WO2011158784A1

WO2011158784A1 - Method for large-scale parallel nucleic acid analysis

Info

Publication number: WO2011158784A1
Application number: PCT/JP2011/063492
Authority: WO
Inventors: 浩子松永; 秀記神原
Original assignee: 株式会社日立製作所
Priority date: 2010-06-16
Filing date: 2011-06-13
Publication date: 2011-12-22
Also published as: JP2012000044A

Abstract

Provided are means or a method for solving the problems of nucleic acid analysis that are associated with homopolymer sequences having a low complementary strand bindability. A method for analyzing a target nucleic acid in a sample comprises: a step for preparing a target nucleic acid from a sample; a step for causing a first probe, the complementary strand of which will bind with the shared sequence possessed by the target nucleic acid, to bind with the target nucleic acid; and a step for forming a first extended strand by complementary strand synthesis reaction of the target nucleic acid using the first probe as the primer, wherein the first probe sequence is designed such as to not completely complement the shared sequence possessed by the target nucleic acid, but rather to have one or several mismatched bases.

Description

Large-scale parallel nucleic acid analysis method

The present invention relates to a method for analyzing a target nucleic acid in a sample. Specifically, the present invention relates to a method including a step of performing a complementary strand synthesis reaction of a target nucleic acid using a probe containing a mismatch base.

モニター Monitoring gene expression levels is widely used for examining gene functions, examining the effects of drugs, and diagnosing diseases. For this purpose, a technique is used in which mRNA is taken out from a cell, and its complementary strand cDNA is synthesized and measured. In order to perform a more detailed analysis, it is necessary to subdivide the number of cells as much as possible, and it is also necessary to analyze at the single cell level. However, when the number of cells to be used is small, it is necessary to amplify the cDNA and measure the expression level of the gene because of problems such as the accuracy of the measuring apparatus and detection sensitivity.

A general method for amplification is the polymerase chain reaction (PCR) method. The technologies currently in use are introduced below. First, in order to capture a target nucleic acid, a target consisting of several tens of bases including a base sequence complementary to a part of the target is used to capture the target and the probe by complementary strand bonding. There are several ways to capture mRNA and generate its reverse transcript, cDNA.

The first is the complementary strand-binding reaction between the poly A sequence (several tens to hundreds of bases in length) at the 3 'end of mRNA and an oligo (dT) DNA probe consisting of poly T sequences (usually 20 to 30 bases in length). And then extending an oligo (dT) probe using mRNA as a template to obtain a cDNA strand. In the case of this method, since cDNA is synthesized from the 3 ′ end of mRNA, a cDNA strand containing the 3 ′ end can be reliably obtained. It is also known that the capture efficiency is high because the poly A chain and the capture probe poly T chain slide and hybridize. Although it is possible to obtain a full-length cDNA using this method, when the mRNA is long (5 to 10 k base length or more), the extension reaction does not proceed to the end because the mRNA has a higher order structure. Only cDNA libraries lacking 5'-end information can be constructed.

The second method is to prepare a set of mixed primers consisting of various sequences of about 6 to 9 bases called random primers, and to obtain cDNA strands by extending the random primers with complementary strands at several locations in the mRNA. Is. In the case of this method, a cDNA chain covering all regions can be obtained regardless of the mRNA chain length. However, the extension reaction of one random primer stops at the site where the next random primer binds to the complementary strand, so the cDNA strand length is often short, and it is almost impossible to obtain a full-length cDNA by this method. is there.

In addition, a method of using an oligo (dT) probe and a random primer by mixing the advantages of the above two methods is also known.

For the purpose of exhaustive analysis of genes expressed in cells or tissues, the full length or a certain site, particularly the 3 ′ end portion that is considered to have a lot of gene specific information (Non-patent Document 1) An obtainable method is desirable, and a method using an oligo (dT) probe is used.

On the other hand, in order to realize comprehensive gene analysis at the cell and tissue level, especially gene expression analysis using mRNA extracted from a single cell that has recently attracted attention, cDNA obtained from mRNA is amplified in a batch. It is essential. In a general amplification method, PCR is performed by combining complementary strands with primers at two locations across the amplification target region, and the target region is repeatedly synthesized by complementary strand synthesis, or the amplification target region is converted into a ring DNA by ligation, RCA (Rolling Circle Amplification) that amplifies a target region by performing complementary strand synthesis for many turns along a ring using a primer having a sequence complementary to a part of this ring is known.

As a representative method for comprehensively amplifying all cDNAs present in a single-cell level cDNA library, there is a method described in Non-Patent Document 2. This method has a poly (T) sequence complementary to the 3 'end poly (A) base of mRNA (consisting of a 24 base T sequence) and a unique sequence of about 20 bases in length at the 5' end. The probe (1) linked with (i) is bonded to the mRNA in a complementary strand, and a first strand cDNA is synthesized from the mRNA. Subsequently, a poly (A) base is introduced into the 3 ′ end of the synthesized first strand cDNA. It has a poly (T) sequence complementary to this poly (A) base (consisting of a 24 base T sequence), and a unique sequence of about 20 base length different from the probe (1) at the 5 ′ end (ii ) -Linked probe (2), product obtained as a result of PCR amplification using probe (1) and probe (2) consisting of a unique sequence and a poly (T) sequence using the first strand cDNA as a template Are subject to analysis.

When a cDNA is prepared using an oligo (dT) DNA probe, a homopolymer site composed of a complementary strand of poly T / poly A is always inserted at the end. A homopolymer sequence is not a preferred sequence for a polymerase reaction because the complementary strand binding force is weak, so that the primer is difficult to bind to the complementary strand in the amplification step, and if it exists in the middle, the extension reaction often stops there. If there is a homopolymer (several consecutive bases) in the DNA to be amplified, the polymerase will synthesize the homopolymer with the wrong chain length, resulting in the length of the amplified product that should be the same length. Is known to be non-uniform (Non-Patent Document 3).

Also, when sequencing is performed after amplification, an event is observed in which the elongation reaction stops at the homopolymer portion and sequencing cannot be performed. When trying to join a complementary strand of a primer to a homopolymer part, the primer may be slightly shifted due to the same base, and the complementary strand may be bound (this is an event generally called slipping) (Non-patent Document 4). As described above, it is known that a desired result cannot be obtained in the extension reaction by the polymerase due to the homopolymer.

Therefore, for comprehensive analysis of genes, it is desirable to create cDNA from the 3 ′ end of mRNA, which is important as genetic information. At this time, it is also possible to generate cDNA that does not contain homopolymer sequences. It is desired. There remains a need for techniques to solve these challenges.

For example, by using a base sequence that is not a homopolymer for the part where the probe in the gene analysis is coupled to the complementary chain, it can be used as a priming site in the amplification reaction, and the probe is accurately and stably amplified by accurately binding the complementary chain to the target. can do. Also, when preparing cDNA using an oligo (dT) DNA probe having an adapter sequence consisting of a known sequence at the 5 ′ end, and performing a polymerase amplification reaction (PCR) using the adapter sequence portion as a priming site If the base of the homopolymer portion is replaced with another base, the problem of the complementary strand synthesis being stopped due to low stability can be solved.

Therefore, as a result of intensive studies to solve the above problems, the present inventor has found that a completely complementary homozygous probe is used as a probe (for example, a probe for capturing mRNA) used for the first complementary strand synthesis from a target nucleic acid. It has been found that by performing a complementary chain synthesis reaction using a probe having a sequence that is not a polymer, the resulting extended chain is different from the homopolymer sequence. In other words, if the target nucleic acid is mRNA, prepare a probe containing a mismatch base to the extent that it does not interfere with complementary strand synthesis as a probe for capturing the polyA sequence located at the 3 'end of the mRNA. Perform complementary strand binding and synthesis reaction. In the extended chain of the obtained probe, the base of the homopolymer part (poly A sequence) is replaced with a different base. Thus, the elimination of the homopolymer portion in the extended chain causes problems in the subsequent analysis of the target nucleic acid (PCR amplification and sequencing), that is, the homopolymer's complementary chain bond is unstable, slipping, etc. The problem of can be overcome.

Therefore, the present invention includes the following [1] to [22].
[1] A step of preparing a target nucleic acid from a sample,
A step of binding to the target nucleic acid a first probe that has a complementary strand binding to a common sequence of the target nucleic acid; and a complementary strand synthesis reaction of the target nucleic acid using the first probe as a primer, Including a step of generating an extended strand, wherein the sequence of the first probe is not completely complementary to the common sequence of the target nucleic acid and has one or several mismatched bases A method for analyzing a target nucleic acid in a sample.
[2] The target nucleic acid is an mRNA having a homopolymer sequence consisting of a poly A sequence at its 3 ′ end, or a DNA or RNA having a homopolymer sequence consisting of a sequence of at least 6 bases of the same type, The method according to [1], wherein the first probe is not completely complementary to the homopolymer sequence as a common sequence and has one or several mismatch bases.
[3] A probe for capturing mRNA having at least 15 bases, wherein the target nucleic acid is mRNA and the first probe includes a sequence comprising a combination of at least 2 to 4 consecutive T bases and A, G, or C bases. The method according to [2], wherein
[4] The target nucleic acid is mRNA, and the first probe is an at least 15-base mRNA capture probe comprising a sequence comprising a combination of at least 5 to 7 consecutive T bases and A, G, or C bases The method according to [2], wherein
[5] The target nucleic acid is mRNA, and the first probe is a probe for capturing mRNA of at least 15 bases comprising a sequence comprising a combination of at least 8 to 10 consecutive T bases and A, G, or C bases The method according to [2], wherein
[6] The method according to any one of [1] to [5], further comprising a step of performing a complementary strand synthesis reaction using the first extended strand as a template and the second probe as a primer to generate a second extended strand The method described.
[7] The method according to [6], further comprising a step of performing a complementary strand synthesis reaction using the second extended strand as a template and the third probe as a primer to generate a third extended strand.
[8] The method according to [7], wherein the third probe is the same as the first probe.
[9] The third probe has a complementary strand binding to the complementary sequence portion of the first probe in the second extended strand, and one or several mismatches to the complementary sequence portion of the first probe The method according to [7], which is designed to have a base.
[10] The method according to any one of [1] to [9], wherein at least one base contained in the probe is an artificial nucleic acid.

[11] A probe having a mismatched base has a VN sequence (V represents A, C or G base, N represents A, C, G or T base) at the 3 ′ end thereof, [1] to [ [10] The method according to any one of [10].
[12] A probe having a mismatched base has a VVN sequence (V represents A, C or G base and N represents A, C, G or T base) at the 3 ′ end thereof, [1] to [ [10] The method according to any one of [10].
[13] A probe having a mismatched base has a VN sequence (V represents A, C or G base, N represents A, C, G or T base) at its 3 ′ end, and its 3 ′ Any one of [1] to [10], which is a mixture with a probe having a VVN sequence at the end (V represents A, C or G base, and N represents A, C, G or T base) the method of.
[14] The method according to any one of [1] to [13], wherein the probe having a mismatched base has an adapter sequence consisting of a known sequence at its 5 ′ end.
[15] The method according to [14], wherein the adapter sequence comprises a class IIS type restriction enzyme recognition sequence.
[16] The method according to any one of [1] to [15], wherein the probe is designed to increase the melting temperature (Tm) of the probe sequence.
[17] The method according to any one of [1] to [16], wherein the probe is designed so that the melting temperature (Tm) is a temperature suitable for the nucleic acid amplification reaction.
[18] The method according to any one of [1] to [16], wherein the probe is designed such that the melting temperature (Tm) is a temperature suitable for the nucleic acid sequencing reaction.
[19] The method according to any one of [1] to [18], wherein the probe is designed so that a restriction enzyme recognition sequence is introduced into the extended strand.
[20] The method according to any one of [1] to [19], wherein the first probe is immobilized on a solid phase carrier.
[21] The method according to any one of [1] to [20], further comprising a step of performing a nucleic acid amplification reaction, a sequencing reaction, or preparation of a cDNA library using the obtained extended strand.
[22] The nucleic acid amplification reaction of the target nucleic acid is performed by mixing the first probe and the second probe, or by mixing the first probe, the second probe, and the third probe. The method described.

The present invention provides a method for analyzing a target nucleic acid in a sample. In the method of the present invention, the problem caused by the homopolymer sequence can be solved by base substitution of the homopolymer sequence contained in the target nucleic acid. In addition, a primer binding site is provided that realizes an increase in the melting temperature Tm of the generated extended strand and enables stable complementary strand binding in the subsequent nucleic acid amplification reaction and sequencing reaction. Therefore, according to the present invention, nucleic acids can be analyzed with high efficiency, speed and accuracy.

The outline of the reaction process of this invention is shown. It is a graph which shows the arrangement | sequence of the probe used in the Example, and the cDNA synthesis reaction efficiency using the probe. It is a graph which shows the arrangement | sequence of the probe used in the Example, and the cDNA synthesis reaction efficiency using the probe. It is a graph which shows the arrangement | sequence of the probe used in the Example, and the cDNA synthesis reaction efficiency using the probe. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention. It is a figure which shows one Embodiment of the reaction process of this invention.

Hereinafter, the present invention will be described in detail. This application claims the priority of Japanese Patent Application No. 2010-137073 filed on June 16, 2010, and includes the contents described in the specification and / or drawings of the above patent application. .

The present invention relates to a method for analyzing a target nucleic acid in a sample. That is, in order to amplify a target nucleic acid from a sample, determine a sequence of the target nucleic acid, or construct a cDNA library from the target nucleic acid, the target nucleic acid is quickly and efficiently captured and processed.

Specifically, the method of the present invention comprises the following steps:
Preparing a target nucleic acid from a sample;
A step of binding to the target nucleic acid a first probe that has a complementary strand binding to a common sequence of the target nucleic acid; and a complementary strand synthesis reaction of the target nucleic acid using the first probe as a primer, Generating an extended chain;

First, target nucleic acid is prepared from the sample. The sample is not particularly limited as long as it is a sample containing nucleic acid, and can be any biological sample (eg, cell sample, tissue sample, liquid sample, etc.), or synthetic sample (eg, nucleic acid library such as cDNA library). A sample can be used. In the case of a sample derived from a living body, the living body from which the sample is derived is not particularly limited, and vertebrates (eg, mammals, birds, reptiles, fishes, amphibians, etc.), invertebrates (eg, insects, nematodes, crustaceans, etc.) ), A sample derived from any living organism such as a protist, a plant, a fungus, a bacterium, or a virus can be used.

The target nucleic acid is not particularly limited as long as it contains the sequence to be analyzed. Deoxyribonucleic acid (DNA), such as cDNA, and ribonucleic acid (RNA), such as messenger RNA (mRNA), and fragments thereof And hybrid nucleic acids. In the present invention, as a target nucleic acid, mRNA having a homopolymer sequence consisting of a polyA sequence at its 3 ′ end, or DNA or RNA having a homopolymer sequence consisting of a sequence of at least 6 bases of the same type is used. It is preferable to do. Here, the “homopolymer sequence” means a sequence in which the same kind of bases are continuously present. For example, a poly A sequence (A bases are continuously present) is well known. In the present invention, the “homopolymer sequence” has at least 6 bases, preferably at least 8 bases, of the same kind of bases.

Preparation of nucleic acid from a sample can be performed by a method known in the art. For example, when preparing a target nucleic acid from cells, use a proteolytic enzyme such as Proteinase K, a chaotropic salt such as guanidine thiocyanate or guanidine hydrochloride, a surfactant such as Tween or SDS, or a commercially available reagent for cell lysis. The cells can be lysed and the nucleic acids contained therein, ie DNA and RNA, can be eluted. When RNA is prepared, among the nucleic acids eluted by cell lysis, DNA is decomposed with a DNA degrading enzyme (DNase), and a sample containing only RNA as a nucleic acid is obtained. When mRNA is prepared, since the mRNA contains a poly A sequence, only the mRNA can be captured from the RNA sample prepared as described above using a DNA probe containing a poly T sequence. In order to prepare such a nucleic acid, kits are sold from many manufacturers, and the target nucleic acid can be easily purified.

The first probe that binds to the common sequence of the target nucleic acid and complementary strand is bound to the target nucleic acid prepared as described above. The common sequence possessed by the target nucleic acid means a sequence commonly contained in a plurality of types of target nucleic acids to be analyzed. Examples of such a common sequence include a poly A sequence in mRNA, a specific repetitive sequence, and a ligation. For example, there may be a chemically synthesized oligo DNA portion introduced in the previous step by the above method, or a sequence of the plasmid portion when inserted into the plasmid in the previous step.

In the present invention, the first probe is not completely complementary to the common sequence of the target nucleic acid and is designed to have one or several mismatch bases. That is, the first probe has a sequence containing a base in which one or several bases are not complementary in a sequence complementary to the common sequence of the target nucleic acid. In the present invention, such non-complementary bases are referred to as “mismatch (base)”, while complementary bases are referred to as “match (base)”. It is known in the art that a probe or primer binds complementarily to a template nucleic acid even if it contains several mismatched bases with respect to the template nucleic acid.

The probe can be prepared by a known oligonucleotide synthesis method. Even if the base contained in the probe is a natural base (adenine A, glycine G, cytosine C, thymine T, uracil U, inosine I, etc.) It may be an artificial nucleic acid (for example, peptide nucleic acid PNA). Alternatively, the probe may be a mixture of a natural base and an artificial nucleic acid, and at least one base can be an artificial nucleic acid.

The probe is designed in consideration of the common sequence of the target nucleic acid, the length of the sequence, the melting temperature (Tm), and the like. Melting temperature: The (Tm M elting T emperature), the temperature at which 50% of the probes and the target nucleic acid to form complementary strands is indicative of complement form stability. The length of the sequence having a function as a probe (or primer) is preferably 10 bases or more, more preferably 15 bases or more, and further preferably 18 bases or more. For example, the length of the probe can be 10-50 bases, 15-50 bases, 15-30 bases, or 20-50 bases.

The case where the target nucleic acid is mRNA and the common sequence is a poly A sequence will be described in detail. As a probe (mRNA capture probe) for capturing mRNA having a poly A sequence, generally 5′-TTTTTTTTTTTTTTTTTTTTVN-3 ′ (SEQ ID NO: 1) (in the sequence, a mixed base of V = A, C and G, A probe having a sequence of N = A, C, G and T) is used. This is a probe that binds complementarily to the poly A sequence at the 3 ′ end of mRNA and the boundary portion of the gene-specific sequence portion that follows. The probe has a melting temperature Tm of 52.6 ° C. (calculated by Integrated DNA Technologies, Inc., Oligo Analyzer 3.1). The probe may have a VVN sequence (V represents A, C, or G base, and N represents A, C, G, or T base) at its 3 ′ end. In the method of the present invention, a probe having a VN sequence (V represents A, C or G base, N represents A, C, G or T base) at its 3 ′ end, and VVN at its 3 ′ end. It is also possible to use a mixture with a probe having the sequence (V represents A, C or G base and N represents A, C, G or T base).

In the design of the first probe, one or several mismatch bases are inserted into a sequence complementary to the above poly A sequence. In the above sequence (SEQ ID NO: 1), Tm is increased by 1.6 to 1.9 ° C. by replacing only one base with G in 20 consecutive T sequences. On the other hand, if there is one mismatched base, Tm decreases by about 1 ° C. This indicates that the insertion of a single mismatch base into the probe has little effect on the reaction. The most commonly used enzyme for reverse transcription (complementary strand synthesis) of mRNA to cDNA (ReversemTranscriptase) is 42-50 ℃, so probes with Tm higher than this range are Under the reaction conditions at a low temperature, most of them are considered to form complementary strands. From this, it is possible to form a complementary strand at the optimum temperature for the reverse transcription reaction even when the temperature drops by about 10 ° C. from the Tm (= 52.6 ° C.) of the probe of SEQ ID NO: 1. For example, as described in Example 1, the Tm of the probe before insertion of the mismatched base and the Tm of the designed probe are calculated and compared, and the Tm of the designed probe is within the target range (for example, It can be confirmed whether or not the temperature is within the optimum temperature range of the reverse transcriptase to be used.

In the present invention, it is preferable to design the probe so that the melting temperature (Tm) increases. Specifically, the melting temperature Tm is calculated from the designed primer / probe sequence composition and base length manually or using a known program, and it is confirmed whether the Tm is within the target temperature range. .

Tm decreases dramatically as the number of mismatched bases increases, and decreases by about 10 ° C when 3 bases are inserted (calculated by Primer analysis software Oligo ver6.71). Therefore, in the case of a probe for capturing mRNA, mismatch bases can be inserted up to about 3 bases out of a homopolymer consisting of T bases having a total length of 20 bases. However, the frequency of mismatch base insertion is not limited to 3 bases because the complementary strand binding ability varies depending on the type of reverse transcriptase and the base type of the mismatch base used. For example, in the case of a probe composed of 20 bases, 1 to 10, preferably 1 to 5, more preferably 1 to 3 mismatch bases can be inserted. / The optimum conditions can be determined by calculating Tm using a primer design program, or by actually conducting experiments each time. Further, the base species inserted as a mismatch base may be the same or a combination of different base species. The frequency of mismatch base insertion need not be the same, and it is possible even if the intervals at which mismatch bases are inserted are different.

For example, the mRNA capture probe (first probe) should be a probe of at least 15 bases comprising a sequence comprising a combination of at least 2 to 4 consecutive T bases and an A, G, or C base other than T. Can do. Further, for example, the mRNA capture probe (first probe) is a probe of at least 15 bases comprising a sequence comprising a combination of at least 5 to 7 consecutive T bases and A, G or C bases other than T. be able to. Alternatively, the probe for mRNA capture (first probe) should be a probe of at least 15 bases comprising a sequence comprising a combination of at least 8 to 10 consecutive T bases and A, G, or C bases other than T. Can do. Specific examples of probe sequences that can be used in accordance with the present invention are shown in SEQ ID NOs: 2-16.

A probe in which a mismatched base of 3 bases is introduced into the aforementioned probe (SEQ ID NO: 1) is, for example, 5'-TTCTTTTTCTTTTTCTTTTTVN-3 '(SEQ ID NO: 12). In the sequence, part C is a mismatch base with respect to the poly A sequence contained in the target nucleic acid. In the extended chain extended using the probe having this mismatched base, the portion where T is linked by 5 bases is the longest and is no longer a homopolymer sequence.

Furthermore, Tm increases from 52.6 ° C to 59.6 ° C by 7 ° C by replacing 3 bases with C base. This works very advantageously when the region corresponding to the probe containing the mismatched base is used as a primer priming site for PCR after the generation of the extended strand. Unlike the reverse transcription reaction, the PCR reaction can improve the accuracy in product specificity as it reacts at a higher temperature. If the Tm of the primer is low, the reaction temperature must be set low in the complementary strand binding step, resulting in a high probability of mismatched complementary strand binding to a site different from the target, resulting in amplification as a by-product after PCR amplification. End up. By using a probe containing a mismatched base as described above, it is possible to efficiently perform base substitution of the homopolymer sequence of the poly A base at the 3 ′ end of the mRNA, thereby allowing base substitution in the subsequent amplification step. It is possible to secure a priming site with an increased Tm value.

Thus, in the present invention, it is preferable that the melting temperature (Tm) in the obtained extended chain is designed to be a temperature suitable for analysis to be performed later. That is, by designing a probe (such as the first probe and / or the second or third probe described later) in accordance with the present invention, the melting temperature Tm of the extended chain produced is suitable for the analysis of the target nucleic acid to be performed later. Temperature can be controlled. For example, when performing a nucleic acid amplification reaction, design the probe so that the melting temperature (Tm) of the region to which the primer for nucleic acid amplification in the extended chain binds is within the optimum temperature range of the polymerase used in the nucleic acid amplification reaction. To do. Alternatively, when performing a sequencing reaction, the melting temperature (Tm) of the region to which the sequencing primer in the extended strand binds is 45 to 70 ° C., preferably 50 to 68 ° C., more preferably 55 to Design the probe to 65 ° C.

The probe (the first probe and / or the second or third probe described later) may have an adapter sequence consisting of a known sequence at its 5 ′ end. The adapter sequence should be of any composition of any length as long as it does not affect reactions for nucleic acid analysis, such as mRNA capture, nucleic acid amplification reactions, sequencing reactions, etc. Can do.

When a complementary strand synthesis reaction is performed using a probe having an adapter sequence, a sequence known as an adapter sequence is introduced into the resulting extended strand. Therefore, it is possible to comprehensively amplify the target nucleic acid in parallel by a nucleic acid amplification reaction using the known sequence as a priming site. In addition, sequencing using a known adapter sequence as a priming site is also possible. Further, by placing a restriction enzyme recognition sequence matched to the cloning vector in the adapter sequence and inserting it into the vector, amplification by cloning becomes possible.

The adapter sequence can be a sequence including a restriction enzyme recognition sequence, for example. Restriction enzyme recognition sequences include, but are not limited to, 4-base recognition restriction enzymes MseI (T ↓ TAA), MboI (↓ GATC), BfaI (C ↓ TAG), FatI (↓ CATG) recognition sequences; 6 Base recognition restriction enzymes PsiI (TTA ↓ TAA), SspI (AAT ↓ ATT), HindIII (A ↓ AGCTT) recognition sequence; Class IIS type restriction enzyme recognition sequence such as GsuI (CTGGAG or GACCTC) (16 bases from the recognition sequence) (Upstream chain) or 14 bases (downstream chain) sites), BbrI, HgaI (JP 2000-197493 A, EP-1006180 B) recognition sequences.

The probe (the first probe and / or the second or third probe described later) may be designed so that a restriction enzyme recognition sequence is introduced into the generated extended chain. For example, as described above, an adapter sequence containing a restriction enzyme recognition sequence may be added to the 5 ′ end, or a restriction enzyme recognition sequence may be inserted into the probe itself using a mismatch base ( That is, it becomes possible to insert a restriction enzyme recognition sequence that originally does not have the target nucleic acid by substitution with a mismatched base).

The first probe may be in a free state, or the 5 ′ end may be immobilized on a solid support. By immobilizing the first probe on the solid phase carrier, the target nucleic acid can be captured on the solid phase carrier. The solid phase carrier to be used is not particularly limited as long as it is a solid phase carrier generally used for nucleic acid manipulation. Specifically, it is preferably a solid support that is insoluble in water and does not melt during heat denaturation. Examples of the material include metals such as gold, silver, copper, aluminum, tungsten, molybdenum, chromium, platinum, titanium, and nickel; alloys such as stainless steel, hastelloy, inconel, monel, and duralumin; silicon; glass, quartz glass, Glass materials such as fused quartz, synthetic quartz, alumina, sapphire, ceramics, forsterite and photosensitive glass; polyester resin, polystyrene, polyethylene resin, polypropylene resin, ABS resin (Acrylonitrile Butadiene Styrene resin), nylon, acrylic resin, fluorine resin , Polycarbonate resin, polyurethane resin, methylpentene resin, phenol resin, melamine resin, epoxy resin, vinyl chloride resin and other plastics; agarose, dextran, cellulose, polyvinyl alcohol, nitro Cellulose, chitin, chitosan. Also, the shape of the solid phase carrier is not particularly limited, and examples thereof include those formed by a flat surface (for example, titer plate, porous or pore array), flat plates, films, tubes, and particles. Furthermore, by using magnetized or magnetizable magnetic beads as particles, separation processing and the like can be automated, made efficient, or accelerated. When particles are used as the solid support, the particle diameter is usually 50 μm or less, for example, 1.0 μm to 3.0 μm.

The method for immobilizing the oligonucleotide or nucleic acid such as the first probe on the solid phase carrier is not particularly limited. For example, covalent bond, ionic bond, physical adsorption, biological bond (for example, biotin and avidin or streptavidin) And the like, and the like. The first probe may be immobilized on the solid support via a spacer sequence, for example, a hydrocarbon group containing 1 to 10 carbon atoms. Alternatively, for example, T bases, TC sequences, and the like can be continuously arranged and used as a spacer sequence, and any spacer sequence can be used as long as it is a spacer sequence recommended by each oligo synthesis manufacturer.

Immobilization of the probe to the solid phase carrier via a covalent bond is performed, for example, by introducing a functional group into the probe and introducing a functional group reactive with the functional group into the solid phase carrier and reacting both. it can. For example, a covalent bond can be formed by introducing an amino group into the probe and introducing an active ester group, epoxy group, aldehyde group, carbodiimide group, isothiocyanate group or isocyanate group into the solid phase carrier. Further, a mercapto group may be introduced into the probe, and an active ester group, maleimide group or disulfide group may be introduced into the solid phase carrier. Examples of the active ester group include a p-nitrophenyl group, an N-hydroxysuccinimide group, a succinimide group, a phthalimide group, and a 5-norbornene-2,3-dicarboximide group.

As one of the methods for introducing a functional group into a solid phase carrier, there is a method of treating a solid surface with a silane coupling agent having a desired functional group. Examples of coupling agents include γ-aminopropyltriethoxysilane, N-β- (aminoethyl) -γ-aminopropyltrimethoxysilane, N-β- (aminoethyl) -β-aminopropylmethyldimethoxysilane, Alternatively, γ-glycidoxypropyltrimethoxysilane or the like can be used. Another method for introducing a functional group to be a binding site into a solid phase carrier is plasma treatment. By such plasma treatment, a functional group such as a hydroxyl group or an amino group can be introduced into the solid phase carrier. The plasma treatment can be performed using an apparatus known to those skilled in the art.

Examples of a method for immobilizing a probe to a solid phase carrier by physical adsorption include a method of electrostatically binding a solid phase carrier surface-treated with a polycation (polylysine, polyallylamine, polyethyleneimine, etc.) using the charge of a nucleic acid. Is mentioned. Subsequently, after the first probe is bound to the target nucleic acid, a complementary strand synthesis reaction of the target nucleic acid is performed using the first probe as a primer. In the method of the present invention, complementary strand synthesis can be performed according to a method known in the art, for example, using an appropriate reverse transcriptase or polymerase in the presence of a base (such as dNTP) serving as a substrate.

When the target nucleic acid is mRNA and cDNA is generated as the first extension strand, complementary strand synthesis can be performed by reverse transcription using reverse transcriptase. When the target nucleic acid is DNA and DNA is generated as the first extended strand, the extended strand can be generated, for example, by a replication reaction using a polymerase.

Reverse transcriptase is an enzyme that has the activity of extending a primer in the 5 'to 3' direction by adding a new base (nucleotide) to the hydroxyl group at the 3 'end of the primer using RNA as a template. M-MLV RT and AMV-RT (both supplied from almost all reagent manufacturers), and those that can react at high temperatures include Super Script III RT (Invitrogen) and MonsterScript (Epicentre) It is commercially available. The polymerase used for complementary strand synthesis is an enzyme that has the activity of extending a primer in the 5 'to 3' direction by adding a new base (nucleotide) to the hydroxyl group at the 3 'end of the primer using DNA as a template. Use, for example, E. coli DNA polymerase, DNA polymerase or Klenow Polymerase (supplied from almost all reagent manufacturers), φ29 DNA polymerase with strand displacement function, Bst DNA polymerase (Fermentase, New England Biolabs, etc.) Can do.

In the method of the present invention, the second extended strand may be generated by performing a complementary strand synthesis reaction using the generated first extended strand as a template and the second probe as a primer. Furthermore, a third extended strand may be generated by performing a complementary strand synthesis reaction using the second extended strand as a template and the third probe as a primer. In this case, complementary strand synthesis can also be performed in the same manner as described above.

The second probe can be a probe having an arbitrary sequence capable of performing complementary strand synthesis using the first extended strand as a template. A person skilled in the art can generate a second extension strand having an appropriate length and including a necessary region according to the subsequent analysis (for example, nucleic acid amplification reaction, sequencing reaction, cDNA library preparation). For example, an appropriate probe can be designed based on common general knowledge.

The third probe may be the same as or different from the first probe. In the case where the first probe is used as the third probe, it is completely complementary chain-bonded (matched) with the complementary sequence portion of the first probe in the second extended strand. When different from the first probe, the third probe binds to the complementary sequence portion of the first probe in the second extended strand, but is 1 or to the complementary sequence portion of the first probe. It is preferably designed to have several mismatched bases. Here, the “complementary sequence portion of the first probe” means that a complementary strand is synthesized with the portion of the first probe in the first extension strand that is the template when the second extension strand is generated. Means a portion having a sequence complementary to the first probe. The third probe can be designed in the same manner as described above for the design of the first probe.

In addition, by using a plurality of types of probes containing mismatched bases, it is possible to sequentially replace the bases of the extended chain generated from the target nucleic acid, and it is possible to obtain a sequence suitable for the subsequent nucleic acid analysis reaction. For example, as described above, restriction enzyme recognition sequences can be sequentially inserted. If the target nucleic acid has a large number of bases to be substituted, complementary strand synthesis can be performed by inserting one to several mismatched bases in the first probe, third probe, and further probes if necessary. It is possible to gradually replace the base in the course of the synthesis reaction.

When using a plurality of probes as described above, the amplification reaction of the target nucleic acid can be performed by mixing the probes. For example, the nucleic acid amplification reaction of the target nucleic acid can be performed by mixing the first probe and the second probe, or by mixing the first probe, the second probe, and the third probe. It is preferable to adjust the mixing ratio of the probe (for the amplification primer) so that the concentration of the primer for generating the extended strand having the required sequence finally becomes the highest.

The extended chain generated as described above can be used for further nucleic acid analysis. Such nucleic acid analysis includes, but is not limited to, nucleic acid amplification reactions (PCR, RCA, etc.), sequencing reactions, cDNA library preparation, cloning, and the like. The extension strand produced according to the method of the present invention has a controlled melting temperature (Tm) of the binding site (priming site) of a primer used in nucleic acid amplification reaction or sequencing reaction, and is suitable for such reaction. .

Therefore, the method of the present invention may further include a step of performing a nucleic acid amplification reaction, a sequencing reaction, or a cDNA library preparation using the obtained extended strand. Such nucleic acid analysis methods are known in the art, and those skilled in the art can select and carry out appropriate methods.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the following examples do not limit the present invention.

[Example 1]
Explains the details of reverse transcription reaction of RNA sample using mismatched mRNA capture probe, eliminating homopolymer sequence, and preparing double-stranded cDNA with gene-specific sequence following mRNA polyA sequence (Figs. 1-2).

Total RNA was extracted from cells and tissues. In this example, Total RNA was extracted from the cells to be analyzed using RNeasy® Plus® Mini® Kit (QIAGEN). Oligonucleotides having the following sequences were prepared as mRNA capture probes.

In this example, a 22-base long mRNA capture probe was used. The base length is not limited to this, and in particular, the Tm value (MeltingelTemperature: the temperature at which the complementary strand is formed for 50% of the strands, which is a measure of the stability of complementary strand binding) 15 A length of ~ 30 bases is appropriate. It is also possible to insert a sequence portion (adapter) that does not contribute to mRNA capture at the 5 ′ end, and in that case, the base length is further increased. In addition, the base species that are intentionally inserted into the mismatch portion need not be the same, and may be composed of A, C, or G bases other than T. The mismatch insertion frequency need not be the same, and can be realized even if the mismatch intervals are different.

A probe for capturing mRNA (1 pmol) was added to 20 ng of total RNA prepared in the above step to make 4 μL with sterilized water, incubated at 70 ° C. for 5 minutes, and then cooled to 4 ° C. As a result, the mRNA capture probe (101) and the 3′-terminal poly A sequence (103) of mRNA (102) in Total RNA were bound by complementary strands. In FIG. 1, a probe 13 including three mismatches (110) is shown as an example. V (104) in the sequence of the above-mentioned mRNA capture probe (101) means a mixed base of 3 bases of A, C or G other than T, and N (105) is 4 of A, C, G or T. By seed mixed base. By arranging the VN sequence at the 3 ′ end, it becomes an mRNA capture probe capable of binding a complementary strand only at the boundary with a poly A sequence in which a sequence other than T appears. Note that the arrangement at the 3 ′ end is not limited to the VN sequence, and the object can also be achieved by a VVN sequence or a mixture of a VN sequence and a VNN sequence. Next, 5 × RT buffer 2 μL, 0.1 M Dithiothreitol (DTT), 0.5 μL, RNaseOUT ^™ (40 units / μL, Invitrogen) 0.25 μL, 10 mM dNTP mixture 1 μL, Super Script III RT (200 units / μL, Invitrogen 1 μL and 1 μL of sterilized water were added, mixed by pipetting, and reacted at 50 ° C. for 1 hour. After completion of the reaction, the enzyme was inactivated by heat treatment at 85 ° C. for 90 seconds. By this reaction, the mRNA capture probe (101) was extended using mRNA (102) as a template, and 1st strand cDNA (106) reversely transcribed from mRNA was synthesized.

Subsequently, 2nd strand cDNA was synthesized. 5x second strand buffer (100 mM Tris-Cl (pH 6.9), 23 mM MgCl ₂ , 450 mM KCl, 0.75 mM β-NAD +, 50 mM (NH ₄ ) ₂ SO ₄ ) 20 μL, 10 mM dNTP 2 μL, E Coli. DNA Ligease (1 units / μL, Invitrogen) 1 μL, E Coli. DNA Polymerase (4 units / μL, Invitrogen) 2 μL, E Coli. RnaseH (0.2 units / μL, Invitrogen 1 μL was added, and 64 μL of sterilized water was added to make the total volume 100 μL. The solution was mixed by pipetting and then reacted at 16 ° C. for 2 hours. After completion of the reaction, 1 μL of 2.5 mM EDTA was added and heat treatment was performed at 65 ° C. for 10 minutes to inactivate the enzyme. The complementary strand binding between the mRNA (102) and the mRNA capture probe (101) contained a mismatch (110), whereas the 2nd strand cDNA (111) was the 1st strand cDNA (106) followed by the mRNA capture probe ( 101) is used as a template, and the resulting double-stranded cDNA does not have a mismatch portion, and all are matched exactly (complementary strand binding) (112).

Fig. 2-1, Fig. 2-2, and Fig. 2-3 show the results of cDNA synthesis efficiency when using the mismatched mRNA capture probes shown in Table 1. Probe 1 is a standard probe containing no mismatch, and the amount of cDNA synthesis product when this probe was used was taken as 1, and the synthesis efficiency was calculated. The amount of the synthesized product was measured by qPCR using ABI7900HT (Applied Biosystems).

Probes 2 to 6 (Fig. 2-1) are probes with a single base G as a mismatch, and probes 7 to 11 (Fig. 2-2) are probes with a single base C as a mismatch. A mismatch was placed at 3, 4, 5, 6 or 7 bases from the 3 ′ end to examine the effect on the synthesis efficiency. Probes 12 to 15 (Fig. 2-3) were arranged with mismatches every 6 bases, every 5 bases, every 4 bases or every 3 bases, and the influence of mismatch frequency on the synthesis efficiency was examined.

In addition, the optimum reaction temperature was 50 ° C and 48 ° C lower by 2 ° C in the protocol recommended by the manufacturer of Super Script III used as reverse transcriptase.

As a result, when a single-base mismatch was placed, the reaction efficiency decreased at 50 ° C, but it was confirmed that cDNA could be synthesized with an efficiency of approximately 80% or more even if the mismatch was placed by lowering the reaction temperature at 2 ° C. (Figs. 2-1 to 2-3). In addition, in both cases where the mismatch is slightly C or G, it is better to place the mismatch at about 5 bases from the 3 'end than to place the mismatch at the 3rd base closest to the 3' end, which is the extension end. It was confirmed that there was little influence. Furthermore, it was confirmed that G as a mismatched base had less influence on reaction efficiency than C. From the results when probes 12 to 15 were used (FIG. 2-3), it was confirmed that the reaction efficiency decreased more markedly as the mismatch frequency increased. In addition, as in the case where one mismatch was inserted, it was confirmed that the efficiency could be improved at 48 ° C., which was obtained by reducing the reaction temperature by 2 ° C. from the optimum temperature. The probe 14 has mismatches every 4 bases, and 4 bases out of 22 bases are mismatches. Even when such a probe is used, cDNA is synthesized with an efficiency of 50% as compared with the probe 1 of perfect match. On the other hand, as shown in Table 1, the Tm of the probe 1 is 52.6 ° C., whereas the Tm of the probe 13 is 62.0 ° C., and the Tm value increases by about 10 ° C. After synthesis of 2nd strand cDNA, which is the complementary strand of the mismatched mRNA capture probe portion, this probe portion becomes a very stable priming site. In addition, since the homopolymer is eliminated, the primer is shifted little by little and complementary chain bond slipping does not occur, so that it can be used as a priming site for PCR and sequencing.

In this embodiment, mismatches are arranged at equal intervals in the probes 12 to 15, but the mismatch arrangement method is not limited to this. As shown in Figures 2-1 to 2-3, the reaction efficiency is determined by the mismatched base species, the distance from the 3 'end, the frequency, and several factors. It is possible to use a mismatched mRNA capture probe that meets the requirements. In addition, artificial nucleic acids such as PNA (peptide nucleic acid) are known to have increased binding power to DNA and RNA. By replacing several bases in the probe with artificial nucleic acids, mismatches occur. It is also possible to increase the binding strength of the complementary strand bond that decreases.

According to the present example as described above, the base is formed by complementary chain binding and extension reaction including a mismatch between the homopolymer sequence part derived from the poly-A sequence of mRNA and a sequence other than T arranged intentionally on the mRNA capture probe. It was possible to obtain a double-stranded cDNA product in which the homopolymer derived from the poly A sequence of mRNA was eliminated. As a result, the sequence portion derived from poly A increased in Tm value due to base substitution, and can be used as a stable priming site in subsequent PCR reactions and sequencing reactions.

[Example 2]
Details of a method for introducing a restriction enzyme recognition sequence into a poly A sequence portion derived from mRNA using a probe for capturing mismatched mRNA will be described in the present example (FIGS. 3 to 5).

Double-stranded cDNA is synthesized by the same method as shown in Example 1, but by introducing a restriction enzyme recognition sequence that can be used in subsequent reactions by devising a probe for capturing mRNA used at that time. Is possible. That is, in this example, 1st strand cDNA was synthesized using the following mismatched mRNA capture probe:
5'-TTTTTTTTTTTTTT AA TTTT C TTTTT G TTVN-3 '(SEQ ID NO: 16)
The underlined part of the sequence is a mismatch.

The above-mentioned mismatched mRNA capture probe (151) is prepared by preparing a probe in which the 5 ′ end is modified with two biotin molecules, followed by six carbons inserted as spacers, and a magnetic bead particle having a streptavidin group modified on the surface ( 203) (diameter 2.8 μm, Dynal BIOTECH) (FIG. 3). According to the method attached to the manufacturer, 10 ⁶ molecules of mRNA capture probe (151) were immobilized per bead.

The material of the solid phase carrier is not particularly limited as long as it is insoluble in water. For example, metals such as gold, silver, copper, aluminum, platinum, titanium, nickel, alloys such as stainless steel and duralumin, silicon Glass materials such as glass, quartz glass, and ceramics, plastics such as polyester resin, polystyrene, polypropylene resin, nylon, epoxy resin, and vinyl chloride resin, agarose, dextran, cellulose, polyvinyl alcohol, chitosan, and the like may be used. Further, the shape of the carrier is not particularly limited, and may be a flat shape or a shape having a plurality of holes. In addition, the method for immobilizing the probe on the solid phase carrier is not particularly limited. Covalent bond, ion bond, physical adsorption, biological bond (for example, binding between biotin and avidin or streptavidin, binding between antigen and antibody) The same effect can be obtained by the method by the above.

Subsequently, a probe-immobilized magnetic bead (203) for capturing mRNA was suspended in 10 mM Tris-Cl (pH 7.5) and 0.1% Tween 20 solution (1 × 10 ⁶ beads / μL), and the same as in Example 1 was performed. The procedure up to the synthesis reaction of 2nd strand cDNA (111) was performed to obtain a double-stranded cDNA. The resulting double strand is free from mismatches, and the homopolymer sequence portion derived from the poly A sequence of mRNA is replaced with a sequence other than T artificially arranged in the probe for capturing mRNA. Furthermore, part of the sequence obtained by this substitution, TTAA is a recognition site for restriction enzyme MseI (T ↓ TAA), and restriction enzyme recognition that did not exist in the poly-A sequence part of mRNA by a mismatched mRNA capture probe. The sequence could be inserted (Figure 3).

Subsequently, this double strand was cleaved with a 4-base recognition restriction enzyme MboI (↓ GATC) (301) (FIGS. 3 and 4). Since this restriction enzyme recognition sequence is present at a frequency of about once every 4 ⁴ = 256 bases, the length of the obtained fragment is also about 256 bases. That is, to the bead solution resuspended in 5 μL of 10 mM Tris-Cl (pH 7.5) and 0.1% (w / v) Tween 20 after the preparation of the second strand cDNA (111), 10 × NEB buffer 4 (New 1 μL of England BioLabs), 1 μL of MboI (5 units / μL; New England BioLabs), and 3 μL of sterilized water were added, and the mixture was allowed to react at 37 ° C. for 1 hour. After removing the supernatant after the reaction, the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution, and 4 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended with Tween20. By this reaction, only the MboI cleaved fragment (161) on the 3 ′ side of the mRNA was purified while immobilized on the beads (FIG. 4).

Subsequently, adapter B (152 and 153) having a known sequence was introduced into the restriction enzyme cleavage end by a ligation reaction (FIG. 4). The prepared adapter is oligo B (153) (5′- GATCGGTATTGTTGGAGGGCAGGTGGCTACACTAGATGGTTTAGGGTTG -3 ′: SEQ ID NO: 17) that binds to the end of cDNA by a phosphodiester bond, and oligo B ′ (152) having a sequence complementary to this oligo (5′- CCAACCCTAAACCATCTAGTGTAGCCACCTGCCCTCCAACAATACC -3 ′: SEQ ID NO: 18). Oligo B (153) is modified with a phosphate group at the 5 ′ end, allowing phosphodiester bonding with the end of the MboI cleavage fragment. Oligo B (153) is shorter by one base at the 3 ′ end than oligo B ′ (152). This is a function to prevent the coupling between the adapters. Mix 2 μL of each of the above two oligo solutions (10 μpmol / μL each), incubate at 72 ° C for 2 minutes, lower the temperature to 4 ° C at a rate of 0.1 ° C / sec, and add oligo B (153) and oligo B ′ (152) was bound to a complementary strand to prepare double-stranded adapter B (152 and 153). 1 μL of double-stranded adapter B (152 and 153) and 2.5 μL of Ligation High (TOYOBO) were added to and mixed with the previously prepared bead suspension, and reacted at 16 ° C. for 30 minutes. After the reaction, the supernatant was removed, and the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution. 10 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended in Tween20. Through the above reaction, adapter B (152 and 153) was inserted into the cDNA end by ligation (FIG. 4).

Subsequently, a cleavage treatment (162) with restriction enzyme MseI (T ↓ TAA) was performed (FIG. 4). Specifically, 10 × NEB ライ buffer 2 (New England BioLabs) was added to the bead solution resuspended in 10µL of 10 M Tris-Cl (pH7.5), 0.1% (w / v) Tween20 after the above ligation. 2 μL, 1 μL of MseI (10 units / μL; New England BioLabs), 0.2 μL of 10 mg / mL BSA, and 6.8 μL of sterilized water were added and stirred, followed by reaction at 37 ° C. for 1 hour. After the reaction, the supernatant was removed, and the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution. 10 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended in Tween20. By this treatment, the MboI cleaved fragment on the 3 ′ end side of the mRNA immobilized on the beads was cleaved from the beads. The bead-side MseI recognition sequence was introduced by an extension reaction using the aforementioned mismatched mRNA capture probe. In this example, MseI was used as the restriction enzyme introduced by the mismatch probe, but the present invention is not limited to this. PsiI (TTA ↓ TAA), SspI (AAT ↓ ATT), BfaI (C ↓ TAG), FatI ( The same effect can be obtained with ↓ CATG).

The obtained fragment is a 3 ′ terminal fragment following the poly A sequence of mRNA, but since it does not have a poly A sequence, this fragment can be easily amplified by PCR (FIG. 5). Furthermore, the same sequence of the base substitution site derived from the mRNA poly A sequence and adapter B is inserted at both ends of all the cDNA restriction enzyme fragments contained in the sample. Comprehensive parallel amplification utilized as One of the primers / probes used in this case consists of a sequence (154) that includes a part of the sequence part that has undergone base substitution due to mismatch on the 3 ′ side, and the primer / probe on the opposite side is the sequence part of the adapter B ′. It consists of the arrangement | sequence (155) which contains the same or a part on 3 'side (FIG. 5). At this time, by inserting the mismatch again into a part of the primer / probe (underlined portion of the primer / probe 154 in FIG. 5), the PCR product is further subjected to base substitution. The substitution sequence obtained as a result of using the primer / probe 154 shown in this example is a recognition sequence for the restriction enzyme HindIII (A ↓ AGCTT). In this way, it is possible to substitute bases by using different types of mismatch probes multiple times, and it is possible to insert a restriction enzyme recognition sequence that is desirable for subsequent reactions (for example, cloning) each time. It becomes possible. Also, if there are a large number of bases to replace from the original sequence, mix two or more mismatch probes whose bases are changed little by little during PCR, and gradually replace the bases with each cycle during the cycle reaction. It is also possible to continue. In this case, the mixing ratio of the probes (meaning PCR primers) may be adjusted so that the concentration of the primer having the finally required sequence becomes the highest. By performing base substitution using a mismatch probe, it is possible to obtain a priming site with higher stability, that is, a high Tm value.

By this example, the homopolymer sequence part derived from the polyA sequence of mRNA is replaced with a sequence other than T artificially arranged in the probe for capturing mRNA, and the homopolymer derived from the polyA sequence of mRNA is eliminated. In addition, a double-stranded cDNA restriction enzyme fragment (156) having a known sequence inserted at both ends was obtained (FIG. 5). Furthermore, this product has sequence information at the 3 ′ end of mRNA, which is said to have a lot of gene-specific information, and has a certain length of fragment between cDNAs by restriction enzyme treatment. For this reason, it is possible to minimize the bias between samples when performing amplification by PCR in the final step, and it is possible to perform gene-overall parallel amplification with higher accuracy. In addition, by performing base substitution using a mismatch probe, it is possible to insert a sequence that does not have the original sequence, whereas the Tm value of the priming site is only 47.6 ° C when it consists only of poly-T The Tm value of the primer / probe 154 was 54.9 ° C. and increased by 7 ° C. or more, so that the stability of complementary strand binding could be increased and more accurate PCR amplification became possible. Furthermore, since it becomes possible to insert a restriction enzyme recognition sequence or the like by base substitution, it can be used effectively in subsequent reactions.

In order to obtain this product, MboI was used as a restriction enzyme. However, the restriction enzyme is not limited to MboI, and the recognition base length is not limited to 4 bases as long as the same effect can be obtained. Furthermore, the sequence of any adapter used in this example is not limited, and any adapter can be designed as long as it has the optimum effect when used for subsequent purposes (PCR, cloning, sequencing). Can do. Furthermore, the base length of the primer or probe can be changed each time.

[Example 3]
This example describes in detail how to prepare a sample for comprehensive gene amplification using a probe in which a sequence part (adapter) that does not contribute to mRNA capture is inserted at the 5 ′ end of the mismatched mRNA capture probe. (FIG. 6).

A double-stranded cDNA is synthesized using the method described in Example 1. In this example, a mismatched mRNA capture probe (201) has an adapter sequence A (sequence underlined portion) (202) at the 5 ′ end. The following sequence was used:
5′-GA TCATCATAAGCAATGACGGCAG CTGAAGTATCTTTCTTTTCTTTTCTTTTVN-3 ′ (SEQ ID NO: 19).

The above-mentioned mismatched mRNA capture probe (201) is prepared by preparing a magnetic bead (203) with a 5 ′ end modified with two biotin molecules, followed by six carbon atoms inserted as a spacer, and a streptavidin group modified on the surface. ) (Diameter 2.8 μm, Dynal BIOTECH) (FIG. 6). In this example, a carbon spacer was disposed between the surface of the solid support and the probe. The space is not limited to this, and the same effect can be expected with spacers recommended by each oligo synthesis manufacturer. For example, a method in which T bases, TC sequences, etc. are continuously arranged and used as spacers. Is also possible.

Immobilize 10 ⁶ molecules of mRNA capture probe (201) per bead according to the method attached to the manufacturer, then suspend in 10 mM Tris-Cl (pH 7.5), 0.1% Tween20 solution (1 × 10 ⁶ beads / μL ), Used for reaction. In place of the mismatched mRNA capture probe (1 pmol) shown in Example 1, 1 × 10 ⁶ beads = 1 μL of the above-mentioned mismatched mRNA capture probe immobilized beads (203) is used to synthesize 2nd strand cDNA (111). And double-stranded cDNA was obtained.

Subsequently, a smoothing treatment was performed on the end opposite to that immobilized on the double-stranded cDNA beads (203). According to the reaction of this example, the end of the synthesized double-stranded cDNA is not necessarily smooth, and it is considered that there are a plurality of ones protruding from the 3 ′ end of 1st strand cDNA (106). The degree of protrusion (number of bases) is unknown. For this reason, in order to perform the subsequent ligation of the adapter without bias to all cDNAs, it is necessary to smooth the ends (treat the ends so as to have the same conditions). Therefore, 10 × Blunting buffer (1.2 M Tris-Cl (pH 8.0), 15) was added to a solution obtained by suspending the above 1 × 10 ⁶ beads in 8 μL of 10 mM Tris-Cl (pH 7.5) and 0.1% Tween20 solution. 1 μL of mM MgCl ₂ , 100 mM KCl, 60 mM (NH ₄ ) ₂ SO ₄ , 2 mM dNTP, 1% TritonX-100, 0.01% BSA), and 1 μL of T4 DNA polymerase (3 units / μL, New England BioLabs) After mixing the solution by pipetting, the mixture was reacted at 37 ° C. for 30 minutes, and then the enzyme was inactivated by treatment at 75 ° C. for 20 minutes and transferred to ice. After removing the supernatant after the reaction, the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution, and 5 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended with Tween20. The enzyme used for blunt-end is not limited to T4 DNA polymerase, but can be replaced with KOD DNA polymerase (TOYOBO) that can achieve the same effect.

Subsequently, adapter D having a known sequence at the end of the above-mentioned blunt-ended double-stranded cDNA was introduced by ligation reaction. The prepared adapter is oligo D (215) (5′- CCAACCCTAAACCATCTAGTGTAGCCACCTGCCCTCCAACAATACC -3 ′: SEQ ID NO: 20) that binds to the end of cDNA by a phosphodiester bond, and oligo D ′ (216) having a sequence complementary to this oligo. (5′- GGTATTGTTGGAGGGCAGGTGGCTACACTAGATGGTTTAGGGTTG -3 ′: SEQ ID NO: 21). Oligo D ′ is modified at its 5 ′ end with a phosphate group to enable a phosphodiester bond. Oligo D ′ (216) is shorter by one base at the 3 ′ end than oligo D (215). This is a function to prevent the coupling between the adapters. Mix 2 μL of each of the above two oligo solutions (10 μpmol / μL each), incubate at 72 ° C for 2 minutes, lower the temperature to 4 ° C at a rate of 0.1 ° C / sec, and add oligo D (215) and oligo D '(216) was complemented to form a double-stranded adapter D (215 and 216). Add 1 μL of double-stranded adapter D, 1 μL of 10 × T4 DNA Ligase buffer, 1 μL of T4 DNA Ligase (New England BioLabs), 3 μL of sterilized water to the bead suspension prepared earlier, and add 16 μC at 16 ° C. Reacted for 1 hour. After the reaction, the supernatant was removed, and the beads were washed with 10% mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween 20 solution, and then 10 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended in Tween20. By the above reaction, the sequence of adapter A (202) derived from the probe for capturing mRNA is located on the side immobilized with the magnetic beads (203), and adapter D (215 and 216) is located on the opposite cDNA end by ligation. Inserted. That is, according to this example, the homopolymer sequence part derived from the polyA sequence of mRNA was replaced with a sequence other than T that was artificially arranged on the probe for capturing mRNA, and the homopolymer derived from the polyA sequence of mRNA was eliminated. And a double-stranded cDNA product with known sequences inserted at both ends was obtained (FIG. 6).

Using the adapter A (202) and adapter D (215) sequences as priming sites, it is possible to amplify cDNA in parallel by PCR reaction, and to recognize the restriction enzyme according to the cloning vector in the adapter. Amplification by cloning is also possible by arranging the sequence and inserting it into the vector. In addition, sequencing using the adapter sequence as a priming site is possible.

This embodiment can be applied more effectively by the following method (FIG. 7). In other words, in parallel amplification of products with adapter A and adapter D inserted, the bias of amplification efficiency is less when the target base length is as long as possible (in general, the shorter base length is the better the amplification efficiency) ). On the other hand, the size of cDNA varies from several hundred base length to over 5,000 base length. Thus, double-stranded cDNAs (106 and 111) were prepared as in this example, and then cleaved with a 4-base recognition restriction enzyme MboI (↓ GATC) (301). Since this restriction enzyme recognition sequence is present at a frequency of about once every 4 ⁴ = 256 bases, the length of the cut fragment is also about 256 bases long. That is, to the bead solution resuspended in 5 μL of 10 mM Tris-Cl (pH 7.5) and 0.1% (w / v) Tween 20 after the preparation of the second strand cDNA (111), 10 × NEB buffer 4 (New 1 μL of England BioLabs), 1 μL of MboI (5 units / μL; New England BioLabs), and 3 μL of sterilized water were added, and the mixture was allowed to react at 37 ° C. for 1 hour. After the reaction, the supernatant was removed, and the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution, and 4 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended with Tween20.

Subsequently, adapter C (302 and 303) having a known sequence was introduced into the restriction enzyme cleavage terminal by a ligation reaction. The prepared adapter is an oligo C ′ (303) (5′- GATCGGTATTGTTGGAGGGCAGGTGGCTACACTAGATGGTTTAGGGTTG-3 ′: SEQ ID NO: 22) that binds to the end of cDNA by a phosphodiester bond, and an oligo C (302) having a sequence complementary to this oligo. (5′- CCAACCCTAAACCATCTAGTGTAGCCACCTGCCCTCCAACAATACC -3 ′: SEQ ID NO: 23). Oligo C ′ (303) is modified with a phosphate group at the 5 ′ end to enable a phosphodiester bond. In addition, oligo C ′ (303) is shorter by one base on the 3 ′ end side than oligo C (302). This is a function to prevent the coupling between the adapters. Mix 2 μL of each of the above 2 oligo solutions (each 10 pmol / μL), incubate at 72 ° C for 2 minutes, then reduce the temperature to 4 ° C at a rate of 0.1 ° C / sec. '(303) was complementary strand-bound to prepare double-stranded adapter C (302 and 303). 1 μL of double-stranded adapter C (302 and 303) and 2.5 μL of Ligation High (TOYOBO) were added to the previously prepared bead suspension and mixed, and then reacted at 16 ° C. for 30 minutes. After the reaction, the supernatant was removed, and the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution. 10 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended in Tween20. As a result of the above reaction, the sequence of adapter A (202) derived from the probe for capturing mRNA is located on the side immobilized with magnetic beads (203), and adapter C (302 and 303) is located on the opposite cDNA end by ligation. Inserted.

That is, according to this example, the homopolymer sequence part derived from the polyA sequence of mRNA was replaced with a sequence other than T that was artificially arranged in the oligo DNA for mRNA capture, and the homopolymer derived from the polyA sequence of mRNA was eliminated. In addition, a double-stranded cDNA restriction enzyme fragment with known sequences inserted at both ends was obtained. This product has sequence information at the 3 ′ end of mRNA, which is said to have a lot of gene-specific information, and has a certain length of fragment between cDNAs by restriction enzyme treatment. This makes it possible to minimize the bias between samples when performing amplification by PCR using adapter A (202) and adapter C (302) as priming sites, enabling more accurate gene-wide parallel amplification. became.

[Example 4]
Arbitrary known sequences are pre-arranged on the 5 'end side of the probe for capturing mRNA containing mismatches, and a restriction enzyme recognition sequence having a cleavage site in addition to the recognition site is placed in this known sequence part, and after double-stranded cDNA preparation It is possible to cleave and remove part or all of the oligo DNA for mRNA capture by acting this restriction enzyme. A method for amplifying cDNA by rolling circle amplification (RCA) method after cutting and removing a part will be described in detail in this example (FIG. 8).

ClassIIS restriction enzyme is known as a restriction enzyme having a cleavage site outside the recognition site. In this example, GsuI was used. The recognition sites for this enzyme are as follows:
5'- CTGGAG NNNNNNNNNNNNNNNN-3 '(SEQ ID NO: 24)
3'- GACCTC NNNNNNNNNNNNNN -5 '(SEQ ID NO: 25).

That is, it has a 6-base recognition sequence (underlined) and cleaves 16 bases (upstream chain) or 14 bases (downstream chain) away from it. The moiety represented by N may be any base species of A, C, G or T. In this example, 5′-GATCATCATAAGCAATGACGGCAG CTGGAG TCTTTTCTTTTCTTTTCTTTTTVN-3 ′ (SEQ ID NO: 26) having an adapter sequence F (411) was used as the mRNA capture probe (401). In accordance with the method described in Example 2, double-stranded cDNA (402 and 403) was prepared using the mRNA capture probe (401) immobilized on a solid support, followed by 4-base recognition restriction enzyme. The cutting process was performed with MboI. The ligation reaction of the adapter to the cleaved fragment was also carried out in the same manner as described in Example 2, except that the adapter was oligo E (404) (5′-TACCTCGAAGCCCCTG-3 ′: SEQ ID NO: 27) and this oligo. Adapter E consisting of oligo E ′ (405) (5′-GATCGCAGGGGCTTCGAGGTAC -3 ′: SEQ ID NO: 28) having a sequence complementary to the above was used. In addition, oligo E (404) and oligo E ′ (405) having the 5 ′ end subjected to phosphate group modification (P) (407) were used.

After removing the supernatant after the ligation reaction, the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution, and 10 μL of 10 mM Tris-Cl (pH 7.5), 0.1 The beads were resuspended with% (w / v) Tween20. Subsequently, cleavage treatment (406) with GsuI was performed, and the inserted product of adapter E (404 and 405) was separated from the bead (203). Furthermore, using Lambda exonuclease, an enzyme that specifically degrades the chain with phosphate group modification at the 5 'end, the downstream strand (408) with phosphate group modification (407) at the 5' end is degraded. Then, single strand formation was performed. That is, 1 μL of 10 × buffer B (Fermentas) (100 mM Tris-HCl (pH 7.5), 100 mM MgCl ₂ and 1 mg / ml BSA) was added to the bead suspension on which the ligation product had been immobilized. / μL; 1 μL of Fermentas) and 3 μL of sterilized water were added and stirred, followed by reaction at 30 ° C. for 1 hour.

When cleaving with restriction enzyme GsuI (406), chemically modify the extended strand of the cDNA to prevent it from being cleaved by a recognition sequence existing in the cDNA other than the desired (recognition sequence of the probe immobilized on the solid phase carrier). Can be applied. Examples of the chemical modification method include modification by methylation. That is, by using a methylated substrate during the extension reaction, for example, 5-methyl 伸長 dCTP, it is possible to methylate the extended strand during reverse transcription (this method is cDNA Library released by Takara Bio Inc.). This is a common method used in construction Kit). This method works effectively when a methylation sensitive restriction enzyme is used, and BbrI, HgaI, etc. are known as methylation sensitive Class II restriction enzymes in addition to GsuI used in this example. (JP 2000-197493 A, EP 1006180 B).

After removing the supernatant after the reaction, the beads were washed with 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) Tween20 solution, and 5 μL of 10 mM Tris-Cl (pH 7.5), 0.1% (w / v) The beads were resuspended with Tween20. Subsequently, 1 μL of 10 × buffer (New England Biolabs) (670 mM Glycine-KOH, 25 mM MgCl ₂ , 500 μg / ml BSA (pH 9.4)), 1 μL of Lambda Exonuclease (5 units / μL; New England Biolabs) After adding 3 μL of sterilized water and stirring, the mixture was reacted at 37 ° C. for 1 hour. After the reaction, heat inactivation treatment was performed at 75 ° C for 10 minutes, and the beads were washed in the same manner as described above. The beads were suspended again with 5 µL of 10 mM Tris-Cl (pH 7.5) and 0.1% (w / v) Tween20. It became cloudy. Thus, a restriction enzyme fragment derived from the 3 ′ end of mRNA, having no homopolymer sequence derived from poly A and having known sequences of CTTTTTVN (409) and adapter E ′ (405) at both ends, respectively. A double-stranded DNA (503) could be obtained.

網羅 Comprehensive amplification of this fragment can also be realized by RCA (Fig. 9). The RCA oligo (502) (5′-NBAAAAAGGTACCTCGAAGCCCCTGCGATC-3 ′: SEQ ID NO: 29) immobilized on the solid phase carrier (501) is used in advance. The material and shape of the solid phase carrier are not particularly limited. In addition, by arranging a spacer composed of carbon or the like on the 5 ′ end side of the RCA oligo, and taking the distance from the solid phase carrier surface to the base, the complementary chain binding ability can be increased. The method for immobilizing the oligo DNA on the solid phase carrier is not particularly limited. Covalent bond, ionic bond, physical adsorption, biological bond (for example, binding between biotin and avidin or streptavidin, binding between antigen and antibody, etc.) ) And the like. Using this immobilized RCA oligo as a template, the single-stranded DNA (503) can be circularly arranged to allow complementary strand binding, and the nicked portion (511) of the circular DNA is bound by a ligation reaction. To obtain a circular DNA (503) as a template for RCA amplification. The ligation reaction is not limited to any enzyme species as long as it can achieve the above purpose, such as T4TLigase DNA or Ampligase (Epicentre).

Following the ligation reaction, an RCA reaction (504) is performed using φ29 DNA-polymerase, which is a DNA-polymerase having a strand displacement function, or Bst DNA-polymerase (Fermentase, New England Biolabs, etc.), and then mRNA 3 ' It is a restriction enzyme fragment derived from a terminal, which has no homopolymer sequence derived from poly A, and has a single-stranded DNA (503) having known sequences of CTTTTTVN (409) and adapter E ′ (405) at both ends, respectively. An amplification reaction (504) could be realized (FIG. 9). The enzyme used for RCA is not particularly limited as long as it has a strand displacement action other than the above enzymes.

As the shape of the reaction vessel used to achieve this example, for example, as shown in FIG. 10, a container (612) having a large number of fine holes is prepared, and a wall in each hole (611) is prepared. By immobilizing the mRNA capture probe (601) and immobilizing the RCA oligo DNA (602) on the bottom surface, it is possible to effectively obtain an amplification product in one hole. The product after the RCA reaction is immobilized on the bottom surface, and gene expression analysis can be performed by inserting a fluorescent probe having a gene-specific sequence to form a complementary strand. It is also possible to perform gene expression analysis quantitatively by real-time PCR technology.

Furthermore, as shown in FIG. 11, the bottom of the hole (711) of the reaction vessel (703) is made of a material (701) from which a solution such as a membrane can flow out, and the solution is held in the hole during the reaction. It is also possible to take the form of removing the solution by suction or the like (702) and adding the solution of the next reaction. This can also be achieved by immobilizing the mRNA capture probe (601) and the immobilized RCA oligo DNA (602) on the wall surface.

All publications, patents and patent applications cited in this specification are hereby incorporated by reference in their entirety.

101 mRNA capture probe 102 mRNA
103 3 'terminal poly A sequence 104 V = mixed base of 3 bases of A, C or G other than T 105 N = 4 mixed bases of A, C, G or T 106 1st strand cDNA
110 mismatch 111 2nd strand cDNA
112 matches (complementary strand binding)
151 Probe for mRNA capture 152 Adapter B (Oligo B)
153 Adapter B (Oligo B ')
154 Primer / Probe 155 Primer / Probe 156 Restriction fragment of double-stranded cDNA 161 MboI cleavage fragment 162 Cleavage with restriction enzyme MseI (T ↓ TAA)

201 Probe for mRNA capture 202 Adapter sequence A
203 Magnetic beads 215 Adapter D (Oligo D)
216 Adapter D (Oligo D ')

301 Cleavage with 4-base recognition restriction enzyme MboI (↓ GATC) 302 Adapter C (Oligo C)
303 Adapter C (Oligo C ')

401 Probe for mRNA capture 402 1st strand cDNA
403 2nd strand cDNA
404 Adapter E (Oligo E)
405 Adapter E (Oligo E ')
406 Cleavage with GsuI 407 Phosphate modification 408 Downstream chain 409 CTTTTTVN sequence 411 Adapter sequence F

501 Solid phase carrier 502 RCA oligo 503 Single-stranded DNA or circular DNA
504 Amplification reaction 511 Nick part of circular DNA

601 Probe for mRNA capture 602 Oligo DNA for RCA
611 hole 612 container 701 Material from which solution can flow out 702 Extraction of solution by suction 703 Reaction container 711 hole

SEQ ID NOs: 1 to 29: Artificial (synthetic oligonucleotide)

Claims

Preparing a target nucleic acid from a sample;
A step of binding to the target nucleic acid a first probe that has a complementary strand binding to a common sequence of the target nucleic acid; and a complementary strand synthesis reaction of the target nucleic acid using the first probe as a primer, Including a step of generating an extended strand, wherein the sequence of the first probe is not completely complementary to the common sequence of the target nucleic acid and has one or several mismatched bases A method for analyzing a target nucleic acid in a sample.
The target nucleic acid is an mRNA having a homopolymer sequence consisting of a polyA sequence at its 3 ′ end, or a DNA or RNA having a homopolymer sequence consisting of a sequence of at least 6 bases of the same type of base, The method according to claim 1, wherein the probe is not completely complementary to the homopolymer sequence as a consensus sequence and is designed to have one or several mismatched bases.
The target nucleic acid is mRNA, and the first probe is a probe for capturing mRNA of at least 15 bases comprising a sequence comprising a combination of at least 2 to 4 consecutive T bases and A, G, or C bases. The method of claim 2.
The target nucleic acid is mRNA, and the first probe is a probe for capturing mRNA of at least 15 bases comprising a sequence comprising a combination of at least 5 to 7 consecutive T bases and A, G, or C bases. The method of claim 2.
The target nucleic acid is mRNA, and the first probe is a probe for capturing mRNA of at least 15 bases comprising a sequence comprising a combination of at least 8 to 10 consecutive T bases and A, G, or C bases. The method of claim 2.
The method according to any one of claims 1 to 5, further comprising a step of performing a complementary strand synthesis reaction using the first extended strand as a template and the second probe as a primer to generate a second extended strand. .
The method according to claim 6, further comprising a step of performing a complementary strand synthesis reaction using the second extended strand as a template and the third probe as a primer to generate a third extended strand.
The method according to claim 7, wherein the third probe is the same as the first probe.
The third probe is complementary to the complementary sequence portion of the first probe in the second extension strand and has one or several mismatch bases with respect to the complementary sequence portion of the first probe. The method according to claim 7, which is designed as follows.
The method according to any one of claims 1 to 9, wherein at least one base contained in the probe is an artificial nucleic acid.
The probe having a mismatched base has a VN sequence (V represents A, C, or G base, and N represents A, C, G, or T base) at its 3 'end. 2. The method according to item 1.
The probe having a mismatched base has a VVN sequence (V represents A, C or G base, and N represents A, C, G or T base) at its 3 'end. 2. The method according to item 1.
A probe having a mismatch base has a VN sequence (V represents A, C or G base, N represents A, C, G or T base) at its 3 ′ end, and VVN at its 3 ′ end. The method according to any one of claims 1 to 10, which is a mixture with a probe having the sequence (V represents A, C or G base and N represents A, C, G or T base).
The method according to any one of claims 1 to 13, wherein the probe having a mismatched base has an adapter sequence consisting of a known sequence at its 5 'end.
The method according to claim 14, wherein the adapter sequence comprises a class IIS type restriction enzyme recognition sequence.
The method according to any one of claims 1 to 15, wherein the probe is designed such that the melting temperature (Tm) of the probe sequence is increased.
The method according to any one of claims 1 to 16, wherein the probe is designed so that the melting temperature (Tm) is a temperature suitable for the nucleic acid amplification reaction.
The method according to any one of claims 1 to 16, wherein the probe is designed so that the melting temperature (Tm) is a temperature suitable for a nucleic acid sequencing reaction.
The method according to any one of claims 1 to 18, wherein the probe is designed so that a restriction enzyme recognition sequence is introduced into the extended strand.
The method according to any one of claims 1 to 19, wherein the first probe is immobilized on a solid phase carrier.
The method according to any one of claims 1 to 20, further comprising a step of performing a nucleic acid amplification reaction, a sequencing reaction, or a cDNA library preparation using the obtained extended strand.
The method according to claim 21, wherein the nucleic acid amplification reaction of the target nucleic acid is performed by mixing the first probe and the second probe, or by mixing the first probe, the second probe, and the third probe. .