WO2012052854A2 - Plant cell lines and methods of isolating the same - Google Patents

Abstract

An isolated plant cell having increased expression of one or more of a PXY and WOL nucleic acid molecule or polypeptide, a method of isolating a plant stem cell, a method of producing a plant-derived biologically active substance using the isolated plant stem cell are disclosed. The cells are undifferentiated, undergo self-renewal, proliferate, and have the ability to differentiate. Cultures of the plant cells minimize variation of cell growth and stably produce biologically active substances, even in long-term culture. Production of biologically active substances using the plant cells solves problems of dedifferentiated plant cell cultures, including decreased cell growth and decreased productivity during long term culture.

Description

PLANT CELL LINES AND METHODS OF ISOLATING THE SAME BACKGROUND OF THE INVENTION

[0001] Plants are a source of extensive biologically active compounds. A plethora of important, chemically diverse natural products are derived from plants, including pharmaceuticals, fragrances, colors, agricultural chemicals, and dyes. Biologically active compounds that are produced from plants include secondary metabolites. There are about 100,000 known plant secondary metabolites, and every year, novel secondary metabolites are discovered continually. There is great interest in secondary metabolites, such as alkaloids, allergens, amino acids, anthraquinone, antileukaemic agents, antimicrobial agents, antitumor agents, antiviral agents, enzymes, flavonoids, insecticides, opiates, perfumes, pigments, vitamins, and polysaccharides, many of which are physiologically active substances. It has been estimated that more than 25% of compounds used medicinally are plant-derived substances.

[0002] Obtaining quantities of plant derived compounds poses many challenges. Despite advances in organic chemistry, chemical synthesis of plant derived compounds may require difficult or complicated chemical reactions. Plant derived compounds may be extracted from plants. However, harvesting plants growing in nature results in destruction of natural environments and generation of pollution. In addition, plant derived compounds extracted from plants are subject to environmental conditions, e.g., season, region and climate, which can affect yield and production cost.

[0003] Plant cell culture offers an attractive option for production of chemical and biologically active compounds. In vitro culture techniques have the advantages of controlled culture conditions and large scale production with minimal space requirements. Current in vitro culture techniques have focussed on dedifferentiated plant cells (DDCs).

[0004] However, in vitro culture of dedifferentiated plant cells is not a commercially viable strategy because of difficulties associated with culturing dedifferentiated plant cells on an industrial scale. For example, Naill & Roberts, Biotechnol. Bioeng. 86(7): 817-826 (2004) have indicated slow growth rate and low productivity of plant cell culture for the secondary metabolite production. To solve this problem, there have been studies to elicit higher productivity by optimization of media, culture conditions, and processes (Zhong, J., J. Bioscien. Bioeng. 94(6): 591-599 (2002). As disclosed in W093/17121, various media was used to culture diverse Taxus for the increase in cell growth rate and paclitaxel productivity. Despite these efforts, variability is still a major issue for the production of paclitaxel from Taxus and other valuable substances from numerous plant systems.

[0005] Importantly, although the cultured cell lines are derived from one plant, metabolite productivity of each cell line is different and unstable. Additionally, through multiple rounds of culturing plant cell lines lose their initial productivity.

[0006] Thus, there is a need to develop approaches for the long term culture of plant cells that can be used for large scale production of plant metabolites.

[0007] The above information disclosed in this Background section is only for enhancement of understanding of the background of the invention and therefore it may contain information that does not form the prior art that is already known in this country to a person of ordinary skill in the art.

SUMMARY OF THE INVENTION

[0008] The present invention generally provides compositions and methods featuring plant cells (e.g., undifferentiated plant cells or plant stem cells) that have stable and rapid cell growth and maintain high metabolite production during long term culture. Methods of isolating, culturing, and using plant cells of the invention (e.g., for the production of a plant-derived compound) are described herein. Plant stem cells from reference species provide a useful biological tool to explore plant stem cell function.

[0009] In one embodiment, the present invention provides a method for characterizing a homogenous plant stem cell line, comprising (a) identifying levels of transcription of specific genes in a test plant stem cell line; and (b) comparing the transcription levels to a reference transcriptome pattern of a reference homogenous plant stem cell line, said reference transciptome pattern comprising: (i) up regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; (ii) down regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; or (iii) a combination of (i) and (ii), wherein said up regulation and down regulation is relative to a reference dedifferentiated plant cell line (DDC). By "reference transcriptome pattern" is meant a series of up regulated and/or down regulated transcription of selected genes identified as characteristic of a certain plant cell line, e.g., a cambial meristematic cells (CMC) cell line in comparison to transcription of corresponding genes in another plant cell or cell line, e.g., a DDC plant cell line. An exemplary "reference transcriptome pattern" is presented by the contigs listed in Table 10 for up-and down regulated genes in a T. cuspidata CMC cell line relative to a T. cuspidata DDC cell line. The nucleotide sequences of the contigs listed in Table 10 are presented elsewhere herein. In certain aspects of this method, the reference transcriptome pattern includes enhanced expression of particular classes of genes, e.g., stress and biotic defense response genes. In particular aspects, the reference homogeneous plant stem cell line is derived from cambium or procambium tissue, and the DDC plant cell line is derived from phloem, cortex and/or epidermal tissues. In particular embodiments, the test plant stem cell line is a cambial meristematic cell line (CMC) derived from cambium or procambium tissue.

[0010] In certain embodiments, characterization of a test plant cell line may involve, without limitation, isolation of the test plant stem cell line, validation of the test plant stem cell line, and/or generation of the test plant stem cell line.

[0011] In particular embodiments of the method described above, the stress and biotic defense response genes control Gene Ontology (GO) cellular functions selected from the group consisting of cell wall processes, protein metabolism, lipid metabolism, DNA metabolic processes, carbohydrate metabolic processes, response to stress, oxidation/reduction, transport, signal transduction, defense response, and a combination of two or more of said cellular functions. The term "Gene Ontology cellular functions" refers to categories of cellular functions with structured controlled vocabularies (ontologies) that describe gene products in terms of their associated biological processes, cellular components and molecular functions in a species-independent manner. See e.g., www.geneontology.org (last visited October 23, 2010).

[0012] In an exemplary embodiment of the above method, the reference homogenous plant stem cell line is characterized by up regulated transcription of one or more marker gene homologs or fragments thereof comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig27072, contig36802, contigl8649, contig33753, contigl6476, contig30863, contig04592, contigl2100, contig34959, contig07908, contig03652, contig07376, contig25130, contig02856, contig00912, contig09859, contig05416, contig04089, cont ig04097, contig 13706, contig02426, contig26011, contig08875, contig32752, cont ig22973, contig06930, contig25806, contig34590, contig23215, contig01413, cont ig21273, contig08488, contigl l520, contig 15994, contig23891, contig22565, cont ig06359, contig27519, contig 12256, contig35410, contig 14051, contig00617, cont ig36068, contig05291, contig34083, contig24918, contig01898, contig32989, cont igl3128, contig04152, contig30526, contig36027, contig25515, contig25115, cont ig 14790, contigl8732, contig02427, contig30421, contig26817, contig25250, cont ig04439, contig 16267, contig05040, contig 12255, contigl3372, contig34839, cont ig23084, contig00857, contig 11456, contig21219, contig21862, contig 14978, cont ig28943, contig 13724, contig26748, contig00718, contig01805, contig36075, cont ig29817, contig24743, contigl8810, contig05557, contigl3949, contig31211, cont ig27710, contig34607, contig09523, contig29684, contig 12698, contig20794, cont ig34615, contig30162, contig 18423, contig27918, contig 13665, contig00739, cont igl 1533, contig23048, contig24462, contig34586, contig21560, contig07958, cont ig03138, contig00738, contig07422, contigl8233, contig26946, contig07532, cont ig27474, contig 19027, contig05995, contig20249, contig35409, contig 17665, cont ig08101, contig02455, contig33166, contig05274, contig05310, contig26747, cont ig20416, contig00872, contig34059, contig24010, contig36449, contig09464, cont ig09299, contig23126, contig09881, contig05165, contig00027, contig34877, cont ig08970, contig03741, contig 14405, contigl5398, contig07669, contig25139, cont ig26273, contigl5034, contig00946, contig07109, contigl0106, contig06648, cont ig28245, contig 12239, contig07072, contig00115, contig31132, contig24645, cont ig06416, contigl5685, contig 17084, contig 16931, contig 10642, contig01072, cont ig26198, contig08428, contig20265, contigl3497, contig30742, contig03757, cont ig04703, contig08669, contig 11080, contig 10277, contig30801, contig33088, cont ig04997, contig34040, contig 12808, contig23659, contig03990, contig22241, cont igl8812, contig21293, contigl2482, contigl3687, contig06626, contig 10736, cont igl 6844, contig34589, contig35288, contig27145, contig24117, contig 10948, cont ig33616, contig 19286, contig03396, contig35423, contigl5918, contig 15623, cont ig00237, contig24745, contigl7057, contig03296, contig06707, contig 18332, cont ig03402, contig 17841, contig 10577, contig04386, contig22709, contig32799, cont igl7854, contig24270, contigl8201, contig09655, contig20801, contig05083, contig07531, contig07921, cont ig04473, contig04392, contig03316, contig00103, contig33905, contig 17735, cont igl4677, contig 16098, contig07690, contig28331, contig27541, contig02712, cont ig05143, contig08273, contig20804, contig06171, contig21572, contig06910, cont ig08569, contig04028, contig 11628, contig06116, contig06409, contigl3142, cont] igl6016, contig00459, contig 19226, contig05694, contig 15453, contig 15843, cont ig07218, contigl0959, contig09693, contig00805, contig 10665, contig33287, cont ig01 120, contig04567, contig05893, contig32410, contig 17311, contig 15714, cont ig01291, contigl511 1, contig 16536, contig22190, contig 10786, contig09809, cont igH631 , contig21287, contig01009, contig26412, contig 16668, contig09566, cont ig 16046, contig00039, contig06098, contig05655, contig 16947, contig 14389, cont igl3624, contig01547, contig03758, contig02817, contig 13673, contig 12644, cont ig08074, contig08296, contig29327, contig 14317, contig34517, contig27942, cont ig00556, contig 19260, contig03298, contig01782, contig07930, contigl0342, cont igl0721, contigl3080, contig07064, contig02893, contig32957, contigl 5387, the complement of any of these T. cuspidata contigs, and/or a combination of two or more of these T. cuspidata contigs or complements thereof. In related embodiments a reference homogenous plant stem cell line can be characterized by up regulated expression of proteins encoded by genes comprising these contigs, or fragments variants, or deriviatives thereof.

Similarly, in another exemplary embodiment of the above method, the reference homogenous plant stem cell line is characterized by down regulated transcription of one or more marker gene homologs or fragments thereof comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig34310, contigl741 1, contig08064, contig33838, contig22966, contig09529, contig01107, contig 19383, contig 12597, contig3241 1, contig34486, contig07578, contig01850, contig 19743, contig33960, contig02354, contigl2160, contig02705, contig21258, contig04524, contig06272, contig 19859, contig33172, contig 10947, contigl 8316, contig33880, contig 10004, contig02419, contig 16070, contig21375, contig 10847, contig00468, contig00002, contig33554, contig33997, contig23679, contig09322, contig06900, contig 10758, contig08205, contig 10699, contig09833, contig09931 , contig33959, contig02060, contig03887, contig 18382, contig05609, contig08869, contig05076, contig04684, contig06973, contig 12529, cont ig05287, contig09647, contig 13051, contig02424, cont ig34558, contig07776, cont ig23772, contig33898, contig 17982, contig09216, cont ig33532, contig 16700, cont Lgl l441, contig21147, contig 12890, contigl3202, cont ig03620, contig09300, cont igl l096, contig02556, contigl4130, contig03215, cont ig24326, contig 16464, cont igl 5519, contig08200, contig05323, contig02095, cont ig25516, contig07288, cont igl4554, contig36355, contig05532, contig06414, cont igl7824, contigl3582, cont igH451, contig 11642, contig06450, contig03544, cont ig23484, contig02223, cont ig21637, contig09410, contigl l 580, contig 10719, cont igl3397, contig32893, cont igl9387, contig 14914, contig20795, contig09388, cont ig02721 , contig32962, cont igl5296, contig05465, contig33042, contig 14636, cont ig 19438, contig 17863, cont ig 1 1094, contig03276, contig09056, contig09138, cont ig03597, contig05704, cont igl 8830, contig 16014, contig30246, contig34327, cont ig 19429, contig00701, cont ig33045, contig07474, contigl3819, contig01406, cont ig05528, contig09066, cont igl3935, contig01983, contig02362, contig24551, cont tg06834, contig 14849, cont ig01636, contig 10645, contigl6883, contig28511, cont igl4963, contig34143, cont ig07304, contig02383, contig 16551, contig03127, cont ig33455, contig 12015, cont igl7537, contigl61 12, contig22484, contig201 19, cont ig01276, contig23453, cont ig32318, contig 16504, contigl6185, contig05722, cont igl9556, contig25983, cont igl2014, contigl l683, contigl2198, contig34765, cont igl6556, contig 12353, cont ig04767, contig 1 1408, contig 19754, contig27189, cont Lgl0091 , contig24063, cont ig02767, contig 19337, contig06243, contig33472, cont ig03538, contig06062, cont ig08567, contig 16727, contig08095, contig06229, cont ig09609, contig 12716, cont) g21523, contig23414, contig07574, contigl5828, cont gl0974, contig20508, cont! g08071 , contig33050, contig 10613, contig00982, cont Lg36231 , contig20970, cont] g33961, contig 10305, contigl7594, contig07796, cont] ig00643, contig07564, cont] g06296, contig35356, contig20971, contig09723, cont g01181, contig01 124, conti gl5401, contig 1 1227, contig09952, contigl8745, cont ig05187, contig23461, conti g05785, contigl2739, contig35804, contig 16074, cont ig06222, contig02210, conti g35585, contig 17838, contig03513, contig00242, cont ig33761 , contig22119, conti g07194, contig02988, contig 12369, contig 19741, cont ig20583, contig07970, conti g22910, contig36415, contig 10027, contig 15960, cont ig04735, contig 1 1877, conti g35933, contig09340, contig26284, contigl501 1, contig32060, contig01847, contigl 831 1, contig36295, contig23275, contigl 8138, contig22625, contig36528, contig32627, contig20216, contigl0242, contigl4727, contigl3174, contigl3598, contigl9561, contig33990, contig01380, contig35561 , contigl5552, contigl4347, contigl9726, contig34643, contig36559, contig32396, the complement of any of these T. cuspidata contigs, and a combination of two or more of these T. cuspidata contigs or complements thereof. In related embodiments a reference homogenous plant stem cell line can be characterized by down regulated expression of proteins encoded by genes comprising these contigs, or fragments variants, or deriviatives thereof.

[0014] In particular non-limiting embodiments of the method described above, the reference homogenous plant stem cell line is characterized by up regulated transcription of a gene homolog or fragment thereof such as a PXY gene homolog comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 or a fragment thereof and/or a WOL gene homolog comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 10710, at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496, or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499, and/or a fragment thereof, or the complement thereof.

[0015] The present invention further provides marker gene homologs and/or a set of marker gene homologs, e.g., at least 5, 10, 20, 30, 50, 70, or 100 of the marker gene homologs, and/or fragments or variants thereof, such as those described above, as well as proteins encoded by such marker gene homologs and/or a set of such proteins, e.g., at least 5, 10, 20, 30, 50, 70, or 100 of such proteins or fragments, variants, or derivatives thereof, where the marker gene homologs and proteins are up regulated and/or down regulated in test plant stem cells and reference plant stem cells relative to reference DDC cells.

[0016] The method described above may be practiced with cells from any plant, including, but not limited to, test cells and/or reference cells derived from plants of the genera Panax, Taxus, Ginkgo, and Solanum, e.g., Panax ginseng, Taxus cuspidata, Ginkgo biloba, or Solanum lycopersicon. [0017] The present invention further provides a CMC plant stem cell line characterized by up regulated expression of one or more genes at least at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs as described above relative to expression in a reference DDC cell line. Further provided is a CMC plant stem cell line characterized by down regulated expression of one or more genes at least at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs as described above relative to expression in a reference DDC cell line. Also provided is a CMC plant stem cell line characterized with both up regulated and down regulated expression of various marker gene homologs. In specific embodiments a CMC plant stem cell line of the invention has increased expression of a PXY gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 or a fragment thereof; and/or increased expression of a WOL gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 10710 or a fragment thereof. Exemplary plant stem cell lines of the invention are isolated from plants of the genera Panax, Taxus, Ginkgo, and Solanum, e.g., Panax ginseng, Taxus cuspidata, Ginkgo biloba, or Solanum lycopersicon.

[0018] In certain embodiments, the present invention provides a CMC plant stem cell line, in particular a CMC plant stem cell line derived from a Panax plant, which produces a ginsenoside. Such CMC plant stem cell lines can be characterized by the up regulation of one or more, two or more, three or more, four or more, or five or more nucleic acids encoding key enzymes integral to the biosynthesis of ginsenosides. Exemplary but non- limiting ginsenodies produced by plant cells of the invention include ginsenoside F2 and/or gypenoside XVII. Certain embodiments provide a CMC plant cell line which produces at least about 100, 200, 300, 400, 500, 600, or 700 mg/kg fresh cell weight (FCW) of Ginsenoside F2 and/or at least about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 mg/kg FCW of gypenoside XVII. Also provided are methods of producing a ginsenoside such as but not limited to ginsenoside F2 and/or gypenoside XVII, comprising culturing a CMC plant cell line as described above, and recovering the ginsenoside. Specifics of such methods are described herein as well as elsewhere in the art or are well known to those of ordinary skill in the art. [0019] In certain embodiments, the present invention provides a CMC plant stem cell line, in particular a CMC plant stem cell line derived from a Taxus plant, which produces an abietane tricyclic diterpenoid derivative. Such CMC plant stem cell lines can be characterized by the up regulation of one or more, two or more, three or more, four or more, or five or more nucleic acids encoding key enzymes integral to the biosynthesis of abietane tricyclic diterpenoid derivatives. Exemplary but non-limiting abietane tricyclic diterpenoid derivatives produced by plant cells of the invention include Taxamairin A and/or Taxamairin C. Certain embodiments provide a CMC plant cell line which produces at least about 100, 200, 300, 400, or 500 mg/kg FCW of Taxamairin C and/or at least about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 mg/kg FCW of Taxamairin A. Also provided are methods of producing an abietane tricyclic diterpenoid derivative such as but not limited to Taxamairin A and/or Taxamairin C, comprising culturing a CMC plant cell line as described above, and recovering the abietane tricyclic diterpenoid derivative. Specifics of such methods are described herein as well as elsewhere in the art or are well known to those of ordinary skill in the art.

[0020] In particular embodiments, CMC plant cell lines of the invention are cultured in ways that promote secretion of the desired proteins products into the medium. An example of such a culturing technique is perfusion culture.

[0021] Further embodiments of the present invention provide a method for isolating a

CMC plant stem cell, comprising providing a tissue from a plant, e.g., a Taxus, Panax Ginkgo, or Solanum plant such as, but not limited to Panax ginseng, Taxus cuspidata, Ginkgo biloba, or Solanum ly coper sicon; isolating from the plant tissue a tissue containing cambium or procambium; culturing the cambium or procambium tissue; and selecting a CMC plant stem cell from the cultured tissue characterized by up regulation and/or down regulation of one or more marker gene homologs as described above, and elsewhere herein. In certain aspects of this embodiment, the cambium or procambium tissue is cultured in a medium comprising auxin, e.g., about 0.1-3 mg/L of auxin. In some embodiments of this method, the plant tissues are sterilized prior to culturing.

Brief DESCRIPTION OF DRAWINGS

[0022] The above and other features of the present invention will now be described in detail with reference to certain exemplary embodiments thereof illustrated the accompanying drawings which are given hereinbelow by way of illustration only, and thus are not limitative of the present invention, and wherein:

Figures 1A-1M show the isolation and culture of plant stem cells. T. cuspidata CMCs were isolated and cultured. Figure 1A is a schematic diagram of a cross-section depicting the location of cambium cells within a typical twig. Reproduced with permission from reference 12. Figure IB is a picture depicting the preparation of a T. cuspidata explant by peeling off cambium, phloem, cortex, and epidermal cells from the xylem. Given cell types are indicated by the following colored arrows: yellow, pith; white, xylem; green, cambium; red, phloem; blue, cortex; and, turquoise, epidermis. The scale bar corresponds to 0.5 mm. Figure 1C is an image depicting the natural split of CMCs from DDCs induced from phloem, cortex and epidermal cells. The top layer is comprised of CMCs while the bottom layer consists of DDCs. The scale bar corresponds to 1 mm. Figure ID is an image of CMCs proliferated from the cambium layer. The scale bar corresponds to 1 mm. Figure IE is an image of DDCs induced from the tissue containing phloem, cortex and epidermal cells. The scale bar corresponds to 1 mm. Figure IF is an image of DDCs induced from the cut edge of a needle explant. The scale bar corresponds to 0.5 mm. Figure 1G is an image of DDCs induced from the cut edge of an embryo explant. The scale bar corresponds to 0.5 mm. Figure 1H depicts micrographs of a CMC and three DDCs. CMCs are significantly smaller and possess characteristic numerous, small vacuole-like structures. The black arrow indicates a vacuole-like structure. The scale bars correspond to 20 μιη. Figure II is an image of CMC stained with neutral red, which marks the presence of vacuoles. Two of many stained vacuoles are denoted by black arrows. The scale bar corresponds to 10 μιη. Figure 1J is an image of a needle-derived DDC stained with neutral red. The single large vacuole present in this cell is marked by a black arrow. The scale bar corresponds to 10 μηι. Figure IK are images showing conditional differentiation of T. cuspidata CMCs to TEs, at the times indicated, following addition of differentiation media (t=0 days, left; t=30 days, right). The scale bar corresponds to 25 μη . Figure 1L is a graph showing differentiation of different T. cuspidata cell lines (i.e., needle-derived DDC (triangle), embryo-derived DDC (square), and CMC (circle)) over time into TEs. Figure 1M is a graph quantifying cell death in T. cuspidata cells (DDC (open) or CMC (filled)) following exposure to increasing levels of ionizing radiation. Figure IN is a graph showing levels of cell death in 71 cuspidata cells (DDC (open) or CMC (filled)) following exposure to the radiomimetic drug, zeocin. Experiments were repeated at least twice with similar results. Data points represent the mean of 3 samples ± S.D.

[0024] Figures 2A-2F show the characterization of plant stem cells. T. cuspidata transcriptome, digital gene expression tag profiling and growth and properties of CMCs was performed. Figure 2A is a scatter plot indicating differentially expressed genes (DEGs) (blue and red) in CMCs from non-DEGs (black). The deployment of further filtering approaches (see Methods) identified more robust DEGs (red) while other DEGs (blue) were filtered out. Figure 2B is a graph showing the analysis of contig 01805 and contig 10710 gene expression. Figure 2C is a graph showing relative percentage of gene ontology (GO) groups within CMC DEGs. Figure 2D is a graph showing growth of CMCs, needle-derived DDC, and embryo-derived DDCs on solid growth media from an initial 3 g few. 95 % confidence limits are too small to be visible on this scale. Figure IE is a bar graph reporting the extent of cell aggregation in needle-derived DDC, embryo- derived DDC, and CMC suspension cultures. Figure IF is a graph showing paclitaxel production by 3 month old DDCs (needle derived or embryo-derived) and CMCs 10 days post-elicitation, following batch culture in a flask format. Error bars represent 95 % confidence limits. These experiments were repeated three times with similar results.

[0025] Figures 3A-3L depict the growth and natural product biosynthesis of CMC suspensions. Figure 3A is a graph depicting growth rate of CMCs (closed square) and needle derived DDCs (open square) in a 10 L stirred tank bioreactor. Figure 3B is a graph depicting growth of given cell suspension cultures (CMC (circle), embryo-derived DDC (square), or needle derived DDC (triangle)) in a 3 L air-lift bioreactor format determined as dry cell weight (d.c.w.). At each passage, 14 days after inoculation, suspension cells were transferred to additional 3 L air-lift bioreactors as required. Figure 3C is a graph depicting growth of needle-derived DDC (triangle), embryo-derived DDC (square), and CMC (circle) suspension cultures in a 20 L air-lift bioreactor, determined as d.c.w. following a single passage. Figure 3D is a graph depicting total paclitaxel production following elicitation of the indicated 6-month old repeatedly subcultured cell suspensions, after batch culture in a 3 L air-lift bioreactor. Figure 3E is a graph depicting intracellular (open square) and extracellular (closed square) paclitaxel yield in the indicated batch cultured suspension cells in a 3 L air-lift bioreactor. Figure 3F is a graph depicting percentage of paclitaxel released into the production medium following batch culture of the given cell suspensions in a 3 L air-lift bioreactor. Figure 3G is a graph depicting intracellular (open square) or extracellular (closed square) synthesis of baccatin III and 10-deacetylbaccatin III in CMCs relative to needle derived DDCs. Figure 3H is a graph depicting magnitude of paclitaxel biosynthesis following elicitation of 28 month old CMCs in a 20 L air-lift bioreactor. Needle- and embryo-derived DDC suspensions did not routinely grow in this size of bioreactor. Figure 31 is a graph depicting intracellular and extracellular paclitaxel yield following 45 days of perfusion cultured needle and embryo derived DDCs and CMCs in a 3 L air-lift bioreactor. Figure 3J is a graph depicting percentage of paclitaxel released into the production medium following perfusion culture of the given cell suspensions as indicated in Figure 31. Figure 3K is a graph depicting synthesis of taxamairin A and C in CMCs and needle-derived DDCs following batch culture in a 3 L air-lift bioreactor. Figure 3L is a graph depicting synthesis of ginsenosides in P. ginseng CMC and pith-derived DDC suspension cells following batch culture in a 3 L air-lift bioreactor. The error bars represent 95 % confidence limits. These experiments were repeated twice with similar results.

[0026] Figures 4A-4C depict the isolation of cambium cell layer from xylem tissue.

Figure 4A is an image depicting preparation of T. cuspidata explant by peeling off cambium, phloem, cortex, and epidermal cells from the xylem. Given cell types are indicated by the following coloured arrow heads: yellow, pith; white, xylem; green, cambium; red, phloem; blue, cortex; and, turquoise, epidermis. Figure 4B is an image depicting a cross-section of xylem tissue from panel a, double-stained with safranine and hematoxylin. Figure 4C is an image depicting cross-section of cambium cell layers (green arrow bar) together with phloem tissue. Cells were double-stained with the widely employed general tissue stains safranine and hematoxylin. The scale bar is equivalent to 0.5 mm for panel A and 15μηι for panels B and C.

[0027] Figures 5A-5F depict the separation of cambium cells. Figure 5A is an image depicting a stem segment of T. cuspidata. Figure 5B is an image depicting separated xylem and pith tissue from stem segment in panel a, stained with lignin-specific dye phloroglucinol-HCl. Figure 5C is an image depicting tissue containing cambium, phloem, cortex, and epidermis from stem segment in panel a, stained with the lignin- specific dye, phloroglucinol-HCl. Note phloroglucinol-HCl did not stain this tissue. Figure 5D is an image depicting lignin-specific dye phloroglucinol-HCl stained xylem tissue (red) in T. cuspidata stem segment. White and yellow arrow heads indicate xylem and cambium cell layers, respectively. Figure 5E is an image depicting a cross-section from stem segment in panel d of xylem tissue. The lignin-specific dye, phloroglucinol- HCl, stained these cells red. Figure 5F is an image depicting a cross-section of cambium cell layer together with phloem tissue. Green and red arrow bars indicate cambium and phloem cell layers, respectively. Note phloroglucinol-HCl did not stain these cells. The scale bar is equivalent to 0.5 mm for Figures 5A-5D and 15 μηι for Figures 5E and 5F.

[0028] Figures 6A-6E depict the differential cell morphologies of CMCs compared to

DDCs. Figure 6A is an image depicting a natural split of CMCs from DDCs induced from phloem, cortex and epidermal cells. The top layer is comprised of CMCs while the bottom layer consists of DDCs. Figure 6B is an image depicting a cross-section of proliferating CMCs from the explant in Figure 6A. Figure 6C is a higher magnification image of red-dotted box in Figure 6B. Figure 6D is an image depicting a cross-section of proliferating DDCs from the explant in Figure 6A. Figure 6E is a higher magnification image of red-dotted box in Figure 6D. Cells were double-stained with the widely employed general tissue stains safranine and hematoxylin in b-e. Scale bar is equivalent to 1 mm for Figure 6 A and 30 μηι for Figures 6B-6E.

[0029] Figures 7A-7F show CMCs and DDCs generated from a variety of plant species.

Figure 7 A is an image depicting proliferating CMCs derived from ginseng (Panax ginseng) tap root. Figure 7B is an image depicting proliferating CMCs derived from ginkgo (Ginkgo biloba) stem. Figure 7C is an image depicting proliferating CMCs derived from tomato (Solanum lycopersicon ) stem. Figure 7D is an image depicting DDCs produced from P. ginseng tap root pith. Figure 7E is an image depicting DDCs produced from G. biloba stem. Figure 7F is an image depicting DDCs produced from S. lycopersicon stem. In Figures 7A-7C, CMCs are indicated by a red arrow head. The scale bar is equivalent to 1 mm for Figures 7A-7C and 2 mm for Figures 7D-7F.

[0030] Figures 8A and 8B are graphs of T. cuspidata transcriptome data showing read and contig length. Figure 8A is a histogram showing number of reads of given length. Figure 8B is a histogram showing number of contigs of given length.

[0031] Figure 9 is a scatter plot indicating differentially expressed genes (DEGs) between

T. cuspidata CMCs and DDCs derived from T. cuspidata needles. At a false discovery rate (FDR) of < = 0.05, this analysis identified 1,229 DEGS in the absence of additional filtering methods.

[0032] Figure 10 is a heat map of 563 DEGs identified following additional filtering.

Red indicates up regulated genes, and blue denotes down regulated genes for T. cuspidata CMC or T. cuspidata DDC samples shown in triplicate. Individual contig numbers are indicated on right of heat map.

[0033] Figure 11 depicts gene expression data for a subset of validated DEGs between T. cuspidata CMCs and DDCs. RT-PCR of the contigs is shown in the gel image above. The image data was quantified in the graph below. All primers were designed to produce ~ 200 bp products. Note that contig 07286 is a putative actin gene {Picea rubens). The error bars represent 90 % confidence limits.

[0034] Figures 12A and 12B depict amino acid sequence comparison between T. cuspidata contigs 01805 or 10710 and CMC marker genes. Figure 12A shows a sequence comparison of T. cuspidata contig 01805 and PXY. PXL denotes PXY-like. AGI code, PXY (At5G61480), PXL1 (AtlG08590), PXL2 (At4G28650). C-terminal sequences were aligned by the CLUSTAL method using the clusterW programme. Figure 12B shows a sequence comparison of T. cuspidata contig 10710 with Arabidopsis WOL (Arabidopsis thaliana; At2G01830) and WOL-like protein in silver birch (Betula pendula. GI:190148353). Red boxes show key conserved residues of signal receiver domains. Red line denotes receiver domain 1 and blue line receiver domain 2 (Mahonen et al. 2000).

[0035] Figure 13 depicts the growth of CMCs and DDCs on solid growth media.

Representative samples of CMCs and DDCs derived from needle and embryo grown on solid media, with subculturing every 14 days, for the times stated (t=0, 1, 22 mo.). The scale bar corresponds to 2 mm.

[0036] Figure 14 depicts reduced cell aggregation in CMCs. Micrographs showing extent of cell aggregation in the specified cell lines (Needle-DDC (left); Embryo-DDC (center); and CMC (right)). The scale bar corresponds to 75 μηι.

[0037] Figures 15A-15D depict the analysis of paclitaxel production by liquid chromatography mass spectrometry. Figures 15A and 15 B are chromatographs showing

LC analysis of paclitaxel standard (Figure 15A) and CMC sample (Figure 15B). In each case, an asterisk denotes the paclitaxel peak. Figures 15C and 15D are chromatographs showing MS analysis of paclitaxel standard (Figure 15C) and CMC sample (Figure 15D).

[0038] Figure 16 shows genes encoding enzymes of paclitaxel biosynthesis are induced in CMCs at 24 hours post elicitation. Contig 01720 encodes taxane 2-alpha-o- benzyltransferase. Contig 09814 encodes 3'-N-debenzoyltaxol N-benzoyltransferase. Contig 07968 encodes 3'-N-debenzoyltaxol-2' deoxytaxol N-benzoyltransferase. Contig 03409 encodes taxane 13-alpha-hydroxylase. Contig 04884 encodes 2-alpha- hydroxytaxane 2-O-benzoyltransferase.

[0039] Figures 17A-17C show the growth of CMCs and DDCs in a 10 L stirred tank bioreactor. Figure 17A is an image of DDCs after 14 days in culture, b, Figure 17A is an image depicting CMCs following 14 days of culture. In Figures 17A and 17B, agitation speed was 200 rpm to promote shear stress. Figure 17C is a graph depicting survival of CMCs relative to DDCs following 14 days of culture in a 10 L stirred tank bioreactor.

[0040] Figure 18 is a growth curve of T. cuspidata CMCs and selected needle and embryo derived DDCs in a 3 L air-lift bioreactor. During 1.8 years growth on solid media more vigorously growing needle and embryo derived DDCs were selected where apparent at each 14 day subculture. CMCs were grown in a similar fashion for 1.8 years without selection. The growth rate of the resulting cells was subsequently determined in a 3 L air-lift bioreactor.

[0041] Figure 19 depicts the growth stability of T. cuspidata CMCs. The growth stabilities of T. cuspidata CMCs or selected DDCs derived from needles were monitored over 1.8 years in a 20 L air-lift bioreactor with subculturing every 2 weeks.

[0042] Figures 20A and 20B depict growth of CMCs over time in a 3 ton bioreactor.

Figure 20 A is a graph showing the growth of CMCs over a 14 day culture period in a 3 ton bioreactor. Determined growth rate was 2.45-fold over this time interval. Figure 20B is an image of bioreactor utilized in this experiment.

[0043] Figure 21 is a chart of data showing up regulation of contigs in Taxus cuspidata cambial meristematic cells compared to dedifferentiated cells.

[0044] Figure 22 is a chart of data showing down regulation of contigs in Taxus cuspidata cambial meristematic cells compared to dedifferentiated cells. [0045] Figure 23 shows BLAST analysis of T. cuspidata contigs with p-values and gene descriptions. The contigs not shown in this figure have no homology to any known sequences under BLAST analysis as of October 22, 2010.

[0046] Figure 24 shows defense response and stress response genes having increased expression in plant stem cells. Filtered DE Genes (FDR<=0.05 AND all replicates consistently higher/lower AND min. TPM difference >= 10).

[0047] Figure 25 is is a Gene Ontology (GO) terms analysis result for CMCs vs DDCs.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

[0048] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following exemplary references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). The definitions provided in these references are not limiting, however. As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.

[0049] The contig numbers used herein correspond to the SEQ ID numbers in the

Sequence Listing. Therefore, Contig No. 00039 means the sequence listed in SEQ ID NO: 39. As such, the terms "Contig No." and "SEQ ID NO:" are interchangeable herein insofar as they refer to contigs of the invention.

[0050] An "isolated" cell or biological substance refers to a cell or substance that is not in its natural milieu. No particular level of purification is required. For example, a cell line that is removed from its native or natural environment can be considered as isolated. The isolated cell line can be grown in cell culture medium such as a flask or a bioreactor. Also, biological substances produced by isolated cells in cell culture are considered isolated for the purpose of the invention as they are produced in an environment different from nature. [0051] The term "purified" as used herein indicates that CMC cells or biological substances produced by the CMC cells (e.g., metabolites, e.g., ginsenosides or abietane tricyclic diterpenoid derivatives) have been removed from their natural environment. The term "purified" does not require absolute purity, but rather is intended as a relative term, unless otherwise indicated by the context. Thus, for example, CMC cells or their biological substances are at a higher concentration than the cells or biological substances that would be in their natural environment within a plant or a cell or at a higher concentration than in the environment from which they were removed. The purified cells or biological substances produced by the CMC cells can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% purified.

[0052] A "plant" means an organism belonging to the kingdom Plantae and includes, but is not limited to, trees, herbs, bushes, grasses, vines, ferns, mosses, or green algae. A "plant" means any parts of a plant, e.g., leaves, stem, twig, flower, root, wood, fruit, and etc. Plant cells are typically distinguished by their large water-filled central vacuole, chloroplasts, and rigid cell walls that are made up of cellulose, hemicellulose, and pectin. Totipotent meristematic cells can be differentiated into vascular storage, protective (e.g., epidermal layer), or reproductive tissues, with more primitive plants lacking some tissue types.

[0053] The term "meristem" as used herein means tissue in most plants consisting of innately undifferentiated cells (meristematic cells), found in zones of the plant where growth can take place. The meristematic cells give rise to various organs of the plant, and keep the plant growing. Apical meristems are the completely undifferentiated (indeterminate) meristems in a plant. The apical meristem, or growing tip, can be found in the buds and growing tips of roots in plants. Its main function is to begin growth of new cells in young seedlings at the tips of roots and shoots (forming buds, among other things). Specifically, an active apical meristem lays down a growing root or shoot behind itself, pushing itself forward. Apical meristems are very small, compared to the cylinder- shaped lateral meristems and contains cambium cells or procambium cells. Apical meristems include shoot apical meristem (SAM) or root apical meristem (RAM). The Shoot Apical Meristem (SAM) gives rise to organs like the leaves and flowers. Unlike the shoot apical meristem, the root apical meristem produces cells in two dimensions. It is covered by the root cap, which protects the apical meristem from the rocks, dirt and pathogens. The root apical meristem also includes cambium cells or procambium cells. Also included in the meaning of "meristem" is intercalary meristem. In angiosperms, intercalary meristems occur only in monocot (in particular, grass) stems at the base of nodes and leaf blades. Intercalary meristems are capable of cell division and allow for rapid growth and regrowth of many monocots. In addition, when plants begin the developmental process known as flowering, the shoot apical meristem is transformed into an inflorescence meristem, which goes on to produce the floral meristem, which produces the familiar sepals, petals, stamens, and carpels of the flower. In contrast to vegetative apical meristems and some exflorescence meristems, floral meristems are responsible for determinate growth, the limited growth of the flower to a particular size and form.

[0054] The term "cambium" as used herein means a type of tissue containing innately undifferentiated plant stem cells present in meristem with thin walls which minutely exist in small populations within a plant. Due to the structural characteristics, cambium cells can easily be damaged by physical force in the process of isolation, thus losing its stem cell characteristics. Cambium cells (also called cambium meristematic cells (CMC)) are innately undifferentiated plant stem cells, which can differentiated into another cell type (e.g., xylem or phloem) or renew itself to become totipotent cells. Cambium includes, but is not limited to, vascular cambium or cork cambium. As used herein, cambium or cambium cells (CMC cells) includes procambium or procambium cells.

[0055] The term "procambium" as used herein also refers to tissue containing innately undifferentiated plant stem cell. Procambium lies just inside the protoderm and develops into primary xylem and primary phloem. A procambium cell has the capacity for long- term self-renewal and is capable of differentiating into one or more specialized cell types.

[0056] A "callus" cell or dedifferentiated plant cell line ("DDC") as used herein is a somatic cell that has undergone dedifferentiation to give rise to a stem cell-like cell, which temporarily gains the ability to proliferate and/or regenerate an embryo. Callus cells or DDCs are obtained only as a temporary response to cure wound in somatic cell. Thus, callus cells or DDCs are not considered as innately undifferentiated plant stem cells. Unlike CMC cells, which are characterized as being homogeneous, callus cells or DDCs are genetically heterogeneous because a callus is often made from structural, differentiated tissue, not individual cells. As used herein the dedifferentiated cell line or DDCs are not a plant stem cell line (or cells). [0057] By "Phloem intercalated with xylem polypeptide" or "PXY polypeptide" is meant a polypeptide or fragment thereof comprising an amino acid sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to NCBI Accession No. NP 200956.1 (1041 amino acids length, SEQ ID NO: 36907). In one embodiment, the PXY polypeptide as used herein comprises an extracellular domain (amino acids 30-652), transmembrane domain (amino acids 653-673), or cytoplasmic domain (amino acids 674 - 1041) of NCBI Accession No. NP_200956.1. In another embodiment, the PXY polypeptide comprises one or more leucine-rich repeat (LRR) domains selected from the group consisting of LRR1 (amino acids 80 - 104), LRR2 (amino acids 105 - 128), LR 3 (amino acids 130 - 152), LRR4 (amino acids 154 - 176), LRR5 (amino acids 177 - 199), LRR6 (amino acids 200 - 224), LR 7 (amino acids 225 - 248), LR 8 (amino acids 250 - 272), LRR9 (amino acids 273 - 296), LRR10 (amino acids 297 - 319), LRR11 (amino acids 321 - 344), LRR12 (amino acids 345 - 368), LRR13 (amino acids 369 - 392), LRR14 (amino acids 394 - 416), LRR15 (amino acids 418 - 439), LRR16 (amino acids 440 - 464), LR 17 (amino acids 466 - 488), LR 18 (amino acids 511 - 535), LRR19 (amino acids 536 - 558), LRR20 (amino acids 559 - 583), LRR21 (amino acids 585 - 607), and any combinations thereof.

[0058] By "Phloem intercalated with xylem nucleic acid molecule" or "PXY nucleic acid molecule" is meant a polynucleotide encoding a PXY polypeptide. An exemplary PXY nucleic acid molecule sequence is provided at NCBI Accession No. NM_125541.1 (3126 nucleic acids length, SEQ ID NO: 36908).

[0059] By "Wooden Leg polypeptide" or "WOL polypeptide" is meant a polypeptide or fragment thereof having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid identity to NCBI Accession NP_565277.1 (isoform 2 having 1057 amino acids length). Isoform 1 of the WOL polypeptide has 1080 amino acids length (SEQ ID NO: 36909) with a signal peptide of 23 amino acids. In one embodiment, the WOL polypeptide has one or more domain selected from the group consisting of a cytoplasmic domain (amino acids 1-124 of isoform 1), a transmembrane domain (amino acids 125 to 145 of isoform 1), an extracellular domain (amino acids 146-429 of isoform 1), a cytoplasmic domain (amino acid 451-1080 of isoform 1), a chase domain (amino acids 198-41 1 of isoform 1), a histidine kinase domain (amino acid 479-760 of isoform 1), a response regulatory domain (amino acid 946-1071 of isoform 1) and a combination thereof.

[0060] By "Wooden Leg nucleic acid molecule" or "WOL nucleic acid molecule" is meant a polynucleotide encoding a WOL polypeptide. An exemplary WOL nucleic acid molecule is provided at NCBI Accession No. NM 126244.2 (3637 nucleic acids length, SEQ ID NO: 36910).

[0061] By "plant stem cell" or "undifferentiated plant cell" is meant cells that can undergo self-renewal as well as proliferation and differentiation. Functional features of plant stem cells are that they are innately undifferentiated; they can give rise to additional undifferentiated plant cells by self-renewal; and they can give rise to differentiated plant cells. Plant stem cells have an undifferentiated morphology, differentiate at high frequency, and are hypersensitive to γ-irradiation and radiomimetic drugs. In long term culture plant stem cells have stable and rapid cell growth and maintain high metabolite production. Examples of plant stem cells include undifferentiated cambial meristematic cells (CMCs), e.g., derived from Taxus cuspidata. Plant stem cells serve as the origin of plant vitality as they provide a steady supply of precursor cells to form differentiated tissues and organs in plant. Thus, plant stem cells have abilities both to create all differentiated cell types and to renew themselves such that the number of the stem cells is maintained in the plant. Plant stem cells are located in specialized structures called meristematic tissues, which are located in root apical meristem (RAM), shoot apical meristem (SAM), or vascular system (vascular meristem).

[0062] The term "homogeneous" as used herein refers to genetic, structural, or morphological uniformity of a group of cells or biological substances. Thus, homogeneous cells can have identical or nearly identical gene expression or stages of differentiation. The homogeneous cells, however, need not be 100% identical to each other. In one embodiment, homogeneous cells (or their gene expression or stages of differentiation) are at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 98%, 99%, or 100% identical to each other. In another embodiment, the term "homogeneous" means that the cells (or their gene expression or stages of differentiation) are more uniform than the corresponding callus cells (or their gene expression or stages of differentiation).

[0063] When the terms "one," "a," or "an' are used in this disclosure, they mean "at least one" or "one or more," unless otherwise indicated. For example, "a taxus stem cell" is understood to represent one or more taxus stem cells. As such, the terms "a" (or "an"),

"one or more," and "at least one" can be used interchangeably herein.

[0064] By "agent" is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.

[0065] By "alteration" is meant an increase or decrease. An alteration may be by as little as 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, or by 40%, 50%, 60%, or even by as much as

75%, 80%, 90%, or 100%.

[0066] By "biologic sample" is meant any tissue, cell, fluid, or other material derived from an organism (e.g., a plant).

[0067] As used herein, "antagonist' is meant to refer to a compound that inhibits a naturally occurring biological activity.

[0068] By "binds" is meant having a physicochemical affinity for that molecule. Binding may be measured by any of the methods of the invention.

[0069] "Detect" refers to identifying the presence, absence or amount of the object to be detected.

[0070] By "fragment" is meant a portion, e.g., of a polypeptide or nucleic acid molecule.

This portion contains, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%), or 99% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain at least 3, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids. A functional fragment of the polypeptide or nucleic acid molecule as used herein can retain one or more function or activity of the polypeptide or the nucleic acid molecule.

[0071] As used herein, "antagonist' is meant to refer to a compound that inhibits a naturally occurring plant biological activity.

[0072] The term "peptide" as used herein is meant to refer to a series of two or more covalently linked amino acids. A linear, cyclic, or branched peptide can be used in practicing the invention.

[0073] By "Marker profile" is meant a characterization of the expression or expression level of two or more polypeptides or polynucleotides.

[0074] As used herein, "obtaining" as in "obtaining an agent" includes synthesizing, purchasing, or otherwise acquiring the agent. [0075] By "reference" is meant a standard of comparison including a standard or control condition. For example, the PXY or WOL polypeptide or polynucleotide level present in a plant sample may be compared to the level of said polypeptide or polynucleotide present in a corresponding differentiated plant cell or tissue (e.g. derived from phloem, cortex and epidermis).

[0076] Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule.

[0077] By "hybridize" is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507). For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, less than about 500 mM NaCl and 50 mM trisodium citrate, and less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, at least about 37° C, or at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In one embodiment, hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In another embodiment, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In some embodiments, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.

[0078] For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

[0079] By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). For example, such a sequence is at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.

[0080] Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e-3 and e-100 indicating a closely related sequence.

[0081] Unless specifically stated or obvious from context, as used herein, the term

"about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.

[0082] In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean "includes," "including," and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

[0083] The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

[0084] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

[0085] The invention features compositions and methods that are useful for isolating and culturing plant stem cells (e.g., undifferentiated cambial meristematic cells), as well as for their use in metabolite production. Undifferentiated cells were identified and isolated from plant cambium. Innately undifferentiated cell lines derived from cambium cells were developed and observed to function as vascular stem cells. The present invention is based, at least in part, on the discovery that PXY and WOL markers are expressed by plant stem cells. Plant stem cells exhibited a plant stem cell transcriptional signature. This discrete population of plant stem cells possessed an undifferentiated morphology, the ability to differentiate at high frequency, and hypersensitivity to γ-irradiation and radiomimetic drugs. The undifferentiated cell lines provide advantages over dedifferentiated cell lines used in in vitro plant cell cultures. Advantageously, paclitaxel biosynthesis in T. cuspidata localizes to cambial meristematic cells (CMCs)¹⁰, which can be isolated according to the methods of the invention for the production of paclitaxel in in vitro plant cell cultures. As reported in more detail below, CMCs derived from Taxus cuspidata, a plant source of the anticancer drug paclitaxel, circumvented obstacles routinely associated with the commercial growth of DDCs. Cultures of plant CMCs provide a cost-effective and environmentally friendly platform for sustainable production of a variety of important plant natural products.

[0086] Plant stem cells, embedded in meristems, located at the tips of shoots and roots or contained inside the vascular system can divide and give rise to cells that ultimately undergo differentiation while simultaneously giving rise to new stem cells. Further, these cells are immortal due to their ability to theoretically divide an unlimited number of times.

Methods of Characterizing or Identifying Taxus Plant Stem Cells

[0087] The present invention is directed to a method of characterizing a plant stem cell line by measuring differential gene expression of transcriptome pattern by the plant stem cell relative to the transcriptome pattern of the reference plant stem cell line, e.g., a CMC cell line. The present method can be used to identify a plant stem cell by comparing gene expression of a stem cell line with the gene expression of a known CMC cell line. The present method can also be used to distinguish a homogeneous plant stem cell line from a dedifferentiated cell line or a non-homogeneous plant cell line. In addition, the method of the invention can be used to distinguish a more homogeneous plant stem cell line from a less homogeneous plant stem cell line. The present invention can also be used to maintain stability or consistency of a plant stem cell culture by monitoring gene expression of the plant stem cells grown in cell culture, for example, in long term cell culture. The gene expression can be monitored over long term culture by periodically comparing the gene expression of a plant stem cell line to the gene expression of the reference plant stem cell line or the gene expression of its earlier stages.

[0088] For the purpose of the present invention, a transcriptome of a plant cell can be the total set of transcripts or specific subset of transcripts. Because a transcriptome includes all mRNA transcripts in the cell, a transcriptome reflects the genes that are being actively expressed at any given time or at any given environmental condition. Thus, studying transcriptomes (i.e., transcriptomics or expression profiling) allows examination of the mRNA expression level in a given cell population (or in a given condition), often using high-throughput techniques based on DNA microassay technology or RNA-Seq. Therefore, a transcriptome study can be used in characterizing a test cell line, for example, whether the cell line is a stem cell, a differentiated cell, or a dedifferentiated cell.

[0089] In one embodiment, the method of characterizing a cell line comprises (a) identifying levels of transcription of specific genes in the cell line; and (b) comparing the transcription levels to a reference transcriptome pattern of a reference homogenous Taxus plant stem cell line, the reference transcriptome pattern comprising: (i) up regulated transcription of one or more transcription contigs identified from the reference transcriptome pattern; (ii) down regulated transcription of one or more transcription contigs identified from the reference transcriptome pattern; or (iii) a combination of (i) and (ii), wherein the up regulation and down regulation can be relative to a reference dedifferentiated plant cell line (DDC). In another embodiment, the cell line being characterized is a plant stem cell line.

[0090] In other embodiments, the method of characterizing a cell line comprises (a) identifying levels of transcription of specific genes in a test cell line; and (b) comparing the transcription levels to a reference transcriptome pattern of a reference homogenous plant stem cell line, the reference transcriptome pattern comprising: (i) up regulated transcription of one or more transcription contigs identified from the reference transcriptome pattern; (ii) down regulated transcription of one or more transcription contigs identified from the reference transcriptome pattern; or (iii) a combination of (i) and (ii), wherein the up regulation and down regulation can be relative to a reference less- homogeneous plant cell line or a reference non-homogeneous plant cell line. [0091] In some embodiments, the method of the invention includes maintaining stability or consistency of a plant stem cell culture. The method comprises (a) identifying levels of transcription of specific genes in a test plant stem cell line before and after cell culturing; and (b) comparing the transcription levels of the test plant stem cell line before and after the cell culturing, wherein the transcriptome pattern of the test stem cell line after the cell culturing is maintained to the comparable level of the transcriptome pattern of the test stem cell line before the cell culturing, wherein the transcriptome pattern of the test stem cell line before the cell culturing comprises (i) up regulated transcription of one or more transcription contigs; (ii) down regulated transcription of one or more transcription contigs; or (iii) a combination of (i) and (ii), and wherein the up regulation and down regulation can be relative to a reference dedifferentiated plant cell line (DDC). The comparable level of the transcriptome pattern of the test stem cell line after the cell culturing can be at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 70%, or 60% of the transcriptome pattern of the test stem cell line before the cell culturing. In other embodiments, the method further comprises selecting a plant stem cell line after a cell culturing process. The cell lines exhibiting transcriptome patterns after a cell culturing process that are comparable to the transcriptome patterns of the cell line before the cell culturing or the patterns of the reference CMC cell line can be selected. Those cell lines that have undergone changes in expressing transcriptome patterns can be discarded.

[0092] The specific genes of which expression levels are identified in the present method can be all genes in a plant stem cell, a selected number of genes, or just one gene. The genes used in the methods can be any genes including, but not limited to, mRNA, rRNA, tRNA, or any non-coding RNA.

[0093] One example of studying gene expression levels of a plant cell is gene expression profiling, e.g., DNA microarray, which measures the relative activity of previously identified target genes. For example, a DNA microarray can be constructed by immobilizing cDNA derived from the mRNA of any combination of up regulated or down regulated genes from a reference homogeneous stem cell line (e.g., cDNA derived from the contigs listed in Figures 21 and 22). In order to characterize a test cell line, cDNAs from a test cell line can be hybridized with the chip. The resulting data (e.g., fluorescence) shows expression patterns of various genes in the test cell line. [0094] Sequence based techniques, like serial analysis of gene expression (SAGE) can also be used for gene expression profiling. SAGE can be used by producing a snapshot of the mRNA population in a sample of interest in the form of small tags that correspond to the fragments of those transcripts. See Valculescu et al, Science 270: 484-487 (1995). Variants of SAGE are are also available: LongSAGE (Saha et al, Nat. Biotechnol. 20(5): 508-512 (2002)), RL-SAGE (Gowda et al, Plant Physiol 134(3): 890-907 (2004)), and SuperSAGE (Matsumura et al, Cell Microbiol. 7(1): 1 1-18 (2005)). SuperSAGE is accurate and can measure any active gene, not just a predefined set.

[0095] The methods of the present invention can also identify one or more marker genes of a plant stem cell, e.g., CMC, or homologs or fragments thereof. Those marker genes or homologs or fragments thereof can be up regulated or down regulated in a plant stem cell, e.g., CMC, compared to a reference plant cell line, e.g., DDC. Thus, those up regulated or down regulated marker genes can be used to characterize a new test cell line by comparing the gene expression of the test cell line to the up regulated and/or dowregulated gene expression pattern of the reference plant stem cell line. In one embodiment, the reference plant stem cell line is characterized by up regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of the contigs listed in Figure 21, Figure 24, Table 1A, Table IB, Table 2 A, or any combinations thereof, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof. In another embodiment, the reference plant stem cell line is characterized by down regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%), 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of the contigs listed in Figure 22 and Table 2B, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof.

[0096] Cellular functions and responses to environmental stimuli are regulated by the activity and interaction of complex molecular networks. In particular, stem cells exhibit a low threshold for auto-execution through apoptosis but express robust defense against environmental stress. Rando, T.A. Cell 129: 1239-1243 (2007). Thus, in stem cells, stress and/or biotic defense response genes are prominently overexpressed. For example, characterization of a test cell line can be achieved by comparing expression (e.g., transcriptome pattern) of the stress and/or biotic defense genes of a test cell line with the expression (e.g., reference transcriptome pattern) of the stress and/or biotic defense genes in a reference stem cell line. Therefore, in one embodiment, the reference transcriptome pattern comprises enhanced expression of stress or biotic defense response genes or both. For example, stress defense response genes can be selected from the group consisting of any one or more sequences in Table 1A. Biotic defense response genes can be selected from the group consisting of any one or more sequences in Table IB.

Table 1 A. Defense Response Genes

Contig Number SEQ ID Number

Contig00039 SEQ ID NO: 00039

Contig04089 SEQ ID NO: 04089

Contig04097 SEQ ID NO: 04097

Contig04997 SEQ ID NO: 04997

Contig08074 SEQ ID NO: 08074

Contig21293 SEQ ID NO: 21293

Contig22973 SEQ ID NO: 22973

Contig26817 SEQ ID NO: 26817

Contig27710 SEQ ID NO: 27710

Contig28331 SEQ ID NO: 28331

Table IB. Stress Response Genes

Contig Number SEQ ID Number

Contig00946 SEQ ID NO: 00946

Contig02455 SEQ ID NO: 02455

Contig06930 SEQ ID NO: 06930

Contig08428 SEQ ID NO: 08428

Contig09809 SEQ ID NO: 09809

Contig 10786 SEQ ID NO: 10786

Contigl2808 SEQ ID NO: 12808 Contig 19226 SEQ ID NO: 19226

Contig24743 SEQ ID NO: 24743

Contig24918 SEQ ID NO: 24918

In another embodiment, the reference plant stem cell line can be characterized by up regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig00039, contig04089, contig04097, contig04997, contig08074, contig21293, contig22973, contig26817, contig27710, contig28331, contig00946, contig02455, contig06930, contig08428, contig09809, contigl0786, contig 12808, contigl9226, contig24743, and contig24918, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof.

Table 2 A. Up regulated Genes With No Known Homology

contig27072, contig32989, contig24462, contig20265,

contig33753, contig30526, contig34586, contig 13497,

contigl2100, contig36027, contig07958, contig30742,

contig07908, contig25115, contig03138, contig33088,

contig02856, contig 14790, contig00738, contig22241,

contig00912, contig 18732, contig27474, contig 16844,

contig05416, contig02427, contig35409, contig35288,

contig 13706, contig25250, contigl7665, contig27145,

contig02426, contig05040, contig33166, contig241 17,

contig26011, contigl2255, contig05274, contig 19286,

contig08875, contig23084, contig05310, contig35423,

contig32752, contig00857, contig00872, contig03296,

contig34590, contig21862, contig24010, contig24270,

contig01413, contig28943, contig36449, contig09655,

contig08488, contig 13724, contig09881, contig04392,

contig23891 , contig36075, contig34877, contig33905,

contig22565, contig3121 1, contig25139, contig 17735,

contig06359, contig34607, contig06648, contig 16098,

contig27519, contig09523, contig 12239, contig02712, contig 12256, contig29684, contig001 15, contig08273,

contig 14051, contig20794, contig24645, contig06910,

contig00617, contig30162, contig06416, contig33287,

contig36068, contig27918, contig 17084, contig04567,

contig34083 contig00739, contig 10642, contig26412,

contig 16046,

Table 2B. Down regulated Genes With No Known Homology

contig08064, contigl7863, contig20970, contig 18311,

contig07578, contig00701, contigl7594, contig36295,

contig33960, contig2851 1, contig 11227, contigl8138,

contig 10758, contig 14963, contig35804, contig22625,

contig09647, contig22484, contig06222, contig36528,

contig33532, contigl9556, contig35585, contig 14727,

contig 16700, contig25983, contig07194, contigl3598,

contig03620, contigl6556, contig20583, contig 19561,

contig06414, contig27189, contig36415, contig33990,

contig 19387, contig 10091, contig26284, contig36559,

contig02721, contig24063, contigl501 1, contig32396,

contig 15296, contig 10613, contig32060, In other embodiments, the reference plant stem cell line can be characterized by up regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig27072, contig33753, contigl2100, contig07908, contig02856, contig00912, contig05416, contigl3706, contig02426, contig26011, contig08875, contig32752, contig34590, contig01413, contig08488, contig23891, contig22565, contig06359, contig27519, contigl2256, contigl4051, contig00617, contig36068, contig34083, contig32989, contig30526, contig36027, contig25115, contigl4790, contigl 8732, contig02427, contig25250, contig05040, contigl2255, contig23084, contig00857, contig21862, contig28943, contigl3724, contig36075, contig3121 1, contig34607, contig09523, contig29684, contig20794, contig30162, contig27918, contig00739, contig24462, contig34586, contig07958, contig03138, contig00738, contig27474, contig35409, contig 17665, contig33166, contig05274, contig05310, contig00872, contig24010, contig36449, contig09881, contig34877, contig25139, contig06648, contig 12239, contig001 15, contig24645, contig06416, contig 17084, contig 10642, contig20265, contig 13497, contig30742, contig33088, contig22241, contig 16844, contig35288, contig27145, contig241 17, contig 19286, contig35423, contig03296, contig24270, contig09655, contig04392, contig33905, contig 17735, contig 16098, contig02712, contig08273, contig06910, contig33287, contig04567, contig26412, contig 16046, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof.

[0099] In some embodiments, the reference plant stem cell line can be characterized by down regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig08064, contig07578, contig33960, contig 10758, contig09647, contig33532, contig 16700, contig03620, contig06414, contig 19387, contig02721, contig 15296, contig 17863, contig00701, contig2851 1 , contig 14963, contig22484, contigl9556, contig25983, contigl6556, contig27189, contig 10091, contig24063, contigl0613, contig20970, contig 17594, contig 1 1227, contig35804, contig06222, contig35585, contig07194, contig20583, contig36415, contig26284, contigl 501 1, contig32060, contig 1831 1, contig36295, contigl8138, contig22625, contig36528, contig 14727, contigl3598, contigl9561, contig33990, contig36559, contig32396, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof.

[0100] In other embodiments, the stress or biotic defense response genes or both can control Gene Ontology (GO) cellular functions selected from the group consisting of cell wall processes, protein metabolism, lipid metabolism, DNA metabolic processes, carbohydrate metabolic processes, response to stress, oxidation/reduction, transport, signal transduction, defense response, and a combination of two or more of the cellular functions. [0101] In certain embodiments, the reference plant stem cell line can be characterized by up regulated transcription of a gene homolog or fragment thereof. The up regulated gene can be selected from the group consisting of (a) a PXY gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 (SEQ ID NO: 01805) or a fragment thereof; (b) a WOL gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 10710 (SEQ ID NO: 10710), at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496 (SEQ ID NO: 07496), or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499 (SEQ ID NO: 25499), or a fragment thereof; (c) the complement of (a) or (b); and (d) a combination of two or more of (a), (b), and (c).

[0102] Characterizing a plant stem cell in the present invention can be combined with any other types of characterization such as phenotypic or morphological characteristics. In one embodiment, the method of characterizing or identifying a plant cell further comprises selecting a cell line that is homogeneous or that has numerous vacuoles. In another embodiment, the method of characterizing a plant stem cell further comprises selecting a single cell during suspension culture having low sensitivity to shear stress in a bioreactor compared to reference cells, e.g., DDC, and/or having high growth rate while being stably cultured in media.

[0103] The present invention is further directed to a method of isolating a CMC plant stem cell line. In one embodiment, the method comprises (1) providing a tissue from a plant, (2) isolating from the plant tissue a tissue containing cambium or procambium, (3) culturing said cambium or procambium tissue; and, (4) selecting a CMC plant stem cell from the cultured tissue characterized by up regulation of one or more marker gene homologs listed in Figure 21, Figure 24, Table 1A, Table IB, Table 2A, or any combinations thereof, and/or down regulation of one or more marker gene homologs listed in Figure 22 and Table 2B. In order to select a CMC plant stem cell, the cambium or procambium tissue at step (3) can be cultured in a culture medium comprising a plant hormone. Plant hormones (phytohormones) that can be useful to grow the procambium tissue include, but are not limited to abscisic acid (ABA), auxins, cytokinins, ethylene, gibberellins, brassinosteroids, sialicylic acids, jasmonates, plant peptide hormones, polyamines, nitric oxide (NO), strigolactones, and karrikins. In one embodiment, the plant hormone is naturally occurring auxin or synthetic auxin selected from the group consisting of indole-3 -acetic acid (IAA), 4-chloroindole-3 -acetic acid (4-CI-IAA), 2- phenylacetic acid (PAA), Indole-3 -butyric acid (IB A), 1 -naphthaleneacetic acid (NAA), 2,4-dichlorophenoxyacetic acid (2,4-D), 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), a- Naphthalene acetic acid (a-NAA), 2-methoxy-3,6-dichlorobenzoic acid (dicamba), 4- Amino-3,5,6-trichloropicolinic acid (tordon or picloram), and 2,4,5- Trichlorophenoxyacetic acid (2,4,5-T). In other embodiments, the plant hormone is gibberellic acid (GA3) or Kinetin. The concentration of the plant hormone useful for growth of the CMC cells can be titrated using methods known to those of skill in the art and, for example, can be O.OOOlmg/L to lOOOmg/L, (e.g., 0.5mg/L - lOOmg/L, 0.5mg/L - lOmg/L, lmg/L-5mg/L, lmg/L-3mg/L, lmg/L, 1.5mg/L, 2mg/L, 2.5mg/L, 3mg/L, 3.5mg/L, 4mg/L, 5mg/L, 6mg/L, 7mg/L, 8mg/L, 9mg/L, or lOmg/L).

[0104] In order to grow the selected CMC cells or produce the biological substances from the cells, the CMC cells can be grown in any culture conditions suitable for its optimal growth, e.g., batch culture, continuous culture, fed-batch, or perfusion culture.

Marker Genes or Protein Homoloss

[0105] The present invention is also directed to one or more marker gene homologs for identifying a CMC of a plant. The phrase "marker gene homolog" as used herein indicates a subset of genes in different plant species that are similar to each other because they originated by vertical descent from a single gene of the last common ancestor. Gene homologs can share similar sequence identity to each other. In some cases, as used herein, homologs may not share sequence identity, but have similar function. Homologous gene sequences can be identified by specialized biological databases, e.g., GenBank.

[0106] In one embodiment, a marker gene homolog for identifying a CMC comprises a sequence at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a T. cuspidata contig, the complement of any of the T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof, wherein the contig or contigs are individually up regulated or down regulated in CMCs compared to the corresponding contig or contigs of a reference plant cell, e.g., a dedifferentiated cell (e.g., DDC). The up regulated contig or contigs can be selected from the group consisting of the contigs listed in Figure 21, Figure 24, Table 1A, Table IB, Table 2A, or any combinations thereof, and the down regulated contig or contigs can be selected from the group consisting of the contigs listed in Figure 22 and Table 2B.

[0107] In another embodiment, the marker gene homolog comprises a sequence at least

50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more of stress genes or biotic defense response genes identified in Tables 1 A and IB.

[0108] In certain embodiments, the present invention is directed to a set of marker gene homologs comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more of the marker gene homologs described herein.

[0109] The invention also includes one or more marker peptides or proteins for identifying CMC, encoded by one or more of the marker gene homologs described herein. A marker peptide or protein can comprise one or more amino acid sequences encoded by up regulated or down regulated genes of a CMC. For example, a marker peptide or protein can be encoded by a nucleotide sequence at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more T. cuspidata contigs shown in Figure 21, Figure 22, Figure 24, Table 1A, Table IB, Table 2 A, Table 2B, and/or any combinations thereof, the complement of any of the T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof, wherein the contig or contigs are individually up regulated or down regulated in CMCs compared to the corresponding contig or contigs of a reference plant cell, e.g., a dedifferentiated cell (e.g., DDC). The up regulated contig or contigs can be selected from the group consisting of the contigs listed in Figure 21, Figure 24, Table 1A, Table IB, Table 2A, or any combinations thereof, and the down regulated contig or contigs can be selected from the group consisting of the contigs listed in Figure 22 and Table 2B. In further embodiments, the invention includes a set of marker proteins comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more of the marker proteins. The marker peptide or protein can also comprise (a) a PXY protein homolog encoded by an at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identical nucleotide sequence to T. cuspidata contig 01805 (SEQ ID NO: 01805), fragment thereof or homolog thereof, (b) a WOL protein homolog encoded by an at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical nucleotide sequence to T. cuspidata contig 10710 (SEQ ID NO: 10710), at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496 (SEQ ID NO: 07496), or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499 (SEQ ID NO: 25499), or a fragment thereof; or (c) a combination of (a) and (b).

Cambium Meristematic Cells (CMC)

[0110] The present invention also includes a cell line that is characterized or identified by the present methods. The invention also includes a lysate of the cell line, a culture of the cell line, a composition comprising the cell line, or a bioreactor containing the cell line.

[0111] Since the beginnings of tissue culture in the 1940's cell suspension cultures have been routinely generated through what was believed to be a dedifferentiation process. Nevertheless, this process results in mitotic reactivation of specialized cell types within a given organ, generating a multicellular mixture of proliferating cells. Suspension cultures derived from such cellular assortments often exhibit poor growth properties with low and inconsistent yields of natural products, due to deleterious genetic and epigenetic changes that occur during this process.

[0112] In contrast to dedifferentiated plant cells, plant stem cells as described herein are undifferentiated and can undergo self-renewal as well as proliferation and differentiation. Plant stem cells have an undifferentiated morphology, differentiate at high frequency, and are hypersensitive to γ-irradiation and radiomimetic drugs. In long term culture plant stem cells have stable and rapid cell growth and maintain high metabolite production.

[0113] "A cell line containing a higher number of mitochondria" as used herein means that the cell line has a higher number—at least twice— of mitochondria than a DDC. The CMC cell line also has a characteristic of having more active mitochondria than a DDC's mitochondria. The term "more active mitochondria" indicates mitochondria that moves around more actively under microscope than a DDC mitochondria. In addition, the CMC cell line has a characteristic of being a pluripotent stem cell and thus differentiating to a tracheary element. The CMC cell line can also be more sensitive to a radiation or radiomimetic drug than a DDC cell line.

[0114] In one embodiment, the invention is directed to a CMC plant stem cell line characterized by up regulated expression of one or more genes at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs, which comprises a sequence selected from the group consisting of the contigs listed in Figure 21 , Figure 24, Table 1A, Table IB, Table 2A, or any combinations thereof or by down regulated expression of one or more genes at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs, which comprises a sequence selected from the group consisting of the contigs listed in Figure 22 or Table 2B, relative to expression in a reference cell line, e.g., DDC. For example, the marker gene homologs can comprise one or more sequence selected from the group consisting of one or more of the contigs listed in Tables 1 A and IB i.e., stress and/or biotic defense response genes.

[0115] In addition, it has been discovered that PXY and WOL are plant stem cell markers. Thus, in one embodiment, a CMC plant stem cell line of the invention has increased expression of a PXY gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 or a fragment thereof; and/or a WOL gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 10710 (SEQ ID NO: 10710), at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496 (SEQ ID NO: 07496), or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499 (SEQ ID NO: 25499) or a fragment thereof. A CMC plant stem cell line can be derived from Taxus (e.g., Taxus cuspidata).

[0116] In one embodiment, a Taxus CMC plant stem cell line can show upregulated expression of a PXY gene at least two times, three times, four times, five times, six times, seven times, eight times, nine times, ten times, 1 1 times, 12 times, 13 times, 14 times, or 15 times compared to a reference cell line, e.g., a Taxus DDC plant cell line. In another embodiment, a Taxus CMC plant stem cell line can show upregulated expression of a WOL gene at least two times, three times, four times, five times, six times, seven times, eight times, nine times, ten times, 1 1 times, 12 times, 13 times, 14 times, or 15 times compared to a reference cell line, e.g., a Taxus DDC plant cell line.

[0117] In certain embodiments, the present invention is directed to one or more biomarkers comprising one or more marker gene homologs, each of which comprising a sequence selected from the group consisting of the contigs listed in Figure 21 , Figure 22, Figure 24, Table 1A, Table IB, Table 2 A, Table 2B, and any combinations thereof, or one or more marker gene homologs selected from the group consisting of a PXY gene and a WOL gene, and any combinations thereof.

[0118] In some embodiments, CMC cells of the invention can express one or more up regulated or down regulated genes selected from the groups consisting of PXY (phloem intercalated with xylem) and WOL (Wooden Leg) and any combination thereof, compared to a reference cell line, e.g., a DDC plant stem cell line. For example, PXY can be up regulated about 4-14-fold, e.g., 9-fold, higher than in DDC cells. WOL gene can be up regulated about 7-17-fold, e.g., 12-fold, higher than in DDC cells.

[0119] A CMC plant cell line of the present invention can also express higher levels of a marker peptide or protein homolog described herein than a dedifferentiated cell line. For example, a CMC plant cell line of the invention can express a higher level of the marker peptide or protein encoded by one or more stress or biotic defense genes than a dedifferentiated cell line, DDC. A non-limiting example of the marker peptide or protein is a PXY protein, fragment, or analogue thereof or a WOL protein, fragment, or analogue thereof. In other aspects, CMC stem cells of the invention can differentiate to tracheary elements (TE).

[0120] A CMC plant cell line of the invention can be in vitro cultured in media. In one embodiment, the present invention is directed to a composition comprising a CMC cell line, cell line extracts, or culture media thereof. The composition comprising the cell line, extracts, lysates, or culture media can be used, for example, for botanical or herbal health products such as a medicine, a dietary supplement, a drink, a cream, or a lotion.

[0121] In another embodiment, a CMC plant cell line of the invention can be used to produce one or more biological substances, e.g., metabolites. In other embodiments, a CMC plant cell line as disclosed herein shows up regulated level of one or more, two or more, three or more, four or more, or five or more nucleic acids encoding key enzymes integral to the biosynthesis of taxoids, taxanes, taxamairin, cephalomannine, 1 β- dehydroxybaccatin VI, taxinine N-1 1, baccatin I, 2a-acetoxytaxusin, abietane, taxamairin C, paclitaxel, 7-epi-taxol, taxol C, baccatin III, 10-deacetylbaccatin III, taxamairin A, baccatin VI, taxayuntin C, taxuyunnanine C, yunnanxane, taxamairin A, an analogue thereof, or any combinations thereof. For example, a CMC plant cell line can show up regulation in one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, twelve or more, fourteen or more, or sixteen or more nucleic acids encoding key enzymes integral to the biosynthesis of abietane tricyclic diterpenoid derivatives. The abietane tricyclic diterpenoid derivative can be selected from the group consisting of Taxamairin A, Taxamairin C, and both. In some embodiments, a CMC plant cell line of the invention can produce at least about 50, 100, 200, 300, 400, or 500 mg/kg FCW of taxamairin C and/or at least about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 mg/kg FCW of taxamairin A. In certain embodiments, the key enzymes overexpressed in CMC cells can be encoded by a sequence selected from the group consisting of contig 01720 (TBT, taxane 2-alpha-o-benzyltransferase), contig 09814 (stereo selective coupling of DBTNBT, 3'-N-debenzoyltaxol N-benzoyltransferase), contig 07968 (DBTNBT, 3'-N- debenzoyltaxol-2' deoxytaxol N-benzoyltransferase), contig 03409 (P450s acetyltransferase, Taxane 13-alpha-hydroxylase), contig 04884 (DBBT, 2-alpha- hydroxytaxane 2-O-benzyltransferase, P450s acetyltransferase), and any combination thereof. Yield of one or more of the key enzymes can be increased by the presence of an elicitor. Examples of taxus plant cells species that can produce the substances include, but are not limited to, Taxus baccata (European Yew), Taxus brevifolia (Pacific Yew, Western Yew), Taxus canadensis (Canadian Yew), Taxus chinensis (Chinese Yew), Taxus cuspidata (Japanese Yew), Taxus floridana (Florida Yew), Taxus globosa (Mexican Yew), Taxus sumatrana (Sumatran Yew), and Taxus wallichiana (Himalayan Yew).

In addition, the present invention is directed to methods of controlling the quality of biological substance production. In one embodiment, in order to control the quality of a biological substances, a CMC cell line can be selected based on its up regulated level of one or more nucleic acids encoding key enzymes integral to the biosynthesis of biological substances relative to a reference cell line, e.g., a DDC cell line, and cultured for the production of the biological substances in cell culture; thus such a CMC cell line produces a higher amount of the biological substances than, e.g., a corresponding DDC cell line. In another embodiment, a CMC cell line according to the present invention is selected based on the consistent up regulation of one or more nucleic acids encoding key enzymes integral to the biosynthesis of certain biological substances relative to a reference cell line, e.g., a DDC cell line and is then cultured for the production of the desired biological substances in cell culture; thus the cell line produces higher amounts of the biological substances for a longer period of time in bioreactor than a reference cell line, e.g., a DDC cell line, or other CMC cell lines that do not show the consistent up regulation of the one or more nucleic acids encoding key enzymes integral to the biosynthesis of biological substances. The biological substances produced by a CMC cell line of the invention can be any one or more substances for which production is desired including, but not limited to, peptides, proteins, lipids, polysaccharides, chemical compounds, or hormones. One example of a biological substances is ginsenoside from ginseng plants. Another example is an abietane tricyclic diterpenoid derivative. Another example is a taxane from one or more Taxus plants.

[0123] In one aspect, a CMC cell line of the present invention is cultured under one or more stress-inducing conditions. The stress-inducing condition can be chosen to elicit a biological or non-biological (e.g., physical or chemical) stress. For example, a biological stress can be induced by, e.g., bacterial, fungal or viral infections, and a non-biological stress can be induced by, e.g., restriction of an air supply or addition of one or more chemicals, e.g., one or more elicitors. The elicitors can be added before, during, or after culturing of a CMC cell line. Examples of the elicitors include, but are not limited to, chitosan or methyl jasmonate (MeJA).

[0124] A non-limiting example of a physical stress inducer is a restriction of air supply.

For example, air can be supplied continually at the proliferation stage in order to obtain biomass or to produce useful compounds at the production stage, but then the air flow can be stopped for a given period of time or be controlled to provide only a limited amount of air. For example, air can be supplied continually for at least about 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days and then discontinued for less than one hour, or at least 1 hour, hours, 3 hours, 6 hours, 9 hours, 12 hours, 24 hours, 48 hours, or more. In another example, the air can be supplied continually at first and then controlled to be supplied in a limited way, e.g., four times a day, three times a day, two times a day, or one time a day. The limited air supply can continue for one day, two days, three days, four days, five days, six days, or seven days. The first step of continual air supply and the second step of discontinuing or limiting (or controlling) air supply can be repeated for twice, three times, four times, five times, six times, or more. In certain aspect, an air supply rate is 0.05~0.5 wm, e.g., 0.1 wm. Nucleotide Sequences and Uses Thereof

The present invention is also directed to an isolated nucleotide sequence comprising a nucleic acid sequence at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a contig selected from the group consisting of contig27072, contig33753, contigl2100, contig07908, contig02856, contig00912, contig05416, contig 13706, contig02426, contig2601 1, contig08875, contig32752, contig34590, contig01413, contig08488, contig23891, contig22565, contig06359, contig27519, contig 12256, contig 14051 , contig00617, contig36068, contig34083, contig32989, contig30526, contig36027, contig251 15, contig 14790, contig 18732, contig02427, contig25250, contig05040, contigl2255, contig23084, contig00857, contig21862, contig28943, contig 13724, contig36075, contig3121 1, contig34607, contig09523, contig29684, contig20794, contig30162, contig27918, contig00739, contig24462, contig34586, contig07958, contig03138, contig00738, contig27474, contig35409, contig 17665, contig33166, contig05274, contig05310, contig00872, contig24010, contig36449, contig09881, contig34877, contig25139, contig06648, contig 12239, contig001 15, contig24645, contig06416, contig 17084, contigl0642, contig20265, contig 13497, contig30742, contig33088, contig22241, contig 16844, contig35288, contig27145, contig24117, contig 19286, contig35423, contig03296, contig24270, contig09655, contig04392, contig33905, contig 17735, contig 16098, contig02712, contig08273, contig06910, contig33287, contig04567, contig26412, contig 16046, contig08064, contig07578, contig33960, contig 10758, contig09647, contig33532, contig 16700, contig03620, contig06414, contig 19387, contig02721, contig 15296, contigl7863, contig00701, contig2851 1, contig 14963, contig22484, contig 19556, contig25983, contig 16556, contig27189, contig 10091, contig24063, contig 10613, contig20970, contig 17594, contig 11227, contig35804, contig06222, contig35585, contig07194, contig20583, contig36415, contig26284, contig 15011, contig32060, contig 18311, contig36295, contigl 8l38, contig22625, contig36528, contig 14727, contigl3598, contig 19561, contig33990, contig36559, contig32396, complements thereof, and any combinations thereof. These contigs showed no homology to any known sequences via BLAST searching, but are differentially regulated in a CMC cell line compared to a corresponding DDC cell line. Therefore, the contigs or genes derived from these contigs can be useful as a marker or a set of markers to identify a CMC cell line. In one embodiment, the invention is drawn to an isolated nucleotide sequence comprising a nucleic acid sequence or a complement thereof, wherein the nucleic acid sequence is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more contigs selected from the group consisting of contig27072, contig33753, contigl2100, contig07908, contig02856, contig00912, contig05416, contigl3706, contig02426, contig2601 1, contig08875, contig32752, contig34590, contig01413, contig08488, contig23891, contig22565, contig06359, contig27519, contigl2256, contigl4051, contig00617, contig36068, contig34083, contig32989, contig30526, contig36027, contig251 15, contigl4790, contigl8732, contig02427, contig25250, contig05040, contigl2255, contig23084, contig00857, contig21862, contig28943, contigl3724, contig36075, contig3121 1, contig34607, contig09523, contig29684, contig20794, contig30162, contig27918, contig00739, contig24462, contig34586, contig07958, contig03138, contig00738, contig27474, contig35409, contigl7665, contig33166, contig05274, contig05310, contig00872, contig24010, contig36449, contig09881, contig34877, contig25139, contig06648, contigl2239, contig001 15, contig24645, contig06416, contigl7084, contigl0642, contig20265, contigl3497, contig30742, contig33088, contig22241, contigl6844, contig35288, contig27145, contig24117, contigl9286, contig35423, contig03296, contig24270, contig09655, contig04392, contig33905, contigl7735, contigl6098, contig02712, contig08273, contig06910, contig33287, contig04567, contig26412, contigl6046, and any combinations thereof, wherein the nucleic acid sequence is up regulated in a Taxus CMC cell line compared to a corresponding nucleotide sequence in a Taxus DDC cell line. In another embodiment, the invention is directed to an isolated nucleotide sequence comprising a nucleic acid sequence or a complement thereof, wherein the nucleic acid sequence is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more contigs selected from the group consisting of contig08064, contig07578, contig33960, contigl0758, contig09647, contig33532, contigl6700, contig03620, contig06414, contigl9387, contig02721, contig 15296, contig 17863, contig00701, contig28511, contigl4963, contig22484, contigl9556, contig25983, contigl6556, contig27189, contig 10091 , contig24063, contigl0613, contig20970, contig 17594, contigl l227, contig35804, contig06222, contig35585, contig07194, contig20583, contig36415, contig26284, contigl501 1 , contig32060, contigl 831 1, contig36295, contigl 8138, contig22625, contig36528, contigl4727, contigl3598, contigl9561 , contig33990, contig36559, contig32396, and any combinations thereof, wherein the nucleotide sequence is down regulated in a Taxus CMC cell line compared to a corresponding nucleotide sequence in a Taxus DDC cell line.

[0127] Also provided in the invention is a set of nucleotide sequences comprising two or more nucleic acid sequences, wherein each of the two or more nucleic acid sequences comprises a nucleotide sequence listed above.

[0128] The invention also provides a method of characterizing or identifying a CMC plant stem cell comprising: extracting RNA from a cell line, and identifying up regulation of one or more nucleotide sequences listed above as being up regulated in Taxus CMC cells when compared to the corresponding nucleotide sequence expressed in the corresponding Taxus DDC cells or identifying down regulation of one or more nucleotide sequences listed above as being down regulated in Taxus CMC cells when compared to the corresponding nucleotide sequence expressed in the corresponding Taxus DDC cells or identifying up regulation and down regulation. The up regulation of the nucleotide sequence or the down regulation of the nucleotide sequence or combination thereof can be identified by various methods known in the art. These include, but are not limited to, Northern blot analysis, SI nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR). In one aspect, the methods, e.g., RT-PCR, utilize at least two primers, each of which have at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to one or more of the nucleotide sequence disclosed herein.

[0129] Although the present invention has been fully described in conjunction with several embodiments thereof with reference to the accompanying drawings, it is to be understood that various changes and modifications can be apparent to those skilled in the art. Such changes and modifications are to be understood as included within the scope of the present invention as defined by the appended claims. EXAMPLES

[0130] Examples of the invention are provided below. The following examples are offered by way of illustration, and not by way of limitation.

Example 1 : Preparation of Plant Materials and Isolation of CMCs

[0131] Twig, needle, and seed samples were collected from a wild-grown T. cuspidata tree. Twig and needle samples were immediately deposited in 0.56 mM ascorbic acid solution. They were stored at 4 °C for 1 month. Then, they were washed in running tap water for 30 min and surface-disinfected with 70 % ethanol for 1 min, followed by 1 % sodium hypochlorite for 20 min for twigs and 15 min for needles and 0.07 % sodium hypochlorite for 20 min, and rinsed 5 times with sterilized distilled water (dH₂0). Lastly, they were rinsed once with dH₂0 containing 150 mg/L citric acid. Seeds were put into 0.01 % sodium hypochlorite for 24 hours with agitation. They were washed in running tap water for 4 hours, surface disinfected with 70 % ethanol for one min and then placed in 1 % sodium hypochlorite for 15 min. Then, they were rinsed 5 times with dH₂0.

[0132] For CMCs, cambium, phloem, cortex and epidermal tissue, were peeled off from the xylem and the epidermal tissue side was laid on B5 medium (Gamborg O.L., Miller R.A., Ojima K. Exp. Cell Res. 50, 151-158 (1968)) excluding (NH₄)₂S0₄ with 1 mg/L picloram, 30 g/L sucrose and 4 g/L gelrite. After 4 to 7 days, cell division was evident only in cambium and after 15 days, DDCs started to form from the layer that consisted of phloem, cortex and epidermis by dedifferentiation. At 30 days post-culture, there was a visible split between cambium cells and DDCs of the phloem, cortex and epidermis. This separation was obvious because cambium cells uniformly divided resulting in the formation of a flat plate of cells. In contrast, DDCs derived from phloem, cortex and epidermis proliferated in an irregular form, presumably due to the discrepancy between cell division rates. Following the natural separation of cambium from the other cell types, this cell layer was transferred onto different petri-dishes containing B5 medium excluding (NH₄)₂S0₄ with 1 mg/L picloram, 10 g/L sucrose and 4 g/L gelrite. Initial cell inoculum size was 3.0 g (f.c.w.) and subsequently, CMCs were subcultured onto the fresh medium every two weeks. Establishment of P. ginseng CMCs was as described above except that the isolation medium contained McCown woody plant medium (McCown, B.H. and Lloyd, G. Hort. Sci. 16: 453 (1981)) with 2 mg/L IAA, 30 g/L sucrose, 100 mg/L ascorbic acid, 150 mg/L citric acid and 3 g/L gelrite. For lignin visualization, tissues were stained with phloroglucinol-HCl (0.5 % (wt/vol) phloroglucinol in 6 N HC1) for 5 min and then observed under a light microscope.

[0133] A recently developed twig was collected from a wild yew, T. cuspidata (Fig. 1 A).

From the xylem, tissue was peeled which contained cambium, phloem, cortex and epidermis (Fig. IB and Figs. 4A-4C). The absence of xylem cells was confirmed by staining with phloroglucinol-HCl which detects lignin deposition (Figs. 5A-5F). This tissue was cultured over time on solid isolation medium (Fig. 1C). Subsequently, actively proliferating cambium cells could be gently separated from the dedifferentiated cells (DDCs) derived from phloem, cortex and epidermis (Figs. 1C-1E and Figs. 6A-6E). This mass of proliferating cells was distinct from DDCs derived from a needle or embryo (Figs. IF and 1G) and the morphology of these CMCs differed from adjacent cells (Fig. 1H and Figs. 6B-6E).

[0134] The above-described method was used to produce such cells from a variety of plant species including, for example, ginseng {Panax ginseng), ginkgo {Ginkgo biloba) and tomato {Solanum lycopersicori), which suggests that this method is applicable to a variety of plants (Figs. 7A-7F). The above-described method or modified method, if necessary, can be used for virtually all other plants. As the modification can be made without undue experimentation by persons having ordinary skills in the art, detailed description thereof is omitted.

Example 2: Culturing of CMCs

[0135] A cell suspension culture of these cells derived from T. cuspidata was developed.

Suspension cultures were established by inoculating a sample of 2.5 g (few.) cultured cells derived from either cambium, needles or embryos into 125 ml Erlenmeyer flasks containing 25 ml of B5 medium containing 1 mg/L picloram, and 20 g/L sucrose, excluding (NH₄)₂S0₄. The flasks were agitated at 100 rpm and 21 °C in the dark. Subculturing was undertaken at 2-week intervals.

[0136] For culturing the cells in 3 L and 20 L air-lift bioreactors, same medium that was used in the initial suspension culture was applied. Diameter, height and pore size of micro-sparger used in the bioreactor was 2 cm, 0.4 cm, 0.2 μηι, respectively. Aeration rate was 0.1-0.2 volume/volume/min (v.v.m) in 3 L air-lift bioreactor, and 0.08-0.18 vvm in 20 L air-lift bioreactor. 3.25 g/L (d.c.w.) of CMCs, 3.3 g/L (d.c.w.) of needle-derived DDCs and 3.1 g/L (d.c.w.) of embryo-derived DDCs were inoculated in 3 L air-lift bioreactor. 3.65 g/L (d.c.w.) of CMCs, 3.64 g/L (d.c.w.) of needle-derived DDCs and 3.41 g/L (d.c.w.) of embryo-derived DDCs were inoculated in 20 L air-lift bioreactor. Working volume was 80 % of total capacity, which are 2.4 L in 3 L air-lift bioreactor and 16 L in 20 L air-lift bioreactor. Subculturing of CMCs and DDCs was undertaken every two weeks in 3 L and 20 L air-lift bioreactor with same initial inoculum size and conditioned medium was re-cycled with the ratio of 25 % of working volume. Growth rate was measured in dry cell weight (g/L) after vacuum filtration and drying of the cells in a dry oven at 70 °C for 24 hours. The CMCs are also termed Ddobyul, meaning another star in Korean.

Example 3: Preparation and Culturing of DDCs

[0137] DDCs of T. cuspidata were induced from embryos and needles largely as previously described ' . For induction of needle-derived DDCs, both ends of the needle were cut in 0.3-0.5 cm (length and width) and were laid on B5 medium containing 1 mg/L picloram, 30 g/L sucrose and 4 g/L gelrite, excluding (NH₄)₂S0₄. After 30 days of culturing, DDCs were induced from the cut-edges (Fig. IF). As culture period continued, DDCs formed over the whole explants. Induced DDCs were transferred to B5 medium containing 1 mg/L picloram, 10 g/L sucrose and 4 g/L gelrite, excluding (N¾)₂S0₄ for growth. Initial inoculum size was 3.0 g (few.) and DDCs were subcultured to fresh medium every 2 weeks.

[0138] For induction of embryo-derived DDCs, both ends of the zygotic embryo were cut and laid on B5 medium containing 1 mg/L 2,4-D, 30 g/L sucrose and 4 g/L gelrite, excluding (NH₄)₂S0₄. After 23 days of culturing, DDCs were induced from the cut-edges (Fig. 1G). As culture period continued, DDCs formed over the whole explants. Induced DDCs were transferred to B5 medium containing 1 mg/L picloram, 10 g/L sucrose and 4 g/L gelrite, excluding (NH₄)₂S0₄ for growth. Initial inoculum size was 3.0 g (few.) and DDCs were subcultured to fresh medium every 2 weeks.

[0139] The above-described method was used to produce such cells from a variety of plant species including, for example, ginseng (Panax ginseng), ginkgo (Ginkgo biloba) and tomato (Solanum lycopersicon), which suggests that this method is applicable to a variety of plants (Figs. 7A-7F). The above-described method or modified method, if necessary, can be used for virtually all other plants. As the modification can be made without undue experiment by persons having ordinary skills in the art, detailed description thereof is omitted.

Example 4: Vacuoles of CMCs and DDCs

[0140] Microscopy analysis was undertaken to examine the isolated CMCs for cell morphology that would indicate they were isolated plant stem cells. Microscopic analysis revealed the presence of small, abundant vacuoles within these cultured cells, a characteristic feature of CMCs¹¹, because this trait enables them to withstand the pressure generated by the expanding secondary xylem¹². In contrast, dedifferentiated T. cuspidata cells derived from needles or embryos possessed only one large vacuole, typical of such plant cells (Figs. II and 1 J).

[0141] Vacuole experimentation was undertaken based on modifications of the methods described previously¹⁴'¹⁵. Briefly, CMCs, needle- and embryo-derived DDCs were stained with 0.01 % (w/v) neutral red (SIGMA-ALDRICH, USA) for 3 min. Then, cells were washed with 0.1 M phosphate buffer (pH 7.2) and were observed with an optical microscope (BX41 Olympus Japan) using the same buffer.

Example 5: Differentiation

[0142] The ability to differentiate into either a tracheary element (TE), the main conductive cell of the xylem or phloem elements is a defining trait of CMCs^13,14. Informatively, these cultured cells could be conditionally differentiated into a TE at high frequency. In contrast, no TEs were formed from T. cuspidata DDCs (Figs. IK and 1L). Both animal and plant stem cells are particularly sensitive to cell death triggered by ionizing radiation, to safeguard genome integrity in populations of such cells¹⁵. In a similar fashion, these cultured cells were found to exhibit hypersensitivity to γ-irradiation (Fig. 1M). Moreover, they also showed increased cell death in response to the radiomimetic drug zeocin¹⁵ (Fig. IN). In aggregate, the findings based on a variety of approaches are consistent with the notion that these cultured cells exhibit stem cell-like properties, consistent with a CMC identity.

[0143] Light microscopy was undertaken using a model BX41, Olympus, Japan. A polarizer for transmitted light, model U-POT, Olympus, Japan, was utilized for TE images. TEs were identified by virtue of their bright fluorescence, due to the presence of lignified secondary cell walls. [0144] The media used to induce CMC differentiation into tracheary elements was B5 medium, excluding (NH₄)₂S0₄ with 10 mg/L NAA, 2 mg/L kinetin, 6 mg/L GA3 and 60 g/L sucrose. TEs were identified by virtue of their bright fluorescence, due to the presence of lignified secondary cell walls. The extent of TE differentiation was determined as the percentage of TEs per total number of cells. This analysis was undertaken in triplicate and in each case 200 cells were counted.

Example 6: Hypersensitivity to γ- irradiation and radiomimetic drug

[0145] CMCs and needle-derived DDCs were obtained from suspension cultures obtained from 20 L air-lift bioreactors. For gamma-irradiation (Co⁶⁰), cells were irradiated at a dose rate of 0.92 Gy/min for 0~400 Gy, which has been modified from a method described previously⁴. Then, cells were suspension cultured for 24 hours in 100 ml flasks at 21 °C, 100 rpm in the dark (Ratio of cell to media was 1 : 10). Suspension cells were treated with zeocin (200 μg/ml, Invitrogen) at 7 days after subculture, essential as described previously⁴. The treated suspension cell culture was incubated in the dark for 24 or 48 hours. For cell death determination, cells were treated with 2 % Evan's blue for 3 min and washed with sterile water several times, then transferred to a microscope slide covered with a thin cover slip. For each sample, cell death was determined 5 times independently and the average cell death rate was measured by excluding the maximum and minimum number of cell counts. All experiments were undertaken in triplicate.

[0146] Both animal and plant stem cells are particularly sensitive to cell death triggered by ionizing radiation, to safeguard genome integrity in populations of such cells¹⁵. In a similar fashion, these cultured cells were found to exhibit hypersensitivity to γ-irradiation (Fig. 1M). Moreover, they also showed increased cell death in response to the radiomimetic drug zeocin¹⁵ (Fig. IN). In aggregate, our findings based on a variety of approaches are consistent with the notion that these cultured cells exhibit stem cell-like properties, consistent with a CMC identity.

Example 7: Molecular Plant Stem Cell Signature of CMCs

[0147] To compare the molecular signatures between these cells and typical DDCs, a combination of deep sequencing technologies were employed. Sequencing was carried out in the GenePool genomics facility at the University of Edinburgh using a Genome Analyser (GA) II_X lllumina Solexa sequencing machine. Three replicates each of both cell lines (CMC/DDC) were sequenced following the manufacturer's protocol. Subsequently, reads were aligned to the T. cuspidata reference genome using MAQ v. 6.0.8. and uniquely aligned reads to the previously assembled T. cuspidata transcriptome were counted.

[0148] RNA was isolated using a Qiagen plant RNA kit following the manufacturer's instructions. cDNA was synthesized by employing a SMART™ procedure to enrich for full length sequences⁵. The resulting cDNA was normalized using kamchatka crab duplex-specific nuclease⁶, to aid the discovery of rare transcripts. cDNA was sheared using a Covaris instruments settings: target size 500 bp, duty cycle 5 %, intensity 3, cycles/burst 200 and time 90 s. Library preparation was undertaken using a Roche GS FLX library kit. The concentration and quality of the synthesized library was analysed using a Agilment bio-analyser. Titration emulsion PCR using a GS FLX emPCR kit was undertaken to determine the optimum number of beads to load for large scale sequencing. A Beckman / Coulter Multisizer 3 bead counter was employed to determine the concentration of beads. 2 million beads were loaded onto a GS FLX pico titre plate using a Roche 05233682001, 70 x 75 kit.

[0149] The sequencing reagents utilized and washes undertaken followed protocols from the manufacturer. The T. cuspidata transcriptome was determined in the GenePool genomics facility at the University of Edinburgh using a Roche 454 GS FLX instrument in titanium mode, which employs massively parallel pyrosequencing technology ' . A total of 860,800 reads were achieved of average length 351 bp, which generated 301 MB of sequence. This data was assembled into isotigs by employing Newbler 2.3. BLAST (blast.ncbi.nlm.nih.gov/Blast.cgi) was utilized to search for similar sequences within available sequence databases. Annot8r was employed to predict GO terms for each isotig⁹.

[0150] Firstly, the T. cuspidata transcriptome was determined employing an approach based on massively parallel pyrosequencing. A total of 860,800 reads of average length 351 bp generated 301 MB of sequence (Fig. 8A and Tables 3-5). Table 3. Deep sequencing data showing read length.

Min read length 40

Max read length 1 ,076

Mean read length 350.50

Standard deviation of read length 134.82

Median read length 386

N50 read length 428

Table 4. Deep sequencing data illustrating number of reads per given length.

Number of reads 860,800

Number of reads >= 1 kb 2

Number of reads in N50 315,677

Table 5. Number of nucleotide bases in given deep sequencing reads.

Number of bases in all reads 301,710,188

Number of bases in reads >=lkb 2,129

GC content of reads 42.06 % From this sequence data 36,906 contigs were assembled de novo of average length

700 bp and maximum length 10,355 bp, with 8,865 contigs > 1 kb (Fig. 8B and Tables 6- 8).

Table 6. Data showing length of assembled contigs.

Min contig length 92

Max contig length 10,355

Mean contig length 699.15

Standard deviation of contig length 516.76

Median read length 514

N50 contig length 1 ,010 Table 7. Information illustrating the number of contigs.

Number of contigs 36,906

Number of contigs >=lkb 8,865

Number of contigs in N50 8,720

Table 8. Data showing the number of nucleotide bases in contigs.

Number of bases in all contigs 25,802,669

Number of bases in contigs >=lkb 13,047,374

GC content of contigs 40.94 %

[0152] Contigs from the T. cuspidata transcriptome listed in the Sequence Listing were subjected to BLAST searches and 62 % were assigned a putative function based on sequence homology (Fig. 23). This data set provides an important resource because there is currently no large scale sequence information derived from this division of the plant kingdom.

[0153] The determination of the T. cuspidata transcriptome enabled the use of digital gene expression tag profiling (DGE)¹⁶ to compare gene expression in prospective CMCs relative to DDCs, in the absence of elicitation for paclitaxel biosynthesis. The analysis of global gene expression in T. cuspidata cell suspension cultures was carried out by digital gene expression tag profiling, using an improved method based on previously described technology¹⁰. Potentially contaminating DNA was removed from R A samples using Ambion turbo DNase treatment. Nlalll library preparation was accomplished by following the manufacturer's standard protocol. 15 PCR cycles were utilized for amplification. 1-10 μg of a given library was used for sequencing from each sample.

[0154] The determination of gene expression levels were carried out by either RT-PCR or

13

qRT-PCR as previously described . The primer sequences employed are listed below: Primer sequences for qRT-PCR

Ct01805-F: CTTGGCAAGGATCCAGTTTAG (SEQ ID NO: 3691 1)

Ct01805-R: AGACCAAGCCCAGGGTCTTC (SEQ ID NO: 36912)

Ctl0710-F: TTCTTCGGCTGTCAGTGATG (SEQ ID NO: 36913)

Ctl0710-R: CCGATAGAAGCTTGCAGGAA (SEQ ID NO: 36914) Primer sequences of RT-PCR

Ct27072-F: CACTTGGAGTTCGTCGTTGA (SEQ ID NO: 36915)

Ct27072-R: CACTGTGCACACTCACCAAA (SEQ ID NO: 36916)

Ct36802-F: GAGCCGTTGCATGGTACACT (SEQ ID NO: 36917)

Ct36802-R: TAACCGTGGTGCTCAAATCA (SEQ ID NO: 36918)

Ctl 8649-F: CCTGACAACAGCGTCTCTGA (SEQ ID NO: 36919)

Ctl 8649-R: AAACCACCAGTACCCACAGC (SEQ ID NO: 36920)

Ct33753-F: GTTAGACCCTTCACCGTCCA (SEQ ID NO: 36921)

Ct33753-R: CTGCAAAGATGAGAGTGGAATG (SEQ ID NO: 36922)

Ct30863-F: GCAACGTCTGAAACGCAGTA (SEQ ID NO: 36923)

Ct30863-R: AGAGTTGCGAACAGCAAAGG (SEQ ID NO: 36924)

Ct34959-F: ACTCGATAGAGCCGACAAGG (SEQ ID NO: 36925)

Ct34959-R: CAGCTGATCGTCCAGCTATG (SEQ ID NO: 36926)

Ct01720-F: CTCCTCTCCAACGAGGAAAA (SEQ ID NO: 36927)

Ct01720-R: GTTTTCCCCAGAAGGGAATC (SEQ ID NO: 36928)

Ct09814-F: TTTGAGGCATGTGGGTTTTA (SEQ ID NO: 36929)

Ct09814-R: TGTCAATCTGTTGCATTGGA (SEQ ID NO: 36930)

Ct07968-F: CGACAACATTCTTGCATTGA (SEQ ID NO: 36931)

Ct07968-R: AACCGTTGCAGGGAACTTAC (SEQ ID NO: 36932)

Ct03409-F: ATGTTCCAAAAATGGGAGGA (SEQ ID NO: 36933)

Ct03409-R: GCTTGGAAAGACCTGAAGGA (SEQ ID NO: 36934)

Ct04884-F: AGTGAATGTAAGCCCCATGA (SEQ ID NO: 36935)

Ct04884-R: TTTGGCATCTTCTTGGATGA (SEQ ID NO: 36936)

Ct07286-F: GTCCATCCATTGTCCATAGAAA (SEQ ID NO: 36937)

Ct07286-R: TGGCAACATTGGTAAAGATATTCA (SEQ ID NO: 36938)

DGE analysis established that 563 genes were differentially expressed in CMCs with 296 up regulated and 267 down regulated (Figs. 2 A, 9, 10, 21-22 and Tables 1 and 2). A subset of these genes was validated by RT-PCR (Fig. 11). Phloem intercalated with xylem (PXY) encodes a leucine-rich repeat (LRR) receptor-like kinase (RLK), which is conspicuously expressed in CMCs. PXY is a member of a small series of closely related LRR RLKs, mutations in which impact CMC function¹⁷. T. cuspidata contig 01805 exhibits high similarity to PXY (Fig. 12 A) and is differentially expressed in our prospective CMC suspension cells (Fig. 21). Analysis by q-RT-PCR established that contig 01805 is up regulated 9-fold in these cells relative to DDCs (Fig. 2B).

[0156] Wooden Leg (WOL) encodes a two-component histidine kinase which is a member of a small gene family in Arabidopsis . WOL-like proteins are unique in having two putative receiver or D-domains and mutations in WOL impact vascular morphogenesis¹⁸. WOL is expressed in the cambium and WOL-like genes are expressed in the cambial zone of the silver birch (Betula pendula) and poplar (Populus trichocarpa†⁹. T. cuspidata contig 10710 exhibits high similarity to WOL and its related genes (Fig. 12B). Gene expression analysis established that this gene is up regulated 12-fold in CMCs relative to DDCs (Fig. 2B).

[0157] Additional sequences observed to have increased expression in T. cuspidata plant stem cells in the DGE analysis included contig27072, contig36802, contig 18649, contig33753, contig 16476, contig30863, cont ig04592, contigl2100, contig34959, contig07908, contig03652, contig07376, cont ig25130, contig02856, contig00912, contig09859, contig05416, contig04089, cont ig04097, contig 13706, contig02426, contig2601 1, contig08875, contig32752, cont ig22973, contig06930, contig25806, contig34590, contig23215, contig01413, cont ig21273, contig08488, contig 1 1520, contig 15994, contig23891, contig22565, cont ig06359, contig27519, contigl2256, contig35410, contig 14051, contig00617, cont ig36068, contig05291 , contig34083, contig24918, contig01898, contig32989, cont igl3128, contig04152, contig30526, contig36027, contig25515, contig251 15, cont ig 14790, contig 18732, contig02427, contig30421, contig26817, contig25250, cont ig04439, contig 16267, contig05040, contigl2255, contigl3372, contig34839, cont ig23084, contig00857, contig 1 1456, contig21219, contig21862, contigl4978, cont ig28943, contig 13724, contig26748, contig00718, contig01805, contig36075, cont ig29817, contig24743, contig 18810, contig05557, contig 13949, contig3121 1 , cont ig27710, contig34607, contig09523, contig29684, contig 12698, contig20794, cont ig34615, contig30162, contig 18423, contig27918, contig 13665, contig00739, cont igl l533, contig23048, contig24462, contig34586, contig21560, contig07958, cont ig03138, contig00738, contig07422, contig 18233, contig26946, contig07532, cont ig27474, contig 19027, contig05995, contig20249, contig35409, contig 17665, cont ig08101, contig02455, contig33166, contig05274, contig05310, contig26747, cont ig20416, contig00872, contig34059, contig24010, contig36449, contig09464, contig09299, contig23126, contig09881, contig05165, contig00027, contig34877, contig08970, contig03741, contig 14405, contigl5398, contig07669, contig25139, contig26273, contigl5034, contig00946, contig07109, contigl0106, contig06648, contig28245, contigl2239, contig07072, contig00115, contig31 132, contig24645, contig06416, contigl5685, contig 17084, contig 16931, contig 10642, contig01072, contig26198, contig08428, contig20265, contig 13497, contig30742, contig03757, contig04703, contig08669, contig 11080, contig 10277, contig30801, contig33088, contig04997, contig34040, contig 12808, contig23659, contig03990, contig22241, contig 18812, contig21293, contig 12482, contig 13687, contig06626, contig 10736, contig 16844, contig34589, contig35288, contig27145, contig24117, contig 10948, contig33616, contig 19286, contig03396, contig35423, contigl5918, contig 15623, contig00237, contig24745, contig 17057, contig03296, contig06707, contig 18332, contig03402, contigl7841, contig 10577, contig04386, contig22709, contig32799, contig 17854, contig24270, contig 18201, contig09655, contig20801, contig05083, contig07531 , contig07921, contig04473, contig04392, contig03316, contig00103, contig33905, contig 17735, contig 14677, contig 16098, contig07690, contig28331, contig27541, contig02712, contig05143, contig08273, contig20804, contig06171, contig21572, contig06910, contig08569, contig04028, contig 1 1628, contig061 16, contig06409, contigl3142, contig 16016, contig00459, contig 19226, contig05694, contig 15453, contig 15843, contig07218, contigl0959, contig09693, contig00805, contig 10665, contig33287, contig01120, contig04567, contig05893, contig32410, contig 17311, contigl 5714, contig01291, contigl5111, contigl6536, contig22190, contig 10786, contig09809, contig 1 1631, contig21287, contig01009, contig26412, contig 16668, contig09566, contig 16046, contig00039, contig06098, contig05655, contig 16947, contig 14389, contig 13624, contig01547, contig03758, contig02817, contig 13673, contig 12644, contig08074, contig08296, contig29327, contig 14317, contig34517, contig27942, contig00556, contig 19260, contig03298, contig01782, contig07930, contigl0342, contig 10721, contig 13080, contig07064, contig02893, contig32957, contigl5387 (Fig. 21).

Sequences observed to have decreased expression in T. cuspidata plant stem cells in the DGE analysis included contig34310, contigl741 1, contig08064, contig33838, contig22966, contig09529, contig01 107, contigl9383, contigl2597, contig3241 1, conti g34486, contig07578 contig01850, cont igl 9743, cont ig33960 contig02354, conti gl2160, contig02705_: contig21258, cont ig04524, cont g06272 contigl 9859, conti g33172, contig 10947_; contigl 8316, cont ig33880, cont g 10004 contig02419, conti g 16070, contig21375, contig 10847, cont ig00468, conti ig00002 contig33554, conti g33997, contig23679_; contig09322, cont ig06900, conti gl0758 contig08205, conti gl0699, contig09833_: contig09931 , cont ig33959, conti g02060 contig03887, conti gl 8382, contig05609_; contig08869, cont ig05076, conti ig04684 contig06973, conti gl2529, contig05287_: contig09647, cont igl 3051 , cont g02424 contig34558, conti g07776, contig23772. contig33898, cont _lg17982, cont g09216 contig33532, conti gl6700, contig 1 1441. contig21 147, cont igl2890, conti ig 13202 contig03620, conti g09300, contig 1 1096_; contig02556, cont igl4130, cont ig03215 contig24326, conti g 16464, contig 15519_; contig08200, cont ig05323, cont Lg02095 contig25516, conti g07288, contig 14554_; contig36355, cont ig05532, conti ig06414 contig 17824, cont igl 3582, contig 1 1451 contig 1 1642, cont ig06450, cont ig03544 contig23484, cont ig02223, contig21637 contig09410, cont Lgl l 580, cont gl 0719 contig 13397, cont ig32893, contig 19387_; contig 14914, cont ig20795, cont g09388 contig02721 , cont _lg32962, contig 15296_: contig05465, cont ig33042, cont igl4636 contig 19438, cont igl7863, contig 1 1094_; contig03276, cont ig09056, cont ig09138 contig03597, cont ig05704, contigl 8830_; contig 16014, cont ig30246, cont ig34327 contig 19429, cont g00701 , contig33045_; contig07474, cont igl 3819, cont g01406 contig05528, cont ig09066, contigl3935 contig01983, cont ig02362, cont ig24551 contig06834, cont ig 14849, contig01636, contig 10645, cont igl6883, cont Lg2851 1 contig 14963, cont _lg34143, contig07304_; contig02383, cont igl6551 , conti ig03127 contig33455, cont Lgl2015, contig 17537, contigl 61 12, cont ig22484, cont g201 19 contig01276, cont _lg23453, contig32318_; contigl 6504, conti igl6185, cont Lg05722 contigl9556, cont ig25983, contigl2014_; contigl l683, cont igl2198, cont ig34765 contigl6556, cont igl2353, contig04767_; contig 1 1408, cont igl9754, cont ig27189 contig 10091 , cont ig24063, contig02767_; contig 19337, cont Lg06243, cont ig33472 contig03538, cont ig06062, contig08567_; contig 16727, cont ig08095, cont ig06229 contig09609, cont igl2716, contig21523. contig23414, cont Lg07574, cont igl5828 contig 10974, cont ig20508, contig08071 _; contig33050, cont gl0613, cont g00982 contig36231 , cont ig20970, contig33961 _; contig 10305, cont gl 7594, cont g07796 contig00643, contig07564, contig06296, cont ig35356, contig20971, contig09723, contig01181, contig01124, contig 15401, cont LgH227, contig09952, contig 18745, contig05187, contig23461, contig05785, cont >gl2739, contig35804, contig 16074, contig06222, contig02210, contig35585, cont igl7838, contig03513, contig00242, contig33761, contig22119, contig07194, cont ig02988, contig 12369, contig 19741 , contig20583, contig07970, contig22910, cont ig36415, contig 10027, contig 15960, contig04735, contigl l877, contig35933, cont ig09340, contig26284, contigl501 1 , contig32060, contig01847, contig 1831 1 , cont ig36295, contig23275, contigl 8138, contig22625, contig36528, contig32627, cont ig20216, contig 10242, contig 14727, contigl3174, contigl3598, contig 19561, cont ig33990, contig01380, contig35561, contigl5552, contigl4347, contigl9726, contig34643, contig36559, contig32396 (Fig. 22).

[0159] To assess the molecular composition and the relative expression of genes indicative of given biological pathways in our prospective CMCs, enrichment analysis of Gene Ontology (GO) terms within the dataset was performed. This approach established' that both stress and biotic defense response genes were prominently over-represented (Fig. 2C; Fig. 25). Stem cells exhibit a low threshold for auto-execution through apoptosis but express robust defenses against environmental stresses²⁰. Collectively, the DGE data is therefore consistent with a CMC identity for these cultured cells.

Example 8: Cell Growth Properties

[0160] To compare the growth properties of these CMCs with DDCs derived from the same wild tree, a solid growth media format and representative cell lines were utilized. At 22 months post inoculation the T. cuspidata needle and embryo derived DDCs produced a total dry cell weight (d.c.w.) of 0.32 g and 0.41 g respectively when grown on solid media with subculturing every 2 weeks (Fig. 2D). In contrast, the d.c.w. generated from CMCs was 1,250 g, an increase of 4.0 x 10⁵ % and 3.0 x 10⁵ %, respectively. Moreover, these cells were still growing rapidly following 22 months of culture, while DDCs possessed conspicuous necrotic patches (Fig. 13) and displayed rapid decrease in their viable cell biomass.

[0161] To establish if these cells exhibit superior growth properties on a larger scale, their growth in a 10 L stirred tank bioreactor was investigated. In this environment, shear stress can be a problem limiting growth, which is intensified by cell aggregation . In this bioreactor, CMCs had a significantly greater growth rate than DDCs (Fig. 3A). Further, in response to shear stress the survival rate of CMCs was strikingly higher relative to DDCs, which by the end of the culture period had largely turned necrotic and had stopped growing (Fig. 17A-17C).

[0162] The growth of these cells in a 3 L air-lift bioreactor was investigated. DDC cultures formed large cell aggregates in the air-lift bioreactor, leading to reduced cell mixing and circulation, which subsequently resulted in cell adherence to the bioreactor wall. Furthermore, many of these adhered cellular aggregates developed necrotic patches. After 4 months of culture the growth of DDCs from either needle or embryo, expressed as dry cell weight (d.c.w.), were 3.33 g and 5.08 g, respectively. In contrast, the CMC line generated a d.c.w. of 3,819.44 g, an increase of 1 14,000 % and 75,000 %, respectively (Fig. 3B).

[0163] The growth of the CMC cell lines was investigated in a 20 L air-lift bioreactor, routinely utilized as a pilot for subsequent large scale production. Typically, DDCs failed to grow in this size of bioreactor under the conditions tested and rapidly became necrotic. Conversely, CMCs always grew rapidly, increasing their dry cell weight (d.c.w.) from 3.65 g/L to 12.85 g/L within 14 d (Fig. 3C). Their relative tolerance of shear stress can likely be attributed to their small and abundant vacuoles, reduced aggregation and thin cell walls .

[0164] To improve the performance of needle and embryo derived DDCs more rapidly growing cells were specifically selected at each subculture on solid media for a period of 1.8 years. This process improved the growth of needle but not embryo derived DDCs in a 3L air-lift bioreactor. However, the performance of CMCs was still strikingly superior to that of these extensively selected cells with respect to specific growth rate ( /), doubling time (TJ) and growth index (GI) (Fig. 18 and Table 9).

Table 9. Comparison of cultural properties of cell lines in 3 L air-lift bioreactor.

Specific growth rate (ju) = LN(X2-X1)/T2-T1

Doubling time (Td )= LN(2)/Max. specific growth rate (j ^max) Growth index(GI) = Max. dry cell weight - initial dry cell weight/initial dry cell weight

[0165] A key trait for the exploitation of plant cells on an industrial scale is the stability of their growth in suspension culture . Therefore the growth stability of these cells was monitored compared to selected DDCs derived from needles. CMCs exhibited a relatively constant growth rate over time. In contrast, this trait exhibited striking fluctuations during the culture of DDCs (Fig. 19). Finally, the growth of CMCs within a 3 metric ton bioreactor was determined. These cells were again successfully cultured with high performance (Figs. 20A and 20B), establishing their utility for growth on an industrial scale.

Example 9: Cell Aggregation

[0166] Pronounced cell aggregation is a typical feature of suspension cultures comprised of DDCs. This can lead to differences in local environments between cells significantly reducing growth rate and natural product biosynthesis . In representative suspension cultures of DDCs derived from either T. cuspidata needles or embryos only 2 % or 5 % respectively of cell aggregates were less than 0.5 mm. Conversely, in representative CMCs 93 % of cell aggregates were less than 0.5 mm, with many cells present as singletons or components of aggregates comprised of only 2-3 cells (Fig. 2E and Fig. 14).

Example 10: Production of Active Substances

[0167] Numerous medicines, perfumes, pigments, antimicrobials and insecticides are derived from plant natural products^1"3'³⁰. Cultured cambial meristematic cells may provide a cost-effective, environmentally friendly and sustainable source of a variety of important natural products. Unlike plant cultivation, this approach is not subject to the unpredictability caused by variation in climatic conditions or political instability in certain parts of the world. Furthermore, CMCs provide an important biological tool to explore plant stem cell function. Non-limiting examples are described below for illustration.

Paclitaxel

[0168] The magnitude of paclitaxel biosynthesis in this novel cell line was determined during batch culture in a 125 ml Erienmeyer flask. At 14 days post cell inoculation of flask cultures, cells were transferred to production medium containing the elicitors methyl-jasmonate and chitosan, together with a precursor phenylalanine, to induce paclitaxel biosynthesis, which was measured 10 days later by high performance liquid chromatography (HPLC). The amount of paclitaxel produced, 102 mg/kg fresh cell weight (f.c.w.), was conspicuously greater than that generated by either needle or embryo-derived DDCs at a f.c.w. value of 23 mg/kg or 39 mg/kg, respectively (Fig. 2F). Measurements of this natural product were confirmed by liquid chromatography mass spectrometry (LC-MS) (Figs. 15A-15D). Further, genes encoding key enzymes integral to the biosynthesis of paclitaxel were induced more strongly in CMCs than in DDCs (Fig. 16).

[0169] Analysis of paclitaxel production was undertaken using an HP 1100 Series liquid chromatography/ HP 1100 Series mass selective detector (Agilent Technologies, Palo Alto, CA, USA). Samples (2 μΐ) were separated on a PerfectSil Target ODS-3 (4.6 mm x 150 mm x 3 μπι) using water (10 mM ammonium acetate): acetonitrile which was isocratic: 50 % acetonitrile for 60 min, at 0.4 ml/min flow rate. Mass detection of paclitaxel was by electrospray ionization (ESI) in the positive ion mode. The drying gas was N2 at 10 L/min, 350 °C, 30 psi. The vaporizer was set to 300 °C, capillary to 4000 V. Identification of paclitaxel was accomplished by comparison of retention times and mass with authentic standards.

[0170] Elicitor signal transduction controls molecular signaling in plant cells and is widely used for the increase of secondary metabolite productivity. After the treatment of methyl jasmonate as an elicitor and 10 other kinds of elicitors, a positive effect on the paclitaxel production was observed. It was possible to obtain relatively high metabolites productivity through the combination of methyl jasmonate and other elicitors. Especially, paclitaxel production was very effective with the treatments of methyl jasmonate (Me- JA), chitosan and phenylalanine.

[0171] The level of paclitaxel production of these different T. cuspidata cell suspensions in both 3L and 20L air-lift bioreactors was determined. To test the capacity for production of paclitaxel in the flask and 3 L and 20 L air-lift bioreactors, cells at 14 days of culturing were transferred to B5 medium excluding KN0₃, and containing 60 g/L fructose and 2 mg/L 1-Naphtalene acetic acid (NAA), and elicitors such as 50 mg/L, chitosan and 100 μΜ methyl-jasmonate, in addition to 0.1 mM of the precursor, phenylalanine. [0172] At 10 days following elicitation, CMCs again synthesized strikingly more paclitaxel than either of the DDC lines in a 3 L air-lift bioreactor. Further, elicitation induced a 220 % (1 1 mg/kg) and 433 % (13 mg kg) increase in paclitaxel production within needle and embryo derived DDCs respectively, whereas the induction was 14,000 % (98 mg/kg) with CMCs (Fig. 3D). CMCs secreted 2.7 x 10⁴ % and 7.2 x 10⁴ % more paclitaxel into the culture medium than the low levels secreted by either needle or embryo derived DDCs, respectively (Figs. 3E and 3F). The amount of paclitaxel secreted to the medium during culture varies significantly both between Taxus species and in response to different culture conditions²². The DDCs secreted less paclitaxel than might be expected. Nevertheless, T. cuspidata CMCs secreted a strikingly greater amount of paclitaxel into the medium during these culture conditions than the associated DCCs. Moreover, these cells also synthesized strikingly more of the related taxanes baccatin III and 10- deacetylbaccatin III²'³ (Fig. 3G). No paclitaxel production was detected by either DDC line in a 20 L air-lift bioreactor. In contrast, CMCs synthesized 268 mg/kg and were again highly responsive to elicitation (Fig. 3H). Previously reported values for T. cuspidata paclitaxel production ranged from 20 - 84 mg/kg few.²³'²⁴. However, this data, including the maximum value, was obtained from flask cultures, where our data suggests DDCs have improved function relative to their performance on a larger scale. Our findings imply that CMCs synthesize strikingly more paclitaxel and are significantly more responsive to elicitation when batch cultured in either 3 L or 20 L air-lift bioreactors compared to typical T. cuspidata suspension cells.

[0173] Perfusion culture promotes the secretion of secondary metabolites into the culture medium, aiding both purification and natural product biosynthesis²². The magnitude of paclitaxel secretion following perfusion culture was compared. Perfusion culture was initiated in a similar fashion to that described for the bioreactors. On day 14, cultures were elicited with 50 mg/L chitosan, 0.1 mM phenylalanine and 100 μΜ methyl jasmonate. Post-elicitation, the spent medium was removed aseptically and replaced with an equal volume of fresh B5 medium excluding KN0₃ with 60 g/L fructose and 2 mg/L 1-Naphtalene acetic acid (NAA) and elicitors of 50 mg/L chitosan, 0.1 mM phenylalanine and 100 μΜ methyl-jasmonate every 5 days. After 45 days of extended culture, intracellular and extracellular paclitaxel levels were analyzed. [0174] Following 45 days of perfusion culture, needle and embryo derived DDCs were largely necrotic; however, CMCs produced a combined total of 264 mg of paclitaxel per kg of cells and 74 % of this was secreted directly into the medium (Figs. 31 and 3J). Perfusion culture of the CMCs both promoted paclitaxel biosynthesis and increased the proportion of this secondary product that is secreted into the medium, facilitating its facile and cost-effective purification. Metabolic engineering approaches and higher yielding Taxus species may further enhance paclitaxel biosynthesis in these cells.

[0175] For cell culture using elicitor, Me-JA was dissolved in 90 % ethanol, chitosan in glacial acetic acid and phenylalanine in distilled water before dilution to the required concentrations. After 10 days, paclitaxel content was analysed. Taxane and abietane production described below was elicited in a similar fashion. Stress triggered ginsenoside accrual was mediated by reducing air supply from a constant 0.1 wm into a 3 L air-lift bioreactor, for 13 days of culture, to 0.1 wm for a 30 min period twice per day for 3 days.

[0176] For analysis, following their separation from the production medium, 0.2 g of cells were weighed, soaked in 4 ml of methanol (Sigma, USA) / dichloromethane (Sigma, USA) (1 : 1 vol/vol) and sonicated (Branson, USA) for 1 hour. 4 ml of the methanol/dichloromethane extract was filtered and concentrated in vacuo and subsequently re-dissolved in 4 ml of dichloromethane and partitioned with 2 ml of water. The latter step was repeated three times and only the dichloromethane fraction was collected. This fraction was concentrated, then re-dissolved in 1 ml of methanol and centrifuged at 8,000 x g for 3 min before HPLC analysis. For determining the extracellular paclitaxel concentration, production medium (5 ml) was extracted 3 times with the same volume of dichloromethane. The combined dichloromethane fraction was subsequently concentrated and then re-dissolved in 0.5 ml methanol. HPLC (nanospace SI-2, Shiseido, Japan) with a CI 8 column (Capcell pak CI 8 MGII column, 5 μιη, 3.0 mm X 250 mm, Shiseido, Japan) was used for the analysis. Column temperature was 40 °C and the mobile phase was a mixture of water and acetonitrile (Burdick & Jackson, USA) (1 :1 isocratic) at a flow rate of 0.5 ml/min. A UV-VIS detector monitored at 227 nm and the sample injection volume was 10 μΐ. Authentic paclitaxel, baccatin III, 10- deacetylbaccatin III standard was purchased from Sigma. Abietane tricyclic diterpenoid derivatives

[0177] T. cuspidata suspension cultures were monitored for the production of the abietane tricyclic diterpenoid derivatives, taxamairin A and taxamairin C, which have also been shown to possess anti-tumor activities.

[0178] Following their separation from the production medium, 20 mg of lyophilized cells were weighed, soaked in 4 ml of methanol (Sigma, USA) / dichloromethane (Sigma, USA) (1 :1 v/v) and sonicated (Branson, USA) for 1 hour. 4 ml of the methanol/dichloromethane extract was filtered and concentrated in vacuo and subsequently re-dissolved in 4 ml of dichloromethane and partitioned with 2 ml of water. The latter step was repeated three times and only the dichloromethane fraction was collected. This fraction was concentrated, then re-dissolved in 1 ml of methanol and centrifuged at 8000 x g for 3 min. Then it was filtered through 0.2 μπι filter for UPLC analysis. UPLC (Waters, USA) with a CI 8 column (BEH CI 8 1.7 μιη, 2.1 X 100 mm Waters, USA) was used for the analysis. Column temperature was 40 °C and the mobile phase was a mixture of water and acetonitrile (Burdick & Jackson, USA) flow rate of 0.4 ml/min. Water (solvent A) and acetonitrile (solvent B) as mobile phase with a linear gradient was used: (1 min : 0 % B, 13 min: 100 % B, 15 min : 100 % B, 16.2 min : 0 % B, 17 min : 0 % B). A UV-VIS detector monitored at 210 nm and the sample injection volume was 2 μΐ. Authentic taxamairin A and taxamairin C standard were isolated at Unhwa Corp.

[0179] Elicitation of these cells within a 3 L air-lift bioreactor induced increases in both taxamairin C and especially taxamairin A to 520.8 and 4,982.5 mg/kg few., respectively, in CMCs. These values were far greater than those determined in DDCs (Fig. 3K). Suspension cultures of T. cuspidata have previously been reported to produce 0.92 and 26.08 mg/kg few. of taxamairin C and taxamairin A, respectively²⁶. Our data implies CMCs might provide a significantly improved source for these abietanes.

Ginsenosides

[0180] To establish if CMCs derived from other plant species may also exhibit superior properties with respect to the biosynthesis of commercially relevant natural products, we determined the synthesis of ginsenosides, a class of triterpenoid saponins, derived exclusively from the plant genus Panax. Ginsenosides have been reported to show multiple bioactivities including neuroprotection, antioxidation and angiogenesis modulation²⁷. Following elicitation of tap root derived P. ginseng suspension cells, cultured using a 3 L air-lift bioreactor, ginsenoside F2 and gypenoside XVII accumulated to strikingly greater levels in P. ginseng CMCs relative to DDCs. Ginsenoside F2 and gypenoside XVII accrued to 791 and 4,425 mg/kg f.c.w., respectively (Fig. 3L). Previously, ginsenoside F2 has been reported to reach 33.3 mg/kg f.c.w. and gypenoside XVII 183.3 mg/kg f.c.w.²⁹ in ginseng roots. Thus, CMCs synthesis 23.8 and 24.1 fold more ginsenoside F2 and gypenoside XVII, respectively, than previously described sources. CMCs may therefore also be utilized for the production of ginsenosides.

[0181] Compounds of Panax ginseng CMCs were analyzed through HPLC-ELSD

(Younglin, Korea) and two major peaks were isolated. Isolated two compounds were identified as ginsenoside F2 and gypenoside XVII through LC-MS (Agilent, USA), 1H NMR, ¹³C NMR, and 2D NMR (Varian, USA). For quantification of ginsenoside F2 and gypenoside XVII in Panax ginseng CMCs, cultured cells were separated from the medium and were lyophilized. 100 mg of lyophilized cells were put into 2 mL of methanol (Sigma, USA), vortexed for 5 min, and were extracted for 1 hour. Cells were centrifuged at 8,000 x g for 3 min. After concentration of the supernatant, it was dissolved in 200 μΐ of methanol and filtered through 0.2 μιη filter for UPLC analysis. UPLC (Waters, USA) with a C18 column (BEH C18 1.7 μιη, 2.1 X 100 mm Waters, USA) was used for the analysis. Column temperature was 40 °C and the mobile phase was a mixture of water and acetonitrile (Burdick & Jackson, USA), flow rate of 0.4 ml/min. Water (solvent A) and acetonitrile (solvent B) as mobile phase with a linear gradient was used: (0 min : 0 % B, 9 min : 100 % B, 11 min : 100 % B, 11.2 min : 0 % B, 12 min : 0 % B). A UV-VIS detector monitored at 203 nm and the sample injection volume was 2 μΐ. Standard of gypenoside XVII were isolated in Unhwa Corp. Ginsenoside F2 was purchased from LKT Laboratories (USA).

Statistical Analysis

[0182] Statistical analysis was performed in R using the edgeR Bioconductor library¹⁰' ⁿ.

We sought to reduce problems created by varying library sizes and noise for lowly expressed genes, by stabilizing read counts by adding a small constant. Therefore we first re-scaled the read counts in each library by dividing by the sum of all read counts in the upper quartile of expression values¹² and afterwards added a constant factor C (C=10) to each count. This transformation alters the signal in such a way that differences between groups for lowly expressed contigs are less likely to be considered differentially expressed, while leaving high transcript counts largely untouched. Briefly, edgeR uses an over-dispersed Poisson distribution to model read count data, where the degree of over- dispersion is moderated using an empirical Bayes procedure. Differential expression is assessed using a modified version of Fisher's exact test. We ran edgeR according to the steps outlined in the library's tutorial (using parameter settings prior.n = 10, grid.length = 500). P-values were adjusted for the false discovery rate and we deemed a threshold of FDR <= 0.05 to be appropriate to detect differentially expressed contigs (n = 1,229).

[0183] In the latter analysis, we decided to first focus on only those differentially expressed contigs, that showed a considerably large change (i.e. the minimum difference between any replicates in both groups, DDC and CMC, was at least 10 transcripts per million (TPM)) and for which the direction of change was consistent between all replicates (i.e. all replicates are either higher or all replicates are lower in one group than in the other). We considered these filtered contigs (n = 563) the most interesting candidates for immediate study and held out the rest for further follow-up studies.

Example 9. Production of Catechin or Gallocatechin from Ginkgo

[0184] CMCs derived from a Ginkgo tree were cultured in suspension following the same method described in Example 2. DDCs of a Gingko tree were obtained from bark and pith and cultured in suspension up to 3L bioreactor. The Gingko CMCs were cultured in the dark for 14 days in sterilized water with 3-5 weight % (g/L) raw sugar and lOOuM of methyl jasmonate for production of catechin and gallocatechin. The CMCs were then collected.

[0185] The CMCs separated from the production medium were freeze-dried. About 20 mg of the freeze-dried cells were dissolved in 600 μ& of methanol (Sigma), vortexed, and undergone sonication for one hour. The resulting solution (600 βί) was extracted and centrifuged at 13000 rpm for 5 min, filtered with 0.2 μηι filter, and analyzed with HPLC.

[0186] C18 column (Watchers 100 ODS-P, 250 X 4.6 (5pm)) was used for HPLC

(Agilent) analysis. The mobile phase was in water and acetonitrile (Burdick & Jackson) and flow rate was lml/min. The mobile phase gradient of water (solvent A) and acetonitrile (solvent B) was (0 min : 5 % B, 30 min: 30 % B, 40 min : 100 % B, 50 min : 100 % B, 50.1 min : 10%). UV-VIS detector was 210nm. Sample injection was 20≠. Catechin and gallocatechin (for control) was purchased from Sigma.

Other Embodiments

[0187] From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

[0188] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

[0189] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Citations

The following documents are cited herein and incorporated by reference.

1. Schmidt, B.M., Ribnicky, D.M., Lipsky, P.E. & Raskin, I. Revisiting the ancient concept of botanical therapeutics. Nature Chem. Biol. 3, 360-366 (2007).

2. Croteau, R., Ketchum, R.E.B., Long, R.M., Kaspera, R. & Wildung, M.R. Taxol biosynthesis and molecular genetics. Phytochemistr Reviews 5, 75-97 (2006).

3. Roberts, S.C. Production and engineering of terpenoids in plant cell culture. Nature Chem. Biol. 3, 387-395 (2007).

4. Laux, T. The stem cell concept in plants: A matter of debate. Cell 1 13, 281-283

(2003).

5. Thorpe, T.A. History of plant tissue culture. Mol. Biotechnol. 37, 169-180 (2007).

6. Sugimoto, K., Jiao, Y. & Meyerowitz, E.M. Arabidopsis regeneration from multiple tissues occurs via a root development pathway. Dev. Cell 18, 463-471 (2010).

7. Grafi, G., Ben-Meir, H., Avivi, Y., Moshe, M., Dahan, Y. & Zemach, A. Histone methylation controls telomerase-independent telomere lengthening in cells undergoing dedifferentiation. Dev. Biol. 306, 838-846 (2007). 8. Baebler, S. et al. Establishment of cell suspension cultures of yew (Taxus x Media Rehd) and assessment of their genomic stability. In Vitro Cell. Dev. Biol.-Plant. 41, 338-343 (2005).

9. Ye, Z.-H. Vascular tissue differentiation and pattern formation in plants. Annu. Rev. Plant Biol. 53, 183-202 (2002).

10. Strobel et al. Taxol formation in yew-Taxus. Plant Science 92, 1-12 (1993).

1 1. Frankenstein, C, Eckstein, D., Schmitt, U. The onset of cambium activity - A matter of agreement? Dendrochronologia 23, 57-62 (2005).

12. Moore, R., Clark, W.D., Stern, K.R. & Vodopich, D. (ed.) Botany (Wm.C. Brown, 2460 Kerper Boulevard, Dubuque, I A 52001, 1995).

13. Turner, S., Gallois, P. & Brown, D. Tracheary element differentiation. Ann. Rev. Plant Biol. 58, 407-433 (2007).

14. Ito, Y., Nakanomyo, I., Motose, H., Iwamoto, K., Sawa, S., Dohmae, N. & Fukuda, H. Dodeca-CLE peptides as suppressors of plant stem cell differentiation. Science 313, 842-845 (2006).

15. Fulcher, N. & Sablowski, R. Hypersensitivity to DNA damage in plant stem cell niches. Proc. Natl. Acad. Sci. USA 106, 20984-20988 (2009).

16. Shendure, J. & Ji, H. Next-generation DNA sequencing. Nature Biotech. 26, 1135-1145 (2008).

17. Fischer, K. & Turner, S. PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development. Curr. Biol. 17, 1061-1066 (2007).

18. Mahonen, A.P., Bonke, M., Kauppinen, L., Riikonen, M., Benfey, P.N. & Helariutta, Y. A novel two-component hybrid molecule regulates vascular morphogenesis of the Arabidopsis root. Genes & Dev. 14, 2938-2943 (2000).

19. Nieminen, K. et al. Cytokinin signaling regulates cambial development in popular. Proc. Natl. Acad. Sci. USA 105, 20032-20037 (2008).

20. Rando, T.A. The immortal strand hypothesis: segregation and reconstruction. Cell 129, 1239-1243 (2007).

21. Joshi, J.B., Elias, C.B., Patole, M.S. Role of hydrodynamic shear in the cultivation of animal, plant and microbial cells. The Chemical Engineering Journal 62, 121-141 (1996). 22. Wang, C, Wu, J. & Mei, X. Enhanced taxol production and release in Tcaus chinesis cell suspension cultures with selected organic solvents and sucrose feeding. Biotechnol. Prog. 17, 89-94 (2001).

23. Mirjalili, N. & Linden, J.C. Methyl jasmonate induced production of Taxol in suspension cultures of Taxus cuspidata: Ethylene interaction and induction models. Biotechnol. Prog. 12, 1 10-1 18 (1996).

24. Wu, Z.L., Yuan, Y.-J., Ma, Z.-H. & Hu, Z.D. Kinetics of two-liquid-phase Taxus cuspidata cell culture for production of Taxol. Biochem. Eng. J. 5, 137-142 (2000).

25. Yang, S.-J., Fang, J.-M. & Cheng, Y.-S. Lignans, flavonoids and phenolic derivatives from Taxus mairei. J. Chinese Chem. Soc. 46, 81 1-818 (1999).

26. Masayoshi Ando et al. Production of biologically active taxoids by a callus culture of Taxus cuspidata. J. Nat. Prod. 67, 58-63 (2004).

27. Leung, K.W. & Wong, A.S.-T. Pharmacology of ginsenosides: a literature review. Chinese Med. 5, 20 (2010).

28. Wei Jia et al. Metabolite profiling of Panax notoginseng using UPLC-ESI-MS. Phytochemistry 69, 2237-2244(2008).

29. L. Bruce Reynolds. Effects of harvest date on some chemical and physical characteristics of American ginseng (Panax quinquefolius L.). J. Herbs, Spices & Medicinal Plants. 6, 63-69(1998).

30. Kutchan, T. & Dixon, R.A. Physiology and metabolism: Secondary metabolism: nature's chemical reservoir under deconvolution. Curr. Opin. Plant Biol. 8, 227-229 (2005).

Claims

WHAT IS CLAIMED IS:

1. A method for characterizing a homogenous plant stem cell line, comprising (a) identifying levels of transcription of specific genes in a test plant stem cell line; and (b) comparing the transcription levels to a reference transcriptome pattern of a reference homogenous plant stem cell line, said reference transciptome pattern comprising: (i) up regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; (ii) down regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; or (iii) a combination of (i) and (ii), wherein said up regulation and down regulation is relative to a reference dedifferentiated plant cell line (DDC).

2. The method of claim 1, wherein said reference transcriptome pattern comprises enhanced expression of stress and/or biotic defense response genes.

3. The method of claim 1 or claim 2, wherein said test plant stem cell line is a cambial meristematic cell line (CMC) derived from cambium or procambium tissue.

4. The method of any one of claims 1-3, wherein said characterizing comprises (a) isolation of said test plant stem cell line; (b) validation of said test plant stem cell line; (c) generation of said test plant stem cell line, or (d) a combination of any two or more of (a), (b) and (c).

5. The method of any one of claims 2-4, wherein said stress and biotic defense response genes control Gene Ontology (GO) cellular functions selected from the group consisting of cell wall processes, protein metabolism, lipid metabolism, DNA metabolic processes, carbohydrate metabolic processes, response to stress, oxidation/reduction, transport, signal transduction, defense response, and a combination of two or more of said cellular functions.

6. The method of any one of claims 1 -5, wherein said reference homogenous plant stem cell line is characterized by up regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig27072, contig36802, contigl8649, contig33753, contigl6476, contig30863, contig04592, contigl2100, contig34959, cont ig07908, conti g03652, contig07376, contig25130, contig02856, contig00912, cont ig09859, cont] ig05416, contig04089, contig04097, contig 13706, contig02426, cont Lg2601 1, conti Lg08875, contig32752, contig22973, contig06930, contig25806, cont ig34590, cont Lg23215, contig01413, contig21273, contig08488, contig 11520, cont igl5994, cont ig23891, contig22565, contig06359, contig27519, contigl2256, cont ig35410, cont igl4051, contig00617, contig36068, contig05291, contig34083, cont ig24918, cont ig01898, contig32989, contigl3128, contig04152, contig30526, cont ig36027, cont ig25515, contig25115, contig 14790, contig 18732, contig02427, cont Lg30421, cont ig26817, contig25250, contig04439, contig 16267, contig05040, cont igl2255, cont igl3372, contig34839, contig23084, contig00857, contig 1 1456, cont ig21219, cont ig21862, contigl4978, contig28943, contig 13724, contig26748, cont ig00718, cont ig01805, contig36075, contig29817, contig24743, contig 18810, cont ig05557, cont ig 13949, contig31211, contig27710, contig34607, contig09523, cont ig29684, cont ig 12698, contig20794, contig34615, contig30162, contig 18423, cont ig27918, cont igl3665, contig00739, contigl l533, contig23048, contig24462, cont ig34586, cont ig21560, contig07958, contig03138, contig00738, contig07422, cont igl 8233, cont ig26946, contig07532, contig27474, contig 19027, contig05995, cont ig20249, cont ig35409, contig 17665, contig08101, contig02455, contig33166, cont ig05274, cont tg05310, contig26747, contig20416, contig00872, contig34059, cont ig24010, cont Lg36449, contig09464, contig09299, contig23126, contig09881, cont ig05165, cont ig00027, contig34877, contig08970, contig03741, contig 14405, cont igl 5398, cont ig07669, contig25139, contig26273, contig 15034, contig00946, cont ig07109, cont igl0106, contig06648, contig28245, contig 12239, contig07072, cont LgOOl 15, cont ig31132, contig24645, contig06416, contig 15685, contig 17084, cont igl6931, cont ig 10642, contig01072, contig26198, contig08428, contig20265, cont igl3497, cont ig30742, contig03757, contig04703, contig08669, contig 11080, cont igl0277, cont ig30801 , contig33088, contig04997, contig34040, contigl2808, cont ig23659, cont ig03990, contig22241, contigl8812, contig21293, contig 12482, cont igl3687, cont ig06626, contigl0736, contig 16844, contig34589, contig35288, cont ig27145, cont ig241 17, contig 10948, contig33616, contig 19286, contig03396, cont Lg35423, cont igl 5918, contig 15623, contig00237, contig24745, contigl7057, cont ig03296, cont ig06707, contigl8332, contig03402, contigl7841, contig 10577, contig04386, contig22709, contig32799, contig 17854, contig24270, contig 18201, contig09655, contig20801, contig05083, contig07531, contig07921, contig04473, contig04392, contig03316, contig00103, contig33905, contigl7735, contig 14677, contig 16098, contig07690, contig28331, contig27541, contig02712, contig05143, contig08273, contig20804, contig06171, contig21572, contig06910, contig08569, contig04028, contig 11628, contig06116, contig06409, contigl3142, contig 16016, contig00459, contig 19226, contig05694, contig 15453, contig 15843, contig07218, contig 10959, contig09693, contig00805, contig 10665, contig33287, contig01120, contig04567, contig05893, contig32410, contig 1731 1, contig 15714, contig01291, contigl51 1 1, contig 16536, contig22190, contig 10786, contig09809, contig 1 1631, contig21287, contig01009, contig26412, contig 16668, contig09566, contig 16046, contig00039, contig06098, contig05655, contig 16947, contig 14389, contig 13624, contig01547, contig03758, contig02817, contigl3673, contig 12644, contig08074, contig08296, contig29327, contig 14317, contig34517, contig27942, contig00556, contig 19260, contig03298, contig01782, contig07930, contig 10342, contig 10721, contigl3080, contig07064, contig02893, contig32957, contigl5387, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof.

7. The method of any one of claims 1-5, wherein said reference homogenous plant stem cell line is characterized by down regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%), 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig34310, contig 1741 1, contig08064, contig33838, contig22966, contig09529, contig01 107, contigl9383, contig 12597, contig3241 1, contig34486, contig07578, contig01850, contig 19743, contig33960, contig02354, contigl2160, contig02705, contig21258, contig04524, contig06272, contig 19859, contig33172, contig 10947, contig 18316, contig33880, contig 10004, contig02419, contig 16070, contig21375, contig 10847, contig00468, contig00002, contig33554, contig33997, contig23679, contig09322, contig06900, contig 10758, contig08205, contig 10699, contig09833, contig09931, contig33959, contig02060, contig03887, contig 18382, contig05609, contig08869, contig05076, contig04684, contig06973, contig 12529, contig05287, contig09647, contig 13051, contig02424, contig34558, contig07776, contig23772, cont g33898, contig 17982, contig09216, contig33532, contigl6700, contig 11441 , conti g21147, contig 12890, contig 13202, contig03620, contig09300, contig 1 1096, conti g02556, contigl4130, contig03215, contig24326, contig 16464, contigl 5519, conti g08200, contig05323, contig02095, contig25516, contig07288, contigl4554, conti g36355, contig05532, contig06414, contigl7824, contigl 3582, contig 1 1451 , cont gl l642, contig06450, contig03544, contig23484, contig02223, contig21637, cont g09410, contigl l580, contigl0719, contig 13397, contig32893, contig 19387, cont gl4914, contig20795, contig09388, contig02721, contig32962, contig 15296, cont g05465, contig33042, contig 14636, contig 19438, contig 17863, contig 11094, cont g03276, contig09056, contig09138, contig03597, contig05704, contigl 8830, cont igl6014, contig30246, contig34327, contig 19429, contig00701 , contig33045, cont ig07474, contig 13819, contig01406, contig05528, contig09066, contigl 3935, cont ig01983, contig02362, contig24551, contig06834, contig 14849, contig01636, cont igl0645, contig 16883, contig2851 1, contig 14963, contig34143, contig07304, cont tg02383, contigl6551, contig03127, contig33455, contig 12015, contigl7537, cont [gl61 12, contig22484, contig201 19, contig01276, contig23453, contig32318, cont Lgl6504, contigl6185, contig05722, contig 19556, contig25983, contig 12014, cont Lgl l683, contigl2198, contig34765, contigl6556, contig 12353, contig04767, cont igl l408, contig 19754, contig27189, contig 10091, contig24063, contig02767, cont igl9337, contig06243, contig33472, contig03538, contig06062, contig08567, cont igl6727, contig08095, contig06229, contig09609, contig 12716, contig21523, cont ig23414, contig07574, contig 15828, contig 10974, contig20508, contig08071, cont ig33050, contig 10613, contig00982, contig36231, contig20970, contig33961 , cont Lgl0305, contig 17594, contig07796, contig00643, contig07564, contig06296, cont ig35356, contig20971, contig09723, contig01 181, contig01 124, contig 15401 , cont Lgl 1227, contig09952, contigl 8745, contig05187, contig23461, contig05785, cont igl2739, contig35804, contig 16074, contig06222, contig02210, contig35585, cont igl7838, contig03513, contig00242, contig33761, contig221 19, contig07194, cont ig02988, contigl2369, contig 19741, contig20583, contig07970, contig22910, cont ig36415, contig 10027, contig 15960, contig04735, contigl l 877, contig35933, cont ig09340, contig26284, contigl 5011, contig32060, contig01847, contig 18311 , cont ig36295, contig23275, contigl 8138, contig22625, contig36528, contig32627, contig20216, contig 10242, contig 14727, contigl3174, contig 13598, contig 19561, contig33990, contig01380, contig35561, contigl5552, contigl4347, contigl9726, contig34643, contig36559, contig32396, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof.

The method of any one of claims 1-6, wherein said reference homogenous plant stem cell line is characterized by up regulated transcription of a gene homolog or fragment thereof selected from the group consisting of (a) a PXY gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 or a fragment thereof; (b) a WOL gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T cuspidata contig 10710, at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496, or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499, or a fragment thereof; (c) the complement of (a) or (b); and (d) a combination of two or more of (a), (b), and (c).

The method of any one of claims 1-8, wherein said test plant stem cell line is derived from a plant genus selected from the group consisting of Panax, Taxus, Ginkgo, and Solanum.

The method of claim 9, wherein said test plant stem cell line is derived from Panax ginseng, Taxus cuspidata, Ginkgo biloba, or Solanum lycopersicon.

A marker gene homolog for identifying a CMC comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig27072, contig36802, contigl8649, contig33753, contigl6476, contig30863, contig04592, contigl2100, contig34959, contig07908, contig03652, contig07376, contig25130, contig02856, contig00912, contig09859, contig05416, contig04089, contig04097, contigl3706, contig02426, contig26011, contig08875, contig32752, contig22973, contig06930, contig25806, contig34590, contig23215, contig01413, contig21273, contig08488, contigl l520, contigl5994, contig23891, contig22565, contig06359, contig27519, contigl2256, contig35410, cont igl4051, cont ig00617, contig36068, cont ig05291, cont Lg34083, contig24918, cont ig01898, cont ig32989, contigl3128, cont ig04152, conti g30526, contig36027, cont ig25515, cont ig25115, contig 14790, cont tgl 8732, conti Lg02427, contig30421, cont ig26817, cont ig25250, contig04439, cont igl6267, cont] ig05040, contigl 2255, cont igl3372, cont ig34839, contig23084, cont ig00857, conti gH456, contig21219, cont ig21862, cont igl4978, contig28943, cont igl3724, conti g26748, contig00718, cont ig01805, cont ig36075, contig29817, cont ig24743, cont gl8810, contig05557, cont igl3949, cont ig31211, contig27710, cont ig34607, cont ig09523, contig29684, cont igl2698, cont ig20794, contig34615, cont ig30162, cont ig 18423, contig27918, cont igl3665, cont ig00739, contigl 1533, cont ig23048, cont ig24462, contig34586, cont ig21560, cont ig07958, contig03138, cont ig00738, cont ig07422, contigl 8233, cont ig26946, cont ig07532, contig27474, cont igl9027, cont ig05995, contig20249, cont ig35409, cont igl7665, contig08101, cont ig02455, cont ig33166, contig05274, cont ig05310, cont ig26747, contig20416, cont ig00872, cont ig34059, contig24010, cont ig36449, cont ig09464, contig09299, cont ig23126, cont ig09881, contig05165, cont ig00027, cont ig34877, contig08970, cont Lg03741, cont igl4405, contigl 5398, cont ig07669, cont ig25139, contig26273, cont tgl5034, cont ig00946, contig07109, cont igl0106, cont ig06648, contig28245, cont _lg12239, cont ig07072, contig001 15, cont ig31132, cont ig24645, contig06416, cont igl5685, cont igl7084, contig 16931, cont ig 10642, cont ig01072, contig26198, cont ig08428, cont ig20265, contigl 3497, cont ig30742, cont ig03757, contig04703, cont ig08669, cont igl l080, contig 10277, cont ig30801, cont ig33088, contig04997, cont ig34040, cont igl2808, contig23659, cont ig03990, cont ig22241, contigl 8812, cont ig21293, cont igl2482, contigl 3687, cont ig06626, cont igl0736, contig 16844, cont ig34589, cont ig35288, contig27145, cont ig24117, cont ig 10948, contig33616, cont Lgl9286, cont ig03396, contig35423, cont igl5918, cont igl5623, contig00237, cont Lg24745, cont igl7057, contig03296, cont ig06707, cont igl 8332, contig03402, cont igl7841, cont igl0577, contig04386, cont ig22709, cont ig32799, contigl 7854, cont ig24270, cont igl8201, contig09655, cont ig20801, cont ig05083, contig07531 , cont Lg07921, cont ig04473, contig04392, cont ig03316, cont ig00103, contig33905, cont igl7735, cont igl4677, contigl 6098, cont ig07690, cont ig28331, contig27541, cont g02712, cont ig05143, contig08273, cont ig20804, cont ig06171, contig21572, cont ig06910, cont ig08569, contig04028, contigl l628, contig061 16, contig06409, contigl3142, contig 16016, contig00459, contig 19226, contig05694, contigl5453, contig 15843, contig07218, contig 10959, contig09693, contig00805, contig 10665, contig33287, contig01 120, contig04567, contig05893, contig32410, contig 1731 1, contig 15714, contig01291, contigl5111, contig 16536, contig22190, contig 10786, contig09809, contig 11631, contig21287, contig01009, contig26412, contig 16668, contig09566, contig 16046, contig00039, contig06098, contig05655, contig 16947, contigl4389, contig 13624, contig01547, contig03758, contig02817, contig 13673, contig 12644, contig08074, contig08296, contig29327, contig 14317, contig34517, contig27942, contig00556, contig 19260, contig03298, contig01782, contig07930, contig 10342, contig 10721, contigl3080, contig07064, contig02893, contig32957, contigl5387, the complement of any of said T. cuspidata contigs, and a combination of two or more of said T. cuspidata contigs or complements thereof, wherein said marker gene homolog is up regulated in CMC relative to DDC.

A marker gene homolog for identifying a CMC comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig34310, contigl7411, contig08064, contig33838, cont ig22966, contig09529, contig01107, contigl9383, contig 12597, contig32411, cont ig34486, contig07578, contig01850, contig 19743, contig33960, contig02354, cont igl2160, contig02705, contig21258, contig04524, contig06272, contig 19859, cont ig33172, contig 10947, contig 18316, contig33880, contig 10004, contig02419, cont igl6070, contig21375, contig 10847, contig00468, contig00002, contig33554, cont g33997, contig23679, contig09322, contig06900, contig 10758, contig08205, cont g 10699, contig09833, contig09931, contig33959, contig02060, contig03887, cont igl 8382, contig05609, contig08869, contig05076, contig04684, contig06973, cont igl2529, contig05287, contig09647, contig 13051, contig02424, contig34558, cont ig07776, contig23772, contig33898, contig 17982, contig09216, contig33532, cont ig 16700, contig 11441, contig21147, contig 12890, contig 13202, contig03620, cont ig09300, contig 11096, contig02556, contigl4130, contig03215, contig24326, cont ig 16464, contigl5519, contig08200, contig05323, contig02095, contig25516, cont ig07288, contig 14554, contig36355, contig05532, contig06414, contig 17824, cont igl3582, contig 1 1451, contig 1 1642, contig06450, contig03544, contig23484, conti g02223, contig21637, contig09410, cont igl l580, contig 10719, contig 13397, conti g32893, contigl9387, contig 14914, cont ig20795, contig09388, contig02721, conti g32962, contig 15296, contig05465, cont ig33042, contig 14636, contig 19438, conti gl7863, contig 1 1094, contig03276, cont ig09056, contig09138, contig03597, conti g05704, contigl 8830, contig 16014, cont ig30246, contig34327, contig 19429, conti g00701, contig33045, contig07474, cont igl3819, contig01406, contig05528, conti g09066, contig 13935, contig01983, cont ig02362, contig24551, contig06834, conti gl4849, contig01636, contigl0645, cont igl6883, contig2851 1, contig 14963, conti g34143, contig07304, contig02383, cont igl6551 , contig03127, contig33455, cont Lgl2015, contigl7537, contigl6112, cont ig22484, contig20119, contig01276, cont ig23453, contig32318, contig 16504, cont igl6185, contig05722, contigl9556, cont ig25983, contig 12014, contig 11683, cont igl2198, contig34765, contigl6556, cont igl2353, contig04767, contig 11408, cont igl9754, contig27189, contig 10091, cont ig24063, contig02767, contig 19337, cont ig06243, contig33472, contig03538, cont ig06062, contig08567, contig 16727, cont ig08095, contig06229, contig09609, cont igl2716, contig21523, contig23414, cont ig07574, contigl5828, contig 10974, cont ig20508, contig08071, contig33050, cont igl0613, contig00982, contig36231, cont ig20970, contig33961, contigl0305, cont igl7594, contig07796, contig00643, cont ig07564, contig06296, contig35356, cont ig20971, contig09723, contig01181, cont tg01124, contig 15401, contig 11227, cont ig09952, contig 18745, contig05187, cont ig23461, contig05785, contig 12739, cont ig35804, contig 16074, contig06222, cont ig02210, contig35585, contig 17838, cont Lg03513, contig00242, contig33761, cont Lg22119, contig07194, contig02988, cont igl2369, contig 19741, contig20583, cont ig07970, contig22910, contig36415, cont ig 10027, contig 15960, contig04735, cont igl l 877, contig35933, contig09340, cont ig26284, contigl 5011, contig32060, cont ig01847, contig 18311, contig36295, cont ig23275, contigl 8138, contig22625, cont ig36528, contig32627, contig20216, cont ig 10242, contig 14727, contigl3174, cont igl3598, contig 19561, contig33990, cont ig01380, contig35561, contigl5552, cont igl4347, contigl9726, contig34643, contig36559, contig32396, the complement of any of said T. of two

contigs or complements thereof, wherein said marker gene homolog is down regulated in CMC relative to DDC.

13. The method of any one of claims 1-6 or 8-10, or the marker gene homolog of claim 11, wherein the marker gene homolog is a stress response gene and/or biotic defense response gene.

14. A set of marker gene homologs comprising at least 5, 10, 20, 30, 50, 70, or 100 of the marker gene homologs of claim 11 and/or claim 12.

15. A marker protein for identifying CMC, encoded by a marker gene homolog of claim 11 and/or claim 12.

16. A set of marker proteins comprising at least 5, 10, 20, 30, 50, 70, or 100 of the marker proteins of claim 15.

17. A CMC plant stem cell line characterized by up regulated expression of one or more genes at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs of claim 11 relative to expression in a reference DDC cell line.

18. A CMC plant stem cell line characterized by down regulated expression of one or more genes at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs of claim 12 relative to expression in a reference DDC cell line.

19. The CMC plant stem cell line of claim 17, having increased expression of a PXY gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 or a fragment thereof; and/or a WOL gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 10710 (SEQ ID NO: 10710), at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496 (SEQ ID NO: 07496), or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499 (SEQ ID NO: 25499) or a fragment thereof.

20. The CMC plant stem cell line of any one of claims 17-19, derived from a plant genus selected from the group consisting of Panax, Taxus, Ginkgo and Solanum.

21. The CMC plant stem cell line of claim 20, wherein said test plant stem cell line is derived from Panax ginseng, Taxus cuspidata, Ginkgo biloba, or Solanum lycopersicon.

22. The CMC plant cell line of any one of claims 17-21, which produces a ginsenoside.

23. The CMC plant cell line of claim 22, wherein one or more, two or more, three or more, four or more, or five or more nucleic acids encoding key enzymes integral to the biosynthesis of ginsenosides are up regulated.

24. The CMC plant cell line of claim 22 or claim 23, wherein said ginsenoside is selected from the group consisting of ginsenoside F2, gypenoside XVII, and a combination thereof.

25. The CMC plant cell line of any one of claims 22-24, which produces at least about 100, 200, 300, 400, 500, 600, or 700 mg/kg fresh cell weight (FCW) of Ginsenoside F2 and/or at least about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 mg/kg FCW of gypenoside XVII.

26. A method of producing a ginsenoside, comprising culturing the CMC plant cell line of any one of claims 22-25, and recovering said ginsenoside.

27. The CMC plant cell line of any one of claims 17-21, which produces an abietane tricyclic diterpenoid derivative.

28. The CMC plant cell line of claim 27, wherein one or more, two or more, three or more, four or more, or five or more nucleic acids encoding key enzymes integral to the biosynthesis of abietane tricyclic diterpenoid derivatives are up regulated.

29. The CMC plant cell line of claim 27 or claim 28, wherein said abietane tricyclic diterpenoid derivative is selected from the group consisting of Taxamairin A, Taxamairin C, and a combination thereof.

30. The CMC plant cell line of any one of claims 27-29, which produces at least about 50, 100, 200, 300, 400, or 500 mg/kg FCW of taxamairin C and/or at least about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, or 4000 mg/kg FCW of taxamairin A.

31. A method of producing an abietane tricyclic diterpenoid derivative, comprising culturing the CMC plant cell line of any one of claims 27-30, and recovering said abietane tricyclic diterpenoid derivative.

32. The method of claim 26 or claim 31, when said CMC plant cell line is subjected to perfusion culture.

33. A method for isolating a CMC plant stem cell, the method comprising:

(a) providing a tissue from a plant;

(b) isolating from the plant tissue a tissue containing procambium or cambium;

(c) culturing said procambium or cambium tissue; and

(d) selecting a CMC plant stem cell from the cultured tissue characterized by up regulation of one or more marker gene homologs of claim 1 1, and/or down regulation of one or more marker gene homologs of claim 12.

34. The method according to claim 33, wherein the procambium or cambium tissue is cultured in a culture medium comprising auxin.

35. The method of claim 34, wherein the medium contains about 0.1-3 mg/L of auxin.

36. The method of any one of claims 33-35, wherein the plant is from the genus Taxus, Panax, Ginkgo, or Solanum.

37. The method of claim 36, where is said plant is Panax ginseng, Taxus cuspidata, Ginkgo biloba, or Solanum lycopersicon.

38. The method of any one of claims 33-37, further comprising sterilizing the plant tissue.

39. The method of claim 1, wherein said reference homogenous plant stem cell line is originated from cambium or procambium tissue, and wherein said reference dedifferentiated plant cell line is originated from phloem, cortex and/or epidermal tissues.

40. A method for characterizing a homogenous plant stem cell line, comprising (a) identifying levels of transcription of specific genes in a test plant stem cell line; and (b) comparing the transcription levels to a reference transcriptome pattern of a reference homogenous plant stem cell line, said reference transciptome pattern comprising: (i) up regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; (ii) down regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; or (iii) a combination of (i) and (ii), wherein said up regulation and down regulation is relative to a reference dedifferentiated plant cell line (DDC),

The method of claim 40, wherein said reference homogenous plant stem cell line is characterized by up regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig27072, cont ig33753, contigl2100, contig07908, contig02856, contig00912, contig05416, cont igl3706, contig02426, contig2601 1, contig08875, contig32752, contig34590, cont ig01413, contig08488, contig23891, contig22565, contig06359, contig27519, cont igl2256, contig 14051, contig00617, contig36068, contig34083, contig32989, cont ig30526, contig36027, contig25115, contig 14790, contig 18732, contig02427, cont ig25250, contig05040, contigl2255, contig23084, contig00857, contig21862, cont ig28943, contig 13724, contig36075, contig3121 1, contig34607, contig09523, cont ig29684, contig20794, contig30162, contig27918, contig00739, contig24462, cont ig34586, contig07958, contig03138, contig00738, contig27474, contig35409, cont igl7665, contig33166, contig05274, contig05310, contig00872, contig24010, cont ig36449, contig09881, contig34877, contig25139, contig06648, contig 12239, cont ig00115, contig24645, contig06416, contig 17084, contig 10642, contig20265, cont ig 13497, contig30742, contig33088, contig22241, contig 16844, contig35288, cont ig27145, contig241 17, contig 19286, contig35423, contig03296, contig24270, cont ig09655, contig04392, contig33905, contig 17735, contig 16098, contig02712, cont ig08273, contig06910, contig33287, contig04567, contig26412, contigl6046, and any combinations thereof.

The method of claim 41 or claim 42, wherein said reference homogenous plant stem cell line is characterized by down regulated transcription of a marker gene homolog or fragment thereof comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig08064, contig07578, contig33960, contigl0758, contig09647, contig33532, contigl6700, contig03620, contig06414, contigl9387, contig02721, contigl 5296, contigl7863, contig00701, contig28511, contigl4963, contig22484, contigl9556, contig25983, contigl6556, contig27189, contigl0091, contig24063, contigl0613, contig20970, contigl7594, contigl l227, contig35804, contig06222, contig35585, contig07194, contig20583, contig36415, contig26284, contigl 5011, contig32060, contigl 831 1, contig36295, contigl 8138, contig22625, contig36528, contigl4727, contigl3598, contigl9561, contig33990, contig36559, contig32396, and any combinations thereof.

43. The method of claim 40, wherein said test plant stem cell line is a cambial meristematic cell line (CMC) derived from cambium or procambium tissue.

44. The method of any one of claims 40-43, wherein the test plant stem cell line is derived from Taxus.

45. The method of claim 44, wherein said test plant stem cell line is derived from Taxus cuspidata.

46. The method of any one of claims 40 to 45, wherein said characterizing comprises (a) isolation of said test plant stem cell line; (b) validation of said test plant stem cell line; (c) generation of said test plant stem cell line, or (d) a combination of any two or more of (a), (b) and (c).

47. The method of any one of claims 40 to 46, wherein the reference homogenous plant stem cell line is characterized by up regulated transcription of a gene homolog or fragment thereof selected from the group consisting of (a) a PXY gene homolog comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 01805 or a fragment thereof; (b) a WOL gene homolog comprising a sequence at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to T. cuspidata contig 10710 (SEQ ID NO: 10710), at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 07496 (SEQ ID NO: 07496), or at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig 25499 (SEQ ID NO: 25499), or a fragment thereof; (c) the complement of (a) or (b); and (d) a combination of two or more of (a), (b), and (c).

A marker gene homolog for identifying a CMC comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig27072, contig33753, contigl2100, contig07908, cont g02856, contig00912, contig05416, contig 13706, contig02426, contig2601 1, cont g08875, contig32752, contig34590, contig01413, contig08488, contig23891 , cont g22565, contig06359, contig27519, contig 12256, contig 14051 , contig00617, cont ig36068, contig34083, contig32989, contig30526, contig36027, contig251 15, cont igl4790, contig 18732, contig02427, contig25250, contig05040, contigl2255, cont ig23084, contig00857, contig21862, contig28943, contig 13724, contig36075, cont Lg3121 1, contig34607, contig09523, contig29684, contig20794, contig30162, cont ig27918, contig00739, contig24462, contig34586, contig07958, contig03138, cont ig00738, contig27474, contig35409, contig 17665, contig33166, contig05274, cont ig05310, contig00872, contig24010, contig36449, contig09881, contig34877, cont ig25139, contig06648, contig 12239, contig001 15, contig24645, contig06416, cont igl 7084, contig 10642, contig20265, contig 13497, contig30742, contig33088, cont ig22241 , contig 16844, contig35288, contig27145, contig241 17, contig 19286, cont ig35423, contig03296, contig24270, contig09655, contig04392, contig33905, cont Lgl 7735, contigl 6098, contig02712, contig08273, contig06910, contig33287, cont ig04567, contig26412, contig 16046, and any combinations thereof.

A marker gene homolog for identifying a CMC comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to T. cuspidata contig selected from the group consisting of contig08064, contig07578, contig33960, contig 10758, contig09647, contig33532, contigl6700, contig03620, contig06414, contigl 9387, contig02721 , contigl 5296, contigl 7863, contig00701, contig2851 1 , contigl4963, contig22484, contigl 9556, contig25983, contigl6556, contig27189, contigl0091 , contig24063, contigl0613, contig20970, contigl 7594, contigl l227, contig35804, contig06222, contig35585, contig07194, contig20583, contig36415, contig26284, contigl 501 1 , contig32060, contigl 831 1, contig36295, contigl 8138, contig22625, contig36528, contigl4727, contigl3598, contigl9561, contig33990, contig36559, contig32396, and any combinations thereof.

50. A set of marker gene homologs comprising at least 5, 10, 20, 30, 50, 70, or 100 of the marker gene homologs of claim 48 or 49.

51. A marker protein for identifying CMC, encoded by a marker gene homolog of claim 48 or 49.

52. A set of marker proteins comprising at least 5, 10, 20, 30, 50, 70, or 100 of the marker proteins of claim 51.

53. A CMC plant stem cell line characterized by up regulated expression of one or more genes at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more marker gene homologs of claim 48 or 49 relative to expression in a reference DDC cell line.

54. A method for isolating a CMC plant stem cell, the method comprising:

(a) providing a tissue from a plant;

(b) isolating from the plant tissue a tissue containing procambium or cambium;

(c) culturing said procambium or cambium tissue; and

(d) selecting a CMC plant stem cell from the cultured tissue characterized by up regulation of one or more marker gene homologs of claim 48, and/or down

. regulation of one or more marker gene homologs of claim 49.

55. The method according to claim 54, wherein the procambium or cambium tissue is cultured in a culture medium comprising auxin.

56. The method of claim 55, wherein the medium contains about 0.1-3 mg/L of auxin.

57. The method of any one of claims 54-56, wherein the plant is from the genus Taxus.

58. The method of claim 57, wherein said plant is Taxus cuspidata.

59. The method of any one of claims 54-58, further comprising sterilizing the plant tissue.

An isolated nucleotide sequence comprising a nucleic acid sequence or a complement thereof, wherein the nucleic acid sequence is at least 70%, 80%>, 90%>, 95%, 96%, 97%., 98%., 99%), or 100% identical to one or more contigs selected from the group consisting of contig27072, contig33753, contigl2100, contig07908, contig02856, contig00912, contig05416, contigl3706, contig02426, contig2601 1, contig08875, contig32752, contig34590, contig01413, contig08488, contig23891, contig22565, contig06359, contig27519, contig 12256, contig 14051, contig00617, contig36068, contig34083, contig32989, contig30526, contig36027, contig251 15, contig 14790, contig 18732, contig02427, contig25250, contig05040, contigl2255, contig23084, contig00857, contig21862, contig28943, contig 13724, contig36075, contig3121 1, contig34607, contig09523, contig29684, contig20794, contig30162, contig27918, contig00739, contig24462, contig34586, contig07958, contig03138, contig00738, contig27474, contig35409, contigl7665, contig33166, contig05274, contig05310, contig00872, contig24010, contig36449, contig09881, contig34877, contig25139, contig06648, contigl2239, contig001 15, contig24645, contig06416, contig 17084, contigl0642, contig20265, contigl3497, contig30742, contig33088, contig22241 , contigl6844, contig35288, contig27145, contig24117, contig 19286, contig35423, contig03296, contig24270, contig09655, contig04392, contig33905, contig 17735, contig 16098, contig02712, contig08273, contig06910, contig33287, contig04567, contig26412, contig 16046, and any combinations thereof.

61. An isolated nucleotide sequence comprising a nucleic acid sequence or a complement thereof, wherein the nucleic acid sequence is at least 70%, 80%>, 90%>, 95%>, 96%, 97%., 98%), 99%, or 100%. identical to one or more contigs selected from the group consisting of contig08064, contig07578, contig33960, contigl0758, contig09647, contig33532, contigl6700, contig03620, contig06414, contigl9387, contig02721, contigl5296, contigl7863, contig00701, contig2851 1, contigl4963, contig22484, contigl9556, contig25983, contigl6556, contig27189, contigl0091, contig24063, contigl0613, contig20970, contigl7594, contigl l227, contig35804, contig06222, contig35585, contig07194, contig20583, contig36415, contig26284, contigl 501 1, contig32060, contigl831 1, contig36295, contigl 8138, contig22625, contig36528, contigl4727, contigl3598, contigl9561, contig33990, contig36559, contig32396, and any combinations thereof.

62. The nucleotide sequence of claim 60, which is up regulated in a Taxus CMC cell line compared to the corresponding nucleic acid sequence in a Taxus DDC cell line.

63. The nucleotide sequence of claim 61, which is down regulated in a Taxus CMC cell line copared to the corresponding nucleic acid sequence in a Taxus DDC cell line.

64. A set of nucleotide sequences comprising two or more nucleic acid sequences, wherein each of the two or more nucleic acid sequences comprises the nucleotide sequence of any one of claims 60 to 63.

65. A vector comprising the nucleotide sequence of any one of claims 58 to 61 or the set of nucleotide sequences of claim 64.

66. The vector of claim 65, wherein the nucleotide sequence or the set of nucleotide sequences is operably linked to a promoter.

67. A method of characterizing or identifying a CMC plant stem cell comprising:

(a) extracting RNA from a cell, and

(b) identifying up regulation of the nucleotide sequence of claim 60 or the marker gene homolog of claim 11 or down regulation of the nucleotide sequence of claim 61 or the marker gene homolog of claim 12, wherein at least one of the nucleotide sequences of claim 60, or at least one of the marker gene homologs of claim 11 is up regulated; or at least one of the nucleotide sequences of claim 61 or the marker gene homologs of claim 12 is down regulated.

68. The method of claim 67, wherein the up regulation of a nucleotide sequence of claim 60 or a marker gene homolog of claim 11 or the down regulation of a nucleotide sequence of claim 61 or a marker gene homolog of claim 12 is identified by RT-PCR.

69. The method of claim 68, wherein the RT-PCR utilizes at least two primers, each of which have at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology to one or more of the nucleotide sequences of claim 60 or 61, one or more of the marker gene homologs of claim 11 or 12, or fragments thereof.

70. The method of any one of claims 67to 69, wherein the plant is from the genus Taxus.

71. The method of any one of claims 70, wherein the plant is Taxus cuspidata.

72. A method of isolating a CMC cell line from a plant comprising innately undifferentiated cells isolated from the plant, wherein said cell line has meristematic continuity of plant meristem without going through dedifferentiation into callus comprising:

(a) obtaining a tissue containing innately undifferentiated CMC cells and at least one of phloem, cortex, or epidermis from the plant;

(b) culturing said tissue in a container containing medium by laying the side of the at least one of phloem, cortex, or epidermis from the plant on the medium, thereby inducing a layer proliferated from the innately undifferentiated CMC cells; and

(c) collecting innately undifferentiated CMC cells by isolating the layer.

73. The method of claim 72, wherein the tissue was obtained from a plant or a part thereof and stored at a temperature between 2 °C and 5 °C.

74. The method of claim 72 or 73, wherein the plant or part thereof in (a) was stored in an antioxidant solution.

75. The method of claim 74, wherein the antioxidant solution is a solution containing ascorbic acid, polyvinyl pyrrolidone (PVP), or both.

76. The method of claim 75, wherein the solution contains about 5 to 20 mg/L ascorbic acid or about 10 to 200 mg/L.

77. The method of claim 76, wherein the solution contains about 0.1 to 5 wieight % PVP.

78. The method of any one of claims 72 to 77, wherein the plant and part thereof in (a) is sterilized.

79. The method of any one of claims 72 to 78, wherein the tissue in (b) is obtained by removing the tissue containing innately undifferentiated CMC cells from xylem tissue.

80. The method of claim 78 or 79, wherein the tissue is removed without damaging the CMC cells and without mixing the xylem tissue.

81. The method of claim 78 or 79, wherein the removing is by peeling off the tissue containing innately undifferentiated CMC cells from the xylem tissue.

82. The method of any one of claims 72 to 81, wherein (d) comprises collecting the CMC cells from the layer proliferated in (c) by separating the CMC cells from the callus cells in the layers proliferated from the cells other than the CMC cells.

83. The method of any one of claims 1 to 10, further comprising measuring the number and/or activity of mitochondria in the test plant stem cell line, wherein the test plant stem cell line contains a higher number and/or higher activity of mitochondria compared to a DDC.

84. The method of any one of claims 1 to 10 and 83, further comprising measuring the test stem cell line's sensitivity to radiation or a radiomimetic drug, wherein the test plant stem cell line is more sensitive to the radiation or a radiomimetic drug compared to a DDC.

85. The method of any one of claims 1 to 10, 83, and 84, further comprising measuring the test stem cell line's ability to differentiate into a part of a plant other than a cambial tissue.

86. The method of claim 85, wherein the part of a plant other than a cambial tissue is a tracheary element (TE), wherein the test stem cell line is capable of differentiate into a TE while a DDC is not capable of differentiation to a TE.

87. A method of characterizing or identifying a CMC stem cell line comprising measuring one or more characteristics of a test plant stem cell line, wherein the one or more characteristics are selected from the group consisting of:

(a) a higher number of mitochondria compared to a DDC;

(b) a higher sensitivity to radiation or a radiomimetic drug; and (c) an ability to differentiate to a TE.

88. The method of claim 87, further comprising identifying levels of transcription of specific genes in the test plant stem cell line; and (b) comparing the transcription levels to a reference transcriptome pattern of a reference homogenous plant stem cell line, said reference transciptome pattern comprising: (i) up regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; (ii) down regulated transcription of one or more transcription contigs identified from said reference transcriptome pattern; or (iii) a combination of (i) and (ii), wherein said up regulation and down regulation is relative to a reference DDC.

89. The method of claim 87 or 88, further comprising one or more characteristics selected from the group consisting of:

(a) forming smaller-sized aggregates than the aggregates formed by cells derived from dedifferentiated callus of the plant;

(b) growing in a rate faster than cells derived from dedifferentiated callus of the plant;

(c) stably growing for a longer period than cells derived from dedifferentiated callus of the plant;

(d) having multiple vacuoles;

(e) having an ability to differentiate to a part of a plant other than a cambial tissue;

(f) comprising a greater number of single cells than cells derived from dedifferentiated callus of the plant; and

(g) having lower sensitivity to shear stress in a bioreactor than cells derived from dedifferentiated callus of the plant.

90. The method of claim 89, wherein the part of a plant other than a cambial tissue is a tracheary element.

91. A set of CMC biomarkers comprising the marker gene homolog of any one of claims 11, 12, 48, or 49, the set of marker gene homologs of claim 14 or 50, the marker protein of claim 15 or 51 , or the set of marker protein of claim 16 or 52.

92. The set of CMC biomarkers further comprising one or more characteristics selected from the group consisting of:

(a) a higher number of mitochondria compared to a DDC;

(b) a higher sensitivity to radiation or a radiomimetic drug; and

(c) an ability to differentiate to a TE.

93. The set of CMC biomarkers of claim 91 or 92, further comprising one or more characteristics selected from the group consisting of:

(a) an ability to form smaller-sized aggregates than the aggregates formed by cells derived from dedifferentiated callus of the plant;

(b) an ability to grow in a rate faster than cells derived from dedifferentiated callus of the plant;

(c) an ability to stably grow for a longer period than cells derived from dedifferentiated callus of the plant;

(d) multiple vacuoles;

(e) an ability to maintain a greater number of single cells than cells derived from dedifferentiated callus of the plant; and

(f) an ability of having lower sensitivity to shear stress in a bioreactor than cells derived from dedifferentiated callus of the plant.

94. A method of producing a biological substance from a CMC cell line comprising (a) culturing the CMC cell line in medium;

(b) providing an air stress to the CMC cell line by restriction air flow; (c) collecting the biological substance from the medium.

95. The method of claim 94, wherein the air stress comprises providing continuous air to the CMC cell line and then controlling the air flow by restricting the amount of air added to the medium.

96. The method of claim 95, wherein the air stress is repeated at least two times, three times, four times, or five times.

97. The method of any one of claims 94 to 96, wherein the air stress induces a higher production of the biological substance in the CMC cell line compared to a CMC cell line cultured without the air stress.

98. The method of any one of claims 94 to 96, wherein the CMC cell line is derived from Taxus and the biological substance is selected from the group consisting of taxanes and abietane tricyclic diterpenoid derivatives.

99. The method of claim 98, wherein the biological substance is selected from the group consisting of paclitaxel, baccatin III, 10-deacetylbaccatin III, taxamairin A, and taxamarin C.

100. The method of any one of claims 94 to 97, wherein the CMC cell line is derived from Ginkgo and the biological substance is catechin or gallocatechin.

101. The method of any one of claims 94 to 97, wherein the CMC cell line is derived from Ginseng and the biological substance is ginsenoside or gypenoside.

102. The method of claim 101, wherein the biological substance is ginsenoside F2 or gypenoside XVII.

103. The method of claim 31 or 32 or the CMC cell line of any one of claims 28 to 30, wherein the key enzymes are selected from the group consisting of taxane 2-alpha-o- benzyltransferase (TBT), 3'-N-debenzoyltaxol N-benzoyltransferase (stereo selective coupling of DBTNBT), 3'-N-debenzoyltaxol-2' deoxytaxol N-benzoyltransferase (DBTNBT), Taxane 13-alpha-hydroxylase, 2-alpha-hydroxytaxane 2-O-benzyltransferase (DBBT), P450 acetyltransferase, and any combination thereof. The method of any one of claims 1-6, wherein said reference homogenous plant stem cell line is characterized by up regulated transcription of a gene homolog or fragment thereof selected from the group consisting of (a) a PXY gene homolog comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36908 or a fragment thereof; (b) a WOL gene homolog comprising a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36910 or a fragment thereof; (c) the complement of (a) or (b); and (d) a combination of two or more of (a), (b), and (c).