WO2012025251A1

WO2012025251A1 - Nucleic acids for treatment of chronic complications of diabetes

Info

Publication number: WO2012025251A1
Application number: PCT/EP2011/004331
Authority: WO
Inventors: Werner Purschke; Florian Jarosch; Dirk Eulberg; Sven Klussmann; Klaus Buchner; Christian Maasch; Nicole Dinse
Original assignee: Noxxon Pharma Ag
Priority date: 2010-08-27
Filing date: 2011-08-29
Publication date: 2012-03-01

Abstract

The present invention is related to a nucleic acid molecule capable of binding to MCP-1, preferably capable of inhibiting MCP-1, whereby the nucleic acid molecule is for use in a method for the treatment and/or prevention of a disease or disorder, or for use as a medicament for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication, diabetic condition, inflammatory joint disease, eye disease, asthma, autoimmune disease, neuroinflammatory disease, tissue disease, cardiovascular disease, renal disease, ischemia injury, reperfusion injury, lung disease, transplantation, gynecological disease and conditions with elevated MCP-1 level.

Description

Nucleic acids for treatment of chronic complications of diabetes

The present invention is related to nucleic acid molecule, the use thereof for the manufacture of a medicament for the treatment of a disease, a disorder or a complication of a disease, preferably the disease is diabetes a pharmaceutical composition comprising such nucleic acid molecule and its use, we as as a method for the treatment of a disease using such nucleic acid molecule.

The most common of the serious metabolic diseases affecting humans is diabetes mellitus (abbr. DM), with estimated 170 million patients in year 2000. Its rapidly increasing prevalence (Wild, Roglic et al. 2004) and its clinical complexity and chronic nature turn DM to a huge medical and socioeconomic problem (Pardes, Manton et al. 1999; Zimmet, Alberti et al. 2001). DM is a progressive disease caused by inherited and/or acquired deficiency in production of insulin (a hormone essential for sugar metabolism) by the pancreas, or by the ineffectiveness of the insulin produced. The insulin deficiency or insensitivity results in increased concentrations of glucose in the blood (referred to as hypergylcemia), which in turn damages many of the body's systems such as diabetic retinopathy, kidney failure, heart disease, diabetic neuropathy and diabetic foot disease.

In general two types of DM are distinguished: In the case of Type 1 diabetes mellitus (abbr. DM1) the insulin producing and secreting beta-cells in the pancreatic islets of Langerhans are destroyed because of an auto-immune reaction of the body. Because of this, DM1 was previously referred to as 'insulin-dependent DM' or 'IDDM'. DM1 may occur already at young age and is believed to be predominantly determined by the genetic background of the patient (Cnop, Welsh et al. 2005).

Type 2 diabetes mellitus (abbr. DM2), previously also referred to as 'non-insulin-dependent DM' or 'NIDDM', is much more common and accounts for around 90% of all diabetes cases worldwide. It occurs most frequently in adults, but is being noted increasingly in adolescents as well. DM2 occurs when the body, notably muscle and liver cells, does not respond correctly to insulin (referred to as insulin resistance), which initially is available even at elevated concentrations (to compensate for its reduced activity) (Stumvoll, Goldstein et al. 2005).

In prediabetic individuals the symptomatic insulin resistance is compensated by increased insulin production from the pancreatic beta-cells (Mulder, Martensson et al. 2000; Ludvik, Thomaseth et al. 2003). At this stage of disease the glucose level generally are normal.

The developing defect of the beta-cells to produce enough insulin in a condition of hyperinsulinemia is a characteristic of the transition from insulin resistance to early stages of DM2. As consequence of the beta-cell defect, the beta-cells can not produce enough insulin anymore (relative lack of insulin - referred to as relative hypoinsulinemia), although more insulin is produced as at healthy state (referred to as absolute hyperinsulinemia). As result a rise in basal and postprandial blood glucose levels occur. Postprandial hypergylcemia is one of the earliest abnormalities of glucose homeostasis whereby the basal blood glucose levels can still accelerate.

With progression of the disease the capacity of the pancreas to produce insulin is more and more reduced because of beta-cell failure. The beta-cell failure leading to hypoinsulinemia and fasting hyperglycemia is characteristic for late stage of DM2. On diagnosis, beta-cell function is generally reduced to approximately 50% of what is considered normal (Tack and Smits 2006). Recent data indicate that during development of DM2, increased beta-cell apoptosis is the main mechanism responsible for beta-cell failure and the advent of hyperglycemia (Rhodes 2005).

DM2 is caused by a combination of genetic factors (determinants that may affect insulin production or/and insulin sensitivity) and environmental factors such as obesity (due to excess food intake and/or lack of physical exercise), which promote development of insulin resistance (Stumvoll, Goldstein et al. 2005). Between 60% and 90% of the cases of type 2 diabetes now appear to be related to obesity (Anderson, Kendall et al. 2003). Hormone metabolic abnormalities are characteristic for DM2, but additionally long term complications involving eyes, nerves, kidneys and blood vessels are consequences of DM2: diabetic retinopathy, diabetic neuropathy, diabetic nephropathy, peripheral vascular disease, high cholesterol, high blood pressure, atherosclerosis, and coronary artery disease. The major cause of death and disability in diabetes is coronary artery disease (Moller 2001).

A third type of DM, gestational diabetes mellitus (abbr. GDM), develops during some cases of pregnancy but usually disappears after pregnancy. Since many patients with GDM go on to develop DM2 (Kim, Newton et al. 2002), and both diseases are characterized by insulin resistance, it was postulated that they represent points on a continuum of glucose intolerance. In a recent study it was shown, that, if a woman had GDM but was not aware of it and was given routine care, then her baby had a three-fold risk of major complications compared to those of women that were treated with insulin (Crowther, Hiller et al. 2005).

Several diseases may be caused by diabetes, may lead to diabetes and/or may occur in relation to diabetes and are summarized herein as diabetic complications or diabetic conditions, whereby the diabetic complications and diabetic conditions are selected from the group but not limited to 'metabolic syndrome' also known as 'insulin resistance syndrome' and 'Syndrome X', insulin resistance, nephropathy such as diabetic nephropathy, atherosclerosis, neuropathy such as peripheral neuropathy, and retinopathy such as proliferative retinopathy, non-alcoholic fatty liver disease and non-alcoholic steatohepatitis.

Because of the complexity and partially unknown mechanism of the DM process/development, preferably the DM2 process/development, the primary aim of treatment of DM, preferably of DM2, is the reduction of blood glucose to as near normal as possible, thereby minimizing both the short- and long-term complications of the disease. The primary treatment for DM, preferably for DM2, is exercise and diet. When diet and exercise do not help to maintain normal or near-normal blood glucose levels, medication is necessary (Webb, Lipsky et al. 2000; Takiya and Chawla 2002).

A plurality of drugs were developed for the medication of diabetes and/or diabetic complications, e.g.:

• Sulfonylurea drugs reduce blood glucose levels by stimulating pancreatic beta cells to secrete insulin, which results in an elevated plasma insulin concentration, a secondary action is improvement in hepatic and peripheral insulin sensitivity (Webb, Lipsky et al. 2000; Takiya and Chawla 2002); • Biguanides like Metformin (brand name Glucophage) lower blood glucose levels primarily by decreasing the amount of glucose produced by the liver; metformin also helps to lower blood glucose levels by making muscle tissue more sensitive to insulin (insulin sensitizer) so glucose can be absorbed (Webb, Lipsky et al. 2000; Takiya and Chawla 2002);

• Alpha-glucosidase inhibitors such as acarbose (brand name Precose) and meglitol (brand name Glyset) decrease the absorption of carbohydrates from the digestive tract, thereby lowering the after-meal glucose levels; the principal action of alpha-glucosidase inhibitors is the partial inhibition of intestinal enzymes that break down carbohydrates into monosaccharides (Webb, Lipsky et al. 2000; Takiya and Chawla 2002);

• Thiazolidinediones such as rosiglitazone (brand name Avandia), troglitazone (brand name Rezulin), and pioglitazone (brand name ACTOS) increase the cell's sensitivity (responsiveness) to insulin and also reduce glucose production in the liver (Webb, Lipsky et al. 2000; Takiya and Chawla 2002);

• Meglitinides such as repaglinide (brand name Prandin) and nateglinide (brand name Starlix) stimulates the release of insulin from the pancreatic beta cells by closing ATP- sensitive potassium channels (Webb, Lipsky et al. 2000; Takiya and Chawla 2002); and

• Exenatide (brand name Byetta) is a synthetic version of exendin-4, an incretin mimetic that works to lower blood glucose levels primarily by increasing insulin secretion.

Monotherapy for DM, preferably DM2 may either fail at the onset or become ineffective over time. The cause is often unknown and does not mean the DM has become worse. If therapy with a single oral agent fails, simply switching to another single agent is not likely to be effective. However, combining agents (oral combination therapy) with different pathophysiologic mechanisms may significantly improve blood glucose control, e.g. sulfonylurea drug and metformin treatment regimen is the most widely used and extensively studied of the combination therapies (Webb, Lipsky et al. 2000; Takiya and Chawla 2002).

Insulin is generally not a first-line treatment for DM, preferably DM2. However, over time, nearly 50 percent of patients with DM2 will need insulin to control their hyperglycemia. Insulin regulates plasma glucose levels by decreasing hepatic glucose production and increasing glucose uptake and metabolism by peripheral tissues. Given in sufficient doses, insulin can lower the HbAlc (glycosylated hemoglobin; glycosylated hemoglobin is a form of hemoglobin used primarily to identify the plasma glucose concentration) to near normal in most patients. It also lowers plasma triglyceride levels and may have a slight beneficial effect on plasma LDL and HDL cholesterol levels. Side effects of insulin therapy include more weight gain and more major hypoglycemic episodes than with oral antihyperglycemic treatment (Webb, Lipsky et al. 2000; Takiya and Chawla 2002).

A substantial increase in tissue macrophages is a common feature of diabetic complications including but not limited to nephropathy such as diabetic nephropathy atherosclerosis, neuropathy such as peripheral neuropathy, and retinopathy such as proliferative retinopathy.

Some of the current therapies to treat diabetic complications indirectly modulate macrophage function, e.g.:

• inhibitors of angiotensin-converting enzyme (abbr. ACE) and angiotensin II receptor blockers (abbr. ARBs) reduce macrophage-mediated injury in diabetic complications (Li, Yang et al. 2003; Mizuno, Sada et al. 2006);

• agonists of peroxisome proliferator-activated receptor-γ (abbr. PPARy), which are used to promote insulin sensitivity, also inhibit macrophage inflammatory responses (Ricote, Li et al. 1998); and

• cholesterol-reducing statins, such as hydroxyl-methyl-glutaryl-CoA reductase inhibitors, appear to inhibit macrophage signalling (Loike, Shabtai et al. 2004).

These clinical treatments, although effective in slowing the development of diabetic complications, do not prevent the progression of tissue inflammation associated with these disorders. A number of other experimental treatments, which indirectly affect tissue inflammation, have also shown promise as stand-alone or adjunct therapies in diabetic complications:

• RAGE-neutralizing antibody, soluble RAGE, inhibitors of AGE formation (such as aminoguanidine, pyridoxarnine, OPB-9195) or an AGE cross-link breaket (ALT-711) (Forbes, Thallas-Bonke et al. 2004);

• anti-oxidants (suppression of macrophage ROS), whereby, however, the success of antioxidant therapies in rodents has not yet translated into similar effectiveness in humans; • functional blockade of aldosterone with either spironolactone or epelerenone by suppressing the production of macrophage chemokines (Schjoedt, Rossing et al. 2005; Sato, Saruta et al. 2006. Han, Kim et al. 2006); and

• immunosuppressants such as mycophenolate mofetil (abbr. MMF) (Allison and Eugui 2000; Romero, Rodriguez-Iturbe et al. 2000).

Although many available therapies can influence macrophage function, these lack specific macrophage targeting and are therefore either mild modulators of macrophage activity or, in the case of general immunosuppressants, treatments with potentially undesirable side-effects. Therapies that are highly selective for targeting the recruitment, proliferation, activation or survival of macrophages are more desirable for treating macrophage-mediated injury.

For example, targeted inhibition of the monocyte chemoattractant protein MCP-1 signaling can prevent glomerulosclerosis by blocking macrophage recruitment to glomeruli with type 1 or type 2 diabetes. In fact, the inventors have previously shown that MCP-1 may represent a promising therapeutic target in diabetic nephropathy because late onset of MCP-1 blockade with a MCP-1 inhibitor was able to prevent diabetic glomerulosclerosis and restored glomerular filtration rate (abbr. GFR) by preventing glomerular macrophage recruitment in late-stage diabetic nephropathy of uninephrectomized db/db mice with type 2 diabetes (Moser et al, 2006; WO 2009/068318). [ MCP-1 (monocyte chemoattractant protein- 1; alternative names or synonyms: MCAF [monocyte chemoattracting and activating factor]; CCL2; SMC- CF [smooth muscle cell-colony simulating factor]; HC-11; LDCF; GDCF; TSG-8; SCYA2; A2; SwissProt accession code, PI 3500) is a potent attractor of monocytes/macrophages, basophils, activated T cells, and NK cells.

Although structurally related, a subgroup of the chemokine superfamily, known as homeostatic chemokines, displays functions independent of tissue inflammation. Homeostatic chemokines are rather constitutively expressed as they contribute to the physiological homing and migration of immune cells in the bone marrow or lymphoid organs. For example, the inventors have recently shown that the blockade the homeostatic chemokine stromal cell- derived factor 1 (SDF-1) prevents diabetic glomerulosclerosis in a way which was independent of glomerular macrophage recruitment (Ninichuk et al., 2007; WO2009/019007). The mechanism underlying the protective effect of SDF-1 blockade on diabetic nephropathy remains unclear. Stromal-cell derived factor- 1 (abbr.: SDF-1; alternative names or synonyms: CXCL12; PBSF [pre-B-cell growth-stimulating factor]; TPAR 1 [TPA repressed gene 1]; SCYB12; TLSF [thymic lymphoma cell stimulating factor]; hIRH [human intercrine reduced in hepatomas]) is an angiogenic CXC chemokine that does not contain the ELR motif typical of the IL-8-like chemokines (Salcedo, Wasserman et al. 1999; Salcedo and Oppenheim 2003) but binds and activates the G-protein coupled receptor CXCR4. As a result of alternative splicing, there are two forms of SDF-1, SDF-1 a and SDF 1β, which, compared to SDF-1 a carries five additional residues at the C-terminus (Shirozu, Nakano et al. 1995). For instance, SDF-1 is required for homing and attachment of epithelial cells to neo vascular sites in the choroid portion of the retina and to maintain stem cells and progenitor cells, e.g. hematopoietic progenitor (usually CD34+) cells in the bone marrow of the adult.

The problem underlying the present invention is to provide a means which specifically interacts with MCP-1 and/or SDF-1, whereby the means are suitable for the prevention and/or treatment of diabetes, diabetic complications and diabetic conditions, respectively. More specifically, the problem underlying the present invention is to provide a first nucleic acid based means which specifically interacts with MCP-1 and/or a second nucleic acid based means which specifically interacts with SDF-1. A still further problem underlying the present invention is to provide a combination therapy that is suitable for the prevention and/or treatment of a diabetes, diabetic complications and diabetic conditions, respectively, whereby such combination therapy comprises one of a nucleic acid based means which specifically interacts with MCP-1 and/or a nucleic acid based means which specifically interacts with SDF-1.

These and other problems underlying the present invention are solved by the subject matter of the attached independent claims. Preferred embodiments may be taken from the dependent claims.

More specifically, the problem underlying the present invention is solved in a first aspect by a nucleic acid molecule capable of binding to MCP-1, preferably capable of inhibiting MCP-1, whereby the nucleic acid molecule is for use in a method for the treatment and/or prevention of a disease or disorder, or for use as a medicament for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication, diabetic condition, inflammatory joint disease, eye disease, asthma, autoimmune disease, neuroinflammatory disease, tissue disease, cardiovascular disease, renal disease, ischemia injury, reperfusion injury, lung disease, transplantation, gynecological disease and conditions with elevated MCP-1 level.

In an embodiment of the first aspect the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

In an embodiment of the first aspect the inflammatory joint disease is an inflammatory joint disease selected from the group of rheumatoid arthritis, osteoarthritis, psoriatic arthritis, gout, juvenile rheumatoid arthritis, and viral arthritides.

In an embodiment of the first aspect the eye disease is an eye disease selected from the group of uveitis, Eales' disease, branch retinal vein occlusion, vernal keratoconjunctivitis, photoreceptor death after surgery-induced retinal detachment, ocular Behcet's disease, retinitis pigmentosa and allergic conjunctivitis.

In an embodiment of the first aspect the asthma is an asthma selected from the group of atopic asthma and chronic bronchitis.

In an embodiment of the first aspect the autoimmune disease is an autoimmune disease selected from the group of systemic lupus erythematosus, ankylosing spondylitis, autoimmune orchitis, Lofgren's syndrome, Crohn's disease and autoimmune myocarditis. In an embodiment of the first aspect the neuroinflammatory disease is a neuroinflammatory disease selected from the group of multiple sclerosis, amyotrophic lateral sclerosis, neuropathic pain, Parkinson's disease, Alzheimer's disease and demyelinating disease.

In an embodiment of the first aspect the tissue disease is a tissue disease selected from the group of polymyositis, dermatomyositis, polymyalgia rheumatica, psoriasis, systemic sclerosis and atopic dermatitis.

In an embodiment of the first aspect the cardiovascular disease is a cardiovascular disease selected from the group of atherosclerosis, carotid atherosclerosis, peripheral arterial disease, coronary heart disease, restenosis, post-PTCA, premature atherosclerosis after Kawasaki disease, giant cell arteritis, idiopathic pulmonary hypertension, Takayasu's arteritis, Kawasaki disease, Wegener's granulomatosis, pulmonary granulomatous vasculitis, temporal arteritis, acute coronary syndrome, thrombosis, chronic hemodialysis, hypertrophic cardiomyopathy, cardiomyopathy in human Chagas' disease, myocardial infarction/ ichemic heart disease, chronic stable angina pectoris, nonfamilial idiopathic dilated cardiomyopathy, post-infarction ventricular remodeling, restenosis after balloon dilatation, in-stent restenosis, pulmonary arterial hypertension and cerebral aneurysm formation.

In an embodiment of the first aspect the renal disease is a renal disease selected from the group of glomerulonephritis, renal vasculitis, lupus nephritis, IgA nephropathy, chronic kidney disease, autosomal dominant polycystic kidney disease, renal fibrosis, tubulointerstitial nephritis and renal artery stenosis.

In an embodiment of the first aspect the ischemia injury and reperfusion injury is an ischemia injury and reperfusion injury selected from the group of myocardial infarction, acute cerebral ischemia, focal brain ischemia, cardiac ischemia, cardiac reperfusion, stroke injury after cerebral artery occlusion, ischemic fibrotic cardiomyopathy after repeated coronary ischemia or reperfusion, skin injury after cutaneous ischemia or reperfusion, retinal ischemia and retinal reperfusion.

In an embodiment of the first aspect the lung disease is a lung disease selected from the group of interstitial lung disease, chronic obstructive pulmonary disease, cystic fibrosis, idiopathic pulomnary fibrosis, chemical-induced pulmonary fibrosis, pulmonary sarcoidosis, pulmonary granulomatosis and granulomatous lung disease.

In an embodiment of the first aspect the transplantation is a transplantation selected from the group of transplantation of lung, transplantation of kidney, transplantation of heart, transplantation of islets, transplantation of cornea, transplantation of bone marrow and transplantation of stem cells.

In an embodiment of the first aspect the gynecological disease is a gynecological disease selected from the group of endometriosis andadenomyosis.

In an embodiment of the first aspect the condition with elevated MCP-1 level is a condition with elevated MCP-1 level selected from the group of sepsis, chronic liver disease, Peyronie's disease, acute spinal chord injury, myocarditis, HIV infection, HIV-associated dementia, hemophagic lymphohistiocytosis, HBV infection, HCV infection, meningitis, influenza A, CMV reactivation, pulmonary tuberculosis, irritable bowel disease, schizophrenia, mixed cryoglobulinemia, hepatitis C associated with autoimmune thyroiditis, musculosceletal trauma, acute liver failure, acute-on-chronic liver failure, intracranial hypertension, polycystic ovary syndrome, cerebral aneurysm, idiopathic inflammatory myopathies, periodontal disease, bladder inflammation, periprosthetic osteolysis of loosened total hip arthroplasty, pulmonary alveolar proteinosis, severe traumatic brain injury, pelvic inflammatory disease, benign prostatic hyperplasia, Tourette syndrome, primary biliary cirrhosis, HLA-B27 associated disease, major depressive disorder, pancreatitis, frontotemporal lobar degeneration, mood disorder, liver fibrosis, colitis, delayed-type hypersensitivity lesions, formation of foreign body giant cells after implantation of biomaterials and dermatitis.

In an embodiment of the first aspect the nucleic acid molecule is selected from the group comprising a type 2 MCP-1 binding nucleic acid molecule, a type 3 MCP-1 binding nucleic acid molecule, a type 4 MCP-1 binding nucleic acid molecule, a type 1A MCP-1 binding nucleic acid molecule, a type IB MCP-1 binding nucleic acid molecule and a type 5 MCP-1 binding nucleic acid molecule. In an embodiment of the first aspect the type 2 MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides, and a second terminal stretch of nucleotides, whereby

the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'X1X2GCA'3, whereby

XI is A or absent and X2 is C, or

XI is absent and X2 is C, the central stretch of nucleotides comprises a nucleotide sequence of 5' CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC '3 (SEQ ID NO: 114), and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'UGCX3X4'3, whereby

X3 is G and X4 is U or absent, or

X3 is G or absent and X4 is absent.

In a preferred embodiment of the first aspect the central stretch of nucleotides comprises a nucleotide sequence of 5' CGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUC '3 (SEQ ID NO: 115).

In a preferred embodiment of the first aspect a) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'ACGCA'3,

and

the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'UGCGU'3; or b) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'CGCA'3, and

the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'UGCG'3; or c) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'GCA'3, and

the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'UGC'3 or 5' UGCG'3.

In a preferred embodiment of the first aspect the type 2 MCP-1 binding nucleic acid comprises a nucleotide sequence according to any one of SEQ ID NO: 24 to SEQ ID NO: 32, and SEQ ID NO: 111, preferably any one of SEQ ID NO: 32 and SEQ ID NO: 111.

In an embodiment of the first aspect the type 3 MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides, a sixth central stretch of nucleotides, a seventh central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence which is selected from the group comprising 5'GURCUGC'3, 5'GKSYGC'3, 5'KBBSC'3 and 5'BNGC'3, the first central stretch of nucleotides comprises a nucleotide sequence of 5'GKMGU'3, the second central stretch of nucleotides comprises a nucleotide sequence of 5'KRRAR'3, the third central stretch of nucleotides comprises a nucleotide sequence of 5'ACKMC'3, the fourth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'CURYGA'3, 5'CUWAUGA'3, 5'CWRMGACW'3 and 5'UGCCAGUG'3, the fifth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'GGY'3 and 5'CWGC'3, the sixth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'YAGA'3, 5'CKAAU'3 and 5'CCUUUAU'3, the seventh central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'GCYR'3 and 5'GCWG'3, and the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the groupe comprising 5'GCAGCAC'3, 5'GCRSMC'3, 5'GSVVM'3 and 5'GCNV'3.

In a preferred embodiment of the first aspect the type 3 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence selected from the group comprising the nucleotide sequences according to any one of SEQ ID NO: 33 to SEQ ID NO: 68, preferably any one of SEQ ID NO: 42 to SEQ ID NO: 48, SEQ ID NO: 51 to SEQ ID NO: 56, SEQ ID NO: 62 to SEQ ID NO: 66 and SEQ ID NO: 68, more preferably any one of SEQ ID NO: 62 to SEQ ID NO: 66, and SEQ ID NO: 68.

In an embodiment of the first aspect the type 4 MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'AGCGUGDU'3, 5'GCGCGAG'3, 5'CSKSUU'3, 5'GUGUU'3, and 5'UGUU'3; the central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5 ' AGNDRDGBKGGURGYARGUAAAG' 3 (SEQ ID NO: 116),

5 ' AGGUGGGUGGU AGU AAGU AAAG' 3 (SEQ ID NO: 117) and 5 ' C AGGUGGGUGGUAGAAUGU AAAGA' 3 (SEQ ID NO: 118), and the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'GNCASGCU'3, 5'CUCGCGUC'3, 5'GRSMSG'3, 5'GRCAC'3, and 5'GGCA'3.

In a preferred embodiment of the first aspect the type 4 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 69 to SEQ ID NO: 81, preferably SEQ ID NO: 75 to SEQ ID NO: 76.

In an embodiment of the first aspect the type 1A MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'AGCRUG'3, the first central stretch of nucleotides comprises a nucleotide sequence of 5'CCCGGW'3, the second central stretch of nucleotides comprises a nucleotide sequence of 5'GUR'3, the third central stretch of nucleotides comprises a nucleotide sequence of 5'RYA'3, the fourth central stretch of nucleotides comprises a nucleotide sequence of 5 ' GGGGGRCGCGAYC ' 3 (SEQ ID NO: 119); the fifth central stretch of nucleotides comprises a nucleotide sequence of 5'UGCAAUAAUG'3 (SEQ ID NO: 288) or 5'URYAWUUG'3, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'CRYGCU'3.

In a preferred embodiment of the first aspect the type 1A MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 5 to SEQ ID NO: 16, preferably of SEQ ID NO: 16.

In an embodiment of the first aspect the type IB MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'AGYRUG'3, the first central stretch of nucleotides comprises a nucleotide sequence of 5'CCAGCU'3 or 5'CCAGY'3, the second central stretch of nucleotides comprises a nucleotide sequence of 5'GUG'3, the third central terminal of nucleotides comprises a nucleotide sequence of 5'AUG'3, the fourth central stretch of nucleotides comprises a nucleotide sequence of 5 ' GGGGGGCGCG ACC ' 3 (SEQ ID NO: 120), the fifth central stretch of nucleotides comprises a nucleotide sequence of 5'CAUUUUA'3 or 5'CAUUUA'3, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'CAYRCU'3. In a preferred embodiment of the first aspect the type IB MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 17 to SEQ ID NO: 23, preferably any one of SEQ ID NO: 22 and SEQ ID NO: 23.

In an embodiment of the first aspect the type 5 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 82 to SEQ ID NO: 110.

In an embodiment of the first aspect the MCP-1 is pyroglutamyl-MCP-1, human MCP-1 or human pyroglutamyl-MCP-1, whereby preferably the human MCP-1 has an amino acid sequence according to SEQ ID No. 1.

In an embodiment of the first aspect the the nucleic acid molecule is for use in a combination therapy for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby the combination therapy comprises the adminsitration of at least a first pharmaceutically active agent and at least a second pharmaceutically active agent, whereby the first pharmaceutically active agent is a nucleic acid molecule according to any embodiment of the first aspect, and whereby the second pharmaceutically active agent is a nucleic acid molecule capable of binding to SDF-1.

In a preferred embodiment of the first aspect the the diabetic complication or diabetic condition is diabetic nephropathy.

In a preferred embodiment of the first aspect the the combination therapy comprises the administration of the first pharmaceutically active agent and the second pharamceutically active agent to a patient suffering from or being at risk of suffering from the disease or disorder.

In an embodiment of the first aspect the first pharmaceutically active agent is administered prior, concommittantly or after the second pharmaceutically active agent. In an embodiment of the first aspect the the first pharmaceutically active agent and the second pharmaceutically active agent are administered as a single dosage unit.

In an embodiment of the first aspect the the first pharmaceutically active agent is administered as a first dosage unit and the second pharmaceutically active agent is administered as a second dosage unit or wherein the first pharmaceutically active agent is administered as a second dosage unit and the second pharmaceutically active agent is administered as a first dosage unit.

In a preferred embodiment of the first aspect the the nucleic acid molecule capable of binding to SDF-1 is selected from the group comprising a type B SDF-1 binding nucleic acid molecule, a type C SDF-1 binding nucleic acid molecule, a type A SDF-1 binding nucleic acid molecule and a type D SDF-1 binding nucleic acid molecule.

In a further preferred embodiment of the first aspect the the type B SDF-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' X1X2SVNS 3' the central stretch of nucleotides comprises a nucleotide sequence of 5' GUGUGAUCUAGAUGUADWGGCUGWUCCUAGUYAGG 3' (SEQ ID NO: 168). and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' BVBSX3X4 3', whereby

XI is either absent or is A, X2 is G, X3 is C and X4 is either absent or is U; or

XI is absent, X2 is either absent or is G, X3 is either absent or is C and X4 is absent. In a preferred embodiment of the first aspect the central stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises the following nucleotide sequence:

5' GUGUGAUCUAGAUGUADUGGCUGAUCCUAGUCAGG 3'(SEQ ID NO:

169).

In an embodiment of the first aspect the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X1X2CRWG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' KRYS X3X4 3', whereby XI is either absent or A, X2 is G, X3 is C and X4 is either absent or U.

In an embodiment of the first aspect the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X1X2CGUG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UACGX3X4 3', whereby XI is either absent or A, X2 is G, X3 is C, and X4 is either absent or U, preferably the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' AGCGUG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UACGCU 3'.

In an embodiment of the first aspect the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X1X2SSBS 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' BVSSX3 X4 3', whereby XI is absent, X2 is either absent or G, X3 is either absent or C, and X4 is absent, preferably the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCGUG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UACGC 3'.

In an embodiment of the first aspect the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 157 to SEQ ID NO: 167, SEQ ID NO: 170 to SEQ ID NO: 181, and SEQ ID NO: 230, preferably any one of SEQ ID NO: 157 to SEQ ID NO: 159, SEQ ID NO: 170, SEQ ID NO: 176, and SEQ ID NO: 230, more preferably any one of SEQ ID NO: 176 and SEQ ID NO: 230.

In an embodiment of the first aspect the type C SDF-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the central stretch of nucleotides comprises a nucleotide sequence of GGUYAGGGCUHRXAAGUCGG (SEQ ID NO: 193), whereby XA is either absent or is A.

In a preferred embodiment of the first aspect the central stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GGUYAGGGCUHRAAGUCGG 3' (SEQ ID NO: 194), 5' GGUYAGGGCUHRAGUCGG 3' (SEQ ID NO: 195) or 5' GGUUAGGGCUHGAAGUCGG 3' (SEQ ID NO: 196), preferably 5' GGUUAGGGCUHGAAGUCGG 3' (SEQ ID NO: 196).

In a further preferred embodiment of the first aspect the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' RKSBUSNVGR 3' (SEQ ID NO: 223) and the second stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YYNRCASSMY 3' (SEQ ID NO: 224), preferably the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' RKSBUGSVGR 3 '(SEQ ID NO: 225) and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YCNRCASSMY 3' (SEQ ID NO: 226).

In a still further preferred embodiment of the first aspect the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' XSSSSV 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' BSSSXS 3', whereby Xs is either absent or is S, preferably the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' SGGSR 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YSCCS 3'.

In a preferred embodiment of the first aspect a) the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCCGG 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CCGGC 3'; or

b) the first stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGUGCGCUUGAGAUAGG 3 '(SEQ ID NO: 434) and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CUGAUUCUCACG 3' (SEQ ID NO: 435); or

c) the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UGAGAUAGG 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule a nucleotide sequence of 5' CUGAUUCUCA 3' (SEQ ID NO: 436); or d) the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GAGAUAGG 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5 ' CUGAUUCUC 3 ' .

In a preferred embodiment of the first aspect 49 the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 182 to SEQ ID NO: 192, SEQ ID NO: 197 to SEQ ID NO: 222, and SEQ ID NO: 232, preferably SEQ ID NO: 182 to SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 197 to SEQ ID NO: 198, SEQ ID NO: 200 to SEQ ID NO: 207 and SEQ ID NO: 213 to SEQ ID NO: 222, more preferably SEQ ID NO: 198, SEQ ID NO: 207, SEQ ID NO: 213, SEQ ID NO: 214, SEQ ID NO: 220 and SEQ ID NO: 221.

In an embodiment of the first aspect the type A SDF-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the central stretch of nucleotides comprises a nucleotide sequence of 5'

AAAGYRACAHGUMAAXAUGAAAGGUARC 3' (SEQ ID NO: 136), whereby XA is either absent or is A.

In a preferred embodiment of the first aspect the central stretch of nucleotides of the type A

SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of

5 ' AAAG YRAC AHGUMAAUG AAAGGU ARC 3' (SEQ ID NO: 137), or

5' AAAGYRACAHGUMAAAUGAAAGGUARC 3'(SEQ ID NO: 138), or

5' AAAGYAACAHGUCAAUGAAAGGUARC 3'(SEQ ID NO: 139), preferably the central stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' AAAGYAACAHGUCAAUGAAAGGUARC 3' (SEQ ID NO:

139). In an embodiment of the first aspect the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprise a nucleotide sequence of 5' X1X2NNBV 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' BNBNX3X4 3' whereby XI is either absent or R, X2 is S, X3 is S and X4 is either absent or Y; or

XI is absent, X2 is either absent or S, X3 is either absent or S and X4 is absent.

In a preferred embodiment of the first aspect the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' RSHRYR 3' and the second stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YRYDSY 3', preferably the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCUGUG 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGCAGC 3'.

In a preferred embodiment of the first aspect the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X2BBBS 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' SBBVX3 3', whereby X2 is either absent or is S and X3 is either absent or is S; preferably the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CUGUG 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGCAG 3'; or the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCGUG 3 'and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGCGC 3'.

In a preferred embodiment of the first aspect the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 122 to SEQ ID NO: 135, SEQ ID NO: 140 to SEQ ID NO: 156, and SEQ ID NO: 231, preferably any one of SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 140, SEQ ID NO: 146, and SEQ ID NO: 231, more preferably any one of SEQ ID NO: 146 and SEQ ID NO: 231.

In an embodiment of the first aspect the type D SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 142 to SEQ ID NO: 143.

In an embodiment of the first aspect the SDF-1 is human SDF-1, whereby preferbaly the human SDF-1 has an amino acid sequence according to SEQ ID No. 3.

In an embodiment of the first aspect the nucleic acid molecule capable of binding MCP-1 comprises a modification, whereby the modification is preferably a high molecular weight moiety and/or whereby the modification preferably allows to modify the characteristics of the nucleic acid molecule in terms of residence time in the animal or human body, preferably the human body.

In an embodiment of the first aspect the nucleic acid molecule capable of binding MCP-1 and/or the nucleic acid molecule capable of binding to SDF-1 comprises a modification, whereby the modification is preferably a high molecular weight moiety and/or whereby the modification preferably allows to modify the characteristics of the nucleic acid molecule capable of binding to MCP-1 and/or the nucleic acid molecule capable of binding to SDF-1 in terms of residence time in the animal or human body, preferably the human body. In a preferred embodiment of the first aspect the modification is selected from the group comprising a HES moiety, a PEG moiety, biodegradable modifications and combinations thereof.

In a more embodiment of the first aspect 61 the modification is a PEG moiety consisting of a straight or branched PEG, whereby preferably the molecular weight of the straight or branched PEG is from about 20,000 to 120,000 Da, more preferably from about 30,000 to 80,000 Da and most preferably about 40,000 Da.

In an alternative preferred embodiment of the first aspect the modification is a HES moiety, whereby preferably the molecular weight of the HES moiety is from about 10,000 to 200,000 Da, more preferably from about 30,000 to 170.000 Da and most preferably about 150,000 Da.

In a further alternative embodiment of the first aspect the modification is attached to the nucleic acid via a linker, wherein preferably the linker is a biostable or biodegradable linker.

In a still further alternative embodiment of the first aspect the modification is attached to the nucleic acid at the 5 '-terminal nucleotide of the nucleic acid molecule and/or the 3 '-terminal nucleotide of the nucleic acid molecule and/or to a nucleotide of the nucleic acid molecule between the 5 '-terminal nucleotide of the nucleic acid molecule and the 3 '-terminal nucleotide of the nucleic acid molecule.

In an embodiment of the first aspect the nucleic acid molecule capable of binding to MCP-1 is an L-nucleic acid molecule.

In a embodiment of the first aspect the nucleic acid molecule capable of binding to SDF-1 is an L-nucleic acid molecule.

The problem underlying the present invention is more specifically also solved in a second aspect by a pharmaceutical composition comprising as a first pharmaceutically active agent a nucleic acid molecule capable of binding to MCP-1 as defined in any one of the embodiments of the first aspect and optionally a further constituent, whereby the further constituent is selected from the group comprising pharmaceutically acceptable excipients, pharmaceutically acceptable carriers and pharmaceutically active agents, and whereby the pharmaceutical composition is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication, diabetic condition and chronic obstructive pulmonary disease.

In an embodiment of the second aspect the further constituent is a pharmaceutically acceptable carrier.

In an embodiment of the second aspect the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

In an embodiment of the second aspect the pharmaceutical composition comprises a second pharmaceutically active agent, whereby the second pharmaceutically active agent is a nucleic acid capable of binding to SDF-1 as defined in any one of the embodiments of the first aspect and whereby the pharmaceutical composition is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein such disease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby preferably the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

In an embodiment of the second aspect the pharmaceutical composition comprises a further pharmaceutically active agent, whereby the further pharmaceutically active agent is selected from the group of sulfonylurea drugs, biguanides, alpha-glucosidase inhibitors, thiazolinediones, meglititinides, incretin mimetics and insulin, and whereby the pharmaceutical composition is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein the diease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby preferably the diabetic complication or the diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

The problem underlying the present invention is more specifically also solved in a third aspect by a medicament comprising one or several dosage units of at least a first pharmaceutically active agent, wherein the pharmaceutically active agent is a nucleic acid molecule capable of binding to MCP-1 as defined in any one of the embodiments of the first aspet.

In an embodiment of the third aspect the medicament comprises a second pharmaceutically active agent, preferably one or several dosage units of a second pharmaceutically active agent, whereby the second pharmaceutically active agent is a nucleic acid molecule capable of binding to SDF-1 as defined in any one of the embodiments of the first aspect. In an embodiment of the third aspect the medicament comprises a further pharmaceutical agent, preferably one or several dosage units of a further pharmaceutically active agent, whereby the further pharmaceutically active agent is selected from the group of sulfonylurea drugs, biguanides, alpha-glucosidase inhibitors, thiazolinediones, meglititinides, glucagon- like peptide analogs, gastric inhibitory peptide analogs, amylin analogs, incretin mimetics and insulin, and whereby the medicament is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein the diease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby preferably the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

In an embodiment of the third aspect the one or several dosage units of the first pharmaceutically active agent comprise the second pharmaceutically active agent.

In an embodiment of the third aspect he one or several dosage units of the first pharmaceutically active agent comprise the further pharmaceutically active agent.

In an embodiment of the third aspect the medicament comprises (a) one or several dosage units of the first pharmaceutically active agent, (b) one or several dosage units of the second pharmaceutically active agent and (c) one or several dosage units of the further pharmaceutically active agent, whereby the one or several dosage units of the first pharmaceutically active agent comprise the second pharmaceutically active agent, or the one or several dosage units of the first pharmaceutically active agent comprise the further pharmaceutically active agent, or the one or several dosage units of the second pharmaceutically active agent comprise the further pharmaceutically active agent, or the one or several dosage units of the first pharmaceutically active agent comprise the second pharmaceutically active agent and the further pharmaceutically active agent.

In an embodiment of the third aspect the one or several dosage units of the first pharmaceutically active agent, the one or several dosage units of the second pharmaceutically active agent and the one or several dosage units of the further pharmaceutically active agent are each separate dosage units.

The problem underlying the present invention is more specifically also solved in a fourth aspect by a method for the treatment of a subject suffering from or being at risk of developing diabetes, a diabetic complication, or a diabetic condition, whereby the method comprises administering to the subject a pharmaceutically effective amount of a nucleic acid molecule capable of binding to MCP-1 as defined in any one of the embodiments of the first aspect.

In an embodiment of the fourth aspect the the method further comprises administering to the subject a pharmaceutically effective amount of a nucleic acid capable of binding to SDF-1, whereby preferably the nucleic acid capable of binding to SDF-1 is as defined in any one of the embodiments of the first aspect.

In an embodiment of the fourth aspect the diabetic condition and the diabetic complication is a diabetic condition or a diabetic complication selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

The problem underlying the present invention is more specifically also solved in a fifth aspect by the use of a nucleic acid molecule as defined in any one of the embodiments of the first aspect, for the manufacture of a medicament for the treatment and/or prevention of diabetes, a diabetic condition, or a diabetic complication.

In an embodiment of the fifth aspect the diabetic condition and the diabetic complication is a diabetic condition or a diabetic complication selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

It will be understood by a person skilled in the art that the following embodiments and features may also be realized in connection with features and embodiments described herein, in particular in connection with the aspects and embodiments as subject to the claims attached hereto.

As outlined in more detail herein and, the present inventors identified a number of different MCP-1 binding nucleic acid molecules and SDF-1 binding nucleic acid molecules, whereby the nucleic acid molecules can be characterised in terms of stretches of nucleotide which are also referred to herein as Boxes. As experimentally shown in examples 9, 10 and 13 the inventors could surprisingly demonstrate that MCP-1 binding nucleic acid molecules, SDF-1 binding nucleic acid molecules or combinations thereof can be used for the treatment of diabetes, diabetic conditions and diabetic complications.

As has been outlined in the introductory part two types of diabetes, which are also referred to as diabetes mellitus, are distinguished: Type 1 diabetes mellitus (abbr. DM1) and Type 2 diabetes mellitus (abbr. DM2). Both types of diabetes are encompasses by the present invention. In the case of Type 1 diabetes mellitus (abbr. DM1) the insulin producing and secreting beta-cells in the pancreatic islets of Langerhans are destroyed because of an autoimmune reaction of the body. Because of this, DM1 was previously referred to as 'insulin- dependent DM' or 'IDDM'. DM1 may occur already at young age and is believed to be predominantly determined by the genetic background of the patient (Cnop, Welsh et al. 2005). Type 2 diabetes mellitus (abbr. DM2), previously also referred to as 'non-insulin-dependent DM' or 'NIDDM', is much more common and accounts for around 90% of all diabetes cases worldwide. It occurs most frequently in adults, but is being noted increasingly in adolescents as well. DM2 occurs when the body, notably muscle and liver cells, does not respond correctly to insulin (referred to as insulin resistance), which initially is available even at elevated concentrations (to compensate for its reduced activity) (Stumvoll, Goldstein et al. 2005). According to the present invention, the preferred embodiments of diabetes are type 1 diabetes mellitus (abbr. DM1) and Type 2 diabetes mellitus (abbr. DM2). Preferred embodiments of diabetic conditions and diabetic complications are described in the following.

Human as well as murine MCP-1 having the amino acid sequence according to SEQ. ID. Nos. 1 and 2, respectively. MCP-1 is highly specific in its receptor usage, binding only to the chemokine receptor CCR2 with high affinity. Like all chemokine receptors, CCR2 is a G- protein-coupled receptor (abbr. GPCR) (Dawson et al, 2003). The amino terminus of naturally occuring MCP-1 is blocked by a pyroglutamyl residue. However, both forms of MCP-1, with either free amino terminus or pyroglutamyl amino terminus are active in terms of CCR2 receptor activation. As shown in Example 11 the MCP-1 binding nucleic acid molecules according to the present invention bind to MCP-1 comprising or not comprsing such a pyroglutamyl residue.

As a result of alternative splicing, there are two forms of SDF-1, SDF-Ια and SDF 1β having the amino acid sequence according to SEQ. ID. Nos. 3 and 4, respectively. The MCP-1 binding nucleic acid molecules and SDF-1 binding nucleic acid molecules of the present invention can be characterised in terms of stretches of nucleotides which are also referred to herein as boxes. The different types of MCP-1 binding nucleic acids molecules and SDF-1 binding nucleic acid molecules comprise different stretches of nucleotides. In general, MCP-1 binding nucleic acids molecules and SDF-1 binding nucleic acid molecules of the present invention comprise at their 5 '-end and the 3 '-end terminal stretches of nucleotides: the first terminal stretch of nucleotides and the second terminal stretch of nucleotides (also referred to as 5 '-terminal stretch of nucleotides and 3 '-terminal stretch of nucleotides). The first terminal stretch of nucleotides and the second terminal stretch of nucleotides can, in principle due to their base complementarity, hybridize to each other, whereby upon hybridization a double-stranded structure is formed. However, such hybridization is not necessarily realized in the molecule under physiological and/or non-physiological conditions. The three stretches of nucleotides of MCP-1 binding nucleic acids molecules and SDF-1 binding nucleic acid molecules - the first terminal stretch of nucleotides, the central stretch of nucleotides and second terminal stretch of nucleotides - are arranged to each other in 5' - 3'- direction: the first terminal stretch of nucleotides - the central stretch of nucleotides - the second terminal stretch of nucleotides. However, alternatively, the second terminal stretch of nucleotides, the central stretch of nucleotides and the terminal first stretch of nucleotides are arranged to each other in 5' 3 '-direction.

The differences in the sequences of the defined boxes or stretches between the different MCP- 1 binding nucleic acid molecules and SDF-1 binding nucleic acid molecules influences the binding affinity to MCP-1 and SDF-1, respectively. Based on binding analysis of the different MCP-1 binding nucleic acids molecules and SDF-1 binding nucleic acid molecules of the present invention, the central stretch and its nucleotide sequence are individually and more preferably in their entirety essential for binding to human MCP-1 and SDF-1.

The central stretch of nucleotides can comprise up to seven substretches such as a first central stretch, a second central stretch, a third central stretch, a fourh stretch, a fifth stretch, a sixth stretch and a seventh stretch. The terms 'stretch' and 'stretch of nucleotide' are used herein in a synonymous manner if not indicated to the contrary.

It is within the present invention that the nucleic acid according to the present invention is a nucleic acid molecule. Insofar the terms nucleic acid and nucleic acid molecule are used herein in a synonymous manner if not indicated to the contrary.

It is within the present invention that the nucleic acids according to the present invention comprise two or more stretches or part(s) thereof can, in principle, hybridise with each other. Upon such hybridisation a double-stranded structure is formed. It will be acknowledged by the ones skilled in the art that such hybridisation may or may not occur, particularly under in vitro and/or in vivo conditions. Also, in case of such hybridisation, it is not necessarily the case that the hybridisation occurs over the entire length of the two stretches where, at least based on the rules for base pairing, such hybridisation and thus formation of a double- stranded structure may, in principle, occur. As preferably used herein, a double-stranded structure is a part of a nucleic acid molecule or a structure formed by two or more separate strands or two spatially separated stretches of a single strand of a nucleic acid molecule, whereby at least one, preferably two or more base pairs exist which are base pairing preferably in accordance with the Watson-Crick base pairing rules. It will also be acknowledged by the one skilled in the art that other base pairing such as Hoogsten base pairing may exist in or form such double-stranded structure. It is also to be acknowledged that the feature that two stretches hybridize preferably indicates that such hybridization is assumed to happen due to base complementarity of the two stretches.

In a preferred embodiment the term arrangement as used herein, means the order or sequence of structural or functional features or elements described herein in connection with the nucleic acids disclosed herein.

It will be acknowledged by the person skilled in the art that the nucleic acids according to the present invention are capable of binding to MCP-1 and SDF-1, respectively. Without wishing to be bound by any theory, the present inventors assume that the MCP-1 or SDF-1 binding results from a combination of three-dimensional structural traits or elements of the claimed nucleic acid molecule, which are caused by orientation and folding patterns of the primary sequence of nucleotides forming such traits or elements, whereby preferably such traits or elements are the first terminal stretch of nucleotides, the central stretch of nucleotides and the second terminal stretch of nucleotides of the MCP-1 binding nucleic acid molecules and SDF- 1 binding nucleic acid molcules. It is evident that the individual trait or element may be formed by various different individual sequences the degree of variation of which may vary depending on the three-dimensional structure such element or trait has to form. The overall binding characteristic of the claimed nucleic acid results from the interplay of the various elements and traits, respectively, which ultimately results in the interaction of the claimed nucleic acid with its target, i. e. MCP-1 or SDF-1. Again without being wished to be bound by any theory, the central stretch of nucleotides that is characteristic for MCP-1 binding nucleic acids and SDF-1 binding nucleic acids seems to be important for mediating the binding of the claimed nucleic acid molecules with MCP-1 and SDF-1, respectively. Accordingly, the nucleic acids according to the present invention are suitable for the interaction with MCP-1 and SDF-1, respectively. Also, it will be acknowledged by the person skilled in the art that the nucleic acids according to the present invention are antagonists to MCP-1 and SDF-1, respectively. Because of this the nucleic acids according to the present invention are suitable for the treatment and prevention, respecticely, of any disease or condition which is associated with or caused by MCP-1 ans SDF-1, respectively. Such diseases and conditions may be taken from the prior art which establishes that MCP-1 and SDF-1, respectively, is involved or associated with said diseases and conditions, respectively, and which is incorporated herein by reference providing the scientific rationale for the therapeutic use of the nucleic acids according to the invention.

The nucleic acids according to the present invention shall also comprise nucleic acids which are essentially homologous to the particular sequences disclosed herein. The term substantially homologous shall preferably be understood such that the homology is at least 75%, preferably 85%, more preferably 90% and most preferably more than 95 %, 96 %, 97 %, 98 % or 99%.

The actual percentage of homologous nucleotides present in the nucleic acid molecule according to the present invention relative to a reference nucleotide sequence or reference nucleic acid molecule according to the present invention will depend on the total number of nucleotides present in the nucleic acid molecule. The percent modification can be based upon the total number of nucleotides present in the nucleic acid molecule. Preferably, the homologous nucleotides of the nucleic acid molecule of the present invention are selected from the group comprising ribonucleotides and 2'-deoxyribonucleotides.

The homology between two nucleic acid molecules can be determined as known to the person skilled in the art. More specifically, a sequence comparison algorithm may be used for calculating the percent sequence homology for the test sequence(s) relative to the reference sequence, based on the designated program parameters. The test sequence is preferably the sequence or nucleic acid molecule which is said to be homologous or to be tested whether it is homologous, and if so, to what extent, to a different nucleic acid molecule, whereby such different nucleic acid molecule is also referred to as the reference sequence. In an embodiment, the reference sequence is a nucleic acid molecule as described herein, preferably a nucleic acid molecule having a sequence according to any one of SEQ ID NO: 32, SEQ ID NO: 111, SEQ ID NO: 62 to SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 16, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 176, SEQ ID NO: 230, SEQ ID NO: 198, SEQ ID NO: 207, SEQ ID NO: 213, SEQ ID NO: 214, SEQ ID NO: 220, SEQ ID NO: 221, SEQ ID NO: 146 and SEQ ID NO: 231. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman (Smith & Waterman, 1981) by the homology alignment algorithm of Needleman & Wunsch (Needleman & Wunsch, 1970) by the search for similarity method of Pearson & Lipman (Pearson & Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection.

One example of an algorithm that is suitable for determining percent sequence identity is the algorithm used in the basic local alignment search tool (hereinafter "BLAST "), see, e.g. Altschul et al (Altschul et al., 1990; and Altschul et al, 1997). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (hereinafter "NCBI"). The default parameters used in determining sequence identity using the software available from NCBI, e.g., BLASTN (for nucleotide sequences) and BLASTP (for amino acid sequences) are described in McGinnis et al (McGinnis et al., 2004). The term inventive nucleic acid or nucleic acid according to the present invention shall also comprise those nucleic acids comprising the nucleic acid sequences disclosed herein or part thereof, preferably to the extent that the nucleic acids or said parts are involved in the binding to MCP-1 or SDF-1.

The nucleic acids according to the present invention shall also comprise nucleic acids which have a certain degree of identity relative to the nucleic acids disclosed herein and defined by their nucleotide sequence. More preferably, the instant invention also comprises those nucleic acid molecules which have an identity of at least 75%, preferably 85%, more preferably 90% and most preferably more than 95 %, 96 %, 97 %, 98 % or 99% relative to the nucleic acids disclosed herein and defined by their nucleotide sequence or a part thereof.

The term inventive nucleic acid as preferably used herein, shall also comprise in an embodiment a nucleic acid which is suitable to bind MCP-1 and to any molecule selected from the group comprising MCP-2, MCP-3, MCP-4, and eotaxin. It will be acknowledged by the ones skilled in the art that the individual nucleic acids according to the present invention will bind to one or several of such molecules.

In an embodiment, one of the nucleic acid molecules described herein, or a derivative and/ or a metabolite thereof is truncated, whereby such derivative and/ or metabolite are preferably a truncated nucleic acid compared to the nucleic acid molecules described herein.. Truncation may be related to either or both of the ends of the nucleic acids as disclosed herein. Also, truncation may be related to the inner sequence of nucleotides of the nucleic acid, i.e. it may be related to the nucleotide(s) between the 5' and the 3' terminal nucleotide, respectively. Moreover, truncation shall comprise the deletion of as little as a single nucleotide from the sequence of the nucleic acids disclosed herein. Truncation may also be related to more than one stretch of the inventive nucleic acid(s), whereby the stretch can be as little as one nucleotide long. The binding of a nucleic acid according to the present invention, preferably to a molecule selected from the group comprising MCP-1, MCP-2, MCP-3, MCP-4 and eotaxin, and, respectively, SDF-1, can be determined by the ones skilled in the art using routine experiments or by using or adopting a method as described herein, preferably as described herein in the example part. It is within an embodiment of the present invention, unless explicitly indicated to the contrary, that whenever it is referred herein to the binding of the nucleic acids according to the present invention to or with MCP-1, this applies also to the binding of the nucleic acids according to the present invention to or with any molecule selected from the group comprising MCP-2, MCP-3, MCP-4 and eotaxin.

The nucleic acids according to the present invention may be either D-nucleic acids or L- nucleic acids. Preferably, the inventive nucleic acids are L-nucleic acids. In addition it is possible that one or several parts of the nucleic acid are present as D-nucleic acids or at least one or several parts of the nucleic acids are L-nucleic acids. The term "part" of the nucleic acids shall mean as little as one nucleotide. Therefore, in a particularly preferred embodiment, the nucleic acids according to the present invention consist of L-nucleotides and comprise at least one D-nucleotide. Such D-nucleotide is preferably attached to a part different from the stretches defining the nucleic acids according to the present invention, preferably those parts thereof, where an interaction with other parts of the nucleic acid or with the target, i.e. MCP-1 and SDF-1, respectively, is involved. Preferably, such D-nucleotide is attached at a terminus of any of the stretches or at a terminus of any nucleic acid according to the present invention, respectively. In a further preferred embodiment, such D-nucleotides may act as a spacer or a linker, preferably attaching modifications or modification groups, such as PEG and HES to the nucleic acids according to the present invention.

It is also within an embodiment of the present invention that each and any of the nucleic acid molecules described herein in their entirety in terms of their nucleic acid sequence(s) are limited to the particular nucleotide sequence(s). In other words, the terms "comprising" or "comprise(s)" shall be interpreted in such embodiment in the meaning of containing or consisting of.

It is also within the present invention that the nucleic acids according to the present invention are part of a longer nucleic acid whereby this longer nucleic acid comprises several parts whereby at least one such part is a nucleic acid according to the present invention, or a part thereof. The other part(s) of these longer nucleic acids can be either one or several D-nucleic acid(s) or one or several L-nucleic acid(s). Any combination may be used in connection with the present invention. These other part(s) of the longer nucleic acid either alone or taken together, either in their entirety or in a particular combination, can exhibit a function which is different from binding, preferably from binding to MCP-1 and SDF-1, respectively. One possible function is to allow interaction with other molecules, whereby such other molecules preferably are different from MCP-1 and SDF-1, respectively, such as, e.g., for immobilization, cross-linking, detection or amplification. In a further embodiment of the present invention the nucleic acids according to the invention comprise, as individual or combined moieties, several of the nucleic acids of the present invention. Such nucleic acid comprising several of the nucleic acids of the present invention is also encompassed by the term longer nucleic acid.

L-nucleic acids or L-nucleic acid molecules as used herein are nucleic acids or nucleic acid molecules consisting of L-nucleotides, preferably consisting completely of L-nucleotides.

D-nucleic acids or D-nucleic acid molecules as used herein are nucleic acids or nucleic acid molecules consisting of D-nucleotides, preferably consisting completely of D-nucleotides.

Also, if not indicated to the contrary, any nucleotide sequence is set forth herein in 5'— > 3' direction.

As preferably used herein any position of a nucleotide is determined or referred to relative to the 5' end of a sequence, a stretch or a substretch. Accordingly, a second nucleotide is the second nucleotide counted from the 5' end of the sequence, stretch and substretch, respectively. Also, in accordance therewith, a penultimate nucleotide is the seond nucleotide counted from the 3' end of a sequence, stretch and substretch, respectively.

Irrespective of whether the inventive nucleic acid consists of D-nucleotides, L-nucleotides or a combination of both with the combination being e.g. a random combination or a defined sequence of stretches consisting of at least one L-nucleotide and at least one D-nucleic acid, the nucleic acid may consist of desoxyribonucleotide(s), ribonucleotide(s) or combinations thereof.

Designing the inventive nucleic acids as L-nucleic acids is advantageous for several reasons. L-nucleic acids are enantiomers of naturally occurring nucleic acids. D-nucleic acids, however, are not very stable in aqueous solutions and particularly in biological systems or biological samples due to the widespread presence of nucleases. Naturally occurring nucleases, particularly nucleases from animal cells are not capable of degrading L-nucleic acids. Because of this the biological half-life of the L-nucleic acid is significantly increased in such a system, including the animal and human body. Due to the lacking degradability of L- nucleic acids no nuclease degradation products are generated and thus no side effects arising therefrom observed. This aspect delimits the L-nucleic acids of factually all other compounds which are used in the therapy of diseases and/or disorders involving the presence of MCP-1 and SDF-1, respectively. L-nucleic acids which specifically bind to a target molecule through a mechanism different from Watson Crick base pairing, or aptamers which consists partially or completely of L-nucleotides, particularly with those parts of the aptamer being involved in the binding of the aptamer to the target molecule, are also called Spiegelmers. Aptamers as such are known to a person skilled in the art and are, among others, described in 'The Aptamer Handbook' (eds. Klussmann, 2006).

It is also within the present invention that the nucleic acids according to the invention, regardless whether they are present as D-nucleic acids, L-nucleic acids or D, L-nucleic acids or whether they are DNA or RNA, may be present as single-stranded or double-stranded nucleic acids. Typically, the inventive nucleic acids are single-stranded nucleic acids which exhibit defined secondary structures due to the primary sequence and may thus also form tertiary structures. The inventive nucleic acids, however, may also be double-stranded in the meaning that two strands regardless whether they are two separate strands or whether they are bound, preferably covalently, to each other, which are complementary or partially complementary to each other are hybridised to each other.

The inventive nucleic acids may be modified. Such modifications may be related to a single nucleotide of the nucleic acid and are well known in the art. Examples for such modification are described in, among others, Venkatesan (2003); Kusser (2000); Aurup (1994); Eaton (1995); Green (1995); Kawasaki (1993); Lesnik (1993); and Miller (1993). Such modification can be a H atom, a F atom or 0-CH3 group or NH2-group at the 2' position of an individual nucleotide which is part of the nucleic acid of the present invention. Also, the nucleic acid according to the present invention can comprises at least one LNA nucleotide. In an embodiment the nucleic acid according to the present invention consists of LNA nucleotides. In an embodiment, the nucleic acids according to the present invention may be a multipartite nucleic acid. A multipartite nucleic acid as used herein, is a nucleic acid which consists of at least two separate nucleic acid strands. These at least two nucleic acid strands form a functional unit whereby the functional unit is a ligand to a target molecule. The at least two nucleic acid strands may be derived from any of the inventive nucleic acids by either cleaving the nucleic acid molecule to generate two strands or by synthesising one nucleic acid corresponding to a first part of the inventive, i.e. overall nucleic acid and another nucleic acid corresponding to the second part of the overall nucleic acid. It is to be acknowledged that both the cleavage and the synthesis may be applied to generate a multipartite nucleic acid where there are more than two strands as exemplified above. In other words, the at least two separate nucleic acid strands are typically different from two strands being complementary and hybridising to each other although a certain extent of complementarity between said at least two separate nucleic acid strands may exist and whereby such complementarity may result in the hybridisation of said separate strands.

Finally it is also within the present invention that a fully closed, i.e. circular structure for the nucleic acids according to the present invention is realized, i.e. that the nucleic acids according to the present invention are closed in an embodiment, preferably through a covalent linkage, whereby more preferably such covalent linkage is made between the 5' end and the 3' end of the nucleic acid sequences as disclosed herein or any derivative thereof.

A possibility to determine the binding constants of the nucleic acid molecules according to the present invention is the use of the methods as described in example 5 and 8 which confirms the above finding that the nucleic acids according to the present invention exhibit a favourable KD value range. An appropriate measure in order to express the intensity of the binding between the individual nucleic acid molecule and the target which is in the present case MCP- 1 and SDF-1, respectively, is the so-called KD value which as such as well the method for its determination are known to the one skilled in the art.

Preferably, the KD value shown by the nucleic acids according to the present invention is below 1 μΜ. A KD value of about 1 μΜ is said to be characteristic for a non-specific binding of a nucleic acid to a target. As will be acknowledged by the ones skilled in the art, the KD value of a group of compounds such as the nucleic acids according to the present invention is within a certain range. The above-mentioned K_D of about 1 μΜ is a preferred upper limit for the K_D value. The lower limit for the K_D of target binding nucleic acids can be as little as about 10 picomolar or can be higher. It is within the present invention that the KD values of individual nucleic acids binding to MCP-1 and SDF-1, respectively, is preferably within this range. Preferred ranges can be defined by choosing any first number within this range and any second number within this range. Preferred upper K_D values are 250 nM and 100 nM, preferred lower K_D values are 50 nM, 10 nM, 1 nM, 100 pM and 10 pM. The more preferred upper KD value is 2.5 nM, the more preferred lower K_D value is 100 pM.

In addition to the binding properties of the nucleic acid molecules according to the present invention, the nucleic acid molecules according to the present invention inhibit the function of the respective target molecule which is in the present case MCP-1 and SDF-1, respectively. The inhibition of the function of MCP-1 and SDF-1, respectively, - for instance the stimulation of the respective receptors as described previously - is achieved by binding of nucleic acid molecules according to the present invention to MCP-1 and SDF-1, respectively, and forming a complex of a nucleic acid molecule according to the present invention and MCP-1 and SDF-1, respectively. Such complex of a nucleic acid molecule and either MCP-1 or SDF-1 cannot stimulate the receptors that normally are stimulated by MCP-1 and SDF-1, respectively. Accordingly, the inhibition of receptor function by nucleic acid molecules according to the present invention is independent from the respective receptor that can be stimulated by MCP-1 and SDF-1, respectively, but results from preventing the stimulation of the receptor by MCP-1 and SDF-1, repectively, by the nucleic acid molecules according to the present invention.

A possibility to determine the inhibitory constant of the nucleic acid molecules according to the present invention is the use of the methods as described in example 6 and 7 which confirms the above finding that the nucleic acids according to the present invention exhibit a favourable inhibitory constant which allows the use of said nucleic acids in a therapeutic treatment scheme. An appropriate measure in order to express the intensity of the inhibitory effect of the individual nucleic acid molecule on interaction of the target which is in the present case MCP-1 and SDF-1, respectively, and the respective receptor, is the so-called half maximal inhibitory concentration (abbr. IC₅₀) which as such as well the method for its determination are known to the one skilled in the art. Preferably, the IC₅₀ value shown by the nucleic acid molecules according to the present invention is below 1 μΜ. An IC₅₀ value of about 1 μΜ is said to be characteristic for a nonspecific inhibition of target functions by a nucleic acid molecule. As will be acknowledged by the ones skilled in the art, the IC₅₀ value of a group of compounds such as the nucleic acid molecules according to the present invention is within a certain range. The above-mentioned IC50 of about 1 μΜ is a preferred upper limit for the IC₅₀ value. The lower limit for the IC50 of target binding nucleic acid molecules can be as little as about 10 picomolar or can be higher. It is within the present invention that the IC₅₀ values of individual nucleic acids binding to MCP-1 and SDF-1, respectively, is preferably within this range. Preferred ranges can be defined by choosing any first number within this range and any second number within this range. Preferred upper IC₅₀ values are 250 nM and 100 nM, preferred lower IC₅₀ values are 50 nM, 10 nM, 1 nM, 100 pM and 10 pM. The more preferred upper IC₅₀ value is 2.5 nM, the more preferred lower IC₅₀ value is 100 pM.

The nucleic acid molecules according to the present invention may have any length provided that they are still able to bind to the target molecule. It will be acknowledged by a person skilled in the art that there are preferred lengths for the nucleic acids according to the present inventions. Typically, the length is between 15 and 120 nucleotides. It will be acknowledged by the ones skilled in the art that any integer between 15 and 120 is a possible length for the nucleic acids according to the present invention. More preferred ranges for the length of the nucleic acids according to the present invention are lengths of about 20 to 100 nucleotides, about 20 to 80 nucleotides, about 20 to 60 nucleotides, about 20 to 50 nucleotides and about 30 to 50 nucleotides.

It is within the present invention that the nucleic acids disclosed herein comprise a moiety which preferably is a high molecular weight moiety and/or which preferably allows to modify the characteristics of the nucleic acid in terms of, among others, residence time in an animal body, preferably a human body. A particularly preferred embodiment of such modification is PEGylation and HESylation of the nucleic acids according to the present invention. As used herein PEG stands for poly(ethylene glycole) and HES for hydroxyethly starch. PEGylation as preferably used herein is the modification of a nucleic acid according to the present invention whereby such modification consists of a PEG moiety which is attached to a nucleic acid according to the present invention. HESylation as preferably used herein is the modification of a nucleic acid according to the present invention whereby such modification consists of a HES moiety which is attached to a nucleic acid according to the present invention. The modifications such as linear poly (ethylene) glycol, branched poly (ethylene) glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate, poly (2-hydroxyethyl)-L-glutamine and polyethylene glycol as well as the process of modifying a nucleic acid using such modifications, are described in the European patent application EP 1 306 382, the disclosure of which is herewith incorporated in its entirety by reference.

In the case of PEG being such high molecular weight moiety the molecular weight is preferably about 20,000 to about 120,000 Da, more preferably from about 30,000 to about 80,000 Da and most preferably about 40,000 Da. In the case of HES being such high molecular weight moiety the molecular weight is is preferably from about 50 to about 1000 kDa, more preferably from about 100 to about 700 kDa and most preferably from 200 to 500 kDa. HES exhibits a molar substitution of 0.1 to 1.5, more preferably of 1 to 1.5 and exhibits a substitution sample expressed as the C2/C6 ratio of approximately 0.1 to 15, preferably of approximately 3 to 10. The process of HES modification is, e.g., described in German patent application DE 1 2004 006 249.8 the disclosure of which is herewith incorporated in its entirety by reference.

The modification can, in principle, be made to the nucleic acid molecules of the present invention at any position thereof. Preferably such modification is made either to the 5' - terminal nucleotide, the 3 '-terminal nucleotide and/or any nucleotide between the 5' nucleotide and the 3' nucleotide of the nucleic acid molecule.

The modification and preferably the PEG and/or HES moiety can be attached to the nucleic acid molecule of the present invention either directly or indirectly, preferably through a linker. It is also within the present invention that the nucleic acid molecule according to the present invention comprises one or more modifications, preferably one or more PEG and/or HES moiety. In an embodiment the individual linker molecule attaches more than one PEG moiety or HES moiety to a nucleic acid molecule according to the present invention. The linker used in connection with the present invention can itself be either linear or branched. This kind of linkers are known to the ones skilled in the art and are further described in patent applications WO2005/074993 and WO2003/035665.

In a preferred embodiment the linker is a biodegradable linker. The biodegradable linker allows to modify the characteristics of the nucleic acid according to the present invention in terms of, among other, residence time in an animal body, preferably in a human body, due to release of the modification from the nucleic acid according to the present invention. Usage of a biodegradable linker may allow a better control of the residence time of the nucleic acid according to the present invention. A preferred embodiment of such biodegradable linker is a biodegradable linker as described in, but not limited to, international patent applications WO2006/052790, WO2008/034122, WO2004/092191 and WO2005/099768.

It is within the present invention that the modification or modification group is a biodegradable modification, whereby the biodegradable modification can be attached to the nucleic acid molecule of the present invention either directly or indirectly, preferably through a linker. The biodegradable modification allows to modify the characteristics of the nucleic acid according to the present invention in terms of, among other, residence time in an animal body, preferably in a human body, due to release or degradation of the modification from the nucleic acid according to the present invention. Usage of biodegradable modification may allow a better control of the residence time of the nucleic acid according to the present invention. A preferred embodiment of such biodegradable modification is biodegradable as described in, but not restricted to, international patent applications WO2002/065963, WO2003/070823, WO2004/113394 and WO2000/41647, preferably in WO2000/41647, page 18, line 4 to 24.

Beside the modifications as described above, other modifications can be used to modify the characteristics of the nucleic acids according to the present invention, whereby such other modifications may be selected from the group of proteins, lipids such as cholesterol and sugar chains such as amylase, dextran etc..

Without wishing to be bound by any theory, it seems that by modifying the nucleic acids according to the present invention with high molecular weight moiety such as a polymer and more particularly one or several of the polymers disclosed herein, which are preferably physiologically acceptable, the excretion kinetic is changed. More particularly, it seems that due to the increased molecular weight of such modified inventive nucleic acids and due to the nucleic acids of the invention not being subject to metabolism particularly when in the L form, excretion from an animal body, preferably from a mammalian body and more preferably from a human body is decreased. As excretion typically occurs via the kidneys, the present inventors assume that the glomerular filtration rate of the thus modified nucleic acids is significantly reduced compared to the nucleic acids not having this kind of high molecular weight modification which results in an increase in the residence time in the animal body. In connection therewith it is particularly noteworthy that, despite such high molecular weight modification the specificity of the nucleic acids according to the present invention is not affected in a detrimental manner. Insofar, the nucleic acids according to the present invention have among others, the surprising characteristic - which normally cannot be expected from pharmaceutically active compounds - such that a pharmaceutical formulation providing for a sustained release is not necessarily required to provide for a sustained release of the nucleic acids according to the present invention. Rather the nucleic acids according to the present invention in their modified form comprising a high molecular weight moiety, can as such already be used as a sustained release-formulation as they act, due to their modification, already as if they were released from a sustained-release formulation. Insofar, the modification(s) of the nucleic acid molecules according to the present invention as disclosed herein and the thus modified nucleic acid molecules according to the present invention and any composition comprising the same may provide for a distinct, preferably controlled pharmacokinetics and biodistribution thereof. This also includes residence time in circulation and distribution to tissues. Such modifications are further described in the patent application WO2003/035665.

However, it is also within the present invention that the nucleic acids according to the present invention do not comprise any modification and particularly no high molecular weight modification such as PEGylation or HESylation. Such embodiment is particularly preferred when the nucleic acid according to the present invention shows preferential distribution to any target organ or tissue in the body or when a fast clearance of the nucleic acid according to the present invention from the body after administration is desired. Nucleic acids according to the present invention as disclosed herein with a preferential distribution profile to any target organ or tissue in the body would allow establishment of effective local concentrations in the target tissue while keeping systemic concentration of the nucleic acids low. This would allow the use of low doses which is not only beneficial from an economic point of view, but also reduces unnecessary exposure of other tissues to the nucleic acid agent, thus reducing the potential risk of side effects. Fast clearance of the nucleic acids according to the present invention from the body after administration might be desired, among others, in case of in vivo imaging or specific therapeutic dosing requirements using the nucleic acids according to the present invention or medicaments comprising the same.

The nucleic acids according to the present invention, and/or the antagonists according to the present invention may be used for the generation or manufacture of a medicament. Such medicament or a pharmaceutical composition according to the present invention contains at least one of the inventive nucleic acids selected from the group of MCP-1 binding nucleic acids and of SDF-1 binding nucleic acids, preferably a combination of a MCP-1 binding nucleic acid and a SDF-1 binding nucleic acid, optionally together with further pharmaceutically active compounds, whereby the inventive nucleic acid preferably acts as pharmaceutically active compound itself. Such medicaments comprise in preferred embodiments at least a pharmaceutically acceptable carrier. Such carrier may be, e.g., water, buffer, PBS, glucose solution, preferably a 5% glucose salt balanced solution, starch, sugar, gelatine or any other acceptable carrier substance. Such carriers are generally known to the one skilled in the art. It will be acknowledged by the person skilled in the art that any embodiments, use and aspects of or related to the medicament of the present invention is also applicable to the pharmaceutical composition of the present invention and vice versa.

The indication, diseases and disorders for the treatment and/or prevention of which the nucleic acids, the pharmaceutical compositions and medicaments in accordance with or prepared in accordance with the present invention result from the involvement, either direct or indirect, of MCP-1 and/or SDF-1, and a combination of MCP-1 and SDF-1 in particular, in the respective pathogenetic mechanism. More specifically, such uses arise, among others, from the expression pattern of MCP-1 and/or SDF-1 which suggests that it plays important roles in human diseases that are characterized by mononuclear cell infiltration. Such cell infiltration is present in many inflammatory and autoimmune diseases, but also in diabetes,several diabetic conditions and diabetic complications such as nephropathy, preferably diabetic nephropathy, insulin resistance, metabolic syndrome, non-alcoholic fatty liver disease (abbr. NAFLD), non-alcoholic steatohepatitis (abbr. NASH) with or without fibrosis, atherosclerosis, neuropathy such as peripheral neuropathy and diabetes related eye diseases such as diabetic retinopathy, diabetic macular edema, and proliferative diabetic vitreoretinopathy.

Diabetic nephropathy occurs in 20-40% of patients with diabetes and is the single leading cause of end-stage renal disease (abbr. ESRD). In diabetic nephropathy, kidney macrophage infiltration is a characteristic histological finding. The development of renal sclerosis is a cardinal feature of the progression of diabetic nephropathy to end-stage renal failure. Studies in diabetic nephropathy and in other types of kidney disease have identified chronic inflammation as one if the main factors that promotes renal fibrosis. In human and experimental DM2 diabetic nephropathy, kidney macrophage accumulation is associated with the progression of renal injury and a decline in renal function, suggesting that inflammation promotes this disease (Nguyen, Ping et al. 2006). Studies in type 2 diabetic mice have shown that macrophages account for almost all kidney leukocyte accumulation in this disease and their accrual correlates with both the progression of diabetes (hyperglycaemia, glycosylated haemoglobin) and the severity of kidney damage (histological lesions, renal dysfunction) (Chow, Ozols et al. 2004).

Standard treatment of patients with diabetic nephropathy consists of: Glucose control, antihypertensive treatment, renin angiotensin system blockage (ACE inhibitors, angiotensin receptor blockers), low protein diet; treatment of cardiovascular risk (ASS, lower cholesterol, smoking cessation), treatment of anemia, avoidance of nephrotoxic drugs. The inventors have recently shown that targeted inhibition of the monocyte chemoattractant protein MCP-1 signaling with MCP-1 binding nucleic acids can prevent glomerulosclerosis by blocking macrophage recruitment to glomeruli of diabetic mice. In fact, the delayed onset of MCP-1 blockade by MCP-1 binding nucleic acid was able to prevent diabetic glomerulosclerosis and restored glomerular filtration rate (abbr. GFR) by preventing glomerular macrophage recruitment in late-stage DN of uninephrectomized db/db mice with type 2 diabetes (WO 2009/068318). Moreover, the inventors have recently shown that SDF-1 blockade by a SDF-1 binding nucleic acid prevents diabetic glomerulosclerosis in a way which was independent of glomerular macrophage recruitment (WO2009/019007). According to the present invention, the inventors could surprisingly show that a combination of an MCP-1 binding nucleic acid and an SDF-1 binding nucleic acid have additive preventive effects on (diabetic) glomerulosclerosis, which may be due to the different pathomechanisms of MCP-1 and SDF- 1 in the specific disease process (see Example 10). Hence, a combination of MCP-1 and SDF- 1 blockade, preferably by MCP-1 binding nucleic acids such as the Spiegelmers mNOX-E36 or NOX-E36 and SDF-1 binding nucleic acids such as Spiegelmer NOX-A12, seems to be a promising novel strategy to more efficiently prevent glomerulosclerosis in type 2 diabetes.

Insulin resistance, which is characteristic for DM2 patients, is defined as failure of normal metabolic response of peripheral tissues and/or liver to action of insulin that is released after eating (postprandial) to maintain normal blood glucose levels (euglycemia). Adipose tissue inflammation in obesity is linked to insulin resistance. MCP-1 is over-expressed by macrophages and adipocytes in obesity and it was shown that MCP-1 causes insulin resistance in cultured human adipocytes (Neels and Olefsky 2006) and it is probable that elevated circulating MCP-1 levels contribute to the development of insulin resistance in diabetic patients. High levels of MCP-1 are found in genetically obese, insulin resistant ob/ob mice (Sartipy and Loskutoff 2003). In experimental animals, therapy with CCR2 or MCP-1 antagonists ameliorated insulin resistance (Kanda, Tateya et al. 2006; Weisberg, Hunter et al. 2006; Tamura, Sugimoto et al. 2008). In addition, MCP-1 and CCR2 knockout mice on high fat diet are protected from insulin resistance (Kanda, Tateya et al. 2006; Weisberg, Hunter et al. 2006). A polymorphism in the MCP-1 gene is associated with insulin resistance in obese diabetic patients (Kouyama, Miyake et al. 2008).

As shown in example 13, in a model for insulin resistance MCP-1 binding nucleic acid mNOX-E36 showed significant effects on insulin sensitivity in comparison to a vehicle group.

The terms 'metabolic syndrome' (Zimmet 1992), 'insulin resistance syndrome' (Zimmet 1992), and 'Syndrome X' (Reaven 1988) are now used specifically to define a constellation of abnormalities that is associated with increased risk for the development of DM2 and cardiovascular disease (abbr. CVD) or atherosclerotic cardiovascular disease (abbr. ACVD) (reviewed by (Grundy 2006)). Evidence is accumulating that obesity (especially abdominal obesity) and insulin resistance plus/minus glucose intolerance are the two major causes for the Metabolic Syndrome (Reaven 1988; Haffner, Valdez et al. 1992; Grundy 2006). Other factors that aggravate the syndrome include physical inactivity, advancing age, genetic aberrations and hormonal imbalance (Eckel, Grundy et al. 2005). Generally, the individual diseases/risk factors that comprise the metabolic syndrome are treated separately. Therapies that target multiple risk factors simultaneously are not available yet. The factors that are in the focus of clinical management of the metabolic syndrome are obesity and insulin resistance/ DM2 and, furthermore, atherogenic dyslipidaemia and elevated blood pressure (Grundy 2006). Inflammation in the vasculature might be an important pathogenic link between cardiovascular diseases and the metabolic syndrome; there is a number of plausible mechanisms for effects of combination therapy to reduce inflammation, improve endothelial dysfunction, and decrease insulin resistance in atherosclerosis, coronary heart disease, and hypertension in the context of insulin-resistant states including diabetes, obesity, and the metabolic syndrome (Koh, Han et al. 2005).

The primary management for the metabolic syndrome includes calorie restriction, increase in physical activity and change in dietary composition. Drug therapy may be required to treat the metabolic syndrome if lifestyle change is not sufficient. Standard treatment of insulin resistance and hyperglycaemia consists of metformin, thiazolidinediones, acarbose and orlistat therapy to prevent or delay the development of type 2 diabetes. Fibrates (PPAR alpha agonists) and statins are used to improve dyslipidemia. In addition, emerging therapies such as incretin mimetics, dipeptidyl peptidase IV inhibitors, protein tyrosine phosphatase IB inhibitors, and the endocannabinoid receptor blocking agents offer potential as future therapies for the metabolic syndrome.

Non-alcoholic fatty liver disease (abbr. NAFLD) represents a spectrum of conditions characterized histologically by hepatic steatosis. When inflammation occurs, the condition is then called non-alcoholic steatohepatitis (abbr. NASH), which is regarded as a major cause for cirrhosis. NAFLD and NASH are highly prevalent findings in obesity and diabetes. Insulin resistance in the early stages of the disease and liver macrophage accumulation in later stages have been described. Elevated free fatty acids may be directly linked to NAFLD and insulin resistance. In patients with NASH, elevated MCP-1 levels are found in comparison with healthy subjects and patients with simple NAFLD (Kudo, Yata et al. 2009), the levels seem to rise further if fibrosis is present in NASH (Estep, Baranova et al. 2009). Serum levels of MCP-1 are elevated in a NASH model (Zhang, Wang et al. 2009), hepatic MCP-1 expression is elevated in mice fed with high-fat diet (Ito, Suzuki et al. 2007). In LDLr^("/_) mice, dietary induction of hepatic MCP-1 expression is paralleled by a concomitant increase in plasma-MCP-1 that is strongly associated with the degree of liver steatosis (Rull, Rodriguez et al. 2009); in baboons, plasma MCP-1 is related with adipocyte dedifferentiation and systemic insulin resistance, thereby potentially contributing to the development of NAFLD (Bose, Alvarenga et al. 2009). Hepatic steatosis was improved in models of fatty liver disease treated with a CCR2 antagonist (Tamura, Sugimoto et al. 2008; Yang, IglayReger et al. 2009). MCP-1 and knockout mice are protected in models of fatty liver (Kanda, Tateya et al. 2006; Weisberg, Hunter et al. 2006; Rull, Rodriguez et al. 2009). NASH can occur in combination with and without fibrosis.

Standard treatment of NAFLD and NASH has not yet emerged. However, as shown in example 9, in a NASH mouse model, wherein the mice progress within ca. four weeks from steatosis (simple NAFLD) via NASH to fibrosis, the therapeutic intervention with MCP-1 binding nucleic acid mNOX-E36 showed significant effects in comparison to a vehicle group.

Endothelial dysfunction is a systemic disorder and a key variable in the pathogenesis of atherosclerosis and its complications. Upregulation of adhesion molecules and generation of chemokines such as MCP-1 contribute to the proinflammatory and prothrombic state seen in endothelial dysfunction. In atherosclerosis, macrophage infiltration is characteristic of vascular wall inflammation and plaque formation. Levels of MCP-1 are elevated in patients with atherosclerosis and in peripheral arterial disease/ coronary heart disease (Nelken, Coughlin et al. 1991; Yla-Herttuala, Lipton et al. 1991; Blaha, Krejsek et al. 2004; Hoogeveen, Morrison et al. 2005; Martinovic, Abegunewardene et al. 2005) as well as in diabetes-associated chronic vascular inflammation (Feng, Matsumoto et al. 2005). Inhibition of MCP-1 or its receptor CCR2 ameliorates experimental models of vascular damage such as atherosclerosis (Ni, Egashira et al. 2001; Reckless, Tatalick et al. 2005; Hu, Liao et al. 2009) or restenosis (Furukawa, Matsumori et al. 1999; Egashira, Zhao et al. 2002; Horvath, Welt et al. 2002; Mori, Komori et al. 2002; Usui, Egashira et al. 2002; Ohtani, Usui et al. 2004). A polymorphism in the MCP-1 as well as in the CCR2 gene has been shown to be associated with carotid atherosclerosis in humans (Nyquist, Winkler et al. 2009; Yuasa, Maruyama et al. 2009). In addition to cardiovascular risk protection through blood glucose control, lipid modifying therapy, blood pressure control, and lifestyle interventions anti-platelet therapy is the standard of care for endothelial dysfunction.

Peripheral neuropathy is a feature of human DM2 that is associated with microvasculitis at the nerve site and local ischemic injury (Pascoe, Low et al. 1997; Dyck and Windebank 2002). Macrophages are prominent in these perivascular lesions and their presence has been associated with nerve demyelination, sugesting that they may be involved in nerve damage.

Proliferative retinopathy is another complication of DM2 that involves microvascular injury. In this disorder, macrophages are present in the epiretinal membrane (Tang, Scheiffarth et al. 1993) and macrophage-derived cytokines are frequently detected in vitreous samples (Demircan, Safran et al. 2006), suggesting that macrophages may play a role in the pathological processes of microvascular cell apoptosis, neovascularization and fibrosis.

Chronic obstructive pulmonary disease (abbr. COPD) is the sixth leading cause of death in the world. COPD is characterized by airway obstruction and progressive lung inflammation that is associated with the influx of inflammatory cells. The primary cause of COPD is smoking, with up to 50% of smokers developing disease normally in cities, with additional identifiable risk factors of increasing age and continued smoking. Inflammation in COPD is present in both small and large airways, and it is thought critical in the development of the pathology of the disease. Although MCP-1 is involved in the inflammation process and the recruitment of monocytes and / or neutrophils that cause inflammation, it was not absolutely clear whether MCP-1 is involved in COPD and/or development of COPD. Surprisingly, as shown in Example 11 of the present invention, in an acknowledged animal model that is widely used to screen substances for usefulness in the treatment of COPD, administration of MCP-1 binding Spiegelmer lead to a reduction of cellular infiltrate into lungs. Based on the data shown in the present application, MCP-1 binding Spiegelmers are suitable for have the use in the therapy of chronic respiratory diseases, preferably COPD, alone or one element of a combination therapy, preferably in combination therapy with a steroid drug, preferably dexamethasone Combination therapy of MCP-1 binding Spiegelmers with desxamethasone or other steroid drugs takes the advantage of two independent mode-of-action in order to treat chronic respiratory diseases such as COPD. Based on the above outlined involvement of MCP-1 in pathways relevant for or involved in various diseases, disorders and diseased conditions, it is evident that the nucleic acid molecules of the present invention, the pharmaceutical compositions containing one or several thereof and the medicaments containing one or several thereof can be in the treatment and/or prevention of said disease, disorders and diseased conditions. Accordingly, such diseases and/or disorders and/or diseased conditions include, but are not limited to, diabtetes, preferably DM2, diabetic complications, diabetic conditions and/or sequelae of DM2, whereby the diabetic complications are selected from the group comprising atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia

In a further embodiment, the medicament comprises a further pharmaceutically active agent. Such further pharmaceutically active compounds are, among others but not limited thereto to compounds for treatment and/or prevention of diabetes, preferably DM2, and of diabetic complications, whereby the compounds are selected from the group comprising, sulfonylurea drugs, biguanides, alpha-glucosidase inhibitors, thiazolinediones, DPP4 inhibitors, meglititinides, glucagon-like peptide analogs, gastric inhibitory peptide analogs, amylin analogs, incretin mimetics, insulin and other therapeutics used in the treatment of insulin resistance and/or DM2 or used in the prevention of insulin resistance and/or DM2, and the like. It will be understood by the one skilled in the art that given the various indications which can be addressed in accordance with the present invention by the nucleic acids according to the present invention, said further pharmaceutically active agent(s) may be any one which in principle is suitable for the treatment and/or prevention of such diseases. The nucleic acid molecules according to the present invention, particularly if present or used as a medicament, are preferably combined with sulfonylurea drugs, biguanides, alpha-glucosidase inhibitors, thiazolinediones, meglititinides, glucagon-like peptide analogs, gastric inhibitory peptide analogs, amylin analogs, incretin mimetics, DPP4 inhibitors, insulin and other therapeutics used in the treatment of insulin resistance and/or DM2 or used in the prevention of insulin resistance and/or DM2, and the like.

It is within the present invention that the medicament is alternatively or additionally used, in principle, for the prevention of any of the diseases disclosed in connection with the use of the medicament for the treatment of said diseases. Respective markers therefore, i.e. for the respective diseases are known to the ones skilled in the art. Preferably, the respective marker is MCP-1. Alternatively and/or additionally, the respective marker is selected from the group comprising MCP-2, MCP-3, MCP-4 and eotaxin. A still further group of markers is selected from the group comprising strong thirst, high drinking volume, frequent urination, extreme hungry feeling, HbAlc value, plasma insulin level, plasma glucose level after OGT, fed fasting plasma glucose level, fasting plasma glucose level, urine glucose level, body weight, blood pressure, lassitude, tiredness, weight loss in absence of a diet, weight gain, frequent bacterial or fungal infections, bad wound healing, numbness in hands and feet and impaired vision.

In one embodiment of the medicament of the present invention, such medicament is for use in combination with other treatments for any of the diseases disclosed herein, particularly those for which the medicament of the present invention is to be used.

Further indications, diseases and disorders for the treatment and/or prevention of which the nucleic acids, the pharmaceutical compositions and medicaments in accordance with or prepared in accordance with the present invention result from the involvement, either direct or indirect, of MCP-1 in the respective pathogenetic mechanism. However, also those indications, diseases and disorders can be treated and prevented in the pathogenetic mechanism of which MCP-2 and/or eotaxin are either directly or indirectly involved, as NOX-E36 binds and inactivates these proteins as well (WO 2009/068318). Involved as preferably used herein, means that if the respective molecule which is involved in the disease, is prevented from exerting one, several or all of its functions in connection with the pathogenetic mechanism underlying the disease, the disease will be cured or the extent thereof decreased or the outbreak thereof prevented; at least the symptoms or any indicator of such disease will be relieved and improved, respectively, such that the symptoms and indicator, respectively, is identical or closer to the one(s) observed in a subject not suffering from the disease or not being at risk to develop such disease. It is obvious for the ones skilled in the art that MCP-1 binding nucleic acids according to the present invention can be used insofar, i.e. for the diseases involving in the broader sense MCP-1, MCP-2 and eotaxin, which interact and bind, respectively, to or with MCP-1 MCP-2, and eotaxin, respectively. Of course, because the MCP-1 binding nucleic acids according to the present invention interact with or bind to MCP-1, MCP-2 and eotaxin a skilled person will generally understand that the MCP-1 binding nucleic acids according to the present invention can easily be used for the treatment, prevention and/or diagnosis of any disease result from the involvement, either direct or indirect, of MCP-1, MCP-2 and eotaxin in the respective pathogenetic mechanism.

A large body of evidence is in favor of the involvement of MCP-1 and its receptor CCR2 in several disease and/or disorders and/or diseased conditions:

Elevated levels of MCP-1 in humans having a disease;

Polymorphisms in the human MCP-1 or CCR2 genes and association with a disease; Beneficial effects anti-MCP-1 agents - or CCR2 antagonist in animal models for disease;

Properties of MCP-1 and CCR2 knock-out mice in animal models of a disease;

Elevated levels of MCP-1 in animal models of a disease.

The term "conditions with elevated MCP-1 level" refers to a condition in a mammal, preferably a human, wherein the level of MCP-1 in the body is elevated compared to the normal level of MCP-1 for such a mammal, such as an elevated MCP-1 serum level compared to the normal MCP-1 serum level for the mammal (approx. mean value of 370 pg/mL in human serum, approx. mean value of 150pg/mL in EDTA plasma, for reference see Quantikine^® Human CCL2/MCP-1 Immunoassay, R& D Systems, MN, USA). Elevated serum MCP-1 levels can, among others, be determined by enzyme-linked immunoassay (commercially available kit by BD Biosciences Pharmingen, CA, USA; BD OptEIA™ 'Human MCP-1 ELISA Kit', or by R& D Systems, MN, USA, Quantikine^® Human CCL2/MCP-1 Immunoassay).

Such elevated MCP-1 level were described e.g. in diabetic patients (Kiyici et al., 2006; Mine et al., 2006; Kouyama et al., 2008; Ezenwaka et al., 2009; Kajitani et al., Zineh et al, 2009), in patients with NAFLD/NASH (Haukeland et al. 2006; Kudo et al., 2009; Estep et al. 2009), in diabetic nephropathy (Banba et al, 2000; Wada et al., 2000); Chiarell et al., 2002; Morii et al., 2003; Hagiwara et al., 2006; Fornoni et al., 2008) and in atherosclerosis/cardiovascular disease (Piemonti et al., 2009; Yla-Herttula et al., 1991; Hoogeveen et al., 2005; Blaha et al., 2004; Matinovic et al., 2005).

Furthermore, elevated levels of MCP-1 in humans has been observed in:

Inflammatory joint diseases such as rheumatoid arthritis (RA), osteoarthritis (OA),psoriatic arthritis (PA), and gout;

Eye diseases including diabetic retinopathy and proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy and proliferative diabetic vitreoretinopathy, uveitis, Eales' disease, branch retinal vein occlusion (BRVO) and vernal keratoconjunctivitis;

Asthma and allergy including atopic asthma / chronic bronchitis and atopic dermatitis;

Autoimmune disease including systemic lupus erythematosus, ankylosing spondylitis and autoimmune orchitis;

Neuroinflammatory disease including amyotrophic lateral sclerosis (ALS), neuropathic pain, Parkinson's disease, Alzheimer's disease;

Tissue disease including polymyositis, dermatomyositis, polymyalgia rheumatica, psoriasis, and systemic sclerosis;

Cardiovascular disease including atherosclerosis, peripheral arterial disease, coronary heart disease, restenosis, post-PTCA, premature atherosclerosis after Kawasaki disease, giant cell arteritis, idiopathic pulmonary hypertension, Takayasu's arteritis, Kawasaki disease, Wegener's granulomatosis, diabetes-associated vascular inflammation, pulmonary granulomatous vasculitis, temporal arteritis, acute coronary syndrome, thrombosis, chronic hemodialysis, and hypertrophic cardiomyopathy;

Renal disease including diabetic nephropathy, glomerulonephritis, renal vasculitis, lupus nephritis, IgA nephropathy, chronic kidney disease and autosomal dominant polycystic kidney disease;

Ischemia andreperfusion injury including myocardial infarction and acute cerebral ischemia;

Metabolic disease including (diet-induced) obesity, insulin resistance, type 1 and type 2 diabetes, nonalcoholic steatohepatitis (NASH) with and without fibrosis, nonalcoholic fatty liver disease (NAFLD); Lung disease including interstitial lung disease, chronic obstructive pulmonary disease (COPD), cystic fibrosis, idiopathic pulomnary fibrosis and asthma;

Organ transplantation including transplantation of lung, kidney, heart, islets and cornea; Gynecological disease including endometriosis, preterm labor/delivery, and adenomyosis; Other conditions including sepsis, chronic liver disease, Peyronie's disease, acute spinal chord injury, myocarditis, HIV-associated dementia, hemophagic lymphohistiocytosis, HCV infection, irritable bowel disease, schizophrenia, mixed cryoglobulinemia, hepatitis C associated with autoimmune thyroiditis, musculosceletal trauma, acute liver failure, acute-on- chronic liver failure, intracranial hypertension, polycystic ovary syndrome, cerebral aneurysm, idiopathic inflammatory myopathies, periodontal disease, bladder inflammation, periprosthetic osteolysis of loosened total hip arthroplasty, pulmonary alveolar proteinosis, severe traumatic brain injury, pelvic inflammatory disease, benign prostatic hyperplasia, Tourette syndrome and primary biliary cirrhosis.

Polymorphisms in the human MCP-1 or CCR2 genes have reported to be associated with systemic sclerosis, asthma, systemic lupus erythematosus, juvenile rheumatoid arthritis, unfavorable outcome of renal transplantation, , long-term haemodialysis, IgA nephropathy, HLA-B27 associated disease, coronary artery disease, myocardial infarction / ischaemic heart disease, Alzheimer's disease, major depressive disorder, type 1 diabetes, type 2 diabetes, insulin resistance in obese type 2 diabetics, HIV-1 infection, pulmonary tuberculosis, cardiomyopathy in human Chagas' disease, hepatitis B virus clearance, hepatitis C virus severity, multiple sclerosis, chronic stable angina pectoris, pulmonary sarcoidosis, Kawasaki disease, Lofgren's syndrome, osteoarthritis, cytomegalovirus reactivation and disease after allogeneic stem cell transplantation, giant cell arteritis, cardiovascular disease in hemodialyzed patients, psoriasis, acute pancreatitis, diabetic kidney failure, allergic disorders, frontotemporal lobar degeneration (FTLD), metabolic syndrome, carotid atherosclerosis, nonfamilial idiopathic dilated cardiomyopathy, ocular Behcet's disease, carotid atherosclerosis, mood disorders, arthritis in patients with psoriasis, Crohn's disease, and diabetic retinopathy in type 2 diabetic patients.

Beneficial effects anti-MCP-1 agents - or CCR2 antagonist - have been described in animal model for several disease and/or disorders and/or diseased conditions: Arthritis, including collagen-induced arthritis (CIA), adjuvans-induced arthritis (AIA), RA of MRL/lpr autoimmune mice;

Ischemia/reperfusion, including focal brain ischemia, cardiac ischemia/reperfusion, stroke injury after cerebral artery occlusion, ischemic fibrotic cardiomyopathy after repeated coronary ischemia/reperfusion;

Kidney injury, including nephrotoxic serum-induced glomerulitis, lupus nephritis, renal fibrosis in unilateral ureteral obstruction (UUO), tubulointerstitial nephritis, protein overload nephropathy, adriamycin-induced focal segmental glomerulosclerosis (FSGS), diabetic nephropathy, renal artery stenosis;

Neuroinflammation, including experimental autoimmune encephalitis, TMEV-induced demyelinating disease, tactile hyperalgesia in a pain model of focal peripheral nerve demyelination;

Vascular disease, including restenosis after wire-induced carotid denudation / balloon injury; in-stent restenosis, neointimal hyperplasia after cuff-induced arterial injury and cardiac allograft transplantation, atherosclerosis, monocrotaline-induced pulmonary hypertension, cardiac fibrosis after experimental myocardial infarction, cerebral aneurysm formation;

Asthma, including ovalbumin-induced atopic asthma (OVA), cockroach-antigen induced atopic asthma, Ascaris suum antigen-induced asthma;

Ocular disease, including retinal neovascularization in oxygen-induced retinopathy and photoreceptor death after surgery-induced retinal detachment;

Transplantation, including cardiac allograft rejection;

Other diseases, including ragweed pollen induced allergic conjunctivitis, Propionibacterium acnei-induced pulmonary granulomatosis, dimethylnitrosamin-induced hepatic fibrosis, dibutyltin dichloride-induced pancreatitis, caerulein-induced pancreatitis, sepsis and endotoxaemia, experimental autoimmune myocarditis, metabolic syndrome (obesity, insulin resistance, hepatic steatosis), TNBS-induced colitis, and hyperglycaemia, insulinemia and hepatomegaly in a model of hepatic steatosis/lipoatrophy.

Properties of MCP-1 knockout mice; it was observed that MCP-1 knockout mice are protected from the following diseases:

Delayed-type hypersensitivity (DTH) lesions, tubular injury in a model of nephrotoxic serum nephritis, middle cerebral artery occlusion (MCAO) infarction, post-infarction ventricular remodeling; nephropathy in diabetic MCP-1 knockout mice, hapten-induced experimental colitis, apoptosis and skin injury in a mouse model of cutaneous ischemia/ reperfusion injury, insulin resistance/ hepatic steatosis/ macrophage accumulation in adipose tissue induced by a high-fat diet, damage and development of oxidative stress in a toxic model of severe acute liver injury, development of liver steatosis in LDLr(-/-) mice, formation of foreign body giant cells (FBGC) after implantation of biomaterials, formation of experimental cerebral aneurysm.

Properties of CCR2 knockout mice; it was observed that CCR2 knockout mice are protected from the following diseases:

Granulomatous lung disease, atherosclerosis, cockroach-allergen induced airway hyperreactivity, intestinal adhesions and mucosal ulcerations in the DSS model, early pathological manifestations of influenza A, EAE induced by MOGp35-55 primed T cells or just MOGp35-55 induced EAE, IL-13 induced lung inflammation & remodeling, myelin removal after spinal chord injury, intimal hyperplasia / neointima formation after arterial injury, LPS- and MCP-1 induced acute lung inflammatory response, neuropathic pain, progressive renal fibrosis induced by unilateral urether obstruction (UUO), bleomycin- induced pulmonary fibrosis, experimental autoimmune myocarditis, myocardial ischemia/reperfusion injury, cerebral ischemia reperfusion injury, TMEV (Theiler's Murine Encephalomyelitis Virus)-induced demyelinating disease, liver fibrosis in CC14 model and the bile duct ligation model, rheumatoid arthritis after intradermal infection of BALB/c CCR2-/- mice with Mycobacterium avium, [diet-induced obese mice] hepatic steatosis, improved insulin sensitivity, less adipose tissue inflammation, albuminuria in experimental streptozotocin induced diabetes.

Elevated levels of MCP-1 in experimental animals have been observed in animal models for the following diseases:

glomerulonephritis, nephrotoxic serum nephritis, immune complex glomerulonephritis, chronic proliferative dermatitis in the mouse, cardiac ischemia/reperfusion in the dog, experimental restenosis & atherosclerosis, acute renal allograft rejection, retinal ischemia/reperfusion, gastric carcinoma in the rat, adjuvant-induced arthritis in the rat, renal ischemia/reperfusion in the rat, gout, MRL/lpr mice, uveitis in the mouse, LPS-induced endotoxic ileum (rat), high-risk corneal transplantation (mouse), atherosclerosis, cardiac myosin-induced experimental autoimmune myocarditis, mSOD mouse (model for ALS), experimental pneumococcal meningitis, retinitis pigmentosa in mice, brain basilar artery vasculitis in rabbits with coccoidal meningitis, neuropathic pain, second-hand smoke exposure, synovial fluid from haemophilic mice with experimentally induced haemarthrosis, streptozotocin-induced diabetic rats, mice on methionine-choline-deficient (MCD) diet [model for NASH], the livers of mice fed with high-fat diet, CD18hypo mice [psoriasis model], response to transient cerebral ischemia, insulin resistant ob/ob mice, LDLr^^"* mice [model for liver steatosis], hepatic stellate cells of thioacetamide (TAA) treated mice [model for liver fibrosis], experimental subarachnoid hemorrhage in rats, experimental viral arthritides, in liver and lung after allogeneic bone marrow transplantation [acute graft-versus- host disease].

A large body of evidence argues in favor of the role of MCP-2 in several disease and/or disorders and/or diseased conditions:

Elevated levels of MCP-2 in humans having a disease

Elevated levels of MCP-2 in animal models for a disease

Elevated levels of MCP-2 in humans have been observed in:

Sepsis, multiple sclerosis (MS) lesions, ulcerative colitis and Crohn's disease, reumatoid arthritis (RA), osteoarthritis (OA), reactive arthritis, idiopathic intracranial hypertension (IIH), acute liver injury-patients in peri-operative stage of liver transplantation, adipose tissue of obese individuals, abdominal aortic aneurysm walls, bullous pemphigoid, women with preterm labor, pulmonary alveolar proteinosis (PAP), newborn infants with bronchopulmonary dysplasia, nasopharyngeal carcinoma, primary biliary cirrhosis.

Elevated levels of MCP-2 in experimental animals have been observed in animal models for the following diseases:

mice after bile duct ligation, mouse model of graft-versus-host disease (in plasma, liver and lung after allogeneic bone marrow transplantation, idiopathic lymphoplasmacytic rhinitis in dogs, and islet allografts associated with graft rejection.

Eotaxin, which is also bound and inactivated by NOX-E36, is known to activate eosinophils and os selectively chemotactic for eosinophils, whereby such specific eosinophil accumulation was observed at the site of administration of eotaxin whether by intradermal or intraperitoneal injection or aerosol inhalation. Tissue eosinophilia is a feature of a number of pathological conditions such as asthma, rhinitis, eczema and parasitic infections. In asthma, eosinophil accumulation and activation are associated with damage to bronchial epithelium and hyperresponsiveness to constrictor mediators (Rot, Krieger et al. 1992; Baggiolini and Dahinden 1994; Ponath, Qin et al. 1996; Bousquet, Chanez et al. 1990). Some years ago, the CCR-3 receptor was identified as a major chemokine receptor that eosinophils use for their response to eotaxin, RANTES and MCP-3. When transfected into a murine pre-β lymphoma line, CCR-3 bound eotaxin, RANTES and MCP-3 and conferred chemotactic responses on these cells to eotaxin, RANTES and MCP-3. The CCR-3 receptor is expressed on the surface of eosinophils, T-cells (subtype Th-2), basophils and mast cells and is highly selective for eotaxin. Studies have shown that pretreatment of eosinophils with an anti-CCR-3 mAb completely inhibits eosinophil chemotaxis to eotaxin, RANTES and MCP-3. Therefore, by blocking the ligands of CCR3 or blocking the ability of the CCR-3 receptor to bind to its ligands RANTES, MCP-3 and eotaxin, the recruitment of eosinophils should provide for the treatment of eosinophil-mediated inflammatory diseases, such as asthma.

Accordingly, disease and/or disorders and/or diseased conditions for the treatment and/or prevention of which the medicament according to the present invention may be used include, but are not limited to:

Inflammatory joint diseases such as rheumatoid arthritis (RA), osteoarthritis (OA), proriatic arthritis (PA), gout; juvenile rheumatoid arthritis, viral arthritides;

Eye diseases includinguveitis, Eales' disease, branch retinal vein occlusion (BRVO), vernal keratoconjunctivitis; photoreceptor death after surgery-induced retinal detachment, ocular Behcet's disease, retinitis pigmentosa, allergic conjunctivitis;

Asthma including atopic asthma, chronic bronchitis ;

Autoimmune disease including systemic lupus erythematosus, ankylosing spondylitis, autoimmune orchitis, Lofgren's syndrome, Crohn's disease,_.autoimmune myocarditis;

Neuroinflammatory disease including multiple sclerosis, amyotrophic lateral sclerosis (ALS), neuropathic pain, Parkinson's disease, Alzheimer's disease, demyelinating disease; Tissue disease including polymyositis, dermatomyositis, polymyalgia rheumatica, psoriasis, and systemic sclerosis (scleroderma, atopic dermatitis;

Cardiovascular disease including atherosclerosis, carotid atherosclerosis, peripheral arterial disease, coronary heart disease, restenosis, post-PTCA, premature atherosclerosis after Kawasaki disease, giant cell arteritis, idiopathic pulmonary hypertension, Takayasu's arteritis, Kawasaki disease, Wegener's granulomatosis, diabetes-associated vascular inflammation, pulmonary granulomatous vasculitis, temporal arteritis, acute coronary syndrome, thrombosis, chronic hemodialysis, hypertrophic cardiomyopathy, cardiomyopathy in human Chagas' disease, myocardial infarction/ ichemic heart disease, chronic stable angina pectoris, nonfamilial idiopathic dilated cardiomyopathy, post-infarction ventricular remodeling, restenosis after balloon dilatation, in-stent restenosis, pulmonary arterial hypertension, cerebral aneurysm formation;

Renal disease including glomerulonephritis, renal vasculitis, lupus nephritis, IgA nephropathy, other nephropathies, chronic kidney disease, autosomal dominant polycystic kidney disease, renal fibrosis, tubulointerstitial nephritis, renal artery stenosis;

Ischemia and reperfusion injury including myocardial infarction, acute cerebral ischemia, focal brain ischemia, cardiac ischemia/reperfusion, stroke injury after cerebral artery occlusion, ischemic fibrotic cardiomyopathy after repeated coronary ischemia/reperfusion, skin injury after cutaneous ischemia reperfusion, retinal ischemia/reperfusion;

Lung disease including interstitial lung disease, chronic obstructive pulmonary disease

(COPD), cystic fibrosis, idiopathic pulomnary fibrosis, chemical-induced pulmonary fibrosis, pulmonary sarcoidosis, pulmonary granulomatosis and granulomatous lung disease;

Organ transplantation including transplantation of lung, kidney, heart, islets and cornea, bone marrow transplantation and stem cell transplantation;

Gynecological disease including endometriosis, and adenomyosis;

Other disease and/or disorders and/or diseased conditions including sepsis, chronic liver disease, Peyronie's disease, acute spinal chord injury, myocarditis, HIV infection, HIV- associated dementia, hemophagic lymphohistiocytosis, HBV infection, HCV infection, meningitis, influenza A, CMV reactivation, pulmonary tuberculosis, irritable bowel disease, schizophrenia, mixed cryoglobulinemia, hepatitis C associated with autoimmune thyroiditis, musculosceletal trauma, acute liver failure, acute-on-chronic liver failure, intracranial hypertension, polycystic ovary syndrome, cerebral aneurysm, idiopathic inflammatory myopathies, periodontal disease, bladder inflammation, periprosthetic osteolysis of loosened total hip arthroplasty, pulmonary alveolar proteinosis, severe traumatic brain injury, pelvic inflammatory disease, benign prostatic hyperplasia, Tourette syndrome and primary biliary cirrhosis, HLA-B27 associated disease, major depressive disorder, pancreatitis, frontotemporal lobar degeneration (FTLD), mood disorders, liver fibrosis, colitis, delayed- type hypersensitivity (DTH) lesions, formation of foreign body giant cells (FBGC) after implantation of biomaterials, dermatitis.

"Combination therapy" or "co-therapy" as preferably used herein, includes the administration of a medicament of the invention and at least a second agent as part of a treatment regimen intended to provide a beneficial effect from the co-action of these therapeutic agents, i. e. the medicament of the present invention and said second agent. Administration of these therapeutic agents as or in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).

"Combination therapy" may, but generally is not, intended to encompass the administration of two or more of therapeutic agents as part of separate monotherapy regimens that incidentally and arbitrarily result in the combinations of the present invention. "Combination therapy" is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to a subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.

Sequential or substantially simultaneous administration of a therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of a specific combination of therapeutically effective agents may be administered by injection while the or an other therapeutic agent of the combination may be administered topically.

Alternatively, for example, all therapeutic agents may be administered topically or all therapeutic agents may be administered by injection. The sequence in which the therapeutic agents are administered is not critical unless noted otherwise. Where the combination therapy further comprises a non-drug treatment, the non-drug treatment may be conducted at any suitable time as long as a beneficial effect from the combination of the therapeutic agents and the non-drug treatment is achieved. For example, in appropriate cases, the beneficial effect may still be achieved when the non-drug treatment is temporally stayed, perhaps by days or even weeks whereas the therapeutic agents are still administered.

As outlined in general terms above, the medicament according to the present invention can be administered, in principle, in any form known to the ones skilled in the art. A preferred route of administration is systemic administration, more preferably by parenteral administration, preferably by injection. Alternatively, the medicament may be administered locally. Other routes of administration comprise intramuscular, intraperitoneal, subcutaneous, per orum, intranasal, intratracheal and pulmonary with preference given to the route of administration that is the least invasive while ensuring efficiancy.

Parenteral administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, one approach for parenteral administration employs the implantation of a slow-release or sustained-released systems, which assures that a constant level of dosage is maintained and which are well known to the ordinary skill in the art.

Furthermore, preferred medicaments of the present invention can be administered by the intranasal route via topical use of suitable intranasal vehicles, inhalants, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will typically be continuous rather than intermittent throughout the dosage regimen. Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels.

The medicament of the present invention will generally comprise an amount of the active component(s) effective for the therapy, including, but not limited to, a nucleic acid molecule of the present invention, preferably dissolved or dispersed in a pharmaceutically acceptable medium. Pharmaceutically acceptable media or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the medicament of the present invention.

In a further aspect the present invention is related to a pharmaceutical composition. Such pharmaceutical composition comprises at least one of the nucleic acids according to the present invention and preferably a pharmaceutically acceptable vehicle. Such vehicle can be any vehicle or any binder used and/or known in the art. More particularly such binder or vehicle is any binder or vehicle as discussed in connection with the manufacture of the medicament disclosed herein. In a further embodiment, the pharmaceutical composition comprises a further pharmaceutically active agent.

The preparation of a medicament and a pharmaceutical composition, respectively, is known to those of skill in the art in light of the present disclosure. Typically, such compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and the like. The use of sterile formulations, such as saline-based washes, by surgeons, physicians or health care workers to treat a particular area in the operating field may also be particularly useful. Compositions may also be delivered via a microdevice, microparticles or a sponge.

Upon formulation, a medicament will be administered in a manner compatible with the dosage formulation, and in such amount as is pharmacologically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.

The medicament according to the invention can also be administered in such oral dosage forms as timed release and sustained release tablets or capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions. Suppositories are advantageously prepared from fatty emulsions or suspensions.

The pharmaceutical composition or medicament according to the invention may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances. The compositions are prepared according to conventional mixing, granulating, or coating methods, and typically contain about 0.1% to 75%, preferably about 1% to 50%, of the active ingredient.

Liquid, particularly injectable compositions can, for example, be prepared by dissolving, dispersing, etc. The active compound is dissolved in or mixed with a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form an injectable solution or suspension. Additionally, solid forms suitable for dissolving in liquid prior to injection can be formulated.

The medicaments and nucleic acid molecules, respectively, of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid components is hydrated with an aqueous solution of drug to form a lipid layer encapsulating the drug, which is well known to the ordinary person skilled in the art. For example, the nucleic acid molecules according to the invention can be provided as a complex with a lipophilic compound or non-immunogenic, high molecular weight compound constructed using methods known in the art. Additionally, liposomes may bear such nucleic acid molecules on their surface for targeting and carrying cytotoxic agents internally to mediate cell killing. An example of nucleic-acid associated complexes is provided in U.S. Patent No. 6,011,020.

The medicaments and nucleic acid molecules, respectively, of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl-methacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues Furthermore, the medicaments and nucleic acid molecules, respectively, of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon capro lactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross- linked or amphipathic block copolymers of hydrogels. Effective plasma levels of the nucleic acid according to the present invention preferably range from 500 fM to 200 μΜ, preferably from 1 nM to 20 μΜ, more preferably from 5 nM to 20 μΜ, most preferably 50 nM to 20 μΜ in the treatment of any of the diseases disclosed herein.

The nucleic acid molecules and medicaments, respectively, of the present invention may preferably be administered in a single daily dose, every second or third day, weekly, every second week, in a single monthly dose or every third month.

It is within the present invention that the medicament as described herein constitutes the pharmaceutical composition disclosed herein.

In a further aspect the present invention is related to a method for the treatment of a subject who is in need of such treatment, whereby the method comprises the administration of a pharmaceutically effective amount of at least one of the nucleic acids according to the present invention. In an embodiment, the subject suffers from a disease or is at risk to develop such disease, whereby the disease is any one of those disclosed herein, particularly any one of those diseases disclosed in connection with the use of any of the nucleic acids according to the present invention for the manufacture of a medicament.

As preferably used herein, the term treatment comprises in a preferred embodiment additionally or alternatively prevention and/or follow-up.

As preferably used herein, the terms disease and disorder shall be used in an interchangeable manner, if not indicated to the contrary.

The various SEQ.ID. Nos., the chemical nature of the nucleic acid molecules according to the present invention and the target molecules MCP-1 and SDF-1 as used herein, the actual sequence thereof and the internal reference number is summarized in the following table.

The present invention is further illustrated by the figures, examples and the sequence listing from which further features, embodiments and advantages may be taken, wherein

Fig. 1 shows an alignment of sequences of MCP-1 binding nucleic acid molecules of "Type 1A;

Fig. 2 shows an alignment of sequences of MCP-1 binding nucleic acid molecules of "Type IB";

Fig. 3 shows an alignment of sequences of MCP-1 binding nucleic acid molecules of "Type 2" and derivatives of MCP-1 binding nucleic acid molecule 180-D 1-002;

Fig. 4 shows an alignment of sequences of MCP-1 binding nucleic acid molecules of "Type 3";

Fig. 5 shows derivatives of the MCP-1 binding nucleic acid molecules 178-D5 and 181-A2 (MCP-1 binding nucleic acid molecules of "Type 3"); Fig. 6 shows an alignment of sequences of MCP-1 binding nucleic acid molecules of "Type 4";

Fig. 7 shows further MCP-1 binding nucleic acid molecules which are, in addition to other MCP-1 binding nucleic acid molecules, also referred to as type 5 MCP-1 binding nucleic acid molecules ;

Fig. 8 shows an alignment of sequences of SDF-1 binding nucleic acid molecules of "Type A";

Figs. 9A+B show derivatives of SDF-1 binding nucleic acid molecule 192- A 10-001

(SDF-1 binding nucleic acid molecules of of "Type A");

Fig. 10 shows an alignment of sequences of SDF-1 binding nucleic acid molecules of "Type B";

Figs. 11A+B show derivatives of SDF-1 binding nucleic acid molecules 193-C2-001 and 193-G2-001 (SDF-1 binding nucleic acid molecules of Type B; Fig. 12 shows an alignment of sequences of SDF-1 binding nucleic acid molecules of "Type C";

Fig. 13 shows derivatives of SDF-1 binding nucleic acid molecule 190- A3 -001

(SDF-1 binding nucleic acid molecules of "Type C");

Figs. 14A+B show derivatives of SDF-1 binding nucleic acid moleculs 190-D5-001

(SDF-1 binding nucleic acid molecules of "Type C"); Fig. 15 shows derivatives of SDF-1 binding nucleic acid molecule 197-B2

(SDF-1 binding nucleic acid molecule of "Type C");

Fig. 16 shows further SDF-1 binding nucleic acid molecules molecules which are, in addition to other SDF-1 binding nucleic acid molecules, also referred to as type D SDF-1 binding nucleic acid molecules;

Fig. 17 shows renal pathology in 6 months old db/db mice after a combination therapy of MCP-1 and SDF-1 binding nucleic acid molecules on diabetic kidney disease;

(A): Renal sections from IK mice of the different treatment groups were stained with periodic acid Schiff (abbr. PAS). Stains show representative glomeruli from each group (original magnification 400x).

(B): PAS stains were scored for the extent of glomerulosclerosis from 0-4 as described. From each mouse 15 glomeruli from each renal section were graded by that score. The graph illustrates the mean percentage of each score ± SEM from all mice in each group. Uninephrectomy was associated with a shift towards higher scores of glomerulosclerosis as seen with the control Spiegelmer and vehicle group. Note that single blockade with either mMCP-1 binding Spieglmer mNOX-E36 or SDF-1 binding Spiegelmer NOX-A12 significantly reduced the overall scores as compared to control Spiegelmer-treated IK db/db mice (* p<0.05). Moreover, dual blockade by mMCP-1 binding Spieglmer mNOX-E36 and SDF-1 binding Spiegelmer NOX-A12 further significantly reduced the percentage of glomeruli with a score 4 and even increased the percentage of glomeruli with a score 1 as compared to either single chemokine blockade (# p<0.05);

Fig. 18 shows podocyte numbers in IK db/db mice after a combination therapy of a MCP-1 binding nucleic acid molecule and an SDF-1 binding nucleic acid molecule on diabetic kidney disease

(A) : Renal sections from IK mice of all treatment groups were stained for WT-1 (original magnification 400x).

(B) : The graph shows the mean number of WT-1 positive cells in 15 glomeruli ± SEM in sections from 6 months old IK db/db mice of each group. Note the potent effect of the anti-SDF-1 Spiegelmer NOX-A12 on the number of podocytes (* p<0.05 versus control Spiegelmer) and the additive effect of dual blockade by mMCP-1 binding Spiegelmer mNOX-E36 and SDF-1 binding Spiegelmer NOX-A12 versus anti- SDF-1 monotherapy with NOX-A12 (# p<0.05 versus anti-SDF-1 Spiegelmer NOX-A12);

Fig. 19 shows GFR and albuminuria in 6 months old db/db mice after a combination therapy of MCP-1 and SDF-1 binding nucleic acids on diabetic kidney disease;

(A) : GFR was determined by FITC-inulin clearance kinetics in all groups at the end of the study as described in methods. Note that IK treated with dual chemokine blockade have the highest GFR levels (comparable to 2K mice);

(B) : Urinary albumin/creatinine ratios (abbr. UACR) were determined as a functional marker of the glomerular filtration barrier at the initiation (4 months, grey bars) and termination of treatment (6 months, black bars). Data in A and B are means ± SEM from at least 6 mice in each group. * p<0.05, ** p<0.01 versus control-Spiegelmer treated IK db/db mice.† p<0.05 versus baseline UACR in the respective group (grey bar);

Fig. 20 shows efficacy of Spiegelmer NOX-E36 to inhibit pyroglutamyl-MCP-

1 in a chemotaxis assay, cells were allowed to migrate towards either 0.5 nM recombinant MCP-1 or 3 nM pyroglutamyl-MCP-1 preincubated at 37°C with various amounts of Spiegelmer NOX-E36, the results show the percentage of fluorescence signal normalized to the signal obtained with no Spiegelmer.

Fig. 21 shows Glucose infusion rate after treatment with vehicle or MCP-1 binding Spiegelmer mNOX-E36 and concomitant MCP-1 infusion: There is a statistically significant difference between the high dose group (10 mg/kg mNOX-E36) and the vehicle group (*** p = 0.0005). Examples

In the following the terms 'nucleic acid' and 'nucleic acid molecule' are used herein in a synonymous manner if not indicated to the contrary. Moreover, the terms 'stretch' and 'stretch of nucleotide' are used herein in a synonymous manner if not indicated to the contrary.

Example 1: Nucleic acid molecules that bind human MCP-1

L-nucleic acid molculess that bind to human MCP-1 and their respective nucleotide sequences are depicted in Figures 1 to 7. The nucleic acid molecules exhibit different sequence motifs, four main types are defined in Figs. 1 and 2 (Type 1A / IB), Fig. 3 (Type 2), Figs. 4 and 5 (Type 3), and Fig. 6 (Type 4), additional MCP-1 binding nucleic acid molecules which can not be related to each other and to the differerent sequence motifs decribed herein, are listed in Fig. 7 and are also referred to as type 5.

For definition of nucleotide sequence motifs, the IUPAC abbreviations for ambiguous nucleotides is used:

s strong G or C;

w weak A or U;

R purine G or A;

Y pyrimidine C or U;

K keto G or U;

M imino A or C;

B not A C or U or G;

D not C A or G or U;

H not G A or C or U;

V not U A or C or G;

N all A or G or C or U

If not indicated to the contrary, any nucleic acid sequence or sequence of stretches and boxes, respectively, is indicated in the 5' - 3' direction.

The nucleic acid molecules were characterized on the aptamer level, i.e. as D-nucleic acid molecules, using direct and competitive pull-down assays with biotinylated human D-MCP-1 in order to rank them with respect to their binding behaviour (for protocol, see Example 5). Selected sequences were synthesized as Spiegelmer (for protocol, see Example 4) and were tested using the natural configuration of MCP-1 (L-MCP) in an in vitro chemotaxis assay (for protocol, see Example 6) or by surface plasmon resonance measurement using a Biacore 2000 instrument (for protocol, see Example 8).

Type 1A MCP-1 binding nucleic acid molecules

As depicted in Fig. 1 all sequences of MCP-1 binding nucleic acid molcules of Type comprise several sequences stretches of nucleotides or boxes whereby boxes [B1A| and [B1B| are the 5'- and 3' terminal stretches of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other. However, such hybridization is not necessarily given in the molecule as actually present under and box B6 are flanked by box [B1A| and box

The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 1A which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 1A MCP-1 binding nucleic acids, the boxes [B1A|, B2, B3, B4, 5,\ B6 and [B1B| and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1 :

boxes [BlAl and [B1B| are the first and the second terminal stretch of nucleotides (also referred to as 5' and 3' terminal stretch of nucleotides), whereby both stretches of nucleotides can hybridize with each other; where pBlA] is [AGCRUCj preferably

[AGCGUGl; and whereby |B1B| is |CRYGCUj preferably |CACGCU|;

box B2 is the first central stretch of nucleotides, which is CCCGGW, preferably

CCCGGU;

box B3 is the second central stretch of nucleotides, which is GUR, preferably GUG; box B4 is the third central stretch of nucleotides, which is RYA, preferably GUA; box p5\ is the fourth central stretch of nucleotides, which is GGGGGRCGCGAYC

(SEQ ID NO: 119); preferably |GGGGGGCGCGACC|(SEQ ID 437); • box B6 is the fifth central stretch of nucleotides, which is UGCAAUAAUG (SEQ ID NO: 288) or URYAWUUG, preferably UACAUUUG;

As depicted in Fig. 1, the nucleic acid molecule referred to as 176-ElOtrc has the best binding affinity to MCP-1 with a ¾ of 5 nM (protocol, see Example 5) and therefore may constitute the optimal sequence and the optimal combination of sequence elements [B1A|, B2, B3, B4,

J5J B6 and jBlBj.

Type IB MCP-1 binding nucleic acid molecules

As depicted in Fig. 2, all sequences of Type IB comprise several sequences stretches of nucleotides or boxes whereby boxes BlA| and BlB| are the 5'- and 3' terminal stretches of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other and boxes B2, B3, B4, ΪΒ5) and box B6 are flanked by box [B1A| and box [BlBj. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions.

The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type IB which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type IB MCP-1 binding nucleic acids, the boxes BlA|, B2, B3, B4, B5,i B6 and BlB| and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1 :

lAGCGUGj; and where [BlBj is |CAYRCU|, preferably 1CACGCU|;

box B2 is the first central stretch of nucleotides, which is CCAGCU or CCAGY.

preferably CCAGU:

box B3 is the second central stretch of nucleotides, which is GUG;

box B4 is the third central stretch of nucleotides, which is AUG;

box d is the fourth central stretch of nucleotides, which is ^GGGGGCG (SEQ ID NO: 120); • box B6 is the fifth central stretch of nucleotides, which is CAUUUUA or CAUUUA, preferably CAUUUUA;

As depicted in Fig. 2, the nucleic acid referred to as 176-C9trc has the best binding affinity to MCP-1 with a K_D of 5 nM (protocol, see Example 5) and therefore may constitute the optimal sequence and the optimal combination of sequence elements |B1A|, B2, B3, B4, 5,\ B6 and

BIB

Type 2 MCP-1 binding nucleic acid molecules

As depicted in Fig. 3, all sequences of Type 2 comprise several sequences stretches of nucleotides or boxes whereby boxes [B1A| and [B1B| are the 5'- and 3' terminal stretches of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other and box B2 is the central sequence element. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions.

The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 3 which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 2 MCP-1 binding nucleic acids, the boxes 1A|, B2, and [B1B| and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP- 1:

box B2 is the central stretch of nucleotides,

CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC (SEQ ID NO: 114), preferably CGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUC (SEQ ID NO: 115). As depicted in Fig. 3, the nucleic acid referred to as 180-D 1-002 as well as the derivatives of 180-D1-002 like 180-D1-011, 180-D1-012, 180-D1-035, and 180-D1-036 have the best binding affinity to MCP-1 as aptamer in the pull-down or competitive pull-down assay with an K_D of < 1 nM (protocol, see Example 5) and therefore may constitute the optimal sequence and the optimal combination of sequence elements ρΒ1Α|, B2, and [B1B|

For nucleic acid molecule 180-D 1-036, a dissociation constant (K_D) of 890 ± 65 pM at room temperature and of 146 ± 13 pM at 37°C was determined (protocol, see Example 5). The respective Spiegelmer 180-D1-036 exhibited an inhibitory concentration (IC50) of ca. 0.5 nM in an in vitro chemotaxis assay (protocol, see Example 6). For the PEGylated derivatives of Spiegelmer 180-D1-036, NOX-E36-3'PEG and NOX-E36-5 EG (also referred to as NOX- E36), an IC₅₀s of < 1 nM in the chemotaxis assay was determined (protocol, see Example 6).

Type 3 MCP-1 binding nucleic acid molecules

As depicted in Figs. 4 and 5, all sequences of Type 3 comprise several sequence stretches of nucleotides or boxes whereby three pairs of boxes are characteristic for Type 3 MCP-1 binding nucleic acids. Both boxes |B1A| and [B1B| as well as boxes B2A and B2B as well as boxes B5A and B5B bear the ability to hybridize with each other. However, such hybridization is not necessarily given in the molecule as actually present under physiological conditions. Between these potentially hybridized sequence elements, non-hybridizing nucleotides are located, defined as box B3, box B4 and box |B6i.

The sequences of the defined boxes may be different between the MCP-1 binding nucleic acids of Type 3 which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 3 MCP-1 binding nucleic acids, the boxes [B1A|, B2A, B3, B2B, B4, B5A, [B6j, B5B, |B1B| and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1 :

[GCAGCACl; preferably glAj is |GUGCUGC| and |B1B| is |GCAGCAC| or B1A is GKSYGCl and gmj is jGCRSMC; preferably B1A is GUGCGC and BIB is

GCGCAC

[B1A| is [KBBSq and [Β1Β| is IGSVVM]; preferably Bl M is [KKSSQ is

IGSSMM];

most preferably [B1A| is |GGGC| and |B1B|

boxes B2A and B2B are the first and the third central stretch of nucleotides, whereby both stretches of nucleotides can hybridize with each other, whereby B2A is GKMGU and B2B is ACKMC; preferably B2A is GUAGU and B2B is ACUAC;

box B3 is the second central stretch of nucleotides, which is KRRAR, preferably UAAAA or GAGAA;

box B4 is the fourth central stretch of nucleotides, which is CURYGA or CUWAUGA or CWRMGACW or UGCCAGUG, preferably CAGCGACU or CAACGACU;

B5A and B5B are the fifth and the seventh central stretch of nucleotides, whereby both stretches can hybridize with each other, B5A is GGY and B5B is GCYR whereas GCY can hybridize with the nucleotides of B5A; or B5A is CWGC and B5B is GCWG;

preferably B5A is GGC and B5B is GCCG;

box |B61 is the sixth central stretch of nucleotides, which is: jYAGAj or jCKAAijj or |CCUl^d, preferably jUAGAj.

As depicted in Figs. 4 and 5, the nucleic acid referred to as 178-D5 and its derivative 178-D5- 030 as well as 181-A2 with its derivatives 181-A2-002, 181-A2-004, 181-A2-005, 181-A2- 006, 181-A2-007, 181-A2-017, 181-A2-018, 181-A2-019, 181-A2-020, 181-A2-021, and 181-A2-023 have the best binding affinity to MCP-1. 178-D5 and 178-D5-030 were evaluated as aptamers in direct or competitive pull-down assays (protocol, see Example 5) with an KD of approx. 500 pM. In the same experimental set-up, 181-A2 was determined with an KD of approx. 100 pM. By Biacore analysis (protocol, see Example 8), the KD of 181-A2 and its derivatives towards MCP-1 was determined to be 200 - 300 pM. In chemotaxis assays with cultured cells (protocol, see Example 6), for both 178-D5 and 181-A2, an IC₅₀ of approx. 500 pM was measured. Therefore, 178-D5 as well as 181-A2 and their derivatives may constitute the optimal sequence and the optimal combination of sequence elements [B1A|, B2A, B3, B2B.

B4, B5A, jB6j, B5B and BlBl Type 4 MCP-1 binding nucleic acids

As depicted in Fig. 6, all sequences of Type 4 comprise several sequences, stretches of nucleotides or boxes whereby boxes [B1A| and [B1B| are the 5'- and 3' terminal stretches (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) that can hybridize with each other and box B2 is the central sequence element.

The sequences of the defined boxes may differ among the MCP-1 binding nucleic acids of Type 4 which influences the binding affinity to MCP-1. Based on binding analysis of the different MCP-1 binding nucleic acids summarized as Type 4 MCP-1 binding nucleic acids, the boxes [B1A|, B2, and |B1B| and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to MCP-1 :

CCGCUO and lBl is |GGGCGG|; and

box B2 is the central stretch of nucleotides, which is

AGNDRDGBKGGURGYARGUAAAG (SEQ ID NO: 116) or

AGGUGGGUGGUAGUAAGUAAAG (SEQ ID NO: 117)or

CAGGUGGGUGGUAGAAUGUAAAGA (SEQ ID NO: 118), preferably

AGGUGGGUGGUAGUAAGUAAAG (SEQ ID NO: 117).

As depicted in Fig. 6, the nucleic acid referred to as 174-D4-004 and 166-A4-002 have the best binding affinity to MCP-1 and may, therefore, constitute the optimal sequence and the optimal combination of sequence elements [B1A|, B2, and [BlBl Other MCP-1 binding nucleic acid molecules

Additionally, the 29 other MCP-1 binding nucleic acids shown in Fig. 7 cannot be described by a combination of nucleotide sequence elements as has been shown for Types 1 - 4 of MCP-1 binding nucleic acids.

It is to be understood that any of the sequences shown in Figs. 1 through 7 are nucleic acid molecules according to the present invention, including those truncated forms thereof but also including those extended forms thereof under the proviso, however, that the thus truncated and extended, respectively, nucleic acid molecules are still capable of binding to the target.

Example 2: A nucleic acid molecule that binds murine MCP-1

The MCP-1 binding nucleic acid molecule mNOX-E36 exhibited an inhibitory concentration (IC₅o) of approx. 3 nM in the chemotaxis assay (protocol, see Example 6).

Example 3: Nucleic acid molecules that bind human SDF-1

L-nucleic acid molecules that bind to human SDF-1 and the respective nucleotide sequences are depicted in Figures 8 to 14. The nucleic acids were characterized on the aptamer, i. e. D- nucleic acid level using competitive or direct pull-down binding assays with biotinylated human D-SDF-1 (protocol, see Example 5). Spiegelmers were tested with the natural configuration of SDF-1 (L-SDF-1) by surface plasmon resonance measurement using a Biacore 2000 instrument (protocol, see Example 8) and a cell culture in vitro chemotaxis assay (protocol, see Example 7).

The SDF-1 binding nucleic acid molecules exhibit different sequence motifs, three main types are defined in Figs. 8, 9A and 9B (Type A), Figs. 10, 11A and 11B (Type B), Figs. 12, 13, 14 A, 14B and 15 (Type C). The nucleic acid molecules exhibit different sequence motifs. For definition of nucleotide sequence motifs, the IUPAC abbreviations for ambiguous nucleotides is used:

S strong G or C;

w weak A or U;

R purine G or A; Y pyrimidine C or U;

κ keto G or U;

Μ imino A or C;

Β not A C or U or G;

D not C A or G or U;

Η not G A or C or U;

V not U A or C or G;

Ν all A or G or C or U

If not indicated to the contrary, any nucleic acid sequence or sequence of stretches and boxes, respectively, is indicated in the 5'→ 3' direction.

Type A SDF-1 binding nucleic acid molecules

As depicted in Fig. 8 all sequences of SDF-1 binding nucleic acid moleculess of Type A comprise one central stretch of nucleotides which is flanked by the first (5'-) terminal and the second (3'-) terminal stretch of nucleotides (also referred to as first terminal stretch of nucleotides and second stretch of nucleotides) whereby both stretches can hybridize to each other. However, such hybridization is not necessarily given in the molecule.

The sequences of the defined boxes or stretches of nucleotides may be different between the SDF-1 binding nucleic acids of Type A which influences the binding affinity to SDF-1. Based on binding analysis of the different SDF-1 binding nucleic acids summarized as Type A SDF- 1 binding nucleic acids, the central strectch of nucleotides and its nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to SDF-1.

The central stretch of nucleotides of all identified sequences of Type A SDF-1 binding nucleic acids share the sequence [AAAGYRACAHGUMAAX_AUGAAAGGUARC| (Type A Formula- 1 , SEQ ID NO: 136), whereby X_A is either absent or is Ά'. If 'A' is absent, the sequence of the central nucleotide sequence can be summarized as Type A Formula-2

(lAAAGYRACAHGUMAA-UGAAAGGUARq, SEQ ID NO: 137. Type A SDF-1 binding nucleic acid 191-A6 (central nucleotide sequence: lAAAGUAACACGUAAAAUGAAAGGUAACI, SEQ ID NO: 438) carrying the additional nucleotide 'A' within the central nucleotide sequence and still binding to SDF-1 let conclude an alternative central nucleotide sequence (|AAAGYRACAHGUMAAAUGAAAGGUARC

Type A Formula-3, SEQ ID NO: 138). Exemplarily for all the other nucleic acids of Type A SDF-1 binding nucleic acids, the Type A SDF-1 binding nucleic acid 192- A 10-001 was characterized for its binding affinity to human SDF-1. The equilibrium binding constant KD was determined using the pull-down binding assay (KD = 1.5 nM) and by surface plasmon resonance measurement (KD = 1.0 nM). The IC₅₀ (inhibitory concentration 50%) of 0.12 nM for 192- A 10-001 was measured using a cell culture in vitro chemotaxis assay. Consequently, all Type A SDF-1 binding nucleic acids as depicted in Fig. 8 were analyzed in a competitive pull-down binding assay vs. 192 -A 10-001. The Type A SDF-1 binding nucleic acids 192-B11 and 192-C10 showed equal binding affinities as 192 -A 10-001 in these competition experiments. Weaker binding affinity was determined for Type A SDF-1 binding nucleic acids 192-G10, 192-F10, 192-C9, 192-E10, 192-D11, 192-G11, 192-H11 and 191-A6. The Type A SDF-1 binding nucleic acids 192-D 10, 192-E9 and 192-H9 have much weaker binding affinity than 192-A10-001.

As mentioned above, the Type A SDF-1 binding nucleic acid 192-Bl l and 192-C10 exhibit equal binding affinity to SDF-1 as 192- A 10-001. However, they show slight differences in the nucleotide sequence of the central stretch of nucleotides. Therefore the consensus sequence of the three molecules binding to SDF-1 with almost the same high affinity can be summarized by the nucleotide sequence [AAAGYAACAHGUCAAUGAAAGGUARq (Type A Formula- 4, SEQ ID NO: 139)) whereby the nucleotide sequence of the central stretch of nucleotides of

192-A10-001 (nucleotide sequence: |AAAGCAACAUGUCAAUGAAAGGUAGC|, SEQ ID NO: 439) represents the nucleotide sequence with the best binding affinity of Type A SDF-1 binding nucleic acids.

Five or six out of the six nucleotides of the 5 '-terminal stretch (also referred to as first terminal stretch) of Type A SDF-1 binding nucleic acids may hybridize to the respective five or six nucleotides out of the six nucleotides of the 3 '-terminal stretch (also referred to as second terminal stretch) to form a terminal helix. Although these nucleotides are variable at several positions, the different nucleotides allow for hybridization of five or six out of the six nucleotides of the 5'- and 3 '-terminal stretches each. The 5 '-terminal and 3 '-terminal stretches of Type A SDF-1 binding nucleic acids as shown in Fig. 8 can be summarized in a generic formula for the 5'-terminal stretch ('RSHRYR', Type A Formula-5-5') and for the 3'- terminal stretch ('YRYDSY', Type A Formula-5-3'). Truncated derivatives of Type A SDF- 1 binding nucleic acid 192-A 10-001 were analyzed in a competitive pull-down binding assay vs. the original molecule 192-A10-001 and 192-A10-008 (Fig. 9A and 9B). These experiments showed that a reduction of the six terminal nucleotides (5'end: GCUGUG; 3'end: CGCAGC) of 192-A10-001 to five nucleotides (5'end: CUGUG; 3'end: CGCAG) of the derivative 192 -Al 0-002 could be done without reduction of binding affinity. However, the truncation to four terminal nucleotides (5'end: UGUG; 3'end: CGCA; 192-A10-003) or less (192-A10-004/ -005/ -006/ -007) led to reduced binding affinity to SDF-1 (Fig. 9A). The determined 5 '-terminal and 3 '-terminal stretches with a length of five and four nucleotides of the derivatives of Type A SDF-1 binding nucleic acid 192 -Al 0-001 as shown in Figs. 9A and 9B can be described in a generic formula for the 5 '-terminal stretch ('X₂BBBS', Type A Formula-6-5') and of the 3'-terminal stretch ('SBBVX₃'; Type A Formula-6-3'), whereby X₂ is either absent or is 'S' and X₃ is either absent or is 'S'.

The nucleotide sequence of the 5'- and 3 '-terminal stretches has an influence on the binding affinity of Type A SDF-1 binding nucleic acids. This is not only shown by the nucleic acids 192-F10 and 192-E10, but also by derivatives of 192-A10-001 (Fig. 9B). The central stretch of 192-F10 and 192-E10 are identical to 192-B11 and 192-ClO, but comprise slight differences at the 3 '-end of 5 '-terminal stretch and at the 5 '-end of 3 '-terminal stretch resulting in reduced binding affinity.

The substitution of 5'- and 3'-terminal nucleotides 'CUGUG' and 'CGCAG' of Type A SDF-1 binding nucleic acid 192-A10-002 by 'GCGCG' and 'CGCGC' (192-A10-015) resulted in a reduced binding affinity whereas substitutions by 'GCGUG' and 'CGCGC (192-A10-008) resulted in same binding affinity as shown for 192-A10-002 (Fig. 9B). Additionally, nine derivatives of Type A SDF-1 binding nucleic acid 192-A 10-001 (192-A 10- 014/ -015/ -016/ -017/ -018/ -019/ -020/ -021/ -022/ -023) bearing four 5'- and 3'-terminal nucleotides respectively were tested as aptamers for their binding affinity vs. 192-A 10-001 or its derivative 192-A 10-008 (both have the identical binding affinity to SDF-1). All molecules showed weaker, much weaker or very much weaker binding affinity to SDF-1 as 192-A 10- 001 (six nucleotides forming a terminal helix) or as 192-A 10-008 with five terminal nucleotides, respectively (Fig. 9B). Consequently, the sequence and the number of nucleotides of the 5'- and 3 '-terminal stretches are essential for an effective binding to SDF-1. As shown for Type A SDF-1 binding nucleic acids 192- A 10-002 and 192- A 10-08 the preferred combination of 5'- and 3 '-terminal stretches are 'CUGUG' and 'CGCAG' (5'- and 3 '-terminal stretches of Type A SDF-1 binding nucleic acid 192-A 10-002) and 'GCGUG' and 'CGCGC (5'- and 3'-terminal stretches of Type A SDF-1 binding nucleic acid 192-A10- 008).

However, combining the 5 '-and 3 '-terminal stretches of all tested Type A SDF-1 binding nucleic acids the generic formula for the 5 '-terminal stretch of Type A SDF-1 binding nucleic acids is 'X^NNBV (Type A Formula-7-5') and the generic formula for the 3'-terminal stretch of Type A SDF-1 binding nucleic acids is 'BNBNX^' (Type A Formula-7-3'), whereas

Xi is 'R' or absent , X₂ is 'S', X₃ is 'S' and X4 is Ύ' or absent;

or

Xi is absent, X₂ is 'S' or absent, X₃ is 'S' or absent and X₄ is absent. Type B SDF-1 binding nucleic acid molecules

As depicted in Fig. 10 all sequences of SDF-1 binding nucleic acids of Type B comprise one central stretch of nucleotides which is flanked by 5'- and 3 '-terminal stretches (also referred to as first and second terminal stretch of nucleotides) that can hybridize to each other. However, such hybridization is not necessarily given in the molecule.

The sequences of the defined boxes or stretches may be different between the SDF-1 binding nucleic acids which influences the binding affinity to SDF-1. Based on binding analysis of the different SDF-1 binding nucleic acids, the central stretch of nucleotides and its nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to SDF-1.

The central stretch of nucleotides of all identified sequences of SDF-1 binding nucleic acids 193-C2-001, 193-G2-001 , 193-F2-001 , 193-G1-002, 193-D2-002, 193-A1-002, 193-D3-002, 193-B3-002, 193-H3-002, 193-E3-002 and 193-D1-002 share the sequence

|GUGUGAUCUAGAUGUADWGGCUGWUCCUAGUYAGG|(SEQ ID NO: 168). The SDF

1 binding nucleic acids 193-G2-001 , 193-C2-001 and 193-F2-001 that differ in one position of the central stretch of nucleotides (consenus sequence of central stretch of nucleotides: GUGUGAUCUAGAUGUADUGGCUGAUCCUAGUCAGd SEQ ID NO: 169) were analyzed in a competitive pull-down binding assay vs. the SDF-1 binding nucleic acid 192- AlO-001 (KD of 1.5 nM determined in a pull-down binding assay, IC₅₀ of 0.12 nM). Each of the SDF-1 binding nucleic acids 193-G2-001, 193-C2-001 and 193-F2 showed superior binding to human SDF-1 in comparison to SDF-1 binding nucleic acid 192- A 10-001 whereby the binding affinity of 193-G2-001 is as good as 193-C2-001 and 193-F2-001 (Fig. 10). The data suggests that the difference in the nucleotide sequence of the central stretch of nucleotides of SDF-1 binding nucleic acids 193-G2-001, 193-C2-001 and 193-F2-001 has no influence on the binding affinity to SDF-1. The SDF-1 binding nucleic acids 193-G1-002, 193-D2-002, 193-A1-002, 193-D3-002, 193-B3-002, 193-H3-002, 193-E3-002 and 193-D1- 002 showed reduced binding to human SDF-1 in comparison to SDF-1 binding nucleic acid 193-G2-001. SDF-1 binding nucleic acid 193-G2-001 was characterized for its binding affinity to human SDF-1. The equilibrium binding constant KD was determined using the pulldown binding assay (K_D = 0.3 nM). The IC₅₀ (inhibitory concentration 50%) of 0.08 nM for 193-G2-001 was measured using a cell culture in vitro chemotaxis assay.

Four, five or six nucleotides out of the six nucleotides of the 5 '-terminal stretch of SDF-1 binding nucleic acids may hybridize to the respective four, five or six out of the six nucleotides of the 3 '-terminal stretch of SDF-1 binding nucleic acids to form a terminal helix. Although the nucleotides are variable at several positions, the different nucleotides allow the hybridization for four, five or six nucleotides out of the six nucleotides of the 5'- and 3'- terminal stretches each. The 5 '-terminal and 3 '-terminal stretches of SDF-1 binding nucleic acids as shown in Fig. 10 can be summarized in a generic formula for the 5 '-terminal stretch ('Xi X₂GCRWG' whereas Xi is 'A' or absent, X₂ is 'G') and of the 3 '-terminal stretch ('KRYSCX₃X₄' whereas X₃ is 'G', X₄ is 'U' or absent). SDF-1 binding nucleic acids 193- Gl-002, 193-D2-002, 193-A1-002 and 193-D3-002 have weaker binding affinities to SDF-1 although they share the identical central stretch of nucleotides with 193-C2-001, 193-G2-001 and 193-F2-001 (Fig. 10). The-unfavorable binding properties of SDF-1 binding nucleic acids 193-G1-002, 193-D2-002, 193-A1-002 and 193-D3-002 may be due to the number of nucleotides and sequence of the 5'- and 3 '-terminal stretches.

Truncated derivatives of the SDF-1 binding nucleic acids 193-G2-001 and 193-C2-001 were analyzed in a competitive pull-down binding assay vs. 193-G2-001 and 193-G2-012, respectively (Fig. 11A and 11B). These experiments showed that a reduction of the six terminal nucleotides (5'end: AGCGUG; 3'end: UACGCU) of SDF-1 binding nucleic acids 193-G2-001 and 193-C2-001 to five nucleotides (5'end: GCGUG; 3'end: UACGC) lead to molecules with similar binding affinity (193-C2-002 and 193-G2-012). The equilibrium dissociation constant KD was determined using the pull-down binding assay (KD = 0.3 nM). A truncation to four (5'end: CGUG; 3'end: UACG; 193-C2-003) or less nucleotides (193-C2- 004, 193-C2-005, 193-C2-006, 193-C2-007) resulted in a reduced binding affinity to SDF-1 which was measured by using the competition pull-down binding assay (Fig. 11 A). The nucleotide sequence of the five terminal nucleotides at the 5'- and 3 '-end, respectively, has an influence on the binding affinity of SDF-1 binding nucleic acids. The substitution of 5'- and 3'-terminal nucleotides 'GCGUG' and 'UACGC (193-C2-002, 193-G2-12) by 'GCGCG' and 'CGCGC (193-G2-013) resulted in a reduced binding affinity. Additionally, the four different derivatives of SDF-1 binding nucleic acid 193-G2-001 with a terminal helix with a length of four base-pairing nucleotides (193-G2-014/ -015/ -016/ -017) were tested. All of them showed reduced binding affinity to SDF-1 (Fig. 11B). Therefore the sequence and the length of the 5'- and 3 '-terminal nucleotides are essential for an effective binding to SDF-1. The 5 '-terminal and 3 '-terminal stretches with a length of five and four nucleotides of the derivatives of SDF-1 binding nucleic acids 193-C2-003 and 193-G2-012 as shown in Figs. 11A and 1 IB can be described in a generic formula for the 5'-terminal stretch ('X^SSBS'), whereby X₁ is absent, X₂ is either absent or is 'G', and of the 3'-terminal stretch ('BVSSX₃X₄'), and whereby X₃ is either absent or is 'C and ¾ is absent. As shown for SDF- 1 binding nucleic acids 193-G2-001 and 193-C2-01 and their derivatives 193-G2-012 and 193-C2-002 the preferred combination of 5'- and 3'-terminal stretches are 'XiX₂GCGUG' (5'-terminal stretch) and 'UACGCX₃X₄' (3'-terminal stretch), whereas Xi is either 'A' or absent, X₂ is 'G' and X₃ is 'C and ¾ is 'U' or absent.

However, combining the 5 '-and 3 '-terminal stretches of all tested SDF-1 binding nucleic acids the generic formula for the 5 '-terminal stretch of SDF-1 binding nucleic acids is 'X₁X₂SVNS' and the generic formula for the 3'-terminal stretch SDF-1 binding nucleic acids is 'BVBSX₃X₄', whereas

Xi is 'A' or absent, X₂ is 'G', X₃ is 'C and X₄ is 'U' or absent; or is absent, X₂ is 'G' or absent, X₃ is 'C or absent and X4 is absent.

In order to prolong the Spiegelmer's plasma residence time in vivo, Spiegelmers 193-G2-012 was covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at the 5 '-end as described in chapter 4 (PEGylated-nucleic acid molecule: 193-G2-012-5'-PEG also referred to as NOX-A12). The PEGylated Spiegelmer NOX-A12 was analyzed in a cell culture in an in vitro TAX-assay and an inhibition of SDF-1 induced chemotaxis was determined (IC₅₀ of 0.2 nM).

Type C SDF-1 binding nucleic acid molecules

As depicted in Fig. 12 all sequences of SDF-1 binding nucleic acids of Type C comprise one central stretch of nucleotides which is flanked by 5'- and 3 '-terminal stretches (also referred to as first terminal stretch and second terminal stretch of nucleotides) that can hybridize to each other. However, such hybridization is not necessarily given in the molecule.

The sequences of the defined boxes or stretches may be different between the SDF-1 binding nucleic acids of Type C which influences the binding affinity to SDF-1. Based on binding analysis of the different SDF-1 binding nucleic acids summarized as Type C SDF-1 binding nucleic acids, the core nucleotide sequence and its nucleotide sequence as described in the following are individually and more preferably in their entirety essential for binding to SDF- 1.

The central stretch of nucleotides of all identified sequences of Type C SDF-1 binding nucleic acids share the sequence |GGUYAGGGCUHRX_AAGUCGG| (Type C Formula- 1, SEQ ID

NO: 193), whereby X_A is either absent or is Ά'. With the exception of Type C SDF-1 binding nucleic acid 197-D1 the central stretch of nucleotides of all identified sequences of Type C

SDF-1 binding nucleic acids share the nucleotide sequence |GGUYAGGGCUHRAAGUCGG| (Type C Formula-2, SEQ ID NO: 194). Type C SDF-1 binding nucleic acid 197-D1 (central stretch of nucleotides: |GGUUAGGGCUAA-AGUCGG| (SEQ ID NO: 440) missing one nucleotide 'A' within the central stretch of nucleotides and still binding to SDF-1 let conclude an alternative central stretch of nucleotides (|GGUYAGGGCUHR-AGUCGG|, Type C Formula-3, SEQ ID NO: 195). Initially, all Type C SDF-1 binding nucleic acids as depicted in Fig. 12 were analyzed in a competitive pull-down binding assay vs. Type A SDF-1 binding nucleic acid 192- A 10-001 ( _D = 1.5 nM determined by pull-down assay and by surface plasmon resonance measurements; IC₅₀ = 0.12 nM). The Type C SDF-1 binding nucleic acids 191-D5-001, 197-B2, 190-A3-001, 197-H1, 197-H3 and 197-E3 showed weaker binding affinities than 192- A 10-001 in competition experiments. Much weaker binding affinity was determined for 191-A5, 197-B1, 197-D1, 197-H2 and 197-D2 (Fig. 12). The molecules or derivatives thereof were further characterized by further competitive pull-down binding assays, plasmon resonance measurements and an in vitro chemotaxis assay. The Type C SDF- 1 binding nucleic acid 191-D5-001 was characterized for its binding affinity to human SDF-1 whereas the equilibrium binding constant KD was determined by surface plasmon resonance measurement (KD = 0.8 nM). The IC₅₀ (inhibitory concentration 50%) of 0.2 nM for 191-D5- 001 was measured using a cell-culture in vitro chemotaxis assay. The binding affinity of Type C SDF-1 binding nucleic acid 197-B2 for human SDF-1 was determined by surface plasmon resonance measurement (KD = 0.9 nM), its IC₅₀ (inhibitory concentration 50%) of 0.2 nM was analyzed in a cell-culture in vitro chemotaxis assay. These data indicates that Type C SDF-1 binding nucleic acids 191-D5-001 and 197-B2 have the similar binding affinity to SDF-1 (Fig. 12 and 15).

Type C SDF-1 binding nucleic acid 190- A3 -001 comprises a 5 '-terminal stretch of 17 nucleotides and a 3 '-terminal stretch of 12 nucleotides whereby on the one hand the four nucleotides at the 5 '-end of the 5 '-terminal stretch and the four nucleotides at the 3 '-end of the 3 '-terminal stretch may hybridize to each other to form a terminal helix. Alternatively the nucleotides 'UGAGA' in the 5 '-terminal stretch may hybridize to the nucleotides 'UCUCA' in the 3 '-terminal stretch to form a terminal helix. A reduction to eight nucleotides of the 5'- terminal stretch ('GAGAUAGG') and to nine nucleotides of the 3'-terminal stretch ('CUGAUUCUC') of molecule 190-A3-001 (whereby six out of the eight/nine nucleotides of the 5'- and 3 '-terminal stretch can hybridize to each other) does not have an influence on the binding affinity to SDF-1 (190-A3-004; Fig. 13). The equilibrium binding constant KD of 190-A3-004 was determined using the pull-down binding assay (KD = 4.6 nM) and by surface plasmon resonance measurement (KD = 4.7 nM). The IC₅₀ (inhibitory concentration 50%) of 0.1 nM for 190- A3 -004 was measured using a cell-culture in vitro chemotaxis assay. However, the truncation to two nucleotides at the 5 '-terminal stretch leads to a very strong reduction of binding affinity (190-A3-007; Fig. 13). The Type C SDF-1 binding nucleic acids 191-D5-001, 197-B2 and 197-Hl (central stretch of nucleotides: |GGUUAGGGCUAGAAGUCGG|, SEQ ID 441, 197-H3/191-A5 (central stretch of nucleotides: GGUUAGGGCUCGAAGUCGG1, SEQ ID NO: 442 and 197-E3/197-B1

(central stretch of nucleotides: |GGUUAGGGCUUGAAGUCGG|, SEQ ID NO: 443 share an almost identical central stretch of nucleotides (Type C formula-4; nucleotide sequence: iGGUUAGGGCUHGAAGUCGGj SEQ ID NO: 196). 191-D5-001, 197-B2 and 197-Hl do not share a similar 5'- and 3 '-terminal stretch (197-H3 and 197-E3 have the identical 5'- and 3'-terminal stretch as 197-B2). However, the respective ten (197-B2, 197-E3, 197-H3) or nine out of the ten (191-D5-001, 197-Hl) nucleotides of the 5'-terminal stretch may hybridize to the respective ten (197-B2, 197-E3, 197-H3) or nine out of the ten (191-D5-001, 197-Hl) nucleotides of the 3 '-terminal stretch (Fig. 12). Thus, the 5 '-terminal stretch of Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001, 197-Hl, 197-E3 and 197-H3 as mentioned above plus 191-A5, 197-B1, 197-H2, 197-D1 and 197-D2 comprise a common generic nucleotide sequence of 'RKSBUSNVGR' (Type C Formula-5-5', SEQ ID NO: 223). The 3'-terminal stretch of Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001, 197-Hl, 197-E3, and 197-H3 as mentioned above plus 191-A5, 197-B1, 197-H2, 197-D1 and 197-D2 comprise a common generic nucleotide sequence of 'YYNRCASSMY' (Type C Formula-5-3', SEQ ID NO: 224), whereby the 5' and the 3 '-terminal stretches of Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001, 197-Hl, 197-E3 and 197-H3 are preferred. These preferred 5'- and 3'-terminal stretches of Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001, 197- Hl, 197-E3 and 197-H3 can be summarized in the generic formula ' RKSBUGS VGR' (Type C Formula-6-5'; 5'-terminal stretch, SEQ ID NO: 225) and 'YCNRCASSMY' (Type C Formula-6-3'; 3'-terminal stretch, SEQ ID NO: 226).

Truncated derivatives of Type C SDF-1 binding nucleic acid 191-D5-001 were constructed and tested in a competitive pull-down binding assay vs. the original molecule 191-D5-001 (Fig. 14A, Fig. 14B). At first the length of the 5'- and 3'-terminal stretches were shortened from ten nucleotides (191-D5-001) each to seven nucleotides each (191-D5-004) as depicted in Fig. 14A whereby nine out of the ten (191-D5-001) or six out of the seven nucleotides (191-D5-004) of the 5'-terminal stretch and of the 3'-terminal stretch, respectively can hybridize to each other. The reduction to seven nucleotides of the 5'- and 3'- terminal stretch respectively (whereas six out of the seven nucleotides can hybridize to each other) led to reduced binding affinity to SDF-1 (191-D5-004). The terminal stretches of Type C SDF-1 binding nucleic acid 191-D5-004 were modified whereby the non-pairing nucleotide 'A' within the 3'-terminal stretch of 191-D5-004 was substituted by a 'C (191-D5-005). This modification led to an improvement of binding. This derivative, Type C SDF-1 binding nucleic acid 191-D5-005, showed similar binding to SDF-1 as 191-D5-001. Further truncation of the 5'- and 3 '-terminal stretch to five nucleotides respectively led to a molecule with a length of total 29 nucleotides (191-D5-007). Because of the similarities of 191-D5-001 and of the Type C SDF-1 binding nucleic acids 197-B2, 191-D5-001, 197-H1, 191-A5, 197-H3, 197- Bl, 197-E3, 197-D1, 197-H2 and 197-D2 and because of the data shown for 191-D5-007 it may assume that the 5 '-and 3 '-terminal stretch can in principle be truncated down to five nucleotides whereby the nucleotide sequence 'CGGGA' for 5'-terminal stretch and 'UCCCG' for the 3 '-terminal stretch was successfully tested (Type C SDF-1 binding nucleic acid 191- D5-007). Type C SDF-1 binding nucleic acid 191-D5-007 surprisingly binds somewhat better to SDF-1 than 191-D5-001 (determined on aptamer level using the competition binding assay). The equilibrium binding constant KD of 191-D5-007 was determined using the pulldown binding assay (KD = 2.2 nM) and by surface plasmon resonance measurement (KD ⁼ 0.8 nM). The IC₅₀ (inhibitory concentration 50%) of 0.1 nM for 191-D5-007 was measured using a cell-culture in vitro chemotaxis assay. Further truncation of both terminal stretches to four nucleotides (191-D5-010, Fig.14 A).

Further derivatives of Type C SDF-1 binding nucleic acid 191-D5-001 (191-D5-017/ -024/ - 029) bearing 5'- and 3 '-terminal stretches of respectively four nucleotides also showed reduced binding affinity to SDF-1 in the competition pull-down binding assay vs. 191-D5-007 (Fig. 14B). Alternative 5'- and 3 '-terminal stretches with a length of respectively five nucleotides were additionally tested, too (191-D5-017-29a, 191-D5-017-29b, 191-D5-019- 29a, 191-D5-024-29a, 191-D5-024-29b). The generic formula of these derivatives for the 5'- terminal stretch is 'X_SSSSV (Type C Formula-7-5') and for the 3'-stretch is 'BSSSX_S' Type C Formula-7-3'), whereby Xs is absent or ,S'. Two out of the five tested variants showed identical binding affinity to SDF-1 as 191-D5-007 (191-D5-024-29a, 191-D5-024-29b; Fig. 14B). The sequences of the 5'-terminal and 3'-terminal stretches of 191 -D5-001 -derivatives that show the best binding affinity to SDF-1 and comprise a 5 '-terminal and 3 '-terminal stretch of five nucleotides respectively (191-D5-007, 191-D5-024-29a, 191-D5-024-29b) can be summarized in a generic formula (5 '-terminal stretch: 'SGGSR', Type C Formula-8-5'; 3'- terminal stretch: , YSCCS', Type C Formula-8-3').

Truncated derivatives of Type C SDF-1 binding nucleic acid 197-B2 were analyzed in a competitive pull-down binding assay vs. the original molecule 197-B2 and 191-D5-007 (Fig. 15). Using the competitive pull-down binding assay vs. 191-D5-007 it was shown that 197-B2 has the same binding affinity to SDF-1 as 191-D5-007. The 5'- and 3'-terminal stretches were shortened without loss of binding affinity from ten nucleotides (197-B2) each to five nucleotides each (197-B2-005) whereby the nucleotides of the 5 '-terminal stretch and of the 3 '-terminal stretch can completely hybridize to each other. If the 5 '-terminal ('GCGGG') and 3'-terminal ('CCUGC') stretch of 197-B2-005 was substituted by 'GCCGG' (5 '-terminal stretch) and by 'CCGGC (3 '-terminal stretch) of 197-B2-006, the binding affinity to SDF-1 fully persisted. Because 197-B2 and 191-D5-001 (and their derivatives) share the identical core nucleotide sequence and several derivatives of 191-D5 with 5'- and 3 '-terminal stretches with a length of respectively four nucleotides were tested, a further truncation of the 5'- and 3 '-terminal stretch was omitted. Two further derivatives were designed that comprise six nucleotides at the 5'- and 3 '-end (5'- and 3 '-terminal stretches) respectively. The binding affinity to SDF-1 of both molecules (197-B2-006-31a and 197-B2- 006-3 lb) is the same as shown for 191-D5-007 and 197-B2-006 (Fig. 15). The sequences of the 5 '-terminal and 3 '-terminal stretches of 197-B2 derivatives that show the best binding affinity to SDF-1 and comprise a 5 '-terminal and 3 '-terminal stretch of five nucleotides respectively can be summarized in a generic formula (5'-terminal stretch: 'GCSGG', Type C Formula-9-5'; 3'-terminal stretch: ,CCKGC, Type C Formula-9-3').

Combining the preferred 5'- and 3 '-stretches of truncated derivatives of Type C SDF-1 binding nucleic acids 191-D5-001 (5'-terminal stretch: 'SGGSR', Type C Formula-8-5'; 3'- terminal stretch: ,YSCCS', Type C Formula-8-3') and 197-B2 (5'-terminal stretch: 'GCSGG', Type C Formula-9-5'; 3'-terminal stretch: ,CCKGC, Type C Formula-9-3') the common preferred generic formula for the 5'-terminal and the 3'-terminal stretch is 'SSSSR' (5'-terminal stretch, Type C Formula- 10-5') and 'YSBSS' (3'-terminal stretch: Type C Formula-10-3'). Further SDF-1 binding nucleic acid molecules

Additionally, further three SDF-1 binding nucleic acids that do not share the SDF-1 binding motifs of 'Type A', 'Type B' and 'Type C were identified and are referred to herein as "Type D". There were analyzed as aptamers using the pull-down binding assay (Fig. 16).

It is to be understood that any of the sequences shown in Figs. 8 through 16 are nucleic acid molecules according to the present invention, including those truncated forms thereof but also including those extended forms thereof under the proviso, however, that the thus truncated and extended, respectively, nucleic acid molecules are still capable of binding to the target.

Example 4: Synthesis and derivatization of Aptamers and Spiegelmers Small scale synthesis

Aptamers and Spiegelmers were produced by solid-phase synthesis with an ABI 394 synthesizer (Applied Biosystems, Foster City, CA, USA) using 2'TBDMS RNA phosphoramidite chemistry (Damha et al, 1993). rA(N-Bz)-, rC(Ac)-, rG(N-ibu)-, and rU- phosphoramidites in the D- and L-configuration were purchased from ChemGenes, Wilmington, MA. Aptamers and Spiegelmers were purified by gel electrophoresis.

Large scale synthesis plus modification

Spiegelmers were produced by solid-phase synthesis with an AktaPilotlOO synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg) using 2'TBDMS RNA phosphoramidite chemistry (Damha et al, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-, and L-rU- phosphoramidites were purchased from ChemGenes, Wilmington, MA. The 5'-amino- modifier was purchased from American International Chemicals Inc. (Framingham, MA, USA). Synthesis of the unmodified Spiegelmer was started on L-riboG, L-riboC, L-riboA or L- riboU modified CPG pore size 1000 A (Link Technology, Glasgow, UK); for the 3'-NH₂- modified Spiegelmer, 3'-Aminomodifier-CPG, 1000 A (ChemGenes, Wilmington, MA) was used. For coupling (15 min per cycle), 0.3 M benzylthiotetrazole (CMS-Chemicals, Abingdon, UK) in acetonitrile, and 3.5 equivalents of the respective 0.1 M phosphoramidite solution in acetonitrile was used. An oxidation-capping cycle was used. Further standard solvents and reagents for oligonucleotide synthesis were purchased from Biosolve (Valkenswaard, NL). The Spiegelmer was synthesized DMT-ON; after deprotection, it was purified via preparative RP-HPLC (Wincott F. et al. 1995) using Source 15RPC medium (Amersham). The 5'DMT-group was removed with 80% acetic acid (30 min at RT). Subsequently, aqueous 2 M NaOAc solution was added and the Spiegelmer was desalted by tangential-flow filtration using a 5 K regenerated cellulose membrane (Millipore, Bedford, MA).

PEGylation of Spiegelmers

In order to prolong the Spiegelmer' s plasma residence time in vivo, the Spiegelmers were covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at the 3 '-end or 5 '-end.

3 '-PEGylation

For PEGylation (for technical details of the method for PEGylation see European patent application EP 1 306 382), the purified 3 '-amino modified Spiegelmer was dissolved in a mixture of H₂0 (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by mixing citric acid · ¾0 [7 g], boric acid [3.54 g], phosphoric acid [2.26 ml], and 1 M NaOH [343 ml] and adding H20 to a final volume of 1 1; pH = 8.4 was adjusted with 1 M HC1).

The pH of the Spiegelmer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG- NHS ester (Nektar Therapeutics, Huntsville, AL) was added at 37°C every 30 min in four portions of 0.6 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8 - 8.5 with 1 M NaOH during addition of the PEG-NHS ester.

The reaction mixture was blended with 4 ml urea solution (8 M), 4 ml buffer A, and 4 ml buffer B (0.1 M triethylammonium acetate in H₂0) and heated to 95°C for 15 min. The PEGylated Spiegelmer was then purified by RP-HPLC with Source 15RPC medium (Amersham), using an acetonitrile gradient (buffer B; buffer C: 0.1 M triethylammonium acetate in acetonitrile). Excess PEG eluted at 5% buffer C, PEGylated Spiegelmer at 10 - 15% buffer C. Product fractions with a purity of >95% (as assessed by HPLC) were combined and mixed with 40 ml 3 M NaOAC. The PEGylated Spiegelmer was desalted by tangential- flow filtration (5 K regenerated cellulose membrane, Millipore, Bedford MA). 5'-PEGylation

For PEGylation (for technical details of the method for PEGylation see European patent application EP 1 306 382), the purified 5 '-amino modified Spiegelmer was dissolved in a mixture of H₂0 (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by mixing citric acid · ¾0 [7 g], boric acid [3.54 g], phosphoric acid [2.26 ml], and 1 M NaOH [343 ml] and adding water to a final volume of 1 1; pH = 8.4 was adjusted with 1 M HC1).

The pH of the Spiegelmer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG- NHS ester (Nektar Therapeutics, Huntsville, AL) was added at 37°C every 30 min in six portions of 0.25 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8 - 8.5 with 1 M NaOH during addition of the PEG-NHS ester.

The reaction mixture was blended with 4 ml urea solution (8 M), , and 4 ml buffer B (0.1 M triethylammonium acetate in H₂0) and heated to 95°C for 15 min. The PEGylated Spiegelmer was then purified by RP-HPLC with Source 15RPC medium (Amersham), using an acetonitrile gradient (buffer B; buffer C: 0.1 M triethylammonium acetate in acetonitrile). Excess PEG eluted at 5% buffer C, PEGylated Spiegelmer at 10 - 15% buffer C. Product fractions with a purity of >95% (as assessed by HPLC) were combined and mixed with 40 ml 3 M NaOAC. The PEGylated Spiegelmer was desalted by tangential-flow filtration (5 K regenerated cellulose membrane, Millipore, Bedford MA).

Example 5: Determination of Binding Constants (Pull-Down Assay) Direct pull-down assay

The affinity of aptamers to D-MCP-1 or D-SDF-1 was measured in a pull down assay format at 20 or 37°C, respectively. Aptamers were 5 '-phosphate labeled by T4 polynucleotide kinase (Invitrogen, Karlsruhe, Germany) using [γ- P]-labeled ATP (Hartmann Analytic, Braunschweig, Germany). The specific radioactivity of labeled aptamers was 200,000 - 800,000 cpm/pmol. Aptamers were incubated after de- and renaturation at 20 pM concentration at 37°C in selection buffer (20 mM Tris-HCl pH 7.4; 137 mM NaCl; 5 mM C1; 1 mM MgCl₂; 1 mM CaCl₂; 0.1% [w/vol] Tween-20) together with varying amounts of biotinylated D-MCP-1 or D-SDF-1 for 4 - 12 hours in order to reach equilibrium at low concentrations. Selection buffer was supplemented with 10 g/ml human serum albumin (Sigma- Aldrich, Steinheim, Germany), and 10 μg/ml yeast RNA (Ambion, Austin, USA) in order to prevent adsorption of binding partners with surfaces of used plasticware or the immobilization matrix. The concentration range of biotinylated D-MCP-1 or D-SDF-1 was set from 8 pM to 100 nM; total reaction volume was 1 ml. Peptide and peptide-aptamer complexes were immobilized on 1.5 μΐ Streptavidin Ultralink Plus particles (Pierce Biotechnology, Rockford, USA) which had been preequilibrated with selection buffer and resuspended in a total volume of 6 μΐ. Particles were kept in suspension for 30 min at the respective temperature in a thermomixer. Immobilized radioactivity was quantitated in a scintillation counter after detaching the supernatant and appropriate washing. The percentage of binding was plotted against the concentration of biotinylated D-MCP-1 or D-SDF-1 and dissociation constants were obtained by using software algorithms (GRAFIT; Erithacus Software; Surrey U.K.) assuming a 1 :1 stoichiometry.

Competitive pull-down assay

In order to compare different D-MCP-1 or D-SDF-1 binding aptamers, a competitive ranking assay was performed. For this purpose the most affine aptamer available was radioactively labeled (see above) and served as reference. After de- and renaturation it was incubated at 37°C with biotinylated D-MCP-1 or D-SDF-1 in 1 ml selection buffer at conditions that resulted in around 5 - 10 % binding to the peptide after immobilization and washing on NeutrAvidin agarose or Streptavidin Ultralink Plus (both from Pierce) without competition. An excess of de- and renatured non-labeled D-RNA aptamer variants was added to different concentrations (e.g. 2, 10, and 50 nM) with the labeled reference aptamer to parallel binding reactions. The aptamers to be tested competed with the reference aptamer for target binding, thus decreasing the binding signal in dependence of their binding characteristics. The aptamer that was found most active in this assay could then serve as a new reference for comparative analysis of further aptamer variants. Example 6: Analysis of the inhibition of MCP-1 induced chemotaxis by MCP-1- binding Spiegelmers

THP-1 cells grown as described above were centrifuged, washed once in HBH (HBSS, containing 1 mg/ml bovine serum albumin and 20 mM HEPES) and resuspended at 3 x 10⁶ cells/ml. 100 μΐ of this suspension were added to Transwell inserts with 5 μπι pores (Corning, #3421). In the lower compartments MCP-1 was preincubated together with Spiegelmers in various concentrations in 600 μΐ HBH at 37°C for 20 to 30 min prior to addition of cells. Cells were allowed to migrate at 37°C for 3 hours. Thereafter the inserts were removed and 60 μΐ of 440 μΜ resazurin (Sigma) in phosphate buffered saline was added to the lower compartments. After incubation at 37°C for 2.5 hours, fluorescence was measured at an excitation wavelength of 544 nm and an emission wavelength of 590 nm in a Fluostar Optima multidetection plate reader (BMG).

Determination of half-maximal effective concentration (EC₅₀) for human MCP-1

After 3 hours migration of THP-1 cells towards various human MCP-1 concentrations, a dose-response curve for human MCP-1 was obtained, indicating a maximal effective concentration of about 1 nM and reduced activation at higher concentrations. For the further experiments on inhibition of chemotaxis by Spiegelmers a MCP-1 concentration of 0.5 nM was used.

Determination of half-maximal effective concentration (EC₅₀) for murine MCP-1

After 3 hours migration of THP-1 cells towards various murine MCP-1 concentrations, a dose-response curve for murine MCP-1 was obtained, indicating a maximal effective concentration of about 1 - 3 nM and reduced activation at higher concentrations. For the further experiments on inhibition of chemotaxis by Spiegelmers a murine MCP-1 concentration of 0.5 nM was used.

Example 7: Analysis of the inhibition of SDF-1 induced chemotaxis by SDF-l-binding

Spiegelmers

Jurkat human T leukemia cells (obtained from DSMZ, Braunschweig) were cultivated at 37°C and 5% C0₂ in RPMI 1640 medium with Glutamax (Invitrogen, Karlsruhe, Germany) which contains 10% fetal bovine serum, 100 units/ml penicillin and 100 μ|¾/ηι1 streptomycin (Invitrogen, Karlsruhe, Germany). One day before the experiment, cells were seeded in a new flask with a density of 0.3 x 10⁶/ml (9 x 10⁶/30 ml) in standard medium (Invitrogen, Karlsruhe, Germany).

For the experiment, cells were centrifuged (5min at 300g ), resuspended, counted and washed once with 15 ml HBH (Hanks balanced salt solution containing 1 mg/ml bovine serum albumin and 20 mM HEPES; Invitrogen, Karlsruhe, Germany). Then the cells were resuspended at 3 x 10⁶/ml or 1.33 x 10⁶/ml, depending on the type of filter plate used. Cells were then allowed to migrate through the porous membranes of the filter plates for several hours towards a solution containing SDF-1 and various amounts of Spiegelmer. Either Transwell plates and inserts with porous Polycarbonate membrane, 5 μιη pore size (Corning; 3421) or MultiScreen MIC plates (Millipore, MAMIC5S10) were used.

Protocol for Transwell plates

The stimulation solutions (SDF-1 + various concentrations of Spiegelmer) were made up in 600 μΐ HBH in the lower compartments of the Transwell plates and incubated for 20 - 30 min. All conditions were made up at least twice. The inserts were transferred to the wells containing the stimulation solutions and 100 μΐ of a cell suspension with 3 x 10⁶/ml were added to the inserts (3 x 10⁵ cells/well). The cells were then allowed to migrate for 3 h at 37°C.

Thereafter, the inserts were removed and 60 μΐ resazurin (Sigma, Deisenhofen, Germany) working solution (440 μΜ in PBS; Biochrom, Berlin, Germany) were added to the wells (also to calibration wells). The plates were then incubated at 37°C for 2.5 to 3 h. After incubation, 200μ1 of each well were transferred to a black 96 well plate. Measurement of the fluorescence signals was done at 544 nm (excitation) and 590 nm (emission) in a Fluostar Optima multidetection plate reader (BMG, Offenburg, Germany).

Protocol for Millipore MultiScreen plates

The stimulation solutions (SDF-1 + various concentrations of Spiegelmer) were made up as 10X solutions in a 0.2 ml low profile 96-tube plate. 135 μΐ HBH were pipetted into the lower compartments of the MultiScreen plate and 15 μΐ of the stimulation solutions were added. All conditions were made up as triplicates. After 20 to 30 min the filter plate was inserted into the plate containing the stimulation solutions and 75 μΐ of a cell suspension with 1.33 x 10⁶/ml were added to the wells of the filter plate (1 x 10⁵ cells/well). The cells were then allowed to migrate for 3 h at 37°C. Thereafter, the insert plate is removed and 20 μΐ resazurin working solution (440 μΜ in PBS) are added to the lower wells. The plates were then incubated at 37°C for 2.5 to 3 h. After incubation, ΙΟΟμΙ of each well were transferred to a black 96 well plate. Measurement of the fluorescence signals was performed as described above.

Evaluation

For evaluation, fluorescence values were corrected for background fluorescence (no cells in well). Then the difference between experimental conditions with and without SDF-1 was calculated. The value for the sample without Spiegelmer (SDF-1 only) was set 100% and the values for the samples with Spiegelmer were calculated as per cent of this. For a dose- response curve the per cent-values were plotted against Spiegelmer concentration and the IC5o-value (concentration of Spiegelmer at which 50% of the activity without Spiegelmer is present) was determined graphically from the resulting curve.

Results

Human SDF-1 was found to stimulate migration of Jurkat cells in a dose dependent manner, with half-maximal stimulation at about 0.3 nM.

When cells were allowed to migrate towards a solution containing human SDF-1 plus increasing concentrations of SDF-1 binding Spiegelmers, dose-dependent inhibition was observed. The respective IC50s of the tested Spiegelmers are specified in Example 3. When an unspecific Control Spiegelmer was used instead of SDF-1 binding Spiegelmers, no inhibitory effect was observed up to 1 μΜ.

Example 8: Binding Analysis by Surface Plasmon Resonance Measurement

The Biacore 2000 instrument (Biacore AB, Uppsala, Sweden) was used to analyze binding of Spiegelmers to the proteins human MCP-1 and human SDF-la. When coupling of human MCP-1 or human SDF-la was to be achieved via amine groups, human MCP-1 or human SDF-Ι was dialyzed against water for 1 - 2 h (Millipore VSWP mixed cellulose esters; pore size, 0.025 μΜ) to remove interfering amines. CM4 sensor chips (Biacore AB, Uppsala, Sweden) were activated before protein coupling by a 35-μ1 injection of a 1 :1 dilution of 0.4 M NHS and 0.1 M EDC at a flow of 5 μΐ/min. Human MCP-1 or human SDF-Ια was then injected in concentrations of 0.1 - 1.5 μg/ml at a flow of 2 μΐ/min until the instrument's response was in the range of 1000 - 2000 RU (relative units). Unreacted NHS esters were deactivated by injection of 35 μΐ ethanolamine hydrochloride solution (pH 8.5) at a flow of 5 μΐ/min. The sensor chip was primed twice with binding buffer and equilibrated at 10 μΐ/min for 1 - 2 hours until the baseline appeared stable. For all proteins, kinetic parameters and dissociation constants were evaluated by a series of Spiegelmer injections at concentrations of 1000, 500, 250, 125, 62.5, 31.25, and 0 nM in selection buffer (Tris-HCl, 20 mM; NaCl, 137 mM; KC1, 5 mM; CaCl₂, 1 mM; MgCl₂, 1 mM; Tween20, 0.1% [w/v]; pH 7.4). In all experiments, the analysis was performed at 37°C using the Kinject command defining an association time of 180 and a dissociation time of 360 seconds at a flow of 10 μΐ/min. Data analysis and calculation of dissociation constants (K_D) was done with the BIAevaluation 3.0 software (BIACORE AB, Uppsala, Sweden) using the Langmuir 1 :1 stochiometric fitting algorithm.

Example 9: Efficacy of Spiegelmer mNOX-E36 in a mouse model of non-alcoholic steatohepatitis

The epidemic occurrence of obesity has led to a rapid increase in the incidence of nonalcoholic fatty liver disease (abbr. NAFLD) in industrial countries. The disease spectrum includes hepatic steatosis, lobular inflammation with steatohepatitis (abbr. NASH) and varying degrees of liver fibrosis, which can progress to cirrhosis. Hepatocellular carcinoma can develop in patients with NASH, even in the absence of cirrhosis. The majority of patients with primary NASH exhibit risk factors that define the metabolic syndrome including insulin resistance and visceral obesity. It has been demonstrated that patients with NAFLD are characterized by a low-grade systemic inflammation. The fact that patients with NASH exhibit much higher levels of CCL2/MCP-1 compared with NAFLD patients indicate that this chemokine might be of importance for the conversion from simple steatosis to NASH. In the employed model, the mice progress within ca. four weeks from steatosis (simple NAFLD) via NASH to fibrosis. Therapeutic intervention included treatment with three different doses of MCP-1 binding Spiegelmer mNOX-E36, vehicle, and Telmisartan (an angiotensin II receptor antagonist) as pharmacological reference substance.

The aim of this study was to evaluate the efficacy of mNOX-E36 on NASH induced in the proprietary model as offered by Stelic Institute & Co., Tokyo, Japan. After inducing NASH in the two-hit model, mice were treated subcutaneously every other day from the begin of week 7 for two weeks with three different doses of mNOX-E36 (0.2, 2 and 20 mg/kg [oligonucleotide portion]). Telmisartan (an angiotensin II receptor antagonist) was administered p.o. with 15 mg/kg daily.

Materials

The PEGylated Spiegelmer mNOX-E36 was provided as lyophilized powder. The vehicle, 5% glucose (sterile solution for injection), was obtained from Otsuka Pharmaceutial Factory, Japan. Telmisartan was purchased from Sigma (St. Louis, MO) and was dissolved in 0.5% hydroxyethylcellulose just before use.

Results

Effect of treatment on liver fibrosis: Sirius red staining demonstrated the collagen deposition in the sinusoids of the pericentral region (zone 3) of liver lobule in the vehicle group. The percentages of the sirius-red positive area in zone 3 were markedly decreased in all treatment groups, with the greatest improvement being seen in the mNOX-E36 20 mg/kg, compared to the vehicle group (vehicle: 1.01 ± 0.32, mNOX-E36 20 mg/kg: 0.44 ± 0.06, pO.001, mNOX- E36 2 mg/kg: 0.66 ± 0.18, pO.01, mNOX-E36: 0.2 mg/kg: 0.66 ± 0.14, p<0.01, Telmisartan: 0.57 ± 0.16, pO.01)

Effect of treatment on the NAFLD activity score: Hematoxylin-eosin staining demonstrated infiltration of inflammatory cell foci, which included neutrophils and lymphocytes, in the liver sections of the vehicle group. mNOX-E36 20 mg/kg, 2 mg/kg and 0.2 mg/kg treatments tended to decrease the number of the inflammatory foci. None of the mNOX-E36 doses showed prominent effects on hepatocellular ballooning and fat deposition in the NASH liver. Telmisartan treatment decreased the infiltration of inflammatory cells in the liver compared to the Vehicle group, but did not affect fat deposition nor ballooning. In accordance with these findings, mild to moderate histological improvement in NASH was shown in mNOX-E36 2 mg/kg (3.6 ± 1.2), mNOX-E36 0.2 mg/kg (3.9 ± 1.1) and Telmisartan (3.6 ± 0.8) treatment groups compared to the Vehicle group (4.9 ± 1.1).

Conclusion

From a clinicopathological standpoint, the pericentral vein area (zone 3) perisinusoidal fibrosis is characteristic for NASH liver (Brunt et al. Am J 1999 In addition, it is advocated that zone 3 fibrosis confers a significantly worse prognosis of NASH (Burt et al., 1998). Accordingly, this pharmacological study was executed focusing on hepatic inflammation and zone-3 perisinusoidal fibrosis.

Treatment of NASH mice with any dose of mNOX-E36 from 7 weeks to 9 weeks of age ameliorated lobular inflammation and zone-3 fibrosis compared to the Vehicle group as shown in the results of NAFLD Acticity Score and Sirius-red positive area.

These results suggest that mNOX-E36 has a preventive effect on the development of fibrosis via inhibition of infiltration of inflammatory cells and fat deposition. The potency of mNOX- E36 could be comparable to telmisartan, for which anti-steatohepatisis and anti-fibrosis activities have been well demonstrated in the NASH model. The mechanism by which mNOX-E36 inhibited inflammation and fibrosis is unknown, however, it is probable that inhibition of MCP-1 -mediated infiltration of inflammatory cells relates to the mechanism of action because mNOX-E36 treatment demonstrably decreased the number of inflammatory foci in the lobular region.

Example 10: Effects of a combination therapy of MCP-1 and SDF-1 binding nucleic acids on diabetic kidney disease

Diabetic nephropathy (abbr. DN) is a leading cause of chronic kidney disease (abbr. CKD). Novel treatment strategies are necessary because the current concept of angiotensin blockade and blood pressure control cannot prevent disease progression in all cases. In diabetic nephropathy the glomerular tuft undergoes a slow but progressive structural remodelling characterized by glomerular hypertrophy, diffuse and nodular accumulation of extracellular mesangial matrix, and podocyte damage. The latter is thought to account for the progression of microalbuminuria in early stages to overt proteinuria and glomerulosclerosis in late stages of diabetic nephropathy. Diabetic nephropathy onset and progression involves numerous additional pathomechanisms including the deposition of advanced glycosylation endproducts, endothelial dysfunction, and the increased local expression of growth factors and proinflammatory mediators. The majority of chemokines belongs to the latter group of factors because pro-inflammatory chemokines promote tissue inflammation and remodeling by recruiting and activating immune cells in diabetic nephropathy like in other types of kidney diseases. For example, targeted inhibition of the monocyte chemoattractant protein MCP-1 signaling can prevent glomerulosclerosis by blocking macrophage recruitment to glomeruli of mice with type 1 or type 2 diabetes. In fact, MCP-1 may represent a promising therapeutic target in DN because delayed onset of MCP-1 blockade was able to prevent diabetic glomerulosclerosis and restored glomerular filtration rate (abbr. GFR) by preventing glomerular macrophage recruitment in late-stage DN of uninephrectomized db/db mice with type 2 diabetes (Moser et al., 2004; WO 2009/068318).

Although structurally related, a subgroup of the chemokine superfamily, known as homeostatic chemokines, displays functions independent of tissue inflammation. Homeostatic chemokines are rather constitutively expressed as they contribute to the physiological homing and migration of immune cells in the bone marrow or lymphoid organs. For example, the inventors have recently shown that the homeostatic chemokine stromal cell-derived factor 1 (SDF-1), is constitutively expressed by podocytes and that SDF-1 blockade prevents diabetic glomerulosclerosis in a way which was independent of glomerular macrophage recruitment (Ninichuk et al., 2007; WO2009/019007). The mechanism underlying the protective effect of SDF-1 blockade on DN remains unclear but a profound effect on podocyte counts was documented. Study aim

The aim of the study was to demonstrate that the combination of the protective effects of reducing glomerular leukocyte recruitment by blocking the pro-inflammatory chemokine MCP-1 (antagonist:MCP-l binding Spiegelmer mNOX-E36) with the protective effects on podocyte loss by blocking the homeostatic chemokine SDF-1 (antagonist: SDF-1 binding Spiegelmer NOX-A12) elicits additive protective effects on diabetic glomerulosclerosis. Therefore, monotherapy with either the MCP-1 antagonist mNOX-E36 or the SDF-1 antagonist NOX-A12 was compared with dual blockade in a model of advanced diabetic glomerulosclerosis in uninephrectomized db/db mice with type 2 diabetes.

Materials

Test Substances. The Spiegelmers mNOX-E36 and NOX-A12 as well as the non-functional control Spiegelmer revNOX-A12 comprise a 40kDa-PEG moiety and were provided as lyophilized powders. The Spiegelmers mNOX-E36 and NOX-A12 bind to MCP-1 and SDF- 1, respectively, with subnanomolar affinities (see Example 2 and 3). Chemokine inhibition was determined for each Spiegelmer using leukocyte chemotaxis assays.

Test System. Male diabetic C57BLKS db/db mice or non-diabetic C57BL/6 mice 5 week old were obtained from Taconic (Ry, Denmark) and housed in filter top cages with a 12 hour dark/light cycle. All animals had unlimited access to food and water throughout the study duration. At the age of 6 weeks uninephrectomy (IK mice) or sham surgery (2K mice) was performed through a 1 cm flank incision. In the sham surgery group the kidney was left in situ. At the age of 4 months, IK db/db mice with documented blood glucose levels > 11 mmol/L and creatinine/albumin ratios >3 (ratio in age-matched wild-type mice = 0.1) were divided into five groups (n=10-12). The groups received either nil (no injections) or subcutaneous injections of 13.4 mg/kg NOX-A12, 14.4 mg/kg mNOX-E36 or 13.4 mg/kg control Spiegelmer, a combination of 13.4 mg/kg NOX-A12 and 14.4 mg/kg mNOX-E36 every other day. Treatment was continued for 8 weeks. Tissues were harvested for histopathological evaluation at the end of the treatment period. Blood and urine samples were obtained at monthly intervals for the estimations of urinary albumin as well as serum and urinary creatinine. Blood glucose levels were monitored using Accu check sensor (Roche, Mannheim, Germany). Plasma chemokine levels were determined at the end of the treatment period by ELISA.

Results

Dual MCP-l/SDF-1 blockade bv mNOX-E36 and NOX-A12 has additive effects on glomerulosclerosis in db/db mice. Renal histomorphology in 6 months old 2K db/db mice showed moderate glomerulosclerosis as compared to age-matched wild-type mice which was aggravated to diffuse glomerulosclerosis by early uninephrectomy of db/db mice (IK db/db mice) (Fig. 17A). MCP-1 inhibition by mNOX-E36 as well as SDF-1 inhibition by NOX-A12 reduced the extent of glomerulosclerosis in IK db/db mice to the level of age-matched sham- operated db/db mice while the control Spiegelmer had no effect. Dual MCP-1 /SDF-1 blockade by mNOX-E36 and NOX-A12 further improved glomerular pathology with significantly less severe lesions and more normal glomeruli as compared to either of the monotherapies with NOX-E36 or NOX-A12. IK db/db mice with dual MCP-l/SDFl blockade by mNOX-E36 and NOX-A12displayed even less glomerular pathology than age-matched 2K db/db mice (Fig. 17B).

Dual MCP-l/SDF-1 blockade bv mNOX-E36 and NOX-A12has additive effects on podocvte numbers in db/db mice. Compared to an average number of 15-20 WT-1 positive podocytes in murine glomerular cross sections the 6 months old IK db/db mice revealed only an average of 11 cells per glomerular cross section. MCP-1 blockade by mNOX-E36 and particularly SDF-1 blockade by NOX-A12 both significantly increased glomerular podocyte counts (Fig. 6). Interestingly, dual MCP-l/SDF-1 blockade by mNOX-A36 and NOX-A12 showed a small but statistically significant additive effect up to an average of 17 WT-1 positive cells per glomerular cross section (Fig. 18).

Dual MCP-l/SDF-1 blockade bv mNOX-E36 and NOX-A12 increases GFR in db/db mice. Glomerular filtration rate (abbr. GFR) was assessed by FITC inulin clearance kinetics. Uninephrectomy was associated with a reduced GFR as compared to a normal GFR of about 350 μΐ min in mice. Either MCP-1 blockade by mNOX-E36 or SDF-1 blockade by NOX-A12 significantly increased GFR in 6 months old IK db/db mice (Fig. 19A). Dual MCP-l/SDF-1 blockade blockade by mNOX-E36 and NOX-A12 was associated with the highest GFR (Fig. 19A).

Dual MCP-l/SDF-1 blockade by mNOX-E36 and NOX-A12 reduces proteinuria in db/db mice. MCP-1 blockade by mNOX-E36 as well as SDF-1 blockade by NOX-A12 significantly reduced urinary albumin/creatinine ratios (abbr. USCR) when compared to control Spiegelmer treatment at 6 months (Fig. 19B). When compared to baseline UACR the blockade of CXCL12 by NOX-A12 as well as dual blockade by NOX-A12 and mNOX-E36 most effectively prevented proteinuria. SDF-1 blockade by NOX-A12, either alone or in combination with MCP-1 blockade by mNOX-E36, effectively prevents proteinuria in IK db/db mice which is consistent with its positive effect on podocytes. Conclusion

The results of this study suggest that chemokine antagonist combinations hold a potential for additive preventive effects on (diabetic) glomerulosclerosis when the individual chemokine targets mediate different pathomechanisms in the specific disease process. A combination of MCP-1 and SDF-1 blockade, preferably by the MCP-1 binding Spiegelmer mNOX-E36 or NOX-E36 and the SDF-1 binding Spiegelmer NOX-A12, represents a promising novel strategy to more efficiently prevent glomerulosclerosis in type 2 diabetes.

Example 11: Effects Inhibition of Pyroglutamyl-MCP-1 induced chemotaxis of THP-1 cells by Spiegelmer NOX-E36.

The amino terminus of naturally occuring MCP-1 is blocked by a pyroglutamyl residue. However, both forms of MCP-1, with either free amino terminus or pyroglutamyl amino terminus are active in terms of CCR2 receptor activation. In order to demonstrate inhibitory activity of the Spiegelmer of MCP-1 binding nucleic acid NOX-E36 also against pyroglutamyl-MCP-1, THP-1 cells were centrifuged, washed once in HBH (HBSS, containing 1 mg/ml bovine serum albumin and 20 mM HEPES) and resuspended at 1.33 x 106 cells/ml. 75 μΐ of this suspension were added to the upper reservoirs of a Transwell plate with 5 μπι pores (Corning, #3388). In the lower compartments either recombinant human MCP-1 (R&D Systems, #279-MC-010) or chemically synthesized pyroglutamyl-MCP-1 (Bachem #H 5826) were preincubated together with NOX-E36 in various concentrations in 235 μΐ HBH at 37°C for 20 to 30 min prior to addition of cells. Cells were allowed to migrate at 37°C for 3 hours. Thereafter the upper reservoir plate was removed and 30 μΐ of 440 μΜ resazurin (Sigma) in phosphate buffered saline were added to the lower compartments. After incubation at 37°C for 2.5 hours, fluorescence was measured at an excitation wavelength of 544 nm and an emission wavelength of 590 nm in a Fluostar Optima multidetection plate reader (BMG).

It could be demonstrated that NOX-E36 inhibits pyroglutamyl-MCP-1 -induced chemotaxis with an IC50 of about 1 nM. Example 12: Evaluation of Spiegelmer mNOX-E36 given subcutaneously in a sub chronic tobacco smoke-induced inflammation model of COPD in C57BL/6 mice

Chronic obstructive pulmonary disease (abbr. COPD) is the sixth leading cause of death in the world. COPD is characterized by airway obstruction and progressive lung inflammation that is associated with the influx of inflammatory cells. The primary cause of COPD is smoking, with up to 50% of smokers developing disease normally in cities, with additional identifiable risk factors of increasing age and continued smoking. Inflammation in COPD is present in both small and large airways, and it is thought critical in the development of the pathology of the disease. Indeed, the severity of inflammation is associated with disease severity as measured by spirometry. The use of sub-chronic tobacco smoke (abbr. TS) exposure models allows the evaluation of potential anti-inflammatory mechanisms and the comparison of their efficacy to other treatments. In this model, the pulmonary cell influx induced in the mouse by exposure to tobacco smoke is assessed by analysis of bronchoalveolar lavage (abbr. BAL). In the study described here, the TS exposure model was used to evaluate a therapeutic effect of Spiegelmer mNOX-E36 on lung inflammation in mice. All animals were exposed to TS on 11 consecutive days. Therapeutic intervention with mNOX-E36 in three different doses and Roflumilast as pharmacological reference substance was performed.

Study aim

The aim of this study was to evaluate the efficacy of mNOX-E36 on pulmonary inflammation induced by 11 consecutive daily TS exposures. The compound was given subcutaneously once on days 1, 3, 5, 7, 9 and 11 at 2 h prior to TS exposure at 0.2, 2 and 20 mg/kg (oligonucleotide portion). Roflumilast, given orally once a day at 5 mg/kg, was used as a reference for this model and was given at 1 h prior to each TS exposure.

Materials

The PEGylated Spiegelmer mNOX-E36 was provided as lyophilized powder. The vehicle, 5% glucose (sterile solution for injection), was obtained from Baxter Healthcare Ltd. Phosphate buffered saline (PBS) was obtained from Gibco. Euthatal (sodium pentobarbitone) was obtained from the National Veterinary Services. Carboxymethylcellulose (CMC), sodium salt was prepared as a 0.5% solution in sterile water as vehicle for the reference compound.

The tobacco smoke was generated using 1R1 cigarettes purchased from the Institute of Tobacco Research, University of Kentucky, USA.

Formulations

The test compound was reconstituted as agreed with the sponsor, at the highest concentration required (2 mg/ml, oligonucleotide portion), as a homogeneous solution in vehicle (5% glucose). Aliquots were prepared and kept frozen until required for dosing. The two lower dosing solutions were prepared by serial dilutions in vehicle. All solutions were protected from light. A fresh frozen aliquot was used at each dosing time point.

For the formulation of Roflumilast, a pre weighed amount was placed in a mortar and ground to a uniform powder using slight pressure on the pestle. Vehicle was added slowly to form initially a paste and then a solution, This was transferred back to the container and the residual volume of vehicle used to wash out the mortar. The washings were then added to the contents of the container. The contents of the container were stirred thoroughly before and during dosing.

Roflumilast, (5 mg/kg) was formulated once daily as described above, immediately prior to the 1 h pre dose.

Methods

Previous studies have established that the total numbers of cells recovered in the BAL are significantly elevated 24 h following the final TS exposure of 11 consecutive daily TS exposures. A time point of 24 h after the final (11th) TS exposure was chosen for analysis.

Treatment regimes

In this study, four groups of mice (n=10) received either one of the 3 doses of mNOX-E36 (0.2, 2 or 20 mg/kg), or vehicle subcutaneously (s.c.) at 2 h prior to TS exposures on days 1, 3, 5, 7, 9 and 11. Another group (n=10) received vehicle and was exposed to air for an equivalent length of time. A further group of mice (n = 10) received the reference compound Roflumilast, orally, daily at 1 h prior to TS exposure.

Results

Exposure of C57BL/6J mice to TS for 11 consecutive days induced a pulmonary inflammation that was significant when the mice were sacrificed on day 12 (24 h post the 11th consecutive exposure). This inflammation consisted of significant increases in macrophages, epithelial cells and neutrophils (all p<0.001) recovered from BAL fluid, when compared with the appropriate air exposed (sham) animals. There were also much smaller but still sigmficant increases in eosinophils and lymphocytes (both p<0.001).

20 mg/kg mNOX-E36 significantly reduced the TS induced increases in BAL cells (37% inhibition, p<0.001). This consisted of marked reductions in neutrophils (67% inhibition, pO.001), eosinophils (88% inhibition, pO.01) and lymphocytes (64% inhibition, p<0.001). The 26% and 24% inhibition of macrophages and epithelial cells respectively failed to attain statistical significance.

2 mg/kg mNOX-E36 significantly reduced the TS induced cell increases in BAL by 36% (pO.001). This consisted of marked reductions in neutrophils (55% inhibition, pO.001) and lymphocytes (61% inhibition, pO.001) and to a lesser extent macrophages (32% inhibition, p<0.05). The 17% and 53% inhibition of epithelial cells and eosinophils respectively failed to attain statistical significance.

0.2 mg/kg mNOX-E36 significantly reduced the TS induced increase in the total numbers of cells recovered in BAL (47% inhibition, pO.001). This consisted of marked reductions in macrophages (41% inhibition, p<0.001), epithelial cells (54% inhibition, pO.001), neutrophils (57% inhibition, pO.001), eosinophils (86% inhibition, pO.01) and lymphocytes (52% inhibition, p<0.001),

Roflumilast as reference compound, when given once daily orally at 5 mg/kg 1 h prior to TS exposure, significantly reduced the number of total cells (45% inhibition, p<0.001). This inhibition was comprised of reductions in macrophages (38%, pO.01), neutrophils (68%, pO.001), eosinophils (94%, pO.001) and lymphocytes (72%, pO.001). Conclusion

In this study, mNOX-E36, given subcutaneously on days 1, 3, 5, 7, 9 and 11 had a statistically significant inhibitory activity on the TS induced increases in inflammatory cells recovered in BAL at all the doses tested (0.2, 2 and 20 mg/kg). This effect was not dose related over the dose range tested in this study.

Roflumilast, when given p.o. once daily (5 mg/kg) in this study, significantly reduced total cell numbers. This inhibition consisted of reductions in macrophage, neutrophil, eosinophil and lymphocyte numbers. This level of efficacy is similar to that seen in earlier mouse TS studies. Roflumilast has also been shown to have inhibitory activity in acute mouse TS and chronic TS exposure models.

Example 13: Efficacy of mNOX-E36 in a mouse model of acute, MCP-1 stimulated insulin resistance

Study aim

Aim of the study was to investigate acute effects of elevated circulating MCP-1 (monocyte chemotactic protein- 1) on insulin senstivity with or without a bolus injection of mNOX-E36. In the literature it is described that acute increased MCP-1 plasma concentration leads to systemic insulin resistance (even without macrophage infiltration; Tateya et al., 2010, Endocrinology 151 :971). The glucose infusion rate after administration of MCP-1 or MCP-1 and mNOX-E36 was determined in a hyperinsulinemic-euglycemic clamp analysis.

Animals

C57B1/6N, male were obtained from Charles River Laboratories. The C57B1/6 mouse strain is commonly used in metabolic studies and in addition, the C57B1/6 background serves for several obesity and diabetes models. Study design

*mNOX-E36 dose referring to the oligonucleotide part of the molecule

Route of administration MCP-1 : continous infusion into the jugular vein

mNOX-E36 or vehicle: bolus injection into the jugular vein

Group 1 : Test substance 1 (mNOX-E36) was administered at a dose of 2 or 10 mg/kg body weight as a bolus injection into the jugular vein 30 minutes before starting MCP-1 infusion.

Group 2: Vehicle was administred as a bolus injection before starting MCP-1 infusion.

In both groups, MCP-1 was administered by infusion into the jugular vein for 120 minutes before and during hyperinsulinemic-euglycemic clamp analysis.

Hyperinsulinemic-euglycemic clamp analysis

A catheter was inserted into the right internal jugular vein for infusion. The catheter was externalized at the back of the neck. This catheter end piece was connected to three infusion pumps. Up to 6 days after the surgery, once the pre-(surgery) body weight had been reached, the hyperinsulinemic-euglycemic clamp analysis in the conscious mouse was performed. Mice were starved for 5 hours in the morning. Before starting the infusions the animals were placed in a restrainer in order to allow the mouse to acclimatize. MCP-1 (15 ng/h; 2 μΐ/min, 125 pg/μΐ in PBS, 0,1% BSA) was infused continuously for 120 min before the onset and during the whole clamp experiment. The clamp experiment was started with a priming insulin dose of 300 mU/kg (3 min; Sanofi-Aventis Insuman rapid 40 IE/ml) followed by a continuous infusion of insulin at a rate of 2.5 mU/kg*min. Blood glucose was measured every 10 min. 20 % Glucose was infused at a variable rate (about 0.1 μΐ/min to 7 μΐ/min to maintain blood glucose at steady state (about 5.5 to 7.5 mmol/1). The cut off for reaching steady state was set to 150 min after the insulin bolus injection. The glucose infusion rate (mg glucose/kg body weight* min) was calculated for the steady state

Results: Effects of acute mNOX-E36 treatment on mice in hyperinsulinemic-euglycemic clamp with concomitant infusion of MCP-1

In total, 6 mice were treated with vehicle (5% Glucose), 6 mice were treated with 2 mg/kg mNOX-E36 and 11 mice were treated with 10 mg/kg mNOX-E36 before starting the MCP-1 infusion. Two out of the 11 animals treated with 10 mg/kg mNOX-E36 did not reach a steady state during 150 min of the clamp period. Therefore they were not included in the following analysis.

There were no differences in plasma glucose levels during the steady state between animals treated with vehicle, 2 mg/kg mNOX-E36 and 10 mg/kg mNOX-E36 and subsequently infused with MCP-1 (mean ± SD: 6.6 ± 0.4 ; 6.6 ± 0.7 resp. 6.8 ± 0.9 mmol/1; p = 0.6).

Overall, the average (± SD) glucose infusion rate (abbr. GIR) in mice treated vehicle was 7.7 ± 1.5 mg/kg*min (n = 7), in mice treated with 2 mg/kg mNOX-E36 12.4 ± 10.7 mg kg* min and in mice treated with 10 mg/kg mNOX-E36 23.8 ± 8.8. (Figure 21). There was a stastistically significant increase in the glucose infusion rate in animals from the 10 mg/kg mNOX-E36 group compared to the animals treated with vehicle.

Summary

Aim of the study was to investigate the effects of acute mNOX-E36 treatment on mice in hyperinsulinemic-euglycemic clamp with concomitant infusion of MCP-1. As it is demonstrated in the literature and in our own previous experiments (data not shown), infusion of MCP-1 in wildtype mice results in decreased glucose infusion rate during a hyperinsulinemic-euglycemic clamp experiment. Therefore, glucose infusion rate in conscious mice was determined after treatment with mNOX-E36 or Vehicle followed by a continous MCP-1 infusion and a hyperinsulinemic-euglycemic clamp analysis. Animals which were treated with 10 mg/kg mNOX-E36 showed a significantly increased GIR compared to animals treated with vehicle prior to the MCP-1 infusion, indicating an inhibition of MCP-1 action. References

The complete bibliographic data of the documents recited herein the disclosure of which is incorporated by reference is, if not indicated to the contrary, as follows.

Allison, A. C. and E. M. Eugui (2000). "Mycophenolate mofetil and its mechanisms of action." Immunopharmacology 47(2-3): 85-118.

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990), Basic local alignment search tool. JMol Biol. 215(3):403-10.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. Sep l;25(17):3389-402.

Anderson, J. W., C. W. Kendall, et al. (2003). "Importance of weight management in type 2 diabetes: review with meta-analysis of clinical studies." J Am Coll Nutr 22(5): 331-9.

Aurup H Tuschl T, Benseler F, Ludwig J, Eckstein F. (1994). Oligonucleotide duplexes containing 2'-amino-2'-deoxycytidines: thermal stability and chemical reactivity. Nucleic Acids Res 22:20

Banba, N., et al., (2000) Kidney Int, 2000. 58(2): p. 684-90.

Blaha, M., J. Krejsek, et al. (2004). "Selectins and monocyte chemotactic peptide as the markers of atherosclerosis activity." Physiol Res 53(3): 273-8.

Bose, T., J. C. Alvarenga, et al. (2009). "Association of monocyte chemoattractant protein-1 with adipocyte number, insulin resistance and liver function markers." J Med Primatol.

Brunt EM, et al. Am J Gastroenterol. 1999;94:2467-74

Burt AD, et al. Sem. Diag. Pathol., 1998;15:246-58., Matteoni CA, et al. Gastroenterol. 999;116:1413-19.).

Chiarelli, F., et al. (2002) Diabetes Care 25(10): p. 1829-34.

Chow F, Ozols E, Nikolic-Paterson DJ, Atkins RC, Tesch GH (2004). Macrophages in mouse type 2 diabetic nephropathy: Correlation with diabetic state and progressive renal injury. Kidney Int. 65:116

Cnop, M., N. Welsh, et al. (2005). "Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many differences, few similarities." Diabetes 54 Suppl 2: S97-107.

Crowther, C. A., J. E. Hiller, et al. (2005). "Effect of treatment of gestational diabetes mellitus on pregnancy outcomes." N Engl J Med 352(24): 2477-86.

Dawson J, Miltz W, Mir AK, Wiessner C (2003). Targeting monocyte chemoattractant protein-1 signalling in disease. Expert Opin. Ther. Targets 7:35

Demircan, N., B. G. Safran, et al. (2006). "Determination of vitreous interleukin-1 (IL-1) and tumour necrosis factor (TNF) levels in proliferative diabetic retinopathy." Eye 20(12): 1366- 9.

Dyck, P. J. and A. J. Windebank (2002). "Diabetic and nondiabetic lumbosacral radiculoplexus neuropathies: new insights into pathophysiology and treatment." Muscle Nerve 25(4): 477-91. Eaton BE, Gold L, Zichi DA. (1995). Let's get specific: the relationship between specificity and affinity. Chem Biol 2:633

Eckel, R. H., S. M. Grundy, et al. (2005). "The metabolic syndrome." Lancet 365(9468): 1415-28.

Egashira, K., Q. Zhao, et al. (2002). "Importance of monocyte chemoattractant protein-1 pathway in neointimal hyperplasia after periarterial injury in mice and monkeys." Circ Res 90(11): 1167-72.

Estep, J. M., A. Baranova, et al. (2009). "Expression of cytokine signaling genes in morbidly obese patients with non-alcoholic steatohepatitis and hepatic fibrosis." Obes Surg 19(5): 617- 24.

Ezenwaka, C.E., et al. (2009) Arch Physiol Biochem, 2009. 115(1): p. 22-7.

Feng, L., C. Matsumoto, et al. (2005). "Chronic vascular inflammation in patients with type 2 diabetes: endothelial biopsy and RT-PCR analysis." Diabetes Care 28(2): 379-84.

Forbes, J. M., V. Thallas-Bonke, et al. (2004). "Advanced glycation: how are we progressing to combat this web of sugar anomalies in diabetic nephropathy." Curr Pharm Des 10(27): 3361-72.

Fornoni, A., A. Ijaz, et al. (2008). "Role of inflammation in diabetic nephropathy." Curr Diabetes Rev 4(1): 10-7.

Furukawa, Y., A. Matsumori, et al. (1999). "Anti-monocyte chemoattractant protein- 1 /monocyte chemotactic and activating factor antibody inhibits neointimal hyperplasia in injured rat carotid arteries." Circ Res 84(3): 306-14.

Green LS et al. (1995). Chem Biol 2:683

Grundy, S. M. (2006). "Drug therapy of the metabolic syndrome: minimizing the emerging crisis in polypharmacy." Nat Rev Drug Discov 5(4): 295-309.

Haffher, S. M, R. A. Valdez, et al. (1992). "Prospective analysis of the insulin-resistance syndrome (syndrome X)." Diabetes 41(6): 715-22.

Hagiwara, S., et al. (2006) Nephrol Dial Transplant 21(3): p. 605-15.

Han, S. Y., C. H. Kim, et al. (2006). "Spironolactone prevents diabetic nephropathy through an anti-inflammatory mechanism in type 2 diabetic rats." J Am Soc Nephrol 17(5): 1362- 72.Haukeland, J.W., et al. (2006) J Hepatol 44(6): p. 1167-74.

Hoogeveen, R. C, A. Morrison, et al. (2005). Plasma MCP-1 level and risk for peripheral arterial disease and incident coronary heart disease: Atherosclerosis Risk in Communities study." Atherosclerosis 183(2): 301-7.

Horvath, C, F. G. Welt, et al. (2002). "Targeting CCR2 or CD 18 inhibits experimental in- stent restenosis in primates: inhibitory potential depends on type of injury and leukocytes targeted." Circ Res 90(4): 488-94.

Hu, Z. J., Y. Liao, et al. (2009). "Effects of antiatherosclerosis in carotid artery by RNAi- mediated silencing of MCP-1 expression." Ann Vase Surg 23(5): 652-62.

Ito, M., J. Suzuki, et al. (2007). "Longitudinal analysis of murine steatohepatitis model induced by chronic exposure to high-fat diet." Hepatol Res 37(1): 50-7.

Kajitani N et al (2010) Diabetes Res Clin Pract. 88(2):171-6. Epub 2010 Feb 6. Kanda, H., S. Tateya, et al. (2006). MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity." J Clin Invest 116(6): 1494-505.

Kawasaki AM et al. (1993). JMed Chem 36:831

Kiyici, S., et al. (2006) Arch Med Res, 2006. 37(8): p. 998-1003.

Kim, C, K. M. Newton, et al. (2002). "Gestational diabetes and the incidence of type 2 diabetes: a systematic review." Diabetes Care 25(10): 1862-8.

Klussmann, S. (eds.); The Aptamer Handbook, 1. Edition - February 2006, Wiley- VCH,Weinheim

Koh, K. K., S. H. Han, et al. (2005). "Inflammatory markers and the metabolic syndrome: insights from therapeutic interventions." J Am Coll Cardiol 46(11): 1978-85.

Kouyama, K., K. Miyake, et al. (2008). "Association of serum MCP-1 concentration and MCP-1 polymorphism with insulin resistance in Japanese individuals with obese type 2 diabetes." Kobe J Med Sci 53(6): 345-54.

Kudo, H., Y. Yata, et al. (2009). "Telmisartan attenuates progression of steatohepatitis in mice: role of hepatic macrophage infiltration and effects on adipose tissue." Liver Int 29(7): 988-96.

Kusser W (2000). Chemically modified nucleic acid aptamers for in vitro selections: evolving evolution. J Biotechnol 74:27-38

Lesnik EA, Guinosso CJ, Kawasaki AM, Sasmor H, Zounes M, Cummins LL, Ecker DJ, Cook PD, Freier SM. (1993). Oligodeoxynucleotides containing 2'-0-modified adenosine: synthesis and effects on stability of DNA:RNA duplexes. Biochemistry 32:7832

Li, C, C. W. Yang, et al. (2003). "Long-term treatment with ramipril attenuates renal osteopontin expression in diabetic rats. "Kidney Int 63(2): 454-63.Loike, J. D., D. Y. Shabtai, et al. (2004). "Statin inhibition of Fc receptor-mediated phagocytosis by macrophages is modulated by cell activation and cholesterol." Arterioscler Thromb Vase Biol 24(11): 2051-6.

Ludvik, B., K. Thomaseth, et al. (2003). "Inverse relation between amylin and glucagon secretion in healthy and diabetic human subjects." Eur J Clin Invest 33(4): 316-22.

Martinovic, I., N. Abegunewardene, et al. (2005). "Elevated monocyte chemoattractant protein- 1 serum levels in patients at risk for coronary artery disease." Circ J 69(12): 1484-9.

McGinnis S, Madden TL (2004). BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32(Web Server issue):W20-5.

Miller LE et al. (1993). J Physiol 469:213

Mine, S., et al. (2006) Biochem Biophys Res Commun 344(3): p. 780-5.

Mizuno, M., T. Sada, et al. (2006). "The effect of angiotensin II receptor blockade on an end- stage renal failure model of type 2 diabetes." J Cardiovasc Pharmacol 48(4): 135-42.

Moller, D. E. (2001). "New drug targets for type 2 diabetes and the metabolic syndrome." Nature 414(6865): 821-7.

Mori, E., K. Komori, et al. (2002). "Essential role of monocyte chemoattractant protein- 1 in development of restenotic changes (neointimal hyperplasia and constrictive remodeling) after balloon angioplasty in hypercholesterolemic rabbits." Circulation 105(24): 2905-10.

Morii, T., et al. (2003) J Diabetes Complications 17(1): p. 11-5. Moser B, Wolf M, Walz A, Loetscher P. Chemokines: multiple levels of leukocyte migration control. Trends Immunol 2004; 25: 75-84:

Mulder, H., H. Martensson, et al. (2000). "Differential changes in islet amyloid polypeptide (amylin) and insulin mRNA expression after high-fat diet-induced insulin resistance in C57BL/6J mice." Metabolism 49(12): 1518-22.

Needleman & Wunsch (1970), A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 48(3):443-53.

Neels, J. G. and J. M. Olefsky (2006). "Inflamed fat: what starts the fire?" J Clin Invest 116(1): 33-5.

Nelken, N. A., S. R. Coughlin, et al. (1991). Monocyte chemoattractant protein-1 in human atheromatous plaques." J Clin Invest 88(4): 1121-7.Nguyen D, Ping F, Mu W, Hill P, Atkins RC, Chadban SJ (2006) Nephrology (Carlton) 11(3):226-31.

Ni, W., K. Egashira, et al. (2001). "New anti-monocyte chemoattractant protein-1 gene therapy attenuates atherosclerosis in apolipoprotein E-knockout mice." Circulation 103(16): 2096-101.

Ninichuk V, Khandoga AG, Segerer S, Loetscher P, et al. The role of interstitial macrophages in nephropathy of type 2 diabetic db/db mice. Am J Pathol 2007; 170: 1267-1276.

Nyquist, P. A., C. A. Winkler, et al. (2009). "Single nucleotide polymorphisms in monocyte chemoattractant protein-1 and its receptor act synergistically to increase the risk of carotid atherosclerosis." Cerebrovasc Dis 28(2): 124-30.

Ohtani, K., M. Usui, et al. (2004). "Antimonocyte chemoattractant protein-1 gene therapy reduces experimental in-stent restenosis in hypercholesterolemic rabbits and monkeys." Gene Ther 11(16): 1273-82.

Pardes, H., K. G. Manton, et al. (1999). "Effects of medical research on health care and economy." Science 283(5398): 36-7.

Pascoe, M. K., P. A. Low, et al. (1997). "Subacute diabetic proximal neuropathy." Mayo Clin Proc 72(12): 1123-32.

Pearson & Lipman (1988), Improved tools for biological sequence comparison. Proc. Nat'l. Acad. Sci. USA 85: 2444

Piemonti L, et al (2009) Diabetes Care. 32(l l):2105-10.Reaven, G. M. (1988). "Banting lecture 1988. Role of insulin resistance in human disease." Diabetes 37(12): 1595-607.

Reckless, J., L. Tatalick, et al. (2005). "Broad-spectrum chemokine inhibition reduces vascular macrophage accumulation and collagenolysis consistent with plaque stabilization in mice." J Vase Res 42(6): 492-502.

Rhodes, C. J. (2005). "Type 2 diabetes-a matter of beta-cell life and death?" Science 307(5708): 380-4.

Ricote, M., A. C. Li, et al. (1998). "The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation." Nature 391(6662): 79-82.

Romero, F., B. Rodriguez-Iturbe, et al. (2000). "Mycophenolate mofetil treatment reduces cholesterol-induced atherosclerosis in the rabbit." Atherosclerosis 152(1): 127-33. Rull A, Rodriguez F, Aragones G, Marsillach J, Beltran R, Alonso-Villaverde C, Camps J, Joven J.(2009) Cytokine. 2009 Dec;48(3):273-9. Epub 2009 Sep 12.

Salcedo R, Wasserman K, Young HA, Grimm MC, Howard OM, Anver MR, Kleinman HK, Murphy WJ, Oppenheim J J (1999) Vascular endothelial growth factor and basic fibroblast growth factor induce expression of CXCR4 on human endothelial cells: In vivo neovascularization induced by stromal-derived factor- 1 alpha. Am J Pathol 154(4): 1125-1135

Salcedo, R. and J. J. Oppenheim (2003). "Role of chemokines in angiogenesis: CXCL12/SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses." Microcirculation 10(3-4): 359-70.

Sartipy, P. and D. J. Loskutoff (2003). "Monocyte chemoattractant protein 1 in obesity and insulin resistance." Proc Natl Acad Sci U S A 100(12): 7265-70.

Sato, A., T. Saruta, et al. (2006). "Combination therapy with aldosterone blockade and renin- angiotensin inhibitors confers organ protection." Hypertens Res 29(4): 211-6.

Schjoedt, K. J., K. Rossing, et al. (2005). "Beneficial impact of spironolactone in diabetic nephropathy." Kidney Int 68(6): 2829-36.

Shirozu, M., T. Nakano, et al. (1995). "Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene." Genomics 28(3): 495-500.

Smith & Waterman (1981), Adv. Appl. Math. 2: 482

Stumvoll, M., B. J. Goldstein, et al. (2005). "Type 2 diabetes: principles of pathogenesis and therapy." Lancet 365(9467): 1333-46.

Tack CJ, Smits P (2006) Neth J Med. 64(6):166-74Takiya, L. and S. Chawla (2002). "Therapeutic options for the management of type 2 diabetes mellitus." Am J Manag Care 8(11): 1009-23; quiz 1024-7.

Tamura, Y., M. Sugimoto, et al. (2008). "Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice." Arterioscler Thromb Vase Biol.

Tang, S., O. F. Scheiffarth, et al. (1993). "Cells of the immune system and their cytokines in epiretinal membranes and in the vitreous of patients with proliferative diabetic retinopathy." Ophthalmic Res 25(3): 177-85.

Usui, M., K. Egashira, et al. (2002). "Anti-monocyte chemoattractant protein- 1 gene therapy inhibits restenotic changes (neointimal hyperplasia) after balloon injury in rats and monkeys." Faseb J 16(13): 1838-40.

Venkatesan N et al. (2003). Curr Med Chem 10: 1973

Wada, T., et al. (2000) Kidney Int58(4): p. 1492-9.

Webb, M. R., M. S. Lipsky, et al. (2000). "Treatment Options for Type 2 Diabetes." American Family Physician http://www.aa .org/online/etc/medialib/aa _org/documents/newsJubs/mono/diabetescare/t reatmentoptions- pdf.Par.0001.File.dat/monograph_diabetes1reatment.pdf#search=%22Treatment%20Options %20for%20Type%202%20Diabetes%22.

Weisberg, S. P., D. Hunter, et al. (2006). "CCR2 modulates inflammatory and metabolic effects of high-fat feeding." J Clin Invest 116(1): 115-24. Wild, S., G. Roglic, et al. (2004). "Global prevalence of diabetes: estimates for the year 2000 and projections for 2030." Diabetes Care 27(5): 1047-53.

Wincott F. et al. (1995) Nucleic Acids Res 23:2677

Yang SJ, IglayReger HB, Kadouh HC, Bodary PF (2009) Diabetologia. 52(5):972-81. Epub 2009 Mar 10.

Yla-Herttuala S, Lipton BA, Rosenfeld ME, Sarkioja T, Yoshimura T, Leonard EJ, Witztum JL, Steinberg D (1991). Expression of monocyte chemoattractant protein 1 in macrophage- rich areas of human and rabbit atherosclerotic lesions. Proc. Natl Acad. Sci. USA 88:5252

Yuasa, S., T. Maruyama, et al. (2009). "MCP-1 gene A-2518G polymorphism and carotid artery atherosclerosis in patients with type 2 diabetes." Diabetes Res Clin Pract.

Zhang, S., J. Wang, et al. (2009). "Farnesoid X receptor agonist WAY-362450 attenuates liver inflammation and fibrosis in murine model of non-alcoholic steatohepatitis." J Hepatol 51(2): 380-8.

Zimmet P, Alberti KG, Shaw J (2001). Global and societal implications of the diabetes epidemic. Nature 414:782

Zimmet, P. Z. (1992). "Kelly West Lecture 1991. Challenges in diabetes epidemiology--from West to the rest." Diabetes Care 15(2): 232-52.

Zineh, I., et al. (2009) Diabetes Care, 2009. 32(3): p. 465-7.

The features of the present invention disclosed in the specification, the claims and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof.

Claims

1. A nucleic acid molecule capable of binding to MCP- 1 , preferably capable of inhibiting MCP-1, whereby the nucleic acid molecule is for use in a method for the treatment and/or prevention of a disease or disorder, or for use as a medicament for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication, diabetic condition, inflammatory joint disease, eye disease, asthma, autoimmune disease, neuroinflammatory disease, tissue disease, cardiovascular disease, renal disease, ischemia injury, reperfusion injury, lung disease, transplantation, gynecological disease and conditions with elevated MCP-1 level.

2. The nucleic acid molecule according to claim 1, whereby the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

3. The nucleic acid molecule according to claim 1, whereby the inflammatory joint disease is an inflammatory joint disease selected from the group of rheumatoid arthritis, osteoarthritis, psoriatic arthritis, gout, juvenile rheumatoid arthritis, and viral arthritides.

4. The nucleic acid molecule according to claim 1, whereby the eye disease is an eye disease selected from the group of uveitis, Eales' disease, branch retinal vein occlusion, vernal keratoconjunctivitis, photoreceptor death after surgery-induced retinal detachment, ocular Behcet's disease, retinitis pigmentosa and allergic conjunctivitis.

5. The nucleic acid molecule according to claim 1, whereby the asthma is an asthma selected from the group of atopic asthma and chronic bronchitis.

6. The nucleic acid molecule according to claim 1, whereby the autoimmune disease is an autoimmune disease selected from the group of systemic lupus erythematosus, ankylosing spondylitis, autoimmune orchitis, Lofgren's syndrome, Crohn's disease and autoimmune myocarditis.

7. The nucleic acid molecule according to claim 1, whereby the neuroinflammatory disease is a neuroinflammatory disease selected from the group of multiple sclerosis, amyotrophic lateral sclerosis, neuropathic pain, Parkinson's disease, Alzheimer's disease and demyelinating disease.

8. The nucleic acid molecule according to claim 1, whereby the tissue disease is a tissue disease selected from the group of polymyositis, dermatomyositis, polymyalgia rheumatica, psoriasis, systemic sclerosis and atopic dermatitis.

9. The nucleic acid molecule according to claim 1, whereby the cardiovascular disease is a cardiovascular disease selected from the group of atherosclerosis, carotid atherosclerosis, peripheral arterial disease, coronary heart disease, restenosis, post-PTCA, premature atherosclerosis after Kawasaki disease, giant cell arteritis, idiopathic pulmonary hypertension, Takayasu's arteritis, Kawasaki disease, Wegener's granulomatosis, pulmonary granulomatous vasculitis, temporal arteritis, acute coronary syndrome, thrombosis, chronic hemodialysis, hypertrophic cardiomyopathy, cardiomyopathy in human Chagas' disease, myocardial infarction/ ichemic heart disease, chronic stable angina pectoris, nonfamilial idiopathic dilated cardiomyopathy, post-infarction ventricular remodeling, restenosis after balloon dilatation, in- stent restenosis, pulmonary arterial hypertension and cerebral aneurysm formation.

10. The nucleic acid molecule according to claim 1, whereby the renal disease is a renal disease selected from the group of glomerulonephritis, renal vasculitis, lupus nephritis, IgA nephropathy, chronic kidney disease, autosomal dominant polycystic kidney disease, renal fibrosis, tubulointerstitial nephritis and renal artery stenosis.

11. The nucleic acid molecule according to claim 1, whereby the ischemia injury and reperfusion injury is an ischemia injury and reperfusion injury selected from the group of myocardial infarction, acute cerebral ischemia, focal brain ischemia, cardiac ischemia, cardiac reperfusion, stroke injury after cerebral artery occlusion, ischemic fibrotic cardiomyopathy after repeated coronary ischemia or reperfusion, skin injury after cutaneous ischemia or reperfusion, retinal ischemia and retinal reperfusion.

12. The nucleic acid molecule according to claim 1, whereby the lung disease is a lung disease selected from the group of interstitial lung disease, chronic obstructive pulmonary disease, cystic fibrosis, idiopathic pulomnary fibrosis, chemical-induced pulmonary fibrosis, pulmonary sarcoidosis, pulmonary granulomatosis and granulomatous lung disease.

13. The nucleic acid molecule according to claim 1, whereby the transplantation is a transplantation selected from the group of transplantation of lung, transplantation of kidney, transplantation of heart, transplantation of islets, transplantation of cornea, transplantation of bone marrow and transplantation of stem cells.

14. The nucleic acid molecule according to claim 1, whereby the gynecological disease is a gynecological disease selected from the group of endometriosis andadenomyosis.

15. The nucleic acid molecule according to claim 1, whereby the condition with elevated MCP-1 level is a condition with elevated MCP-1 level selected from the group of sepsis, chronic liver disease, Peyronie's disease, acute spinal chord injury, myocarditis, HIV infection, HIV-associated dementia, hemophagic lymphohistiocytosis, HBV infection, HCV infection, meningitis, influenza A, CMV reactivation, pulmonary tuberculosis, irritable bowel disease, schizophrenia, mixed cryoglobulinemia, hepatitis C associated with autoimmune thyroiditis, musculosceletal trauma, acute liver failure, acute-on-chronic liver failure, intracranial hypertension, polycystic ovary syndrome, cerebral aneurysm, idiopathic inflammatory myopathies, periodontal disease, bladder inflammation, periprosthetic osteolysis of loosened total hip arthroplasty, pulmonary alveolar proteinosis, severe traumatic brain injury, pelvic inflammatory disease, benign prostatic hyperplasia, Tourette syndrome, primary biliary cirrhosis, HLA-B27 associated disease, major depressive disorder, pancreatitis, frontotemporal lobar degeneration, mood disorder, liver fibrosis, colitis, delayed- type hypersensitivity lesions, formation of foreign body giant cells after implantation of biomaterials and dermatitis.

16. The nucleic acid molecule according to any one of claims 1 to 15, whereby the nucleic acid molecule is selected from the group comprising a type 2 MCP-1 binding nucleic acid molecule, a type 3 MCP-1 binding nucleic acid molecule, a type 4 MCP-1 binding nucleic acid molecule, a type 1A MCP-1 binding nucleic acid molecule, a type IB MCP-1 binding nucleic acid molecule and a type 5 MCP-1 binding nucleic acid molecule.

17. The nucleic acid molecule according to claim 16, whereby the type 2 MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides, and a second terminal stretch of nucleotides, whereby

the first terminal stretch of nucleotides comprises a nucleotide sequence of ^X&GCA^, whereby

Xi is A or absent and X₂ is C, or

Xi is absent and X₂ is C, the central stretch of nucleotides comprises a nucleotide sequence of 5' CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC '3 (SEQ ID NO: 114), and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'UGCX₃X4'3, whereby

X₃ is G and X4 is U or absent, or

X₃ is G or absent and X4 is absent.

18. The nucleic acid molecule according to claim 17 whereby the central stretch of nucleotides comprises a nucleotide sequence of 5' CGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUC '3 (SEQ ID NO: 115).

19. The nucleic acid molecule according to any one of claims 17 to 18, whereby a) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'ACGCA'3,

and

20. The nucleic acid molecule according to any one of claims 1 to 19, whereby the type 2 MCP-1 binding nucleic acid comprises a nucleotide sequence according to any one of SEQ ID NO: 24 to SEQ ID NO: 32, and SEQ ID NO: 111, preferably any one of SEQ ID NO: 32 and SEQ ID NO: 111.

21. The nucleic acid molecule according to claim 16, whereby the type 3 MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides, a sixth central stretch of nucleotides, a seventh central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence which is selected from the group comprising 5'GURCUGC'3, 5'GKSYGC'3, 5'KBBSC'3 and 5'BNGC'3, the first central stretch of nucleotides comprises a nucleotide sequence of 5'GKMGU'3, the second central stretch of nucleotides comprises a nucleotide sequence of 5'KRRAR'3, the third central stretch of nucleotides comprises a nucleotide sequence of 5'ACKMC'3, the fourth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'CURYGA'3, 5'CUWAUGA'3, 5'CWRMGACW'3 and 5'UGCCAGUG'3, the fifth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'GGY'3 and 5'CWGC'3, the sixth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'YAGA'3, 5'CKAAU'3 and 5'CCUUUAU'3, the seventh central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'GCYR'3 and 5'GCWG'3, and the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the groupe comprising 5'GCAGCAC'3, 5'GCRSMC'3, 5'GSVVM'3 and 5'GCNV'3.

22. The nucleic acid molecule according to claim 21, whereby the type 3 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence selected from the group comprising the nucleotide sequences according to any one of SEQ ID NO: 33 to SEQ ID NO: 68, preferably any one of SEQ ID NO: 42 to SEQ ID NO: 48, SEQ ID NO: 51 to SEQ ID NO: 56, SEQ ID NO: 62 to SEQ ID NO: 66 and SEQ ID NO: 68, more preferably any one of SEQ ID NO: 62 to SEQ ID NO: 66, and SEQ ID NO: 68.

23. The nucleic acid molecule according to claim 16, whereby the type 4 MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'AGCGUGDU'3, 5'GCGCGAG'3, 5'CSKSUU'3, 5'GUGUU'3, and

5'UGUU'3; the central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising

5 ' AGNDRDGBKGGURGYARGUAAAG' 3 (SEQ ID NO: 116),

5 ' AGGUGGGUGGU AGU AAGU AAAG' 3 (SEQ ID NO: 117) and 5 ' C AGGUGGGUGGU AG AAUGU AAAG A ' 3 (SEQ ID NO: 118), and the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising 5'GNCASGCU'3, 5'CUCGCGUC'3, 5'GRSMSG'3, 5'GRCAC'3, and

5'GGCA'3.

24. The nucleic acid molecule according to claim 23, whereby the type 4 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 69 to SEQ ID NO: 81, preferably any one of SEQ ID NO: 75 to SEQ ID NO: 76.

25. The nucleic acid molecule according to claim 16, whereby the type 1 A MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'AGCRUG'3, the first central stretch of nucleotides comprises a nucleotide sequence of 5'CCCGGW'3, the second central stretch of nucleotides comprises a nucleotide sequence of 5'GUR'3, the third central stretch of nucleotides comprises a nucleotide sequence of 5'RYA'3, the fourth central stretch of nucleotides comprises a nucleotide sequence of 5 ' GGGGGRCGCGA YC ' 3 (SEQ ID NO: 119); the fifth central stretch of nucleotides comprises a nucleotide sequence of 5'UGCAAUAAUG'3 (SEQ ID NO: 288) or 5'URYAWUUG'3, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'CRYGCU'3.

26. The nucleic acid molecule according to claim 25, whereby the type 1 A MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 5 to SEQ ID NO: 16, preferably of SEQ ID NO: 16.

27. The nucleic acid molecule according to claim 16, whereby the type IB MCP-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence of 5'AGYRUG'3, the first central stretch of nucleotides comprises a nucleotide sequence of 5'CCAGCU'3 or 5'CCAGY'3, the second central stretch of nucleotides comprises a nucleotide sequence of 5'GUG'3, the third central terminal of nucleotides comprises a nucleotide sequence of 5'AUG'3, the fourth central stretch of nucleotides comprises a nucleotide sequence of 5 ' GGGGGGCGCG ACC 3 (SEQ ID NO: 120), the fifth central stretch of nucleotides comprises a nucleotide sequence of 5'CAUUUUA'3 or 5'CAUUUA'3, and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5'CAYRCU'3.

28. The nucleic acid molecule according to claim 27, whereby the type IB MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 17 to SEQ ID NO: 23, preferably any one of SEQ ID NO: 22 and SEQ ID NO: 23.

29. The nucleic acid molecule according to claim 16, whereby the type 5 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 82 to SEQ ID NO: 110.

30. The nucleic acid molecule according to any one of claims 1 to 29, whereby the MCP-1 is pyroglutamyl-MCP-1, human MCP-1 or human pyroglutamyl-MCP-1, whereby preferably the human MCP-1 has an amino acid sequence according to SEQ ID No. 1.

31. The nucleic acid molecule according to any one of claims 1 to 30, whereby the nucleic acid molecule is for use in a combination therapy for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby the combination therapy comprises the adminsitration of at least a first pharmaceutically active agent and at least a second pharmaceutically active agent, whereby the first pharmaceutically active agent is a nucleic acid molecule according to any of claims 1 to 30, and whereby the second pharmaceutically active agent is a nucleic acid molecule capable of binding to SDF-1.

32. The nucleic acid molecule according to claim 31, whereby the diabetic complication or diabetic condition is diabetic nephropathy.

33. The nucleic acid according to any one of claims 31 to 32, whereby the combination therapy comprises the administration of the first pharmaceutically active agent and the second pharamceutically active agent to a patient suffering from or being at risk of suffering from the disease or disorder.

34. The nucleic acid according to claim 33, whereby the first pharmaceutically active agent is administered prior, concommittantly or after the second pharmaceutically active agent.

35. The nucleic acid according to any one of claims 1 to 33, whereby the first pharmaceutically active agent and the second pharmaceutically active agent are administered as a single dosage unit.

36. The nucleic acid according to any one of claims 1 to 34, whereby the first pharmaceutically active agent is administered as a first dosage unit and the second pharmaceutically active agent is administered as a second dosage unit or wherein the first pharmaceutically active agent is administered as a second dosage unit and the second pharmaceutically active agent is administered as a first dosage unit.

37. The nucleic acid according to any one of claims 31 to 36, whereby the nucleic acid molecule capable of binding to SDF-1 is selected from the group comprising a type B SDF-1 binding nucleic acid molecule, a type C SDF-1 binding nucleic acid molecule, a type A SDF- 1 binding nucleic acid molecule and a type D SDF-1 binding nucleic acid molecule.

38. The nucleic acid molecule according to claim 37, whereby the type B SDF-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX₂SVNS 3' the central stretch of nucleotides comprises a nucleotide sequence of 5' GUGUGAUCUAGAUGUADWGGCUGWUCCUAGUYAGG 3' (SEQ ID NO: 168). and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' BVBSX₃X4 3', whereby

Xi is either absent or is A, X₂ is G, X₃ is C and ¾ is either absent or is U; or

Xi is absent, X₂ is either absent or is G, X₃ is either absent or is C and is absent.

39. The nucleic acid molecule according to claim 38, whereby the central stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises the following nucleotide sequence:

5' GUGUGAUCUAGAUGUADUGGCUGAUCCUAGUCAGG 3'(SEQ ID NO:

169).

40. The nucleic acid molecule according to any one of claims 38 to 39, whereby the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X1X2CRWG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' KRYS X₃X4 3', whereby Xi is either absent or A, X₂ is G, X₃ is C and X₄ is either absent or U.

41. The nucleic acid molecule according to any one of claims 38 to 40, whereby the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X₁X₂CGUG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UACGX₃X₄ 3', whereby Xi is either absent or A, X₂ is G, X₃ is C,_and X₄ is either absent or U, preferably the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' AGCGUG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UACGCU 3'.

42. The nucleic acid molecule according to any one of claims 38 to 39, whereby the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X₁X₂SSBS 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' BVSSX3 X4 3', whereby Xi is absent, X₂ is either absent or G, X₃ is either absent or C, and X4 is absent, preferably the first terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCGUG 3' and the second terminal stretch of nucleotides of the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UACGC 3'.

43. The nucleic acid molecule according to any one of claims 37 to 42, whereby the type B SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 157 to SEQ ID NO: 167, SEQ ID NO: 170 to SEQ ID NO: 181, and SEQ ID NO: 230, preferably any one of SEQ ID NO: 157 to SEQ ID NO: 159, SEQ ID NO: 170, SEQ ID NO: 176, and SEQ ID NO: 230, more preferably any one of SEQ ID NO: 176 and SEQ ID NO: 230.

44. The nucleic acid molecule according to claim 36, whereby the type C SDF-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the central stretch of nucleotides comprises a nucleotide sequence of GGUYAGGGCUHRX_AAGUCGG (SEQ ID NO: 193), whereby X_A is either absent or is A.

45. The nucleic acid molecule according to claim 44, whereby the central stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GGUYAGGGCUHRAAGUCGG 3' (SEQ ID NO: 194), 5' GGUYAGGGCUHRAGUCGG 3' (SEQ ID NO: 195) or 5' GGUUAGGGCUHGAAGUCGG 3' (SEQ ID NO: 196), preferably 5' GGUUAGGGCUHGAAGUCGG 3' (SEQ ID NO: 196).

46. The nucleic acid molecule according to any of claims 44 to 45, whereby the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' RKSBUSNVGR 3' (SEQ ID NO: 223) and the second stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YYNRCASSMY 3' (SEQ ID NO: 224), preferably the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' RKSBUGSVGR 3 '(SEQ ID NO: 225) and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YCNRCASSMY 3' (SEQ ID NO: 226).

47. The nucleic acid molecule according to any one of claims 44 to 45, whereby the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' XsSSSV 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' BSSSXs 3', whereby X_s is either absent or is S, preferably the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' SGGSR 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YSCCS 3'.

48. The nucleic acid molecule according to any one of claims 44 to 45, whereby a) the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCCGG 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CCGGC 3'; or

c) the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' UGAGAUAGG 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule a nucleotide sequence of 5' CUGAUUCUCA 3' (SEQ ID NO: 436); or

d) the first terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GAGAUAGG 3' and the second terminal stretch of nucleotides of the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CUGAUUCUC 3'.

49. The nucleic acid molecule according to any of claims 44 to 48, whereby the type C SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 182 to SEQ ID NO: 192, SEQ ID NO: 197 to SEQ ID NO: 222, and SEQ ID NO: 232, preferably SEQ ID NO: 182 to SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 197 to SEQ ID NO: 198, SEQ ID NO: 200 to SEQ ID NO: 207 and SEQ ID NO: 213 to SEQ ID NO: 222, more preferably SEQ ID NO: 198, SEQ ID NO: 207, SEQ ID NO: 213, SEQ ID NO: 214, SEQ ID NO: 220 and SEQ ID NO: 221.

50. The nucleic acid molecule according to claim 37, whereby the type A SDF-1 binding nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby the central stretch of nucleotides comprises a nucleotide sequence of 5' AAAGYRACAHGUMAAXAUGAAAGGUARC 3' (SEQ ID NO: 136), whereby XA is either absent or is A.

51. The nucleic acid molecule according to claim 50, whereby the central stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of

5 ' AAAG YRAC AHGUMAAUG AAAGGU ARC 3' (SEQ ID NO: 137), or

5' AAAGYRACAHGUMAAAUGAAAGGUARC 3'(SEQ ID NO: 138), or

139).

52. The nucleic acid molecule according to any one of claims 50 to 51, whereby the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprise a nucleotide sequence of 5' X₁X₂NNBV 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' BNBNXs t 3' whereby Χγ is either absent or R, X₂ is S, X₃ is S and 4 is either absent or Y; or X] is absent, X₂ is either absent or S, X₃ is either absent or S and X₄ is absent.

53. The nucleic acid molecule according to any one of claims 50 to 52, whereby the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' RSHRYR 3' and the second stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' YRYDSY 3', preferably the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCUGUG 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGCAGC 3'.

54. The nucleic acid molecule according to any one of claims 50 to 52, whereby the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' X₂BBBS 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' SBBVX₃ 3', whereby X₂ is either absent or is S and X₃ is either absent or is S; preferably the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CUGUG 3' and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGCAG 3'; or the first terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' GCGUG 3 'and the second terminal stretch of nucleotides of the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence of 5' CGCGC 3'.

55. The nucleic acid molecule according to any one of claims 50 to 54, whereby the type A SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 122 to SEQ ID NO: 135, SEQ ID NO: 140 to SEQ ID NO: 156, and SEQ ID NO: 231, preferably any one of SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 140, SEQ ID NO: 146, and SEQ ID NO: 231, more preferably any one of SEQ ID NO: 146 and SEQ ID NO: 231.

56. The nucleic acid molecule according to claim 16, whereby the type D SDF-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NO: 142 to SEQ ID NO: 143.

57. The nucleic acid molecule according to any one of claims 31 to 56, whereby the SDF- 1 is human SDF-1, whereby preferbaly the human SDF-1 has an amino acid sequence according to SEQ ID No. 3.

58. The nucleic acid molecule according to any one of claims 1 to 30, whereby the nucleic acid molecule capable of binding MCP-1 comprises a modification, whereby the modification is preferably a high molecular weight moiety and/or whereby the modification preferably allows to modify the characteristics of the nucleic acid molecule in terms of residence time in the animal or human body, preferably the human body.

59. The nucleic acid molecule according to any one of claims 31 to 57, whereby the nucleic acid molecule capable of binding MCP-1 and/or the nucleic acid molecule capable of binding to SDF-1 comprises a modification, whereby the modification is preferably a high molecular weight moiety and/or whereby the modification preferably allows to modify the characteristics of the nucleic acid molecule capable of binding to MCP-1 and/or the nucleic acid molecule capable of binding to SDF-1 in terms of residence time in the animal or human body, preferably the human body.

60. The nucleic acid molecule according to any one of claims 58 and 59, whereby the modification is selected from the group comprising a HES moiety, a PEG moiety, biodegradable modifications and combinations thereof.

61. The nucleic acid molecule according to claim 60, whereby the modification is a PEG moiety consisting of a straight or branched PEG, whereby preferably the molecular weight of the straight or branched PEG is from about 20,000 to 120,000 Da, more preferably from about 30,000 to 80,000 Da and most preferably about 40,000 Da.

62. The nucleic acid molecule according to claim 60, whereby the modification is a HES moiety, whereby preferably the molecular weight of the HES moiety is from about 10,000 to 200,000 Da, more preferably from about 30,000 to 170.000 Da and most preferably about 150,000 Da.

63. The nucleic acid molecule according to any one of claims of 60 to 62, whereby the modification is attached to the nucleic acid via a linker, wherein preferably the linker is a biostable or biodegradable linker.

64. The nucleic acid molecule according to any one of claims of 60 to 63, whereby the modification is attached to the nucleic acid at the 5 '-terminal nucleotide of the nucleic acid molecule and/or the 3 '-terminal nucleotide of the nucleic acid molecule and/or to a nucleotide of the nucleic acid molecule between the 5 '-terminal nucleotide of the nucleic acid molecule and the 3 '-terminal nucleotide of the nucleic acid molecule.

65. The nucleic acid molecule according to any one of claims 1 to 64, whereby the nucleic acid molecule capable of binding to MCP-1 is an L-nucleic acid molecule.

66. The nucleic acid molecule according to any one of claims 31 to 65, whereby the nucleic acid molecule capable of binding to SDF-1 is an L-nucleic acid molecule.

67. A pharmaceutical composition comprising as a first pharmaceutically active agent a nucleic acid molecule capable of binding to MCP-1 as defined in any one of claims 1 to 66 and optionally a further constituent, whereby the further constituent is selected from the group comprising pharmaceutically acceptable excipients, pharmaceutically acceptable carriers and pharmaceutically active agents, and whereby the pharmaceutical composition is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein the disease or disorder is selected from the group of diabetes, diabetic complication, diabetic condition and chronic obstructive pulmonary disease.

68. The pharmaceutical composition according to claim 67, whereby the further constituent is a pharmaceutically acceptable carrier.

69. The pharmaceutical composition according to any one of claims 67 and 68, wherein the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

70. The pharmaceutical composition according to any one of claims 67 to 69, wherein the pharmaceutical composition comprises a second pharmaceutically active agent, whereby the second pharmaceutically active agent is a nucleic acid capable of binding to SDF-1 as defined in any one of claims 37 to 66 and whereby the pharmaceutical composition is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein such disease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby preferably the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

71. The pharmaceutical composition according to any one of claims 67 to 70, wherein the pharmaceutical composition comprises a further pharmaceutically active agent, whereby the further pharmaceutically active agent is selected from the group of sulfonylurea drugs, biguanides, alpha-glucosidase inhibitors, thiazolinediones, meglititinides, incretin mimetics and insulin, and whereby the pharmaceutical composition is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein the diease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby preferably the diabetic complication or the diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

72. A medicament comprising one or several dosage units of at least a first pharmaceutically active agent, wherein the pharmaceutically active agent is a nucleic acid molecule capable of binding to MCP-1 as defined in any one of claims 1 to 66.

73. The medicant according to claim 72, wherein the medicament comprises a second pharmaceutically active agent, preferably one or several dosage units of a second pharmaceutically active agent, whereby the second pharmaceutically active agent is a nucleic acid molecule capable of binding to SDF-1 as defined in any one of claims 37 to 66.

74. The medicament according to any one of claims 72 to 73, wherein the medicament comprises a further pharmaceutical agent, preferably one or several dosage units of a further pharmaceutically active agent, whereby the further pharmaceutically active agent is selected from the group of sulfonylurea drugs, biguanides, alpha-glucosidase inhibitors, thiazolinediones, meglititinides, glucagon-like peptide analogs, gastric inhibitory peptide analogs, amylin analogs, incretin mimetics and insulin, and whereby the medicament is for use in a method for the treatment and/or prevention of a disease or disorder, or for the treatment and/or prevention of a disease or disorder, wherein the diease or disorder is selected from the group of diabetes, diabetic complication and diabetic condition, whereby preferably the diabetic complication or diabetic condition is a diabetic complication or a diabetic condition selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

75. The medicament according to any one of claims 73 to 74, wherein the one or several dosage units of the first pharmaceutically active agent comprise the second pharmaceutically active agent.

76. The medicament according to claim 74, wherein the one or several dosage units of the first pharmaceutically active agent comprise the further pharmaceutically active agent.

77. The medicant according to claim 74, wherein the medicament comprises (a) one or several dosage units of the first pharmaceutically active agent, (b) one or several dosage units of the second pharmaceutically active agent and (c) one or several dosage units of the further pharmaceutically active agent, whereby the one or several dosage units of the first pharmaceutically active agent comprise the second pharmaceutically active agent, or the one or several dosage units of the first pharmaceutically active agent comprise the further pharmaceutically active agent, or the one or several dosage units of the second pharmaceutically active agent comprise the further pharmaceutically active agent, or the one or several dosage units of the first pharmaceutically active agent comprise the second pharmaceutically active agent and the further pharmaceutically active agent.

78. The medicament according to any one of claims 74 to 77, whereby the one or several dosage units of the first pharmaceutically active agent, the one or several dosage units of the second pharmaceutically active agent and the one or several dosage units of the further pharmaceutically active agent are each separate dosage units.

79. A method for the treatment of a subject suffering from or being at risk of developing diabetes, a diabetic complication, or a diabetic condition, whereby the method comprises administering to the subject a pharmaceutically effective amount of a nucleic acid molecule capable of binding to MCP-1 as defined in any one of claims 1 to 66.

80. The method according to claim 79, wherein the method further comprises administering to the subject a pharmaceutically effective amount of a nucleic acid capable of binding to SDF-1, whereby preferably the nucleic acid capable of binding to SDF-1 is as defined in any one of claims 37 to 66.

81. The method according to any one of claims 79 to 80, wherein the diabetic condition and the diabetic complication is a diabetic condition or a diabetic complication selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.

82. Use of a nucleic acid molecule as defined in any one of claims 1 to 66, for the manufacture of a medicament for the treatment and/or prevention of diabetes, a diabetic condition ,or a diabetic complication.

83. The use according to claim 82, wherein the diabetic condition and the diabetic complication is a diabetic condition or a diabetic complication selected from the group of atherosclerosis, coronary artery disease, diabetic foot disease, diabetic retinopathy, proliferative diabetic retinopathy, diabetic macular edema, diabetic vitreoretinopathy, proliferative diabetic vitreoretinopathy, diabetic nephropathy, diabetic neuropathy, gestational diabetes mellitus, glucose intolerance, heart disease, high blood pressure, high cholesterol, impaired glucose tolerance, impotence, insulin resistance, kidney failure, metabolic syndrome, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis with or without fibrosis, peripheral vascular disease, reduced glucose sensitivity, reduced insulin sensitivity, obesity, hepatic steatosis, hyperglycaemia and diabetes-associated vascular inflammation.