plant tissues used for food, feed, fiber, or processing; enhanced utility for agricultural or industrial processing; enhanced resistance to plant diseases; enhanced tolerance of adverse environmental conditions including, but not limited to, drought, excessive cold, excessive heat, or excessive soil salinity or extreme acidity or alkalinity; and alterations in plant architecture or development, including changes in developmental timing.
- the deployment of such identified trait genes by either transgenic or non-transgenic approaches can materially improve crop plants for the benefit of agriculture.
- genes that are important for crop development is thus an ongoing effort in the agricultural community. Additional information can also be derived by analyzing the genomes of important plants. For example, the identification of transcriptional regulatory elements that can direct the expression of linked nucleotide sequences can also lead to the ability to manipulate the plant genome to express polypeptides of interest in desirable spatial and/or temporal manners.
- promoters play important roles, as transcription initiation is often a rate-limiting step in the expression of polypeptides of interest, particularly relative to subsequent stages such as the translation of mKNAs. As such, the characteristics of the promoter can be an important consideration in the selection of how to best accomplish protein production through transgensis. Promoters are capable of regulating transcription initiation in several ways. For example, certain promoters can be induced by the presence of particular compounds and/or external stimuli, such that they direct expression of operably linked nucleotide sequences only in specific tissues and/or cell types and/or during specific stages of development. Other promoters are capable of constitutively expressing linked sequences.
- the transcription of a coding sequence of interest can be regulated by operably linking the coding sequence to whichever promoter can provide the desired regulatory characteristics.
- different promoters can be employed in different ways to enhance the agronomic, pharmaceutical, and/or nutritional value of crops.
- heterologous nucleotide sequences in plant cells To meet these needs, the presently disclosed subject matter provides in some embodiments promoter sequences for directing expression of heterologous nucleotide sequences in plant cells. The presently disclosed subject matter addresses these problems associated with the expression of nucleotide sequences in transgenic plants, as well as other problems.
- nucleic acid sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, wherein the sequences are capable of driving expression in a plant cell.
- the plant cell can be a monocot or dicot plant cell.
- the plant root cell may be a monocot root cell, and may further be a maize root cell.
- the present invention also relates to an expression cassette comprising SEQ ID NO: 1 or SEQ ID NO: 2 operably linked to a nucleotide sequence of interest.
- the expression cassette is comprised within an expression vector.
- the present invention relates to a method of expressing a
- heterologous gene comprising constructing an expression cassette comprising SEQ ID NO: 1 or SEQ ID NO: 2, wherein the expression cassette is functional in a plant or plant cell, and creating a plant or plant cell comprising the expression cassette, wherein the heterologous gene is expressed.
- the plant or plant cell is a monocot, and may further be maize.
- the invention relates to a plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene.
- the invention relates to progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene.
- the invention relates to seed derived from the progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene.
- the present invention relates to a method of expressing a
- heterologous genes comprising constructing an expression cassette comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the expression cassette is functional in a plant or plant cell, and creating a plant or plant cell comprising the expression cassette, wherein the heterologous genes are expressed.
- the plant or plant cell is a monocot, and may further be maize.
- the invention relates to a plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene or genes.
- the invention relates to progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene or genes.
- the invention relates to seed derived from the progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene or genes.
- the present invention relates to a plant, plant cell, or plant tissue or portion thereof comprising an expression cassette comprising the promoter set forth in either SEQ ID NO: 1 or SEQ ID NO: 2.
- the plant, plant cell, or plant tissue or portion thereof is a monocot and further may be maize.
- the present invention relates to a method of expressing a gene of interest in plant roots, comprising planting seed comprising SEQ ID NO: 1 or SEQ ID NO: 2, growing the seed into a plant, and harvesting seed of the plant; wherein the plant expresses in the roots a the gene of interest operably linked to SEQ ID NO: 1 or SEQ ID NO: 2.
- the present invention relates to a plant, plant cell, or plant tissue or portion thereof comprising an expression cassette comprising the promoters set forth in
- the plant, plant cell, or plant tissue or portion thereof is a monocot and further may be maize.
- the present invention relates to a method of expressing a gene or genes of interest in plant roots, comprising planting seed comprising SEQ ID NO: 1 and SEQ ID NO: 2, growing the seed into a plant, and harvesting seed of the plant; wherein the plant expresses in the roots a the gene of interest operably linked to SEQ ID NO: 1 and a gene of interest operably linked to SEQ ID NO: 2.
- SEQ ID NO: 1 is the engineered promoter derived from Osl035893_at (also
- prOs 1035893 referred to as prOs 1035893.
- SEQ ID NO: 2 is the engineered promoter derived from Osl053629_at (also
- prOsl053629 referred to as prOsl053629.
- SEQ ID NO: 3 is the primer 629-P1.
- SEQ ID NO: 4 is the primer 629-P2.
- SEQ ID NO: 5 is the primer 629-P3.
- SEQ ID NO: 6 is the primer 629-P4.
- SEQ ID NO: 7 is the mutagenesis primer 629-ml .
- SEQ ID NO: 8 is the mutagenesis primer 629-m2.
- SEQ ID NO: 9 is the mutagenesis primer 629-ml .1.
- SEQ ID NO: 10 is pNOV6901.
- SEQ ID NO: 11 is the assembly vector 15672.
- SEQ ID NO: 12 is vector 15289.
- SEQ ID NO: 13 is the binary vector 15673; (comprises Osl053629-expression cassette).
- SEQ ID NO: 14 is the binary vector 15706; (comprises Os 1035893 -expression cassette).
- SEQ ID NO: 15 is the primer 893-P1.
- SEQ ID NO: 16 is the primer 893-P2.
- SEQ ID NO: 17 is the primer 893-P3.
- SEQ ID NO: 18 is the primer 893-P4.
- SEQ ID NO: 19 is the mutagenesis primer 893-ml .
- SEQ ID NO: 20 is the mutagenesis primer 893-m2.
- SEQ ID NO: 21 is the mutagenesis primer 893-m3.
- SEQ ID NO: 22 is the mutagenesis primer 893-m4.
- SEQ ID NO: 23 is the mutagenesis primer 893-m5.
- SEQ ID NO: 24 is the mutagenesis primer 893-m7.
- SEQ ID NO: 25 is the mutagenesis primer 893-m8.
- SEQ ID NO: 26 is the mutagenesis primer 893-m9.
- SEQ ID NO: 27 is the mutagenesis primer 893-mlO.
- SEQ ID NO: 28 is the mutagenesis primer 893-ml 1.
- SEQ ID NO: 29 is the mutagenesis primer 893-m6.
- SEQ ID NO: 30 is the assembly vector 15705.
- SEQ ID NO: 31 is the consensus sequence for Os 1053629
- SEQ ID NO: 32 is the consensus sequence for Osl035893_at from rice
- SEQ ID NO: 33 is the engineered terminator derived from Osl035893_at (also referred to as tOsl035893).
- SEQ ID NO: 34 is the engineered terminator derived from Osl053629_at (also referred to as tOs!053629).
- the terms “a”, “an”, and “the” refer to “one or more” when used in this application, including the claims.
- a cell refers to one or more cells, including, for example, tissues and organs unless the context in which the term appears clearly excludes such an interpretation.
- the phrase “at least one”, when employed herein to refer to an entity refers to, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more of that entity, including but not limited to whole number values between 1 and 100 and greater than 100 as would be understood by one of ordinary skill in the art with respect to the context in which the phrase appears.
- the phrase “A, B, C, and/or D” includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D.
- nucleic acid molecule of the presently disclosed subject matter can "consist essentially of a promoter, a reporter gene coding sequence, and a transcriptional terminator. It is noted, however, that additional nucleotides that are not specifically recited in the corresponding SEQ ID NOs. can also be present, provided that the additional nucleotides do not materially alter the activity of any of the promoter, the reporter gene coding sequence, and the transcriptional terminator.
- the presently disclosed subject matter relates to nucleic acid molecules that comprise plant promoters. It would be understood by one of ordinary skill in the art after review of the instant disclosure that the presently disclosed subject matter thus encompasses nucleic acid molecules that consist essentially of the plant promoters of the presently disclosed subject matter, as well as nucleic acid molecules that consist of the plant promoters of the presently disclosed subject matter.
- the phrases "associated with”, “operably linked”, and “operatively linked” refer to two or more nucleotide sequences that are related physically or functionally.
- a promoter or other regulatory DNA sequence is said to be “associated with” a DNA sequence that encodes an RNA or a polypeptide if the two sequences are operably linked, and/or are situated such that the regulator DNA sequence will affect the expression level of the coding or structural DNA sequence.
- a coding sequence can be
- a transcription terminator can be operably linked to a promoter and to a coding sequence when transcription from the promoter through the coding sequence is terminated by the presence of the terminator.
- operably linked refers to a nucleotide sequences that are present in a single nucleic acid molecule (for example, an expression cassette or an expression vector).
- the phrase “operably linked” is synonymous with “physically linked”
- Antisense inhibition refers to the production of antisense RNA transcripts
- a target gene including an endogenous gene, a transgene, or a gene from another organism, e.g., an insect.
- Cis-element refers to a cis-acting transcriptional regulatory element that confers an aspect of the overall control of gene expression.
- a cis-element may function to bind transcription factors, trans-acting protein factors that regulate transcription. Some cis- elements bind more than one transcription factor, and transcription factors may interact with different affinities with more than one cis-element.
- Cis-elements can be identified by a number of techniques, including deletion analysis, i.e., deleting one or more nucleotides from the 5' end or internal to a promoter; DNA binding protein analysis using DNase I footprinting, methylation interference, electrophoresis mobility-shift assays, in vivo genomic footprinting by ligation-mediated PCR, and other conventional assays; or by DNA sequence similarity analysis with known cis-element motifs by conventional DNA sequence comparison methods. The fine structure of a cis-element can be further studied by mutagenesis (or substitution) of one or more nucleotides or by other conventional methods. Cis-elements can be obtained by chemical synthesis or by isolation from promoters that include such elements, and they can be synthesized with additional flanking nucleotides that contain useful restriction enzyme sites to facilitate subsequence manipulation.
- Chromeric is used to indicate that a DNA sequence, such as a vector or a gene, is comprised of two or more DNA sequences of distinct origin that are fused together by recombinant DNA techniques resulting in a DNA sequence, which does not occur naturally.
- Chrosomally-integrated refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. Where genes are not “chromosomally integrated” they may be “transiently expressed.” Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
- coding sequence and “open reading frame” (ORF) are used interchangeably and refer to a nucleotide sequence that is transcribed into
- RNA such as but not limited to mRNA, rRNA, tRNA, snRNA, sense RNA, or antisense RNA.
- the RNA is then translated in vivo or in vitro to produce a polypeptide.
- an ORF is a coding sequence of a reporter gene (e.g. , cellobiohydrolase I (CBHI); ⁇ -glucuronidase (GUS)).
- CBHI cellobiohydrolase I
- GUS ⁇ -glucuronidase
- initiation codon and “termination codon” refer to a unit of three adjacent nucleotides ⁇ i.e., a "codon" in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
- intron refers to an intervening section of DNA which occurs almost exclusively within eukaryotic genes, but which is not translated to amino acid sequences in the gene product as a consequence of being removed from a primary RNA transcript (sometimes referred to as a "heterogenous nuclear RNA", or "hnRNA”) through the process of splicing.
- intron includes modifications to the nucleotide sequence of an intron derived from a target gene, provided the modified intron does not significantly reduce the activity of its associated 5' regulatory sequence.
- Example refers to a section of DNA which carries the coding sequence for a
- Exons are separated by intervening, non- coding sequences (introns).
- the definition of the term "exon” includes modifications to the nucleotide sequence of an exon derived from a target gene, provided the modified exon does not significantly reduce the activity of its associated 5' regulatory sequence.
- Constitutive promoter refers to a promoter that is able to express the gene that it controls in all or nearly all of the plant tissues during all or nearly all developmental- stages of the plant, thereby generating “constitutive expression” of the gene.
- Couple suppression and “sense suppression” refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially identical transgene or endogenous genes.
- Contiguous is used herein to mean nucleic acid sequences that are immediately preceding or following one another.
- “Expression” refers to the transcription and stable accumulation of mRNA.
- Expression may also refer to the production of protein.
- “Expression cassette” as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
- the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction.
- the expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
- fragment refers to a sequence that comprises a subset of another sequence.
- fragment and “subsequence” are used interchangeably.
- a fragment of a nucleotide sequence can be any number of nucleotides that is less than that found in another nucleotide sequence, and thus includes, but is not limited to, the sequences of an exon or intron, a promoter, an enhancer, an origin of replication, a 5' or 3' untranslated region, a coding region, and a polypeptide binding domain.
- a fragment or subsequence can also comprise less than the entirety of a nucleotide sequence, for example, a portion of an exon or intron, promoter, enhancer, etc.
- a fragment or subsequence of an amino acid sequence can be any number of residues that is less than that found in a naturally occurring polypeptide, and thus includes, but is not limited to, domains, features, repeats, etc.
- a fragment or subsequence of an amino acid sequence need not comprise the entirety of the amino acid sequence of the domain, feature, repeat, etc.
- a fragment can also be a "functional fragment", in which the fragment retains a specific biological function of the nucleotide sequence or amino acid sequence of interest.
- a functional fragment of a transcription factor can include, but is not limited to, a D A binding domain, a transactivating domain, or both.
- a functional fragment of a receptor tyrosine kinase can include, but is not limited to, a ligand binding domain, a kinase domain, an ATP binding domain, and combinations thereof.
- Expression patterns of a set of promoters are said to be complementary when the expression pattern of one promoter shows little overlap with the expression pattern of the other promoter.
- Gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences.
- Native gene refers to a gene as found in nature.
- chimeric gene refers to any gene that contains 1)
- a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
- a "transgene” refers to a gene that has been introduced into the genome by transformation and is stably maintained. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed.
- transgenes may comprise native genes inserted into a non-native organism, or chimeric genes.
- endogenous gene refers to a native gene in its natural location in the genome of an organism.
- a “foreign” gene refers to a gene not normally found in the host organism but one that is introduced into the organism by gene transfer.
- a “gene” is a defined region that is located within a genome and that, besides the aforementioned coding nucleic acid sequence, comprises other, primarily regulatory, nucleic acid sequences responsible for the control of the expression, that is to say the transcription and translation, of the coding portion.
- a gene may also comprise other 5' and 3 ' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
- Gene silencing refers to homology-dependent suppression of viral genes
- Gene silencing may be transcriptional, when the suppression is due to decreased transcription of the affected genes, or post-transcriptional, when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes. (English, et al., 1996, Plant Cell 8: 179-1881). Gene silencing includes virus-induced gene silencing (Ruiz et al., 1998, Plant Cell 10:937-946).
- Genetically stable and “heritable” refer to chromosomally-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations.
- Heterologous DNA Sequence is a DNA sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring DNA sequence.
- Inducible promoter refers to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as and by way of example only a chemical, light, hormone, stress, or a pathogen.
- Insecticidal is defined as a toxic biological activity capable of controlling
- insects preferably by killing them.
- 5' non-coding sequence refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. (Turner et at., 1995, Molecular Biotechnology, 3 :225).
- 3 ' non-coding sequence refers to nucleotide sequences located 3 ' (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 ' end of the mRNA precursor.
- the use of different 3' non- coding sequences is exemplified by Ingelbrecht et al. (1989, Plant Cell, 1 :671-680).
- nucleic acid refers to a polynucleotide of high molecular weight which can be single-stranded or double-stranded, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrrolidine.
- a "nucleic acid fragment” is a fraction of a given nucleic acid molecule.
- deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins.
- a “genome” is the entire body of genetic material contained in each cell of an organism. The term
- nucleotide sequence refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
- isolated nucleic acid fragment refers to a polymer of ribonucleotides (RNA) or deoxyribonucleotides (DNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
- An isolated nucleic acid fragment in the form of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
- the phrase "percent identical" in the context of two nucleic acid sequences, refers to two or more sequences or subsequences that have in some embodiments at least 60% (e.g., 60, 63, 65, 67, or 69%), in some embodiments at least
- 70% e.g., 70, 73, 75, 77, or 79%), in some embodiments at least 80% (e.g., 80, 83, 85, 86, 87, 88, or 89%), in some embodiments at least 90% (e.g., 90, 91 , 92, 93, 94, 95, 96, 97, or 98%), and in some embodiments at least 99% nucleotide identity, respectively, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
- the percent identity exists in some embodiments over a region of the sequences that is at least about 50 nucleotides in length, in some embodiments over a region of at least about 100 nucleotides in length, in some embodiments over a region of at least about 250 nucleotides in length, in some embodiments over a region of at least about 500 nucleotides in length, in some embodiments over a region of at least about 1000 nucleotides in length, and in some embodiments, the percent identity exists over at least about 1500 residues. In some embodiments, the percent identity exists over the entire length of one or both of the sequences (e.g., any of SEQ ID NOs: 1 -2).
- open reading frame and “ORF” refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
- initiation codon and “termination codon” refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
- operably-linked and “Operatively-linked” refer to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
- a promoter is operably-linked with a coding sequence or functional RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences in sense or antisense orientation can be operably-linked to regulatory sequences.
- Plant tissue includes differentiated and undifferentiated tissues or plants
- the plant tissue may be in plants or in organ, tissue or cell culture.
- Preferred expression is the expression of gene products that are preferably
- Primary transformant and “TO generation” refer to transgenic plants that are of the same genetic generation as the tissue that was initially transformed (i.e., not having gone through meiosis and fertilization since transformation).
- Secondary transformants and the “Tl, T2, T3, etc. generations” refer to transgenic plants derived from primary transformants through one or more meiotic and fertilization cycles. They may be derived by self-fertilization of primary or secondary transformants or crosses of primary or secondary transformants with other transformed or untransformed plants.
- Promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for R A polymerase and other factors required for proper transcription.
- Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA-box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
- Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence.
- Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments.
- a promoter may also contain DNA segments that are involved in the binding of protein factors that control the effectiveness of transcription initiation in response to
- Promoter regulatory sequences or
- promoter regulatory sequences can comprise proximal and more distal upstream elements and/or downstream elements. Promoter regulatory sequences influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence. Promoter regulatory sequences include enhancers, untranslated leader sequences, introns, exons, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that can be a combination of synthetic and natural sequences.
- an “enhancer” is a nucleotide sequence that can stimulate promoter activity and can be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter.
- the primary sequence can be present on either strand of a double-stranded DNA molecule, and is capable of functioning even when placed either upstream or downstream from the promoter.
- promoter includes “promoter regulatory sequences.”
- Exemplary promoters of the presently disclosed subject matter include nucleotide sequences that are in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%>, in some embodiments at least 91%, in some embodiments at least 92%, in some
- the percent identity is calculated over 100 nucleotides, 200 nucleotides, 300 nucleotides, 500 nucleotides, 750 nucleotides, 1000 nucleotides, 1500 nucleotides, or the full length of any of SEQ ID NOs: 1-2.
- Reference sequence as used herein is defined as a sequence that is used as a basis for sequence comparison.
- a reference sequence may be a subset or the entirety of a specified sequence; for example, as a fragment of a full-length cDNA or gene sequence, or the full-length cDNA or gene sequence.
- Regulated promoter refers to promoters that direct gene expression not
- tissue-specific and inducible promoters constitutively, but in a temporally- and/or spatially-regulated manner, and include both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences.
- Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions.
- Inducible promoters are regulated by external stimuli.
- RNA transcript refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence.
- the primary transcript When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived by posttranscriptional processing of the primary transcript and is referred to as the mature RNA.
- Messenger RNA (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell.
- cDNA refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA.
- a "functional RNA” refers to an antisense RNA, ribozyme, or other RNA that is not translated, but participates in a reaction or process as a RNA.
- a "selectable marker gene” refers to a gene whose expression in a plant cell gives the cell a selective advantage.
- the selective advantage possessed by the cells transformed with the selectable marker gene may be due to their ability to grow in presence of a negative selective agent, such as an antibiotic or a herbicide, compared to the ability to grow of non-transformed cells.
- the selective advantage possessed by the transformed cells may also be due to their enhanced capacity, relative to non-transformed cells, to utilize an added compound as a nutrient, growth factor or energy source.
- a selective advantage possessed by a transformed cell may also be due to the loss of a previously possessed gene in what is called "negative selection".
- a compound is added that is toxic only to cells that did not lose a specific gene (a negative selectable marker gene) present in the parent cell (typically a transgene).
- a specific gene typically a transgene.
- Specific expression is the expression of gene products that is limited to one or a few plant tissues (spatial limitation) and/or to one or a few plant developmental stages (temporal limitation).
- Substantially identical in the context of two nucleic acid or protein sequences, refers to two or more sequences or subsequences that have at least 60%, preferably 80%, more preferably 90, even more preferably 95%, and most preferably at least 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
- the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues.
- the sequences are substantially identical over the entire length of the coding regions.
- substantially identical nucleic acid or protein sequences perform substantially the same function.
- sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- a gap penalty is typically introduced and is subtracted from the number of matches.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, 1981, Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443, by the search for similarity method of Pearson & Lipman, 1988, Proc. Nat'l. Acad. Sci. 85 : 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group,
- BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al, 1990, J. Mol. Biol. 215 : 403-410.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- the BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- W word length
- E expectation
- BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. 89: 10915).
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl Acad. Sci. USA 90: 5873-5787 (1993)).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about
- comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program.
- equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
- hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular) of
- Bind(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
- high stringency hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
- T m thermal melting point
- a probe will hybridize to its target subsequence, but to no other sequences.
- the T m is the temperature (under defined ionic strength and pH) at which 0% of the target sequence hybridizes to a perfectly matched probe.
- Very high stringency conditions are selected to be equal to the T m for a particular probe.
- An example of high stringency hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42°C, with the hybridization being carried out overnight.
- An example of very high stringency wash conditions is 0.1 5M NaCl at 72°C for about 15 minutes.
- An example of high stringency wash conditions is a 0.2x SSC wash at 65°C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal.
- An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is lx SSC at 45°C for 15 minutes.
- An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC at 40°C for 15 minutes.
- high stringency conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C.
- High stringency conditions can also be achieved with the addition of destabilizing agents such as formamide.
- a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
- Nucleic acids that do not hybridize to each other under high stringency conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
- Exemplary moderate stringency conditions include hybridization in 40 to 45%
- Exemplary high stringency conditions include hybridization in 0% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. 1 X SSC at 60 to 65°C.
- a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 4 , 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 4 , 1 mM EDTA at 50°C with washing in IX SSC, 0.1 % SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP0 4 , 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C,
- M is the molarity of monovalent cations
- %GC is the percentage of guanosine and cytosine nucleotides in the DNA
- % form is the percentage of formamide in the hybridization solution
- L is the length of the hybrid in base pairs.
- the TM is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
- T is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10°C. Generally, high stringency conditions are selected to be about 19°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- very high stringency conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (T m ); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (T m ); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or
- nucleic acid sequences or proteins are substantially identical is that the protein encoded by the first nucleic acid is immunologically cross reactive with, or specifically binds to, the protein encoded by the second nucleic acid.
- a protein is typically substantially identical to a second protein, for example, where the two proteins differ only by conservative substitutions.
- tissue- specific promoter refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as leaves, roots or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells). These also include promoters that are temporally regulated, such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.
- Transactivating gene refers to a gene encoding a transactivating protein. It can encode a transcription factor. It can be a natural gene, for example, a plant transcriptional activator, or a chimeric gene, for example, when plant regulatory sequences are operably- linked to the open reading frame of a transcription factor from another organism.
- Transactivating genes may be chromosomally integrated or transiently expressed. “Trans-activation” refers to switching on of gene by the expression of another
- a "transcriptional cassette” will comprise in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a DNA sequence of interest, and a transcriptional and translational termination region functional in plants.
- the termination region may be native with the transcriptional initiation region, may be native with the DNA sequence of interest, or may be derived from another source.
- the "transcription initiation site” is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered.
- Downstream sequences i.e. further protein encoding sequences in the 3 ' direction
- upstream sequences are denominated negative
- transcription initiation site is the first nucleotide of a transcribed DNA sequence where RNA polymerase (DNA-
- RNA transcript begins synthesizing the RNA transcript.
- transcription initiation site is also referred to as the “transcription start site” or TSS.
- transformation refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance.
- Transiently transformed refers to cells in which transgenes and foreign DNA have been introduced (for example, by such methods as Agrobacterium-mediatQd transformation or biolistic bombardment), but not selected for stable maintenance.
- Stably transformed refers to cells that have been selected and regenerated on a selection media following
- Transformed / transgenic / recombinant refer to a host organism such as a
- nucleic acid molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be present as an extrachromosomal molecule. Such an extrachromosomal molecule can be auto-replicating.
- Transformed cells, tissues, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof.
- a "non-transformed", “non-transgenic", or “non- recombinant" host refers to a wild-type organism, e.g., a bacterium or plant, which does not contain the heterologous nucleic acid molecule.
- translational enhancer sequence refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') of the translation start codon.
- the translational enhancer sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
- Vector is defined to include, inter alia, any plasmid, cosmid, phage or
- Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist
- shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
- Visible marker refers to a gene whose expression does not confer an advantage to a transformed cell but can be made detectable or visible. Examples of visible markers include but are not limited to ⁇ -glucuronidase (GUS), luciferase (LUC) and green fluorescent protein (GFP).
- GUS ⁇ -glucuronidase
- LOC luciferase
- GFP green fluorescent protein
- Wild-type refers to the normal gene, virus, or organism found in nature without any known mutation.
- the promoter nucleotide sequences and methods disclosed herein are useful in regulating expression of any heterologous nucleic acid sequences in a host plant in order to alter the phenotype of a plant.
- modifying the fatty acid composition in a plant altering the amino acid composition of a plant, altering a plant' s pathogen defense system, altering plant response to the environment and the like.
- results can be achieved by providing for a reduction of expression of one or more endogenous products, particularly enzymes or cofactors in the plant. These changes result in a change in phenotype of the transformed plant.
- transgenes also known as heterologous genes, for example, include, but are not limited to, genes encoding important agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain or seed characteristics, abiotic stress tolerance and commercial products. Genes of interest include, generally, those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting seed size, plant development, plant growth regulation, and yield improvement. Plant development and growth regulation also refer to the development and growth regulation of various parts of a plant, such as the flower, seed, root, leaf, and shoot.
- genes and proteins conferring cold, heat, salt, and drought resistance are genes and proteins conferring cold, heat, salt, and drought resistance.
- Disease and/or insect resistance genes may encode resistance to pests that have great yield drag such as for example, anthracnose, soybean mosaic virus, soybean cyst nematode, root-knot nematode, brown leaf spot, Downy mildew, purple seed stain, seed decay, and seedling diseases commonly caused by the fungi Pythium sp., Phytophthora sp., Rhizoctonia sp., Diaporthe sp. Bacterial blight caused by the bacterium
- Pseudomonas syringae pv. Glycinea Genes conferring insect resistance include, for example, Bacillus thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881 ; and Geiser et al (1986) Gene 48: 109); lectins (Van
- Herbicide resistance traits may include genes coding for resistance to herbicides that act to inhibit the action of acetolactate synthase (ALS), in particular the sulfonylurea- type herbicides (e.g., the acetolactate synthase ALS gene containing mutations leading to such resistance, in particular the S4 and/or HRA mutations).
- ALS acetolactate synthase
- the ALS -gene mutants encode resistance to the herbicide chlorosulfuron.
- Glyphosate acetyl transferase is an N-acetyltransferase from Bacillus licheniformis that was optimized by gene shuffling for acetylation of the broad spectrum herbicide, glyphosate, forming the basis of a novel mechanism of glyphosate tolerance in transgenic plants (Castle et al. (2004) Science 304,
- herbicide resistance traits include, but are not limited to, EPSPS (U.S. Pat. No. 6,248,076), Bar (U.S. Pat. No. 6,025,545), and HPPD (U.S. Pat. No. 7,312,379).
- the present invention includes the transformation of a recipient cell with at least one advantageous transgene.
- Two or more transgenes can be supplied in a single transformation event using either distinct transgene-encoding vectors, or a single vector incorporating two or more gene coding sequences. Any two or more transgenes of any description, such as those conferring herbicide tolerance, insect resistance, disease (viral, bacterial, fungal, and nematode) resistance or drought resistance, oil quantity and quality, or those increasing yield or nutritional quality may be employed as desired.
- isolated promoter sequence of the present invention can be modified to
- Embraced by the present invention are also functional equivalents of the promoters of the present invention, i.e. nucleotide sequences that hybridize under stringent conditions to any one of SEQ ID NO:l or SEQ ID NO: 2.
- a stringent hybridization can be performed at a temperature of 65°C, preferably 60°C and most preferably 55°C in double strength (2X) citrate buffered saline (SSC) containing 0.1 % SDS followed by rinsing of the support at the same temperature but with a buffer having a reduced SSC concentration.
- SSC double strength citrate buffered saline
- Such reduced concentration buffers are typically one tenth strength SSC (0.1 X SSC) containing 0.1 % SDS, preferably 0.2X SSC containing 0.1 % SSC and most preferably half strength SSC (0.5X SSC) containing 0.1 % SDS.
- rice expression profiling data were analyzed for probes which demonstrated strong expression in root tissue and little or no expression in leaf tissue.
- expression refers to the normalized signal measured on an AffymetrixTM GeneChip.
- the query summarized in Table 1, focused on expression in leaf and root tissue.
- the probes are ranked based on the ratio of the root to leaf signals.
- Analysis of the data identified Osl035893_at (SEQ ID NO: 32) and Osl053629_at (SEQ ID NO: 31) as target candidate probes for expression cassette development. Both showed very strong signals in root tissue and weak signals in leaf tissue (signals below 100 are considered background).
- the signal ratio between roots and leaf for SEQ ID NO: 32 and SEQ ID NO: 33 was 55-fold and 42-fold, respectively.
- SEQ ID NO: 32 An electronic northern (see, for example, Toufighi, et al.) was generated to further explore the expression pattern of SEQ ID NO: 32 and SEQ ID NO: 33.
- Table 2 reports the relative expression of identified root-preferred and root specific probes. Data are sorted by Booting Stage root score. The data in Table 2 show that both SEQ ID NO: 32 and SEQ ID NO: 33 have strong or high signals in all root samples and low or weak signals in leaf and reproductive tissue samples. SEQ ID NO: 32 also shows a strong signal in two stem samples. Taken together, the expression profiling data identify the genes represented by SEQ ID NO: 32 and SEQ ID NO: 33 as ideal candidates for root- preferred expression cassette development.
- Expression cassette development began with the identification of cDNA and gDNA represented by Osl035893_at (SEQ ID NO: 32) and Osl053629_at (SEQ ID NO: 33). The complete transcript for each gene was assembled, then the corresponding gDNA sequence was identified. gDNA was sought that included the transcript plus 2-3 kb of 5'- and 3'-flanking sequence. This was accomplished by querying GenBank. The
- Osl053629_at transcript is represented by sequence AP005707 (GenBank). The
- Osl053629_at gene does not contain introns.
- Osl035893_at The gDNA sequence represented by Osl035893_at was identified in GenBank (AC135561). Only the sequence in close proximity to the Osl035893_at gene was reported. The Osl035893_at gene has one intron.
- Osl035893_at genes were identified. This was done by identifying the largest open reading frame in each transcript. Their location helps define boundaries for the 5'- and 3'- regulatory sequence.
- the Osl053629_at expression cassette was designed to capture the regulatory sequence residing outside the protein coding sequence.
- the 1682 base pair (bp) promoter (SEQ ID NO: 2) includes a 97 bp 5'-UTR that terminates at an Ncol restriction endonuclease site. The Ncol site also encodes the translation start codon for trait protein expression.
- the promoter is designed to terminate in a maize-optimized Kozak sequence.
- the terminator tOsl053629 (SEQ ID NO: 34) initiates with sequence immediately downstream of the translation stop codon and extends for 897 bp. It includes, in addition to an engineered Sacl site, 361 bp of 3'-UTR.
- the Osl053629 promoter and terminus were amplified from rice gDNA template in a 50 EXTENSOR DNA polymerase reaction kit, supplied by ABgene®, containing 100 ng gDNA, 5 ⁇ 10X Extensor Buffer, 2.0 10 mM dNTP mix, 10.0 ⁇ , Q solution, 5 Units Extensor polymerase and 1.0 each of 20 ⁇ primers 629-P1 (SEQ ID NO: 3; 5'-ctcgagggaacccttcaatatgtgagga-3') and 629-P2 (SEQ ID NO: 4; 5'- ataccatggtggatcctgatgattattacttagcttgg-3') for the 1.68 kb promoter or 629-P3 (SEQ ID NO: 5; 5'-gagctcgatcaatcgatcacgtcgt-3') and 629-P4 (SEQ ID NO: 6; 5'-
- thermocycling program was 95°C for 2 minutes followed by 10 cycles of 95°C for 30 seconds, 50°C for 1 minute and 68°C for 4 minutes, then 30 cycles of 95°C for 30 seconds and 68°C for 5 mmutes.
- the final extension step was 68°C for 15 minutes.
- the reaction products were gel-purified on 1 % TAE agarose and the DNA was extracted using QIAPREP® DNA extraction method according to the manufacturer's instructions.
- the DNA products were concentrated by ethanol precipitation, recovered in 10 ⁇ d 2 I3 ⁇ 4C) and cloned into a pCR- TOPO vector, provided by Invitrogen®. Both products were completely sequenced.
- PCPv System 9700 thermal cyclers provided by Applied Biosystems®, were used to carry out the DNA sequencing reactions according to the manufacturer's instructions.
- 3730x1 DNA Analyzer also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
- QUIKCHANGETM Multi Site Directed Mutagenesis kit supplied by Stratagene®.
- the basic protocol included 1 ⁇ DNA template, 2.5 ⁇ 10X reaction buffer, ⁇ , dNTP mix, 0.75 ⁇ Quik solution, 1 ⁇ QuikChange enzyme and ⁇ each of 20 ⁇
- thermocycling program was 95°C for 5 minutes followed by 35 cycles of 95°C for 1 minute, 50°C for 1 minute and 65°C for 13 minutes.
- the reaction products were completely sequenced.
- GENEAMPTM PCPv System 9700 thermal cyclers provided by Applied Biosystems®, were used to carry out the DNA sequencing reactions according to the manufacturer's instructions.
- 3730x1 DNA Analyzer also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
- the Osl035893_at expression cassette was designed to capture all the regulatory sequence residing upstream and downstream of the protein coding sequence. In order to capture the intron, the protein coding sequence in the first exon was silenced by altering the methionine codons.
- the 2214 bp promoter (SEQ ID NO: 1) includes a 237 bp 5'-UTR that terminates at an Ncol restriction endonuclease site. The Ncol site also encodes the translation start codon for trait protein expression.
- the promoter is designed to terminate in a maize-optimized Kozak sequence.
- the tOsl035893 terminator (SEQ ID NO: 33) initiates with sequence immediately downstream of the translation stop codon and extends for 1041 bp. It includes, in addition to an engineered Sad site, 330 bp of 3'-UTR.
- thermocycling program was 95°C for 2 minutes followed by 10 cycles of 95°C for 30 seconds, 50°C for 1 minute and 68°C for 4 minutes, then 30 cycles of 95°C for 30 seconds and 68°C for 5 minutes.
- the final extension step was 68°C for 15 minutes.
- the reaction products were gel-purified on 1 % TAE agarose and the DNA was extracted using QIAPREP DNA extraction method.
- the DNA products were concentrated by ethanol precipitation, recovered in 10 ⁇ d 2 ]3 ⁇ 40 and cloned into a pCR-TOPO vector, provided by
- Analyzer also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
- the basic protocol included 1 ⁇ DNA template, 2.5 ⁇ , 10X reaction buffer, ⁇ dNTP mix, 0.75 ⁇ , Quik solution, 1 ⁇ QuikChange enzyme and 1 ⁇ , each of 20 ⁇ phosphorylated
- thermocycling program was
- the Osl035893 at expression cassette (SEQ ID NO: 14) , with the ⁇ -glucuronidase (GUS) coding sequence was excised from 15705 (SEQ ID NO: 30) as a SanDVRsrll fragment and ligated to the RsrII site of the agrobacterium binary vector 15289 (SEQ ID NO: 12).
- This created vector 15706 (SEQ ID NO: 14).
- plasmid vectors comprising the instant recombinant expression constructs can be constructed.
- the choice of plasmid vector is dependent upon the method that will be used to transform host cells. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene.
- Agrobacterium tumefaciens, and obtaining transgenic plants have been published, among others, for cotton (U.S. Pat. No. 5,004,863, U.S. Pat. No. 5,159,135); soybean (U.S. Pat. No. 5,569,834, U.S. Pat. No. 5,416,011); Brassica (U.S. Pat. No. 5,463, 174); and peanut (Cheng et al, Plant Cell Rep. 15:653-657 (1996), McKently et al, Plant Cell Rep. 14:699-703 (1995)).
- cotton U.S. Pat. No. 5,004,863, U.S. Pat. No. 5,159,135)
- soybean U.S. Pat. No. 5,569,834, U.S. Pat. No. 5,416,011
- Brassica U.S. Pat. No. 5,463, 174
- peanut Choeng et al, Plant Cell Rep. 15:653-657 (1996), McKently et al
- the particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated.
- the regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, Eds.; In Methods for Plant Molecular Biology; Academic Press, Inc.: San Diego, Calif, 1988).
- This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development or through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated.
- the resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
- the regenerated plants are self -pollinated to provide homozygous transgenic plants.
- a transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
- Transformation and selection can be accomplished using methods well-known to those skilled in the art including, but not limited to, the methods described herein.
- expression cassettes function in maize. Both expression cassettes show a root-preferred expression pattern.
- Tl/Fl seedlings for several events comprising the Osl053629 expression cassette, as comprised in SEQ ID NO: 13 were germinated in axenic culture. Seedlings were assayed for GUS enzyme activity, GUS protein and localization of GUS activity. Data are summarized in Table 6. It's clear from the Tl data that this expression cassette is not root-preferred. Rather, the data indicate that the SEQ ID NO: 2 promoter causes strong GUS expression in leaf tissue. On average the amount of GUS protein/GUS enzyme activity is 4-6 times higher in leaf samples compared with root samples. [00144] Table 6. Characterization of GUS expression in select prOsl053629 (15673)
- Tissues were frozen at -20°C for 2 hours, thawed, then infiltrated with the histochemical reagent. Tissues were incubated at 37°C overnight then cleared with ethanol. The scoring is identical to that of Table 5.
- Tl/Fl seedlings for several events comprising the expression cassette SEQ ID NO: 14 (Os 1035893) were germinated in axenic culture. Seedlings were assayed for GUS enzyme activity, GUS protein and localization of GUS activity. Data are summarized in Table 8, below. It is clear from the Tl data, below, that this expression cassette shows stronger expression in root tissue. On average the amount of GUS protein/GUS enzyme activity is 8-10 times higher in root samples compared with leaf samples. The histochemical staining (data not shown) support this conclusion.
- the present invention relates to a nucleic acid sequence, preferably an isolated nucleic acid sequence, capable of driving expression in a plant cell, wherein the isolated nucleic acid sequence comprises a 5 '-untranslated region, a first exon, a first intron, and a portion of a second exon of a gene represented by a sequence selected from the group consisting of SEQ ID NOs: 31 , 32, and 35-64.
- the invention also relates to a nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated nucleic acid sequence, preferably an isolated
- nucleic acid sequence selected from the group consisting of prOsl035893 SEQ ID NO: 1 and prOsl0 3629 SEQ ID NO: 2, wherein the nucleic acid sequence, preferably an isolated nucleic acid sequence, is capable of driving expression in a plant cell.
- the plant cell is a plant root cell.
- the plant root cell is a monocot root cell.
- the monocot root cell is a maize root cell.
- the present invention also relates to an expression cassette comprising a nucleic acid sequence, preferably an isolated nucleic acid sequence, selected from the group consisting of prOsl035893 SEQ ID NO: 1 and prOsl053629 SEQ ID NO: 2, wherein the nucleic acid sequence is capable of driving expression in a plant cell, and wherein the nucleic acid sequence is operably linked to a nucleotide sequence of interest.
- the present invention further relates to an expression vector comprising the expression cassette above.
- the present invention also provides for a method of expressing a heterologous gene comprising: (a) constructing an expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the expression cassette is functional in a plant, plant cell, or plant tissue; and (b) creating a plant, plant cell, or plant tissue or portion thereof comprising the expression cassette, wherein the heterologous gene is expressed.
- the present invention also provides for the method above, wherein the plant, plant cell, or plant tissue or portion thereof is a monocot.
- the plant, plant cell, or plant tissue or portion thereof is maize.
- the present invention also provides for a plant, plant cell, or plant tissue or
- the present invention also provides for the progeny of the above plant, plant cell, or plant tissue or portion thereof.
- the present invention provides for seed derived from the above progeny, wherein the seed comprise an isolated nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
- the present invention also provides for a plant, plant cell, or plant tissue or
- the plant, plant cell, or plant tissue is a monocot. In still yet another embodiment, the plant, plant cell, or plant tissue is maize.
- the present invention also provides for a method of expressing a gene of interest in plant roots by: (a) planting seed comprising an isolated nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; (b) growing seed into a plant; and (c) harvesting seed of the plant; wherein roots of the plant of step (b) express a gene of interest operably linked to the isolated nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
- the present invention also provides for grain produced from seed comprising a expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2. [00159] The present invention also provides for grain produced from seed comprising a expression cassette comprising the promoters SEQ ID NO: 1 and SEQ ID NO: 2
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Highly active root-preferred expression cassettes are desirable tools for improving drought tolerance in maize, rice, and other monocots. Two rice genes with strong root-preferred expression profiles were identified by querying data from rice expression profiling experiments. The gene structure and regulatory sequence for each were used to design and build two novel root-preferred expression cassettes.
Description
ROOT PREFERRED PROMOTERS DERIVED FROM RICE
AND METHODS OF USE
FIELD OF THE INVENTION
The presently disclosed subject matter is closely related to the fields of molecular biology and biotechnology. The presently disclosed subject matter is additionally closely related to the field of plant biotechnology.
BACKGROUND
An objective of crop trait functional genomics is to identify crop trait genes of interest, for example, genes capable of conferring useful agronomic traits in crop plants. Such agronomic traits include, but are not limited to, enhanced yield, whether in quantity or quality; enhanced nutrient acquisition and metabolic efficiency; enhanced or altered nutrient composition of plant tissues used for food, feed, fiber, or processing; enhanced utility for agricultural or industrial processing; enhanced resistance to plant diseases; enhanced tolerance of adverse environmental conditions including, but not limited to, drought, excessive cold, excessive heat, or excessive soil salinity or extreme acidity or alkalinity; and alterations in plant architecture or development, including changes in developmental timing. The deployment of such identified trait genes by either transgenic or non-transgenic approaches can materially improve crop plants for the benefit of agriculture.
The identification of genes that are important for crop development is thus an ongoing effort in the agricultural community. Additional information can also be derived by analyzing the genomes of important plants. For example, the identification of transcriptional regulatory elements that can direct the expression of linked nucleotide sequences can also lead to the ability to manipulate the plant genome to express polypeptides of interest in desirable spatial and/or temporal manners.
Among the transcriptional regulatory elements that can be employed, promoters play important roles, as transcription initiation is often a rate-limiting step in the expression of polypeptides of interest, particularly relative to subsequent stages such as the translation of mKNAs. As such, the characteristics of the promoter can be an important consideration in the selection of how to best accomplish protein production through transgensis.
Promoters are capable of regulating transcription initiation in several ways. For example, certain promoters can be induced by the presence of particular compounds and/or external stimuli, such that they direct expression of operably linked nucleotide sequences only in specific tissues and/or cell types and/or during specific stages of development. Other promoters are capable of constitutively expressing linked sequences. Thus, the transcription of a coding sequence of interest can be regulated by operably linking the coding sequence to whichever promoter can provide the desired regulatory characteristics. As such, different promoters can be employed in different ways to enhance the agronomic, pharmaceutical, and/or nutritional value of crops.
What are needed, then, are new methods and compositions for expressing
heterologous nucleotide sequences in plant cells. To meet these needs, the presently disclosed subject matter provides in some embodiments promoter sequences for directing expression of heterologous nucleotide sequences in plant cells. The presently disclosed subject matter addresses these problems associated with the expression of nucleotide sequences in transgenic plants, as well as other problems.
SUMMARY
[0001] It is the object of the present invention to provide a isolated nucleic acid sequence capable of driving expression in a plant cell, wherein the isolated nucleic acid sequence comprises a 5 ' -untranslated region, a first exon, a first intron, and a portion of a second exon of a gene represented by a sequence selected from the group consisting of SEQ ID NOs: 31, 32, and 35-64.
[0002] It is also the object of the present invention to provide a nucleic acid sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, wherein the sequences are capable of driving expression in a plant cell. The plant cell can be a monocot or dicot plant cell.
[0003] It is also an object of the present invention to provide a nucleic acid sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, wherein the sequences are capable of driving expression in a plant root cell. The plant root cell may be a monocot root cell, and may further be a maize root cell.
[0004] It is a further object of the present invention to provide an isolated nucleic acid sequence, comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the sequences are capable of driving expression of a single, two genes, or at least two genes in a plant cell.
[0005] In another aspect, the present invention also relates to an expression cassette comprising SEQ ID NO: 1 or SEQ ID NO: 2 operably linked to a nucleotide sequence of interest. In yet another aspect, the expression cassette is comprised within an expression vector.
[0006] In another aspect, the present invention relates to a method of expressing a
heterologous gene, comprising constructing an expression cassette comprising SEQ ID NO: 1 or SEQ ID NO: 2, wherein the expression cassette is functional in a plant or plant cell, and creating a plant or plant cell comprising the expression cassette, wherein the heterologous gene is expressed. In yet another aspect, the plant or plant cell is a monocot, and may further be maize. In still another aspect, the invention relates to a plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene. In further yet another aspect, the invention relates to progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene. In still yet another aspect, the invention relates to seed derived from the progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene.
[0007] In another aspect, the present invention relates to a method of expressing a
heterologous genes, comprising constructing an expression cassette comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the expression cassette is functional in a plant or plant cell, and creating a plant or plant cell comprising the expression cassette, wherein the heterologous genes are expressed. In yet another aspect, the plant or plant cell is a monocot, and may further be maize. In still another aspect, the invention relates to a plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene or genes. In further yet another aspect, the invention relates to progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene or genes. In still yet another aspect, the invention relates to seed derived from the progeny of the plant, plant cell, or plant tissue or portion thereof made by the method of expressing a heterologous gene or genes.
[0008] In another aspect, the present invention relates to a plant, plant cell, or plant tissue or portion thereof comprising an expression cassette comprising the promoter set forth in either SEQ ID NO: 1 or SEQ ID NO: 2. In yet another aspect, the plant, plant cell, or plant tissue or portion thereof is a monocot and further may be maize.
[0009] In yet another aspect, the present invention relates to a method of expressing a gene of interest in plant roots, comprising planting seed comprising SEQ ID NO: 1 or
SEQ ID NO: 2, growing the seed into a plant, and harvesting seed of the plant; wherein the plant expresses in the roots a the gene of interest operably linked to SEQ ID NO: 1 or SEQ ID NO: 2.
[0010] In another aspect, the present invention relates to a plant, plant cell, or plant tissue or portion thereof comprising an expression cassette comprising the promoters set forth in
SEQ ID NO: 1 and SEQ ID NO: 2. In yet another aspect, the plant, plant cell, or plant tissue or portion thereof is a monocot and further may be maize.
[0011] In yet another aspect, the present invention relates to a method of expressing a gene or genes of interest in plant roots, comprising planting seed comprising SEQ ID NO: 1 and SEQ ID NO: 2, growing the seed into a plant, and harvesting seed of the plant; wherein the plant expresses in the roots a the gene of interest operably linked to SEQ ID NO: 1 and a gene of interest operably linked to SEQ ID NO: 2.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
[0012] SEQ ID NO: 1 is the engineered promoter derived from Osl035893_at (also
referred to as prOs 1035893).
[0013] SEQ ID NO: 2 is the engineered promoter derived from Osl053629_at (also
referred to as prOsl053629).
[0014] SEQ ID NO: 3 is the primer 629-P1.
[0015] SEQ ID NO: 4 is the primer 629-P2.
[0016] SEQ ID NO: 5 is the primer 629-P3.
[0017] SEQ ID NO: 6 is the primer 629-P4.
[0018] SEQ ID NO: 7 is the mutagenesis primer 629-ml .
[0019] SEQ ID NO: 8 is the mutagenesis primer 629-m2.
[0020] SEQ ID NO: 9 is the mutagenesis primer 629-ml .1.
[0021] SEQ ID NO: 10 is pNOV6901.
[0022] SEQ ID NO: 11 is the assembly vector 15672.
[0023] SEQ ID NO: 12 is vector 15289.
[0024] SEQ ID NO: 13 is the binary vector 15673; (comprises Osl053629-expression cassette).
[0025] SEQ ID NO: 14 is the binary vector 15706; (comprises Os 1035893 -expression cassette).
[0026] SEQ ID NO: 15 is the primer 893-P1.
[0027] SEQ ID NO: 16 is the primer 893-P2.
[0028] SEQ ID NO: 17 is the primer 893-P3.
[0029] SEQ ID NO: 18 is the primer 893-P4.
[0030] SEQ ID NO: 19 is the mutagenesis primer 893-ml .
[0031] SEQ ID NO: 20 is the mutagenesis primer 893-m2.
[0032] SEQ ID NO: 21 is the mutagenesis primer 893-m3.
[0033] SEQ ID NO: 22 is the mutagenesis primer 893-m4.
[0034] SEQ ID NO: 23 is the mutagenesis primer 893-m5.
[0035] SEQ ID NO: 24 is the mutagenesis primer 893-m7.
[0036] SEQ ID NO: 25 is the mutagenesis primer 893-m8.
[0037] SEQ ID NO: 26 is the mutagenesis primer 893-m9.
[0038] SEQ ID NO: 27 is the mutagenesis primer 893-mlO.
[0039] SEQ ID NO: 28 is the mutagenesis primer 893-ml 1.
[0040] SEQ ID NO: 29 is the mutagenesis primer 893-m6.
[0041] SEQ ID NO: 30 is the assembly vector 15705.
[0042] SEQ ID NO: 31 is the consensus sequence for Os 1053629
Affymetrix Chip probes.
[0043] SEQ ID NO: 32 is the consensus sequence for Osl035893_at from rice
Affymetrix Chip probes.
[0044] SEQ ID NO: 33 is the engineered terminator derived from Osl035893_at (also referred to as tOsl035893).
[0045] SEQ ID NO: 34 is the engineered terminator derived from Osl053629_at (also referred to as tOs!053629).
DEFINITIONS
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently disclosed subject matter pertains. For clarity of the present specification, certain definitions are presented herein below.
Following long-standing patent law convention, the terms "a", "an", and "the" refer to "one or more" when used in this application, including the claims. For example, the phrase "a cell" refers to one or more cells, including, for example, tissues and organs unless the context in which the term appears clearly excludes such an interpretation. Similarly, the phrase "at
least one", when employed herein to refer to an entity, refers to, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more of that entity, including but not limited to whole number values between 1 and 100 and greater than 100 as would be understood by one of ordinary skill in the art with respect to the context in which the phrase appears.
Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". The term "about", as used herein when referring to a measurable value such as an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%>, and in some embodiments ±0.1 % from the specified amount, as such variations are appropriate to perform the disclosed methods. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently disclosed subject matter.
As used herein, the term "and/or" when used in the context of a list of entities, refers to the entities being present singly or in combination. Thus, for example, the phrase "A, B, C, and/or D" includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D.
The term "comprising", which is synonymous with "including" "containing", or "characterized by", is inclusive or open-ended and does not exclude additional, unrecited elements and/or method steps. "Comprising" is a term of art that means that the named elements and/or steps are present, but that other elements and/or steps can be added and still fall within the scope of the relevant subject matter.
As used herein, the phrase "consisting of excludes any element, step, or ingredient not specifically recited. It is noted that, when the phrase "consists of appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.
As used herein, the phrase "consisting essentially of limits the scope of the related disclosure or claim to the specified materials and/or steps, plus those that do not materially affect the basic and novel characteristic(s) of the disclosed and/or claimed subject matter. For example, a nucleic acid molecule of the presently disclosed subject matter can "consist essentially of a promoter, a reporter gene coding sequence, and a transcriptional terminator.
It is noted, however, that additional nucleotides that are not specifically recited in the corresponding SEQ ID NOs. can also be present, provided that the additional nucleotides do not materially alter the activity of any of the promoter, the reporter gene coding sequence, and the transcriptional terminator.
With respect to the terms "comprising", "consisting of, and "consisting essentially of, where one of these three terms is used herein, the presently disclosed and claimed subject matter can include the use of either of the other two terms. For example, in some
embodiments, the presently disclosed subject matter relates to nucleic acid molecules that comprise plant promoters. It would be understood by one of ordinary skill in the art after review of the instant disclosure that the presently disclosed subject matter thus encompasses nucleic acid molecules that consist essentially of the plant promoters of the presently disclosed subject matter, as well as nucleic acid molecules that consist of the plant promoters of the presently disclosed subject matter.
As used herein, the phrases "associated with", "operably linked", and "operatively linked" refer to two or more nucleotide sequences that are related physically or functionally. For example, a promoter or other regulatory DNA sequence is said to be "associated with" a DNA sequence that encodes an RNA or a polypeptide if the two sequences are operably linked, and/or are situated such that the regulator DNA sequence will affect the expression level of the coding or structural DNA sequence. Similarly, a coding sequence can be
"associated with" or "operably linked" to a promoter which drives the expression of the coding sequence in particular cells or cell types. Also similarly, a transcription terminator can be operably linked to a promoter and to a coding sequence when transcription from the promoter through the coding sequence is terminated by the presence of the terminator. In some embodiments, however, the phrase "operably linked" refers to a nucleotide sequences that are present in a single nucleic acid molecule (for example, an expression cassette or an expression vector). In such embodiments, the phrase "operably linked" is synonymous with "physically linked"
[0046] "Antisense inhibition" refers to the production of antisense RNA transcripts
capable of suppressing the expression of protein from a target gene, including an endogenous gene, a transgene, or a gene from another organism, e.g., an insect.
[0047] "Cis-element" refers to a cis-acting transcriptional regulatory element that confers an aspect of the overall control of gene expression. A cis-element may function to bind transcription factors, trans-acting protein factors that regulate transcription. Some cis-
elements bind more than one transcription factor, and transcription factors may interact with different affinities with more than one cis-element. Cis-elements can be identified by a number of techniques, including deletion analysis, i.e., deleting one or more nucleotides from the 5' end or internal to a promoter; DNA binding protein analysis using DNase I footprinting, methylation interference, electrophoresis mobility-shift assays, in vivo genomic footprinting by ligation-mediated PCR, and other conventional assays; or by DNA sequence similarity analysis with known cis-element motifs by conventional DNA sequence comparison methods. The fine structure of a cis-element can be further studied by mutagenesis (or substitution) of one or more nucleotides or by other conventional methods. Cis-elements can be obtained by chemical synthesis or by isolation from promoters that include such elements, and they can be synthesized with additional flanking nucleotides that contain useful restriction enzyme sites to facilitate subsequence manipulation.
[0048] "Chimeric" is used to indicate that a DNA sequence, such as a vector or a gene, is comprised of two or more DNA sequences of distinct origin that are fused together by recombinant DNA techniques resulting in a DNA sequence, which does not occur naturally.
[0049] "Chromosomally-integrated" refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. Where genes are not "chromosomally integrated" they may be "transiently expressed." Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
[0050] As used herein, the phrases "coding sequence" and "open reading frame" (ORF) are used interchangeably and refer to a nucleotide sequence that is transcribed into
RNA, such as but not limited to mRNA, rRNA, tRNA, snRNA, sense RNA, or antisense RNA. In some embodiments, the RNA is then translated in vivo or in vitro to produce a polypeptide. In some embodiments, an ORF is a coding sequence of a reporter gene (e.g. , cellobiohydrolase I (CBHI); β-glucuronidase (GUS)). Thus, in some embodiments an "ORF" refers to a nucleotide sequence between translation initiation and termination codons of a coding sequence. The terms "initiation codon" and "termination codon" refer to a unit of three adjacent nucleotides {i.e., a "codon") in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
[0051] As used herein, the term "intron" refers to an intervening section of DNA which occurs almost exclusively within eukaryotic genes, but which is not translated to amino acid sequences in the gene product as a consequence of being removed from a primary RNA transcript (sometimes referred to as a "heterogenous nuclear RNA", or "hnRNA") through the process of splicing. Splicing removes introns, thereby connecting exons into a final messenger RNA (mRNA) form than can be translated into a polypeptide. For purposes of the presently disclosed subject matter, the definition of the term "intron" includes modifications to the nucleotide sequence of an intron derived from a target gene, provided the modified intron does not significantly reduce the activity of its associated 5' regulatory sequence.
[0052] "Exon" refers to a section of DNA which carries the coding sequence for a
protein or part of it. Exons are separated by intervening, non- coding sequences (introns). For purposes of the present invention, the definition of the term "exon" includes modifications to the nucleotide sequence of an exon derived from a target gene, provided the modified exon does not significantly reduce the activity of its associated 5' regulatory sequence.
[0053] "Constitutive promoter" refers to a promoter that is able to express the gene that it controls in all or nearly all of the plant tissues during all or nearly all developmental- stages of the plant, thereby generating "constitutive expression" of the gene.
[0054] "Co-suppression" and "sense suppression" refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially identical transgene or endogenous genes.
[0055] "Contiguous" is used herein to mean nucleic acid sequences that are immediately preceding or following one another.
[0056] "Expression" refers to the transcription and stable accumulation of mRNA.
Expression may also refer to the production of protein.
[0057] "Expression cassette" as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction. The expression cassette
comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
[0058] As used herein, the term "fragment" refers to a sequence that comprises a subset of another sequence. When used in the context of a nucleic acid or amino acid sequence, the terms "fragment" and "subsequence" are used interchangeably. A fragment of a nucleotide sequence can be any number of nucleotides that is less than that found in another nucleotide sequence, and thus includes, but is not limited to, the sequences of an exon or intron, a promoter, an enhancer, an origin of replication, a 5' or 3' untranslated region, a coding region, and a polypeptide binding domain. It is understood that a fragment or subsequence can also comprise less than the entirety of a nucleotide sequence, for example, a portion of an exon or intron, promoter, enhancer, etc. Similarly, a fragment or subsequence of an amino acid sequence can be any number of residues that is less than that found in a naturally occurring polypeptide, and thus includes, but is not limited to, domains, features, repeats, etc. Also similarly, it is understood that a fragment or subsequence of an amino acid sequence need not comprise the entirety of the amino acid sequence of the domain, feature, repeat, etc. A fragment can also be a "functional fragment", in which the fragment retains a specific biological function of the nucleotide sequence or amino acid sequence of interest. For example, a functional fragment of a transcription factor can include, but is not limited to, a D A binding domain, a transactivating domain, or both. Similarly, a functional fragment of a receptor tyrosine kinase can include, but is not limited to, a ligand binding domain, a kinase domain, an ATP binding domain, and combinations thereof.
[0059] The "expression pattern" of a promoter (with or without an enhancer) is the
pattern of expression level that shows where in the plant and in what developmental stage the promoter initiates transcription. Expression patterns of a set of promoters are said to be complementary when the expression pattern of one promoter shows little overlap with the expression pattern of the other promoter.
[0060] "Gene" refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences. The term "Native gene" refers to a gene as found in nature. The term "chimeric gene" refers to any gene that contains 1)
DNA sequences, including regulatory and coding sequences, that are not found together in nature, or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or
comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. A "transgene" refers to a gene that has been introduced into the genome by transformation and is stably maintained. Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes. The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" gene refers to a gene not normally found in the host organism but one that is introduced into the organism by gene transfer. Furthermore, a "gene" is a defined region that is located within a genome and that, besides the aforementioned coding nucleic acid sequence, comprises other, primarily regulatory, nucleic acid sequences responsible for the control of the expression, that is to say the transcription and translation, of the coding portion. A gene may also comprise other 5' and 3 ' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
[0061] Gene silencing" refers to homology-dependent suppression of viral genes,
transgenes, or endogenous nuclear genes. Gene silencing may be transcriptional, when the suppression is due to decreased transcription of the affected genes, or post-transcriptional, when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes. (English, et al., 1996, Plant Cell 8: 179-1881). Gene silencing includes virus-induced gene silencing (Ruiz et al., 1998, Plant Cell 10:937-946).
[0062] "Genetically stable" and "heritable" refer to chromosomally-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations.
[0063] "Heterologous DNA Sequence" is a DNA sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring DNA sequence.
[0064] "Inducible promoter" refers to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as and by way of example only a chemical, light, hormone, stress, or a pathogen.
[0065] "Insecticidal" is defined as a toxic biological activity capable of controlling
insects, preferably by killing them.
[0066] "5' non-coding sequence" refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation
codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. (Turner et at., 1995, Molecular Biotechnology, 3 :225).
[0067] "3 ' non-coding sequence" refers to nucleotide sequences located 3 ' (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 ' end of the mRNA precursor. The use of different 3' non- coding sequences is exemplified by Ingelbrecht et al. (1989, Plant Cell, 1 :671-680).
[0068] The term "nucleic acid" refers to a polynucleotide of high molecular weight which can be single-stranded or double-stranded, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrrolidine. A "nucleic acid fragment" is a fraction of a given nucleic acid molecule. In higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. A "genome" is the entire body of genetic material contained in each cell of an organism. The term
"nucleotide sequence" refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. An "isolated nucleic acid fragment" refers to a polymer of ribonucleotides (RNA) or deoxyribonucleotides (DNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
[0069] As used herein, the phrase "percent identical"," in the context of two nucleic acid sequences, refers to two or more sequences or subsequences that have in some embodiments at least 60% (e.g., 60, 63, 65, 67, or 69%), in some embodiments at least
70% (e.g., 70, 73, 75, 77, or 79%), in some embodiments at least 80% (e.g., 80, 83, 85, 86, 87, 88, or 89%), in some embodiments at least 90% (e.g., 90, 91 , 92, 93, 94, 95, 96, 97, or 98%), and in some embodiments at least 99% nucleotide identity, respectively, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. The percent identity exists in some embodiments over a region of the sequences that is at least about 50 nucleotides in length, in some embodiments over a region of at least about 100 nucleotides in length, in some embodiments over a region of at least about 250 nucleotides in length, in some embodiments over a region of at least about 500
nucleotides in length, in some embodiments over a region of at least about 1000 nucleotides in length, and in some embodiments, the percent identity exists over at least about 1500 residues. In some embodiments, the percent identity exists over the entire length of one or both of the sequences (e.g., any of SEQ ID NOs: 1 -2).
[0070] The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence. The terms "initiation codon" and "termination codon" refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
[0071] "Operably-linked" and "Operatively-linked" refer to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably-linked with a coding sequence or functional RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences in sense or antisense orientation can be operably-linked to regulatory sequences.
[0072] "Over expression" refers to the level of expression in transgenic organisms that exceeds levels of expression in normal or untransformed organisms.
[0073] "Plant tissue" includes differentiated and undifferentiated tissues or plants,
including but not limited to roots, stems, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells and culture such as single cells, protoplast, embryos, and callus tissue. The plant tissue may be in plants or in organ, tissue or cell culture.
[0074] "Preferred expression" is the expression of gene products that are preferably
expressed at a higher level in one or a few plant tissues (spatial limitation) and/or to one or a few plant developmental stages (temporal limitation) while in other
tissues/developmental stages there is a relatively low level of expression.
[0075] "Primary transformant" and "TO generation" refer to transgenic plants that are of the same genetic generation as the tissue that was initially transformed (i.e., not having gone through meiosis and fertilization since transformation). "Secondary transformants" and the "Tl, T2, T3, etc. generations" refer to transgenic plants derived from primary transformants through one or more meiotic and fertilization cycles. They may be derived by self-fertilization of primary or secondary transformants or crosses of primary or secondary transformants with other transformed or untransformed plants.
[0076] The terms "protein," "peptide" and "polypeptide" are used interchangeably herein.
7] "Promoter" refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for R A polymerase and other factors required for proper transcription. "Promoter" includes a minimal promoter that is a short DNA sequence comprised of a TATA-box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA segments that are involved in the binding of protein factors that control the effectiveness of transcription initiation in response to
physiological or environmental conditions. "Promoter regulatory sequences" or
"regulatory sequences" can comprise proximal and more distal upstream elements and/or downstream elements. Promoter regulatory sequences influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence. Promoter regulatory sequences include enhancers, untranslated leader sequences, introns, exons, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that can be a combination of synthetic and natural sequences. An "enhancer" is a nucleotide sequence that can stimulate promoter activity and can be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. The primary sequence can be present on either strand of a double-stranded DNA molecule, and is capable of functioning even when placed either upstream or downstream from the promoter. The meaning of the term "promoter" includes "promoter regulatory sequences." Exemplary promoters of the presently disclosed subject matter include nucleotide sequences that are in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%>, in some embodiments at least 91%, in some embodiments at least 92%, in some
embodiments at least 93%, in some embodiments at least 94%, in some embodiments at least 95%, in some embodiments at least 96%>, in some embodiments at least 97%, in some embodiments at least 98%, in some embodiments at least 99% identical, or that are 100%) identical to any of SEQ ID NOs: 1-2. In some embodiments, the percent identity is
calculated over 100 nucleotides, 200 nucleotides, 300 nucleotides, 500 nucleotides, 750 nucleotides, 1000 nucleotides, 1500 nucleotides, or the full length of any of SEQ ID NOs: 1-2.
[0078] "Reference sequence" as used herein is defined as a sequence that is used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a fragment of a full-length cDNA or gene sequence, or the full-length cDNA or gene sequence.
[0079] "Regulated promoter" refers to promoters that direct gene expression not
constitutively, but in a temporally- and/or spatially-regulated manner, and include both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences.
Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Inducible promoters are regulated by external stimuli.
[0080] The term "RNA transcript" refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived by posttranscriptional processing of the primary transcript and is referred to as the mature RNA. "Messenger RNA" (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell. "cDNA" refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA. A "functional RNA" refers to an antisense RNA, ribozyme, or other RNA that is not translated, but participates in a reaction or process as a RNA.
[0081] A "selectable marker gene" refers to a gene whose expression in a plant cell gives the cell a selective advantage. The selective advantage possessed by the cells transformed with the selectable marker gene may be due to their ability to grow in presence of a negative selective agent, such as an antibiotic or a herbicide, compared to the ability to grow of non-transformed cells. The selective advantage possessed by the transformed cells may also be due to their enhanced capacity, relative to non-transformed cells, to utilize an added compound as a nutrient, growth factor or energy source. A selective advantage possessed by a transformed cell may also be due to the loss of a previously possessed gene in what is called "negative selection". In the negative selection example, a compound is added that is toxic only to cells that did not lose a specific gene (a negative selectable marker gene) present in the parent cell (typically a transgene).
[0082] "Specific expression" is the expression of gene products that is limited to one or a few plant tissues (spatial limitation) and/or to one or a few plant developmental stages (temporal limitation).
[0083] Substantially identical: the phrase "substantially identical," in the context of two nucleic acid or protein sequences, refers to two or more sequences or subsequences that have at least 60%, preferably 80%, more preferably 90, even more preferably 95%, and most preferably at least 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In an especially preferred embodiment, the sequences are substantially identical over the entire length of the coding regions. Furthermore, substantially identical nucleic acid or protein sequences perform substantially the same function.
[0084] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.
[0085] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, 1981, Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443, by the search for similarity method of Pearson & Lipman, 1988, Proc. Nat'l. Acad. Sci. 85 : 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group,
575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al, infra).
[0086] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul
et al, 1990, J. Mol. Biol. 215 : 403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11 , an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. 89: 10915).
[0087] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about
0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
[0088] For purposes of the present invention, comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default
parameters or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
[0089] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent hybridization conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular) of
DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
[0090] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory
Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid
Probes part I chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York. Generally, high stringency hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. Typically, under high stringency conditions a probe will hybridize to its target subsequence, but to no other sequences.
[0091] The Tm is the temperature (under defined ionic strength and pH) at which 0% of the target sequence hybridizes to a perfectly matched probe. Very high stringency conditions are selected to be equal to the Tm for a particular probe. An example of high stringency hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42°C, with the hybridization being carried out overnight. An example of very high stringency wash conditions is 0.1 5M NaCl at 72°C for about 15 minutes. An example of high stringency wash conditions is a 0.2x SSC
wash at 65°C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is lx SSC at 45°C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC at 40°C for 15 minutes.
For short probes (e.g., about 10 to 50 nucleotides), high stringency conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C. High stringency conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under high stringency conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
[0092] Low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium. citrate) at 50 to 55°C.
Exemplary moderate stringency conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 0% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. 1 X SSC at 60 to 65°C.
[0093] The following are examples of sets of hybridization/wash conditions that may be used to clone homologous nucleotide sequences that are substantially identical to reference nucleotide sequences of the present invention: a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in IX SSC, 0.1 % SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 0.1X SSC, 0.1% SDS at 50°C, more preferably in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 0.1X SSC, 0.1% SDS at 65°C.
4] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA- DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl
Anal. Biochem. 138:267-284 (1984); TM 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The TM is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, high stringency conditions are selected to be about 19°C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, very high stringency conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or
20°C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired T, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T of less than 45 °C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Acid Probes, Part 1, Chapter 2 (Elsevier, New York); and Ausubel et al, eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley - Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, New York).
[0095] A further indication that two nucleic acid sequences or proteins are substantially identical is that the protein encoded by the first nucleic acid is immunologically cross reactive with, or specifically binds to, the protein encoded by the second nucleic acid. Thus, a protein is typically substantially identical to a second protein, for example, where the two proteins differ only by conservative substitutions.
[0096] "Tissue- specific promoter" refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as leaves, roots or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells). These also include promoters that are temporally regulated, such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.
[0097] "Transactivating gene" refers to a gene encoding a transactivating protein. It can encode a transcription factor. It can be a natural gene, for example, a plant transcriptional activator, or a chimeric gene, for example, when plant regulatory sequences are operably- linked to the open reading frame of a transcription factor from another organism.
"Transactivating genes" may be chromosomally integrated or transiently expressed. "Trans-activation" refers to switching on of gene by the expression of another
(regulatory) gene in trans.
[0098] A "transcriptional cassette" will comprise in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a DNA sequence of interest, and a transcriptional and translational termination region functional in plants. The termination region may be native with the transcriptional initiation region, may be native with the DNA sequence of interest, or may be derived from another source.
[0099] The "transcription initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered.
Downstream sequences (i.e. further protein encoding sequences in the 3 ' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative. Furthermore, the "transcription initiation site" is the first nucleotide of a transcribed DNA sequence where RNA polymerase (DNA-
Directed RNA Polymerase) begins synthesizing the RNA transcript. The "transcription initiation site" is also referred to as the "transcription start site" or TSS.
[00100] The term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. "Transiently
transformed" refers to cells in which transgenes and foreign DNA have been introduced (for example, by such methods as Agrobacterium-mediatQd transformation or biolistic bombardment), but not selected for stable maintenance. "Stably transformed" refers to cells that have been selected and regenerated on a selection media following
transformation.
[00101] "Transformed / transgenic / recombinant" refer to a host organism such as a
bacterium or a plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be present as an extrachromosomal molecule. Such an extrachromosomal molecule can be auto-replicating. Transformed cells, tissues, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof. A "non-transformed", "non-transgenic", or "non- recombinant" host refers to a wild-type organism, e.g., a bacterium or plant, which does not contain the heterologous nucleic acid molecule.
[00102] The term "translational enhancer sequence" refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') of the translation start codon. The translational enhancer sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
[00103] "Vector" is defined to include, inter alia, any plasmid, cosmid, phage or
Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist
extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication). Specifically included are shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
[00104] "Visible marker" refers to a gene whose expression does not confer an advantage to a transformed cell but can be made detectable or visible. Examples of visible markers include but are not limited to β-glucuronidase (GUS), luciferase (LUC) and green fluorescent protein (GFP).
[00105] "Wild-type" refers to the normal gene, virus, or organism found in nature without any known mutation.
DETAILED DESCRIPTION
[00106] The promoter nucleotide sequences and methods disclosed herein are useful in regulating expression of any heterologous nucleic acid sequences in a host plant in order to alter the phenotype of a plant.
[00107] Various changes in phenotype are of interest including, but not limited to,
modifying the fatty acid composition in a plant, altering the amino acid composition of a plant, altering a plant' s pathogen defense system, altering plant response to the environment and the like. These results can be achieved by providing expression of heterologous products or increased expression of endogenous products in plants.
Alternatively, the results can be achieved by providing for a reduction of expression of one or more endogenous products, particularly enzymes or cofactors in the plant. These changes result in a change in phenotype of the transformed plant.
[00108] Genes of interest are reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest change, and as developing nations open up world markets, new crops and technologies will emerge also. In addition, as our understanding of agronomic characteristics and traits such as yield and heterosis increase, the choice of genes for transformation will change accordingly.
Categories of transgenes, also known as heterologous genes, for example, include, but are not limited to, genes encoding important agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain or seed characteristics, abiotic stress tolerance and commercial products. Genes of interest include, generally, those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting seed size, plant development, plant growth regulation, and yield improvement. Plant development and growth regulation also refer to the development and growth regulation of various parts of a plant, such as the flower, seed, root, leaf, and shoot.
[00109] Other commercially desirable traits are genes and proteins conferring cold, heat, salt, and drought resistance.
[00110] Disease and/or insect resistance genes may encode resistance to pests that have great yield drag such as for example, anthracnose, soybean mosaic virus, soybean cyst nematode, root-knot nematode, brown leaf spot, Downy mildew, purple seed stain, seed
decay, and seedling diseases commonly caused by the fungi Pythium sp., Phytophthora sp., Rhizoctonia sp., Diaporthe sp. Bacterial blight caused by the bacterium
Pseudomonas syringae pv. Glycinea. Genes conferring insect resistance include, for example, Bacillus thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881 ; and Geiser et al (1986) Gene 48: 109); lectins (Van
Damme et al. (1994) Plant Mol. Biol. 24:825); vegetative insecticidal proteins (VIP3C, U.S. Pat. No. 7,378,493); and the like.
[00111] Herbicide resistance traits may include genes coding for resistance to herbicides that act to inhibit the action of acetolactate synthase (ALS), in particular the sulfonylurea- type herbicides (e.g., the acetolactate synthase ALS gene containing mutations leading to such resistance, in particular the S4 and/or HRA mutations). The ALS -gene mutants encode resistance to the herbicide chlorosulfuron. Glyphosate acetyl transferase (GAT) is an N-acetyltransferase from Bacillus licheniformis that was optimized by gene shuffling for acetylation of the broad spectrum herbicide, glyphosate, forming the basis of a novel mechanism of glyphosate tolerance in transgenic plants (Castle et al. (2004) Science 304,
1151-1154). Other herbicide resistance traits include, but are not limited to, EPSPS (U.S. Pat. No. 6,248,076), Bar (U.S. Pat. No. 6,025,545), and HPPD (U.S. Pat. No. 7,312,379).
[00112] The present invention includes the transformation of a recipient cell with at least one advantageous transgene. Two or more transgenes can be supplied in a single transformation event using either distinct transgene-encoding vectors, or a single vector incorporating two or more gene coding sequences. Any two or more transgenes of any description, such as those conferring herbicide tolerance, insect resistance, disease (viral, bacterial, fungal, and nematode) resistance or drought resistance, oil quantity and quality, or those increasing yield or nutritional quality may be employed as desired.
[00113] The isolated promoter sequence of the present invention can be modified to
provide a range of root-preferred expression levels of the heterologous nucleotide sequence. Thus, less than the entire promoter regions may be utilized and the ability to drive expression of the coding sequence retained. However, it is recognized that expression levels of the mRNA may be decreased with deletions of portions of the promoter sequences. Therefore, fragments of SEQ ID NO: 1 or 2 which are 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1 or 2, respectively, may still function as exemplified by this description.
[00114] Embraced by the present invention are also functional equivalents of the promoters of the present invention, i.e. nucleotide sequences that hybridize under stringent conditions to any one of SEQ ID NO:l or SEQ ID NO: 2. A stringent hybridization can be performed at a temperature of 65°C, preferably 60°C and most preferably 55°C in double strength (2X) citrate buffered saline (SSC) containing 0.1 % SDS followed by rinsing of the support at the same temperature but with a buffer having a reduced SSC concentration. Such reduced concentration buffers are typically one tenth strength SSC (0.1 X SSC) containing 0.1 % SDS, preferably 0.2X SSC containing 0.1 % SSC and most preferably half strength SSC (0.5X SSC) containing 0.1 % SDS.
Example 1. Identification of root-preferred genes in rice
[00115] In order to identify rice candidate genes appropriate for expression cassette
development, rice expression profiling data were analyzed for probes which demonstrated strong expression in root tissue and little or no expression in leaf tissue. Here expression refers to the normalized signal measured on an Affymetrix™ GeneChip. The query, summarized in Table 1, focused on expression in leaf and root tissue. The probes are ranked based on the ratio of the root to leaf signals. Analysis of the data identified Osl035893_at (SEQ ID NO: 32) and Osl053629_at (SEQ ID NO: 31) as target candidate probes for expression cassette development. Both showed very strong signals in root tissue and weak signals in leaf tissue (signals below 100 are considered background). The signal ratio between roots and leaf for SEQ ID NO: 32 and SEQ ID NO: 33 was 55-fold and 42-fold, respectively.
Table 1.
[00116] An electronic northern (see, for example, Toufighi, et al.) was generated to further explore the expression pattern of SEQ ID NO: 32 and SEQ ID NO: 33. Table 2 reports the relative expression of identified root-preferred and root specific probes. Data are sorted by Booting Stage root score. The data in Table 2 show that both SEQ ID NO: 32 and SEQ ID NO: 33 have strong or high signals in all root samples and low or weak
signals in leaf and reproductive tissue samples. SEQ ID NO: 32 also shows a strong signal in two stem samples. Taken together, the expression profiling data identify the genes represented by SEQ ID NO: 32 and SEQ ID NO: 33 as ideal candidates for root- preferred expression cassette development.
[00117] Table 2.
[00118] Table 2, continued.
[00119] Table 2, continued.
[00120] Table 2, continued.
Example 2. Identification and annotation of the Osl035893_at and Osl053629_at
[00121] Expression cassette development began with the identification of cDNA and gDNA represented by Osl035893_at (SEQ ID NO: 32) and Osl053629_at (SEQ ID NO: 33). The complete transcript for each gene was assembled, then the corresponding gDNA
sequence was identified. gDNA was sought that included the transcript plus 2-3 kb of 5'- and 3'-flanking sequence. This was accomplished by querying GenBank. The
Osl053629_at transcript is represented by sequence AP005707 (GenBank). The
Osl053629_at gene does not contain introns.
[00122] The gDNA sequence represented by Osl035893_at was identified in GenBank (AC135561). Only the sequence in close proximity to the Osl035893_at gene was reported. The Osl035893_at gene has one intron.
[00123] Next, the translation start and stop codons for both the Osl053629_at and
Osl035893_at genes were identified. This was done by identifying the largest open reading frame in each transcript. Their location helps define boundaries for the 5'- and 3'- regulatory sequence.
Example 3. Design and construction of the Osl053629_at-based expression cassettes
[00124] The Osl053629_at expression cassette was designed to capture the regulatory sequence residing outside the protein coding sequence. The 1682 base pair (bp) promoter (SEQ ID NO: 2) includes a 97 bp 5'-UTR that terminates at an Ncol restriction endonuclease site. The Ncol site also encodes the translation start codon for trait protein expression. The promoter is designed to terminate in a maize-optimized Kozak sequence. The terminator tOsl053629 (SEQ ID NO: 34) initiates with sequence immediately downstream of the translation stop codon and extends for 897 bp. It includes, in addition to an engineered Sacl site, 361 bp of 3'-UTR.
[00125] The Osl053629 promoter and terminus were amplified from rice gDNA template in a 50 EXTENSOR DNA polymerase reaction kit, supplied by ABgene®, containing 100 ng gDNA, 5 μΕ 10X Extensor Buffer, 2.0 10 mM dNTP mix, 10.0 μΐ, Q solution, 5 Units Extensor polymerase and 1.0 each of 20 μΜ primers 629-P1 (SEQ ID NO: 3; 5'-ctcgagggaacccttcaatatgtgaggaa-3') and 629-P2 (SEQ ID NO: 4; 5'- ataccatggtggatcctgatgattattacttagcttgg-3') for the 1.68 kb promoter or 629-P3 (SEQ ID NO: 5; 5'-gagctcgatcaatcgatcacgtcgt-3') and 629-P4 (SEQ ID NO: 6; 5'- atatcccgggcggtccggaatttagcggttgacctaggt-3') for the 0.9 kb terminator. The thermocycling program was 95°C for 2 minutes followed by 10 cycles of 95°C for 30 seconds, 50°C for 1 minute and 68°C for 4 minutes, then 30 cycles of 95°C for 30 seconds and 68°C for 5 mmutes. The final extension step was 68°C for 15 minutes. The reaction products were gel-purified on 1 % TAE agarose and the DNA was extracted using QIAPREP® DNA extraction method according to the manufacturer's instructions. The DNA products were
concentrated by ethanol precipitation, recovered in 10 μί d2I¾C) and cloned into a pCR- TOPO vector, provided by Invitrogen®. Both products were completely sequenced. GENEAMP™ PCPv System 9700 thermal cyclers, provided by Applied Biosystems®, were used to carry out the DNA sequencing reactions according to the manufacturer's instructions. 3730x1 DNA Analyzer, also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
[00126] Each cloned sequence required some modification. This was done using
QUIKCHANGE™ Multi Site Directed Mutagenesis kit supplied by Stratagene®. The basic protocol included 1 μΕ DNA template, 2.5 μΕ 10X reaction buffer, ΙμΙ, dNTP mix, 0.75 μΕ Quik solution, 1 μΕ QuikChange enzyme and ΙμΕ each of 20 μΜ
phosphorylated oligonucleotide (noted in Table 3) in a 25 μΐ^ reaction. The thermocycling program was 95°C for 5 minutes followed by 35 cycles of 95°C for 1 minute, 50°C for 1 minute and 65°C for 13 minutes. The reaction products were completely sequenced. GENEAMP™ PCPv System 9700 thermal cyclers, provided by Applied Biosystems®, were used to carry out the DNA sequencing reactions according to the manufacturer's instructions. 3730x1 DNA Analyzer, also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
[00127] Table 3.
SEQ ID NO: Primer Name Sequence 3'-5' Component
7 629-ml gcccttctcgagggacccttcaatatgtgag promoter
8 629-m2 agtcggctatacgaacatcacccccctc promoter
9 629-ml.l gaataatttagtaacatttaaaatatcaaattag terminus [00128] The Osl053629 promoter was ligated to pNOV6901 (SEQ ID NO: 10) as an
XhoVNcol fragment, then the Osl053629 terminus was ligated as a SacVXmal fragment to create the Osl053629 assembly vector. This became vector 15672 (SEQ ID NO: 11). The Osl053629 expression cassette, with the β-glucuronidase (GUS) coding sequence was excised from 15672 as a SanOl/Rsrll fragment and ligated to the Rsrll site of the agrobacterium binary vector 15289 (SEQ ID NO: 12), thereby creating vector 15673
(SEQ ID NO: 13).
Example 4. Design and construction of the Osl035893_at-based expression cassettes
[00129] The Osl035893_at expression cassette was designed to capture all the regulatory sequence residing upstream and downstream of the protein coding sequence. In order to capture the intron, the protein coding sequence in the first exon was silenced by altering
the methionine codons. The 2214 bp promoter (SEQ ID NO: 1) includes a 237 bp 5'-UTR that terminates at an Ncol restriction endonuclease site. The Ncol site also encodes the translation start codon for trait protein expression. The promoter is designed to terminate in a maize-optimized Kozak sequence. The tOsl035893 terminator (SEQ ID NO: 33) initiates with sequence immediately downstream of the translation stop codon and extends for 1041 bp. It includes, in addition to an engineered Sad site, 330 bp of 3'-UTR.
[00130] The Osl035893_at promoter and terminus were amplified from rice gDNA
template in a 50 μί Extensor (ABgene) DNA polymerase reaction containing 100 ng gDNA, 5 μΕ 10X Extensor Buffer, 2.0 10 mM dNTP mix, 10.0 μΕ Q solution, 5 Units Extensor polymerase and 1.0 μΕ each of 20 μΜ primers 893-P1 (SEQ ID NO: 15; 5'- ctcgagggacccagcgtgcctcctcctct-3') and 893-P2 (SEQ ID NO: 16; 5'- ataccatggtggatccggtttgtagttgaaaactgcatgc-3') for the 2.2 kb promoter or 893-P3 (SEQ ID NO: 17; 5'-gagctctgaaactccggcgacagatc-3') and 893-P4 (SEQ ID NO: 18; 5'- atatcccgggcggtccgccactccctaccagcactgt-3') for the 1.0 kb terminator. The thermocycling program was 95°C for 2 minutes followed by 10 cycles of 95°C for 30 seconds, 50°C for 1 minute and 68°C for 4 minutes, then 30 cycles of 95°C for 30 seconds and 68°C for 5 minutes. The final extension step was 68°C for 15 minutes. The reaction products were gel-purified on 1 % TAE agarose and the DNA was extracted using QIAPREP DNA extraction method. The DNA products were concentrated by ethanol precipitation, recovered in 10 μί d2]¾0 and cloned into a pCR-TOPO vector, provided by
Invitrogen®. Both products were completely sequenced. GENEAMP™ PCR System 9700 thermal cyclers, provided by Applied Biosystems®, were used to carry out the DNA sequencing reactions according to the manufacturer's instructions. 3730x1 DNA
Analyzer, also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
[00131] Each cloned sequence required some modification. This was done using
Stratagene's QuikChange Multi Site Directed Mutagenesis kit. The basic protocol included 1 μΕ DNA template, 2.5 μΐ, 10X reaction buffer, ΙμΕ dNTP mix, 0.75 μΐ, Quik solution, 1 μΕ QuikChange enzyme and 1 μΐ, each of 20 μΜ phosphorylated
oligonucleotide (noted in Table 4) in a 25 μΕ reaction. The thermocycling program was
95°C for 5 minutes followed by 35 cycles of 95°C for 1 minute, 50°C for 1 minute and 65°C for 13 minutes. The reaction products were completely sequenced. GENEAMP™ PCR System 9700 thermal cyclers, provided by Applied Biosystems®, were used to carry out the DNA sequencing reactions according to the manufacturer's instructions. 3730x1
DNA Analyzer, also provided by Applied Biosystems®, was used to read the sequenced product according to the manufacturer's instructions.
[00132] Table 4.
SEQ ID NO: Primer Name Sequence 3 '-5' Component
19 893-ml gcatagggccatcgggaagtacagtg promoter
20 893-m2 cctaaaattgtgcgcatggttaacttctcg promoter
21 893-m3 cgccggctaggcagccgtccgatggaagt promoter
22 893-m4 tggctgaaacacaagttgttggtgact promoter
23 893-m5 tgatagctgggctgttggaaaggtcttcg promoter
24 893-m7 atggtactgaaatcaatagatgcaagcaac promoter
25 893-m8 gtttacaacctgcgattgaaggggttgta promoter
26 893-m9 gtggcttcacccgatggaataattaaccac promoter
27 893-ml 0 caaaatcagcacgtatgcactaacacaagc promoter
28 893-ml 1 cttaaatttttttgaataagacgaaccgtca promoter
29 893-m6 ctatgtactggagtggctgacactgg terminus [00133] The ( 035893 at promoter was ligated to pNOV6901 (SEQ ID NO: 10) as an XhoVNcol fragment, then the Osl035893_at terminus was ligated as a Sac\IXma\ fragment to create the Osl035893_at assembly vector 15705 (SEQ ID NO: 30). The Osl035893 at expression cassette (SEQ ID NO: 14) , with the β-glucuronidase (GUS) coding sequence was excised from 15705 (SEQ ID NO: 30) as a SanDVRsrll fragment and ligated to the RsrII site of the agrobacterium binary vector 15289 (SEQ ID NO: 12).
This created vector 15706 (SEQ ID NO: 14).
[00134] Other plasmid vectors comprising the instant recombinant expression constructs can be constructed. The choice of plasmid vector is dependent upon the method that will be used to transform host cells. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene.
[00135] Methods for transforming monocots, primarily by use of Agrobacterium
tumefaciens, and obtaining transgenic plants have been published for monocots (U.S. Pat. No. 6,037,522), wheat (Cheng et al, Plant Cell Rep. 15:971 -980 (1997), and in particular maize (U.S. pat. No. 6,051 ,409). Methods for transforming dicots, primarily by use of
Agrobacterium tumefaciens, and obtaining transgenic plants have been published, among others, for cotton (U.S. Pat. No. 5,004,863, U.S. Pat. No. 5,159,135); soybean (U.S. Pat. No. 5,569,834, U.S. Pat. No. 5,416,011); Brassica (U.S. Pat. No. 5,463, 174); and peanut (Cheng et al, Plant Cell Rep. 15:653-657 (1996), McKently et al, Plant Cell Rep.
14:699-703 (1995)). For a review of other commonly used methods of plant
transformation see Newell, C. A., Mol. Biotechnol. 16:53-65 (2000).
[00136] There are a variety of methods for the regeneration of plants from plant tissues.
The particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated. The regeneration, development and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, Eds.; In Methods for Plant Molecular Biology; Academic Press, Inc.: San Diego, Calif, 1988). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development or through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Preferably, the regenerated plants are self -pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
[00137] In addition to the above discussed procedures, practitioners are familiar with the standard resource materials which describe specific conditions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc.), generation of recombinant DNA fragments and recombinant expression constructs and the screening and isolating of clones, (see for example, Sambrook, J. et al, In Molecular Cloning: A Laboratory Manual; 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y., 1989; Maliga et al, In Methods in Plant Molecular
Biology; Cold Spring Harbor Press, 1995; Birren et al, In Genome Analysis: Detecting Genes, 1; Cold Spring Harbor: New York, 1998; Birren et al., In Genome Analysis: Analyzing DNA, 2; Cold Spring Harbor: New York, 1998; Clark, Ed., In Plant Molecular Biology: A Laboratory Manual; Springer: New York, 1997).
[00138] The skilled artisan will also recognize that different independent transformation events will result in different levels of expression of the chimeric genes (Jones et al, EMBO J. 4:241 1-2418 (1985); De Almeida et al, Mol. Gen. Genetics 218:78-86 (1989)). Thus, multiple events must be screened in order to obtain lines displaying the desired expression level. Such screening may be accomplished by Northern analysis of mRNA
expression or qRT-PCR, Western analysis of protein expression, or phenotypic analysis. Also of interest are seeds obtained from transformed plants displaying the desired gene expression profile.
[00139] Transformation and selection can be accomplished using methods well-known to those skilled in the art including, but not limited to, the methods described herein.
Example 5. Analysis of root-preferred promoters in TO maize
[00140] The agrobacterium binary vectors carrying the Osl053629 (15673; SEQ ID NO:
13) and ( 035893 (15706; SEQ ID NO: 14) expression cassettes fused to the plant reporter gene β-glucuronidase (GUS) were transformed into maize. A total of 11 low- medium copy events were produced for construct 15673 and 16 events were produced for construct 15706. Some higher copy number TO plants were analyzed for GUS expression by histochemical assay. Root and leaf tissue were collected from each plant and vacuum- infiltrated with the histochemical reagent, then incubated in darkness overnight at 37°C. The tissue was cleared with ethanol and analyzed for presence of the blue histochemical precipitate. The data are summarized in Table 5.
[00141] Table 5.
SEO ID Event Insert Copv Root Tissue Leaf Tissue
NO: Number Number Staining* Staining *
13 5 >2 medium light
13 8 >2 medium light
14 5 2 strong light
14 6 2 light absent
14 21 1 light absent
*absent=no detectable blue precipitate, light=faint blue precipitate, medium=dark blue precipitate, strong=dark blue precipitate in tissue and staining media
[00142] The histochemical analysis shows that both the Osl053629and Osl035893
expression cassettes function in maize. Both expression cassettes show a root-preferred expression pattern.
Example 6. Analysis of root-preferred promoters in Tl maize
[00143] Tl/Fl seedlings for several events comprising the Osl053629 expression cassette, as comprised in SEQ ID NO: 13 were germinated in axenic culture. Seedlings were assayed for GUS enzyme activity, GUS protein and localization of GUS activity. Data are summarized in Table 6. It's clear from the Tl data that this expression cassette is not
root-preferred. Rather, the data indicate that the SEQ ID NO: 2 promoter causes strong GUS expression in leaf tissue. On average the amount of GUS protein/GUS enzyme activity is 4-6 times higher in leaf samples compared with root samples. [00144] Table 6. Characterization of GUS expression in select prOsl053629 (15673)
Tl/Fl maize events germinated in axenic culture.
[00145] As shown in Table 6, seed from four Osl053629-GUS events were germinated and grown in axenic culture on MS basic media for 4 weeks at temperature 26/18°C (day/night) and 12 hours photoperiod. Leaf and root tissue were sampled for GUS enzyme activity (MUG assay) and ELISA assay. Data are the mean of three replicate assays. Seedings were then subject to histochemical localization of the GUS enzyme.
Tissues were frozen at -20°C for 2 hours, thawed, then infiltrated with the histochemical reagent. Tissues were incubated at 37°C overnight then cleared with ethanol. The scoring is identical to that of Table 5.
[00146] To ensure the results are not due to the culture conditions several 15673 Tl Fl seedlings were germinated in the greenhouse. Seed from four Osl053629-GUS events were germinated and grown under standard greenhouse conditions for two weeks. Leaf and root tissue were sampled for GUS enzyme activity (MUG assay) and ELISA assay. Roots were carefully cleaned of soil by rinsing with tap water. Data are the mean of three replicate assays. Data are summarized in Table 7. These data support the axenic culture data. Histochemical staining (data not shown) confirm the leaf preferred expression pattern.
[00147] Table 7. Characterization of GUS expression in select prOsl053629 (15673) Tl Fl maize events germinated in the greenhouse.
H-48 Fl undetectable 456 undetectable undetectable
H-14 Fl 663 84 undetectable undetectable
H-45 Fl 67308 10414 3175 512
[00148] Tl/Fl seedlings for several events comprising the expression cassette SEQ ID NO: 14 (Os 1035893) were germinated in axenic culture. Seedlings were assayed for GUS enzyme activity, GUS protein and localization of GUS activity. Data are summarized in Table 8, below. It is clear from the Tl data, below, that this expression cassette shows stronger expression in root tissue. On average the amount of GUS protein/GUS enzyme activity is 8-10 times higher in root samples compared with leaf samples. The histochemical staining (data not shown) support this conclusion.
[00149] Table 8. Characterization of GUS expression in select prOsl035893 (15706) Tl/Fl maize events germinated in axenic culture.
K-l Tl light medium 1 120 ± 67.5 6930 ± 442 105 719
K-3 Tl light light 2480 ± 122 3450 ± 322 169 464
K-4 Tl light medium 649 ± 31.4 6590 ± 786 72.2 902
K-5 Tl light strong 1 120 ± 53.8 15200 ± 581 93.9 1 130
K-6 Tl light medium 923 ± 53.6 10200 ± 128 115 1250
L-l Fl light light 252 ± 32.8 2420 ± 29.7 67.3 487
L-2 Fl light medium 0.6 ± 35 1860 ± 79.8 10.8 265
[00150] As shown in Table 8, seed from four Osl035893-GUS events were germinated and grown in axenic culture on MS basic media for 4 weeks at temperature 26/18°C (day/night) and 12 hours photoperiod. Leaf and root tissue were sampled for GUS enzyme activity (MUG assay) and ELISA assay. Data are the mean of three replicate assays. Seedings were then subject to histochemical localization of the GUS enzyme. Tissues were frozen at -20°C for 2 hours, thawed, then infiltrated with the histochemical reagent. Tissues were incubated at 37°C overnight then cleared with ethanol. The scoring is identical to that of Table 5.
[00151] In view of the results provided here, the present invention relates to a nucleic acid sequence, preferably an isolated nucleic acid sequence, capable of driving expression in a plant cell, wherein the isolated nucleic acid sequence comprises a 5 '-untranslated region, a first exon, a first intron, and a portion of a second exon of a gene represented by a sequence selected from the group consisting of SEQ ID NOs: 31 , 32, and 35-64.
[00152] The invention also relates to a nucleic acid sequence, preferably an isolated
nucleic acid sequence, selected from the group consisting of prOsl035893 SEQ ID NO: 1 and prOsl0 3629 SEQ ID NO: 2, wherein the nucleic acid sequence, preferably an isolated nucleic acid sequence, is capable of driving expression in a plant cell. In another embodiment, the plant cell is a plant root cell. In yet another embodiment, the plant root cell is a monocot root cell. In still yet another embodiment, the monocot root cell is a maize root cell.
[00153] The present invention also relates to an expression cassette comprising a nucleic acid sequence, preferably an isolated nucleic acid sequence, selected from the group consisting of prOsl035893 SEQ ID NO: 1 and prOsl053629 SEQ ID NO: 2, wherein the nucleic acid sequence is capable of driving expression in a plant cell, and wherein the nucleic acid sequence is operably linked to a nucleotide sequence of interest. The present invention further relates to an expression vector comprising the expression cassette above.
[00154] The present invention also provides for a method of expressing a heterologous gene comprising: (a) constructing an expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the expression cassette is functional in a plant, plant cell, or plant tissue; and (b) creating a plant, plant cell, or plant tissue or portion thereof comprising the expression cassette, wherein the heterologous gene is expressed. In another embodiment, the present invention also provides for the method above, wherein the plant, plant cell, or plant tissue or portion thereof is a monocot. In yet another embodiment, the plant, plant cell, or plant tissue or portion thereof is maize.
[00155] The present invention also provides for a plant, plant cell, or plant tissue or
portion thereof made by the method of expressing a heterologous gene comprising: (a) constructing an expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the expression cassette is functional in a plant, plant cell, or plant tissue; and (b) creating a plant, plant cell, or plant tissue or portion thereof comprising the expression cassette, wherein the heterologous gene is expressed. In another embodiment, the present invention also provides for the progeny of the above plant, plant cell, or plant tissue or portion thereof. In yet another embodiment, the present invention provides for seed derived from the above progeny, wherein the seed comprise an isolated nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
[00156] The present invention also provides for a plant, plant cell, or plant tissue or
portion thereof comprising an expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2. In another embodiment, the plant, plant cell, or plant tissue is a monocot. In still yet another embodiment, the plant, plant cell, or plant tissue is maize.
[00157] The present invention also provides for a method of expressing a gene of interest in plant roots by: (a) planting seed comprising an isolated nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2; (b) growing seed into a plant; and (c) harvesting seed of the plant; wherein roots of the plant of step (b) express a gene of interest operably linked to the isolated nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
[00158] The present invention also provides for grain produced from seed comprising a expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2.
[00159] The present invention also provides for grain produced from seed comprising a expression cassette comprising the promoters SEQ ID NO: 1 and SEQ ID NO: 2
[00160]
REFERENCES
[00161] Altschul et al., 1990, J. Mol. Biol. 215: 403-410
[00162] Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2
(Greene Publishing and Wiley - Interscience, New York)
[00163] Birren et al., In Genome Analysis: Detecting Genes, 1; Cold Spring Harbor: New
York, 1998
[00164] Birren et al., In Genome Analysis: Analyzing DNA, 2; Cold Spring Harbor: New York, 1998
[00165] Castle et al. (2004) Science 304, 1 151-1 154
[00166] Cheng et al, Plant Cell Rep. 15:653-657 (1996)
[00167] Cheng et al, Plant Cell Rep. 15:971-980 (1997)
[00168] Clark, Ed., In Plant Molecular Biology: A Laboratory Manual; Springer: New York, 1997
[00169] English, et al, 1996, Plant Cell 8: 179-1881
[00170] Geiser et al (1986) Gene 48: 109
[00171] Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. 89: 10915
[00172] Ingelbrecht et al. 1989, Plant Cell, 1 :671-680
[00173] Jones et al, EMBO J. 4:241 1-2418 (1985); De Almeida et al, Mol. Gen. Genetics 218:78-86 (1989)
[00174] Karlin & Altschul, Proc. Natl Acad. Sci. USA 90: 5873-5787 (1993)
[00175] Maliga et al., In Methods in Plant Molecular Biology; Cold Spring Harbor Press, 1995
[00176] McKently et al. Plant Cell Rep. 14:699-703 (1995)
[00177] Meinkoth and Wahl Anal. Biochem. 138:267-284 (1984)
[00178] Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443
[00179] Newell, C. A, Mol. Biotechnol. 16:53-65 (2000)
[00180] Pearson & Lipman, 1988, Proc. Nat'l. Acad. Sci. 85: 2444
[00181] Ruiz et al., 1998, Plant Cell 10:937-946
[00182] Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold
Spring Harbor Laboratory Press, Plainview, New York)
[00183] Smith & Waterman, 1981, Adv. Appl. Math. 2: 482
[00184] Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Acid Probes part I chapter 2 , "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York
[00185] Toufighi K, Brady SM, Austin R, Ly E, Provart NJ. The Botany Array Resource: e-Northerns, Expression Angling, and promoter analyses. The Plant Journal (2005) 43 : 153-163
[00186] Turner et al, 1995, Molecular Biotechnology, 3 :225
[00187] Van Damme et al. (1994) Plant Mol. Biol. 24:825
[00188] Weissbach and Weissbach, Eds.; In Methods for Plant Molecular Biology;
Academic Press, Inc.: San Diego, Calif, 1988
[00189] U.S. Pat. No. 5,004,863
[00190] U.S. Pat. No. 5,159,135
[00191] U.S. Pat. No. 5,366,892
[00192] U.S. Pat. No. 5,416,011
[00193] U.S. Pat. No. 5,463,174
[00194] U.S. Pat. No. 5,569,834
[00195] U.S. Pat. No. 5,593,881
[00196] U.S. Pat. No. 5,723,756
[00197] U.S. Pat. No. 5,737,514
[00198] U.S. Pat. No. 5,747,450
[00199] U.S. Pat. No. 6,025,545
[00200] U.S. Pat. No. 6,037,522
[00201] U.S. pat. No. 6,051 ,409
[00202] U.S. Pat. No. 6,248,076
[00203] U.S. Pat. No. 7,312,379
[00204] U.S. Pat. No. 7,378,493
Claims
1. An isolated promoter comprising a nucleic acid sequence with a sequence identity to any of SEQ ID NOs: 1-2 of greater than 98% over at least 100.
2. An isolated transcription terminator comprising a nucleic acid sequence with a
sequence identity to any of SEQ ID NOs: 33-34 of greater than 98%) over at least 100.
3. A nucleic acid molecule comprising a promoter operably linked to a heterologous nucleotide sequence, wherein the promoter is selected from the group consisting of:
(a) a nucleic acid sequence comprising a fragment of at least about 100 consecutive nucleotides of any of SEQ ID NOs: 1-2, wherein the fragment has promoter activity;
(b) a nucleic acid sequence with a sequence identity of greater than about 95% to one of SEQ ID NOs: 1-2 over the full length of the one of SEQ ID NOs: 1-2, wherein the nucleic acid sequence has promoter activity; and
(c) the nucleic acid sequence of any of SEQ ID NOs: 1-2.
4. The nucleic acid sequence of claim 1, wherein the sequence is capable of driving expression in a plant root cell.
5. The nucleic acid sequence of claim 1, wherein the sequence is capable of driving expression in a monocot root cell.
6. The nucleic acid sequence of claim 1, wherein the sequence is capable of driving expression in a maize root cell.
7. An expression cassette comprising the nucleic acid sequence of claim 1, wherein the nucleic acid sequence is operably linked to a nucleotide sequence of interest.
8. An expression vector comprising the expression cassette of claim 7.
9. A plant, comprising the promoter set forth in claim 1.
10. Grain derived from the plant of claim 9.
11. A method of expressing a heterologous gene comprising:
a) constructing an expression cassette comprising a promoter selected from the group comprising SEQ ID NO: 1 and SEQ ID NO: 2, wherein the expression cassette is functional in a plant, plant cell, or plant tissue; and
b) creating a plant, plant cell, or plant tissue or portion thereof comprising the expression cassette, wherein the heterologous gene is expressed.
12. The method of claim 11, wherein the plant, plant cell, or plant tissue or portion thereof is a monocot.
13. The method of claim 9, wherein the plant, plant cell, or plant tissue or portion thereof is maize.
14. A plant, plant cell, or plant tissue or portion thereof made by the method of claim 11.
15. Progeny of the plant, plant cell, or plant tissue or portion thereof, of claim 14.
16. Seed derived from the progeny of claim 15.
17. A plant, plant cell, or plant tissue or portion thereof comprising an expression cassette according to any one of claims 7 or 8.
18. The plant, plant cell, or plant tissue or portion thereof of claim 17, wherein the plant, plant cell, or plant tissue is a monocot.
19. The plant, plant cell, or plant tissue or portion thereof of claim 18, wherein the plant, plant cell, or plant tissue is maize.
20. A method of expressing a gene of interest in plant roots by
a) planting seed of claim 16;
b) growing seed into a plant; and
c) harvesting seed of the plant;
wherein roots of the plant of step (b) express the gene of interest operably linked to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201161504421P | 2011-07-05 | 2011-07-05 | |
US61/504,421 | 2011-07-05 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2013004668A1 true WO2013004668A1 (en) | 2013-01-10 |
WO2013004668A9 WO2013004668A9 (en) | 2013-02-28 |
Family
ID=46506351
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2012/062855 WO2013004668A1 (en) | 2011-07-05 | 2012-07-02 | Root preferred promoters derived from rice and methods of use |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2013004668A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN116606856A (en) * | 2023-07-14 | 2023-08-18 | 隆平生物技术(海南)有限公司 | Rice green tissue specific promoter pOsPTHR and application thereof |
Citations (20)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5004863A (en) | 1986-12-03 | 1991-04-02 | Agracetus | Genetic engineering of cotton plants and lines |
US5366892A (en) | 1991-01-16 | 1994-11-22 | Mycogen Corporation | Gene encoding a coleopteran-active toxin |
US5416011A (en) | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
US5463174A (en) | 1986-05-29 | 1995-10-31 | Calgene Inc. | Transformation and foreign gene expression in Brassica species |
US5593881A (en) | 1994-05-06 | 1997-01-14 | Mycogen Corporation | Bacillus thuringiensis delta-endotoxin |
US5723756A (en) | 1990-04-26 | 1998-03-03 | Plant Genetic Systems, N.V. | Bacillus thuringiensis strains and their genes encoding insecticidal toxins |
US5737514A (en) | 1995-11-29 | 1998-04-07 | Texas Micro, Inc. | Remote checkpoint memory system and protocol for fault-tolerant computer system |
US5747450A (en) | 1991-08-02 | 1998-05-05 | Kubota Corporation | Microorganism and insecticide |
US6025545A (en) | 1990-01-22 | 2000-02-15 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
US6037522A (en) | 1998-06-23 | 2000-03-14 | Rhone-Poulenc Agro | Agrobacterium-mediated transformation of monocots |
US6051409A (en) | 1995-09-25 | 2000-04-18 | Novartis Finance Corporation | Method for achieving integration of exogenous DNA delivered by non-biological means to plant cells |
US6248076B1 (en) | 1997-09-29 | 2001-06-19 | Boston Scientific Corporation | Ultrasound imaging guidewire with static central core and tip |
WO2003008540A2 (en) * | 2001-06-22 | 2003-01-30 | Syngenta Participations Ag | Abiotic stress responsive polynucleotides and polypeptides |
EP1375668A1 (en) * | 2001-03-27 | 2004-01-02 | National Institute of Agrobiological Sciences | Vegetative growth-specific promoter and genetically modified plants obtained thereby |
US20060101541A1 (en) * | 1999-07-20 | 2006-05-11 | Stanislaw Flasinski | RCc3 regulatory elements for use in plants |
US20070020621A1 (en) * | 2000-07-19 | 2007-01-25 | Boukharov Andrey A | Genomic plant sequences and uses thereof |
US7312379B2 (en) | 2000-12-07 | 2007-12-25 | Syngenta Limited | Methods for production of plants resistant to HPPD herbicides |
US7378493B2 (en) | 2002-03-06 | 2008-05-27 | Syngenta Participations Ag | Vip3 toxins and methods of use |
US20080227639A1 (en) * | 2000-07-19 | 2008-09-18 | Monsanto Technology Llc | Rice Metallothionein Promoters |
US20110160444A1 (en) * | 2007-07-09 | 2011-06-30 | Huazhong Agricultural University | Cloning Transcription Factor Gene OsWOX20 That Regulates The Growth and Development of Monocotyledon's Root and Uses Thereof |
-
2012
- 2012-07-02 WO PCT/EP2012/062855 patent/WO2013004668A1/en active Application Filing
Patent Citations (25)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5463174A (en) | 1986-05-29 | 1995-10-31 | Calgene Inc. | Transformation and foreign gene expression in Brassica species |
US5004863A (en) | 1986-12-03 | 1991-04-02 | Agracetus | Genetic engineering of cotton plants and lines |
US5159135A (en) | 1986-12-03 | 1992-10-27 | Agracetus | Genetic engineering of cotton plants and lines |
US5004863B1 (en) | 1986-12-03 | 1992-12-08 | Agracetus | |
US5159135B1 (en) | 1986-12-03 | 2000-10-24 | Agracetus | Genetic engineering of cotton plants and lines |
US5004863B2 (en) | 1986-12-03 | 2000-10-17 | Agracetus | Genetic engineering of cotton plants and lines |
US5416011A (en) | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
US5569834A (en) | 1988-07-22 | 1996-10-29 | Monsanto Company | Method for soybean transformation and regeneration |
US6025545A (en) | 1990-01-22 | 2000-02-15 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
US5723756A (en) | 1990-04-26 | 1998-03-03 | Plant Genetic Systems, N.V. | Bacillus thuringiensis strains and their genes encoding insecticidal toxins |
US5366892A (en) | 1991-01-16 | 1994-11-22 | Mycogen Corporation | Gene encoding a coleopteran-active toxin |
US5747450A (en) | 1991-08-02 | 1998-05-05 | Kubota Corporation | Microorganism and insecticide |
US5593881A (en) | 1994-05-06 | 1997-01-14 | Mycogen Corporation | Bacillus thuringiensis delta-endotoxin |
US6051409A (en) | 1995-09-25 | 2000-04-18 | Novartis Finance Corporation | Method for achieving integration of exogenous DNA delivered by non-biological means to plant cells |
US5737514A (en) | 1995-11-29 | 1998-04-07 | Texas Micro, Inc. | Remote checkpoint memory system and protocol for fault-tolerant computer system |
US6248076B1 (en) | 1997-09-29 | 2001-06-19 | Boston Scientific Corporation | Ultrasound imaging guidewire with static central core and tip |
US6037522A (en) | 1998-06-23 | 2000-03-14 | Rhone-Poulenc Agro | Agrobacterium-mediated transformation of monocots |
US20060101541A1 (en) * | 1999-07-20 | 2006-05-11 | Stanislaw Flasinski | RCc3 regulatory elements for use in plants |
US20070020621A1 (en) * | 2000-07-19 | 2007-01-25 | Boukharov Andrey A | Genomic plant sequences and uses thereof |
US20080227639A1 (en) * | 2000-07-19 | 2008-09-18 | Monsanto Technology Llc | Rice Metallothionein Promoters |
US7312379B2 (en) | 2000-12-07 | 2007-12-25 | Syngenta Limited | Methods for production of plants resistant to HPPD herbicides |
EP1375668A1 (en) * | 2001-03-27 | 2004-01-02 | National Institute of Agrobiological Sciences | Vegetative growth-specific promoter and genetically modified plants obtained thereby |
WO2003008540A2 (en) * | 2001-06-22 | 2003-01-30 | Syngenta Participations Ag | Abiotic stress responsive polynucleotides and polypeptides |
US7378493B2 (en) | 2002-03-06 | 2008-05-27 | Syngenta Participations Ag | Vip3 toxins and methods of use |
US20110160444A1 (en) * | 2007-07-09 | 2011-06-30 | Huazhong Agricultural University | Cloning Transcription Factor Gene OsWOX20 That Regulates The Growth and Development of Monocotyledon's Root and Uses Thereof |
Non-Patent Citations (34)
Title |
---|
"Current Protocols in Molecular Biology", 1995, GREENE PUBLISHING AND WILEY - INTERSCIENCE |
"Methods for Plant Molecular Biology", 1988, ACADEMIC PRESS, INC. |
"Plant Molecular Biology: A Laboratory Manual", 1997, SPRINGER |
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
BIRREN ET AL.: "Genome Analysis: Analyzing DNA", 1998, COLD SPRING HARBOR |
BIRREN ET AL.: "Genome Analysis: Detecting Genes", 1998, COLD SPRING HARBOR |
CASTLE ET AL., SCIENCE, vol. 304, 2004, pages 1151 - 1154 |
CHENG ET AL., PLANT CELL REP., vol. 15, 1996, pages 653 - 657 |
CHENG ET AL., PLANT CELL REP., vol. 15, 1997, pages 971 - 980 |
DATABASE EMBL [Online] 24 October 2006 (2006-10-24), "Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRN124L23, full insert sequence.", XP002683407, retrieved from EBI accession no. EM_PL:CT835675 Database accession no. CT835675 * |
DATABASE Geneseq [online] 2 June 2005 (2005-06-02), "Rice stress-regulated promoter SEQ ID NO:13818.", XP002683406, retrieved from EBI accession no. GSN:ACL35255 Database accession no. ACL35255 * |
DATABASE Geneseq [online] 7 February 2008 (2008-02-07), "Rice genomic promoter sequence SEQ ID NO: 38514.", XP002683405, retrieved from EBI accession no. GSN:AOB93579 Database accession no. AOB93579 * |
DE ALMEIDA ET AL., MOL. GEN. GENETICS, vol. 218, 1989, pages 78 - 86 |
ENGLISH ET AL., PLANT CELL, vol. 8, 1996, pages 179 - 1881 |
GEISER ET AL., GENE, vol. 48, 1986, pages 109 |
HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI., vol. 89, 1989, pages 10915 |
INGELBRECHT ET AL., PLANT CELL, vol. 1, 1989, pages 671 - 680 |
JONES ET AL., EMBO J., vol. 4, 1985, pages 2411 - 2418 |
KARLIN; ALTSCHUL, PROC. NAT'L. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787 |
MALIGA ET AL.: "Methods in Plant Molecular Biology", 1995, COLD SPRING HARBOR PRESS |
MCKENTLY ET AL., PLANT CELL REP., vol. 14, 1995, pages 699 - 703 |
MEINKOTH; WAHL, ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284 |
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
NEWELL, C. A., MOL. BIOTECHNOL., vol. 16, 2000, pages 53 - 65 |
PEARSON; LIPMAN, PROC. NAT'L. ACAD. SCI., vol. 85, 1988, pages 2444 |
RUIZ ET AL., PLANT CELL, vol. 10, 1998, pages 937 - 946 |
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
SAMBROOK, J. ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER |
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays" |
TOUFIGHI K; BRADY SM; AUSTIN R; LY E; PROVART NJ.: "The Botany Array Resource:e-Northerns, Expression Angling, and promoter analyses.", THE PLANT JOURNAL, vol. 43, 2005, pages 153 - 163 |
TURNER ET AL., MOLECULAR BIOTECHNOLOGY, vol. 3, 1995, pages 225 |
VAN DAMME ET AL., PLANT MOL. BIOL., vol. 24, 1994, pages 825 |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN116606856A (en) * | 2023-07-14 | 2023-08-18 | 隆平生物技术(海南)有限公司 | Rice green tissue specific promoter pOsPTHR and application thereof |
CN116606856B (en) * | 2023-07-14 | 2023-09-15 | 隆平生物技术(海南)有限公司 | Rice green tissue specific promoter pOsPTHR and application thereof |
Also Published As
Publication number | Publication date |
---|---|
WO2013004668A9 (en) | 2013-02-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7214854B2 (en) | Maize metallothionein promoter | |
US9481890B2 (en) | Modification of plant development and morphology | |
CA2343721C (en) | Maize promoters | |
EP2661498B1 (en) | Fiber selective promoters | |
CA2826276C (en) | Root-preferred promoter and methods of use | |
BR122019018071B1 (en) | RECOMBINANT DNA MOLECULE AND PROCESS FOR EXPRESSION OF A TRANSCRIBABLE POLYNUCLEOTIDE MOLECULE | |
US20040031074A1 (en) | Putrescine-n-methyltransferase promotor | |
EP2970977B1 (en) | Root-preferred promoter and methods of use | |
US7074985B2 (en) | Development of a stress-responsive promoter from maize | |
US8338662B2 (en) | Viral promoter, truncations thereof, and methods of use | |
US8350121B2 (en) | Viral promoter, truncations thereof, and methods of use | |
US8395022B2 (en) | Viral promoter, truncations thereof, and methods of use | |
CN106574274B (en) | Plant regulatory elements and methods of use thereof | |
WO2013004668A1 (en) | Root preferred promoters derived from rice and methods of use | |
CN111620933B (en) | Application of protein GmNAC2 in regulation and control of salt tolerance of plants | |
EP1941041A1 (en) | Maize promoter active in silks, stalk nodes, roots and leaf sheaths | |
ES2938850T3 (en) | Regulatory elements of plants and methods of use thereof | |
US8304607B2 (en) | Epidermal tissue promoter derived from potato for monocots | |
US20100313306A1 (en) | Viral Promoter, Truncations Thereof, and Methods of Use | |
US20090205078A1 (en) | Maize Leaf- and Stalk-Preferred Promoter | |
WO2013067259A2 (en) | Regulatory nucleic acids and methods of use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12733666 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 12733666 Country of ref document: EP Kind code of ref document: A1 |