WO2012051491A1 - Compositions and methods for controlling neurotropic viral pathogenesis by micro-rna targeting - Google Patents

Abstract

The invention provides attenuated viral vaccines with reduced neurotropic viral pathogenesis, and methods of making and using them.

Description

COMPOSITIONS AND METHODS FOR CONTROLLING NEUROTROPIC VIRAL PATHOGENESIS BY MICRO-RNA TARGETING

RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application Ser. No.

61/455,261, filed October 14, 2010 the entire contents of which are hereby

incorporated herein by reference.

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH

Research supporting this application was carried out by the United States of America as represented by the Secretary, Department of Health and Human Services. This research was supported by the Division of Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health, USA. The Government has certain rights in the invention.

BACKGROUND

There are more than 70 single-stranded, positive-sense RNA viruses in the arthropod-borne flavivirus genus of the Flaviviridae family, many of which are important human pathogens that cause a devastating and often fatal neuroinfection (Lindenbach et al. , 2007) .

Flaviviruses share the same genome organization: 5'-C-preM-E-NSl-NS2A- NS2B-NS3-NS4A-NS4B-NS5-3' in which the first three genes code the capsid (C), premembrane (preM) and envelope (E) proteins, while the remaining genes encode nonstructural proteins. Homology between mosquito-borne and tick-borne

flaviviruses is relatively low. However, homology among mosquito-borne flaviviruses or among tick-borne flaviviruses is relatively high.

Flaviviruses are transmitted in nature to various mammals and birds through the bite of an infected mosquito or tick; they are endemic in many regions of the world and include mosquito-borne yellow fever (YFV), Japanese encephalitis (JEV), West Nile (WNV), St. Louis encephalitis (SLEV), and dengue viruses (DEN) and the tick-borne encephalitis (TBEV) viruses. During the past two decades, both mosquito- and tick-borne flaviviruses have emerged in new geographic areas of the world where previously they were not endemic and have caused outbreaks of diseases in humans and domestic animals (TBEV in North Europe and Japan; JEV in Australia and Oceania; Usutu virus, an African flavivirus, in Central Europe; WNV in North and South America).

There are only two successful live flavivirus vaccines against diseases caused by YFV and JEV viruses, and these were attenuated by the classical method of repeated passage of virus in cell cultures (Halstead and Jacobson, 2008; Monath, 2005). Long-term experience with these two vaccines has demonstrated that live attenuated virus vaccines are an efficient approach to prevent diseases caused by virulent flaviviruses since just a single dose of the vaccine virus provides a long- lasting protective immunity in humans that mimics the immune response following natural infection (Monath, 2005). For many years, a number of new flavivirus vaccine strategies have been developed or are underway (Pugachev et al., 2003), but they have not yet led to successfully licensed human vaccines against other neurotropic flaviviruses such as TBEV, SLEV, or WNV.

SUMMARY OF THE INVENTION

The invention provides a recombinant attenuated neurotropic virus containing nucleic acid sequences complementary to the target sequences of microRNAs.

In one aspect, the invention generally features a nucleic acid sequence encoding a viable recombinant attenuated neurotropic flavivirus genome containing a nucleic acid sequence that is complementary to at least contiguous nucleotides of a microRNA (miR), where the complementary miR-target sequence inserted into the virus genome is selected from the group consisting of: (miR124 target) 5'- UGGCAUUCACCGCGUGCCUUAA-3' ; (let-7c target) 5'- AACCAUACAACCUACUACCUCA-3' ; (mir-9 target) 5'- UCAUACAGCUAGAUAACCAAAGA-3' ; (mir-128 target) 5'- AAAAGAGACCGGUUCACUGUGA-3' ; and (mir-218 target) 5'- ACAUGGUUAGAUCAAGCACAA-3 ' or a combination thereof or other CNS- expressed microRNA targets. In another aspect, the invention generally features a method for controlling neurotropic viral pathogenesis of an attenuated RNA flavivirus vaccine involving inserting a nucleic acid sequence into the viral genome that is complementary to a brain expressed microRNA, wherein the nucleic acid sequence is identical to at least 15 contiguous nucleotides of microRNA-targets selected from the group consisting of: (miR124 target) 5'-UGGCAUUCACCGCGUGCCUUAA-3' ; (let-7c target) 5'- AACCAUACAACCUACUACCUCA-3' ; (mir-9 target) 5'- UCAUACAGCUAGAUAACCAAAGA-3' ; (mir-128 target) 5'- AAAAGAGACCGGUUCACUGUGA-3' ; and (mir-218 target) 5'- ACAUGGUUAGAUCAAGCACAA-3' .

In another aspect, the invention generally features a n immunogenic composition comprising a claimed nucleic acid sequence or a claimed recombinant genetic construct.

In various embodiments of any of the above aspects of the invention delineated herein, the nucleic acid sequence contains a full genome-length nucleic acid clone of a flavivirus genome where the flavivirus is defined as an approximately 11-kilobase positive strand RNA virus having a genome that codes in one open reading frame (ORF) for three structural proteins, capsid (C), premembrane (preM) and envelope (E), followed by seven non-structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5, where the open reading frame is between a 5' untranslated region (5' UTR) upstream of the coding sequence and a 3' untranslated region (3' UTR) downstream of the coding sequence.

In another embodiment the the flavivirus is selected from the group consisting of mosquito-borne yellow fever virus (YFV), Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV), and dengue virus (DEN) type 1 (DEN1), DEN2, DEN3, DEN4, tick-borne encephalitis (TBEV) virus, a flavivirus listed in Table 2; or any combination thereof.

In a further embodiment the virus comprises a region of nucleic acid encoding two or three structural proteins of a first flavivirus operably linked to a region of nucleic acid encoding the non-structural proteins of a second flavivirus, where the second flavivirus is a different flavivirus from the first flavivirus. In other

embodiments the two structural proteins are prM and E. In additional embodiments the region of nucleic acid encoding structural protein encodes premembrane protein and envelope protein of the first virus, and encodes the capsid protein from the second flavi virus. In another embodiment the second flavi virus is a dengue virus selected from the group consisting of dengue virus type 4, dengue virus type 1, dengue virus type 2, and dengue virus type 3. In further embodiments the first flavi virus is selected from the group consisting of tick-borne encephalitis (TBEV) virus, mosquito-borne yellow fever (YFV), Japanese encephalitis (JEV), West Nile (WNV), and St. Louis encephalitis (SLEV).

In additional embodiments of any of the above aspects of any other aspect of the invention the second virus is dengue virus type 4, and the first virus is selected from the group consisting of tick-borne encephalitis (TBEV) virus, mosquito-borne yellow fever (YFV), Japanese encephalitis (JEV), West Nile (WNV), and St. Louis encephalitis (SLEV). In another embodiment the first flavi virus is a chimeric tick- borne encephalitis virus (TBEV) and second flavivirus is a dengue type 4 (DEN4) virus.

In various embodiments of any of the above aspects of any other aspect of the invention delineated herein, the nucleic acid sequence further contains at least one mutation that is introduced into the viral genome in a structural gene, in a nonstructural gene, in a 3' untranslated region (3' UTR), in a 5' untranslated region (5'- UTR); or any combination thereof. In further embodiments the mutation statistically significantly reduces neuropathogenesis of the virus as compared to a viable recombinant flavivirus not including the mutation in the viral genome. In yet another embodiment the mutation does not statistically significantly reduce neuropathogenesis of the virus as compared to a viable recombinant flavivirus not including the mutation in the viral genome. In further embodiments the mutation is selected from the group consisting of: one or more mutations that reduce glycosylation of premembrane protein, envelope protein or NS1(1) protein; one or more mutations that reduce cleavage of premembrane protein to membrane protein; one or more substitutions at a site encoding glycine, which site is at position +1 following polyprotein NS1-NS2A cleavage site; one or more deletions comprising at least 30 nucleotides between nucleotide 113 and 384 inclusive, number 1 being a 3'-most nucleotide of a 3'-non- coding end; and one or more mutations in a sequence encoding one or more of eight amino acids at the carboxyl terminus cleavage site of NS1. In another embodiment the mutation comprises a deletion of nucleotide sequence within the 3' UTR. In further embodiments the mutation in the 3' UTR comprise a deletion of 1-20 nt, 1-30 nt, 1-40 nt, 1-50 nt, 1-60 nt, 1-70 nt, 1-80 nt, 1-90 nt, 1-100 nt, 1-110 nt, 1-120 nt, 1- 130 nt, 1-140 nt, 1-150 nt, 1-160 nt, 1-170 nt, 1-180 nt, 1-190 nt, 1-200 nt, 1-210 nt, 1-220 nt, 1-230 nt, 1-240 nt, 1-250 nt, or more; or any value within the ranges set forth. In certain embodiments of the invention the deletion begins at nt 1, nt 10, nt 20, nt 30, nt 40, nt 50, nt 60, nt 70, nt 80, nt 90, nt 100, nt 110, nt 120, nt 130, nt 140, nt 150, nt 160, nt 170, nt 180, nt 190, nt 200, nt 210, nt 220, nt 230, nt 240, nt 250, or further 3' from the end of the stop codon; or at any nucleotide within the range of 1- 250 nt from the 3' end of the stop codon. In other embodiments the deletion identical to a nucleotide sequence selected from the group consisting of: nucleotide 10,281 to any nucleotide from 10,384 to 10,550 of GenBank FJ828986; nucleotide 10,379 to any nucleotide from 10,479 to 10,550 of GenBank FJ828986; nucleotide 10,474 to any nucleotide from 10,523 tol0,550 of GenBank FJ828986; nucleotide 10,266 to any nucleotide from 10,369 to 10,535 of GenBank AF326573; nucleotide 10,364 to any nucleotide from 10,464 to 10,535 of GenBank AF326573; nucleotide 10,459 to any nucleotide from 10,508 tol0,535 of GenBank AF326573) wherein the virus is competent for replication in at least one cell type. In additional embodiments the virus comprises a deletion of a nucleotide sequence identical to a selected from the group consisting of: 10,281-10,384 of GenBank FJ828986; 10,281-10,479 of

GenBank FJ828986; 10, 281-10,523 of GenBank FJ828986; 10,281- 10,550 of GenBank FJ828986; 10,379-10,479 of GenBank FJ828986; 10,379-10,523 of

GenBank FJ828986; 10,379-10,550 of GenBank FJ828986; 10,474-10,523 of

GenBank FJ828986; and 10,474-10,550 of GenBank FJ828986; 10,266-10,3369 of GenBank AF326573; 10,266-10,464 of GenBank AF326573; 10,266-10,508 of GenBank AF326573; 10,266- 10,535 of GenBank AF326573; 10,364-10,464 of GenBank AF326573; 10,364-10,508 of GenBank AF326573; 10,364-10,535 of GenBank AF326573; 10,459-10,508 of GenBank AF326573; 10,459-10,535 of GenBank AF326573. In yet another embodiment the virus comprises the sequence set forth in GenBank FJ828986 with one or more deletions or insertions.

In certain embodiments of any of the above aspects or any other aspect of the invention delineated herein the virus contains the sequence set forth in GenBank FJ828986 with a deletion of a nucleotide sequence selected from the group consisting of: nucleotide 10,281 to any nucleotide from 10,384 to 10,550; nucleotide 10,379 to any nucleotide from 10,479 to 10,550; nucleotide 10,474 to any nucleotide from 10,523 to 10,550; nucleotide 10,478-10,507; wherein the virus is competent for replication in at least one cell type.

In another embodiment the virus comprises the sequence set forth in GenBank FJ828986 with a deletion of a nucleotide sequence selected from the group consisting of: 10,281-10,384; 10,281-10,479; 10,281-10,523; 10,281- 10,550; 10,379-10,479; 10,379-10,523; 10,379-10,550; 10,474-10,523; and 10,474-10,550. In further embodiments the nucleic acid sequence that is complementary to 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of the target microRNA. In additional embodiments the nucleic acid sequence encoding the nucleic acid sequence complementary to a brain-expressed microRNA is inserted in the 3'UTR, the open reading frame, the 5' UTR; or any combination thereof. In yet another embodiment the nucleic acid sequence encoding the nucleic acid sequence complementary to a brain-expressed microRNA is inserted in the viral sequence in at least one position selected from the group consisting of: between nucleotides 10280 and 10281 (a site 1), 10292 and 10293 (a site 2), 10307 and 10308 (a site 3), 10384 and 10385 (a site 4), 10470 and 10471 (a site 5), 10502 and 10503 (a site 6), or 10553 and 10554 (a site 7); or for DEN4 GenBank AF326573 sequence: 10265 and 10266 (a site 1), 10277 and 10278 (a site 2), 10292 and 103293 (a site 3), 10369 and 10370 (a site 4), 10455 and 10456 (a site 5), 10487 and 10488 (a site 6), or 10538 and 10539 (a site 7). In additional embodiments the nucleic acid sequence encoding 2, 3, 4, or 5 nucleic acid sequences complementary to a brain-expressed microRNA is inserted in the viral genome. In certain embodiments the nucleic acid sequence encoding 2, 3, 4, or 5 nucleic acid sequences complementary to a single brain-expressed microRNA.

In various embodiments of the invention the nucleic acid sequence encoding 2, 3, 4, or 5 nucleic acid sequences complementary to 2, 3, 4, or 5 distinct brain- expressed microRNA. In further embodiments the nucleic acid sequence encoding the nucleic acid sequences complementary to a brain-expressed microRNA are inserted in the viral genome in tandem. In various embodiments of any of the above aspects of any other aspect of the invention delineated herein the nucleic acid that is complementary to a brain- expressed microRNA inserted in tandem is contiguous to each other. In further embodiments the nucleic acid that is complementary to a brain-expressed microRNA are inserted in tandem are separated by spacers wherein the length of each spacer is selected independently from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 nucleotides in length.

In various embodiments of any of the above aspects of any other aspect of the invention delineated herein the nucleic acid sequence is in an expression vector. In other embodiments a recombinant genetic construct encodes the viable recombinant flavivirus. In further embodiments the recombinant genetic construct is in a host cell. In certain embodiments the recombinant genetic construct is in an expression construct. In other embodiments the flavivirus is encoded by any of the claimed nucleic acid sequences.

In various embodiments the immunogenic compositions are in a

pharmaceutically acceptable carrier. In other embodiments the invention includes a method of vaccinating a subject against flavivirus infection comprising administering a claimed immunogenic composition to a subject. In onther embodiments the method further involves identifying a subject susceptible to flavivirus infection. In additional embodiments the method further includes testing the subject to determine if an immune response occurred. In other embodiments the immune response is a protective immune response. In additional embodiments the testing is selected from the group consisting of immunoassay and pathogen challenge. In further

embodiments the method includes: (a) preparing the genetic construct of claim 33 or 34, wherein said genetic construct comprises DNA; (b) generating infectious RNA transcripts from said DNA construct; (c) introducing said RNA transcripts into a cell; (d) expressing said RNA transcripts in said cell to produce virus; (e) harvesting said virus from said cell; (f) testing said virus in an animal model; and (g) inoculating said host with virus produced by repeating steps (a)-(e).

In various embodiments of the any aspect of the invention provided herein the nucleic acid sequence is identical to 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides selected from the group consisting of: (miR124) 5'-UGGCAUUCACCGCGUGCCUUAA-3'; (let-7c) 5'- AACCAUACAACCUACUACCUCA-3'; (mir-9) 5'- UCAUACAGCUAGAUAACCAAAGA-3 ' ; (mir-128) 5'- AAAAGAGACCGGUUCACUGUGA-3' ; and (mir-218) 5'- ACAUGGUUAGAUCAAGCACAA-3' .

In another embodiment the attenuated RNA virus vaccine comprises full genome-length flavivirus genome wherein the flavivirus is defined as an

approximately 11-kilobase positive strand RNA virus having a genome that codes in one open reading frame (ORF) for three structural proteins, capsid (C), premembrane (preM) and envelope (E), followed by seven non- structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5, wherein the open reading frame is between a 5' untranslated region (5' UTR) upstream of the coding sequence and a 3' untranslated region (3' UTR) downstream of the coding sequence.

In additional embodiments the flavivirus is selected from the group consisting of mosquito-borne yellow fever virus (YFV), Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV), and dengue virus (DEN) type 1 (DEN1), DEN2, DEN3, DEN4, tick-borne encephalitis (TBEV) virus, the flaviviruses listed in Table 2, or any combination thereof.

The invention further provides kits for containing the compositions of the invention or for practicing the methods of the invention.

Other embodiments of the invention are provided infra.

BRIEF DESCRIPTION OF THE FIGURES

Figures 1A & IB. Schematic representations of the viral genomes used in the experiments. (A) The DEN4 viral genome and TBEV, WN, or SLE genomes, and the chimera resulting from the combination of the two genomes. (B) A TBEV/DEN4 chimeric genome and the miRNA target sequences inserted into its 3' end that are complementary to brain tissue-expressed let-7c, mir-9, mir-124a, mir-128a, or mir- 218 miRNA.

Figures 2A-2D. Effect of miRNA-target insertions on the TBEV/DEN4 replication in cell cultures. Multicycle growth analysis of indicated viruses was performed in (2A) mosquito C3/36 cells or (2B) simian Vero kidney cells following inoculation at an MOI of 0.01. Virus in culture medium of infected cells was harvested on indicated days after infection. Virus titer was determined by PFA on C6/36 or Vero cells, respectively, and its values represent the mean titer. Limit of virus detection was 1.0 logio PFU/ml. (2C) Replication kinetics of let-7cT virus in C6/36 (mosquito), Vero (simian kidney), SH-SY5Y (human neuroblastoma), LN18 (human gliblastoma), and HeLa (human cervical cancer) cells infected at an MOI of 0.01. Virus titer was determined by PFA on the C6/36 or Vero cell line. (2D)

Mutations identified in the let-7c targeting sequences of two escape mutant viruses (let-7cT* and let-7cTA) that were isolated from Vero cells infected with C6/36 cell- recovered let-7cT virus. Deletion of 14 nts in the let-7cTAgenome and single A-to-G mutation in the genome of let-7cT* are shown in red. The flanked BstBI (TTCGAA) and Xhol (CTCGAG) site sequences are underlined.

Figure 3. Virus growth and TBEV-specific antigen expression are inhibited in primary rat neurons infected with TBEV/DEN4 mutants carrying a target sequence for miRNA let-7c, mir-9, mir-124, or mir-128. (A) Growth kinetics of TBEV/DEN4, let-7cT, mir-9T, mir-124T, mir-128T, and mir-218T in primary rat neurons infected at an MOI of 0.5. Virus titers in the daily harvested culture medium were determined by PFA on Vero or C6/36 (for let-7cT virus) cells. (B-M) Immunofluorescence assay. Mock and virus-infected neurons were fixed on day 3 following infection with the indicated virus and stained with TBEV-specific antibodies and DAPI. Representative images were captured with a Nikon 90i microscope at an objective magnification of xlOO (B, D, F, H, J, and L) and x400 (C, E, G, I, K, M, and inset in B).

Figure 4. Neurovirulence of TBEV/DEN4 in the highly permissive Swiss mice was greatly attenuated by insertion of either let-7c, mir-9, mir-124, mir-128, or mir-218 target sequence into the virus genome. Mice inoculated IC with 10, 10 2 , 103 , 10⁴, or 10⁵ PFU of either let-7cT, mir-9T, mir-124T, mir-128T, or mir-218T virus survived without showing any neurological signs during the 21 -day observation (blue filled diamond). At the end of study, brains of mice infected with a 10⁵ PFU dose of the above mentioned miRNA-target viruses were harvested, and the virus amount in the each individual brain suspension was determined by titration in Vero or C6/36 cells and by RT-PCR. Survival curves of mice infected with TBEV/DEN4 at doses from 1 to 10^J PFU are shown. Figures 5A & 5B. Introduction of miRNA-target sequence for let-7c, mir-9, mir-124, or mir-128, but not for mir-218, into the TBEV/DEN4 genome increased survival of SCID mice against lethal virus inoculation. (5 A) Survival curves of SCID mice infected IP with a dose of 10⁵ PFU of indicated virus. (5B) Mutations that accumulated in the miRNA-target sequences of viruses isolated from the mouse brain (MB) on the indicated day post-inoculation. Only nucleotides different (in red color) from the inoculated virus sequence (shown on top) are shown. The sequences of miRNA-targets (shown in italics) are flanked with BstBI (TTCGAA) and Xhol sites (CTCGAG) (blue) inserted between position 10280 and 10281 of the TBEV/DEN4 genome. The ORF stop codon is underlined.

Figures 6A-6C. The 3 'NCR deletions for attenuation of TBEV/DEN4 virus and sites of insertion of miR target sequences to reduce neuro virulence. (6A) Schematic showing sites of deletions in the 3'NCR of parental TBEV/DEN4. (6B) Table listing the site and length of each deletion. (6C) Sequences of each of the deletions in the 3'UTR. The deleted nucleotides in the each constructed virus (Δ1- Δ9) are shown in the parenthesizes. The ORF-stop codon underlined and the introduced a BstBI-site is shown in red.

Figures 7A-7L. (7 A) Proposed secondary structure of TBEV/DEN4 3'NCR and sites for miR target insertions. (7B) Table listing insertion sites. The miR sequence was inserted immediately after the nucleotide listed on the TBEV/DEN4 sequence. (7C) TBEV/DEN4 viruses for simultaneous targeting with multiple copies of homologous (mir-124) or mixed (mir-9 and mir-124) microRNAs. Schematic showing sites of insertion of miR target sequences that do (black boxes) or do not inhibit viral replication and/or growth in Vero cells. Sites for miR-target insertions were located between nucleotide positions: 10280 and 10281 (a site 1), 10292 and 10293 (a site 2), 10307 and 10308 (a site 3), 10384 and 10385 (a site 4), 10470 and 10471 (a site 5), 10502 and 10503 (a site 6), 10553 and 10554 (a site 7). (7D) Insertion of multiple miRNA-targets in the TBEV/DEN4 genome significantly attenuated virus neurovirulence for suckling mice. Schematic showing sites for insertion of miR target sequences that do not inhibit viral replication in the Vero cell culture line. These viruses were less neurovirulent in 3-day-old mice and their LD₅₀ values and the fold-reduction of neurovirulence as compared to the parental TBEV/DEN4 virus are shown. Figures 7E-7L show the sequences of the 3 'NCR of eight engineered TBEV/DEN4 viruses carrying 2, 3, or 4 miRNA targets [designated 2x mir-124T(1,2) (Fig. 7E), mir-9T-124T(1,2) (Fig. 7F), mir-9T-124T-124T(1,2,3) (Fig. 7G), 3x mir-124T(1,2,3) (Fig. 7H), 3x mir-124T(1,2,5) (Fig. 71), 3x mir- 124T(1,2,7) (Fig. 7J), 4x mir-124T(1,2,3,5) (Fig. 7K), and 4x mir-124T(1,2,3,7) (Fig. 7L)] that were evaluated for neurovirulence in suckling mice. For each virus construct (Fig. 7E-7L), the 3'NCR sequence from a TAA-stop codon to the end of TBEV/DEN4 genome is shown (nts 10278-10664). The inserted sequences of miRNA targets and their flanked restriction sites are underlined; the sequences of miRNA targets are shown in red italics.

Figures 8A-8C. Strategies to increase the level of microRNA-controlled virus suppression in the CNS and prevent the emergence of escape mutants: (8 A)

Schematic showing sites of insertion of miR target sequences for simultaneous multiple miR-targeting of the virus genome in the 3'NCR and between envelope E and NS1 protein genes. Four viruses [designated E(3x miR-124-9-124T)-3'NCR(3x miR-124 _,5T), E(3x miR-124-9-124T)-3'NCR(3x miR-124_1,2,7T), E(3x mir-124T)- 3'NCR(3x miR-124 _,5T), and E(3x miR-124T)-3'NCR(3x miR-124_1,2,7T)] carrying 6 miRNA targets were constructed and assessed for neurovirulence in suckling mice. For each virus construct, the DNA XhoI-XhoI-fragment [E(miR 124-9-124T) or E(miR 124-124-124T)] that contains 103 nts of TBEV genome (nts from 2388 to

2491), miRNA target sequences flanked with restriction enzyme sites, and 216 nts of DEN4 genome (nts from 2129 to 2344) was used for insertion into a Xhol site (nt 2360; GenBank accession number FJ828986) of the full-length 3x miR-124T(1,2,5) or 3x miR-124T(1,2,7) cDNA genome. (8B) Sequence of the E/NS1 intergenic junctions (a XhoI-XhoI-fragment) of the TBEV/DEN4 miR-targeted cDNA genomes carrying target sequences for mir-124 and mir-9 microRNAs. The sequences of miRNA targets and their flanked restriction sites are underlined; the sequences of miRNA targers are shown in red bold italics. TBEV and DEN4 sequences (GenBank accession numbers U39292 and AF26573) are shown in small black or blue fonts, respectively. (8C) Results of neurovirulence test of multiple miR-targeted viruses in

3-day-old Swiss mice. Mice inoculated IC with 10, 10 2", or 103^J PFU of either E(3x miR-124-9-124T)-3'NCR(3x miR-124_1,2,5T), E(3x miR-124-9-124T)-3'NCR(3x miR- 124 _,7T), E(3x mir-124T)-3'NCR(3x miR-124 _,5T), or E(3x miR-124T)-3'NCR(3x miR-124_1,2,7T) virus survived without showing any neurological signs during the 21- day observation.

Figure 9 is a table that shows the immunogenicity and protective efficacy of

TBEV/DEN4 miRNA-target viruses in adult Swiss mice.

a Three-week-old Swiss mice were inoculated IP with 10⁵ PFU of virus and serum for neutralization assay was collected on day 28.

b Number (%) of seropositive mice with plaque-reduction (50%) neutralizing antibody titers (PRNT_50%) > 1:5. PRNT_50% (reciprocal) was determined against the unmodified TBEV/DEN4 virus .

c GMT, geometric mean titers (reciprocal) are calculated for mice that were seropositive.

d Groups of mice that had been immunized with the designated virus on day 0 were challenged by an IC route with 100 IC LD₅₀ (600 PFU) of TBEV/DEN4 on day 33. AST, average survival times of moribund mice following the TBEV/DEN4 challenge.

DETAILED DESCRIPTION

Definitions

As used herein, "adjuvant" is understood as is a pharmacological or immunological agent that modifies the effect of other agents (e.g., vaccines) while having few if any direct effects when given by itself. Adjuvants are frequently administered with vaccines to enhance the recipient's immune response to a supplied antigen while keeping the injected foreign material at a minimum. Adjuvants may be essentially inert when administered alone.

As used herein, "attenuated" is understood as is a vaccine created by reducing the virulence of a pathogen, but still keeping it viable (or "live"). Attenuation takes a living agent and alters it so that it becomes harmless or less virulent. These vaccines contrast to those produced by "killing" the virus. As used herein, an attenuated virus can be propagated in at least one cell type, either in a host organism or preferably in culture. In a preferred embodiment, the cell does not include any heterologous nucleic acid sequences to permit viral replication. As used herein, "changed as compared to a control" sample or subject is understood as having a level of the analytic or diagnostic or therapeutic indicator to be detected at a level that is statistically different than a sample from a normal, untreated, or control sample. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods to select and test control samples are within the ability of those in the art. An analytic substance can be a naturally occurring substance that is characteristically expressed or produced by the cell or organism (e.g., antibodies, viral particles) or a substance produced by a reporter construct (e.g, β-galactosidase or luciferase). Depending on the method used for detection the amount and measurement of the change can vary. Determination of statistical significance is within the ability of those skilled in the art.

As used herein, "chimeric" as in "chimeric virus" is understood as a genome, particularly a viral genome, having nucleic acid sequences from two distinct species. For example, a chimeric virus can include nucleic acid sequences from two distinct species of flavi virus. Preferably, a chimeric virus has at least one full coding sequence of a protein from the other species of virus. Preferably, a chimeric virus is capable of replicating in at least one cell type autonomously. However, chimeric viruses can also include deletions such that the virus must be replicated in a helper cell line to heterologously provide one or more gene sequences not provided in the viral genome.

"Co-administration" as used herein is understood as administration of one or more agents to a subject such that the agents are present and active in the subject at the same time. Co-adminsitration does not require a preparation of an admixture of the agents or simultaneous administration of the agents.

"Complementary" as used herein in relation to nucleic acids is understood by its usual meaning of two nucleic acid strands (either individual strands or portions of a single strand folded back on itself) in which each A pairs with a T (in DNA) or a U (in RNA); and each C pairs with a G. As used herein, nucleic acid sequences can be complementary over a specific number of contiguous nucleotides (i.e., nucleotides touching or connected throughout in an unbroken sequence). In an embodiment, the sequence in the virus is complementary to at least 15 contiguous nucleotides of the target miR. In an embodiment, the sequence in the virus is complementary to at least 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 up to the full length of the processed miR, which may be less than 25 nucleotides. In an embodiment, the virus is complementary to at least 19 nucleotides of the miR to the full length of the miR at least 20 nucleotides of the miR to the full length of the miR, or at least 21 nucleotides of the miR to the full length of the miR. In preferred embodiments of the instant invention, the viruses include one or more RNA sequences that are complementary to a miR over a sufficient number of nucleotides to promote cleavage of the viral genome by any method, e.g., RNA interference.

A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. For example, families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Other conserved amino acid substitutions can also occur across amino acid side chain families, such as when substituting an asparagine for aspartic acid in order to modify the charge of a peptide. Conservative changes can further include substitution of chemically homologous non-natural amino acids (i.e. a synthetic non- natural hydrophobic amino acid in place of leucine, a synthetic non-natural aromatic amino acid in place of tryptophan).

"Contacting a cell" is understood herein as providing an agent to a test cell e.g., a cell to be treated in culture, ex vivo, or in an animal, such that the agent can interact with the test cell or cell to be treated, potentially be taken up by the test cell or cell to be treated, and have an effect on the test cell or cell to be treated. The agent or virus can be delivered to the cell directly (e.g., by addition of the agent to culture medium or by injection into the cell or tissue of interest), or by delivery to the organism by an eternal or parenteral route of administration for delivery to the cell by vascular, lymphatic, or other means. As used herein, "detecting", "detection" and the like are understood that an assay performed to determine one or more characteristics of a sample. For example, detection can include identification of a specific analyte in a sample, a product from a reporter construct, heterologous expression construct (e.g., viral vector), or virus (e.g., attenuated viral vaccine) in a sample, or an activity of an agent in a sample. Detection can include the determination of nucleic acid or protein expression, or dye uptake in a cell or tissue, e.g., as determined by PCR, immunoassay, microscopy. Detection can include determination of the presence of an antibody using routine immunological methods, e.g., ELISA or pathogen challenge. The amount of analyte or activity detected in the sample can be none or below the level of detection of the assay or method.

The terms "effective amount," or "effective dose" refers to that amount of an agent to produce the intended pharmacological, therapeutic or preventive result. The pharmacologically effective amount that results in the prevention of onset of disease, either in an individual or in the frequency of disease in a population, as a result of contact with a virus or pathogen that causes disease. More than one dose may be required to provide an effective dose. It is understood that an effective dose in one population may or may not be sufficient in all populations. Thus, in connection with the administration of a drug, a drug which is "effective against" a disease or condition indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a prevention of disease onset, improvement of symptoms, a cure, a reduction in disease signs or symptoms, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition.

The invention provides flaviviruses comprising nucleic acid sequences that "encode" structural proteins and non-structural proteins. It is understood that an amino acid sequence can be encoded by any of a number of nucleotide sequences and that the nucleotide sequences that encode the amino acid sequences are completely predictable and can be determined using routine methods. The invention includes the encoded structural proteins and non- structural proteins that may include one or more amino mutations that may or may not alter the function of the protein from the wild- type sequence. As the viruses of the invention are attenuated viruses, and frequently chimeric attenuated viruses, by definition the sequences encoding the protein and/ or the untranslated regions, must include one or more mutations that produce an attenuated virus. Nucleic acid sequences that encode structural or non- structural proteins encode proteins that are able to function to allow for propagation of the virus in at least one cell type.

As used herein, an "escape mutant" is a virus that contains additional mutation(s), typically mutations that arise in the viral genome during virus propagation or after administration to a subject as a vaccine that can modulate its virulence, e.g., typically increase, but also decrease it, by 10-fold, 100-fold, 1000- fold, 10,000-fold, etc.

A "flavivirus" is a single-stranded, positive-sense RNA viruses in the arthropod-borne flavivirus genus of the Flaviviridae family, many of which are important human pathogens that cause a devastating and often fatal neuroinfection. The sequences of many flaviviruses are known. Genomes of flaviviruses referred to in the instant application under various GenBank numbers that are incorporated by reference as of the date of the filing of the application. The sequences are also attached. Information related to the various proteins encoded is provided in the GenBank entries and in Tables 1 and 2.

Table 1. Flaviviruses and SEQ ID NOs. that refer to protein (odd number) and nucleic acid (even number) sequences.

Table 2. Additional partial flavivirus sequences from the NS5 gene. Each GenBank reference number is incorporated by reference as of the priority date of the application and can be used to identify full length viral sequences (Table copied from Maher-Sturgess et al., 2008. Universal Primers that amplify RNA from all three flavivirus subgroups. Virology J. 24:16, which is incorporated herein by reference.)

As used herein, a "host cell" is any cell in which a virus of the invention can be propagated. As used herein, the terms "identity" or "percent identity", refers to the subunit sequence similarity between two polymeric molecules, e.g., two polynucleotides or two polypeptides. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two peptides is occupied by serine, then they are identical at that position. The identity between two sequences is a direct function of the number of matching or identical positions, e.g., if half (e.g., 5 positions in a polymer 10 subunits in length), of the positions in two peptide or compound sequences are identical, then the two sequences are 50% identical; if 90% of the positions, e.g., 9 of 10 are matched, the two sequences share 90% sequence identity. The identity between two sequences is a direct function of the number of matching or identical positions. Thus, if a portion of the reference sequence is deleted in a particular peptide that deleted section is not counted for purposes of calculating sequence identity. Identity is often measured using sequence analysis software e.g., BLASTN or BLASTP (available at (www.ncbi.nih.gov/BLAST). The default parameters for comparing two sequences (e.g., "Blast"-ing two sequences against each other), by BLASTN (for nucleotide sequences) are reward for match = 1, penalty for mismatch = -2, open gap = 5, extension gap = 2. When using BLASTP for protein sequences, the default parameters are reward for match = 0, penalty for mismatch = 0, open gap = 11, and extension gap = 1. Additional, computer programs for

determining identity are known in the art.

As used herein, an "immunoassay" is a detection method based on the specific binding of at least one antibody to an antigen, e.g., ELISA, RIA, western blot, etc.

As used herein "immunogen" or "immunogenic" and the like refer to substances that can promote an immune response, preferably an antibody based immune response, in at least one organism.

As used herein, "isolated" or "purified" when used in reference to a polypeptide means that a naturally polypeptide or protein has been removed from its normal physiological environment (e.g., protein isolated from plasma or tissue) or is synthesized in a non-natural environment (e.g., artificially synthesized in an in vitro translation system or using chemical synthesis). Thus, an "isolated" or "purified" polypeptide can be in a cell-free solution or placed in a different cellular environment (e.g., expressed in a heterologous cell type). The term "purified" does not imply that the polypeptide is the only polypeptide present, but that it is essentially free (about 90-95%, up to 99-100% pure) of cellular or organism material naturally associated with it, and thus is distinguished from naturally occurring polypeptide. Similarly, an isolated nucleic acid is removed from its normal physiological environment.

"Isolated" when used in reference to a cell means the cell is in culture (i.e., not in an animal), either cell culture or organ culture, of a primary cell or cell line. Cells can be isolated from a normal animal, a transgenic animal, an animal having spontaneously occurring genetic changes, and/or an animal having a genetic and/or induced disease or condition. An isolated virus or viral vector is a virus that is removed from the cells, typically in culture, in which the virus was produced.

As used herein, "kits" are understood to contain at least one non-standard laboratory reagent composition provided herein (e.g., attenuated viruses including a nucleic acid sequence complementary to a miR sequence) for use in the methods of the invention. The kit can further include any other components required to practice the method of the invention, as dry powders, concentrated solutions, or ready to use solutions. In some embodiments, the kit comprises one or more containers that contain reagents for use in the methods of the invention; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding reagents.

As used herein, a "mutation" is a change in the amino acid or nucleic acid sequence as compared to the wild-type sequence. In a nucleic acid coding sequence, the mutation results in a change of the amino acid sequence encoded by the nucleic acid. As used herein, a mutation in a coding sequence preferably does not result in a frame shift in the coding sequence. In a non-coding, but functional, nucleic acid sequence, the mutation alters the function of the nucleic acid. A mutation can be an insertion, deletion, or change of one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, etc) amino acids or nucleotides as compared to a wild-type sequence.

The viruses provided in the instant applications include mutations, for example to attenuate the virus. For example, viruses of the invention can include one or more mutations that reduce glycosylation of premembrane protein, envelope protein or NS1(1) protein; one or more mutations that reduce cleavage of premembrane protein to membrane protein; one or more substitutions at a site encoding glycine, which site is at position +1 following polyprotein NS1-NS2A cleavage site; one or more deletions comprising at least 30 nucleotides between nucleotide 113 and 384 inclusive, number 1 being a 3'-most nucleotide of a 3'-non- coding end; and one or more mutations in a sequence encoding one or more of eight amino acids at the carboxyl terminus cleavage site of NS1. Examples of mutations include those provided in USP 6,184,024 which is incorporated herein by reference. The exemplary list of possible mutations demonstrates the tolerance of flavivirus to changes in nucleic acid sequence and post-translational modifications without eliminating replication competence of the virus. Mutations to alter glycosylation or cleavage include:

Table 3. Attenuating flavivirus mutations

Deletions in untranslated region (UTR), e.g., in the 3' UTR are also provided in USP 6,184,024, e.g., in Figure 13; and in Figure 6 of the instant application.

Deletions in the 3' UTR that do not prevent virus recovery include deletion of nucleotides 172-113, 172-143, 243-283, 303-183, 333-183, and 384-183 per the numbering of USP 6,184,024. As can be readily seen in Figure 6A of the instant application, large mutations are tolerated, and no particular sequence within nucleotides 10281-10550 appears to be necessary for replication competence.

Although the Δ4 mutant is not replication competent, the deletion of nucleotides 10523-10550 is tolerated in the Δ7 and Δ9 mutations. This suggests that any deletion of less than 270 nucleotides, specifically 243 nucleotides or less, from nucleotide 10281-10550 does not result in replication incompetence. It is understood that the specific deletions generated are representative of possible deletion mutations and do not limit possible deletions in the 3' region. Although deletions reduce plaque size to non-detectable in one cell line, the virus was able to replicate and form visible plaques in another cell type. Methods to identify mutations that permit replication of viruses are routine in the art.

As used herein, "neuropathogenesis" is understood to mean any pathology of nervous tissue caused by virus, including but not limited to neurovirulence and neuroinvasiveness.

As used herein, "neurotropic" is understood as a virus that can infect and replicate in the CNS in neuronal cells. This can result in cell damage and undesirable pathological outcomes.

As used herein, "nucleic acid" as in a nucleic acid for delivery to a cell is understood by its usual meaning in the art as a polynucleotide or oligonucleotide which refers to a string of at least two base-sugar-phosphate combinations.

Nucleotides are the monomeric units of nucleic acid polymers. The term includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) in the form of an oligonucleotide messenger RNA, anti-sense, plasmid DNA, parts of a plasmid DNA or genetic material derived from a virus. An oligonucleotide is distinguished, here, from a polynucleotide by containing less than 120 monomeric units. Polynucleotides include nucleic acids of at least two monomers. Anti- sense is a polynucleotide that interferes with the function of DNA, or more typically RNA. An siRNA or an shRNA is a double stranded RNA that inhibits or disrupts activity or translation, for example by promoting degradation of modifying splicing or processing of the cellular nucleic acid, e.g., mRNA, microRNA, to which it is targeted. As used herein, siRNA and shRNA include any double stranded RNA molecule wherein about 18 to about 30 nucleotides form the double stranded portion of the molecule wherein the double stranded RNA can modulate the stability, translation, or splicing of an RNA to which at least one strand of the double stranded nucleic acid hybridizes. RNAs are well known in the art, e.g., see patent publications WO02/44321, WO/2003/099298, US

20050277610, US 20050244858; and US Patents 7,297,786, 7,560,438 and 7,056,704, all of which are incorporated herein by reference. Nucleic acid as used herein is understood to include a non-natural polynucleotide (not occurring in nature), for example: a derivative of natural nucleotides such as phosphothionates or peptide nucleic acids (such as those described in the patents and applications cited

immediately above). A nucleic acid can be delivered to a cell in order to produce a cellular change that is therapeutic. The delivery of a nucleic acid or other genetic material for therapeutic purposes is gene therapy. The nucleic acid may express a protein or polypeptide, e.g., a protein that is missing or non-functional in the cell or subject. The nucleic acid may be single or double stranded, may be sense or anti- sense, and can be delivered to a cell as naked DNA, in combination with agents to promote nucleic acid uptake into a cell (e.g., transfection reagents), or in the context of a viral vector. The nucleic acid can be targeted to a nucleic acid that is endogenous to the cell (mRNA or microRNA), or a nucleic acid of a pathogen (e.g., viral gene, e.g., hepatitis viral gene). Delivery of a nucleic acid means to transfer a nucleic acid from a container outside a mammal to within the outer cell membrane of a cell in the mammal.

"Obtaining" is understood herein as manufacturing, purchasing, or otherwise coming into possession of.

As used herein, "operably linked" is understood as joined, preferably by a covalent linkage, e.g., joining an amino-terminus of one peptide, e.g., expressing an enzyme, to a carboxyl terminus of another peptide, e.g., expressing a signal sequence to target the protein to a specific cellular compartment; joining a promoter sequence with coding or non-coding nucleic acid sequence, in a manner that the two or more components that are operably linked either retain their original activity, or gain an activity upon joining such that the activity of the operably linked portions can be assayed, colocalized, and/or have detectable activity, e.g., transcription or translation inhibition, enzymatic activity, protein expression activity, nucleic acid levels, etc.

The phrase "pharmaceutically acceptable carrier" is art recognized and includes a pharmaceutically acceptable material, composition or vehicle, suitable for administering compounds of the present invention to mammals. Preferred

pharmaceutical carriers for use in the instant invention include this approved for use in humans. It is understood that nucleic acids can be resuspended in another solution, e.g., normal saline, sterile water, and added to an adjuvant or other carrier appropriate for administration.

It is understood that other agents may be delivered in conjunction with a vaccine including, but not limited to, adjuvants. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. For example, pharmaceutically acceptable carriers for administration of cells typically is a carrier acceptable for delivery by injection, and do not include agents such as detergents or other compounds that could damage the virus to be delivered. Some examples of materials which can serve as

pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate;

powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations, particularly phosphate buffered saline solutions which are preferred for intraocular delivery.

Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

Examples of pharmaceutically acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, a-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like. Formulations of the present invention include those suitable for oral, nasal, topical, transdermal, buccal, sublingual, intramuscular, intraperitoneal, intraocular, and/or other routes of parenteral administration. The specific route of administration will depend, inter alia, on the specific cell to be targeted. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect.

As used herein, "plurality" is understood to mean more than one. For example, a plurality refers to at least two, three, four, five, or more.

A "polypeptide" or "peptide" as used herein is understood as two or more independently selected natural or non-natural amino acids joined by a covalent bond (e.g., a peptide bond). A peptide can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more natural or non-natural amino acids joined by peptide bonds. Polypeptides as described herein include full length proteins (e.g., fully processed proteins) as well as shorter amino acids sequences (e.g., fragments of naturally occurring proteins or synthetic polypeptide fragments).

As used herein, "prevention" is understood as to limit, reduce the rate or degree of onset, or inhibit the development of at least one sign or symptom of a disease or condition particularly in a subject prone to developing the disease or disorder, e.g., due to geographic location, lack of clean water, immunosuppressed state, etc. For example, a subject immunized with the attenuated viral vaccine of the invention will not develop the disease for at least 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or 10 years after immunization. Prevention can require the administration of more than one dose of an agent or therapeutic.

Prevention may occur in only a subset of individuals to whom the vaccine is administered who are subsequently exposed to the pathogen. There may be a delay from the time of administration until the vaccine is effective in preventing productive viral infection. Such considerations are well known to those of skill in the art.

As used herein, a "recombinant" virus is a non-naturally occurring virus that is generated using molecular biology techniques. A "sample" as used herein refers to a biological material that is isolated from its environment (e.g., blood or tissue from an animal, cells, or conditioned media from tissue culture) and is suspected of containing, or known to contain an analyte, such as a virus, an antibody, or a product from a reporter construct. A sample can also be a partially purified fraction of a tissue or bodily fluid. A reference sample can be a "normal" sample, from a donor not having the disease or condition fluid, or from a normal tissue in a subject having the disease or condition, or an untreated subject (e.g., a subject not treated with the vaccine). A reference sample can also be taken at a "zero time point" prior to contacting the cell or subject with the agent or therapeutic intervention to be tested.

A "subject" as used herein refers to living organisms. In certain embodiments, the living organism is an animal. In certain preferred embodiments, the subject is a mammal. In certain embodiments, the subject is a domesticated mammal or a primate including a non-human primate. Examples of subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, goats, and sheep. A human subject may also be referred to as a patient.

A subject "suffering from or suspected of suffering from" a specific disease, condition, or syndrome has a sufficient number of risk factors or presents with a sufficient number or combination of signs or symptoms of the disease, condition, or syndrome such that a competent individual would diagnose or suspect that the subject was suffering from the disease, condition, or syndrome. Methods for identification of subjects suffering from or suspected of suffering from viral infections is within the ability of those in the art. Subjects suffering from, and suspected of suffering from, a specific disease, condition, or syndrome are not necessarily two distinct groups.

As used herein, "susceptible to" or "prone to" or "predisposed to" a specific disease or condition and the like refers to an individual who based on genetic, environmental, health, and/or other risk factors is more likely to develop a disease or condition than the general population. An increase in likelihood of developing a disease may be an increase of about 10%, 20%, 50%, 100%, 150%, 200%, or more.

As used herein, "tandem" as in a "tandem repeat" is understood as two or more repeats of a sequence, e.g., a sequence complementary to a miR, arranged one behind the other or used or acting in conjunction. As used herein, tandem repeat sequences can include intervening or spacer nucleic acids between the sequences. Preferably, the intervening or spacer nucleic acids between the repeats of the sequence of interest. However, spacer sequences are preferably short, e.g., 20 or less, 15 or less, 12 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, 2 or less, or 1. Also, it is preferred that spacer sequence are not functional sequences, e.g., do not encode an polypeptide, are note authentic viral genome sequences, are not designed to specifically hybridize to a particular sequence. It is understood that multiple sequences complementary to one or more miRs can be present in a virus without being present in tandem, or with only some being present in tandem.

"Therapeutically effective amount," as used herein refers to an amount of an agent which is effective, upon single or multiple dose administration to the cell or subject, in prolonging the survivability of the patient with such a disorder, reducing one or more signs or symptoms of the disorder, preventing or delaying and the like beyond that expected in the absence of such treatment.

An agent or other therapeutic intervention can be administered to a subject, either alone or in combination with one or more additional therapeutic agents or interventions, as a pharmaceutical composition in mixture with conventional excipient, e.g., pharmaceutically acceptable carrier, or therapeutic treatments.

The pharmaceutical agents may be conveniently administered in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical arts, e.g., as described in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, PA, 21^st Edition, 2006). Formulations for parenteral administration may contain as common excipients such as sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes and the like. In particular, biocompatible, biodegradable lactide polymer, lactide/ glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be useful excipients to control the release of certain agents.

It will be appreciated that the actual preferred amounts of active compounds used in a given therapy will vary according to e.g., the specific compound being utilized, the particular composition formulated, the mode of administration and characteristics of the subject, e.g., the species, sex, weight, general health and age of the subject, the route of administration. Optimal administration rates for a given protocol of administration can be readily ascertained by those skilled in the art using conventional dosage determination tests conducted with regard to generally accepted practices.

As used herein, a "vaccine" is understood as a composition that stimulates an immune response to provide resistance to a specific disease or condition, frequently an infection, without causing the disease or condition. The antigen can be a live virus, preferably an attenuated virus, a killed virus, a mixture of proteins, an isolated protein, a nucleic acid, a carbohydrate, a chemical, or any other agent that can induce an immune response, or any combination thereof. A vaccine can induce an immune response after a single immunization or may need to be administered multiple times (e.g., 2, 3, 4, etc. times) either at short intervals (multiple administrations within a year) to produce a sustained response, or at long intervals, e.g., every 5, 10, 15, 20, etc. years to maintain immunity. Administration of a dose of the vaccine can also be prompted by possible or known exposure to the pathogen. Such considerations are understood by those of skill in the art.

A "vector" is a nucleic acid sequence that includes sequences to allow for replication of the nucleic acid sequence in an appropriate cell type. In a preferred embodiment, a vector includes sequences, e.g., restriction sites, to allow for the insertion of another nucleic acid fragment, for example to allow for propagation of the inserted sequence in the vector. Vectors include, but are not limited to, plasmid vectors and viral vectors.

Ranges provided herein are understood to be shorthand for all of the values within the range. This includes all individual sequences when a range of SEQ ID NOs: is provided. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms "a", "an", and "the" are understood to be singular or plural.

Unless specifically stated or obvious from context, as used herein, the term "about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein can be modified by the term about.

The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Nucleic acids encoding the various polypeptide sequences can readily be determined by one of skill in the art, and any sequence encoding any of the polypeptide sequences of the invention falls within the scope of the invention.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

As used herein, the compounds of this invention are defined to include pharmaceutically acceptable derivatives thereof. A "pharmaceutically acceptable derivative" means any pharmaceutically acceptable salt, ester, salt of an ester, or other derivative of a compound of this invention which, upon administration to a recipient, is capable of providing (directly or indirectly) a compound of this invention.

Particularly favored derivatives are those that increase the bioavailability of the compounds of this invention when such compounds are administered to a mammal (e.g., by allowing an orally administered compound to be more readily absorbed into the blood, to increase serum stability or decrease clearance rate of the compound) or which enhance delivery of the parent compound to a biological compartment (e.g., the brain or lymphatic system) relative to the parent species. Derivatives include derivatives where a group which enhances aqueous solubility or active transport through the gut membrane is appended to the structure of formulae described herein. The compounds of this invention may be modified by appending appropriate functionalities to enhance selective biological properties. Such modifications are known in the art and include those which increase biological penetration into a given biological compartment (e.g., blood, lymphatic system, central nervous system), increase oral availability, increase solubility to allow administration by injection, alter metabolism and alter rate of excretion. Pharmaceutically acceptable salts of the compounds of this invention include those derived from pharmaceutically acceptable inorganic and organic acids and bases. Examples of suitable acid salts include acetate, adipate, benzoate, benzenesulfonate, butyrate, citrate, digluconate, dodecylsulfate, formate, fumarate, glycolate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, lactate, maleate, malonate, methanesulfonate, 2- naphthalenesulfonate, nicotinate, nitrate, palmoate, phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, tartrate, tosylate and undecanoate. Salts derived from appropriate bases include alkali metal (e.g., sodium), alkaline earth metal (e.g., magnesium), ammonium and N-(alkyl)4+ salts. This invention also envisions the quaternization of any basic nitrogen-containing groups of the compounds disclosed herein. Water or oil-soluble or dispersible products may be obtained by such quaternization.

The compounds of the invention can, for example, be administered ex vivo by injection, intraheptatically, with a dosage ranging from about 0.001 to about 100 mg/kg of body weight, or according to the requirements of the particular drug and more preferably from 0.5-10mg/kg of body weight. For administration of viral particles, dosages are typically provided by number of virus particles (or viral genomes) or plaque forming units (PFUs), and effective dosages would range from about 1 to 10 8 particles or about 1 to 108 plaque forming units.

In alternative embodiment, the effective dose can be the total number of particles administered, of one or more types. The methods herein contemplate administration of an effective amount of compound or compound composition to achieve the desired or stated effect.

Frequency of dosing will depend on the agent administered, exposure to the pathogen, antibody titer in a subject, and other considerations known to those of skill in the art. Administration will preferably occur only once, however multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8 administrations) are possible within the scope of the invention, either at specific periodic intervals, or episodically depending on exposure or potential exposure to the virus. Dosing may be determined in conjunction with monitoring of antibody titer.

The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. A typical preparation will contain from about 1% to about 95% active compound (w/w). Alternatively, such preparations contain from about 20% to about 80% active compound.

Lower or higher doses than those recited above may be required. Specific dosage and treatment regimens for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, condition or symptoms, the patient's disposition to the disease, condition or symptoms, method of administration, and the judgment of the treating physician.

The term "pharmaceutically acceptable carrier" refers to a carrier that can be administered to a patient, together with a compound of this invention, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the compound.

The pharmaceutical compositions of this invention may be administered enterally, by oral administration, parenterally, intraocularly, by inhalation spray, topically, nasally, buccally, or via an implanted reservoir, preferably by oral administration or administration by injection. The pharmaceutical compositions of this invention may contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases, or buffers to enhance the stability of the formulated compound or its delivery form. The term parenteral as used herein includes, for example, intraocular, subcutaneous, intraperitoneal,

intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrastemal, intrathecal, intralesional, and intracranial injection, or other infusion techniques. The pharmaceutical carriers may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. Preferably agents of the invention are prepared as pharmaceutical compositions in solution acceptable for use in conjunction with vaccines or viral delivery. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer' s solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, or carboxymethyl cellulose or similar dispersing agents which are commonly used in the formulation of pharmaceutically acceptable dosage forms such as emulsions and or suspensions. Other commonly used surfactants such as TWEENs® or SPANs® and/or other similar emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation.

When the compositions of this invention comprise a combination of a compound of the formulae described herein and one or more additional therapeutic or prophylactic agents, both the compound and the additional agent should be present at dosage levels of between about 1 to 100%, and more preferably between about 5 to 95% of the dosage normally administered in a monotherapy regimen. The additional agents may be administered separately, as part of a multiple dose regimen, from the compounds of this invention. Alternatively, those agents may be part of a single dosage form, mixed together with the compounds of this invention in a single composition.

Effective dosages of the expression constructs of the invention to be administered may be determined through procedures well known to those in the art which address such parameters as biological half-life, bioavailability, route of administration, and toxicity. Kits

The present invention also encompasses a finished packaged and labelled pharmaceutical product or laboratory reagent. This article of manufacture includes the appropriate instructions for use in an appropriate vessel or container such as a glass vial or other container that is hermetically sealed. A pharmaceutical product may contain, for example, a compound of the invention in a unit dosage form in a first container, and in a second container, sterile water or adjuvant for injection.

As with any pharmaceutical product, the packaging material and container are designed to protect the stability of the product during storage and shipment. Further, the products of the invention include instructions for use or other informational material that advise the physician, technician, or patient on how to appropriately prevent or treat the disease or disorder in question. In other words, the article of manufacture includes instructions indicating or suggesting a dosing regimen including, but not limited to, actual doses, monitoring procedures (e.g. antibody titer), and other monitoring information.

Specifically, the invention provides an article of manufacture including packaging material, such as a box, bottle, tube, vial, container, sprayer, needle for administration, envelope and the like; and at least one unit dosage form of a pharmaceutical agent contained within the packaging material, wherein the pharmaceutical agent includes a compound of the invention, and the packaging material includes instruction which indicate that the compound can be used to immunize a subject against viral infection using specific dosing regimens as described herein.

Co-administration of compounds

The compositions and methods of the invention can be combined with any other composition(s) and method(s) known or not yet known in the art for the prevention, amelioration, or treatment of viral infection. The compositions and methods provided herein can be used in combination with any other therapeutic methods deemed appropriate by the treating physician. Detailed Description Flaviviruses such as West Nile, Japanese encephalitis, St. Louis encephalitis virus, and tick-borne encephalitis (TBEV) viruses are important neurotropic human pathogens, causing a devastating and often fatal neuroinfection. Here, we demonstrate that the incorporation of a target sequence for central nervous system (CNS)- expressed (e.g., brain expressed), preferably CNS-specific (brain- and/or spinal cord- specific) microRNAs into the viral genome is a powerful approach to control the neuropathogenesis of flavivirus infection. As a model virus to be used for this type of modification, we selected a chimeric tick-borne encephalitis/dengue virus

(TBEV/DEN4) that contained the structural protein genes of a highly virulent TBEV. The inclusion of just a single copy of the target for a brain-enriched mir-9, mir-124a, mir-128, mir-218, or let-7c microRNA into the TBEV/DEN4 genome was sufficient to prevent the development of lethal encephalitis in mice infected directly in the brain with a large dose of virus. Viruses bearing a complementary target for mir-9 or mir- 124 were highly restricted in replication in primary neuronal cells, had limited access into the central nervous system of immunodeficient mice, and retained the ability to induce a strong humoral immune response in monkeys. This work demonstrates that a microRNA-targeting approach to control virus tissue tropism can provide a new basis for design of safe and effective live virus vaccines against neurotropic flaviviruses.

Mature microRNAs (miRNAs) regulate diverse cellular processes in many plant and animal species through the assembly of a miRNA-induced silencing complex (RISC), which binds the complementary targets in messenger RNA and subsequently catalytically cleaves or transcriptionally represses the targeted mRNA (Bartel, 2004; He and Hannon, 2004; Filipowicz et al., 2008). In addition, recent studies suggest that miRNAs also play a role in the regulation of virus infections (Gottwein and Cullen, 2008; Jopling, et al., 2005; Cullen, 2006). Since the pattern of miRNA expression is cell- and tissue-specific, it is believed that viruses avoid the sequences in their genomes that are complementary to cellular miRNAs present in tissues in which they replicate efficiently and cause disease.

MicroRNA sequences are available from a number of sources including the miRBase database available at www.mirbase.org/index.shtml. Nucleic acids, i.e. DNAs, which encode flavivirus genome, will include the sequence of the miR with the U's replaced with T's. As the DNA will encode an RNA (complementary sequence) that will be complementary to the mature miR present in the cell. A f avivirus, which is an RNA virus, will necessarily include a sequence complementary to the miR. It is understood that the virus or the nucleic acid encoding the virus need not include the full miR sequence or a complement of the full length miR sequence. The miR sequence/sequence complementary to the miR simply needs to be long enough to promote cleavage/ inactivation of the resulting virus. The following miR sequences and complements thereof are provided as examples (all sequences are read 5' to 3' . MicroRNA sequences and complementary sequences are RNA, and the coding miR-target sequences are DNA). Table 4. MicroRNA sequences, complementary sequences, and encoding target sequences

The sequences in the table are human miR sequences, but are identical to microRNA sequences from a number of other species (e.g., miR124 sequence in the table is identical to Homo sapiens, Gorilla gorilla, Ateles geoffroyi, Pan paniscus, Pongo pygmaeus, Pan troglodytes, Macaca mulatto, Lagothrix lagotricha, Xenopus tropicalis, Monodelphis domestica; and identical for 21 out of 22 contiguous nucleotides of mirl24 of Caenorhabditis elegans, Drosophila melanogaster,

Caenorhabditis briggsae, Drosophila pseudoobscura, Apis mellifera, Anopheles gambiae, Danio rerio, Sus scrofa, Fugu rubripes, Tetraodon nigroviridis, Bos Taurus, Schmidtea mediterranea, Bombyx mori, Ciona intestinalis, Ciona savignyi,

Ornithorhynchus anatinus, Tribolium castaneum, Drosophila ananassae, Drosophila erecta, Drosophila grimshawi, Drosophila sechellia, Drosophila simulans,

Drosophila virilis, Drosophila willistoni, Drosophila yakuba, Branchiostoma floridae, Capitella teleta, Lottia gigantean, Daphnia pulex, Ixodes scapularis, Brugia malayi, Taeniopygia guttata, Acyrthosiphon pisum, and Nasonia vitripennis . Such alignments can be readily performed using the miRbase database at

www.mirbase.org/search.shtml. It is understood that many of the genuses (e.g., Caenorhabditis, Drosophila) and species listed are not relevant to vaccine

administration. The list is provided to demonstrate the wide spread conservation of microRNA sequences throughout the animal kingdom. Further, it is known in the art that there is conservation of localization of miRs, e.g., mirl24 in brain in mammals, e.g., humans and mouse. Therefore, it is expected that inclusion of the target sequences provided herein to diminish virus neurotropism will be useful in a number of mammals for which immunization is relevant (e.g., dogs, cats, horses, etc.).

MicroRNAs are transcribed as precursor RNA molecules that are processed to the active length of about 21 to 24 nucleotides.

Many flaviviruses cause neurologic disease such as meningitis and/or encephalitis, and we sought to design a flavi virus that was selectively attenuated for the CNS, since this is a target of wild- type neurotropic virus. Herein we demonstrate the ability of the brain tissue-expressed cellular miRNAs to control the neurotropism of a flavi virus bearing complementary miRNA-target sequences. We demonstrate that these viruses replicate in peripheral (i.e., non-CNS) tissues and induce a strong adaptive immune response, but are restricted in their ability to replicate in the CNS. Without being bound by mechanism, it is suggested that since the CNS-expressed miRNAs recognize the introduced complementary target sequences in the viral RNA genome, the miRNAs limit the translation, replication, and assembly of the virus genome into a virion.

The miRNA target sequences that were selected for insertion into the viral genome were complementary to let-7c, mir-9, mir-124a, mir-128a, or mir-218 miRNA, which have evolutionarily conserved sequences among mammalian species including mice and humans (Sempere et al., 2004). With the exception of mir-218, which is predominantly expressed in motor neurons (Kapsimali et al., 2007), all of the other selected miRNAs were previously found to be highly expressed in the brain of adult mice and humans (Lagos-Quintana et al., 2002; Sempere et al., 2004; Bak et al., 2008). Mir-124a is highly upregulated in neuronal cells as are mir-9 and mir-128a, but the latter two are also found in peripheral tissues (Sempere et al., 2004; Plaisance et al., 2006). The brain-enriched let-7c miRNA is a member of the let-7 family of miRNAs that are found to be widely expressed in many tissues of various species and also act as tumour suppressors (Zhang et al., 2007; Barh et al., 2010). The flavivirus genome is a positive-sense single- stranded RNA that is approximately 11 kb in length and contains 5' and Ύ non-coding regions (NCR) flanking a single open reading frame (ORF) encoding a polyprotein that is processed by viral and cellular proteases into three structural proteins (capsid (C), premembrane (prM), and envelope (E)) and seven non- structural proteins (Lindenbach et al., 2007). The five miRNA targets that we selected were individually introduced into the 3 'NCR of the flavi viral genome.

A number of neurotropic flaviviruses are known, including, but not limited to mosquito-borne WNV, JEV, SLEV, YFV, and tick-borne viruses including TBEV (Central European, Siberian, and Far Eastern subtypes), Langat, Kyasanur forest disease, Omsk hemorrhagic fever, and Powassan viruses.

As a model virus for modification of flavivirus neurotropism, we selected a chimeric tick-borne encephalitis/dengue type 4 virus (TBEV/DEN4) that was constructed by replacing the structural prM and E protein genes of the non- neuroinvasive, mosquito-borne dengue type 4 virus (DEN4) with the corresponding genes of the highly virulent Far Eastern strain of TBEV (Pletnev et al, 1992 and US Patent Publication 20030165539, both incorporated herein by reference).

TBEV/DEN4 retains a high level of neurovirulence from its TBEV parent (a

Biosafety Level 4 agent) in mice inoculated intracerebrally, however, consistent with the phenotype of its other parent, a DEN4 virus, the chimeric TBEV/DEN4 virus is non-neuroinvasive in immunocompetent mice and monkeys following the peripheral route of inoculation (Rumyantsev et al., 2006).

We demonstrate that the incorporation of miRNA target sequence into the viral genome is a powerful new approach to control the virus neuropathogenesis of flavivirus infection. Based on the known mechanism of RNA interference (RNAi) (see, e.g., WO200175164, incorporated herein by reference), the microRNA-targeting approach should be useful for reducing neurtropism of RNA viruses in general, particularly neurotropic flaviviruses as demonstrated herein. Without being bound by mechanism, if the virus is being cleaved by a microRNA-mediated mechanism, the virus should contain a sequence at least 19 nucleotides in length that is

complementary to the target miR, typically the fully processed miR sequence. The sequence in the virus can be complementary to the full length of the miR, typically about 20, 21, 22, or 23 nucleotides. From the five selected miRNA-target sequences that were introduced into the flavi virus genome, the let-7c or mir-124 miRNA targeting was most effective in terms of both inhibition of virus replication in vitro and reduction of virus pathogenicity in mice, with the virus containing a sequence complementary to miR- 124 proving a more robust immune response.

Chimeric TBEV/DEN4 virus, like many other flaviviruses, is neurotropic and efficiently replicates in human cells of neuronal origin and in the brains of mice and monkeys inoculated IC, in which virus antigens were detected exclusively in neurons (Rumyantsev et al., 2006; Engel et al., 2010; Maximova et al., 2008). MicroRNA mir- 124 is CNS-specific, broadly distributed throughout many regions of brain, expressed only in neurons, and regulates neuronal differentiation (Sempere et al., 2004; Bak et al., 2008; Makeyev et al., 2007). As demonstrated herein, the virus bearing the mir- 124 target was found to be highly restricted for replication (greater than 1000-fold) in vitro in primary rat neurons compared to parental TBEV/DEN4 virus and attenuated in vivo in adult immunocompetent mice. In addition, the introduction of mir-124 target sequence into the TBEV/DEN4 genome decreased the neuroinvasive potential of the virus in immunodeficient SCID mice. Nevertheless, the mir-124T virus retained the ability of its parent to replicate in peripheral non-CNS-tissues in monkeys and stimulates a high level of neutralizing antibody. Immunogenicity of the mir-124T virus in monkeys was higher than that observed for a commercial inactivated TBEV vaccine given at three doses of immunization; this level of TBEV- specific antibodies induced by the inactivated TBEV vaccine was shown to be sufficient to completely protect the immunized monkeys against challenge with tick-borne Langat virus as observed previously (Rumyantsev et al., 2006). Based on these results, it is expected that inclusion of sequences complementary to mir-124 of sufficient length is useful for restricting virus tissue tropism and reducing viral pathogenesis of any RNA virus. Although the inclusion of target sequences for three other brain-enriched miRNAs (mir-9, mir-128, or mir-218) attenuated the TBEV/DEN4 virus for the CNS of immunocompetent mice inoculated IC, the pathogenic potential of the mir-9T, mir- 128T, or mir-218T virus to replicate and cause encephalitis from the peripheral site of inoculation was less restricted than that of mir-124T. The absence of potent B and T cell responses in SCID mice allows for prolonged replication of virus, leading to the emergence of mutations which restore the ability of virus to cause encephalitis.

All of the brain-isolated miRNA-target viruses from the paralyzed mice contained single-nucleotide mutations located in miRNA target insertions, suggesting that these mutations permit viruses to overcome miRNA-mediated inhibition. The emergence of escape mutations could occur in the peripheral tissues before the invasion into the CNS of SCID mice or after invasion, when virus was replicating under miRNA pressure in the CNS. For this reason, in preferred embodiments, the viruses include sequences complementary to one or more miRs that are specifically expressed in the CNS.

Interestingly, the observed level of attenuation of miRNA-target viruses in SCID mice reflects the level of expression and distribution of the corresponding miRNA in the mouse brain (mir-124a > let-7c > mir-9 > mir-128a > mir-218) (1) suggesting the important role of miRNA expression level in controlling replication of these viruses in the CNS (Bak et al., 2008). The expression of mir-128 and mir-218 miRNAs is limited in many regions of the brain. Without being bound by

mechanism, it is suggested that the reason that the mir-128 and mir-218 miRNA targets were less effective in restricting virus replication in primary rat neurons and preventing lethal encephalitis in SCID mice. Inclusion of a target for miRNA mir-9, which is highly expressed in many regions of the CNS (Bak et al., 2008; Krichevsky et al., 2003), significantly reduced replication of TBEV/DEN4 in primary rat neurons (~ 8,000-fold reduction) and completely abolished virus replication in adult mice and monkeys. Without being bound by mechanism, it is suggested that the greatly restricted viremia in mir-9T-infected monkeys might be a result of the virus inhibition by the mir-9 miRNA expressed in non-CNS tissues. Findings in recent studies indicate that mir-9 is expressed in peripheral tissues (Plaisance et al., 2006; Wang et al., 2010). The inclusion of the let-7c target in the TBEV/DEN4 genome did not allow us to rescue virus in Vero cells in which the let-7c miRNA is expressed. Thus, the let- 7cT virus was generated in mosquito cells where let-7c miRNA was not detected. Following infection of Vero cells with let-7cT virus, we demonstrated that a single nucleotide mutation within the target sequence of let-7cT* virus resulted in a mismatched base paring with the corresponding miRNA and restored the ability of the recovered virus to efficiently replicate in Vero cells (Figure 2). These observations reflect and support the mechanism of cellular defence against virus infection throughout miRNA-mediated regulation. Let-7c is a member of a large let-7 family of miRNAs which are ubiquitously expressed in a multitude of tissues and cells and thus can restrict virus replication. The mosquito cell-derived let-7cT virus was restricted in replication in primary rat neurons, simian Vero and human cell lines and was not able to cause neurological disease in mice via the IC or IP route. Based on our experience with mir-9T virus, we would expect that the high level and broad expression of let-7c in peripheral tissue would also significantly impair virus replication resulting in a reduced level of immunogenicity.

In the 1950's and 1960's, there were many attempts to develop oncolytic flaviviruses with tumor specificity. TBEV and WNV were evaluated in many clinical trials as oncolytic therapeutic agents against a variety of cancers (Kelly and Russell, 2007; Meerani and Yao, 2010), but clinical trials were stopped because of limited success due to severe adverse events. Recent advances in engineering cytolytic viruses with miRNA targets to control virus tissue-tropism has revived an interest in their use for oncolytic virotherapy. Such designed viruses would be restricted for replication in normal cells, but would not be restricted in cancer cells allowing for a targeted lysis of cancer cells. Members of the miRNA let-7 family, including let-7c, are tumor suppressors and downregulated in several cancers (Zhang et al., 2007; Barh et al., 2010). The insertion of a target for widely expressed miRNA, such as let-7c (or other members of the let -7 family), into the TBEV/DEN4 flavi virus has provided us with an opportunity to investigate its oncolytic potential.

In conclusion, we demonstrated that the inclusion of a single copy of the target for a brain-enriched miRNA into the genome of highly neurovirulent flavivirus completely prevents the development of lethal encephalitis in adult mice infected directly in the brain. This finding supports the further use of the miRNA approach to control the virus tropism and develop live attenuated virus vaccines against neurotropic viruses.

The levels of attenuation of miR-targeted viruses in suckling mice were significantly lower than that observed in adult mice, since newborn mice have both developing CNS and immature immune system and are a most sensitive animal model for measuring neurovirulence of flaviviruses, including the assessment of residual neurovirulence of live attenuated vaccine viruses In an effort to enhance the safety of new vaccine candidates, the benefit of multiple target copies for a single designated neuron- specific miRNA (such as mir-124) alone or in combination with targets for brain-enriched mir-9 miRNA was investigated next. Virus escape from miRNA- mediated inhibition in the CNS of suckling mice was progressively reduced by increasing the number of target sites for broadly CNS-expressed miRNAs in the 3 'NCR of viral genome. We found that combining two tandem targets for two brain- specific miRNAs (mir-9 and mir-124) in viral genome was more efficient in restricting the virus neurovirulence compared to a tandem of two or three targets for mir-124. We demonstrated that the three tandem-repeat copies of a mir-124 target (at sites #1, 2, and 3) are less efficacious in the prevention of escape mutant generation in the mouse CNS than the same number of mir-124 target elements with the increasing space distance between targets (at sites #1, 2, and 5 or 1, 2, and 7). Analysis of the escape mutants derived from the brains of moribund mice shows that resistant viruses overcame this inhibition exclusively by acquiring large deletions that included the introduced miRNA-targeted sequences and the portion of viral genome located between two most distant miRNA targets. These findings indicate that the increase in the number of miRNA-targets in the 3 'NCR as well as in the length of targeted genome sequence led to a significant attenuation of flavivirus neurovirulence even in the immature CNS of newborn mice. Importantly, multiple miRNA-target insertions (2, 3, or 4 copies) in the 3 'NCR of viral genome completely abolished

neuroinvasiveness of virus in adult mice and did not impaired immunogenicity and protective efficacy in mice. Mice immunized with a single dose of either miRNA- targeted virus were partially or completely protected against severe IC challenge during the 21 day period of observation (Figure 9) and there was no difference in the level of protection induced in mice by parental TBEV/DEN4 (67%) or its miRNA- targeted viruses (50-100%).

Based on the studies in suckling mice with TBEV/DEN4 carrying multiple miRNA-target insertions (2, 3, or 4 copies) in the 3'NCR, we conclude that the best way to avoid the virus escape from miR-inhibition and further restrict virus neurotropism is to increase of the number of target sites and targeting the viral genome at the sequence that is functionally essential for virus life. Next, we explored the miR-mediated suppression of virus replication by the simultaneous miR- targeting of the virus genome in the 3'NCR and in the open reading frame (ORF) of polyprotein. Four viruses [E(3x miR-124-9-124T)-3'NCR(3x miR-124_1,2,5T), E(3x miR-124-9-124T)-3'NCR(3x miR-124_1,2,7T), E(3x mir-124T)-3'NCR(3x miR- 124_1,2,5T), and E(3x miR-124T)-3'NCR(3x miR-124_1,2,7T)] were generated that carried six miR-target elements, three in the 3'NCR and three between structural envelope E and non-structural NS1 protein genes. We demonstrate that the simultaneous multiple miR- targeting of virus genome in two distinct regions abolished virus neurovirulence in suckling mice and completely prevented the virus escape from miR-mediated repression.

The following examples are provided merely as illustrative of various aspects of the invention and shall not be construed to limit the invention in any way. EXAMPLES

Example 1. Materials and Methods

Cells and viruses. Mosquito C6/36 cells (ATCC) were maintained in Eagle's minimal essential medium (Invitrogen) supplemented with 10% fetal calf serum (Lonza), 2 mM L-glutamine, 2 mM nonessential amino acids, and 50 μg/ml gentamicin (Invitrogen) at 32°C in an atmosphere of 5% CO₂. Simian Vero (kidney cell line) and human HeLa (cervical cancer cell line), SY-SH5Y (neuroblastoma cell line), or LN-18 (glioblastoma cell line) cells were cultured as previously described (Engel et al., 2010). Primary rat cortex neuron cells (Invitrogen) were maintained in Neurobasal™ medium supplemented with 0.5 mM GlutaMAX™-I and 2% B27 Supplement (Invitrogen) at 37°C in 5% CO₂. All experiments using TBEV/DEN4 and its derived viruses were conducted in BSL-3 containment laboratories at the NIAID, NIH. Chimeric TBEV/DEN4 cDNA (GenBank accession no. FJ828986, incorporated herein by reference in the version available on the filing date of the application) contains the prM and E protein genes of Far Eastern subtype TBEV strain Sofjin with the remaining sequence derived from recombinant DEN4 virus (Pletnev et al., 1992). This chimeric cDNA was used to generate recombinant viruses containing a large deletion in the 3 'NCR or insertion of a miRNA-target sequence. To generate the Δ1-Δ9 deletion mutant viruses, each deletion was introduced into the full-length cDNA genome of TBEV/DEN4 through site-directed mutagenesis. The resulting cDNA clones were differed from parental TBEV/DEN4 cDNA by the designed deletion of 104 (Δ1; from nt 10281 to 10384), 199 (Δ2; from nt 10281 to 10479), 243 (Δ3; from nt 10281 to 10523), 270 (Δ4; from nt 10281 to 10550), 99 (Δ5; from nt 10379 to 10479), 144 (Δ6; from nt 10379 to 10523), 172 (Δ7; from nt 10379 to 10550), 50 (Δ8; from nt 10474 to 10523), or 77 (Δ9; from nt 10474 to 10550) nts of the TBEV/DEN4 genome and by the insertion of the new BstBI cleavage site located in the site of each deletion (see Figure 6).

To generate viruses carrying a single complement target for let-7c, mir-9, mir- 124a, mir-128a, or mir-218 miRNA, the inserted sequence was 5'- TTCGAAAACCATACAACCTAC TACCTCACTCGAG-3 ' , 5'- TTCGAATCATACAGCTAGATAACCAAAGACTCGAG-3 ' , 5 ' - TTCGAATGGCATTC ACCGCGTGCCTTAACTCGAG-3 ' , 5 ' - TTCGAAAAAAGAGACCGGTTC ACTGTGACTCGA G-3', or 5'- TTCGAAACATGGTTAGATCAAGCACAACTCGAG-3 ' , respectively. Each miRNA-target sequence flanked with a BstBI site at the 5 '-end and an Xhol site at the 3 '-end was synthesized by Blue Heron Biotechnology and inserted immediately after the TAA-stop codon into the TBEV/DEN4 genome between nt 10280 and 10281.

RNA transcripts derived from the modified TBEV/DEN4 cDNA clones were generated by transcription with SP6 polymerase and used to transfect Vero or C6/36 mosquito cells in the presence of Lipofectamine™ (Invitrogen) as described previously (Pletnev et al., 2001; Engel et al., 2010). Transfected cells were examined by immunofluorescence assay (IFA) for presence of TBEV proteins using the TBEV- specific antibodies in the hyperimmune mouse ascetic fluid (ATCC). When 80-100% of cells were positive by IFA, the recovered viruses from the cell culture medium were collected, biologically cloned by two terminal dilutions and then amplified by two passages in Vero or C6/36 cells.

The 3' NCR deletion mutants (Δ1-Δ9) and four TBEV/DEN4 viruses carrying miRNA-target (designated as mir-9T, mir-124T, mir-128T, and mir-218T) were recovered from Vero and C6/36 cells, while a virus containing the target sequence for miRNA let-7c (designed as let-7cT) was rescued only from C6/36 cells. Viral RNA for each virus was isolated and the complete sequence of the genome was determined. To verify the presence of the introduced deletion or miRNA-target insertion into the genome, viral RNA for each virus was isolated and the consensus sequence of the genome was determined.

Virus infections in cell cultures. The kinetics and level of replication of parental and derivative viruses were compared in Vero, C6/36, HeLa, SH-SY5Y, and LN-18 cell lines. Cells grown on 6- well plates were inoculated with virus at a multiplicity of infection (MOI) of 0.01 plaque forming unit (PFU)/cell and were allowed to adsorb for 1 hr. Inoculum was then replaced with fresh medium. Virus in culture medium from one individual well was harvested daily and its titer was determined in Vero or C6/36 cells using a plaque forming assay (PFA) as described previously (Pletnev et al., 2001 ; Pletnev and Men, 1998).

To initiate let-7cT virus replication in Vero cells, cells were infected with the C6/36 cell-derived let-7cT virus at an MOI of 5 and examined on every third day post-inoculation by IFA. In two separate experiments, on days 12 and 15 of postinfection, when -100% of cells became virus antigen-positive, two viruses (let-7cTA and let-7cT*) were isolated, purified, sequenced, and used for studies in cell cultures and animals. Primary rat cortex neuron cells were grown 7 days on the chambers (10⁵ cells/chamber) of BD BioCoat™ glass slides (BD Biosciences) and then infected with viruses at an MOI of 0.5. Cell supernatant was collected daily, and virus titer was determined in Vero or C6/36 cells.

Immunofluorescence assay. Virus-infected cells on the glass slides were fixed with 4% paraformaldehyde for 20 min, washed three times with D-PBS (Invitrogen), and permeabilized with 0.3% Triton-XlOO for 5 min. Following three D-PBS washes, cells were blocked with 5% goat serum (Invitrogen) in D-PBS for 1 hr and then treated sequentially with 1:100 diluted TBEV- specific antibodies for 1 hr and 1:500 diluted fluorescein-labeled antibodies to mouse IgG (KPL). Cells were rinsed three times with D-PBS and mounted with VectaShield™ medium containing DAPI (Vector Laboratories).

RNA isolation, reverse transcription, sequence analysis, and quantitation. Viral RNA from cell culture medium or mouse brain homogenates was isolated using the QiaAmp™ Viral RNA Mini kit (Qiagen) and one-step RT-PCR was performed using the Superscript One-Step kit (Invitrogen) with DEN4- or TBEV-specific primers. The nucleotide consensus sequences of the virus genomes were determined through direct sequence analysis of the PCR fragments on a 3730 Genetic Analyzer using TBEV or DEN4 virus-specific primers in BigDye™ terminator cycle sequencing reactions (Applied Biosystems) and were analyzed using Sequencher 4.7 software (Gene Codes Corporation).

Total RNA from 4 xlO⁶ Vero or C6/36 cells was isolated using a Qiagen miRNeasy™ kit (Qiagen) and used to determine the copy number of let-7c, mir-9, mir-124a, mir-128a, and mir-218 microRNA molecules by TaqMan® microRNA qRT- PCR (Applied Biosystem) according to manufacturer's protocols. Briefly, 1 ng of each RNA sample was reverse transcribed and the subsequent product was amplified and measured in triplicate using an AB TaqMan® microRNA assay on a validated AB 7900HT Real-Time Thermocycler. To determine each miRNA copy number per ng, the absolute quantity of each miRNA was calculated using a standard curve that was independently-generated with known quantities of the corresponding synthetic miRNA oligonucleotide (Asuragen™, Inc.).

Evaluation of viruses in mice. Studies in mice were conducted according to

Federal and NIAID Animal Care and Use Committee regulations. The neuro virulence of parental TBEV/DEN4 and TBEV/DEN4A242 viruses was evaluated in 3-day-old Swiss Webster mice (Taconic Farms) by intracerebral (IC) inoculation. Suckling mice in litters of 10 were inoculated with 1, 10, or 10 PFU of virus and monitored for morbidity and mortality up to 21 days post-inoculation. The 50% lethal dose (LD₅₀) was determined by the Reed & Muench method (Reed and Muench, 1938). Moribund (paralyzed) mice were humanely euthanized. To determine the neurovirulence of TBEV/DEN4 and all miRNA-target TBEV/DEN4 viruses, 6-week-old Swiss mice in groups of 5 were inoculated IC with 10-fold serial dilutions of virus ranging from 1 to 10^J PFU of TBEV/DEN4 or from 10 to 10⁵ PFU of each engineered miRNA-target virus. Mice were monitored for signs of encephalitis for 21 days, and the brains of mice which received a 10⁵ PFU dose of virus were harvested on day 22 and were assayed for virus by PFA on Vero and C6/36 cells (Rumyantsev et al., 2006; Engel et al., 2010) and by RT-PCR.

To investigate the neuroinvasive phenotype of TBEV/DEN4 and its derivatives, 3-week-old SCID mice (ICRSC-M; Taconic Farms) in groups of 5 were inoculated intraperitoneally (IP) with 10⁵ PFU of virus and observed for 49 days for signs of morbidity typical for CNS involvement, including paralysis. Moribund mice were humanely euthanized and their brain homogenates were prepared as previously described (Engel et al., 2010) to assess the level of virus replication using the PFA on Vero or C6/36 cells. Also, viral RNA from brain homogenates was extracted and the sequence of the genomic region containing the engineered miRNA-target was determined.

Evaluation of viruses in rhesus monkeys. Studies in monkeys were conducted at the NIAID BSL-3 facility in accordance with Federal and NIAID Animal Care and Use Committee regulations. Twelve Macaca mulatta monkeys, weighting 2.5-5 kg, were screened for neutralizing antibody to TBEV and DEN4 and found to be seronegative. Groups of four monkeys were subcutaneously inoculated with 10⁵ PFU of TBEV/DEN4, mir-9T, or mir-124T virus. Monkeys were bled daily for 7 days for detection of viremia and on days 21 and 28 for measurement of neutralizing antibody titer. The amount of virus in serum was determined by direct titration on Vero cells using the PFA (Pletnev et al., 2001 ; Rumyantsev et al., 2006). The TBEV-specific neutralizing antibody titer was determined by a plaque reduction assay for individual serum samples using TBEV/DEN4 virus. Serum samples from another group of four monkeys that received three doses of a commercial TBEV inactivated vaccine (Encepur®, Chiron/Behring) in our previous study (Rumyantsev et al., 2006) were used for comparison.

EXAMPLE 2- The miRNA-targeting resulted in the restriction of TBEV/DEN4 virus replication in vitro. The 3 'NCR of flavi viruses varies from 380 to 800 nucleotides (nts) in length, and the terminal 120 nts (core element), which are essential for viral replication (Markoff , 2003), are more conserved among all flavivirus genomes than the

"variable" region located between the stop codon of the ORF and the core element. The 3 'NCR of TBEV/DEN4 is 384 nts in length, and we introduced a set of (Δ1-Δ9) large deletion ranging from 50 to 270 nts into the genome that extended into the entire "variable" element of the 3' NCR (Fig. 6A). The recovered deletion mutant viruses (Δ1, Δ2, Δ3, Δ5, Δ6, Δ7, Δ8, andA9) were not considerably different from the unmodified TBEV/DEN4 virus with respect to their replication in simian Vero cells (mean peak virus titer from 2xl0⁵ to 8xl0⁶ PFU/ml) and neuro virulence in suckling mice inoculated via the intracerebral (IC) route (the 50% lethal doses for parental and each deletion mutant were approximately 1 PFU). Consistent with previous observations, these data suggest that the "variable" region of a flavivirus genome can tolerate large insertions or deletions without significantly effecting virus replication in vivo and in vitro (Pierson et al., 2005; Markoff, 2003; Hoenninger et al., 2008, each incorporated herein by reference). The deletion mutants generated and tested herein are exemplary of the broad range of deletions that are tolerated in the 3' UTR and are not limiting.

The selected miRNA-target sequences were complementary to brain- specific or brain-enriched miRNAs (let-7c, mir-9, mir-124a, mir-128a, or mir-218) and inserted into the "variable" element of the 3 'NCR of TBEV/DEN4 genome between nucleotides 10280 and 10281 abutting the TAA-stop codon (Fig. IB). Each inserted target consisted of the exact complement sequence of its corresponding cellular miRNA, which should direct the immediate cleavage of the modified TBEV/DEN4 RNA genome mediated by the cellular RISC (Bartel, 2004; Grimson et al., 2007; Filipowicz et al., 2008).

Mosquito C6/36 and simian Vero cells were selected for virus recovery since both cell lines maintained an efficient replication of parental TBEV/DEN4 virus. The latter cell line is certified as a cell substrate for production of vaccines for use in humans. Genomic RNA transcripts were generated by SP6 polymerase from the engineered full-length cDNAs and transfected into cells as described previously (Pletnev and Men, 1992; Pletnev et al., 2001; Engel et al., 2010). We demonstrated that mosquito C6/36 cells, which do not express the above-mentioned miRNAs as measured by TaqMan® microRNA assay, were able to support the generation of each TBEV/DEN4 mutant virus (designated as let-7cT, mir-9T, mir-124T, mir-128T, and mir-218T) containing the inserted miRNA-targets. MiRNA-target insertions did not significantly affect the virus replication in C6/36 cells since the growth kinetics of the unmodified parental TBEV/DEN4 and its derivatives were similar (Fig. 2A). Also, viruses bearing targets for brain-expressed miRNAs (mir-9, mir-124a, mir-128a, and mir-218) were recovered in Vero cells and their levels of replication were comparable with that of parental TBEV/DEN4 virus (Fig. 2B).

In contrast, recovery of the mir-7cT virus in Vero cells failed despite several attempts, and we found that the corresponding miRNA (let-7c) was expressed in these cells up to 463 copies/ng of total cellular RNA. Furthermore, the replication of C6/36 cell-derived let-7cT virus was greatly restricted in simian Vero cells or human SH- SY5Y, LN-18, or HeLa cells (Fig. 2C) compared to its replication in mosquito cells. Two escape mutant viruses (let-7cTA and let-7cT*) emerged in Vero cells that were infected with virus at a multiplicity of infection of 5 and isolated after a long-term incubation (on days 12 and 15 of post-infection) in two separate experiments.

Sequence analysis of the let-7cTA virus genome revealed a deletion of 14 nts in the 3 '-end of the miRNA-target sequence, which is required for efficient base paring with the "seed" sequence of the miRNA let-7c and subsequent repression of viral RNA translation and replication (Fig. 2D). A second Vero cell escape mutant (let-7cT*) contains a single A-to-G mutation that is located at a position 13 nt from the 3'-end of the target sequence and resulted in a U:G mismatch between the let-7c miRNA and its target in the viral genome (Fig. 2D). This mutation in the let-7cT* genome completely restored the ability of the virus to efficiently replicate in Vero cells (Fig. 2B). Insertion of other miR sequences did not inhibit replication in Vero cells, and the virus including the miR-7T sequence was able to replicate in the C6/36 mosquito cells as well as the parental virus not containing any miR sequence (Fig. 2C). Without being bound by mechanism, these observations support the miRNA- mediated mechanism of let-7cT virus suppression in Vero cells which can be eliminated by imperfect base pairing between the target and let-7c miRNA. To provide further evidence of miRNA-mediated inhibition of TBEV/DEN4 mutant viruses in vitro, growth analysis of the Vero cells-recovered viruses (mir-9T, mir-124T, mir-128T, and mir-218T) and the C6/C36-recovered let-7cT virus was performed in primary rat neurons derived from the cortex of embryonic rat brains. During prenatal brain development, rat neurons express increased levels of miRNA mir-9 and mir-124a, but not mir-128a (Krichevsky et al., 2003).

Parental TBEV/DEN4 and engineered mir-218T viruses replicated efficiently with nearly identical kinetics (Fig. 3A), reaching virus titers of 7.0 or 7.5 loglO PFU/ml by day 3 or 4 post-infection, respectively. At that time, the vast majority of cells infected with these two viruses expressed the TBEV-specific antigen in the cytoplasm as detected by immunofluorescence (Fig. 3B-E). The TBEV antigen immuno staining in the neurons infected with mir-128T virus (Fig. 3F and G) was diminished compared to that observed in TBEV/DEN4-infected cells. Also, the mir- 128T virus titer in cell culture medium was 50-fold lower than that attained by the TBEV/DEN4 virus (Fig. 3A).

The growth of mir-9T, mir-124T, and let-7cT viruses was impaired in the neurons since these viruses exhibited a greater than 1000-fold reduction in their titeres compared to the parent virus and the signal of fluorescence in each virus-infected cells (Fig. 3H-M) was less intense compared to that of TBEV/DEN4-infected cells (Fig. 3B and C), but was higher to that of mock cells (Fig. 3, Mock insertion in B).

Thus, these findings clearly indicate that the presence of a target sequence for highly-enriched brain miRNAs (let-7c, mir-9 or mir-124a) in the viral genome restricted or attenuated viral replication in developing primary neurons to a greater extent than the insertion of a target for the miRNAs (mir-128a and mir-218), which are not as widely distributed and expressed in the brain (Krichevsky et al., 2003; Bak et al., 2008).

EXAMPLE 3-- miRNA-target insertions decreased the neurovirulence and neuroinvasiveness of TBEV/DEN4 in mice.

Since TBEV/DEN4 retains the high neurovirulence of its TBEV parent when inoculated directly into brain of mice (Pletnev et al., 1993), we next sought to investigate the effect of miRNA-target insertions on viral pathogenesis by

determining the 50% lethal dose (LD₅₀) of viruses in immunocompetent mice. Adult mice were used because they are a highly sensitive animal model for assessment of TBEV neurovirulence, and because the expression pattern of brain- specific and brain- enriched miRNAs is conserved in adult mice, monkeys, and humans (Sempere et al., 2004; Bak et al., 2008; Miska et al., 2004).

Six-week-old Swiss mice were inoculated by the IC route with 10-fold serial dilutions ranging from 1 to 10³ PFU of TBEV/DEN4 or from 10 to 10⁵ PFU of miRNA-target viruses. The morbidity/mortality rate of TBEV/DEN4-inoculated mice

2 3 was dose-dependent, and all mice which received the highest doses (10 or 10 PFU) of TBEV/DEN4 died or developed paralysis, while 40% or 60% of the mice which received a dose of 1 or 10 PFU survived, respectively (Fig. 4).

Thus, in adult mice, parental TBEV/DEN4 virus was highly neuro virulent with a calculated IC LD₅₀ of 6 PFU and replicated efficiently in the mouse brain attaining a mean peak virus titer of 7.1 logio PFU/g of brain tissue. In contrast, mice inoculated with a dose of 10⁵ PFU (16,600-fold higher than the IC LD₅₀ of the parent virus) of virus carrying let-7c, mir-9, mir-124, mir-128, or mir-218 miRNA target remained healthy, without showing any neurological signs during the 21-day observation. On day 22 of the study, brains of five surviving animals from each group of mice infected with the highest dose (10⁵ PFU) of the above mentioned miRNA- target viruses were harvested and the virus titer of each individual brain suspension was determined on Vero or C6/36 cells. All mouse brains tested were found to be free from inoculated virus and did not contain detectable levels of viral RNA as determined by RT-PCR. Without being bound by mechanism, we conclude that the neurovirulence of TBEV/DEN4 in mice was greatly reduced or abolished by the introduction of the let-7c, mir-9, mir-124, mir-128, or mir-218 miRNA target sequence.

The engineered viruses were assessed for peripheral virulence in mice to determine the ability of virus to replicate, accumulate mutations, invade the CNS, and cause fatal encephalitis by escaping the miRNA-mediated inhibition. This possibility was evaluated in adult immunodeficient SCID mice, which are deficient for immune functions mediated by B and T lymphocytes and represent a considerably more sensitive animal model for detection of flavi virus neuroinvasiveness (Pletnev and Men, 1998; Rumyantsev et al., 2006). Unlike TBEV, which is highly pathogenic for normal, immunocompetent mice by intraperitoneal (IP) inoculation, chimeric

TBEV/DEN4 virus, even at a high dose of 10 PFU, failed to produce disease in the CNS and was not detected in brains on day 28 post-inoculation (Pletnev et al., 1993). However, TBEV/DEN4 is a neuroinvasive virus in SCID mice with an estimated IP LD₅₀ of approximately 25,000 PFU (Rumyantsev et al., 2006).

In SCID mice, the mir-218T virus exhibits a pathogenicity that was nearly similar to the parent TBEV/DEN4 virus when infected at a dose of 10⁵ PFU: all mice succumbed to TBEV/DEN4 or mir-218T virus infection between day 23 and 32 post- inoculation (Fig. 5A). A decrease in neuroinvasiveness was observed for mir-9T and mir-128T viruses as demonstrated by the reduction in morbidity/mortality of mice and by a significant delay in the onset of encephalitis compared to the parent virus. Each of the seven individual viruses that were present in brains of mice which succumbed to mir-9T, mir-128T, or mir-218T infection contained only single-nucleotide mutations within the miRNA-target sequence (Fig. 5B).

The identified mutations were located at the central part or the 3 '-end of target sequence and resulted in the disruption of the complementary pairing between the miRNA sequence and its target. These findings suggest that the acquired mutations in the miRNA-target region permit the virus to escape from the miRNA-mediated inhibition of virus replication. Interestingly, immunodeficient SCID mice were completely resistant to the mir-7cT or mir-124T infection. Thus, introduction of a target sequence for brain-expressed let-7c, mir-9, mir-124, or mir-128, but not for mir-218 miRNA, decreased the neuroinvasive potential of TBEV/DEN4 for immunodeficient mice.

EXAMPLE 4— Deletions in the 3' UTR are well tolerated for replication and do not reduce neurovirulence

A series of deletions in the 3 'UTR were generated and tested for the ability to replicate in Vero cells. The constructs are shown schematically in Figure 6A.

With exception for the Δ4 construct, mutant viruses were recovered from transfection of Vero cells and their titers were ranged from 2xl0⁵ to 8xl0⁶ PFU/ml. As can be readily seen in Figure 6A of the instant application, large mutations are tolerated, and no particular sequence within nucleotides 10281-10550 appears to be necessary for replication competence. Although the Δ4 mutant was not recovered (available), the deletion of nucleotides 10523-10550 is tolerated in the Δ7 and Δ9 mutants. This suggests that any deletion of less than 270 nucleotides, specifically 243 nucleotides or less, from nucleotide 10281-10550 does not result in replication incompetence. It is understood that the specific deletions generated are representative of possible deletion mutations and do not limit possible deletions in the 3' region. Although deletions reduce plaque size to non-detectable in one cell line, the virus was able to replicate and form visible plaques in another cell type. Methods to identify mutations that permit replication of viruses are routine in the art. The sequence of each virus genome was determined and shown in Figure 6C.

Virus neurovirulence was evaluated in 3-day-old Swiss mice inoculated intracerebrally (IC) with a dose of 1, 10, or 100 PFU of virus. For any deletion mutant, the IC LD₅₀ was determined to be <1 PFU. Introduction of any indicated large deletion in the 3' NCR of the TBEV/DEN4 genome does not result in reduced neurovirulence in suckling mice.

EXAMPLE 5-- Response of rhesus monkeys infected with TBEV/DEN4 carrying the target complementary to mir-9 or mir-124 miRNA.

Since the TBEV/DEN4 virus is poorly infectious in immunocompetent mice from the peripheral route of inoculation, presumably due to the DEN4 genetic background, we sought to evaluate the level of attenuation and immunogenicity of two engineered viruses (mir-9T and mir-124T) in the more susceptible and relevant rhesus monkey model. TBEV and its chimeric viruses usually cause an asymptomatic infection in non-human primates following peripheral inoculation (Nathanson and Harrington, 1966; Rumyantsev et al., 2006; both incorporated herein by reference). Presence, duration, and magnitude of viremia serve as reliable criteria of virus virulence, while immunogenicity is often assessed by measuring the level of virus- induced neutralizing antibodies.

Although clinical illness was not seen in any monkey tested, each monkey inoculated subcutaneously with the TBEV/DEN4 parent developed viremia lasting 3- 4 days with a mean peak virus titer of 1.8 logio PFU/ml of serum (Table 5).

Table 5. TBEV/DEN4 bearing mir-9 or mir-124 target sequence is highly immuno enic in rhesus monke s.

The level of viremia and its duration were significantly lower and shorter than that observed in macaques infected with TBEV (Nathanson and Harrington, 1966). The replication of mir-124T virus was not reduced compared to that of its

TBEV/DEN4 progenitor. In contrast, incorporation of a mir-9-target into the

TBEV/DEN4 genome attenuated the virus, as none of the four monkeys infected with 10⁵ PFU of mir-9T developed detectable viremia (<0.7 logio PFU/ml). However, despite the restricted infection of the parental TBEV/DEN4 and its two derivatives in monkeys, all viruses induced a high level of serum TBEV-specific neutralizing antibody in each immunized animal as measured on day 28 following inoculation. The humoral immune response to a single dose of either virus was comparable (for mir-9T) or higher (for TBEV/DEN4 and mir-124T) than that induced by three doses of a licensed inactivated TBEV vaccine (Table 5).

EXAMPLE 6— Increase in both the number of miRNA targets and their sites of insertion in the 3 'NCR of viral genome dramatically increased the level of virus attenuation in the CNS of mice, but did not impair immunogenicity and protective efficacy in mice.

In an effort to increase the level of microRNA-mediated inhibition of virus replication in the CNS and to prevent the emergence of escape mutants, we constructed a set of TBEV/DEN4-miRNA-target viruses for simultaneous targeting with multiple copies of homologous (mir-124) or mixed (mir-9 and mir-124) microRNAs. We selected seven sites for the multiple target insertions that were inserted into the A/T-enriched loops of the proposed secondary structure of

TBEV/DEN4 3'NCR (Fig. 7A). These sites for miR-target insertions were positioned between nucleotide positions: 10280 and 10281 (site 1), 10292 and 10293 (site 2), 10307 and 10308 (site 3), 10384 and 10385 (site 4), 10470 and 10471 (site 5), 10502 and 10503 (site 6), 10553 and 10554 (site 7) (Fig. 7A and 7B).

We demonstrate that the insertion of miRNA-target in the site 4 or 6 inhibited the growth of viruses in Vero cells, but not in C6/36 cells (Fig. 7C); however, viruses that carried 2, 3, or 4 miR-targets using the insertion sites 1, 2, 3, 5, and 7 replicated efficiently in both C6/36 and Vero cells. This demonstrates that the miR sequence can be inserted essentially anywhere within the 3' UTR without disrupting viral replication. It is expected that insertion of the sequence into the 5 'UTR or the coding sequence can result in efficient attenuation of neuro virulence. However, as demonstrated herein that the target sequence in the virus needs to be complementary to the miR sequence over a sufficient number of nucleotides, insertion of such sequences into the coding region can be more difficult. Parental TBEV/DEN4 and its eight engineered viruses, carrying 2, 3, or 4 miRNA targets in the 3'NCR (Figs. 7D - 7L), were assessed in suckling mice following an IC inoculation to determine the the effect of multiple miRNA-target insertions into the genome on viral neurovirulence by estimating the IC LD₅₀ values of viruses (Fig. 7D). Combining 2 or 3 copies of sequences complementary to mir-9 and mir-124 or 4 copies of sequences complementary to mir-124 had an additive effect on reducing neurovirulence of the TBEV/DEN4 virus in highly sensitive suckling mice inoculated IC route (Fig. 7D). When 3 or 4 copies of sequences complementary to miR-124a target were introduced into virus genome viruses: 3 x mir-124T (1, 2, 5 or 1, 2, 7) and 4 x mir-124T (1, 2, 3, 5 or 1, 2, 3, 7), we achieved a greater than 1250-fold reduction of TBEV/DEN4 neurovirulence in 3-day-old mice (Fig. 7D). We also found that composition of miR-targets, their positions in the virus genome, and distance between inserted targets affect the level of miRNA-mediated virus inhibition.

Immunogenicity and protective efficacy of parental and miRNA-targeted viruses were evaluated in immunocompetent adult Swiss mice at a dose of 10⁵ PFU and the findings summarized in Figure 9. Despite the poor immunogenicity of DEN4 and its chimeric viruses in mouse model, both parental and each miRNA-targeted viruses induced a moderate titer of TBEV- specific neutralizing antibodies as measured on day 28 of post-inoculation. On day 33, mice were challenged by the IC route of inoculation with a 100 IC LD₅₀ of highly virulent unmodified TBEV/DEN4 virus; the IC LD₅₀ of TBEV/DEN4 for adult mice was found to be 6 PFU (see EXAMPLE 3). All mock- inoculated mice developed paralysis or died between day 7 and 10 of post-challenge. However, mice immunized with a single dose of either miRNA-targeted virus were partially or completely protected against severe IC challenge during the 21 day period of observation (Fig. 9) and there was no difference in the level of protection induced in mice by parental (67%) or its miRNA-targeted viruses (50-100%).

EXAMPLE 7 - The simultaneous multiple miR-targeting of virus genome in the 3'NCR and between E and NS1 protein genes completely prevented the virus escape from miR-mediated suppression in the CNS and enables alteration of virus neurovirulence in suckling mice. To increase the level of microRNA-mediated control of virus replication in the CNS and reduce the probability of the escape mutant emergence, we introduced multiple miR-targets into two distict regions of virus genome: in the 3'NCR and between structural envelope E and non- structural NS1 protein genes (Fig. 8). Four new recombinant viruses carrying 6 miRNA targets were generated in Vero cells and assessed for neurovirulence in suckling mice. Mice inoculated IC with 10, 10 2 , or 103 PFU of either E(3x miR-124-9-124T)-3'NCR(3x miR-124_1,2,5T), E(3x miR-124-9- 124T)-3'NCR(3x miR-124_1,2,7T), E(3x mir-124T)-3'NCR(3x miR-124 _,5T), or E(3x miR-124T)-3'NCR(3x miR-124i_{;2 7}T) virus survived without showing any neurological signs during the 21-day observation. In addition, brains of five surviving animals from each group of mice infected with the highest dose (10 PFU) of the above-mentioned miRNA target viruses were harvested on day 22 of the study, and the virus titer of each individual brain suspension was determined on Vero cells. All mouse brain suspensions tested were found to be free from inoculated virus as determined by plaque-forming assay. Based on these data, we conclude that the simultaneous multiple miR-targeting of virus genome in two distinct regions abolished virus neurovirulence in the hypersensitive animal model such as suckling mice and completely prevented the virus escape from miR-mediated suppression.

Thus, the neurovirulece data in suckling mice demonstrate that the

incorporation of multiple target sequences into the virus, either targeted by multiple copies of a single mir (e.g., either miR-9 or mirl24) or targeted by multiple copies of mixed miRs (e.g., miR-9 and mirl24) are effective in reducing viral

neuropathogenesis of a flavi virus and restricting its tissue tropism. The data suggest that having a larger portion of viral genome between at least two of the target sequences is preferable. These data indicate that the specific placement of target sequences is flexible and can be introduced throughout the entire genome, e.g., in the 5'NCR, 3'NCR, or open reading frame of polyprotein.

All patents, patent applications, GenBank numbers in the version available as of the priority date of the instant application, and published references cited herein are hereby incorporated by reference in their entirety as if they were incorporated individually. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

REFERENCES

Bak, M., A. Silahtaroglu, M. Moller, M. Christensen, M.F. Rath, B. Skryabin,

N. Tommerup, and S. Kauppinen. 2008. MicroRNA expression in the adult mouse central nervous system. RNA 14:432-444.

Barh, D., R. Malhotra, B. Ravi, and P. Sindhurani. 2010. MicroRNA let-7: an emerging next-generation cancer therapeutic. Curr. Oncol. 17:70-80.

Barnes, D., M. Kunitomi, M. Vignuzzi, K. Saksela, and R. Andino. 2008.

Harnessing endogenous miRNAs to control virus tissue tropism as a strategy for development attenuated virus vaccines. Cell Host Microbe 4:239-248.

Bartel. D.P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:281-297.

Cawood, R., H.H. Chen, F. Carroll, M. Bazan-Peregrino, N. van Rooijen, and

L.W. Seymour. 2009. Use of tissue-specific microRNA to control pathology of wild- type adenovirus without attenuation of its ability to kill cancer cells. PLoS Pathog. 5:el000440. doi :10.1371/journal.ppat.l000440.

Cullen, B.R. 2006. Viruses and microRNAs. Nat. Genet. 38(suppl.):S25-S30. Edge, R.E., T.J. Falls, C.W. Brown, B.D. Lichty, H. Atkins, and J.C. Bell.

2008. A let-7 microRNA-sensitive vesicular stomatitis virus demonstrates tumor- specific replication. Mol. Ther. 16:1437-43.

Engel A.R., A. A. Rumyantsev, O.A. Maximova, J.M. Speicher, B. Heiss, B.R. Murphy, and A.G. Pletnev. 2010. The neurovirulence and neuroinvasiveness of chimeric tick-borne encephalitis/dengue virus can be attenuated by introducing defined mutations into the envelope and NS5 protein genes and the 3' non-coding region of the genome. Virology 405:243-252.

Gottwein, E., and B.R. Cullen. 2008. Viral and cellular microRNAs as determinants of viral pathogenesis and immunity. Cell Host Microbe 3:375-387. Grimson, A., K.K.H. Farth, W.K. Johnston, P. Garrett-Engele, L.P. Lim, and D.P. Bartel. 2007. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol. Cell 27:91-105.

Halstead, S.B., and J. Jacobson. 2008. Japanese encephalitis vaccines. In Vaccines. Plotkin, S., W. Orenstein, P. Offit, editors. Elsevier, Philadelphia, 311-352.

He, L., and G.J. Hannon. 2004. microRNAs: small RNAs with a big role in gene regulation. Nat. Genet. 5:522-531.

Hoenninger ,V.M., H. Rouha, K.K. Orlinger, L. Miorin, A. Marcello, R.M. Kofler, and C.W. Mandl. 2008. Analysis of the effects of alterations in the tick-borne encephalitis virus 3'-noncoding region on translation and RNA replication using reporter replicons. Virology 377:419-30.

Filipowicz, W., S.N. Bhattacharyya, and N. Sonenberg. 2008. Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat. Rev .Genet. 9:102-114.

Jopling, C.L., M. Yi, A.M. Lancaster, S.M. Lemon, and P. Samow. 2005.

Modulation of hepatitis C RNA abundance by a liver- specific MicroRNA. Science 309:1577-81.

Kapsimali, M., W.P. Kloosterman, E. de Bruijn, F. Rosa, R.H.A. Plasterk, and S.H. Wilson. 2007. MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system. Genome Biol. 8:R173.

Kelly, E., and S.J. Russell. 2007. History of oncolytic viruses: genesis to genetic engineering. Mol. Ther. 15:651-659.

Kelly, E.J., E.M. Hadac, S. Greiner, and S.J. Russell. 2008. Engineering microRNA responsiveness to decrease virus pathogenicity. Nat. Med. 14:1278-1283.

Kelly, E.J, and S.J. Russell. 2009. MicroRNAs and regulation of vector tropism. Mol. Ther. 17:409-416.

Kelly, E.J., R. Nace, .N. Barber, and S.J. Russell. 2010. Attenuation of vesicular stomatitis virus encephalitis through microRNA targeting. J. Virol. 84:1550- 62. Kelly, E.J., E.M. Hadac, B.R. Cullen, and S.J. Russell. 2010a. MicroRNA antagonism of the picornaviral life cycle: alternative mechanisms of interference. PloS Pathog. 6:el000820. doi:10.1371/joumal.ppat.l000820.

Krichevsky A.M. K.S. King, CP. Donahue, K. Khrapko, and K.S. Kosik. 2003. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 9:1274-1281.

Lagos-Quintana, M., R. Rauhut, A. Yalcin, J. Meyer, W. Lendeckel, and T. Tuschl. 2002. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12:735-739.

Lauring, A.S., J.O. Jones, and R. Andino. 2010. Rationalizing the

development of live attenuated virus vaccines. Nat. Biotechnol. 28:573-579.

Lindenbach, B., H. Thiel, and C. Rice. 2007. Flaviviridae: The viruses and their replication. In Fields Virology. Knipe, D., and P. Howley, editors. 5th ed.

Lippincott-Raven Publishers, Philadelphia. 1101-1152.

Makeyev, E.V., J. Zhang, M.A. Carrasco, and T. Maniatis. 2007. The microRNA miR-124 promotes neuronal differentiation by triggering brain- specific alternative pre-mRNA splicing. Mol. Cell 27:435-448.

Markoff, L. 2003. 5'- and 3'-noncoding regions in flavivirus RNA. Adv. Virus Res. 59:177-228.

Maximova, O.A., J.M. Ward, D.M. Asher, M. St. Claire, B.W. Finneyfrock, J.M. Speicher, B.R. Murphy, and A.G. Pletnev. 2008. Comparative neuropathogenesis and neurovirulence of attenuated flaviviruses in nonhuman primates, J. Virol.

82:5255-5268.

Meerani, S., and Y. Yao. 2010. Oncolytic viruses in cancer therapy. Eur. J. Sci. Res. 40:156-171.

Miska, E.A., E. Alvarez- Saavedra, M. Townsend, A. Yoshii, N. Sestan, P. Rakic, M. Constanine- Paton, and H.R. Horvitz. 2004. Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 5:R68.

Monath, T. P., 2005. Yellow fever vaccine. Expert. Rev. Vaccines. 4:553-74. Nathanson, N., and B. Harrington. 1966. Experimental infection of monkeys with Langat virus. Am. J. Epidemiol. 84:541-556.

Pierson, T.C., M.S. Diamond, A. A. Ahmed, L.E. Valentine, C.W. Davis, M.A. Samuel, S.L. Hanna, B.A. Puffer, and R.W. Doms. 2005. An infectious West Nile virus that expresses a GFP reporter gene. Virology 334:28-40.

Plaisance, V., A. Abderrahmani, V. Perret-Menoud, P. Jacquemin, F.

Lemaigre, and R. Regazzi. 2006. MicroRNA-9 controls the expression of

granuphilin/Slp4 and the secretory response of insulin-producing cells. J. Biol. Chem. 281:26932-42.

Pletnev, A.G., M. Bray, J. Huggins, and C.J. Lai. 1992. Construction and characterization of chimeric tick-borne encephalitis/dengue type 4 viruses. Proc Natl Acad Sci U S A 89:10532-6.

Pletnev, A.G., M. Bray, and C.J. Lai. 1993. Chimeric tick-borne encephalitis and dengue type 4 viruses: effects of mutations on neurovirulence in mice. J. Virol. 67:4956-63.

Pletnev, A.G., and R. Men. 1998. Attenuation of the Langat tick-borne flavivirus by chimerization with mosquito-borne flavivirus dengue type 4. Proc Natl Acad Sci U S A 95:1746-51.

Pletnev, A.G., M. Bray, K.A. Hanley, J. Speicher, and R. Elkins. 2001. Tick- borne Langat/mosquito-borne dengue flavivirus chimera, a candidate live attenuated vaccine for protection against disease caused by members of the tick-borne encephalitis virus complex: evaluation in rhesus monkeys and in mosquitoes. J. Viro.l 75:8259-67.

Pugachev, K.V., F. Guirakhoo, D.W. Trent, and T.P. Monath. 2003.

Traditional and novel approaches to flavivirus vaccines. Int. J. Parasitol. 33:567-582.

Reed, L., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27:493-497.

Rumyantsev, A. A., R.M. Chanock, B.R. Murphy, and A.G. Pletnev. 2006. Comparison of live and inactivated tick-borne encephalitis virus vaccines for safety, immunogenicity and efficacy in rhesus monkeys. Vaccine 24:133-43. Sempere, L.F., S. Freemantle, I. Ritha-Rowe, E. Moss, E. Dmitrovsky, and V. Ambors. 2004. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 5:R13.

Smirnova, L., A. Grafe, A. Seiler, S. Schumacher, R. Nitsch, and F.G.

Wulczyn. 2005. Regulation of miRNA expression during neural cell specification. Eur. J. Neurosci. 21:1469-1477.

Wang, K., B. Long, J. Zhou, and P.F. Li. 2010. miR-9 and NFATc3 regulate myocardin in cardiac hypertrophy. J. Biol. Chem. 285:11903-12.

Zhang, B., X. Pan, G.P. Cobb, and T.A. Anderson. 2007. microRNAs as oncogenes and tumor suppressors. Dev. Biol. 302:1-12.

US Patents 6,184,024; 6,497,884; and 6,676,936 are all incorporated herein by reference in their entirety.

Claims

What is claimed is:

1. A nucleic acid sequence encoding a viable recombinant attenuated neurotropic flavivirus genome comprising a nucleic acid sequence that is

complementary to at least contiguous nucleotides of a microRNA (miR) target sequence.

2. The nucleic acid sequence of claim 1, wherein the mircoRNA-target sequence is a CNS-expressed microRNA.

3. The nucleic acid sequence of claim 1, wherein the nucleic acid sequence that is complementary to the microRNA-target sequence is selected from the group consisting of:

(miR124 target) 5'-UGGCAUUCACCGCGUGCCUUAA-3';

(let-7c target) 5'-AACCAUACAACCUACUACCUCA-3' ;

(mir-9 target) 5'-UCAUACAGCUAGAUAACCAAAGA-3' ;

(mir-128 target) 5 ' - AAAAGAGACCGGUUCACUGUGA-3 ' ; and

(mir-218 target) 5'-ACAUGGUUAGAUCAAGCACAA-3'or a combination thereof.

4. The nucleic acid sequence of any of claims 1 to 3 comprising:

a full genome-length nucleic acid clone of a flavivirus genome wherein the flavivirus is defined as an approximately 11-kilobase positive strand RNA virus having a genome that codes in one open reading frame (ORF) for three structural proteins, capsid (C), premembrane (preM) and envelope (E), followed by seven nonstructural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5, wherein the open reading frame is between a 5' untranslated region (5' UTR) upstream of the coding sequence and a 3' untranslated region (3' UTR) downstream of the coding sequence.

5. The nucleic acid sequence of any of claims 1 or 4, wherein the flavivirus is selected from the group consisting of mosquito-borne yellow fever virus (YFV), Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV), and dengue virus (DEN) type 1 (DEN1), DEN2, DEN3, DEN4, tick-borne encephalitis (TBEV) virus, a flavivirus listed in Table 2; replication-defective pseudoinfectious flavivirus; or any chimeric viruses represting combination thereof.

6. The nucleic acid sequence of any of claims 1 to 5, wherein the virus comprises a region of nucleic acid encoding two or three structural proteins of a first flavivirus operably linked to a region of nucleic acid encoding the non-structural proteins of a second flavivirus, wherein the second flavivirus is a different flavivirus from the first flavivirus.

7. The nucleic acid sequence of claim 6, wherein the two structural proteins are prM and E.

8. The nucleic acid sequence of claim 6 or 7, wherein the region of nucleic acid encoding structural protein encodes premembrane protein and envelope protein of the first virus, and encodes the capsid protein from the second flavivirus.

9. The nucleic acid sequence of any of claims 6 to 8, wherein the second flavivirus is a dengue virus selected from the group consisting of dengue virus type 4, dengue virus type 1, dengue virus type 2, and dengue virus type 3.

10. The nucleic acid sequence of any of claims 6 to 9, wherein the first flavivirus is selected from the group consisting of tick-borne encephalitis (TBEV) virus, mosquito-borne yellow fever (YFV), Japanese encephalitis (JEV), West Nile (WNV), St. Louis encephalitis (SLEV), Dengue (DENV), or a flavivirus listed in Table 2.

11. The nucleic acid sequence of any of claims 6 to 10, wherein the second virus is dengue virus type 4, and the first virus is selected from the group consisting of tick-borne encephalitis (TBEV) virus, mosquito-borne yellow fever (YFV), Japanese encephalitis (JEV), West Nile (WNV), St. Louis encephalitis (SLEV), Dengue (DENV), or a flavivirus listed in Table 2.

12. The nucleic acid sequence of any of claims 6 to 11, wherein the first flavivirus is a chimeric tick-borne encephalitis virus (TBEV) and second flavivirus is a dengue type 4 (DEN4) virus.

13. The nucleic acid sequence of any of claims 1 to 12, further comprising at least one mutation that is introduced into the viral genome in a structural gene, in a non- structural gene, in a 3' untranslated region (3' UTR), in a 5' untranslated region (5'-UTR); or any combination thereof.

14. The nucleic acid sequence of claim 13, wherein the at least one mutation comprises a deletion or an insertion.

15. The nucleic acid sequence of claim 13 or 14, wherein the mutation statistically significantly reduces neuropathogenesis of the virus as compared to a viable recombinant flavivirus not including the mutation in the viral genome.

16. The nucleic acid sequence of claim 13 or 14, wherein the mutation does not statistically significantly reduce neuropathogenesis of the virus as compared to a viable recombinant flavivirus not including the mutation in the viral genome.

17. The nucleic acid sequence of any of claims 13 to 16, wherein the mutation is selected from the group consisting of: one or more mutations that reduce glycosylation of premembrane protein, envelope protein or NS1(1) protein; one or more mutations that reduce cleavage of premembrane protein to membrane protein; one or more substitutions at a site encoding glycine, which site is at position +1 following polyprotein NS1-NS2A cleavage site; one or more deletions comprising at least 30 nucleotides between nucleotide 113 and 384 inclusive, number 1 being a 3'- most nucleotide of a 3'-non-coding end; and one or more mutations in a sequence encoding one or more of eight amino acids at the carboxyl terminus cleavage site of NS1.

18. The nucleic acid sequence of any of claims 13 to 17, wherein the mutation comprises a deletion of nucleotide sequence within the 3' UTR.

19. The nucleic acid sequence of claim 18, wherein the mutation in the 3' UTR comprise a deletion of 1-20 nt, 1-30 nt, 1-40 nt, 1-50 nt, 1-60 nt, 1-70 nt, 1-80 nt, 1-90 nt, 1-100 nt, 1-110 nt, 1-120 nt, 1-130 nt, 1-140 nt, 1-150 nt, 1-160 nt, 1-170 nt, 1-180 nt, 1-190 nt, 1-200 nt, 1-210 nt, 1-220 nt, 1-230 nt, 1-240 nt, 1-250 nt, or more; or any value within the ranges set forth.

20. The nucleic acid sequence of claim 19, wherein the deletion begins at nt 1, nt 10, nt 20, nt 30, nt 40, nt 50, nt 60, nt 70, nt 80, nt 90, nt 100, nt 110, nt 120, nt 130, nt 140, nt 150, nt 160, nt 170, nt 180, nt 190, nt 200, nt 210, nt 220, nt 230, nt 240, nt 250, or further 3' from the end of the stop codon; or at any nucleotide within the range of 1-250 nt from the 3' end of the stop codon.

21. The nucleic acid sequence of claims 18 to 20, wherein the deletion identical to a nucleotide sequence selected from the group consisting of: nucleotide 10,281 to any nucleotide from 10,384 to 10,550 of GenBank FJ828986; nucleotide 10,379 to any nucleotide from 10,479 to 10,550 of GenBank FJ828986; nucleotide 10,474 to any nucleotide from 10,523 tol0,550 of GenBank FJ828986; nucleotide 10,266 to any nucleotide from 10,369 to 10,535 of GenBank AF326573; nucleotide 10,364 to any nucleotide from 10,464 to 10,535 of GenBank AF326573; nucleotide 10,459 to any nucleotide from 10,508 tol0,535 of GenBank AF326573) wherein the virus is competent for replication in at least one cell type.

22. The nucleic acid sequence of any of claims 18 to20, wherein the virus comprises a deletion of a nucleotide sequence identical to a selected from the group consisting of: 10,281-10,384 of GenBank FJ828986; 10,281-10,479 of GenBank FJ828986; 10, 281-10,523 of GenBank FJ828986; 10,281- 10,550 of GenBank FJ828986; 10,379-10,479 of GenBank FJ828986; 10,379-10,523 of GenBank FJ828986; 10,379-10,550 of GenBank FJ828986; 10,474-10,523 of GenBank FJ828986; and 10,474-10,550 of GenBank FJ828986; 10,266-10,3369 of GenBank AF326573; 10,266-10,464 of GenBank AF326573; 10,266-10,508 of GenBank AF326573; 10,266- 10,535 of GenBank AF326573; 10,364-10,464 of GenBank AF326573; 10,364-10,508 of GenBank AF326573; 10,364-10,535 of GenBank AF326573; 10,459-10,508 of GenBank AF326573; 10,459-10,535 of GenBank AF326573.

23. The nucleic acid sequence of any of claims 1 to 22, wherein the virus comprises the sequence set forth in GenBank FJ828986 with one or more deletions or insertions.

24. The nucleic acid sequence of any of claims 1 to 23, wherein the virus comprises the sequence set forth in GenBank FJ828986 with a deletion of a nucleotide sequence selected from the group consisting of: nucleotide 10,281 to any nucleotide from 10,384 to 10,550; nucleotide 10,379 to any nucleotide from 10,479 to 10,550; nucleotide 10,474 to any nucleotide from 10,523 to 10,550; nucleotide 10,478-10,507; wherein the virus is competent for replication in at least one cell type.

25. The nucleic acid sequence of any of claims 1 to 24, wherein the virus comprises the sequence set forth in GenBank FJ828986 with a deletion of a nucleotide sequence selected from the group consisting of: 10,281-10,384; 10,281- 10,479; 10,281-10,523; 10,281- 10,550; 10,379-10,479; 10,379-10,523; 10,379- 10,550; 10,474-10,523; and 10,474-10,550.

26. The nucleic acid sequence of any of claims 1 to 25, wherein the nucleic acid sequence that is complementary to a microRNA-target sequence is

complementary to 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of the microRNA-target sequence.

27. The nucleic acid sequence of any of claims 1 to 18, wherein the nucleic acid sequence that is complementary to a microRNA-target sequence is inserted in the 3'UTR, the open reading frame, the 5' UTR; or any combination thereof.

28. The nucleic acid sequence of any of claims 1 to 27, wherein the nucleic acid sequence that is complementary to a microRNA-target sequence is inserted in the viral sequence in at least one position selected from the group consisting of: between nucleotides 10280 and 10281 (a site 1), 10292 and 10293 (a site 2), 10307 and 10308 (a site 3), 10384 and 10385 (a site 4), 10470 and 10471 (a site 5), 10502 and 10503 (a site 6), or 10553 and 10554 (a site 7); or for DEN4 GenBank AF326573 sequence: 10265 and 10266 (a site 1), 10277 and 10278 (a site 2), 10292 and 103293 (a site 3), 10369 and 10370 (a site 4), 10455 and 10456 (a site 5), 10487 and 10488 (a site 6), or 10538 and 10539 (a site 7)

29. The nucleic acid sequence of claim 27 or 28, wherein the nucleic acid comprises 2, 3, 4, or 5 nucleic acid sequences complementary to a microRNA-target sequence inserted in the viral genome.

30. The nucleic acid sequence of claim 29, wherein the nucleic acid sequence comprising 2, 3, 4, or 5 nucleic acid sequences are complementary to a single microRNA-target sequence.

31. The nucleic acid sequence of claim 29, wherein the nucleic acid sequence comprising 2, 3, 4, or 5 nucleic acid sequences are complementary to 2, 3, 4, or 5 distinct microRNA-target sequences.

32. The nucleic acid sequence of any of claims 29 to 31, wherein the nucleic acid sequences complementary to a microRNA-target sequence are inserted in the viral genome in tandem.

33. The nucleic acid sequence of claim 32, wherein the nucleic acid sequences complementary to a microRNA-target sequence inserted in tandem are contiguous to each other.

34. The nucleic acid sequence of claim 29 to 33, wherein the nucleic acid sequences complementary to a microRNA-target sequence inserted in tandem are separated by spacers wherein the length of each spacer is selected independently from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 nucleotides in length.

35. The nucleic acid sequence of any of claims 29 to 31, wherein the nucleic acid sequences comprising 2, 3, 4, or 5 nucleic acid sequences complementary to a microRNA-target sequence are inserted into multiple sites within the viral genome.

36. The nucleic acid sequence of claim 35, wherein the nucleic acid sequences comprising 2, 3, 4, or 5 nucleic acid sequences complementary to a microRNA-target sequence are inserted into the 3' NCR of the viral genome and into the ORF of the viral genome.

37. The nucleic acid sequence of claim 36, wherein at least one nucleic acid sequence complementary to a microRNA is inserted into the 3' NCR of the viral genome and at least one nucleic acid sequence complementary to a microRNA-target sequence is inserted between the nucleic acid sequence encoding the E and NS1 protein.

38. The nucleic acid sequence of any of claims 1 to 37 in an expression vector.

39. A recombinant genetic construct encoding the viable recombinant flavi virus of any of claims 1 to 37.

40. The recombinant genetic construct of claim 39, wherein the recombinant genetic construct is in a host cell.

41. The recombinant genetic construct of claim 39, wherein the recombinant genetic construct is in an expression construct.

42. A flavivirus encoded by the nucleic acid sequence of any of claims 1 to

38.

43. An immunogenic composition comprising a nucleic acid sequence of any of claims 1 to 38 or a recombinant genetic construct of claim 39 to 42.

44. The immunogenic composition of claim 43 in a pharmaceutically acceptable carrier.

45. A method of vaccinating a subject against flavivirus infection comprising administering a composition of claim 43 or 44 to a subject.

46. The method of claim 45, further comprising identifying a subject susceptible to flavivirus infection.

47. The method of claim 45 or 46, further comprising obtaining the composition of claim 43 or 44.

48. The method of any of claims 45 to 47, wherein the method further includes testing the subject to determine if an immune response occurred.

49. The method of claim 48, wherein the immune response is a protective immune response.

50. The method of claim 48 or 49, wherein the testing is selected from the group consisting of immunoassay and pathogen challenge.

51. The method of any of claims 45 to 50, wherein the method comprises: (a) preparing the genetic construct of any of claims 39 to 41, wherein said genetic construct comprises DNA; (b) generating infectious RNA transcripts from said DNA construct; (c) introducing said RNA transcripts into a cell; (d) expressing said RNA transcripts in said cell to produce virus; (e) harvesting said virus from said cell; (f) testing said virus in an animal model; and (g) inoculating said host with virus produced by repeating steps (a)-(e).

52. A method for controlling neurotropic viral pathogenesis of an attenuated RNA flavivirus vaccine comprising inserting a nucleic acid sequence into the viral genome that is complementary to a brain expressed microRNA, wherein the nucleic acid sequence is identical to at least 15 contiguous nucleotides of microRNA- targets selected from the group consisting of:

(miR124 target) 5'-UGGCAUUCACCGCGUGCCUUAA-3'; (let-7c target) 5'- AACCAUACAACCUACUACCUCA-3' ; (mir-9 target) 5'- UCAUACAGCUAGAUAACCAAAGA-3' ; (mir-128 target) 5'- AAAAGAGACCGGUUCACUGUGA-3' ; and (mir-218 target) 5'- ACAUGGUUAGAUCAAGCACAA-3' .

53. The method of claim 52, wherein the nucleic acid sequence is identical to 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides selected from the group consisting of:

(miR124) 5'-UGGCAUUCACCGCGUGCCUUAA-3' ; (let-7c) 5'- AACCAUACAACCUACUACCUCA-3' ; (mir-9) 5'- UCAUACAGCUAGAUAACCAAAGA-3' ; (mir-128) 5'- AAAAGAGACCGGUUCACUGUGA-3' ; and (mir-218) 5'- ACAUGGUUAGAUCA AGCAC AA-3 ' .

54. The method of claim 52 or 53, wherein the attenuated RNA virus vaccine comprises full genome-length flavivirus genome wherein the flavivirus is defined as an approximately 11-kilobase positive strand RNA virus having a genome that codes in one open reading frame (ORF) for three structural proteins, capsid (C), premembrane (preM) and envelope (E), followed by seven non- structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5, wherein the open reading frame is between a 5' untranslated region (5' UTR) upstream of the coding sequence and a 3' untranslated region (3' UTR) downstream of the coding sequence.

55. The nucleic acid sequence of any of claims 52 to 54, wherein the flavivirus is selected from the group consisting of mosquito-borne yellow fever virus (YFV), Japanese encephalitis virus (JEV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV), and dengue virus (DEN) type 1 (DEN1), DEN2, DEN3, DEN4, tick-borne encephalitis (TBEV) virus, the flavi viruses listed in Table 2, or any combination thereof.

56. A nucleic acid sequence encoding a viable recombinant attenuated neurotropic flavivirus genome comprising a nucleic acid sequence that is complementary to a sequence of at least one microRNA (miR), wherein the mircoRNA is a CNS-expressed microRNA and further wherein the nucleic acid sequence complementary to at least one microRNA is inserted into the 3 'NCR of a viral genome and another nucleic acid sequence complementary to at least one microRNA is inserted into an ORF of a viral genome between the nucleic acid sequences encoding an E and a NS1 protein.

57. The nucleic acid sequence of claim 56, wherein the sequence complementary to at least one microRNA is selected from the group consisting of: (miR124 target) 5'-UGGCAUUCACCGCGUGCCUUAA-3' ;

(let-7c target) 5'-AACCAUACAACCUACUACCUCA-3' ;

(mir-9 target) 5'-UCAUACAGCUAGAUAACCAAAGA-3' ;

(mir-128 target) 5 ' - AAAAGAGACCGGUUCACUGUGA-3 ' ; and

(mir-218 target) 5'-ACAUGGUUAGAUCAAGCACAA-3'or a combination thereof.

58. The nucleic acid sequence of claim 56 or 57 comprising:

a full genome-length nucleic acid clone of a flavivirus genome wherein the flavivirus is defined as an approximately 11-kilobase positive strand RNA virus having a genome that codes in one open reading frame (ORF) for three structural proteins, capsid (C), premembrane (preM) and envelope (E), followed by seven non- structural proteins, NS 1 , NS2A, NS2B, NS3, NS4A, NS4B and NS5, wherein the open reading frame is between a 5' untranslated region (5' UTR) upstream of the coding sequence and a 3' untranslated region (3' UTR) downstream of the coding sequence.