WO2012051415A2 - Inhibitors of acid ceramidase and uses thereof in cancer and other disease treatment therapies - Google Patents

Abstract

The disclosure relates to a method of inhibiting acid ceramidase expression or activity in a cell or tissue. The method involves providing a cell or tissue containing acid ceramidase and contacting the cell or tissue with an inhibitor under conditions effective to inhibit expression or activity of the acid ceramidase in said cell or tissue. The inhibitor is derived from a cystatin family protein. Also disclosed are methods of treating a subject having a condition such as a cancer, that is mediated by upregulation of acid ceramidase, an isolated cystatin family peptide, a method for screening for therapeutic compounds using acid ceramidase, and a method of isolating acid ceramidase.

Description

INHIBITORS OF ACID CERAMIDASE AND USES THEREOF IN CANCER AND OTHER DISEASE TREATMENT THERAPIES

[0001] This application claims the priority benefit of U.S. Provisional Patent

Application Serial No. 61/392,786, filed October 13, 2010, which is hereby incorporated by reference in its entirety.

[0002] This invention was made with government support under grant number

DK54830 awarded by the National Institutes of Health. The U.S. Government has certain rights in this invention. FIELD OF THE INVENTION

[0003] The present invention relates to inhibitors of acid ceramidase and uses thereof in cancer and other disease treatment therapies.

BACKGROUND OF THE INVENTION [0004] Over the past decade, sphingo lipids have been recognized as important bioactive signaling molecules involved in the regulation of cell differentiation, proliferation, and death. Acid ceramidase (AC; N-acylsphingosine deacylase; EC 3.5.1.23) is a key enzyme in this pathway required to maintain the proper balance between the pro-apoptotic lipid, ceramide, and the anti-apoptotic lipid, sphingosine-1- phosphate (SIP). Mutations in the AC gene (Asahl) cause the severe lipid storage disorder, Farber lipogranulomatosis (i.e., Farber disease), associated with the

accumulation of ceramide in various tissues. Farber disease is an extremely rare disorder and has been associated with embryonic lethality, highlighting the importance of this enzyme in mammalian development.

[0005] Recently, increased AC activity has been found in a wide variety of human cancers, including prostate, breast, head and neck cancers, and melanoma. Based on these observations, there has been growing interest in the use of AC inhibitors for cancer therapy. Examples include the use of ceramide analogs, as well as AC-specific siRNA. Ceramide analogs, while useful in cell culture, have questionable specificity, and may affect multiple cellular pathways and have unwanted toxicities. siRNA, while also effective in cell culture and highly specific, may have low efficiency in vivo. In addition to cancer, AC is also overexpressed in other diseases where ceramide is elevated, including Alzheimer's Disease and cystic fibrosis.

[0006] It has recently been shown that the inactive AC precursor undergoes self- cleavage to form a mature, active enzyme, and that the mechanism of this transformation is similar to other members of the Ntn hydrolase superfamily. Typically, the activity of one Ntn-hydrolase subfamily member, the cysteine proteases, is inhibited by small proteins known as cystatins. Cystatins are evolutionary related proteins, all of which are composed of at least one cystatin-like domain (CLD) with conserved sequence motifs. Aberrant regulation of cystatins occurs in a number of human diseases, including certain neurodegenerative disorders and cancer. For example, the cystatin A (Stefin A) gene is differentially expressed in primary and metastatic mammary tumors. Cystatin B also is elevated in tissues and urine of bladder cancer patients, and its levels in urine are positively correlated with tumor grade, stage, and a shorter time to disease recurrence and progression. Decreased levels of cystatin C were found in plasma of mice with Lewis lung adenocarcinoma and cystatin E/M is a suppressor gene of cervical and breast cancer. One member of the salivary cystatins (cystatin SN) also was found to be differentially regulated (activated or suppressed) in cancerous lesions of gastric cancer patient tissues.

[0007] The present invention is directed to overcoming these and other deficiencies in the art.

SUMMARY OF THE INVENTION

[0008] One aspect of the present invention relates to a method of inhibiting acid ceramidase expression or activity in a cell or tissue. The method involves providing a cell or tissue containing acid ceramidase and contacting the cell or tissue with an inhibitor under conditions effective to inhibit expression or activity of the acid ceramidase in said cell or tissue. The inhibitor is derived from a cystatin family protein.

[0009] A further aspect of the present invention relates to a method of treating a subject having a condition mediated by upregulation of acid ceramidase. The method involves selecting a subject having a condition mediated by upregulation of acid ceramidase and administering to the selected subject an inhibitor of acid ceramidase expression or activity under conditions effective to treat the subject for the condition. The inhibitor is derived from a cystatin family protein. [0010] In a further embodiment of the present invention, the inhibitor is an isolated peptide comprising an amino acid sequence selected from the group consisting of TICTQIVGG (SEQ ID NO: 1), QIVGGTICT (SEQ ID NO: 2), EGGTICTKSQPDTCA (SEQ ID NO: 3), and CREQIVGGTICT (SEQ ID NO: 4).

[0011] Another aspect of the present invention relates to a cancer therapeutic agent containing a chemotherapeutic agent and a cystatin SA or a peptide derived from cystatin SA.

[0012] Another aspect of the present invention relates to a method of screening for compounds potentially useful in treating cancer. The method involves providing an acid ceramidase and a plurality of candidate inhibitors. The acid ceramidase is then contacted with any of the plurality of candidate inhibitors. Physical interaction between any of the plurality of candidate inhibitors and the acid ceramidase is detected. The candidate compounds which physically interact with the acid ceramidase are identified as potentially useful in treating cancer.

[0013] An additional aspect of the present invention relates to a method of isolating acid ceramidase. The method involves providing a sample containing acid ceramidase. The sample is contacted with a protein derived from a cystatin family protein under conditions effective for the ceramidase to bind to the protein as a complex. Acid ceramidase is then recovered from the complex.

[0014] The present invention identifies functional domains within cystatin SA that are responsible for AC inhibitory effects. This characterization of functional domains eventually can facilitate the development of small molecules and peptide-based inhibitors using the cystatin SA sequence.

[0015] The present invention may further provide the use of cystatin-based inhibitors in vivo which may induce IFNy release from CD4+ T cells. As a result, antitumor immune response is enhanced.

[0016] Based on the AC self-cleavage and activation mechanism, which exposes a free cysteine residue, applicants have hypothesized that one or more cystatins might also inhibit AC. Accordingly, the effect of five candidate cystatins (A, B, C, E/M and SA) on AC cleavage and activity has been assessed. In the present invention, applicants identify cystatin SA as a physiological inhibitor of AC. The interaction of AC and cystatin SA is demonstrated by co-immunoprecipitation and co-localization studies using confocal microscopy. Furthermore, overexpression of cystatin SA in cancer cells reduces AC activity, increases ceramide, and results in apoptotic cell death, while inhibition of cystatin SA with siR A is elevated AC activity. Applicants further propose that the future development of cystatin based AC inhibitors could provide highly specific and effective reagents that might be used to treat cancers in which AC is overexpressed.

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figures 1 A-B illustrate AC activity in the presence of cystatins A, B, C, E/M and SA. Figure 1 A shows AC activity measured in HEK 293T17 cell extracts after transient expression of the full-length AC cDNA alone, or co-expression of AC and the cystatin A, B, C, E/M or SA cDNAs. AC activity is significantly lower (t-test, P<0.03) after co-expression of AC and cystatin SA only. Data represent mean ± SEM, n = 3 independent experiments. Figure IB shows the expression level of the active (14kDa, alpha subunit) form of AC in the cell extracts, analyzed by western blotting. The level of AC expression is comparable for all samples, and AC expression in non-transfected HEK 293T17 cells is non-detectable. The blot shown is representative of 3 independent experiments.

[0018] Figures 2A-F illustrate interaction between AC and cystatin SA. Figure 2A shows co-IP of AC and cystatin SA from cell extracts following transient transfection of HEK 293T17 cells with full-length cDNAs of cystatin SA only, or cystatin SA and AC together. IP is performed using a polyclonal anti-AC serum. Western blotting is then performed and cystatin SA is detected using a polyclonal anti-cystatin SA antibody. Figure 2B shows a pull-down assay of recombinant AC and recombinant His-tagged cystatin SA, incubated in vitro for 24h. The pull-down is performed using Ni-NTA resin, followed by western blotting and detection of AC in the elution fractions using a monoclonal anti-AC antibody. Figures 2C-F show localization of AC and cystatin SA within human gingival fibroblasts, detected by immunohistochemistry of the cells using anti-cystatin SA (Figure 2C) and anti-AC (Figure 2D) antibodies for protein detection and Hoechst for DNA labeling (Figure 2E). Localization of the primary antibodies was visualized using a fluorescent second antibody Cy-3/2 and laser-scanning confocal microscopy. Figure 2F is a merged image showing colocalization of the two proteins. The results shown are representative of 3 independent experiments.

[0019] Figures 3A-C illustrate the characterization of AC inhibitory mechanism by cystatin SA. Figure 3 A shows that cleavage of the AC precursor into the active heterodimer is assessed by incubation of protein extracts prepared from HEK 293T17 cells transiently transfected with the AC cDNA alone or in combination with cystatin SA. AC precursor cleavage is not affected by co-expression of cystatin SA. Figure 3B shows AC activity in cell extracts in the presence or absence of cystatin SA at 0, 50, 100, and 150 μΜ of BODIPY-conjugated ceramide. Concentration of product (BODIPY fatty acid) formed after 24h at 37°C is shown. Gray and black bars represent activity in the presence and absence of cystatin SA, respectively. Figure 3C shows Lineweaver-Burk plots for AC activity in the presence and absence of cystatin SA represented by equations y=l .82x+l .93 and y=6.12x+3.68, respectively. Gray squares represent activity in the presence of cystatin SA, while black circles represent activity in the absence of cystatin SA. The analyses indicate that cystatin SA has characteristics of a non-competitive inhibitor. Data represent 3 independent experiments.

[0020] Figures 4A-C illustrate a computer modeling and characterization of the interaction site of AC and cystatin SA. Figure 4A illustrates a proposed model of cystatin SA, generated by 3D-JIGSAW protein homology modeling, based on PDB entry 1 rn7_A, showing the location of potential functional domains (i.e., cystatin-like domain (CLD; QXVXG (SEQ ID NO: 5)), the N-terminal region, Loop 1, Loop 2, and AC-like domain (ACLD (SEQ ID NO: 6); TICT (SEQ ID NO: 7)). Figure 4B shows designs of partial cDNA fragments encoding the potential functional domains of cystatin SA. Figure 4C shows a graph of AC activity measured in HEK 293T17 cell extracts after transient expression of the AC cDNA and co-expression of fragments 1-5, subcloned into the pCMV vector. AC activity in the presence of fragments 2 and 3, both of which contain the AC-like domain, is significantly lower in comparison to AC only (t-test, P<0.005 and 0.002, respectively). Data represent mean ± SEM, n = 3 independent experiments.

[0021] Figures 5A-D illustrate a baseline AC and cystatin SA expression in cancer cell lines. Figure 5 A shows AC activities in cell extracts that are determined using BODIPY-conjugated C12 ceramide. Concentration of the product (BODIPY fatty acid) formed after 24h at 37°C is shown. Figure 5B shows protein expression of the AC active form (14kDa) analyzed by western blotting using a monoclonal antibody specific to the AC alpha subunit. Figure 5C shows expression of cystatin SA in cell extracts detected using monoclonal antibody specific to cystatin SA. Activity in SK-MEL is below the expected level based on the very high protein expression, presumably due to the presence of cystatin SA. Figure 5D shows AC activity in SK-MEL cell extract collected 72h following transfection of cystatin SA siR A, control siRNA, or none. Activity of the enzyme is significantly elevated after suppression of cystatin SA expression (*p=0.0002 comparing with control siRNA, and ** 0.00006 comparing with the non-trans fected group). Data represent 3 independent experiments.

[0022] Figures 6A-D illustrate overexpresssion of cystatin SA in SK-MEL cells inhibits AC activity and cell proliferation. Figure 6A shows cell viability 24 and 48h after transfection of SK-MEL cells with the cystatin SA cDNA, assessed by the MTA viability assay. Gray and black bars represent viability in the presence and absence of cystatin SA, respectively. Figure 6B shows the activity of endogenous AC in protein extracts collected 48h following transfection of SK-MEL cells with the cystatin SA cDNA. Concentration of the product (BODIPY fatty acid) formed after 24h at 37°C is shown. Figure 6C shows ceramide levels 48h following transfection. Figure 6D shows a panel of representative pro and anti-apoptotic markers, assessed by western blotting of protein extracts, collected 48h following transfection of SK-MEL cells with the cystatin SA cDNA. Expression of cystatin SA in SK-MEL cells can decrease proliferation at both 24 and 48h (p<4.6^A-08 and 2^A-08, respectively), probably due to a decrease in AC activity (p<0.03) and accumulation of ceramide (p<0.01), leading to initiation of pro- apoptotic signaling, associated with decrease in Aktl, increase in Bax and the caspase-3 breakdown product PARP.

[0023] Figure 7 illustrates a proposed mechanism of cystatin SA anti-cancer activity. Cystatin SA potentially sensitizes cancer cells to apoptosis by inhibition of AC activity leading to ceramide accumulation, which results in recruitment of TRAIL receptor to the cell surface, Bax and caspase-3 activation, Aktl down-regulation, and TRAIL-induced apoptosis. In addition, cystatin SA may stimulate IFN-gamma release from CD4+ T cells, which also enhances TRAIL-induced apoptosis, and may inhibit extracellular AC activity as well. DETAILED DESCRIPTION OF THE INVENTION

[0024] One aspect of the present invention relates to a method of inhibiting acid ceramidase expression or activity in a cell or tissue. The method involves providing a cell or tissue containing acid ceramidase and contacting the cell or tissue with an inhibitor under conditions effective to inhibit expression or activity of the acid ceramidase in said cell or tissue. The inhibitor is derived from a cystatin family protein.

[0025] According this aspect of the present invention, cells or tissue inhibited by an inhibitor of the cystatin family protein include, but are not limited to, cancer cells or tissues, red and white blood cells, skin and gingival fibroblasts, and amniocytes. These cells or tissues may be derived from humans or animals.

[0026] According to this aspect of the present invention, inhibition of acid ceramidase may vary from cells or tissues, regardless of the expression or activity level of AC in the cell or tissue. Inhibition of AC would partially or fully limit expression and activity of AC. Inhibition according to the present may be, without limitation, competitive or non-competitive.

[0027] In one embodiment of this aspect of the present invention, the inhibitor is a peptide comprising an amino acid sequence selected from the group consisting of TICTQIVGG (SEQ ID NO: 1), QIVGGTICT (SEQ ID NO: 2), EGGTICTKSQPDTCA (SEQ ID NO: 3), and CREQIVGGTICT (SEQ ID NO: 4).

[0028] Another aspect of the present invention relates to a method of treating a subject having a condition mediated by upregulation of acid ceramidase. The method involves selecting a subject having a condition mediated by upregulation of acid ceramidase and administering to the selected subject an inhibitor of acid ceramidase expression or activity under conditions effective to treat the subject for the condition. The inhibitor is derived from a cystatin family protein.

[0029] Another aspect of the present invention relates to a cancer therapeutic agent containing a chemotherapeutic agent and a cystatin SA or a peptide derived from cystatin SA.

[0030] The condition mediated by upregulation of acid ceramidase includes, without limitation, breast cancer, lung cancer, brain cancer, pancreatic cancer, ovarian cancer, liver cancer, cervical cancer, colon cancer, melanoma, diabetes, arthritis, and Alzheimer's Disease.

[0031] This treatment can be carried out for the benefit of humans or animals

(e.g., rat, mice, pigs, horses, monkeys, cows, sheep, guinea pigs, dogs, and cats).

[0032] Inhibitors of the present invention can be administered orally, parenterally, for example, subcutaneously, intravenously, intramuscularly, intraperitoneally, by intranasal instillation, or by application to mucous membranes, such as, that of the nose, throat, and bronchial tubes. They may be administered alone or with suitable

pharmaceutical carriers, and can be in solid or liquid form such as, tablets, capsules, powders, solutions, suspensions, or emulsions.

[0033] The tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, or alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a fatty oil.

[0034] Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar, or both. A syrup may contain, in addition to the active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.

[0035] Inhibitors of the present invention may also be administered in the form of solutions or suspensions. Solutions or suspensions of these inhibitors can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. In general, water, saline, aqueous dextrose and related sugar solution, and glycols such as, propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. [0036] Numerous standard references are available that describe procedures for preparing various formulations suitable for administering the compounds according to the invention. Examples of potential formulations and preparations are contained, for example, in the Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (current edition); Pharmaceutical Dosage Forms: Tablets (Lieberman, Lachman and Schwartz, editors) current edition, published by Marcel Dekker, Inc., as well as Remington's Pharmaceutical Sciences (Arthur Osol, editor), 1553-1593 (current edition), which are hereby incorporated by reference in their entirety.

[0037] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.

[0038] Autoproteolytic cleavage of the inactive acid ceramidase (AC) precursor into the active heterodimer exposes a free cysteine residue. Applicants have therefore hypothesized that AC could be regulated by one or more members of the cystatin family, known cysteine protease inhibitors. The present invention corroborates applicants' initial hypothesis. In the present invention, expression of the full-length cystatin SA, but not the cystatin A, B, C or E/M cDNAs, significantly decreases AC activity in HEK 293T17 cells. A physical interaction between AC and cystatin SA is also detected by co- immunoprecipitation and Ni-NTA affinity chromatography, and by co-localization of the endogenous proteins in gingival fibroblasts. Computer modeling and co-expression studies of AC and partial fragments of cystatin SA further allow identification of the potential inhibitory domains. Finally, since AC expression is upregulated in many cancers and/or in response to several chemotherapy drugs, the anti-oncogenic potential of cystatin SA in SK-melanoma cells, which expressed high levels of AC protein, but relatively low AC activity is also assessed. It is noteworthy to mention that cystatin SA expression is detectable in SK-melanoma cells, and inhibition with siRNA elevates AC activity. On the other hand, overexpression of cystatin SA in SK-melanoma cells leads to reduced AC activity, accumulation of the pro-apoptotic substrate, ceramide, and initiation of apoptosis, characterized by a decreased number of cells, downregulation of Aktl, and an increase in Bax protein and caspase 3 activity. Based on these discoveries, a model of cystatin SA - AC mediated inhibition, leading to cancer cell death is proposed in the present invention.

[0039] In this aspect of present invention, cystatin SA potentially sensitizes cancer cells to apoptosis by inhibition of AC activity leading to ceramide accumulation, which results in recruitment of TRIAL receptor to the cell surface, Bax and caspase-3 activation, Aktl down-regulation and TRAIL-induced apoptosis. In addition, cystatin SA may stimulate IFN-gamma released from CD4+ T cells, which also enhances TRAIL- induced apoptosis, and may inhibit extracellular AC activity as well

[0040] Another aspect of the present invention relates to a method of screening for compounds potentially useful in treating cancer. The method involves providing an acid ceramidase and a plurality of candidate inhibitors. The acid ceramidase is then contacted with any of the plurality of candidate inhibitors. Physical interaction between any of the plurality of candidate inhibitors and the acid ceramidase is detected. The candidate compounds which physically interact with the acid ceramidase are identified as potentially useful in treating cancer.

[0041] In one embodiment of the present invention, detection of the physical method is carried out by immunoprecipitation,

[0042] According to the present invention, detecting the presence of a physical interaction involves detecting a complex between the enzyme or binding portion thereof and an inhibitor of the present invention. This can be carried out by any conventional method for detecting antigen-antibody reactions, examples of which can be found, e.g., in Klein, Immunology, New York: John Wiley & Sons, pp. 394-407 (1982), which is hereby incorporated by reference. For in vitro detection, the formation of a complex between the enzyme and inhibitor present in the cell or tissue sample can be detected by enzyme linked assays, such as ELISA assays. Briefly, the enzyme/inhibitor complex is contacted with an antibody which recognizes a portion of the enzyme that is complexed with the inhibitor. Generally, the antibody is labeled so that its presence (and, thus, the presence of an enzyme/inhibitor complex) can be detected. Alternatively, the enzyme or binding portion thereof can be bound to a label effective to permit detection of the substrate upon binding of the antibody or binding portion thereof to the inhibitor. Suitable labels include, fluorophores, chromophores, radiolabels, and the like.

[0043] Detection of the enzyme/inhibitor complex can be carried out by a variety of conventional methods. These include immunoprecipitation, electrophoresis, DNA sequencing, blotting, microplate hybridization, or microscopic visualization.

Alternatively, the probe can have bound thereto a label, such as detectable functional nucleotide sequence (e.g., a T7 site, a restriction site, and the like) or one of the labels described above as suitable for use in the detection method of the present invention employing antibodies. Detection, in this case, involves detecting the presence of the label, for example using the techniques discussed above or by using one of the conventional methods for detecting detectable functional nucleotide sequences.

[0044] Yet another aspect of the present invention relates to a method of isolating acid ceramidase. The method involves providing a sample containing acid ceramidase. The sample is contacted with a protein derived from a cystatin family protein under conditions effective for the ceramidase to bind to the protein as a complex. Acid ceramidase is then recovered from the complex.

[0045] According to this aspect of the present invention, as described above, the protein can be derived from cystatin SA, A, B, or E/M, and their analogs. In particular, the protein can include an amino acid sequence selected from the group consisting of TICTQIVGG (SEQ ID NO: 1), QIVGGTICT (SEQ ID NO: 2), EGGTICTKSQPDTCA (SEQ ID NO: 3), and CREQIVGGTICT (SEQ ID NO: 4).

[0046] Typically, the sample is a cell lysate, a cell culture medium, or a bodily fluid.

[0047] In this aspect of the present invention, the protein derived from a cystatin family protein can be immobilized on a solid support. The sample is then contacted with the immobilized protein. As a result, acid ceramidase in the sample is removed by affinity separation where that protein binds to and, as a result, immobilizes the acid ceramidase to the solid support in form of a protein-acid ceramidase complex. Recovery of the acid ceramidase can be carried out by elution chromatography. EXAMPLES

[0048] The Examples set forth below are for illustrative purposes only and are not intended to limit, in any way, the scope of the present invention. Example 1 ~ Antibodies and Reagents

[0049] The following antibody reagents were used from Santa Cruz

Biotechnology (SCBT): anti-AC goat polyclonal IgG, cat# sc-28486; anti-Bax rabbit polyclonal IgG, cat# sc-526; anti-PARP rabbit polyclonal IgG, cat# sc-7150; anti-Akt 1 goat polyclonal IgG, cat# sc-1618-R; donkey anti-goat IgG-horseradish peroxidase (HRP) conjugate, cat# sc-2020; and goat anti-mouse IgG-HRP conjugate, cat# sc-2005. Anti- AC mouse monoclonal IgM also was obtained from BD Transduction Laboratories, cat# 612302; and goat anti-rabbit IgG-HRP conjugate was from GE Healthcare, cat#

NA9340V. Hoechst was purchased from Sigma Aldrich, cat# 33342.

CELLTiter96Aqueous One cell proliferation and TUNEL assay kits were purchased from Promega. The lipofectamine transfection reagent was purchased from Invitrogen, cat# 11668019. Full-length cDNAs encoding cystatins A, B, C, E/M and SA in the pCMV vector were purchased from OriGene Technologies. Sense and antisense oligonucleotides for cystatin SA were purchased from Sigma Aldrich. Example 2 ~ Oligonucleotide Generation and cDNA Cloning

[0050] The full-length human AC cDNA was subcloned in-frame into the pCMV vector (Sigma). Commercial cDNAs of cystatins A, B, C, E/M and SA in the pCMV vector also were used. Partial cystatin SA cDNA fragments were generated by annealing of single-stranded, synthetic sense (see below) and antisense oligonucleotides flanked with Hindlll and BamHI restriction sites, using graduated temperature decrease. Cloning sites were then created by restriction digest using Hindlll and BamHI, and subcloned into the pCMV vector, digested by the same enzymes. The newly synthesized cDNA constructs were transfected into Top 10 competent bacterial cells, and the integrity of the constructs were confirmed by sequencing. The sequences of the reuse primers used for the fragment constructs were:

Fragment 1 (SEQ ID NO: 8): AATTAAGCTTTGGAGCCCCCAGGAGGAGGACA GGATAATCGAGGGTGGCATCTATGATGCAGAC

CTCAATGATGAGCGGGTACAGCGTGCCCTTCAC

TTTGTCATAGGGATCC Fragment 2 (SEQ ID NO: 9): AATTAAGCTTAGACGCCTGCTGCGGGTGCTACG

AGCCAGGGAGCAGATCGTGGGCGGGGTGAATT ACTTCTTCGACATAGAGGTGGGCCGAACCATAT GTACCTAGGGATCC

Fragment 3 (SEQ ID NO: 10) AATTAAGCTTCAGATCGTGGGCGGGGTGAATTA

CTTCTTCGACATAGAGGTGGGCCGAACCATATG TACCAAGTCCCAGCCCAACTTGGACACCTGTGC CTTCTAGGGATCC Fragment 4 (SEQ ID NO: 11): AATTAAGCTTTGGAGCCCCCAGGAGGAGGAC

AGGATAATCGAGGGTGGCATCACCATATGTAC CAAGTCCCAGCCCAACTTGGACACCTGTGCCTT CCATTAGGGATCC

Fragment 5 (SEQ ID NO: 12) AATTAAGCTTTGGAGCCCCCAGGAGGAGGACA

GGATAATCGAGGGTGGCATCCGAGCCAGGGAG

CAGATCGTGGGCGGGGTGAATTACTTCTTCGAC TAGGGATCC

Example 3 ~ Transient Transfection of HEK 293T17 Cells

[0051] For transient expression of the AC and cystatin cDNAs into HEK 293T17 cells, cDNA constructs were pre-incubated with the Lipofectamin-2000 transfection reagent in Optimem media according to the commercial instructions. DNA- Lipofectamin-2000 complexes were then added to cells cultured overnight in 0.5ml of antibiotic free DMEM media. After 24 or 48h, the treated cells were harvested, centrifuged at 800g for 5 min at 4°C, and kept at -20°C. To prepare protein extracts from the 293T cells, cell pellets were lysed with the celLytic reagent (Sigma) and centrifuged (10,000g) to obtain cell lysates.

Example 4 ~ Inhibition of Cystatin SA with siRNA

[0052] 200 pmol of cystatin SA specific (Santa Cruz Biotechnologies, sc-44521) or control siRNA (Dharmacon, D-001210-02-20) was transfected into SK-melanoma cells at 30% confluency in E-well plates, using the Lipofectamine-2000 transfection reagent (Invitrogen). Cell extracts were collected 72h after transfection and subjected to further analysis.

Example 5 ~ AC Activity Assay

[0053] The AC activity assay was performed as previously described (He et al,

Anal. Biochem. 293:204-211 (2001), which is hereby incorporated by reference in its entirety). Briefly, cell lysates were incubated for 22h at 37°C with O. lng/itl BODIPY conjugated C12-ceramide in 0.1M citrate/phosphate buffer, pH 4.5, 150mM NaCl, 0.05% BSA, and 0.1% Igepal CA-630. The reactions were stopped by ethanol, centrifuged, and the supematants were analyzed using an HPLC separation system (Waters). Fluorescence was quantified using a Waters 474 fluorescence detector set to excitation and emission wavelengths of 505 and 540nm, for the product (i.e., BODIPY-conjugated C12-fatty acid) and substrate, respectively. The amount of product was calculated using a regression equation that was established from a standard curve using BODIPY-conjugated C12-fatty acid.

Example 6 ~ Western Blot Analysis

[0054] Samples were separated by SDS-PAGE using 12%> precast Nupage

Bis/Tris gels under reducing conditions and MES running buffer (Invitrogen, Carlsbad, CA, USA), and then transferred onto nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ, USA) using a semidry transfer apparatus (Bio-Rad, Hercules, CA, USA) and Nupage -MOPS transfer buffer. For immunoblot analysis, membranes were blocked with TBS/Tween containing 5% dry milk, and then incubated with specific antibodies that were recognized by secondary antibodies conjugated to HRP. Detection was achieved using an enhanced chemiluminescence (ECL) detection reagent (Amersham Biosciences). Approximate molecular masses were determined by comparison with the migration of prestained protein standards (Bio-Rad).

Example 7 ~ In Vitro, Auto-Proteolytic Cleavage Analysis

[0055] Cell lysates were incubated at 4 or 37°C. At various times, an aliquot was withdrawn and subjected to SDS-PAGE and immunoblotting as described above. Example 8 ~ Immunohistochemistry

[0056] For immunostaining of gingival fibroblasts, cells were cultured in MEM media on chamber slides. Slides were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton, and labeled with anti-AC and cystatin SA antibodies. Localization of the primary antibodies was visualized using a fluorescent second antibody (Cy-3/2) and laser-scanning confocal microscopy.

Example 9 ~ Immunoprecipitation

[0057] For co -immunoprecipitation of AC and cystatin SA, HEK 293T17 cells were lysed 24h after transfection with the full-length cDNAs, and incubated overnight with polyclonal anti-AC serum, followed by magnetic beads precipitation (Dynabeads, Invitrogen) according to the manufacturer's protocol. The eluted proteins were separated using SDS-PAGE and detected by western blotting using specific antibodies for AC and cystatin SA. For pull-down assays, recombinant AC and His-tagged cystatin SA were incubated at 4°C overnight and a pull down assay was performed using Ni-NTA resin (Novagen, cat# 70691) and the Ni-NTA buffer kit (Novagen, cat# 70899-3).

Example 10 ~ Ceramide Quantification

[0058] SK-Melanoma cells, cultured to 90%> confluence, were transiently transfected with the cystatin SA cDNA and total cell lysates were prepared by three cycles of freeze/thaw 48h following the transfection. Lipids were extracted by mixing 150111 of the cell lysate with chloroform:methanol (1 :2, v/v), and sonicated for 5 minutes. After sonication, lOOpl of lmol/L NaCl and 10111 of concentrated HC1 were added, vortexed, and centrifuged at 10,000g for 2 minutes. The lower organic phase was transferred to a new tube, dried with a SpeedVac concentrator, and resuspended in 10 of ethanol. Ceramide was quantified from the lipid extracts using the diacylglycerol kinase method (Bielawska et al., Anal. Biochem. 298: 141-150 (2001), which is hereby incorporated by reference in its entirety). The combined data from triplicate experiments were subjected to a t-test analysis and results were considered significant at P < 0.05. Example 11— Cell Proliferation Assays

[0059] SK-Melanoma cells, cultured to 90% confluence on 12 well plates, were transiently transfected with the cystatin SA cDNA and harvested 24 and 48h after transfection. Cells were diluted 1 :3 into 96 well plates and the number of viable cells was assessed using the CELLTiter96 Aqueous kit (Promega). The combined data from triplicate experiments, comparing transfected and non-trans fected cells, were subjected to a t-test analysis, and results were considered significant at P < 0.05.

[0060] To assess the effect of different cystatins on AC activity, the full-length cDNAs encoding cystatins A, B, C, E/M or SA were co-transfected with the AC cDNA into HEK 293T17 cells. AC activity was determined in cell extracts 24h post- trans fection. As shown in Figure 1 A, each cystatin inhibited the expressed AC activity to varying degrees, although the results were only significant for cystatin SA (p<0.03), where the degree of inhibition was -50%. Western blotting also was performed

(Figure IB) to demonstrate that similar levels of the AC polypeptide were present in each of the transfected cell lines. Note that in the absence of transfection endogenous AC expression was non-detectable in HEK 293T17 cells.

[0061] To confirm a physical interaction between AC and cystatin SA, immunoprecipitation from HEK 293T17 cell extracts after co-transfection of the AC and cystatin SA cDNAs (Figure 2A) was performed. AC was immunoprecipitated using a polyclonal anti-AC antibody, and the presence of cystatin SA in the precipitate was detected by western blot analysis. As shown in this figure, after immunoprecipitation with the anti-AC antibody cystatin SA in cells that were co-transfected with both cDNAs could readily be detected, revealing that AC and cystatin SA formed a complex in these cells following co-expression.

[0062] To obtain additional evidence for this protein-protein interaction, an in vitro binding assay using recombinant human AC and His-tagged cystatin SA was performed. Both proteins were incubated in vitro, followed by pull-down using Ni-NTA resin and spin columns as described in the Methods. Proteins were eluted using a denaturing elution buffer and AC was detected in the elution fractions by western blot analysis using a monoclonal anti-AC antibody (Figure 2B). These results showed that AC eluted from the beads in a gradient manner, peaking in elution fraction 2. The fact that there was no detectable AC in fraction 1 indicates that the interaction and elution from the Ni-NTA columns was specific, and not due to "spill-over" from the input. The findings were further supported by immunostaining of non-transfected gyngyval fibroblasts, which are known to express endogenous cystatin SA (Figures 2C-F). A distinctive co-localization of AC and cystatin SA was observed in these cells, mostly in perinuclear vesicles resembling lysosomes.

[0063] To investigate the mechanism of cystatin SA inhibition further, overexpression of the cystatin SA blocked transition of the AC precursor into the active heterodimer was assessed. For this purpose HEK 293T17 cells were transiently transfected with cDNAs encoding AC alone or both AC and cystatin SA. Cell extracts were prepared 24h post-transfection, and then incubated at 37°C for 48h. Following incubation the protein extracts were analyzed by western blotting using a monoclonal anti-AC antibody that recognized the AC alpha-subunit (14kDa). This allowed detection of both the inactive 50kDa precursor and heterodimeric active form (Figure 3A). The results revealed that the conversion of AC from the precursor to active form was the same, regardless of cystatin SA co-transfection. Thus, cystatin SA did not interfere with AC processing, despite inhibiting activity.

[0064] To characterize the inhibitory effect further, AC activity in HEK 293T17 cell extracts was measured at three different substrates (BODIPY-C12 ceramide) concentrations following AC or cystatin SA cDNA expression (Figures 3B-C). In the presence of cystatin SA, the inhibition of AC exhibited the characteristics of a noncompetitive inhibitor, as enzyme activity (velocity) was reduced while the Km remained unchanged. This observation implies that cystatin SA binds AC at a site other than the enzyme's active site (allosteric site), and is in agreement with the model of endopeptidase inhibition by cystatins described by Bode and Huber (Bode et al, Biochim Biophys Acta. 1477:241-52 (2000), which is hereby incorporated by reference in its entirety). However, when this effect was attempted in vitro by mixing purified, recombinant cystatin SA and human AC, inhibition was not observed. This suggests that the inhibitory effect of cystatin SA on AC is dependent on the in situ environment.

[0065] The three-dimensional structure of cystatin SA has not yet been resolved (Vray et al, Cell Mol. Life Sci. 59: 1503-12 (2002), which is hereby incorporated by reference in its entirety). Thus, the protein's secondary structure based on sequence homology to chicken cystatin C (Protein Data Bank accession code 1CEW) (Figure 4 A) was modeled. Visualization of the predicted cystatin SA structure, together with data obtained from published sources (Hall et al, Biochem. J. 291 : 123-9 (1993); Stubbs et al, EMBO J. 9: 1939-47 (1990), which are hereby incorporated by reference in their entirety) and analysis of the cystatin SA amino acid sequence, revealed several structural components that applicants hypothesized might be involved in the AC inhibitory process. These regions included the N-terminal segment, containing a conserved Gly at residue 24, a conserved hairpin loop (loop 1) containing the "cystatin-like" domain (CLD; QXVXG (SEQ ID NO: 5)), and a second hairpin loop (loop 2) containing an "AC-like" domain (ACLD (SEQ ID NO: 6); TICT (SEQ ID NO: 7)). The latter "AC-like" domain was defined by a region within cystatin SA (residues 92-95) that was homologous to a region in human AC (residues 141-145), and formed by a disulfide bridge between residues C94 and CI 04.

[0066] Five cDNA fragments containing these potential inhibitory domains in different combinations were synthesized and their effect on AC activity was assessed in HEK 293T17 cells 24h following co-transfection with the full-length AC cDNA

(Figures 4B-C). This analysis showed that fragment 3, containing the CLD, Beta3 region, ACLD (SEQ ID NO:6) and loop 2 regions, and fragment 4, containing the N-terminal region, ACLD (SEQ ID NO:6) and loop 2 regions, exhibited statistically significant inhibition (p<0.005 and p<0.002, respectively). Fragments containing the N-terminal alpha helix domain or Beta2 regions alone had no effect on AC inhibition.

[0067] Cystatin SA has not been well studied, and has not been detected in any tissues other than the submandibular and parotid glands (Dickinson et al., DNA Cell Biol. 21 :47-65 (2002), which is hereby incorporated by reference in its entirety). Its physiological function also is poorly understood (Kato et al, Biol Chem. 385:419-22 (2004), which is hereby incorporated by reference in its entirety). In contrast, AC is widely expressed in many tissues, and AC activity is significantly elevated in several types of cancer (Raisova et al, FEBS Lett 516, 47-52 (2002); Seelan et al, Genes

Chromosomes Cancer 29: 137-46 (2000); Karahatay et al., Cancer Lett 256: 101-11 (2007), which are hereby incorporated by reference in their entirety). A baseline evaluation of AC activity and protein expression in several cancer cell lines was performed, and surprisingly, found that AC protein expression did not correlate with AC activity. For example, the SK-melanoma cell line (SK-MEL) had very high levels of mature AC (as evidenced by the presence of the 14kDa alpha-subunit), but equivalent activity to the liver cancer cell line, Hep3b (Figures 5A-B). Applicants hypothesized that one reason for this discrepancy might be elevated, endogenous expression of cystatin SA in the SK-MEL cells. To evaluate this hypothesis, western blot analysis of cystatin SA was performed on these two cell lines, and only the SK-MEL cells were found to express detectable cystatin SA (Figure 5C). Of note, inhibition of cystatin SA expression in these cells with siR A led to elevated AC activity (Figure 5D), providing additional evidence that this cystatin inhibits AC activity.

[0068] These results also suggested that overexpression of cystatin SA might overcome the high level AC activity observed in many cancers. To test this hypothesis, the cystatin SA cDNA was transiently overexpressed in SK-MEL cells, followed by assessment of cell viability using the MTS assay. At 24 and 48h post-transfection, 50- 70% of the cells overexpressing cystatin-SA cDNA had died, as compared to the mock- transfected (control) cells (Figure 6A). Cell extracts also were prepared 48h post- transfection, and AC activity and ceramide levels were assessed. These results showed that AC activity in cells transfected with the cystatin SA cDNA was decreased -50%, and the ceramide levels were increased ~20%> (Figure 6B-C). These results are consistent with applicants' hypothesis that cystatin SA inhibits AC activity, leading to elevated ceramide and cell death. Both differences (AC activity and ceramide) were statistically significant (p<0.03 and 0.01, respectively).

[0069] To characterize the molecular changes induced by cystatin SA

overexpression, intracellular expression of cystatin SA and several pro- and anti-apoptotic markers by western blot analysis of the SK-MEL cell extracts collected 48h post- transfection was followed. These results demonstrated that cystatin SA overexpression was correlated with a decrease in the anti-apoptotic factor Aktl, and an increase in the pro-apoptotic markers, Bax and caspase-3, the latter detected by a decrease of the 116kDa PARP substrate and an increase in the 24kDa proteolytic product (Figure 6D). Overall, the protein expression changes induced by overexpression of cystatin SA in the SK-MEL cells indicated that apoptosis signaling pathways were being activated.

[0070] Many studies have shown that cancer cells and/or primary tumors exhibit increased levels of AC, which could favor proliferation by maintaining low levels of the pro-apoptotic lipid substrate, ceramide, and/or by increasing levels of the proliferative lipid, SIP. AC overexpression also has been associated with resistance to chemotherapy, and its inhibition was shown to sensitize cancer cells to various commonly used cancer drugs (e.g., doxorubicin, (Saad et al, Cancer Biol Ther. 6(9): 1455-60 (2007), which is hereby incorporated by reference in its entirety) and irradiation (Raisova et al., FEB S Lett 516, 47-52 (2002); Holman et al, Cancer Chemother Pharmacol 61 :231-42 (2008); Selzner et al, Cancer Res. 61 :1233-40 (2001); Morales et al, Oncogene. 26:905-16 (2007); Samsel et al, Prostate 58:382-93 (2004); Elojeimy et al, FEBS Lett. 580:4751-6 (2006); Granot et al, Leukemia 20:392-9 (2006); Elojeimy et al, Mol. Ther. 15:1259-63 (2007), which are hereby incorporated by reference in their entirety). Thus, AC inhibition has emerged an attractive target for new anti-oncogenic treatment approaches. Most available AC inhibitors are ceramide analogues, which effect AC activity and/or enhance protein degradation (Raisova et al., FEBSLett 516, 47-52 (2002); Holman et al., Cancer Chemother Pharmacol 61 :231-42 (2008); Selzner et al, Cancer Res. 61 : 1233-40 (2001); Samsel et al, Prostate 58:382-93 (2004); Granot et al, Leukemia 20:392-9 (2006); El- Zawahry et al., Cancer Gene Ther. 13:281-9 (2006), which are hereby incorporated by reference in their entirety). In addition, pharmacological compounds, such as

desipramine (Elojeimy et al, FEBSLett. 580:4751-6 (2006), which is hereby

incorporated by reference in its entirety) and N-oleoylethanolamine (Batra et al., Cancer Res. 64:5415-24 (2004), which is hereby incorporated by reference in its entirety) also have inhibitory effects on AC activity and induced apoptosis in cancer cell lines. Finally, the protein based inhibitor, apoptin, activates apoptotic signaling and leads to AC degradation (Liu et al, Mol. Ther. 14:627-36 (2006); Liu et al, Mol. Ther. 14, 637-46 (2006), which are hereby incorporated by reference in their entirety). All of the above result in effective cytotoxicity, however it is not clear whether the inhibitory effects on AC are specific, or if AC degradation is a consequence of upstream signaling, induced by disruption of the lysosomes and release of proteases. Lack of specificity of AC inhibition raises an important concern regarding unwanted toxicity in normal cells. The only current method for achieving specific AC inhibition is by siRNA, which also has been successfully used for induction of cytotoxicity in cancer cell lines (Morales et al, Oncogene 26:905-16 (2007); Elojeimy et al, Mol. Ther. 15: 1259-63 (2007); Batra et al, Cancer Res. 64:5415-24 (2004); Mandy et al, Mol Ther. 17:430-8 (2009), which is hereby incorporated by reference in its entirety). However, while effective for research purposes, AC specific siRNA would be difficult to deliver in sufficient and consistent doses for in vivo use. Thus, it is essential to continue to develop new inhibitors for AC that are more specific, potentially less toxic, and more easily adapted for drug delivery. [0071] Applicants have previously reported that the inactive AC precursor undergoes self-cleavage and activation, similar to N-terminal nucleophile (Ntn)hydrolases family members (Shtraizent et al., J. Biol. Chem. 83: 11253-9 (2008), which is hereby incorporated by reference in its entirety). This is the only mammalian ceramidase known to undergo this activation mechanism. Having cysteine residues at the cleavage site implies that AC is within the same sub-category of Ntn hydrolases as the cysteine proteases. In the present invention, AC is inhibited by the cysteine protease inhibitors, cystatins, particularly by cystatins A, B, C, E/M and SA, which are known to be differentially expressed in various types of cancer. Herein it is revealed that cystatin SA, which is a salivary cystatin within the type 2 cystatin family, is a novel physiological inhibitor of AC. Analysis of the physical interaction between AC and cystatin SA showed that a complex could be formed between the two proteins in vitro and in situ following transient co-expression. This data is further supported by the results of confocal microscopy in gingival fibroblasts, showing co-localization of AC and cystatin SA.

[0072] To identify region(s) of cystatin SA responsible for the AC inhibitory effect applicants constructed partial cystatin SA cDNA fragments, which include various combinations of known functional domains (e.g., the N-terminal and CLD domains), as well as new potential binding domains identified by protein modeling, including several alpha helices, an "AC-like" domain, ACLD (SEQ ID NO: 6), and loop 2 are constructed. Over-expression of partial cDNA fragments in HEK 293T17 cells is followed by monitoring of the enzymatic activity of expressed AC activity, showed that the cystatin SA inhibitory effect was most significant for fragments containing the ACLD (SEQ ID NO: 6), CLD, and loop 2 regions. This combination of common (e.g., CLD) and unique (e.g., ACLD (SEQ ID NO: 6)) features leads to preferential inhibition of AC by cystatin SA, as compared to other enzymes that may also be affected by this protein (e.g., cathepsin C and L, (Mandy et al, Mol. Ther. 17:430-8 (2009), which is hereby incorporated by reference in its entirety).

[0073] To further characterize the mechanism of inhibition applicants performed western blotting and kinetic analysis of AC in the presence of cystatin SA. The results indicate that cystatin SA did not interfere with precursor transformation of recombinant AC into the active heterodimer, nor did it inhibit AC activity after mixing of the two proteins in vitro. However, overexpression of cystatin SA in cells clearly inhibited AC activity, and kinetic analysis was consistent with the action of a non-competitive inhibitor. The findings were consistent with kinetic models proposed for the inhibitory effects of cystatins on endopeptidases (Bode et al, Biochim. Biophys. Acta. 1477:241-52 (2000), which is hereby incorporated by reference in its entirety), and implied that cystatin SA may bind AC by interaction of the ACLD with an allosteric site on the enzyme, adjacent to but not within the active site. Further support for an in situ interaction of AC and cystatin SA was obtained from experiments in cancer cells, where inhibition of cystatin SA with siRNA led to elevation of AC activity, while

overexpression inhibited AC expression and led to ceramide-mediated apoptosis.

[0074] In vivo, cystatin SA is found in the submandibular-sublingual saliva and submandibular and parotid glands (Dickinson et al., DNA Cell Biol. 21 :47-65 (2002); Al- Hashimi et al, J. Biol. Chem. 263:9381-7 (1988), which are hereby incorporated by reference in their entirety), where it functions as a defense factor against microorganisms and infectious viruses in the oral cavity (Blankenvoorde et al, Biol. Chem. 377:847-50 (1996); Abrahamson et al, Biochem. Soc. Symp. 70: 179-99 (2003), which are hereby incorporated by reference in their entirety). Recently, cystatin SA also was shown to induce interleukin-6 production by human gingival fibroblast (Kato et al., Mol. Immunol. 39:423-30 (2002), which is hereby incorporated by reference in its entirety), and interferon gamma (IFNy) expression in CD4 positive T cells (Kato et al., Biol. Chem. 385:419-22 (2004), which is hereby incorporated by reference in its entirety). IFNy released by CD4 positive T cells is an important part of anti-tumor immunity, leading to an induction of TRAIL (tumor necrosis factor related apoptosis-inducing ligand)- mediated apoptosis in tumor cells (Tateishi et al, Int. J. Cancer 118:2237-46 (2006), which is hereby incorporated by reference in its entirety). Interestingly, TRAIL signaling includes activation of acid sphingomyelinase (ASM) and the release of its product, ceramide (Dumitru et al, Oncogene 25:5612-25 (2006); Dumitru et al, Apoptosis 12: 1533-41 (2007), which are hereby incorporated by reference in their entirety), and in some cancers this pathway may be defective, leading to chemotherapy and radiation resistant phenotypes (Voelkel- Johnson et al, Mol. Cancer. Ther. 4:1320-7 (2005), which is hereby incorporated by reference in its entirety). Ceramide also can negatively regulate the Akt signaling pathway through p38 MAPK activation (Kim et al., Cancer Lett.

260:88-95 (2008), which is hereby incorporated by reference in its entirety), resulting in increased levels of Bax and activation of caspase 3 (Werner et al., J. Biol. Chem.

277:40760-7 (2002); Werner et al, J. Biol. Chem. 277:22781-8 (2002), which are hereby incorporated by reference in their entirety). PBKIAkt, on the other hand, is a survival factor (Brunei et al, Cell 96:857-68 (1999), which is hereby incorporated by reference in its entirety) that functions as an oncogene in some cancer cells, leading to down- regulation of TRAIL and a decreased number of death receptors at the cell surface, as well as a decreased immune response to cytokines and tumor resistance in some cancers, including melanoma (Larribere et al., Cell Death Differ. 11 : 1084-91 (2004), which is hereby incorporated by reference in its entirety).

[0075] Analysis of several cancer cell lines for AC expression showed a lack of correlation between activity and protein levels. This suggested that post-translational factors were very important for regulating AC activity, and that one possible factor could be the presence of an endogenous inhibitor. One example of this was observed in SK- MEL cells, where AC protein expression was very high, but the activity was equivalent to or below several other cancer cell lines, including HepG2. Interestingly, as compared to these cancer cell lines with equivalent activity but much lower protein expression, SK- MEL cells were the only cells in which endogenous expression of cystatin S A could be detected. Inhibition of cystatin SA with siRNA led to elevated AC activity, consistent with the concept that cystatin SA functions as a physiological inhibitor of AC activity. Applicants also further inhibited AC in SK-MEL cells by over-expressing the full-length cystatin SA cDNA, and found that this led to decreased cell viability, correlating with an increase in ceramide. Further analysis of cell extracts showed that cystatin SA

overexpression activated signaling mechanisms that are usually downstream of the TRAIL receptor, including decreased Akt and Bax expression and increased activity of caspase 3, detected by decreased expression of the PARP 116kDa fragment and an increase in the 24kDa breakdown product.

[0076] Applicants have shown for the first time that cystatin SA may function as a physiological inhibitor of AC, and that overexpression of this protein can be used to inhibit this enzyme in cancer cells, contributing to cell death. Applicants have also identified functional domains within cystatin SA that are responsible for the inhibitory effect, which might facilitate the development of small molecule, peptide-based inhibitors based on the cystatin SA sequence. Inhibition of AC in tumor cells by cystatin SA and/or cystatin SA based peptides could potentially be more specific than existing inhibitors, which are mostly substrate analogues that could interact with other ceramidases and have unwanted toxicities. In addition to its effects on AC, the use of such cystatin-based inhibitors in vivo may have an additional advantage of inducing IFNy release from CD4+ T cells (Kato et al, Biol. Chem. 385:419-22 (2004), which is hereby incorporated by reference in its entirety), thereby enhancing the anti-tumor immune response. A potential scheme for the anti-cancer effects of cystatin SA is depicted in Figure 7.

[0077] Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.

Claims

WHAT IS CLAIMED:

1. A method of inhibiting acid ceramidase expression or activity in a cell or tissue, said method comprising:

providing a cell or tissue containing acid ceramidase and

contacting the cell or tissue with an inhibitor under conditions effective to inhibit expression or activity of the acid ceramidase in said cell or tissue, wherein the inhibitor is derived from a cystatin family protein.

2. The method of claim 1, wherein the cell or tissue is a cancer cell or tissue. 3. The method of claim 1, wherein the cell or tissue is from a human.

4. The method of claim 1, wherein the inhibitor is derived from cystatin SA.

5. The method of claim 1, wherein the inhibitor is a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

6. The method of claim 5, wherein the amino acid sequence is SEQ

ID NO: 1.

7. The method of claim 5, wherein the amino acid sequence is SEQ

ID NO: 2. 8. The method of claim 5, wherein the amino acid sequence is SEQ

ID NO: 3.

9. The method of claim 5, wherein the amino acid sequence is SEQ

ID NO: 4.

10. The method of claim 1 , wherein the method of inhibiting is performed in vivo or in vitro.

11. A method of treating a subject having a condition mediated by upregulation of acid ceramidase, said method comprising: selecting a subject having a condition mediated by upregulation of acid ceramidase and

administering to the selected subject an inhibitor of acid ceramidase expression or activity under conditions effective to treat the subject for the condition, wherein the inhibitor is derived from a cystatin family protein.

12. The method of claim 11 , wherein the inhibitor is derived from cystatin SA.

13. The method of claim 11 , wherein the inhibitor is a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

The method of claim 13, wherein the amino acid sequence is SEQ

ID NO: 1.

The method of claim 13, wherein the amino acid sequence is SEQ

ID NO: 2.

The method of claim 13, wherein the amino acid sequence is SEQ

The method of claim 13, wherein the amino acid sequence is SEQ

ID NO: 4.

18. The method of claim 11 , wherein the condition mediated by upregulation of acid ceramidase is selected from the group consisting of breast cancer, lung cancer, brain cancer, pancreatic cancer, ovarian cancer, liver cancer, cervical cancer, melanoma, Alzheimer's Disease, diabetes, and arthritis.

19. The method of claim 11 further comprising:

administering a chemotherapeutic agent to the selected subject. 20. An isolated peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

21. The peptide of claim 20, wherein the amino acid sequence is SEQ

ID NO: 1.

22. The peptide of claim 20, wherein the amino acid sequence is SEQ

ID NO: 2. 23. The peptide of claim 20, wherein the amino acid sequence is SEQ

ID NO: 3.

24. The peptide of claim 20, wherein the amino acid sequence is SEQ

ID NO: 4.

25. A cancer therapeutic agent comprising a chemotherapeutic agent and the isolated peptide of claim 20.

26. A cancer therapeutic agent comprising:

a chemotherapeutic agent and

a cystatin SA or a peptide derived from cystatin SA.

27. A method of screening for compounds potentially useful in treating cancer, said method comprising:

providing an acid ceramidase;

providing a plurality of candidate inhibitors;

contacting the acid ceramidase with any of the plurality of candidate inhibitors;

detecting physical interaction between any of the plurality of candidate inhibitors and the acid ceramidase; and

identifying candidate compounds which physically interact with the acid ceramidase as potentially useful in treating cancer.

28. The method of claim 27, wherein the physical interaction is binding between candidate inhibitor and the acid ceramidase.

29. The method of claim 27, wherein said detecting is carried out by immunoprecipitation.

30. A method of isolating acid ceramidase, said method comprising: providing a sample containing acid ceramidase;

contacting the sample with a protein derived from a cystatin family protein under condition effective for acid ceramidase to bind to the protein as a complex; and recovering acid ceramidase from the complex.

31. The method of claim 30, wherein the protein is derived from cystatin SA.

32. The method of claim 30, wherein the protein is a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

The method of claim 32, wherein the amino acid sequence is SEQ

ID NO: 1.

The method of claim 32, wherein the amino acid sequence is SEQ

ID NO: 2.

35. The method of claim 32, wherein the amino acid sequence is SEQ

ID NO: 3.

The method of claim 32, wherein the amino acid sequence is SEQ

ID NO: 4.