WO2011076147A1

WO2011076147A1 - Plasma-based micro-rna biomarkers and methods for early detection of colorectal cancer

Info

Publication number: WO2011076147A1
Application number: PCT/CN2010/080247
Authority: WO
Inventors: Zhaoyong Li; Ying Wu; Hongguang Zhu
Original assignee: Fudan University
Priority date: 2009-12-24
Filing date: 2010-12-24
Publication date: 2011-06-30

Abstract

The present invention provides a diagnostic kit of molecular markers in blood for diagnosing colorectal cancer, and/or monitoring the therapeutic effect for treating colorectal cancer. The kit comprises a plurality of nucleic acid molecules, and each nucleic acid molecule encodes a microRNA biomarker, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma of patient and healthy control, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of colorectal cancer. The invention further provides corresponding methods using such nucleic acid expression biomarkers for identifying colorectal cancer as well as for preventing or treating such a condition. Finally, the invention provides a pharmaceutical composition for the prevention and/or treatment of colorectal cancer.

Description

PLASMA-BASED MICRO-RNA BIOMARKERS AND METHODS FOR EARLY DETECTION OF COLORECTAL CANCER

FIELD OF THE INVENTION

The present invention relates to the validated miRNA biomarkers in plasma of colorectal cancer (CRC) patients and corresponding methods for early CRC detection by screening high risk individuals, early detection of the cancer recurrence and monitoring therapeutic effect of colorectal cancer patients.

BACKGROUND OF THE INVENTION

Colorectal cancer (CRC) is the most significant human cancer with an incidence of -1067, 900 new cases worldwide in 2009. It is the third most common cancer and the fourth leading cause of cancer deaths in the world (Gryfe, R. et al. (1997) Curr Probl Cancer 21, 233-300; Petersen, G.M. et al. (1999) Cancer 86, 2540-2550). CRC is curable if diagnosed at an early stage of development. At this early stage, most patients have no phenotypic symptoms of the disease. Therefore, screening is necessary to detect CRC at its early stages. Evidence indicates that early colorectal cancer detection can significantly reduce the incidence and mortality of the disease (Anwar, R. (2006) Digestive and Liver Disease 34, 279-282).

Initially, CRC is characterized by the occurrence of a hyper-proliferative (dysplastic) epithelium in the colon, which first turns into adenomatous polyps, then into adenomas, which are abnormal neoplasms (i.e. benign tumors) in the inner lining of the colon or rectum. Usually, only a small subset of the adenomas formed (occurring with an incidence of 60-70% by age 60) progress into malignant adenocarcinomas. More than 95% of the cases of CRC are manifested as adenocarcinomas (Muto, T. et al. (1975) Cancer 36, 2251-2270; Fearon, E.R. and Vogelstein, B. (1990) Cell 61, 759- 767).

Molecular studies have shown that the etiology of colon carcinogenesis results from an accumulation of multiple epigenetic and genetic alterations including inter alia activating mutations of the K-ras proto-oncogene, inactivating mutations of APC and p53 tumor suppressor genes and DNA repair genes (cf, e.g., Forrester, K. et al. (1987) Nature 327, 298-303; Baker, S.J. et al. (1989) Science 244, 217-221). Genomic instability is another crucial step in progression from adenomas to adenocarcinomas and occurs in two ways in CRC (Lengauer, C. et al. (1997) Nature 386, 623-627). DNA mismatch repair deficiency leading to microsatellite instability, explains only about 15% of the cases of adenoma to carcinoma progression (Umar, A. et al. (2004) J. Natl. Cancer Inst. 96, 261-268; di Pietro, M. et al. (2005) Gastroenterology 129, 1047-1059). In the other 85%, genomic instability occurs at the chromosomal level (CIN), giving rise to aneuploidy. Chromosomal aberrations frequently reported in CRC are 7pq, 8q, 13q, and 20q gains and 4pq, 5q, 8p, 15q, 17p, and 18q losses (Douglas, E.J. et al. (2004) Cancer Res. 64, 4817-4825).

However, no specific molecular markers have been identified so far that allow for a reliable diagnosis of CRC, preferably CRC manifested as an adenocarcinoma, and/or the progression of a benign adenoma into such a malignant tumor, even though cDNA microarray analyses revealed a set of differentially expressed genes apparently involved in the development of CRC (Kitahara, O. et al. (2001) Cancer Res. 61, 3544-3549).

The identification of such molecular markers and development of the matched clinical tests would be of utmost clinical importance, particularly if these markers enable a diagnosis at an early stage of tumor progression in order to allow early stage treatment of carcinomas by the surgical intervention. Ideally, such markers should enable the identification of a carcinoma at a stage where the presence of malignant cells is not yet detectable by microscopic analysis of biopsy or resection materials.

The current standard screening methods for CRC include colonoscopy and the fecal occult blood tests. Both tests, however, suffer from serious disadvantages. The colonoscopy test is effective, but many people are hesitant to have this procedure due to its high cost, high discomfort and its potential for more significant side effects. The fecal occult blood test, on the other hand, is a simple and cheap test, but is relatively inaccurate. However, no specific molecular markers have been identified so far that allow for a reliable diagnosis of CRC.

Many diagnostic assays are also hampered by the fact that they are typically based on the analysis of only a single molecular marker, which might affect detection reliability and/or accuracy. In addition, a single marker normally does not enable detailed predictions concerning latency stages, tumor progression, and the like. Thus, there is still a continuing need for the identification of alternative molecular markers and assay formats overcoming these limitations.

One approach to address this issue might be based on small regulatory R A molecules, in particular on microRNAs (miRNAs) which, constitute an evolutionary conserved class of endogenously expressed small non-coding RNAs of 20- 25 nucleotides (nt) in size that can mediate the expression of target mRNAs and thus - since their discovery about ten years ago - have been implicated with critical functions in cellular development, differentiation, proliferation, and apoptosis (Bartel, D.P. (2004) Cell 116, 281-297, Ambros,V. (2004) Nature 431, 350-355; He. L. et al. (2004) Nat Rev Genet 5, 522-531). Furthermore, miRNAs have advantages over mRNAs as cancer biomarkers, since they are very stable in vitro and long-lived in vivo (Lu, J. et al. (2005) Nature 435, 834-838; Lim, L.P. et al. (2005) Nature 433, 769-773).

MiRNAs are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another RNase III termed Dicer cleaves of the loop of the pre-miRNA hairpin to form a short double-stranded (ds) RNA, one strand of which is incorporated as mature miRNA into a miRNA-protein (miRNP). The miRNA guides the miRNPs to their target mRNAs where they exert their function (Bartel, D.P. (2004) Cell 23, 281- 292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531).

Depending on the degree of complementarity between the miRNA and its target, miRNAs can guide different regulatory processes. Target mRNAs that are highly complementary to miRNAs are specifically cleaved by mechanisms identical to RNA interference (RNAi). Thus, in such scenario, the miRNAs function as short interfering RNAs (siRNAs). Target mRNAs with less complementarity to miRNAs are either directed to cellular degradation pathways or are translationally repressed without affecting the mRNA level. However, the mechanism of how miRNAs repress translation of their target mRNAs is still a matter of controversy. Emerging data available indicate that miRNAs can play roles in cancer as oncogenes or tumor suppressor genes, such as overexpressed miR- 17-92 in cancers, may function as oncogenes and promote cancer development by negatively regulating tumor suppressor genes and/or genes that control cell differentiation or apoptosis, as well as underexpressed let-7a, function as tumor suppressor genes and may inhibit cancers by regulating oncogenes and/or genes that control cell differentiation or apoptosis (Zhang, B. (2007) Dev Biol 302, 1-12), suggesting their contribution to cancer development and progression.

High-throughput miRNA quantification technologies, such as miRNA microarray, real-time RT-PCR-based TaqMan miRNA assay and so on, have provided powerful tools to study the global miRNA profile in whole cancer genome. Increasing evidence shows that many miRNAs are deregulated in human cancer including leukemia, lymphoma, glioblastoma, colon, lung, breast, prostate, thyroid, liver, and ovarian cancer and are differentially expressed in normal tissues and cancers (Zhang, L.

(2008) Adv Exp Med Biol 622, 69-78). Therefore, miRNA profiling is used to create signatures for a variety of cancers, indicating that the profile will help further establish molecular diagnosis, prognosis and therapy. The aberrant expression of miRNAs in human cancer indicates the potential of these miRNAs as biomarkers and targets for molecular therapy.

Among the many possible types of samples, blood is thought to be ideal for screening high risk individuals, leading to early detection, diagnosis, monitoring and efficient treatment of cancers- since blood can be collected easily in a minimally invasive manner. It has been demonstrated that tumor-derived miRNAs are present in human plasma or serum in a remarkably stable form that is protected from endogenous RNase activity. These tumor-derived miRNAs in serum or plasma are at levels sufficient to be measurable as biomarkers for cancer detection. Moreover, the levels of plasma and serum miRNAs correlate strongly, suggesting that either plasma or serum samples will be suitable for clinical applications using miRNAs as cancer diagnostic biomarkers (Mitchell, P.S. et al. (2008) Proc Natl Acad Sci USA 105, 10513-10518; Gilad, S. et al. (2008) PLoS ONE 3, e3148; Chen, X. et al. (2008) Cell Res 18, 997- 1006).

Several studies have reported miRNA expression profiling in plasma or serum of human colorectal cancer (Chen, X. (2008) Cell Res 18, 997-1006; Ng, E.K.O.

(2009) Gut 58, 1375-1381; Huang, Z. 2009, Int J Cancer, published on line). More than 100 circulating miRNAs can be identified in the blood of healthy individuals (Mitchell, P.S. (2008) Proc Natl Acad Sci USA 105, 10513-10518) and this profile differs significantly from that of patients with colorectal cancer who have several tumor- specific miRNAs. Chen and colleagues demonstrated 69 miRNAs in the serum of patients with colorectal cancer, which were not present in the serum of healthy controls (Chen, X. (2008) Cell Res 18, 997-1006). Moreover, they identified a unique expression profile of 14 serum miRNAs for colorectal cancers that were not present in another cancer group (lung cancer). Ng et al's study suggested that miR-92 is significantly elevated in plasma of patients with CRC and can be a potential non-invasive molecular marker for CRC screening (E.K.O. (2009) Gut 58, 1375-1381). Furthermore, Huang and colleagues found that plasma miR-29a and miR-92a have strong potential as novel noninvasive biomarkers for early detection of CRC (Huang, Z. 2009, Int J Cancer. published on line). Nevertheless, another study found that hsa-miR-92a dramatically decreased in the plasma of acute leukemia patients and the ratio of miR-92a/miR-638 in plasma has strong potential as a novel biomarker for detection of leukemia (Tanaka, M. et al. (2009) PLoS ONE 4,e5532). However, lack of sufficient sensitivity and specificity determined by single miRNA is unsuitable as accurate diagnostic biomarkers in clinical use.

Thus, there remains a need for discovery of a set of diagnostic miRNA markers in plasma or serum of colorectal cancer patients. Establishment of blood-based miRNA profiles (fingerprints) by combination of multiple miRNA biomarkers will enable a non-invasive, rapid, accurate, and cost-saving identification of patients exhibiting colorectal cancer. In addition, there is also a continuing need for corresponding methods for early stage-colorectal cancer screening in high risk individuals, early detection of the cancer recurrence, and/or monitoring the cancer therapy.

OBJECT AND SUMMARY OF THE INVENTION

It is an objective of the present invention to provide the validated miRNA biomarkers for early detection of colorectal cancer by screening high-risk individuals, early detection of the cancer recurrence and monitoring therapeutic effect of colorectal cancer patients by determining a plurality of nucleic acid molecules in blood specimens, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in plasma of colorectal cancer patients, analyzed as compared to healthy controls, wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of colorectal cancer and the therapeutic effect.

Furthermore, it is an object of the invention to provide corresponding methods for identifying one or more nucleic acid expression biomarker in blood specimens exhibiting colorectal cancer.

These objectives as well as others, which will become apparent from the ensuing description, are attained by the subject matter of the independent claims. Some of the preferred embodiments of the present invention are defined by the subject matter of the dependent claims.

In a first aspect, the present invention relates to a diagnostic kit of miRNA biomarkers in blood for identifying colorectal cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma and in one or more control plasma, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of colorectal cancer.

The nucleic acid expression biomarker, as defined herein, may comprise at least eight nucleic acid molecules, preferably at least four panels of nucleic acid molecule combinations.

In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy controls. In preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-16-2*, hsa- miR-25, hsa-miR-7, hsa-miR-93, hsa-miR-345, hsa-miR-409-3p, hsa-miR-671-3p and hsa-miR-331-3p.

For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-1228 is used, which is stably expressed in colorectal cancer plasma.

Particularly preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-345, hsa-miR-409-3p, hsa-miR-671-3p, hsa-miR- 33 l-3p is up-regulated, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-16-2*, hsa-miR-25, hsa-miR-7 and hsa-miR-93 is down-regulated and the expression hsa-miR-1228 is un-changed in the one or more target plasma compared to the one or more healthy controls.

In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecule combinations encoding hsa- miR-93/hsa-miR-16-2*, hsa-miR-345/hsa-miR-16-2*, hsa-miR-25/hsa-miR-16-2*, hsa- miR-16-2 */hsa-miR-25, hsa-miR-7/hsa-miR-25, hsa-miR-671-3p/hsa-miR-25, hsa- miR-671-3p/hsa-miR-93, hsa-miR-16-2*/hsa-miR-93, hsa-miR-7/hsa-miR-93, hsa- miR-7/hsa-miR-345, hsa-miR-409-3p/hsa-miR-345, hsa-miR-16-2*/hsa-miR-345, hsa- miR-671-3p/hsa-miR-345, hsa-miR-409-3p/hsa-miR-331-3p and hsa-miR-16-2*/hsa- miR-331-3p.

Particularly preferably, the expression of any one or more of the nucleic acid molecule combinations encoding hsa-miR-16-2*/hsa-miR-25, hsa-miR-7/hsa-miR- 25, hsa-miR-671-3p/hsa-miR-25, hsa-miR-671-3p/hsa-miR-93, hsa-miR-16-2*/hsa- miR-93, hsa-miR-7/hsa-miR-93, hsa-miR-7/hsa-miR-345, hsa-miR-409-3p/hsa-miR- 345, hsa-miR-16-2*/hsa-miR-345, hsa-miR-671-3p/hsa-miR-345, hsa-miR-409-3p/hsa- miR-331-3p and hsa-miR-16-2*/hsa-miR-331-3p is up-regulated and the expression of any one or more of the nucleic acid molecule combinations encoding hsa-miR-93/hsa- miR-16-2*, hsa-miR-345/hsa-miR-16-2* and hsa-miR-25/hsa-miR-16-2* is down- regulated in the one or more target plasma compared to the one or more healthy controls.

In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecule combinations encoding panel 1 (hsa-miR-25/hsa-miR-1228, hsa-miR-93/hsa-miR-1228 and hsa-miR-331-3p/hsa-miR- 1228), panel 2 (hsa-miR-16-2*/hsa-miR-1228, hsa-miR-7/hsa-miR-25, hsa-miR-671- 3p/hsa-miR-345 and hsa-miR-93/hsa-miR-16-2*), panel 3 (hsa-miR-345/hsa-miR-1228, hsa-miR-7/hsa-miR-345 and hsa-miR-671-3p/hsa-miR-25) and panel 4 (hsa-miR-16- 2*/hsa-miR-25, hsa-miR-409-3p/hsa-miR-345, hsa-miR-7/hsa-miR-93 and hsa-miR- 93/hsa-miR-1228).

In a second aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating adenoma (pre-cancer lesion) and all stages of colorectal cancer patients from healthy individuals, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma and in one or more healthy individuals, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of colorectal adenoma, Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinoma.

The nucleic acid expression biomarker, as defined herein, may comprise at least one nucleic acid molecule combination.

In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy individuals, and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy individuals.

In more preferred embodiments, the nucleic acid expression biomarker comprises one nucleic acid molecule combination encoding hsa-miR-7/hsa-miR-25.

Particularly preferably, the expression of the nucleic acid molecule combination encoding hsa-miR-7/hsa-miR-25 is up-regulated in the one or more target plasma compared to the one or more healthy individuals.

In a third aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating all stages of colorectal cancer patients from healthy individuals, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma and in one or more healthy individuals, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of colorectal Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinoma.

The nucleic acid expression biomarker, as defined herein, may comprise at least three nucleic acid molecule combinations.

In more preferred embodiments, the nucleic acid expression biomarker comprises one or more nucleic acid molecule combinations encoding hsa-miR-93/hsa- miR-1228, hsa-miR-93/hsa-miR-16-2* and hsa-miR-7/hsa-miR-93.

Particularly preferably, the expression of the nucleic acid molecule combination encoding hsa-miR-7/hsa-miR-93 is up-regulated and the expression of any one or more of the nucleic acid molecule combinations encoding hsa-miR-93/hsa-miR- 1228 and hsa-miR-93/hsa-miR-16-2* is down-regulated in the one or more target plasma compared to the one or more healthy controls.

In a fourth aspect, the present invention relates to a diagnostic kit of molecular markers for monitoring therapeutic effect of colorectal cancer patients, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma before and after a treatment, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the therapeutic effect of colorectal cancer patients.

The nucleic acid expression biomarker, as defined herein, may comprise at least three nucleic acid molecules.

In preferred embodiments, the nucleic acid expression biomarker comprises at least one or more nucleic acid molecules encoding a microRNA sequence whose expression is up-regulated in the in the one or more target plasma after a treatment compared to the control plasma before a treatment, and at least one or more nucleic acid molecules encoding a microRNA sequence whose expression is down- regulated in the one or more target plasma after a treatment compared to the one or more control plasma before a treatment.

In more preferred embodiments, the nucleic acid expression biomarker comprises one or more nucleic acid molecules encoding hsa-miR-345, hsa-miR-25 and hsa-miR-93.

Particularly preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-345, hsa-miR-25 and hsa-miR-93 is up-regulated in the one or more target plasma after a treatment compared to the one or more control plasma before a treatment.

In a fifth aspect, the present invention relates to a method for identifying one or more target plasma exhibiting colorectal cancer, the method comprising: (a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control plasma; and (c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined herein, that is indicative for the presence of colorectal cancer.

In a sixth aspect, the present invention relates to a method for monitoring therapeutic effect of colorectal cancer patients, the method comprising: (a) identifying in the one or more target plasma a nucleic acid expression biomarker by using a method, as defined herein; and (b) monitoring in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression in plasma is up-regulated before treatment but is down-regulated after treatment and the expression of a nucleic acid molecule whose expression in plasma is down-regulated before treatment but is up-regulated after treatment.

In a seventh aspect, the present invention relates to a method for preventing or treating colorectal cancer, the method comprising: (a) identifying in plasma a nucleic acid expression biomarker by using a method, as defined herein; and (b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up- regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.

In a eighth aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of colorectal cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from colorectal cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from colorectal cancer patients, as defined herein.

Finally, in a ninth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of colorectal cancer.

Other embodiments of the present invention will become apparent from the detailed description hereinafter.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts a flow chart schematically illustrating the essential method steps for determining an miRNA biomarker in blood specimens according to the present invention for early detection of colorectal cancer by screening high-risk individuals, early detection of CRC recurrence and monitoring therapeutic effect of colorectal cancer patients.

Figure 2A illustrates the human miRNAs comprised in particularly preferred miRNA biomarkers obtained on the microarrays in the first aspect according to the present invention for identifying one or more target plasma exhibiting colorectal cancer. The respective data were normalized against an internal stable control hsa-miR-1238. Also indicates the expression levels and accuracy (RUC) of these miRNAs in the patients with colorectal cancer as compared to healthy controls (i.e. an up-regulation or a down-regulation). The data indicate that colorectal cancer patients can be reliably discriminated from healthy individuals in blood specimens.

Figure 2B depicts stepwise logistic regression analysis of miRNA biomarker panel 1 (hsa-miR-25/hsa-miR-1228, hsa-miR-331-3p/hsa-miR-1228 and has- miR-93/hsa-miR-1228) obtained on the microarrays in the first aspect according to the present invention for identifying one or more target plasma exhibiting colorectal cancer. The data indicate that colorectal cancer can be reliably discriminated from healthy individuals (AUC=0.888) in blood specimens.

Figure 3A illustrates the human miRNAs comprised in particularly preferred miRNA biomarkers validated by quantitative RT-PCR method in the first aspect according to the present invention for identifying one or more target plasma exhibiting colorectal cancer. The respective data were normalized against an internal stable control hsa-miR-1238. Also indicates the expression levels and accuracy (RUC) of these miRNAs in the patients with colorectal cancer as compared to healthy controls (i.e. an up-regulation or a down-regulation). The data indicate that colorectal cancer patients can be reliably discriminated from healthy individuals in blood specimens.

Figure 3B depicts stepwise logistic regression analysis of miRNA biomarker panel 2 (hsa-miR-16-2*/hsa-miR-1228, hsa-miR-7/hsa-miR-25, hsa-miR- 671-3p/hsa-miR-345 and hsa-miR-93/hsa-miR-16-2*) validated by quantitative RT- PCR method in the first aspect according to the present invention for identifying one or more target plasma exhibiting colorectal cancer. The data indicate that colorectal cancer can be reliably discriminated from healthy individuals (AUC=0.905) in blood specimens.

Figure 3C depicts stepwise logistic regression analysis of miRNA biomarker panel 3 (hsa-miR-345/hsa-miR-1228, hsa-miR-7/hsa-miR-345 and hsa-miR- 671-3p/ hsa-miR-25) validated by quantitative RT-PCR method in the first aspect according to the present invention for identifying one or more target plasma exhibiting colorectal cancer. The data indicate that colorectal cancer can be reliably discriminated from healthy individuals (AUC=0.903) in blood specimens.

Figure 3D depicts stepwise logistic regression analysis of miRNA biomarker panel 4 (hsa-miR-16-2*/ hsa-miR-25, hsa-miR-409-3p/hsa-miR-345, hsa- miR-7/hsa-miR-93 and hsa-miR-93/hsa-miR-1228) validated by quantitative RT-PCR method in the first aspect according to the present invention for identifying one or more target plasma exhibiting colorectal cancer. The data indicate that colorectal cancer can be reliably discriminated from healthy individuals (AUC=0.892) in blood specimens.

Figure 4A illustrates the human miRNAs comprised in particularly preferred one miRNA biomarker combination (hsa-miR-7/hsa-miR-25) validated by quantitative RT-PCR method in the second aspect according to the present invention for identifying one or more target plasma exhibiting colorectal adenoma, Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinoma. The data indicate that patients with colorectal adenoma and all stages of colorectal cancer can be reliably discriminated from healthy individuals in blood specimens.

Figure 4B depicts the respective expression levels of the hsa-miR- 7/hsa-miR-25 combination in the patients with colorectal adenoma, Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinomas and healthy individuals. The data indicate that colorectal cancer can be detected at the very early stages (pre-cancer lesion and Dukes' A carcinoma) by the miRNA biomarkers provided in the present invention.

Figure 5A illustrates the human miRNAs comprised in particularly preferred three miRNA biomarker combinations (hsa-miR-93/hsa-miR-1228, hsa-miR- 93/hsa-miR-16-2* and hsa-miR-7/hsa-miR-93) validated by quantitative RT-PCR method in the third aspect according to the present invention for identifying one or more target plasma exhibiting Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinoma. The data indicate that colorectal cancer patients with all stages of carcinomas can be reliably discriminated from healthy individuals in blood specimens.

Figure 5B depicts the respective expression levels of the hsa-miR- 93/hsa-miR-1228 combination in the colorectal cancer patients with Dukes' A, Dukes' B, Dukes' C, Dukes' D carcinomas and healthy individuals. The data indicate that colorectal cancer can be detected at the early colorectal cancer stages (Dukes' A carcinoma) by the miRNA biomarkers provided in the present invention.

Figure 5C depicts the respective expression levels of the hsa-miR- 93/hsa-miR-16-2* combination in the colorectal cancer patients with Dukes' A, Dukes' B, Dukes' C, Dukes' D carcinomas and healthy individuals. The data indicate that colorectal cancer can be detected at the early colorectal cancer stages (Dukes' A carcinoma) by the miRNA biomarkers provided in the present invention.

Figure 5D depicts the respective expression levels of the hsa-miR- 7/hsa-miR-93 combination in the colorectal cancer patients with Dukes' A, Dukes' B, Dukes' C, Dukes' D carcinomas and healthy individuals. The data indicate that colorectal cancer can be detected at the early colorectal cancer stages (Dukes' A carcinoma) by the miRNA biomarkers provided in the present invention.

Figure 6 illustrates the human miRNAs comprised in particularly preferred three miRNA biomarkers (hsa-miR-345, hsa-miR-25 and hsa-miR-93) validated by quantitative RT-PCR method in the fourth aspect according to the present invention for monitoring therapeutic effect of colorectal cancer patients. The data indicate that the therapeutic effect of colorectal cancer patients can be reliably monitored by the miRNA biomarkers provided in the present invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based on the unexpected finding that colorectal cancer can be reliably identified based on particular miRNA expression biomarkers in plasma with high sensitivity and specificity, wherein the expression biomarkers as defined herein typically comprises both up- and down-regulated human miRNAs. More specifically, said miR A expression biomarkers - by analyzing the overall miR A expression pattern and/or the respective individual miRNA expression level(s) in plasma - allow the detection of colorectal cancer at an early disease state by screening high-risk individuals, early detection of CRC recurrence and monitoring therapeutic effect of CRC patients.

The present invention illustratively described in the following may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.

The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. The drawings described are only schematic and are to be considered non-limiting.

Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. For the purposes of the present invention, the term "consisting of is considered to be a preferred embodiment of the term "comprising of. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group, which preferably consists only of these embodiments.

Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated.

The term "about" in the context of the present invention denotes an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value of ± 10%, and preferably ± 5%.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein. Further definitions of term will be given in the following in the context of which the terms are used.

The following terms or definitions are provided solely to aid in the understanding of the invention. These definitions should not be construed to have a scope less than understood by a person of ordinary skill in the art.

The term "colorectal", as used herein, relates to the colon, the rectum and/or the appendix, i.e. the complete large intestine.

The term "cancer" (also referred to as "carcinoma"), as used herein, generally denotes any type of malignant neoplasm, that is, any morphological and/or physiological alterations (based on genetic re-programming) of target cells exhibiting or having a predisposition to develop characteristics of a carcinoma as compared to unaffected (healthy) wild-type control cells. Examples of such alterations may relate inter alia to cell size and shape (enlargement or reduction), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death) or cell survival. Hence, the term "colorectal cancer" refers to cancerous growths in the colon, rectum, and appendix.

The most common colorectal cancer (CRC) cell type is adenocarcinoma that accounts for about 95% of cases. Other types of CRC include inter alia lymphoma and squamous cell carcinoma.

Colorectal cancer may be classified according to the Dukes system (Dukes, C.E. (1932) J. Pathol. Bacteriol. 35, 323-325), which identifies the following stages: Dukes A - a tumour confined to the intestinal wall; Dukes B - a tumor invading through the intestinal wall; Dukes C - a tumor also involving the lymph node(s); and Dukes D - a tumor with distant metastasis.

The term "plasma", as used herein, is the yellow liquid component of blood, in which the blood cells in whole blood would normally be suspended. It makes up about 55% of the total blood volume. It is mostly water (90% by volume) and contains dissolved proteins, glucose, clotting factors, mineral ions, hormones and carbon dioxide (plasma being the main medium for excretory product transportation). Blood plasma is prepared by spinning a tube of fresh blood in a centrifuge until the blood cells fall to the bottom of the tube. The blood plasma is then poured or drawn off. Blood plasma has a density of approximately 1025 kg/m³, or 1.025 kg/1. Recent research showed that miRNA is stable in plasma. The term "plasma sample" refers to plasma taken from individuals being examined or from healthy control.

The term "patient", as used herein, refers to a human being at least supposed to have colorectal cancer; where as "target plasma", as used herein, refers to plasma collected from patients; The term "healthy individual" or "healthy control" typically denotes a healthy person not having characteristics of such a cancerous phenotype. And "control plasma", as used herein, denotes plasma collected from healthy individuals. However, in some applications, for example, when comparing different cancer types, the individual having the other cancer types and plasma collected from these individuals is typically considered the "control".

Typically, the plasma samples used are derived from biological specimens collected from the subjects to be diagnosed for the presence of colorectal cancer. Furthermore, in order to corroborate the data obtained "comparative samples" may also be collected from subjects having a given known disease state. The biological samples may include body tissues and fluids, such as colorectal tissue, serum, blood cell, sputum, and urine. Furthermore, the biological sample may be obtained from individual have colorectal cancerous characteristics or suspected to be cancerous. Furthermore, the sample may be purified from the obtained body tissues and fluids if necessary, and then used as the biological sample. According to the present invention, the expression level of the nucleic acid markers of the present invention is determined in the subject-derived biological sample(s).

The sample used for detection in the in vitro methods of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved. The samples to be analyzed are typically from blood. Furthermore, colorectal tissue and other types of sample can be used as well.

The term "microRNA" (or "miRNA"), as used herein, is given its ordinary meaning in the art (Barrel, D.P. (2004) Cell 23, 281-292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Accordingly, a "microRNA" denotes an RNA molecule derived from a genomic locus that is processed from transcripts that can form local RNA precursor miRNA structures. The mature miRNA is usually 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.

The miRNA encoding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within an imperfect RNA duplex (herein also referred to as stem-loop or hairpin structure or as pre-miRNA), which serves as an intermediate for miRNA processing from a longer precursor transcript. This processing typically occurs through the consecutive action of two specific endonucleases termed Drosha and Dicer, respectively. Drosha generates from the primary transcript (herein also denoted "pri-miRNA") a miRNA precursor (herein also denoted "pre-miRNA") that typically folds into a hairpin or stem-loop structure. From this miRNA precursor a miRNA duplex is excised by means of Dicer that comprises the mature miRNA at one arm of the hairpin or stem-loop structure and a similar-sized segment (commonly referred to miRNA*) at the other arm. The miRNA is then guided to its target mRNA to exert its function, whereas the miRNA* is degraded. In addition, miRNAs are typically derived from a segment of the genome that is distinct from predicted protein-coding regions.

The term "miRNA precursor" (or "precursor miRNA" or "pre-miRNA"), as used herein, refers to the portion of a miRNA primary transcript from which the mature miRNA is processed. Typically, the pre-miRNA folds into a stable hairpin (i.e. a duplex) or a stem-loop structure. The hairpin structures typically range from 50 to 80 nucleotides in length, preferably from 60 to 70 nucleotides (counting the miRNA residues, those pairing to the miRNA, and any intervening segment(s) but excluding more distal sequences).

The term "nucleic acid molecule encoding a microRNA sequence", as used herein, denotes any nucleic acid molecule coding for a microRNA (miRNA). Thus, the term does not only refer to mature miRNAs but also to the respective precursor miRNAs and primary miRNA transcripts as defined above. Furthermore, the present invention is not restricted to RNA molecules but also includes corresponding DNA molecules encoding a microRNA, e.g. DNA molecules generated by reverse transcribing a miRNA sequence. A nucleic acid molecule encoding a microRNA sequence according to the invention typically encodes a single miRNA sequence (i.e. an individual miRNA). However, it is also possible that such nucleic acid molecule encodes two or more miRNA sequences (i.e. two or more miRNAs), for example a transcriptional unit comprising two or more miRNA sequences under the control of common regulatory sequences such as a promoter or a transcriptional terminator.

The term "nucleic acid molecule encoding a microRNA sequence", as used herein, is also to be understood to include "sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence (5'→ 3') matches or corresponds to the encoded miRNA (5'→ 3') sequence) and "anti-sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'→ 3') sequence or, in other words, matches the reverse complement (3'→ 5') of the encoded miRNA sequence). The term "complementary", as used herein, refers to the capability of an "anti-sense" nucleic acid molecule sequence of forming base pairs, preferably Watson-Crick base pairs, with the corresponding "sense" nucleic acid molecule sequence (having a sequence complementary to the anti-sense sequence).

Within the scope of the present invention, two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. Alternatively, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). Preferably, the "complementary" nucleic acid molecule comprises at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in corresponding "sense" nucleic acid molecule.

Accordingly, the plurality of nucleic acid molecules encoding a miRNA sequence that are comprised in a diagnostic kit of the present invention may include one or more "sense nucleic acid molecules" and/or one or more "anti-sense nucleic acid molecules". In case, the diagnostic kit includes one or more "sense nucleic acid molecules" (i.e. the miRNA sequences as such), said molecules are to be considered to constitute the totality or at least a subset of differentially expressed miRNAs (i.e. molecular markers) being indicative for the presence of or the disposition to develop a particular condition, here lung cancer. On the other hand, in case a diagnostic kit includes one or more "anti-sense nucleic acid molecules" (i.e. sequences complementary to the miRNA sequences), said molecules may comprise inter alia probe molecules (for performing hybridization assays) and/or oligonucleotide primers (e.g., for reverse transcription or PCR applications) that are suitable for detecting and/or quantifying one or more particular (complementary) miRNA sequences in a given sample.

A plurality of nucleic acid molecules as defined within the present invention may comprise at least two, at least ten, at least 50, at least 100, at least 200, at least 500, at least 1.000, at least 10.000 or at least 100.000 nucleic acid molecules, each molecule encoding a miRNA sequence.

The term "differentially expressed", as used herein, denotes an altered expression level of a particular miRNA in the disease plasma as compared to the healthy controls, or as compared to other types of disease samples, which may be an up- regulation (i.e. an increased miRNA concentration in the plasma) or a down-regulation (i.e. a reduced or abolished miRNA concentration in the plasma). In other words, the nucleic acid molecule is activated to a higher or lower level in the disease plasma samples than in the control plasma.

Within the scope of the present invention, a nucleic acid molecule is to considered differentially expressed if the respective expression levels of this nucleic acid molecule in disease plasma samples and control samples typically differ by at least 5% or at least 10%, preferably by at least 20% or at least 25%, and most preferably by at least 30% or at least 50%. Thus, the latter values correspond to an at least 1.3-fold or at least 1.5-fold up-regulation of the expression level of a given nucleic acid molecule in the disease plasma samples compared to the control plasma samples or vice versa an at least 0.7-fold or at least 0.5-fold down-regulation of the expression level in the disease plasma samples, respectively.

The term "expression level", as used herein, refers to extent to which a particular miR A sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in the plasma sample to be analyzed.

As outlined above, the term "control plasma" typically denotes a plasma sample collected from (healthy) individual not having characteristics of a colorectal cancer phenotype. However, in some applications, for example, when comparing other cancer types, the plasma collected from the patients with other cancer types is typically considered the "control plasma".

The determining of expression levels typically follows established standard procedures well known in the art (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M. et al. (2001) Current Protocols in Molecular Biology. Wiley & Sons, Hoboken, NJ). Determination may occur at the RNA level, for example by Northern blot analysis using miRNA-specific probes, or at the DNA level following reverse transcription (and cloning) of the RNA population, for example by quantitative PCR or real-time PCR techniques. The term "determining", as used herein, includes the analysis of any nucleic acid molecules encoding a microRNA sequence as described above. However, due to the short half-life of pri-miRNAs and pre-mRNAs typically the concentration of only the mature miRNA is measured.

In specific embodiments, the standard value of the expression levels obtained in several independent measurements of a given sample (for example, two, three, five or ten measurements) and/or several measurements within several samples or control samples are used for analysis. The standard value may be obtained by any method known in the art. For example, a range of mean ± 2 SD (standard deviation) or mean ± 3 SD may be used as standard value. The difference between the expression levels obtained for disease and control plasma may be normalized to the expression level of further control nucleic acids, e.g. housekeeping genes whose expression levels are known not to differ depending on the disease states of the individual from whom the sample was collected. Exemplary housekeeping genes include inter alia β-actin, glycerinaldehyde 3- phosphate dehydrogenase, and ribosomal protein PI . In preferred embodiments, the control nucleic acid is another miRNA known to be stably expressed during the various non-cancerous and (pre-) cancerous states of the individual from whom the sample was collected.

However, instead of determining in any experiment the expression levels for plasma sample it may also be possible to define based on experimental evidence and/or prior art data on or more cut-off values for a particular disease phenotype (i.e. a disease state). In such scenario, the respective expression levels for the plasma sample can be determined by using a stably expressed control miRNA for normalization. If the "normalized" expression levels calculated are higher than the respective cutoff value defined, then this finding would be indicative for an up-regulation of gene expression. Vice versa, if the "normalized" expression levels calculated are lower than the respective cutoff value defined, then this finding would be indicative for a down- regulation of gene expression.

In the context of the present invention, the term "identifying colorectal cancer and/or discriminating other cancer types" is intended to also encompass predictions and likelihood analysis (in the sense of "diagnosing"). The compositions and methods disclosed herein are intended to be used clinically in making decisions concerning treatment modalities, including therapeutic intervention, diagnostic criteria such as disease stages, and disease monitoring and surveillance for the disease. According to the present invention, an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease. Alternatively, the invention may be used to detect cancerous changes through plasma sample, and provide a doctor with useful information for diagnosis.

Within the present invention, one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression biomarker that is indicative for colorectal cancer through plasma sample. The term "expression biomarker", as used herein, denotes a set of nucleic acid molecules (e.g., miRNAs), wherein the expression level of the individual nucleic acid molecules differs between the plasma collected from colorectal cancer patient and the healthy control. Herein, a nucleic acid expression biomarker is also referred to as a set of markers and represents a minimum number of (different) nucleic acid molecules, each encoding a miRNA sequence that is capable for identifying a phenotypic state of an individual.

The nucleic acid expression biomarker, as defined herein, may comprise at least eight nucleic acid molecules, preferably at least thirteen nucleic acid molecule combinations, more preferably at least four panels of nucleic acid molecule combinations.

In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy controls.

Typically, the nucleic acid molecules comprised in the nucleic acid expression signature are human sequences (hereinafter designated "hsa" (Homo sapiens).

In preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-16-2* (SEQ ID NO: l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-7 (SEQ ID NO:3), hsa-miR-93 (SEQ ID NO:4), hsa-miR-345 (SEQ ID NO:5), hsa-miR-409-3p (SEQ ID NO:6), hsa- miR-671-3p (SEQ ID NO:7) and hsa-miR-331-3p (SEQ ID NO:8).

For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-1228 (SEQ ID NO:9) is used, which is stably expressed in colorectal cancer plasma.

The nucleic acid sequences of the above -referenced miRNAs are listed in Table 1.

TABLE 1

All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158). Particularly preferably, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-345, hsa-miR-409-3p, hsa-miR-671-3p, hsa-miR- 33 l-3p is up-regulated, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-16-2*, hsa-miR-25, hsa-miR-7 and hsa-miR-93 is down-regulated and the expression hsa-miR-1228 is un-changed in the one or more target plasma compared to the one or more healthy controls.

The terms "any one or more of the plurality of nucleic acid molecules" or "any one or more of the plurality of nucleic acid molecules" as used herein, may relate to any subgroup of the plurality of nucleic acid molecules, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid molecules, each encoding a microRNA sequence that are comprised in the nucleic acid expression biomarker.

In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecule combinations encoding hsa- miR-93 (SEQ ID NO:4)/hsa-miR-16-2*(SEQ ID NO: l), hsa-miR-345 (SEQ ID NO:5)/hsa-miR-16-2* (SEQ ID NO: l), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-16-2* (SEQ ID NO: l), hsa-miR-16-2* (SEQ ID NO: l)/hsa-miR-25 (SEQ ID NO:2), hsa-miR- 7 (SEQ ID NO:3)/hsa-miR-25 (SEQ ID NO:2), hsa-miR-671-3p (SEQ ID NO:7)/hsa- miR-25 (SEQ ID NO:2), hsa-miR-671-3p (SEQ ID NO:7)/hsa-miR-93 (SEQ ID NO:4), hsa-miR-16-2* (SEQ ID NO: l)/hsa-miR-93 (SEQ ID NO:4), hsa-miR-7 (SEQ ID NO:3)/hsa-miR-93 (SEQ ID NO:4), hsa-miR-7(SEQ ID NO:3)/hsa-miR-345 (SEQ ID NO:5), hsa-miR-409-3p (SEQ ID NO:6)/hsa-miR-345 (SEQ ID NO:5), hsa-miR-16-2* (SEQ ID NO: l)/hsa-miR-345 (SEQ ID NO:5), hsa-miR-671-3p (SEQ ID NO:7)/hsa- miR-345(SEQ ID NO:5), hsa-miR-409-3p (SEQ ID NO:6)/hsa-miR-331-3p (SEQ ID NO:8) and hsa-miR-16-2* (SEQ ID NO:l)/hsa-miR-331-3p (SEQ ID NO:8).

In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecule combinations encoding panel 1 ((hsa-miR-25 (SEQ ID NO:2)/hsa-miR-1228 (SEQ ID NO:9), hsa-miR-93 (SEQ ID NO:4)/hsa-miR-1228 (SEQ ID NO:9) and hsa-miR-331-3p(SEQ ID NO:8)/hsa-miR- 1228 (SEQ ID NO:9)), panel 2 ((hsa-miR-16-2* (SEQ ID NO: l)/hsa-miR-1228 (SEQ ID NO:9), hsa-miR-7(SEQ ID NO:3)/hsa-miR-25 (SEQ ID NO:2), hsa-miR-671- 3p(SEQ ID NO:7)/hsa-miR-345 (SEQ ID NO:5) and hsa-miR-93 (SEQ ID N0:4)/hsa- miR-16-2* (SEQ ID N0: 1)), panel 3 ((hsa-miR-345 (SEQ ID NO:5)/hsa-miR-1228 (SEQ ID N0:9), hsa-miR-7 (SEQ ID NO:3)/hsa-miR-345 (SEQ ID N0:5) and hsa- miR-671-3p (SEQ ID NO:7)/hsa-miR-25 (SEQ ID N0:2)) and panel 4 ((hsa-miR-16-2* (SEQ ID NO: l)/hsa-miR-25 (SEQ ID N0:2), hsa-miR-409-3p (SEQ ID N0:6)/hsa- miR-345 (SEQ ID N0:5), hsa-miR-7 (SEQ ID NO:3)/hsa-miR-93 (SEQ ID N0:4) and hsa-miR-93 (SEQ ID NO:4)/hsa-miR-1228 (SEQ ID N0:9)).

The term "nucleic acid combinations" refers to the usage of at least two nucleic acid expression levels as a whole. Preferably may use the relative changes or calculate results through a formulation as a whole.

The nucleic acid expression biomarker may comprise at least one nucleic acid molecule combination.

In more preferred embodiments, the nucleic acid expression biomarker comprises one nucleic acid molecule combination encoding hsa-miR-7 (SEQ ID NO:3)/hsa-miR-25 (SEQ ID NO:2).

The nucleic acid sequences of the above -referenced miRNAs are listed in Table 2. TABLE 2

All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths- Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).

The nucleic acid expression biomarker may comprise at least three nucleic acid molecule combinations.

In more preferred embodiments, the nucleic acid expression biomarker comprises one or more nucleic acid molecule combinations encoding hsa-miR-93 (SEQ ID NO:4)/hsa-miR-1228 (SEQ ID NO:9), hsa-miR-93 (SEQ ID NO:4)/hsa-miR-16-2* (SEQ ID NO: l) and hsa-miR-7 (SEQ ID NO:3)/hsa-miR-93 (SEQ ID NO:4).

The nucleic acid sequences of the above -referenced miRNAs are listed in Table 3. TABLE 3

The nucleic acid expression biomarker may comprise at least three nucleic acid molecules.

In more preferred embodiments, the nucleic acid expression biomarker comprises one or more nucleic acid molecules encoding hsa-miR-345 (SEQ ID NO:5), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-93 (SEQ ID NO:4)

The nucleic acid sequences of the above -referenced miRNAs are listed in Table 4.

TABLE 4

In a fifth aspect, the present invention relates to a method for identifying one or more target plasma exhibiting colorectal cancer, the method comprising:

(a) determining in the one or more target plasma the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence;

(b) determining the expression levels of the plurality of nucleic acid molecules in one or more healthy control plasma; and

(c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of colorectal cancer.

For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-1228 (SEQ ID NO:9) may be preferably used, which is stably expressed in colorectal plasma.

In preferred embodiments of the invention, the method comprising: (a) determining in the one or more target plasma the expression levels of a combination of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, and calculate with certain formula, then;

(b) determining the expression levels of the combination of nucleic acid molecules in healthy control plasma, and calculate with certain formula; and

(c) identifying the difference of the combination in the one or more target and control plasma by comparing the respective calculation results obtained in steps (a) and (b), wherein the one or more differentially expressed combinations together represent a biomarker that is indicative for the presence of colorectal cancer.

In a sixth aspect, the present invention relates to a method for monitoring therapeutic effect of colorectal cancer patients, the method comprising:

(a) identifying in the one or more target plasma a nucleic acid expression biomarker by using a method, as defined herein; and

(b) monitoring in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression in plasma is up-regulated before treatment but is down-regulated after treatment and the expression of a nucleic acid molecule whose expression in plasma is down-regulated before treatment but is up-regulated after treatment.

In a seventh aspect, the present invention relates to a method for preventing or treating colorectal cancer, the method comprising:

(a) identifying in plasma a nucleic acid expression biomarker by using a method, as defined herein; and

(b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated.

The term "modifying the expression of a nucleic acid molecule encoding a miR A sequence", as used herein, denotes any manipulation of a particular nucleic acid molecule resulting in an altered expression level of said molecule, that is, the production of a different amount of corresponding miRNA as compared to the expression of the "wild-type" (i.e. the unmodified control). The term "different amount", as used herein, includes both a higher amount and a lower amount than determined in the unmodified control. In other words, a manipulation, as defined herein, may either up-regulate (i.e. activate) or down-regulate (i.e. inhibit) the expression (i.e. particularly transcription) of a nucleic acid molecule.

Within the present invention, expression of one or more nucleic acid molecules encoding a microRNA sequence comprised in the nucleic acid expression signature is modified in such way that the expression of a nucleic acid molecule whose expression is up-regulated in plasma is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in plasma is up-regulated. In other words, the modification of expression of a particular nucleic acid molecule encoding a miRNA sequence occurs in an anti-cyclical pattern to the regulation of said molecule in plasma of cancer patients in order to interfere with the "excess activity" of an up- regulated molecule and/or to restore the "deficient activity" of a down-regulated molecule in plasma.

In a preferred embodiment of the inventive method, down-regulating the expression of a nucleic acid molecule comprises introducing into the patient a nucleic acid molecule encoding a sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated.

The term "introducing into blood", as used herein, refers to any manipulation allowing the transfer of one or more nucleic acid molecules into blood. Examples of such techniques include injection, digestion or any other techniques may be involved.

The term "complementary sequence", as used herein, is to be understood that the "complementary" nucleic acid molecule (herein also referred to as an "anti- sense nucleic acid molecule") introduced into blood is capable of forming base pairs, preferably Watson-Crick base pairs, with the up-regulated endogenous "sense" nucleic acid molecule.

Two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. In other embodiments, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). In further embodiments, the "complementary" nucleic acid molecule comprises a stretch of at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in the up- regulated "sense" nucleic acid molecule.

The "complementary" nucleic acid molecule (i.e. the nucleic acid molecule encoding a nucleic acid sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated) may be a naturally occurring DNA- or RNA molecule or a synthetic nucleic acid molecule comprising in its sequence one or more modified nucleotides which may be of the same type or of one or more different types.

For example, it may be possible that such a nucleic acid molecule comprises at least one ribonucleotide backbone unit and at least one deoxyribonucleotide backbone unit. Furthermore, the nucleic acid molecule may contain one or more modifications of the RNA backbone into 2'-O-methyl group or 2'- O-methoxyethyl group (also referred to as "2'-O-methylation"), which prevented nuclease degradation in the culture media and, importantly, also prevented endonucleolytic cleavage by the RNA-induced silencing complex nuclease, leading to irreversible inhibition of the miRNA. Another possible modification - which is functionally equivalent to 2'-O-methylation - involves locked nucleic acids (LNAs) representing nucleic acid analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA-mimicking sugar conformation (Oram, U.A. et al. (2006) Gene 372, 137-141).

Another class of silencers of miRNA expression was recently developed. These chemically engineered oligonucleotides, named "antagomirs", represent single- stranded 23-nucleotide RNA molecules conjugated to cholesterol (Krutzfeldt, J. et al. (2005) Nature 438, 685-689). As an alternative to such chemically modified oligonucleotides, microRNA inhibitors that can be expressed in cells, as RNAs produced from transgenes, were generated as well. Termed "microRNA sponges", these competitive inhibitors are transcripts expressed from strong promoters, containing multiple, tandem binding sites to a microRNA of interest (Ebert, M.S. et al. (2007) Nat. Methods 4, 721-726).

In particularly preferred embodiments of the inventive method, the one or more nucleic acid molecules whose expression is to be down-regulated encode microRNA sequences selected from the group consisting of hsa-miR-16-2*, hsa-miR- 25, hsa-miR-7 and hsa-miR-93 with respect to the expression biomarker, presumably indicative for colorectal cancer as defined above.

In a further preferred embodiment of the inventive method, up-regulating the expression of a nucleic acid molecule comprises introducing into blood a nucleic acid molecule encoding the microRNA sequence encoded by nucleic acid molecule to be up-regulated. In other words, the up-regulation of the expression of a nucleic acid molecule encoding a miRNA sequence is accomplished by introducing into the one or more cells another copy of said miRNA sequence (i.e. an additional "sense" nucleic acid molecule). The "sense" nucleic acid molecule to be introduced into blood may comprise the same modification as the "anti-sense" nucleic acid molecules described above.

In a particularly preferred embodiment, the one or more nucleic acid molecules whose expression is to be up-regulated encode microRNA sequences selected from the group consisting of hsa-miR-345, hsa-miR-409-3p, hsa-miR-671-3p and hsa-miR-331-3p with respect to the expression signature, presumably indicative for colorectal cancer as defined above.

The "sense" and/or the "anti-sense" nucleic acid molecules to be introduced into blood in order to modify the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature may be operably linked to a regulatory sequence in order to allow expression of the nucleotide sequence. In order to unravel any potential implication of the miRNAs identified in the cancerous or pre-cancerous samples preliminary functional analyses may be performed with respect to the identification of mRNA target sequences to which the miRNAs may bind. Based on the finding that miRNAs may be involved in both tumor suppression and tumorigenesis (Esquela-Kerscher, A. and Slack, F.J (2006) supra; Calin, G.A. and Croce, CM. (2007) supra; Blenkiron, C. and Miska, E.A. (2007) supra) it is likely to speculate that mRNA target sites for such miRNAs include tumor suppressor genes as well as oncogenes.

A nucleic acid molecule is referred to as "capable of expressing a nucleic acid molecule" or capable "to allow expression of a nucleotide sequence" if it comprises sequence elements which contain information regarding to transcriptional and/or translational regulation, and such sequences are "operably linked" to the nucleotide sequence encoding the polypeptide. An operable linkage is a linkage in which the regulatory sequence elements and the sequence to be expressed (and/or the sequences to be expressed among each other) are connected in a way that enables gene expression.

The precise nature of the regulatory regions necessary for gene expression may vary among species, but in general these regions comprise a promoter which, in prokaryotes, contains both the promoter per se, i.e. DNA elements directing the initiation of transcription, as well as DNA elements which, when transcribed into RNA, will signal the initiation of translation. Such promoter regions normally include 5' non-coding sequences involved in initiation of transcription and translation, such as the -35/- 10 boxes and the Shine-Dalgarno element in prokaryotes or the TATA box, CAAT sequences, and 5'-capping elements in eukaryotes. These regions can also include enhancer or repressor elements as well as translated signal and leader sequences for targeting the native polypeptide to a specific compartment of a host cell. In addition, the 3' non-coding sequences may contain regulatory elements involved in transcriptional termination, polyadenylation or the like. If, however, these termination sequences are not satisfactory functional in a particular host environment, then they may be substituted with signals functional in that environment.

Furthermore, the expression of the nucleic molecules, as defined herein, may also be influenced by the presence, e.g., of modified nucleotides (cf. the discussion above). For example, locked nucleic acid (LNA) monomers are thought to increase the functional half-life of miR As in vivo by enhancing the resistance to degradation and by stabilizing the miRNA-target duplex structure that is crucial for silencing activity (Naguibneva, I. et al. (2006) Biomed Pharmacother 60, 633-638).

Therefore, a nucleic acid molecule of the invention to be introduced into blood provided may include a regulatory sequence, preferably a promoter sequence, and optionally also a transcriptional termination sequence. The promoters may allow for either a constitutive or an inducible gene expression. Suitable promoters include inter alia the E. coli lac\TV5 and tet (tetracycline-responsive) promoters, the T7 promoter as well as the SV40 promoter or the CMV promoter.

The nucleic acid molecules of the invention may also be comprised in a vector or other cloning vehicles, such as plasmids, phagemids, phages, cosmids or artificial chromosomes. In a preferred embodiment, the nucleic acid molecule is comprised in a vector, particularly in an expression vector. Such an expression vector can include, aside from the regulatory sequences described above and a nucleic acid sequence encoding a genetic construct as defined in the invention, replication and control sequences derived from a species compatible with the host that is used for expression as well as selection markers conferring a selectable phenotype on host. Large numbers of suitable vectors such as pSUPER and pSUPERIOR are known in the art, and are commercially available.

In a eighth aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of colorectal cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from colorectal cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from colorectal cancer patients.

Within the scope of the present invention, suitable pharmaceutical compositions include inter alia those compositions suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Administration may be local or systemic. Preferably, administration is accomplished via the oral or intravenous routes. The formulations may also be packaged in discrete dosage units.

Pharmaceutical compositions according to the present invention include any pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as ointments, and oil- in water emulsions such as creams, lotions, and balms.

The ("sense" and "anti-sense") nucleic acid molecules described above can be formulated into pharmaceutical compositions using pharmacologically acceptable ingredients as well as established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA; Crowder, T.M. et al. (2003 ) A Guide to Pharmaceutical Particulate Science. Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).

In order to prepare the pharmaceutical compositions, pharmaceutically inert inorganic or organic excipients (i.e. carriers) can be used. To prepare e.g. pills, tablets, capsules or granules, for example, lactose, talc, stearic acid and its salts, fats, waxes, solid or liquid polyols, natural and hardened oils may be used. Suitable excipients for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.

The pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect. The latter is to be understood that the nucleic acid molecules may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes, nanoparticles, and microcapsules.

To target most tissues within the body, clinically feasible noninvasive strategies are required for directing such pharmaceutical compositions, as defined herein, into cells. In the past years, several approaches have achieved impressive therapeutic benefit following intravenous injection into mice and primates using reasonable doses of siRNAs without apparent limiting toxicities.

One approach involves covalently coupling the passenger strand (miRNA* strand) of the miRNA to cholesterol or derivatives/conjugates thereof to facilitate uptake through ubiquitously expressed cell-surface LDL receptors (Soutschek, J. et al. (2004) Nature 432, 173-178). Alternatively, unconjugated, PBS-formulated locked-nucleic-acid-modified oligonucleotides (LNA-antimiR) may be used for systemic delivery (Elmen, J. et al. (2008) Nature 452, 896-899). Another strategy for delivering miRNAs involves encapsulating the miRNAs into specialized liposomes formed using polyethylene glycol to reduce uptake by scavenger cells and enhance time spent in the circulation. These specialized nucleic acid particles (stable nucleic acid- lipid particles or SNALPs) delivered miRNAs effectively to the liver (and not to other organs (Zimmermann, T.S. et al. (2006) Nature 441, 111-114). Recently, a new class of lipid-like delivery molecules, termed lipidoids (synthesis scheme based upon the conjugate addition of alkylacrylates or alkyl-acrylamides to primary or secondary amines) has been described as delivery agents for RNAi therapeutics (Akinc, A. et al. (2008) Nat Biotechnol 26, 561-569).

A further targeting strategy involves the mixing of miRNAs with a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge (Song, E. et al. (2005) Nat. Biotechnol. 23, 709-717). Multiple modifications or variations of the above basic delivery approaches have recently been developed. These techniques are known in the art and reviewed, e.g., in de Fougerolles, A. et al. (2007) Nat. Rev. Drug Discov 6, 443-453; Kim, D.H. and Rossi, J.J. (2007) Nat Genet 8, 173-184).

The invention is further described by the figures and the following examples, which are solely for the purpose of illustrating specific embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way.

EXAMPLES

Example 1: Patient materials

In the discovery study, 79 blood specimens from CRC patients and healthy individuals were collected at Zhongshan and Huashan Hospitals in Shanghai between 2008 and 2009. All patients who participated in the study had given informed consent. The collection of the tissue specimens in accordance with the protocol was approved by the Institutional Review Board of the Hospitals. All of the samples from the patients were procured before surgery.

In the validation study, 166 blood specimens from CRC patients and healthy individuals were collected at Huashan Hospital in Shanghai. Of the 122 CRC specimens, 44 were collected at 7 days after the surgery. Baseline characteristics of the blood specimens for both discovery and validation studies are shown in Table 5.

Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases. Tumor histopathology was classified according to the World Health Organization Classification of Tumor system by three pathologists independently. Pathologic follow- up (for example, histological analysis via hematoxylin and eosin (H&E) staining) was used for evidently determining the disease state (i.e. healthy control, adenoma, adenocarcinoma or intermediate state) of a given sample as well as to ensure a consistent classification of the specimens. Table 5

Baseline characteristics of blood specimens

Example 2: Sample preparation

Peripheral blood (2 ml) was drawn into EDTA tubes. Within two hours, the tubes were subjected to centrifuge at 820g for 10 min. Then, 1-ml aliquots of the plasma was transferred to 1.5-ml tubes and centrifuged at 16,000g for 10 min to pellet any remaining cellular debris. Subsequently, the supernatant was transferred to fresh tubes and stored them at -80 °C.

Total RNA was extracted from the plasma by using mirVana PARIS miRNA Isolation kit according to the instructions from the manufacturer (Ambion, Austin, TX). The concentration was quantified by NanoDrop 1000 Spectrophotometer (NanoDrop Technologies, Waltham, MA). The quality control of RNA was performed by a 2100 Bioanalyzer using the RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clara, CA).

Example 3: The microarray data

In the discovery study, a qualitative analysis of the miRNAs differentially expressed in a particular sample may optionally be performed using the Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA). The microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 79 plasma specimens were used as inputs for labeling via Cy3 incorporation. Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed according to the protocols in the Agilent miRNA microarray system. The raw data obtained for single-color (CY3) hybridization were normalized by one internal stable control hsa- miR-1228.

Unpaired t-test after Fisher test (F-test) was used to identify top miRNA signatures between CRC patients vs. healthy individuals. For the specificity and sensitivity of the individual miRNA as diagnostic biomarkers, MedCalc software was used to perform receiver operating characteristic (ROC) curve analysis of the individual miRNA. 95% confidence interval was used to determine the significance. Stepwise logistic regression analysis was performed to determine the specificity and sensitivity of combined miRNAs as diagnostic biomarkers.

The experimental data on the array analysis of 8 key candidate miRNAs in the first aspect for discriminating colorectal cancer patients from healthy individuals are shown in Table 6.

Table 6

Candidate miRNA biomarkers on the microarray for discriminating colorectal cancer patients from healthy individuals

Colorectal cancer patient/healthy i ndividual

p-value Fold change Sensitivity Specificity AUC hsa-miR-1 6-2^* 1 .7E-04 0.2 66% 69% 0.723 hsa-miR-25 6.7E-04 0.4 55% 86% 0.717 hsa-miR-7 1 .2E-03 0.3 68% 72% 0.740 hsa-miR-93 6.7E-03 0.4 57% 89% 0.740 hsa-miR-345 6.5E-03 4.2 74% 58% 0.664 hsa-miR-409-3p 4.5E-03 4.0 72% 64% 0.652 hsa-miR-671 -3p 1 .0E-03 4.8 70% 69% 0.683 hsa-miR-331 -3p 1 .0E-02 3.3 53% 78% 0.655

Logistic regression (panel 1 )

hsa-miR-25 & 87% 75% 0.888 hsa-miR-331 -3p &

hsa-miR-93 Example 4: Validation of the microarrav data

For validation of the miRNA expression data acquired on microarrays, an established quantitative RT-PCR employing a TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) was used according to the manufacturer's instructions. The assays were performed for hsa-miR-16-2* (SEQ ID NO: 1), hsa-miR- 25 (SEQ ID NO: 2), hsa-miR-7 (SEQ ID NO: 3), hsa-miR-93 (SEQ ID NO: 4), hsa- miR-345 (SEQ ID NO: 5), hsa-miR-409-3p (SEQ ID NO: 6) and hsa-miR-671-3p (SEQ ID NO: 7) using 166 plasma specimens. The expression level of one internal stable control hsa-miR-1228 was used as the normalization control. All assays were carried out in triplicate.

Briefly, reverse transcription (RT) was performed with Taqman microRNA RT Kits according to the instruction from Applied Biosystem. lOOng total RNA was reverse-transcripted in 15ul RT solution mix that contains IX Reverse Transcription Buffer, IX RT primer, InM dNTP, 4U RNase Inhibitor and 50U MultiScribe Reverse Transcriptase. Then the RT solutions were performed by using the thermal program of 16°C, 30min; 42°C, 30min; 85°C, 5min on the PCR machine (Thermal cycler alpha engine, Bio-rad). Quantitative PCR was performed with TaqMan Universal PCR Master Mix kit and and Taqman microRNA assays kits according to the instruction from Applied Biosystem. 2ul RT products were PCR amplified in IX TaqMan Universal PCR Master Mix, No AmpErase UNG, IX TaqMan MicroRNA Assay mix. The real-time PCR was performed in Roch Light Cycling 480 machine with the program of 96°C, 5min initial heating; then 45 or 50 cycles of 95°C, 15s; 60°C, 60s. Cp value was calculated with 2nd derivative method in LC480 software. Then miRNAs were absolutely quantified with the standard samples Cp values.

Unpaired t-test after Fisher test (F-test) was used for differential expression analysis between colorectal cancer patients and healthy individuals. For the specificity and sensitivity of the individual miRNA as diagnostic biomarkers, MedCalc software was used to perform receiver operating characteristic (ROC) curve analysis of the individual miRNA. 95% confidence interval was used to determine the significance.

The experimental data on 8 validated miRNA biomarkers in the first aspect for discriminating colorectal cancer patients from healthy individuals are shown in Table 7. Particularly preferred hsa-miR-25 (SEQ ID NO: 2) and hsa-miR-93 (SEQ ID NO: 4) are shown in bold.

Table 7

Validated miRNA biomarkers for discriminating colorectal cancer patients from healthy individuals

The stepwise logistic regression analysis on 3 panels of the validated miRNA biomarkers in the first aspect for discriminating colorectal cancer patients from healthy individuals are shown in Table 8.

Table 8

Combinations of the validated miRNA biomarkers for discriminating colorectal cancer patients from healthy individuals

Stepwise logistic regression analysis

Panel mi RNA combi nation Sensitivity Specificity AUC

Panel 2

hsa-miR-16-27hsa-miR-1228 & 73% 93% 0.905 hsa-miR-7/ hsa-miR-25 &

hsa-miR-671 -3p/ hsa-miR-345 &

hsa-miR-93/ hsa-miR-1 6-2^*

Panel 3 hsa-miR-345/hsa-miR-1228 &

hsa-miR-7/hsa-miR-345 & 86% 85% 0.903 hsa-miR-671 -3p/ hsa-miR-25

Panel 4 hsa-miR-16-2 hsa-miR-25 &

hsa-miR-409-3p/ hsa-miR-345 &

81 % 82% 0.892 hsa-miR-7/hsa-miR-93 &

hsa-miR-93/hsa-miR-1228

The experimental data on the validated miRNA biomarkers in the second aspect for discriminating adenoma and all stages of colorectal cancer patients from healthy individuals are shown in Table 9.

Table 9

Validated miRNA biomarker for discriminating adenoma and all stages of colorectal cancer patients from healthy individuals

The experimental data on the validated miRNA biomarkers in the third aspect for discriminating all stages of colorectal cancer patients from healthy individuals are shown in Table 10. Table 10

Validated miRNA biomarker for discriminating all stages of colorectal cancer patients from healthy individuals

The experimental data on the validated miRNA biomarkers in the fourth aspect for monitoring treatment response of colorectal cancer patients before and after the surgery are shown in Table 11.

Table 11

Validated miRNA biomarkers for monitoring treatment response of colorectal cancer patients before and after the sur gery

Example 5: Method for quantifying miRNA biomarkers

A quantitative analysis of the miRNA biomarkers (differentially) expressed in a particular sample may optionally be performed by quantitative RT-PCR employing a TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.

Alternatively, the quantification of the miRNAs may be performed by using real-time quantitative RT-PCR employing SYBR Green I (Sigma Aldrich

Corporation, St. Louis, MO, USA), an asymmetrical cyanine dye binding to double- stranded DNA. The resulting DNA-dye-complex absorbs blue light

= 488 nm) and emits green light

= 522 nm).

For quantitative determination, the 8 miRNA biomarkers listed in Table 1 were selected: hsa-miR-16-2* (SEQ ID NO: l), hsa-miR-25 (SEQ ID NO:2), hsa- miR-7 (SEQ ID NO:3), hsa-miR-93 (SEQ ID NO:4), hsa-miR-345 (SEQ ID NO:5), hsa-miR-409-3p (SEQ ID NO:6), hsa-miR-671-3p (SEQ ID NO:7) and hsa-miR-331-3p (SEQ ID NO:8).

As a first step, the miRNAs were reverse transcribed following standard procedures using the oligonucleotide primers listed in Table 12. The 3 '-ends of the primers are complementary to the 10-13 terminal nucleotides at 3'-ends of the respective miRNAs (shown in lower case letters and in bold). The 5 '-ends of the primers have a common sequence for subsequently performing the real-time PCR (shown in capital letters).

TABLE 12

mi RNA Pri mer for reverse transcription (5'→ 3')

Biomarker

hsa-miR-16-2^* ACG GTCCTATATG G CTCCACTTCTGTTTTCtaaagcagcac hsa-miR-25 ACG GTCCTATATG G CTCC ACTTCTGTTTTCtcagaccgag hsa-miR-7 ACGGTCCTATATGGCTCCACTTCTGTTTTCacaacaaaatcac hsa-miR-93 ACGGTCCTATATGGCTCCACTTCTGTTTTCctacctgcac hsa-miR-345 ACGGTCCTATATGGCTCCACTTCTGTTTTCgagccctggac hsa-miR-409-3p ACGGTCCTATATGGCTCCACTTCTG I I I I Caggggttcac hsa-miR-671 -3p ACGGTCCTATATGGCTCCACTTCTGTTTTCggtggagccc hsa-miR-331 -3p ACGGTCCTATATGGCTCCACTTCTGTTTTCttctaggatagg

Internal stable control

hsa-miR-1228 ACGGTCCTATATGGCTCCACTTCTGTTTTCggggggcgag

The reaction mix (per sample) for performing reverse transcription includes:

RNA sample 1.0 μΐ (lOOng) lO mM dNTPs 1.5 μΐ

Reverse Transcriptase (50 U/μΙ) 1.0 μΐ

10 x Reverse Transcription Buffer 1.5 μΐ

RNase Inhibitor, 20 U/μΙ 0.2 μΐ

RT primer (10 μΜ) 0.3 μΐ

Nuclease-free water 9.5 μΐ

Reverse transcription was performed in a PCR thermal cycler (for example, the 7500 Real-Time PCR System, Applied Biosystems, Inc., Foster City, CA, USA) using the following parameters:

Step Type Time (min) Temperature (°C) HOLD 30 16

HOLD 30 42

HOLD 5 85

HOLD oo 4

After synthesis of the second cDNA strand according to established standard procedures the real-time PCR is performed. The 5' (up-stream) oligonucleotide primers used for PCR amplification are listed in Table 13. The universal 3' (downstream) primer has the sequence 5'- ACGGTCCTATATGGCTCCAC -3' that is complementary to the 5'-ends of the primers used for reverse transcription (cf. Table 12). The reaction mix (per sample) for performing real-time PCR includes:

RT product 2.0 μΐ

10 x PCR buffer (with dNTPs/Mg²⁺) 2.0 μΐ

miRNA qPCR primers (10 μΜ each) 0.3 μΐ

20 x SYBR Green I 1.0 μΐ

Taq DNA polymerase (5 U/μΙ) 0.2 μΐ

Nuclease-free water 14.5 μΐ

TABLE 13

Real-time PCR was performed in a PCR thermal cycler (for example, the 7500 Real-Time PCR System, Applied Biosystems, Inc., Foster City, CA, USA) using the following parameters:

Step Type Time Temperature (°C) HOLD 3 min 96

CYCLES 15 s 95

CYCLES 1 min 60

40 cycles in total The respective data were collected at 60°C and absorption wavelength of 490 nm and an emission wavelength of 530 nm. The calculation of the Ct value for each PCR reaction and the subsequent quantification of the miRNA were performed according to the manufacturer's instructions.

Typically, at least three independent experiments were performed for each measurement and the miRNA expression level determined represents the mean value of the respective individual data obtained. The mean expression levels of the 8 miRNAs selected were normalized against the mean expression level of the stably expressed control miRNA hsa-mir-1228 (SEQ ID NO:9) using the formula:

log₂([miRNA expression level]-[hsa-miR-1228 expression level]).

The identification of the miRNA expression biomarkers of the present invention provides a unique molecular marker that allows screening, detection, diagnosing colorectal cancer in blood. Furthermore, the expression biomarkers can be used to monitor the therapy response and guide the treatment decision in colorectal cancer patients. Additionally, the expression biomarkers may be also used for development of anti-colorectal cancer drugs.

The present invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by embodiments and optional features, modifications and variations of the inventions embodied therein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention. The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

Claims

1. Diagnostic kit of molecular markers in blood for identifying one or more target plasma exhibiting colorectal cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence,

wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma and in one or more control plasma,

wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of colorectal cancer.

2. The kit of claim 1, wherein The nucleic acid expression biomarker comprise at least eight nucleic acid molecules, preferably at least four panels of nucleic acid molecule combinations.

3. The kit of claim 1 or 2, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target plasma compared to the one or more healthy controls and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target plasma compared to the one or more healthy controls.

4. The kit of any of claims 1 to 3, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-16- 2*, hsa-miR-25, hsa-miR-7, hsa-miR-93, hsa-miR-345, hsa-miR-409-3p, hsa- miR-671-3p and hsa-miR-331-3p.

5. The kit of any of claims 4 , wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-345, hsa-miR-409-3p, hsa-miR-671- 3p, hsa-miR-331-3p is up-regulated, the expression of any one or more of the nucleic acid molecules encoding hsa-miR-16-2*, hsa-miR-25, hsa-miR-7 and hsa-miR-93 is down-regulated and the expression hsa-miR-1228 is un-changed in the one or more target plasma compared to the one or more healthy controls.

6. The kit of any of claim 1 to 3, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecule combinations encoding hsa-miR-93/hsa-miR- 16-2*, hsa-miR-345/hsa-miR- 16-2*, hsa-miR-25/hsa-miR- 16-2*, hsa-miR-16-2*/hsa-miR-25, hsa-miR-7/hsa-miR-25, hsa-miR-671- 3p/hsa-miR-25, hsa-miR-671-3p/hsa-miR-93, hsa-miR-16-2*/hsa-miR-93, hsa- miR-7/hsa-miR-93, hsa-miR-7/hsa-miR-345, hsa-miR-409-3p/hsa-miR-345, hsa-miR-16-2*/hsa-miR-345, hsa-miR-671-3p/hsa-miR-345, hsa-miR-409- 3p/hsa-miR-331-3p and hsa-miR-16-2*/hsa-miR-331-3p.

7. The kit of any of claim 1 to 3 and 6, wherein the expression of any one or more of the nucleic acid molecule combinations encoding hsa-miR-16-2*/hsa-miR-25, hsa-miR-7/hsa-miR-25, hsa-miR-671-3p/hsa-miR-25, hsa-miR-671-3p/hsa-miR- 93, hsa-miR-16-2*/hsa-miR-93, hsa-miR-7/hsa-miR-93, hsa-miR-7/hsa-miR- 345, hsa-miR-409-3p/hsa-miR-345, hsa-miR-16-2*/hsa-miR-345, hsa-miR-671- 3p/hsa-miR-345, hsa-miR-409-3p/hsa-miR-331-3p and hsa-miR-16-2*/hsa- miR-331-3p is up-regulated and the expression of any one or more of the nucleic acid molecule combinations encoding hsa-miR-93/hsa-miR-16-2*, hsa- miR-345/hsa-miR-16-2* and hsa-miR-25/hsa-miR-16-2* is down-regulated in the one or more target plasma compared to the one or more healthy controls.

8. The kit of any of claim 1 to 3, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecule combinations encoding panel 1 (hsa-miR-25/hsa-miR-1228, hsa-miR-93/hsa-miR-1228 and hsa-miR- 331-3p/hsa-miR-1228), panel 2 (hsa-miR-16-2*/hsa-miR-1228, hsa-miR-7/hsa- miR-25, hsa-miR-671-3p/hsa-miR-345 and hsa-miR-93/hsa-miR-16-2*), panel 3 (hsa-miR-345/hsa-miR-1228, hsa-miR-7/hsa-miR-345 and hsa-miR-671- 3p/hsa-miR-25) and panel 4 (hsa-miR-16-2*/hsa-miR-25, hsa-miR-409-3p/hsa- miR-345, hsa-miR-7/hsa-miR-93 and hsa-miR-93/hsa-miR-1228).

9. The kit of any of claims 1 to 3, for the further use of discriminating colorectal adenoma, Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinoma of colorectal tumor patients from healthy individuals, particularly preferably, early detection of colorectal cancer by screening high-risk individuals and early detection of the cancer recurrence.

10. The kit of claim 9, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule combination.

11. The kit of any of claims 10, wherein the nucleic acid expression biomarker comprises one nucleic acid molecule combination encoding hsa-miR-7/hsa- miR-25.

12. The kit of any of claims 11, wherein the expression of the nucleic acid molecule combination encoding hsa-miR-7/hsa-miR-25 is up-regulated in the one or more target plasma compared to the one or more healthy individuals.

13. The kit of any of claims 1 to 3, for the further use of discriminating colorectal Dukes' A, Dukes' B, Dukes' C or Dukes' D carcinoma of colorectal tumor patients from healthy individuals, particularly preferably, early detection of colorectal cancer by screening high-risk individuals and early detection of the cancer recurrence.

14. The kit of claim 1 to 3 and 13, wherein the nucleic acid expression biomarker comprises at least three nucleic acid molecule combinations.

15. The kit of any of claim 1 to 3 and 14, wherein the nucleic acid expression biomarker comprises one or more nucleic acid molecule combinations encoding hsa-miR-93/hsa-miR-1228, hsa-miR-93/hsa-miR-16-2* and hsa-miR-7/hsa- miR-93.

16. The kit of any of claims 15, wherein the expression of the nucleic acid molecule combination encoding hsa-miR-7/hsa-miR-93 is up-regulated and the expression of any one or more of the nucleic acid molecule combinations encoding hsa- miR-93/hsa-miR-1228 and hsa-miR-93/hsa-miR-16-2* is down-regulated in the one or more target plasma compared to the one or more healthy controls.

17. The kit of any of claims 1 to 3, for the further use of monitoring therapeutic effect of colorectal cancer patients.

18. The kit of claim 1 to 3 and 13, wherein the nucleic acid expression biomarker comprises at least three nucleic acid molecules.

19. The kit of any of claim 1 to 3 and 18, wherein the nucleic acid expression biomarker comprises one or more nucleic acid molecules encoding hsa-miR-345, hsa-miR-25 and hsa-miR-93.

20. The kit of any of claims 19, wherein the expression of any one or more of the nucleic acid molecules encoding hsa-miR-345, hsa-miR-25 and hsa-miR-93 is up-regulated in the one or more target plasma after a treatment compared to the one or more control plasma before a treatment.

21. Method for identifying one or more target plasma exhibiting colorectal cancer, the method comprising:

(c) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control plasma by comparing the respective expression levels obtained in steps (a) and (b), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined in any of claim 1 to 20, that is indicative for the presence of colorectal cancer.

22. The method of claim 21, for the further use of early detection of colorectal cancer by screening high-risk individuals and early detection of the cancer recurrence

23. Method for monitoring therapeutic effect of colorectal cancer patients, the method comprising:

(b) monitoring in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression in plasma is up-regulated before treatment but is down- regulated after treatment and the expression of a nucleic acid molecule whose expression in plasma is down-regulated before treatment but is up-regulated after treatment.

24. Method for preventing or treating colorectal cancer, the method comprising:

(a) identifying a nucleic acid expression biomarker in blood by using a method, as defined claim 1 to 20, and

(b) modifying in blood the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up-regulated in blood is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in blood is up-regulated.

25. Pharmaceutical composition for the prevention and/or treatment of colorectal cancer in blood, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in plasma from colorectal cancer patients, as defined in any of claim 1 to 20, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down- regulated in plasma from colorectal cancer patients,

26. Use of the pharmaceutical composition of 25 for the manufacture of a medicament for the prevention and/or treatment of colorectal cancer.