WO2012076452A1

WO2012076452A1 - Release of endogenous il7 by the infusion of genetically modified cells for immune reconstitution

Info

Publication number: WO2012076452A1
Application number: PCT/EP2011/071711
Authority: WO
Inventors: Chiara Bonini; Luca Vago; Claudio Bordignon
Original assignee: Molmed Spa
Priority date: 2010-12-06
Filing date: 2011-12-05
Publication date: 2012-06-14

Abstract

The present invention is related to new therapeutic approaches to improve the release of endogenous IL7 in order to obtain immune reconstitution in allogeneic transplantation settings, as well as in pathological conditions characterized by immune dysregulation, or in other immunotherapeutic settings including those in which a gene transfer procedure is required, such as the adoptive transfer of genetically engineered T-cells.

Description

Release of endogenous IL7 by the infusion of genetically modified cells for immune reconstitution

Field of the invention

The present invention relates to the use of allogeneic T-cells, genetically modified with a suicide gene, for the release of the endogenous cytokine Interleukin 7 (IL7) that promotes immune reconstitution.

Background

Over the last two decades the clinical implementation and overall outcome of Hematopoietic Stem Cell Transplantation (HSCT) registered a constant improvement, availing its role as treatment of choice for most high-risk hematological malignancies (Baldomero et al., 2011). Besides the unsolved issue of primary disease recurrence, two additional problems keep accounting for majority of the treatment-related mortality in transplanted patients: Graft-versus-Host Disease (GvHD) and opportunistic infections. The incidence and morbidity related to these complications is particularly relevant in the case of HLA-mismatched transplantation where their lethality is very high. For this reason the transplantation from alternative sources like Umbilical Cord Blood and haploidentical family donors is to date rarely performed.

The therapeutic options to treat or prevent GvHD have expanded considerably in the last years, with the introduction in clinical practice of new powerful clinical tools, such as anti Tumor Necrosis Factor a (TNFa) agents, Anti Thymocyte Globulin (ATG), a nd the use of extracorporeal photoapheresis (Mastaglio et al., 2010). Still, none of these agents have yet demonstrated a clear-cut clinical benefit in severe steroid-resistant GvHD, and all of them carry as a drawback the risk of prolonged and profound immune suppression. The so called "suicide gene therapy" represents a different strategy to ma nage GvHD after a llogeneic transplantation (Lupo-Stanghellini et al., 2010). I n this approach, patients receive purified stem cell grafts, followed by the infusions of donor T cells ex vivo manipulated to express a suicide gene that is able to confer sensitivity to specific prodrugs, which activate the gene product and selectively eliminate genetically modified cells. The safety a nd efficacy of lymphocytes modified by this approach have been tested in clinical studies (Bonini et al., 2003; Ciceri et al., 2007). In a recent multicentric phase l/ll clinical trial (TK007) the infusion of T cells modified with the suicide gene Thymidine Kinase of the Herpes Simplex Virus (HSV- TK) after HSCT from HLA-haploidentical family donors provided rapid and effective GvHD control in all patients who required activation of the suicide machinery (Ciceri et al., 2009).

Although a plethora of antimicrobial agents are available for clinical use, the incidence of infections after HSCT remains high until a functional and complete immune recovery is attained. To face this threat, in the last decades, several centres have successfully developed approaches of antigen-specific cellular therapies targeting the most lethal pathogens in transplanted patients (Cytomegalovirus (CMV), Epstein-Barr Virus (EBV), adenovirus a nd Aspergillus) (Beck et al., 2006). However, these targeted adoptive cell therapies require being ready in a short time, are associated with considerable costs, and ultimately grant protection against a limited array of pathogens.

The most attractive strategy to improve immune reconstitution after HSCT is to promote the de novo development of new T cells, often compromised in adult patients by age-related involution of the thymus, which can be aggravated by the concomitant occurrence of GvHD (Weinberg et al., 2001). The infusion of ex vivo matured T cell precursors and several soluble factors implicated in thymic recovery and T cell maturation (Keratinocyte Growth Factor, Growth Hormone, IL-7) are currently under evaluation in preclinical and phase I clinical studies (Holland and van den Brink, 2009). Both thymic activity and the early stages of T cell differentiation are tightly regulated by an asset of concerted signals, coming from cell-to-cell interaction but also from several soluble factors, amongst which IL7 has been shown by several studies to play a major role (Takahama, 2006). IL7 is produced by stromal cells in the bone marrow and thymus, where it is required for the development of mature T cells, and has a prominent role in the peripheral compartment, where it promotes the survival and proliferation of naive and memory T lymphocytes (Alves et al., 2009; Surh and Sprent, 2008). Thus, I L7 appea rs to be a promising immune restorative agent as adjuva nt to vaccine or adoptive immune therapy. Studies in murine models with I L7 in the setting of a llogeneic transplantation demonstrated a potent effect of the cytokine in this therapeutic approach, but also indicated that IL7 potentially increases the possibility to develop GvHD and that this may abrogate the immune benefits (Snyder KM et al., 2006).

Summary of the invention

In particular, the present invention relates to the use of allogeneic T-cells genetically modified to express a transgene, for example a suicide gene such as the HSV-TK gene, to improve the secretion of endogenous IL7. Such allogeneic T-cells can be then infused in patients who receive a T-depleted stem cell transplantation from a donor, employing peripheral blood, bone marrow or cord blood as stem cell sources, or in patients treated with adoptive transfer of genetically engineered T-cells. The endogenous secretion of IL7 in the proper q ua ntity, at the proper sites a nd at the proper ti me, wi l l favour i m m une reconstitution of the patient in the most appropriate manner. Moreover, the presence of the suicide gene will allow GvHD control in the case it will occur.

Statements of the invention

According to a first aspect of the invention there are provided allogeneic T-cells comprising a transgene, preferably a suicide gene, for use in the induction of the release of endogenous IL7 in the host patient.

Preferably the suicide gene is selected from HSV-TK, CD20, FKBP-FAS, FKBP Caspase-9 (iCasp9). More preferably the suicide gene is HSV-TK and the donor T-cells further comprise the truncated form of the Low Affi nity Nerve G rowth Factor Receptor (ALNGFR) as a selection marker. In a preferred aspect, the host patient receives simultaneously, sequentially or separately a T depleted allogeneic transplantation or an adoptive transfer of genetically engineered T- cells.

Preferably the T depleted allogeneic transplantation consists in the infusion of stem cells from a donor, more preferably a mismatched donor, employing peripheral blood, bone marrow or cord blood as stem cell sources.

Preferably the adoptive transfer of genetically engineered T-cells consists in the infusion of T cells genetically modified to express a T Cell Receptor (TCR) conferring specificity for a tumor associated antigen such as for example Mage or WTl or a Chimeric Antigen Receptor (CAR).

In another preferred aspect the donor T-cells are stimulated ex vivo, cultured in presence of growth factors and than transduced with a retroviral vector encoding HSV-TK and ALNGFR. More preferably the stimulation is obtained with factors selected from a) an anti CD3 antibody, such as OKT3^®, followed by culture in the presence of the cytokine IL2 or b) anti-CD3/CD28 antibodies, optionally conjugated to microbeads, followed by culture in the presence of the cytokines IL7 and IL15.

In another aspect of the invention there is provided a method for obtaining the release of endogenous IL7 in the host patient comprising the administration of allogeneic T-cells comprising a transgene, preferably a suicide gene. Detailed description of the invention

A detailed description of preferred features and embodiments of the invention will be described by way of non-limiting example.

The invention can be put into practice by a person of ordinary skill in the art who will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology. All such techniques are disclosed and explained in published literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F.M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, a nd 16, John Wiley & Sons, New York, N.Y.); Current Protocols in Immunology, ch. 12, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J . M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J . Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; and, D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical. Analysis of DNA Methods in Enzymology, Academic Press. All these publications are incorporated by reference.

Endogenous release of IL7

The present invention is related to a new therapeutic approach to improve the release of endogenous IL7. IL7 is an homeostatic cytokine primary involved in T cell homeostasis and is an important factor in the process of immune reconstitution in pathological conditions associated to immune dysregulation, such as HIV infections, chronic immunodeficiencies and autoimmune disorders. In addition, IL7 is an important factor in the immune reconstitution further to T-depleted stem cell transplantation. Therefore, its recombinant form is currently under preclinical and clinical evaluation in those therapeutic settings that require immune reconstitution, particularly T-depleted allogeneic transplantations and adoptive immunotherapies. Even though administration of recombinant IL7 does improve immune restoration, some studies suggest that it may induce GvHD in allogeneic settings. The aim of the invention is to induce the release of endogenous IL7, with the advantage of producing the cytokine at the proper site in the proper quantity and at the proper time, as a result of the T-cell infusion itself. In particular embodiments, the allogeneic T-cells of the invention allow, at the same time, the possibility to manage GvHD events thanks to the presence of the suicide gene system.

According to a first aspect of the invention there are provided allogeneic T- cells comprising a transgene, particularly a suicide gene, for use in the induction of the release of endogenous IL7 in the host patient.

In fact, an increase of the release of endogenous IL7 has been surprisingly found in a clinical trial for the treatment of high-risk hematologic malignancies, where the patients received a T-depleted transplantation, spacifically a Hematopoietic Stem Cells Transplantation (HSCT) from a HLA-haploidentical family donor, followed by monthly infusions of donor lymphocytes, genetically modified with a retroviral vector encoding the

HSV-TK. Those patients who experienced engraftment of the infused donor T-cells, an increase in the serum levels of IL-7 reproducibly occurred after the donor T-cells add-backs, reaching values not commonly observed in physiological conditions. Importantly, this peak in

IL-7 serum concentration was reproducibly followed by a concomitant rise in peripheral T cell counts, leading to long-term immune reconstitution.

Therefore, in a preferred aspect, the allogeneic T cells are for use in patients who receives simultaneously, sequentially or separately a T depleted allogeneic transplantation or an adoptive transfer of genetically engineered T-cells. Preferably the T depleted allogeneic transplantation consists in the infusion of stem cells from a mismatched donor employing peripheral blood, bone marrow or cord blood as stem cell sources.

The clinical applications in which the release of endogenous IL7 generated according to the present invention can be employed are the treatment of all diseases that require bone marrow transplantation, particularly hematological malignancies, more particularly leukemias, lymphomas and myelomas, and all diseases characterized by immune dysregulation, such as HIV infection, chronic immunodeficiencies and autoimmune disorders.

The allogeneic T-cells of the present invention are also for use in the host patient who receives simultaneously, sequentially or separately an adoptive tra nsfer of genetically engineered T-cells.

The adoptive transfer of genetically engineered T-cells is a form of immunotherapy in which genetically engineered T cells are created by infecting patient's cells with a virus that contain a copy of a transgene. The transgene may be specialised to recognise tumour antigens. The virus is not able to reproduce itself within the cells however integrates into the human genome. This is beneficial as new transgene remains stable in the T-cell. Patient's own T cells are exposed to these viruses and then expanded non-specifically or stimulated using antigens. The cells are then transferred back into the patient and ready to have an immune response against the pathogen.

Therefore, according to the present invention, the adoptive transfer consists in the infusion of T cells genetically modified to express a transgene, for example a TCR conferring specificity for a tumor associated antigen, such as Mage or WT1, or a Chimeric Antigen Receptor.

Therefore other clinical applications in which the release of the endogenous IL7 generated according to the present invention can be employed, is the treatment of solid tumors, particularly melanoma.

Suicide gene systems

The suicide gene system is a therapeutic approach that allows to selectively control GvHD in which patients are infused with donor cells genetically modified to express a foreign gene that confers sensitivity to a prodrug that is non toxic to non expressing cells. In case GvHD occurs the prodrug is administered to the patients a nd the donor cells a re selectively eliminated. The donor T-cells of the present invention are genetically modified to express a suicide gene in order to control GvHD in case it will occur after the infusions.

The suicide gene is preferably selected from HSV-TK, CD20, FKBP-FAS, FKBP Caspase-9. More preferably the suicide gene is HSV-TK and the donor T-cells further comprises the truncated form of Low Affinity Nerve Growth Factor Receptor (ALNGFR) as a selection marker.

The donor T-cells are stimulated ex vivo, cultured in presence of growth factors and then transduced with a retroviral vector encoding HSV-TK and ALNGFR. Preferably the stimulation is obtained with factors selected from a) OKT3 followed by culture in the presence of the cytokine IL2 or b) Anti-CD3/CD28 antibodies, optionally conjugated to microbeads, followed by culture in the presence of the cytokines IL7 and IL15.

As also shown in the examples, besides an efficient protection against infectious events, a low incidence of GvHD was recorded in patients who received HSCT from haploidentical donor followed by the donor T-cells of the present invention despite the absence of any pharmacological immunosuppressive treatment. The re lease of the e ndoge no us I L7 improves therefore the clinical outcome of the transplant and, at the same time, appears to have a positive effect in respect to the incidence of GvHD. On the contrary the administration of recombinant IL7 in some preclinica l models resulted in an increase of GvHD. As discussed above, the release the endogenous IL7 allows to obtain the cytokine in the proper dose, at the proper site and at the proper time and, therefore, results to be advantageous.

Description of the figures

Figure 1. Infusion of purified TKpos cells after T cell-depleted HSCT prompts the immune recovery of TKneg naive T cells. (A) Composition of 43 genetically modified T cell products infused to 25 patients enrolled to the TK007 clinical trial: upon magnetic selection the large majority of infused cells express the surface marker ALNGFR (TKpos, in black), whereas only a minor fraction is negative for the transgene (TKneg, in white). (B) Absolute counts of circulating T cells in TK007 patients before (Baseline) and at different time-points after the infusion of TKpos cell add-backs (at immune reconstitution, defined as the attainment of a CD3 cell count above 100 cells/μΙ; at 6 months after HSCT; and at 12 months after HSCT). Histogram bars are subdivided to represent the relative frequency of circulating TKpos (in black) and TKneg (in white) T cells at each time-point. Shown is average with Standa rd Deviation (SD). (C) Correlation between the frequency of PBMCs expressing on their surface the ALNGFR marker (on the x axis) and that of PBMCs having integrated in their genome the HSV-TK transgene, as assessed by specific qPCR (on the y axis), in 25 patients enrolled to the TK007 trial. (D) Absolute counts of circulating TKpos (left panels) and TKneg (right panels) T cells at different time-points after HSCT and TKpos cell add-backs, subdivided according to the CD4 or CD8 subtype (in black and white, respectively; upper panels) and to their naive, central memory or effector phenotype (in black, grey, and white, respectively; lower panels). Shown are the averages, with SDs, of the results obtained from 10 TK007 patients. The figure summarizes results from more than five independent experiments. Figure 2. TKpos cell add-backs prompt the systemic release of IL-7, leading to T cell immune recovery. Line graphs indicate the serum concentration of IL-7 (solid lines) and the absolute T cell counts (dashed lines) in three representative TK007 patients who experienced systemic engraftment of TKpos cells and subsequent immune reconstitution (three out of six studied patients are shown, panels on the left) and in two patients that received the suicide gene- modified cells but failed to attain T cell reconstitution. Arrows indicate time of HSCT (white), infusions of TKpos cells (black) or infusions of unmanipulated donor lymphocytes (grey). The figure summarizes results from two independent experiments. Figure 3. sj TRECs rise in the peripheral blood of TK007 patients after HSCT and suicide gene therapy. Absolute counts of sjTRECS per 100 ng of genomic DNA extracted from PBMCs of TK007 patients at different time-points during their follow-up. Pie charts below the graph represent the percentage of patients in whom circulating sjTREC counts were above (in black) or below (in white) the sensitivity of the detection method (3 TREC copies/100 ng of DNA). The asterisk indicate p<0.05, in a Chi Square test. The figure summarizes results from three independent experiments.

Figure 4. Na ive T cells ci rculating after TKpos cell add-backs a re CD31+ Recent Thymic Emigrants. (A) Frequency of CD4 naive T cells amongst total CD3+ lymphocytes in healthy individuals (white bar) and in TK007 patients before treatment and at different time-points during their follow-up (black bars). Shown is average with SD. (B) Correlation between age of the subject (x axis) and the frequency of CD31+ cells amongst the CD4 naive subset (y axis) in 26 healthy individuals. (C) CD31 expression analysis in a representative patient from the TK007 clinical trial (UPN#4, age 57). In the upper row are shown the dot plots of CD3+CD4+ALNGFR- T cells, according to their expression of CD45RA (horizontal axis) and CD62L (vertical axis) at different time-points during the treatment: gated in black are naive cells, identified as CD45RA+ and CD62L+. Histograms below the dot plots represent CD31 positivity amongst naive CD4 cells (in black) and, as a negative control, amongst effectors (in white) . ( D) Freq uency of CD31+ ce l ls a mongst na ive CD4+ T lym phocytes i n hea lthy individuals (either volunteer blood donors or stem cell donors for TK007 patients; white dia monds), i n TK007 patie nts at different time-poi nts d u ri ng thei r fol low-u p (black diamonds), or in a control group of patients receiving haploidentical HSCT without T cell depletion of the graft, followed by pharmacological GvHD prophylaxis (grey diamonds). One asterisk indicates p<0.05, two asterisks p<0.005 in a paired sample Student t test. The figure summarizes results from more than five independent experiments. Examples

Example I : General methods

Patients, procedures and biological samples

Fifty-four adult patients with high-risk hematologic malignancies were enrolled to an open, non-randomized, prospective phase l-ll clinical trial of haploidentical HSCT and infusions of donor lymphocytes engineered to express the HSV-TK suicide gene (TK007 trial). Details on patient characteristics, transplantation and T cell add-back procedures, and clinical outcome are summarized in a previous report from our group (Ciceri et al., 2009). Briefly, after a myeloablative conditioning patients received CD34+ peripheral blood hematopoietic stem cells, positively selected with the CliniMacs one-step procedure (Clinimatics, Miltenyi Biotec, Bergisch Gladbach, Germany), to achieve a final median CD34+ count of 11.6xl06/kg (range 4.6-16.8), with only l.lxl04/kg contaminant donor CD3+ cells (range 0.26-10.0). For genetic modification with the HSV-TK gene, donor PBMCs were collected by leukapheresis, activated with muromonab anti-CD3 in the presence of 600 lU/ml IL-2 (EuroCetus, Novartis, Basel, Switzerland) and transduced with the Replication-Competent Retrovirus (RCR)-free SFCMM- 3 retroviral vector to transfer the HSV-TK suicide gene and a truncated form of the ALNGFR marker. After magnetic immune-selection, genetically modified T cells were administered as serial monthly infusions to tra nsplanted patients, starting at 42 days from HSCT with an initial dose of 1x106 cells/kg (amended during the trial to 1x107 cells/kg). Peripheral blood samples of patients and their respective donors were collected at serial time-points during treatment follow-up, upon written informed consent approved from the San Raffaele institutional Ethical Committee. Samples were processed to purify serum and PBMCs, which were then cryopreserved at -80°C or in liquid nitrogen, respectively, for further biological studies. Flow cytometry analysis

Absolute quantification of circulating T and TKpos cells in TK007 patients was performed according to the ISCT immunological gating protocol (Sutherland et al., 1996). To assess the phenotype of circulating T cells and the frequency of CD31+ RTEs patient and healthy donor PBMCs were stained with monoclonal antibodies specific for CD3 (clone UCHT1, Beckman Coulter Inc, Brea, CA), CD4 (clone RPA-T4), CD8 (clone SKI), CD45RA (clone HIlOO), CD62L (clone Dreg56), CD31 (clone WM59) and NGFR (clone C40-1457; all from BD Biosciences, San Jose, CA). Seven-color immunophenotypic analysis was performed using a Canto II flow cytometer (BD Biosciences, San Jose, CA) and data were processed using the FCS Express 3.00 software (De Novo Software, Los Angeles, CA). For all samples at least 105 events were collected.

Quantitative PCR for the HSV-TK suicide gene

The presence of the HSV-TK gene sequences was analyzed in genomic DNA extracted from PBMCs by a 40-cycles qPCR using the TK-for (GGACACGTTATTTACCCTGTTTCG) and TK-rev (GCCCAGGCAAACACGTTATAC) primers and the FAM-TTGCTGGCCCCCAAC-MGB fluorescent probe. Results were normalized upon quantification of the Telomerase reference gene (Forward primer: GGCACACGTGGC I I I I CG; reverse primer:

GGTGAACCTCGTAAGTTTATGCAA; probe: VIC-TCAGGACGTCGAGTGGACACGGTG-TAMRA) and relative expression as compared to a reference sample (100% of cells positive for HSV-TK) was obtained using the 2-ΔΔΠ^" formula. Sensitivity of the assay allowed detection of up to 1% of HSV-TK positive cells.

Quantification of sjTRECs

Genomic DNA was isolated from PBMCs using the QIAamp DNA Mini kit or Micro kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. Real-time quantitative PCR was performed for sjTRECs as previously described (Guazzi et al., 2002; Selleri et al., 2011), and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a control to standardize DNA content. Briefly, a mplification reactions were performed in a fina l volume of 25 μΙ containing 50 ng of genomic DNA, TaqMan universal PCR master mix (Perkin Elmer Applied Biosystem, Foster City, CA), and the appropriate primers and probes. The amount of TREC per 100 ng of DNA was determined on the basis of a standard curve developed in-house by cloning the sequence of al circles from huma n cord blood genomic DNA into a plasmid vector, and diluting the plasmid into human DNA from a cell line devoid of TRECs (K562), with a lower limit of detection of 3 copies/100 ng of genomic DNA.

Quantification of Serum Cytokines

The Bio-Plex Pro Human Cytokine 4-plex array (Bio-Rad, Hercules, CA) was used to simultaneously analyze the concentration of IL-2, IL-7, IL-15 and IL-17 in patients' sera, according to the manufacturer's instructions. All samples were analyzed in duplicate. For each studied cytokine two 8 points-standard curves (at high sensitivity for low cytokine concentrations or at low sensitivity for high cytokine concentrations) were prepared by serial dilutions of recombinant cytokines. Data were analyzed using Bio-Plex Manager Version 5.0 software (Bio-Rad).

Example II : the clinical trial TK007

Infusion of gene-manipulated donor T cells after transplantation prompts the recovery of a transgene-negative T cell repertoire

Between 2002 and 2008, 54 adult patients underwent HSCT from HLA-haploidentical family donors for high-risk hematologic malignancies in a multicentre, open, non- randomised, prospective phase HI clinical trial (TK007). The infused graft was extensively selected for CD34+ cells, and contaminating T cells were lxl04/kg for all patients.

To improve immune reconstitution, 28 patients received serial monthly infusions of donor lymphocytes, starting from day 42 after transplantation. To enable selective GvHD control in the absence of pha rmacologica l im m une suppression, infused cel ls were genetica lly modified with a retroviral vector encoding the Herpes Simplex Virus-Thymidine Kinase (HSV- TK) suicide gene, which enables the conversion of ganciclovir (GCV) into a toxic product able to selectively eliminate cells expressing the transgene. To purify TKpos cells for infusion, the retroviral construct included a selection surface marker, the truncated form of the Low- affinity Nerve Growth Factor Receptor (ALNGFR), which also enabled in vivo tracking of gene-modified cells in treated patients. All infused cell products, manipulated under Good Manufacturing Practice conditions in a specialized facility, displayed a high purity of TKpos cells (average 94.69+1.92%, n=43; Figure 1A).

Patients who did not receive gene-modified cell infusions failed to attain T cell immune reconstitution (defined as an absolute count of circulating T cells superior to 100/μλ), and expe rie nced a disma l cli n ica l outcome, mostly d ue to the occu rre nce of i nfectious complications. Conversely 22/28 patients who received the purified TKpos cells achieved recovery of protective T cell counts at a median time of 74 days after transplantation, which were stably maintained over time, with a concomitant improvement in clinical outcome mostly due to reduction of late transplant-related mortality (Ciceri et al., 2009). During the immunological follow-up of treated patients we detected in the periphera l blood also consistent numbers of CD3+ cells which were negative for the surface marker ALNGFR (TKneg cells), starting from the time of immune recovery and progressively growing in both frequency and absolute counts to dominate the newly reconstituting T cell repertoire (Figure IB). Hematopoietic chimerism in bone marrow and peripheral blood was full donor for all these patients, and at corresponding time-points donor-derived TKneg cells could not be detected in patients who did not receive the genetically modified T cells, nor in those who did not experience TKpos cell engraftment.

Quantitative PCR for the HSV-TK gene performed on peripheral blood of treated patients confirmed the results obtained from the immunophenotype, demonstrating a tight correlation with the expression of the surface marker (r2=0.597, p<0.0001), thus excluding that the observation of circulating TKneg cel ls ca me from loss, or downregu lation, of ALNGFR expression on genetically modified cells (Figure 1C).

TKneg cells were enriched in CD4 T cells as compared to their TKpos counterparts or their respective infused cell products (Figure ID, upper pa nels). Moreover, only in the TKneg subset we could detect a recovery of T lymphocytes with a naive phenotype (CD62L+CD45RA+), which were barely detectable at the time of immune reconstitution (4.25 cells/μΙ, 3.22% of CD3+ cells), and progressively increased in numbers and frequency over time, to reach physiological cell counts at 1 year after HSCT (250.70 cells/μΙ, 24.20% of CD3+ cells; Figure ID, lower panels), of particular relevance in a patient population with the median age of 55 years (range 17-64).

Example III : IL7 endogenous release and immune reconstitution lnterleukin-7 serum levels peak after TKpos cell infusions It was measured the seru m concentrations of severa l cytoki nes re lated to T cel l development, homeostasis and differentiation (I L-2, IL-7, IL-15, and IL-17) over time after HSCT by a multiplex fluorescent bead-based assay in selected TK007 patients who received donor gene-modified T cell add-backs.

Neither IL-2 nor IL-17 could be detected in the peripheral blood of studied patients at any time-point, whereas IL-15 rose a bove the assay detection sensitivity on ly for the days immediately following HSCT conditioning, returning to basal levels by day 19.

A similar peak in serum concentration in the early post-transplantation days could be detected for IL-7, possibly induced by the rapid and profound lymphodepletion caused by the chemotherapeutic conditioning regimen (Figure 2). Strikingly, in patients who experienced engraftment of the infused TKpos cells and T cell recovery, an additional sharp increase in the serum levels of IL-7 reproducibly occurred after the TKpos cell add-backs, reaching values not commonly observed in physiological conditions, even above 25 pg/ml (Figure 2B). Importantly, this second peak in IL-7 serum concentration was reproducibly followed by a concomitant rise in peripheral T cell counts, leading to long-term immune reconstitution (dashed line in Figure 2). I nterestingly, in the only patient who received an unmanipulated T cell add-back due to impending disease relapse (UPN#9, day 309, Figure 2A), no evident rise in IL-7 concentration could be documented, while a subsequent TKpos cell infusion (day 355) was able again to mediate such effect.

Appearance of sjTRECs after donor T cell add-backs suggests thymic contribution to immune recovery

Single joint T cell Receptor Excision Circles (sjTRECs) are byproducts of the physiological rearrangement of the β chain of the T cell receptor, which are maintained as episomal DNA in newly generated T lymphocytes when they egress from the thymus. Therefore their quantification represents a reliable assessment of thymic output (Weinberg et al., 2001). sjTREC counts was measured by qPCR in the peripheral blood of 13 TK007 patients treated with gene-modified donor cells, studied longitudinally during their transplantation follow-up (Figure 3). As expected from the adult age of the patient cohort, sjTRECs at the time of transplantation were exceedingly low, below the detection limit of the method in six out of eight patients (75%). When sjTRECs were measured at the moment of T cell immune reconstitution (circulating CD3+ cells > 100/μΙ), they were detectable in one single patient (7.7%). This was in line with the low numbers of circulating T cells at this early time-point (14.67% of periphera l blood mononuclea r cells (PBMCs)), with a further dilution of the sjTREC-rich na ive su bset, a mi nor fraction of the CD3 cells (Figure ID). Pa ra llel to the increase in the numbers of naive T cells, however, also sjTREC counts rose over time during imm une recovery, a nd when assessed at one yea r after HSCT most of the patients (6/9, 66.67%) had detectable circulating sjTRECs, thus evidencing a significant increase in thymic output as compared to their pre-transplantation determination (p=0.02).

Although these data are supportive of an increase in thymic activity after HSCT and infusion of TKpos cells, they cannot reveal the relative contribution of thymic-dependent and -independent mechanisms of T cell recovery. To this aim, the early phases of immune recovery were further studied, taking advantage of a subset-specific quantitative method such as flow cytometry.

Naive TKneg cells reconstituting after suicide gene therapy are Recent Thymic Emigrants

The surface immunoglobulin-like receptor CD31 (PECAM-1) is a cell adhesion and signaling receptor expressed on hematopoietic and endothelial cells. It serves several functions in the extravasation of leukocytes and in the inflammatory process. Amongst CD4+ na ive T cells, positivity for CD31 ca n distinguish the sjTREC-rich Recent Thymic Emigrants (RTEs) from aged naive cells that did not encounter their cognate antigen and underwent homeostatic proliferation over time (Kimmig et al., 2002; Kohler and Thiel, 2009). Thus, the relative size of the CD31+ compartment amongst naive CD4 cells is an indirect index of the contribution of thymic-dependent lymphopoiesis to the immune repertoire, expected to decrease with age as involution of the thymus takes place (Junge et al., 2007; Kilpatrick et al., 2008).

In TK007 treated patients the naive CD4 subset of lymphocytes (CD4+CD45RA+CD62L+ cells), which is the denominator of the CD31 expression analysis, was detectable at all time- points following TKpos cell add-backs, progressively i ncreasing in freq uency unti l fu ll normalization at one year after HSCT (Figure 4A).

In a control cohort of 26 healthy individuals, CD31 expression in CD4 naive lymphocytes displayed a very stringent correlation with age of the subject (r2=0.728, p<0.0001; Figure 4B), with an average frequency of CD31+ RTEs of 58.28+13.48% for adults. The frequency of CD31+ RTEs measured in 18 adult patients before haploidentical HSCT for hematological malignancies was comparable to the one documented in their respective stem cell donors or in age-matched healthy controls, demonstrating that nor underlying disease nor previous treatments significantly deregulate CD31 expression. Of these 18 patients, 8 were enrolled to the TK007 protocol and received a CD34-selected graft and the gene-modified lymphocytes, whereas 10 underwent an unselected, non-T cell-depleted procedure followed by pharmacological GvHD prophylaxis. As summarized in Figure 4D and exemplified for a representative patient in Figure 3C (UPN#4, age 57), we observed that only in TK007 patients we could document that almost the totality of TKneg naive CD4 cells were positive for CD31, thus bona fide RTEs (89.54+9.55% at immune reconstitution, 81.84+15.9% at 6 months after HSCT, a nd 79.55+16.66% at 12 months after HSCT). At 1 yea r after transplantation, when the overa ll frequency and the a bsolute counts of naive cells were recove red to pre-transpla ntation levels, more tha n 80% of these cel ls displayed the phenotypic features of thymic emigrants, indicating an active regenerative process, with the continuous output of cellular elements with novel specificities. I mporta ntly, the control group of patients who underwent unselected HSCT did not show a ny i ncrease i n the frequency of their circulating RTEs, suggesting that in this group of patients peripheral expansion of the donor T cells contained in the graft rather than thymopoiesis accounted for T cell count recovery. References

Alves, N.L., O. Richard-Le Goff, N.D. Huntington, A. P. Sousa, V.S. Ribeiro, A. Bordack, F.L. Vives, L. Peduto, A. Chidgey, A. Cumano, R. Boyd, G. Eberl, and J.P. Di Santo. 2009. Characterization of the thymic IL-7 niche in vivo. Proceedings of the National Academy of Sciences of the United States of America 106:1512-1517.

Baldomero, H., M. Gratwohl, A. Gratwohl, A. Tichelli, D. Niederwieser, A. Madrigal, and K. Frauendorfer. 2011. The EBMT activity survey 2009: trends over the past 5 years. Bone marrow transplantation 46:485-501.

Beck, O., M.S. Topp, U. Koehl, E. Roilides, M. Simitsopoulou, M. Hanisch, J. Sarfati, J.P. Latge, T. Klingebiel, H. Einsele, and T. Lehrnbecher. 2006. Generation of highly purified and functionally active human TH1 cells against Aspergillus fumigatus. Blood 107:2562-2569.

Bonini, C, M. Grez, C. Traversari, F. Ciceri, S. Marktel, G. Ferrari, M. Dinauer, M.

Sadat, A. Aiuti, S. Deola, M. Radrizzani, A. Hagenbeek, J. Apperley, S. Ebeling, A.

Martens, H.J. Kolb, M. Weber, F. Lotti, A. Grande, E. Weissinger, J.A. Bueren, M.

Lamana, J.H. Falkenburg, M.H. Heemskerk, T. Austin, S. Kornblau, F. Marini, C. Benati, Z. Magnani, S. Cazzaniga, S. Toma, C. Gallo-Stampino, M. Introna, S. Slavin, P.D.

Greenberg, M. Bregni, F. Mavilio, and C. Bordignon. 2003. Safety of retroviral gene marking with a truncated NGF receptor. Nature medicine 9:367-369.

Ciceri, F., C. Bonini, S. Marktel, E. Zappone, P. Servida, M. Bernardi, A. Pescarollo, A. Bondanza, J. Peccatori, S. Rossini, Z. Magnani, M. Salomoni, C. Benati, M. Ponzoni, L. Callegaro, P. Corradini, M. Bregni, C. Traversari, and C. Bordignon. 2007. Antitumor effects of HSV-TK-engineered donor lymphocytes after allogeneic stem-cell transplantation. Blood 109:4698-4707.

Ciceri, F., C. Bonini, M.T. Stanghellini, A. Bondanza, C. Traversari, M. Salomoni, L. Turchetto, S. Colombi, M. Bernardi, J. Peccatori, A. Pescarollo, P. Servida, Z. Magnani, S.K. Perna, V. Valtolina, F. Crippa, L. Callegaro, E. Spoldi, R. Crocchiolo, K.

Fleischhauer, M. Ponzoni, L. Vago, S. Rossini, A. Santoro, E. Todisco, J. Apperley, E. Olavarria, S. Slavin, E.M. Weissinger, A. Ganser, M. Stadler, E. Yannaki, A. Fassas, A. Anagnostopoulos, M. Bregni, C.G. Stampino, P. Bruzzi, and C. Bordignon. 2009.

Infusion of suicide-gene-engineered donor lymphocytes after family haploidentical haemopoietic stem-cell transplantation for leukaemia (the TK007 trial): a non- randomised phase l-ll study. Lancet Oncol 10:489-500.

Ciceri, F., M. Labopin, F. Aversa, J.M. Rowe, D. Bunjes, P. Lewalle, A. Nagler, P. Di Bartolomeo, J.F. Lacerda, M.T. Lupo Stanghellini, E. Polge, F. Frassoni, M.F. Martelli, and V. Rocha. 2008. A survey of fully haploidentical hematopoietic stem cell transplantation in adults with high-risk acute leukemia: a risk factor analysis of outcomes for patients in remission at transplantation. Blood 112:3574-3581.

Guazzi, V., F. Aiuti, I. Mezzaroma, F. Mazzetta, G. Andolfi, A. Mortellaro, M.

Pierdominici, R. Fantini, M. Marziali, and A. Aiuti. 2002. Assessment of thymic output in common variable immunodeficiency patients by evaluation of T cell receptor excision circles. Clinical and experimental immunology 129:346-353.

Holland, A.M., and M.R. van den Brink. 2009. Rejuvenation of the aging T cell compartment. Current opinion in immunology 21:454-459. Junge, S., B. Kloeckener-Gruissem, R. Zufferey, A. Keisker, B. Salgo, J.C. Fauchere, F. Scherer, T. Shalaby, M. Grotzer, U. Siler, R. Seger, and T. Gungor. 2007. Correlation between recent thymic emigrants and CD31+ (PECAM-1) CD4+ T cells in normal individuals during aging and in lymphopenic children. European journal of

immunology 37:3270-3280.

Kilpatrick, R.D., T. Rickabaugh, L.E. Hultin, P. Hultin, M.A. Hausner, R. Detels, J. Phair, and B.D. Jamieson. 2008. Homeostasis of the naive CD4+ T cell compartment during aging. Journal of immunology 180:1499-1507.

Kimmig, S., G.K. Przybylski, C.A. Schmidt, K. Laurisch, B. Mowes, A. Radbruch, and A. Thiel. 2002. Two subsets of naive T helper cells with distinct T cell receptor excision circle content in human adult peripheral blood. The Journal of experimental medicine 195:789-794.

Kohler, S., and A. Thiel. 2009. Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood 113:769-774.

Lupo-Stanghellini, M.T., E. Provasi, A. Bondanza, F. Ciceri, C. Bordignon, and C. Bonini. 2010. Clinical impact of suicide gene therapy in allogeneic hematopoietic stem cell Mastaglio, S., M.T. Stanghellini, C. Bordignon, A. Bondanza, F. Ciceri, and C. Bonini.

2010. Progress and prospects: graft-versus-host disease. Gene therapy 17:1309-1317. Selleri, S., I. Brigida, M. Casiraghi, S. Scaramuzza, B. Cappelli, B. Cassani, F. Ferrua, M. Aker, S. Slavin, A. Scarselli, C. Cancrini, S. Marktel, M. Grazia Roncarolo, and A. Aiuti.

2011. In vivo T-cell dynamics during immune reconstitution after hematopoietic stem cell gene therapy in adenosine deaminase severe combined immune deficiency. The Journal of allergy and clinical immunology 127:1368-1375 el368.

Snyder, K.M., Mackall, C.L., Fry, T.J. 2006. IL7 in allogenei transplant: clinical promise and potential pitfalls. Leukemia & Lumphoma 47(7):1222-1228

Sutherland, D.R., L. Anderson, M. Keeney, R. Nayar, and I. Chin-Yee. 1996. The

ISHAGE guidelines for CD34+ cell determination by flow cytometry. International

Society of Hematotherapy and Graft Engineering. Journal of hematotherapy 5:213-

226.

Takahama, Y. 2006. Journey through the thymus: stromal guides for T-cell

development and selection. Nature reviews. Immunology 6:127-135.

Vago, L., S.K. Perna, M. Zanussi, B. Mazzi, C. Barlassina, M.T. Stanghellini, N.F. Perrelli, C. Cosentino, F. Torri, A. Angius, B. Forno, M. Casucci, M. Bernardi, J. Peccatori, C. Corti, A. Bondanza, M. Ferrari, S. Rossini, M.G. Roncarolo, C. Bordignon, C. Bonini, F. Ciceri, and K. Fleischhauer. 2009. Loss of mismatched HLA in leukemia after stem-cell transplantation. N Engl J Med 361:478-488.

Weinberg, K., B.R. Blazar, J.E. Wagner, E. Agura, B.J. Hill, M. Smogorzewska, R.A. Koup, M.R. Betts, R.H. Collins, and D.C. Douek. 2001. Factors affecting thymic function after allogeneic hematopoietic stem cell transplantation. Blood 97:1458- 1466.

Claims

1. Allogeneic T-cells comprising a transgene for use in the induction of the release of endogenous IL7 in the host patient

2. Allogeneic T-cells according to claim 1 wherein the transgene is a suicide gene

3. Allogeneic T-cells according to claim 2 wherein the suicide gene is selected from HSV-TK, CD20, FKBP-FAS, FKBP Caspase-9

4. Allogeneic T-cells according to claim 2 or 3 wherein the suicide gene is HSV-TK

5. Allogeneic T-cells according to anyone of claim 1 to 4 further comprising the truncated form of Low Affinity Nerve Growth Factor Receptor (ALNGFR)

6. Allogeneic T-cells according to anyone of claims claim 1 to 5 wherein the host patient receives simultaneously, sequentially or separately a T depleted allogeneic transplantation or an adoptive transfer of genetically engineered T-cells

7. Allogeneic T-cells according to claim 6 wherein the T-depleted allogeneic transplantation consists in the infusion of stem cells from a mismatched donor employing peripheral blood, bone marrow or cord blood as stem cell source

8. Allogeneic T-cells according to claim 6 wherein the adoptive transfer of genetically engineered T-cells consists in the infusion of T cells genetically modified to express a T Cell Receptor conferring specificity for a tumor associated antigen or a Chimeric Antigen Receptor.

9. Allogeneic T-cells according to anyone of preceding claims wherein the cells are stimulated ex vivo, cultured in presence of growth factors and then transduced with a retroviral vector encoding HSVTK and ALNGFR.

10. Allogeneic T-cells according to claim 9 wherein the stimulation is obtained with factors selected from:

a. A anti-CD3 antibody followed by culture in the presence of the cytokine IL2 or b. Anti-CD3/CD28 antibodies, optionally conjugated to microbeads, followed by culture in the presence of the cytokines IL7 and IL15.