WO2011073692A1

WO2011073692A1 - Proteins, nucleic acid molecules and compositions

Info

Publication number: WO2011073692A1
Application number: PCT/GB2010/052158
Authority: WO
Inventors: Richard John Pleass
Original assignee: The University Of Nottingham
Priority date: 2009-12-18
Filing date: 2010-12-20
Publication date: 2011-06-23
Also published as: GB0922209D0

Abstract

A polymeric fusion protein comprising two or more polypeptide monomer units; wherein each polypeptide monomer unit comprises: an Fc receptor binding portion comprising two immunoglobulin heavy chain constant regions which are covalently iinked to each other by at least one disulphide bond; and a tailpiece region fused C-terminal to each of the two immunoglobulin heavy chain constant regions; wherein the tailpiece region of each polypeptide monomer unit causes the monomer units to assemble into a polymer; and wherein at least one of the polypeptide monomer units is covalently linked to at least one functional factor. A nucleic acid molecule encoding the same; and expression vector comprising the nucleic acid molecule; a host cell comprising the expression vector; a vaccine or therapeutic composition comprising the polymeric fusion protein or expression vector; medical uses of the compositions.

Description

PROTEINS, NUCLEIC ACID MOLECULES AND COMPOSITIONS

The invention relates to fusion proteins which are capable of binding to Fc receptors. The fusion proteins may be antigen fusion proteins in which case they may be suitable for use as vaccines. Alternatively, the fusion proteins may be a therapeutic fusion proteins, in which case they be used in therapeutic applications such as drug delivery. The invention also relates to nucleic acid molecules encoding the fusion proteins, vaccine compositions and therapeutic compositions comprising the fusion proteins. Background

Vaccine development traditionally has focused on the generation of protective antibodies capable of neutralizing infectious agents. To date, the agents used as vaccines typically include inactivated or attenuated microorganisms (for example, bacteria or viruses), their products (for example, toxins), or purified antigens. Induction of immunity requires the coordinated participation of the innate and adaptive immune systems. An early step is antigen (Ag) internalization by antigen presenting cells (APCs) of the innate immune system, particularly by dendritic cells (DCs), which are professional APCs that are capable of presenting Ag to naive T cells (Trombetta and Mellman (2005) Ann Rev Immunol 23: 975-1028). Internalized Ag is processed through the endosomal/lysosomal pathway. Processed peptides, bound to MHC class II molecules, are then delivered to the cell surface. Those CD4⁺ T cells with appropriate receptors respond to such peptides provided co-stimulatory molecules are expressed by the DC. Ag activates B cells bearing appropriate surface immunoglobulin directly to produce Ig . CD4⁺ T ceils, having responded to processed Ag, induce immunoglobulin class-switching from IgM to IgG.

Limited uptake of soluble antigenic peptide by DCs constrains subsequent Ag processing and presentation. Furthermore, a second signal is often required to drive DC maturation and efficient co-stimulatory molecule expression. In addition to one or more antigens to which it is desired to generate a protective immune response, vaccines typically contain adjuvants, which provide the second signal and/or concentrate the antigen in the vicinity of DCs. For many malaria antigens, protective immunity in experimental animals requires the use of toxic adjuvants that are not suitable for human use (Kumar S er al (2000) Infect. Irnmun. 68: 2215-2223). Vaccination with exogenous antigen typically results in a CD4⁺ T cell response that generally results in antibody production. Cytotoxic T cells (CTL) are typically not stimulated by such a pathway. Apparently, CTL are stimulated in situations where the antigen originates from inside the APC itself (endogenous antigen), for example, via production of viral proteins in a virally infected cell or cancer-specific proteins in a cancer cell. In many viral diseases, the generation of CTL is believed to be critical in eliminating virus-infected cells, and thus recovery from infection.

Studies indicate that endogenous and exogenous antigens are processed differently. During synthesis of nascent polypeptides, a portion of the polypeptide is degraded by an intracellular structure called a proteosome. Fragments from this process complex with newly synthesized MHC class I rather than MHC class 11 molecules, whereupon the resulting antigen containing MHC Class I complexes are transported to the ceil surface. Again, T cells with specificity for the specific peptide fragment bind T cells, but in this case, the required co-receptor interaction occurs between MHC class I molecule and a CD8 molecule. Accordingly, endogenous antigen on the surface of the APC is presented to CD8+ T cells. Although there are some types of CD8+ T cells that are not cytotoxic, the CD8+ T cells make up the majority of CTL. A vaccine capable of inducing strong CTL response, generally requires that the antigenic molecule (generally a protein) either be made inside the cell or delivered into the appropriate cellular compartment so that it can enter the MHC class I processing pathway. The delivery of exogenous peptides or proteins to the MHC class I pathway has been partially successful through use of chemical adjuvants such as Freund's adjuvant, and mixtures of squalene and detergents (Hilgers et al. (1999) VACCINE 17:219-228), and more recently through use of small antigen-coated beads which are phagocytosed by macrophages and induce CTL responses via an alternative MHC class I pathway (De Bruijn et al. (1995) EUR. J. IMMUNOL. 25: 1274-1285). Again, such adjuvants may not be suitable for use in humans. immune responses increase when Ag uptake is facilitated. This property has been exploited in recombinant antigen-antibody fragment fusion proteins which target antigen to APCs by binding of the antibody fragment portion to Fc receptors and subsequent internalisation into the APC. For example, WO 01/07081 (Lexigen Pharmaceutical Corp; Gillies er al) describes fusion proteins in which an antigen is fused to the Fc portion of IgG. These monomeric entities did not reliably raise antigen-specific antibody responses, and it was generally necessary to include an adjuvant. Although, only capable of delivering two molecules of antigen, this monomeric construct nonetheless elicited significant 8 and T cell proliferative responses in mice, suggesting that linear monomeric Fc-fusions that cross-link multiple FcyRs induce different responses to those observed here with polymeric structures that deliver many more copies of Ag.

Antibody responses, if present, were generally weak in the absence of an adjuvant. Lanza et al (1993) Proc Natl Acad Sci USA 90:1 1683-7 describes an alternative approach in which antibody molecules were engineered to contain small immunodominant peptides from human CD4 receptor. Although antigen-specific immune responses were generated, these too relied on the presence of an adjuvant.

There remains a need for improved means of delivering antigens to APCs by Fc receptor-mediated internalisation and of inducing strong, protective immunity. In particular, it is desirable to reduce the need for adjuvants, particularly toxic adjuvants, or eliminate them altogether. In addition, the goal of a vaccine is to induce protective immunity against natural antigens, which may be only weakly immunogenic. This has not been shown in relation to the prior art antigen-antibody fragment fusion proteins. Different isotypes and subtypes of antibodies perform different effector functions, and it is desirable to be able to induce appropriate isotypes and subtypes for strong, protective immunity. Furthermore, there remains a need for vaccines which can induce CTL.

The inventor has developed a polymeric antigen fusion protein which exploits the immune system in a manner not possible in the recombinant antigen-antibody fragment fusion proteins of the prior art, by covalently linking the antigen to antibody portions which are arranged in a polymeric structure which is spatially orientated to bind to more than one Fc receptor. By simultaneously binding to more than one Fc receptor, the polymeric antigen fusion protein acts like an immune complex (IC). It is known that natural immune complexes induce stronger Ab responses than Ag alone (Wemersson ef al (1999) Scand J Immunol 52: 563-569. IC driven, FcyR-mediated, Ag internalization favours DC maturation and hence expression by them of costimu!atory molecules (Regnault et al (1999) J Exp Med 189; 371-380). These phenomena had not hitherto been exploited in a recombinant polymeric antigen fusion protein in which the antibody portions are arranged in the most advantageous spatial orientation.

The inventor has also developed a polymeric therapeutic fusion protein which can be used to deliver therapeutic agents. In the polymeric therapeutic fusion protein a therapeutic agent replaces the antigen. Monomeric therapeutic fusion proteins, also referred to as monomeric Fc-fusion proteins are known for use in therapeutic interventions, and are increasingly being exploited by the pharmaceutical sector for the development of novel drugs. For example, etanercept, an Fc-fusion to the TNF-receptor, is used for the treatment of iife-long inflammatory conditions. Etanercept works by binding to and inhibiting the action of TNF, and is a significant blockbuster drug in the top 20 in US drug sales. Currently, monomeric etanercept can bind two TNF molecules, if the fusion protein was polymeric it would be able to bind many more TNF molecules, making the drug more effective at a lower dose. The listing or discussion of a prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

Description of the invention

A first aspect of the invention provides a polymeric fusion protein comprising two or more polypeptide monomer units; wherein each polypeptide monomer unit comprises: an Fc receptor binding portion comprising two immunoglobulin heavy chain constant regions which are covalently linked to each other by at least one disulphide bond; and a tailpiece region fused C-terminal to each of the two immunoglobulin heavy chain constant regions; wherein the tailpiece region of each polypeptide monomer unit causes the monomer units to assemble into a polymer; and wherein at least one of the polypeptide monomer units is covalently linked to at least one functional factor. The at least one functional factor may be an antigen, in which case the polymeric fusion protein may be referred to as a polymeric antigen fusion protein or a polymeric antigen Fc-fusion protein.

Altemativefy, the at least one functional factor may be a therapeutic agent, in which case the polymeric fusion protein may be referred to as a polymeric therapeutic fusion protein or a polymeric therapeutic Fc-fusion protein. Polymeric fusion proteins according to the invention may also be referred to as polymeric Fc-fusion proteins.

In one embodiment the invention provides a polymeric antigen fusion protein comprising two or more polypeptide monomer units; wherein each polypeptide monomer unit comprises: an Fc receptor binding portion comprising two immunoglobulin heavy chain constant regions which are covalently linked to each other by at least one disulphide bond; and a tailpiece region fused C-terminal to each of the two immunoglobulin heavy chain constant regions; wherein the tailpiece region of each polypeptide monomer unit causes the monomer units to assemble into a polymer; and wherein at least one of the polypeptide monomer units is covalently linked to at least one antigen.

In another embodiment the invention provides a polymeric therapeutic fusion protein comprising two or more polypeptide monomer units; wherein each polypeptide monomer unit comprises: an Fc receptor binding portion comprising two immunoglobulin heavy chain constant regions which are covalently linked to each other by at least one disulphide bond; and a tailpiece region fused C-terminal to each of the two immunoglobulin heavy chain constant regions; wherein the tailpiece region of each polypeptide monomer unit causes the monomer units to assemble into a polymer; and wherein at least one of the polypeptide monomer units is covalentiy linked to at least one therapeutic agent.

The term "immunoglobulin heavy chain constant region" means a native immunoglobulin heavy chain region, or variant or fragment thereof. The Fc receptor binding portion typically comprises the Fc portion of an immunoglobulin, or fragment or variant thereof. The term "Fc portion" includes a fragment of an jgG molecule which is obtained by limited proteolysis with the enzyme papain, which acts on the hinge region of IgG. An Fc portion obtained in this way contains two identical disulphide linked peptides containing the heavy chain CH2 and CH3 domains of IgG, also referred to as Cy2 and Cy3 domains respectively. The two peptides are linked by two disulphide bonds between cysteine residues in the N-terminal parts of the peptides. "Fc portion" also includes the corresponding portion of any of the other four immunoglobulin classes, namely IgM, IgA, IgD or IgE. The Fc portion of igM contains two identical disulphide linked peptide heavy chain CH2, CH3 and CH4 domains, also referred to as Cp2, Cp3 and Cp4. The peptides are disulphide linked at a cysteine residue occurring between the Cp2 and Cp3 domains. The Fc portion of IgA contains two identical disulphide linked peptide heavy chain CH2 and CH3 domains, also referred to as Ca2 and Ca3. The peptides are disulphide linked at a cysteine residue occurring N-terminal to the Cp2 domain. The arrangements of the disulphide linkages described for IgG, IgM and IgA pertain to natural human antibodies. There may be some variation among antibodies from other mammalian species, although such antibodies may be suitable in the context of the present invention. Antibodies are also found in birds, reptiles and amphibians, and they may likewise be suitable. Nucleotide and amino acid sequences of human Fc IgG are disclosed, for example, in Ellison et al. (1982) NUCLEIC ACIDS RES. 10: 4071- 4079. Nucleotide and amino acid sequences of murine Fc lgG2a are disclosed, for example, in Bourgois et al. (1974) EUR. J. BIOCHEM. 43; 423-435.

Typically, in the polymehc fusion protein of the first aspect of the invention, each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence of a IgG, IgM, or IgA heavy chain constant region; or variant thereof. Typically, each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence of a mammalian heavy chain constant region, preferably a human heavy chain constant region; or variant thereof. Suitably, each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence of a !gG heavy chain constant region, preferably a human IgG. Suitable human IgG subtypes are !gG1 , igG2, igG3 and lgG4, although igG1 or lgG3 are preferred. The Fc receptor binding portion may comprise more than the Fc portion of an immunoglobulin. For example, it may include the hinge region of the immunoglobulin which occurs between CH1 and CH2 domains in a native immunoglobulin. For certain immunoglobulins, the hinge region is necessary for binding to Fc receptors. Preferably, the Fc receptor binding portion lacks a CH1 domain and heavy chain variable region domain (VH). The Fc receptor binding portion may be truncated at the C- and/or N- terminus compared to the Fc portion of the corresponding immunoglobulin. Such a Fc receptor binding portion is thus a "fragment" of the Fc portion.

The Fc receptor binding portion is capable of binding to an Fc receptor, it will be appreciated that Fc receptor binding portions which comprise the Fc portion of a particular immunoglobulin, will bind to different Fc receptors depending on the binding specificity of the particular immunoglobulin. Typically, the Fc receptor binding portion will have an affinity for a given Fc receptor which is at least comparable to the affinity of a native monomeric immunoglobulin molecule (or fragment of a polymeric immunoglobulin molecule such as IgM or IgA which comprises only a single Fc receptor binding portion) which binds to the given Fc receptor. However, lower affinities may be tolerated because the polymeric antigen fusion protein comprises at least two such Fc receptor binding portions, and will therefore bind to Fc receptors with higher avidity. Therefore, the Fc receptor binding portion will typically have an affinity which is at least a tenth, suitably at least a fifth and most suitably at least a half of the affinity of the corresponding native monomeric immunoglobulin molecule (or fragment of a polymeric immunoglobulin molecule such as IgM or IgA which comprises only a single Fc receptor binding portion) which binds to the given Fc receptor. Affinity constants can be readily determined by surface Plasmon Resonance Analysis (Biacore). The Fc receptor binding portions can be passed over flow cells from CM5 sensor chips amine-coupled to Fc receptors. Equimolar concentrations of the Fc receptor binding portion or intact monomeric antibody (or fragment of a polymeric immunoglobulin which comprises only a single Fc receptor binding portion) may be injected over each Fc receptor and association and dissociation observed in real time. Data from a BIAcore X machine may be analyzed using BIAevaluation 3.0 software to determine accurate affinity constants.

There are three classes of human Fey receptor (Gessner et al (1998) Ann Hematol 76: 231 -48; Raghavan and Bjorkman (1996) Ann Rev Cell Dev Biol 12: 181 -220). FcyRI (CD64) binds monomeric igG with high affinity. FcyRil (CD32) and FcyRII! (CD16) are the low affinity receptors for Fc and can only interact with high affinity with antibodies that are presented to the immune system as immune complexes (ICs). Several studies have shown that !Cs are potent activators of DCs and can prime stronger immune responses than antigen alone (Bolland S & Ravetch JV. (1999) Adv. Immunol. 72: 149-177; Regnault A, er al (1999) J. Exp. Med. 189: 371 -380; Dhodapkar KM, et al (2002) J. Exp. Med. 195: 125-133; Groh V, ef al (2005) Proc. Natl. Acad. Sci. U.S.A. 102: 6461-6466; Rafiq K, Bergtold A & Clynes R. (2002) J. Clin. Invest. 1 10: 71-79; Schuurhuis OH, er a/ (2006) J. Immunol. 176: 4573-4580). Importantly, FcyR-dependent !C internalization not only results in (vlHC-class-N-restricted antigen presentation but also in cross-presentation on MHC class I molecules, thereby priming both CD4⁺ and CD8⁺ T-cel! responses (Regnault A, et al (supra)).

FcyRI! and FcyRIII are closely related in the structure of their ligand-binding domains. In humans three separate genes, FcyRIIA, FcyRilB, and FcyRIIC, two of which give rise to alternatively spliced variants, code for FcyRII. FcyRISa delivers activating signals whereas FcyRllb delivers inhibitory signals. The functional basis for the divergent signals arises from signaling motifs located within the cytoplasmic tails of the receptors. An immunoreceptor tyrosine-based inhibitor motif (IT!M) located in the cytoplasmic tail of the FcyRllb is involved in negative receptor signaling. The !TIM motif is a unique feature of the FcyRI !b receptor as it is not apparently present in any other Fey receptor class, in contrast, an activator/ immunoreceptor tyrosine-based activation motif or ITAM is located in the cytoplasmic tail of FcyRI la. !TAM motifs transduce activating signals. They are also found in the FcRy-chains, which are identical to the γ chains of the high affinity IgE receptor (FcsRI). While FcyRlla and FcyRllb are widely expressed on myeioid ceils and some T-cell subsets they are notably absent from NK cells.

Human FcyRIII is also present in multiple isoforms derived from two distinct genes (FcyRIIIA and FcyR!IIB). FcyRlllb is unique in its attachment to the eel! membrane via a glycosylphosphatidyi anchor, FcyRlllb expression is restricted to neutrophils while FcyRliia is expressed by macrophages, and NK cells. FcyRHIa is also expressed by some T-cell subsets and certain monocytes. FcyRMIa requires the presence of the FcRv- chain or the

for cell surface expression and signal transduction. The FcRy- chain and the Οϋ3ζ~οη3ίη are dimeric and possess ITAM motifs. FcyRIHa forms a multimeric complex with these subunits and signalling is transduced through them. Thus, there is considerable FcyR receptor heterogeneity and diverse expression

The binding sites for FcyRil and FcyRIII map to the hinge and proximal region of the CH2 domain of IgG, the same region originally identified for FcyRi (Duncan ef al (1988) Nature 332: 563-4; Morgan ei al (1995) Immunol 86: 319-324; Lund ef al (1991 ) J Immunol 147: 2657-2662).

Fey receptors (FcyRs) trigger activatory and/or inhibitory signalling pathways that set thresholds for cell activation and culminate in a we!l-baianced immune response (Nimmerjahn F & Ravetch JV (2008) Nat. Rev. Immunol. 8: 34-47). Activating and inhibitory FcRs are widely expressed throughout the haematopoetic system but particularly on professional antigen presenting cells (APCs) (Nimmerjahn F & Ravetch JV (2008) supra). For example in humans, FcyRi is constitutively expressed by blood myeloid dendritic cells (DCs) and FcyRII has been detected on every DC subset examined to date, whereas the expression of FcyRi, FcyRHB and FcyRIII dominate on murine DCs (Ravetch JV (2003) in Fundamental Immunology (ed. Paul WE) 685-700 (Lippincott-Raven, Philidelphia); Bajtay Z ei al (2006) Immunol. Lett. 104: 46-52). FcyRs also play a pre-eminent role in antigen presentation and immune-complex-mediated maturation of dendritic cells (DCs), and in regulation of B-cell activation and plasma-cell survival (Ravetch JV (2003) supra; Bajtay Z et al, (2006) supra). Moreover, by regulating DC activity, FcyRs control whether an immunogenic or tolerogenic response is initiated after the recognition of antigenic peptides presented on the surface of DCs to cytotoxic T cells, T helper cells, and regulatory T cells. FcyRs also co-operate with Toll-like receptors (TLRs) in controlling levels of the important regulatory cytokines, IL-12 and IL-10 (Polumuri SK, 2007, J. Immunol 179: 236-246). Thus, FcyRs are involved in regulating innate and adaptive immune responses, which makes them attractive targets for the development of novel immunotherapeutic approaches (Nimmerjahn F & Ravetch JV (2008) supra).

Where the Fc receptor binding portion comprises immunoglobulin heavy chain constant regions of a human IgG isotype or variants thereof, it will typically bind to human Fcy- receptors (FcyRI, FcvRI I and Fcy l ll). Surface Plasmon Resonance Analysis as described above can be used to determine affinity constants. Typical affinity constants for binding of human lgG1 or lgG3 to FcyRI are about 10^"9 M; for FcyRI I are about 0.6- 2.5x10^"6 M; for FcyRI I!A are about 5x10^"5 M; for FcyRII IB are about 0.6-2.5x10^"s M. Where the Fc receptor binding portion comprises immunoglobulin heavy chain constant regions of a human IgM isotype or variants thereof, it will typically bind to human ig receptor (Kubagawa H ef al (2009) J Exp Med, Nov 23;206(12):2779-93. Epub 2009 Oct 26.) Where the Fc-receptor binding portion comprises immunoglobulin heavy chain constant regions or variants thereof of a human IgA isotype, it will typically bind to human Fca receptor (CD89). Both FC\J R and FcaR can be found on professional antigen presenting cells.

The appropriate limits for and determination of affinity constants for Fc receptor binding portions which comprise variants of native immunoglobulin heavy chain constant regions, or fragments of Fc portions, is as described above.

A "variant" refers to a protein wherein at one or more positions there have been amino acid insertions, deletions, or substitutions, either conservative or non-conservative. A "variant" may have modified amino acids. Suitable modifications include acetylation, glycosylation, hydroxylation, methylation, nucleotidylation, phosphorylation, ADP- ribosylation, and other modifications known in the art. Such modifications may occur postranslationally where the peptide is made by recombinant techniques. Otherwise, modifications may be made to synthetic peptides using techniques known in the art. Modifications may be included prior to incorporation of an amino acid into a peptide. Carboxylic acid groups may be esterified or may be converted to an amide, an amino group may be alkylated, for example methylated. A variant may also be modified post- translationally, for example to remove carbohydrate side-chains or individual sugar moieties e.g. sialic acid groups or to add sialic acid groups.

By "conservative substitutions" is intended combinations such as Val, lie, Leu, Ala, Met; Asp, Glu; Asn, Gin; Ser, Thr, Gly, Ala; Lys, Arg, His; and Phe, Tyr, Trp. Preferred conservative substitutions include Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.

Typical variants of the immunoglobuSin heavy chain constant regions will have an amino acid sequence which is at least 70%, typically at least 80%, at least 90%, at least 95%, at least 99% or at least 99.5% identical to the corresponding immunoglobulin heavy chain constant region of a native immunoglobulin.

A "fragment" refers to a protein wherein at one or more positions there have been deletions. Typically a fragment of a Fc portion comprises at least 60%, more typically at least 70%, 80%, 90%, 95% or up to 99% of the complete sequence of the Fc portion. Fragments of variants are also encompassed.

The percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally.

The alignment may alternatively be carried out using the Clustal W program (Thompson ef a/., (1994) Nucleic Acids Res., 22(22), 4673-80). The parameters used may be as follows:

» Fast pairwise alignment parameters: K-tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent.

* Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. « Scoring matrix: BLOSUM.

Variants may be natural or made using the methods of protein engineering and site-directed mutagenesis as are well known in the art. "Peptides" generally contain up to 10, 20, 50 or 100 amino acids. Peptides and polypeptides may conveniently be blocked at the N- or C-terminus so as to help reduce susceptibility to exoproteolytic digestion. Peptides and polypeptides may be produced by recombinant protein expression or in vitro translation systems (Sam brook et al, "Molecular cloning: A laboratory manual", 2001 , 3^rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Peptides may be synthesised by the Fmoc- poiyamide mode of solid-phase peptide synthesis as disclosed by Lu ef al (1981 ) J. Org. Chem. 46, 3433 and references therein.

Suitably, according to the first aspect of the invention, each of the immunogiobulin heavy chain constant regions is an IgG heavy chain constant region comprising an amino acid sequence which is modified compared to the amino acid sequence of a native IgG heavy chain constant region, to increase the affinity of the Fc receptor binding portion for at least one activatory Fc receptor and/or to decrease the affinity of the Fc receptor binding portion for at least one inhibitory Fc receptor.

The interactions between IgG and Fc receptors have been analyzed in biochemical and structural studies using wild type and mutated Fc. One consensus indicates that some regions for binding to Fc receptors are located in the part of the hinge region closest to the CH2 domain and in the amino-terminus of the CH2 domain that is adjacent to the hinge, including for example residues 233-239 (Glu-Leu-Leu-Gly-G!y-Pro-Ser). Mutations within this region can result in altered binding to Fc receptors. This region appears to be responsible for some of the direct interactions with Fc receptors (Woof JM & Burton D, Nature Reviews Immunology 2004, 4: 89-99). Further into the CH2 domain, and away from the hinge, are other residues that may, at least in some contexts, contribute to Fc receptor binding, including for example, Pro-329 of human lgG 1 (EU numbering) which appears to be involved in direct contact with the Fc receptor and Asn-297 which appears to be the sole site for N-linked glycosylation within the Fc region of human lgG 1 . The presence of carbohydrate at this residue may contribute to the binding to Fc receptors.

Activatory Fc receptors are as described above; in the human, they are FcyRI, FcyRIIA/C, FcyRII IA, FcaR and FCERI . FcyRIIB is an inhibitory human Fc receptor. As the ligand binding properties of FcyRIIB and FcyRI IA/C are the same, it may not be possible to increase affinity for FcyRIIA/C whilst simultaneously decreasing affinity for FcyRII B. Lazar et al (2006) PNAS 103: 4005-10 describes mutations in the Fc portion of a human IgG which affect binding affinity to different Fc receptors. A wildtype IgG bound to FcyRll la with a K₀ of 252 nM; the K₀ of a I332E mutant was 30 nM and the K_D of a S239D/I332E mutant was 2 nM. Combination of an A330L mutation with S239D/I332E increased FcyRll la affinity and reduced FcyRllb affinity. Shields RL er al (2001 ) J. Biol, Chem. 276: 6591 -6604 describes mutations in the Fc portion of human lgG1 which affect binding affinity to different Fc receptors. The S298A mutation increased affinity for FcyRl lla and decreased affinity for FcyRI IA; the E333A mutation increased affinity for FcyRll la and decreased affinity for FcyRIIA; the mutation K334A increased affinity for FcyRl i la. Any or all of the above mutations may be used individually or in combination. Other suitable mutations may be identified by routine methods.

Suitably, if the polymeric fusion protein is for use as a vaccine, the affinity of the Fc receptor binding portion for FcyRIIB is decreased. It is known that the inhibitory FcyRI IB controls the magnitude of the immune response, as DCs derived from FcyRI IB-knockout mice generate stronger and longer-lasting immune responses in vitro and in vivo (Bergtold A, Desai DD, ef al (2005) immunity 23: 503-514; Kalergis A M & Ravetch JV. (2002) J. Exp. Med. 195: 1653-1659). More importantly, FcyR!IB-deficient DCs or DCs incubated with a mAb that blocks immune complex binding to FcyRI!B showed a spontaneous maturation (Boruchov AM, ef a/ (2005) J. Clin. Invest. 1 15: 2914-2923; Dhodapkar KM, ef a/ (2005) Proc. Natl Acad. Sci. USA 102: 2910-2915). This suggests that the inhibitory FcyR not only regulates the magnitude of cell activation but also actively prevents spontaneous DC maturation under non-inflammatory steady-state conditions. Indeed, low levels of immune complexes can be seen in the serum of healthy donors, emphasizing the importance of regulatory mechanisms that prevent unwanted DC activation (Dhodapkar KM, et al (2005) Proc. Natl Acad. Sci. USA 102: 2910-2915). For malaria, where a maxima! immune response is desirable, blocking FcyRIIB activity might therefore be a novel way to obtain greater therapeutic efficacy. In fact, it has recently been shown that FcyRIIB deficient mice have increased clearance of Plasmodium chaubaudi malaria and develop less severe disease, and that polymorphic variants of human FcyRIIB which result in loss of function are common in African individuals who also show enhanced phagocytosis of parasites (Clatworthy MR ef al (2007) Proc. Natl Acad. Sci. USA 104: 7169-74). The loss of FcyRIIB also results in the priming of more antigen-specific T cells (Kalergis A M & Ravetch JV. (2002) J. Exp. Med. 195: 1653-1659). Therefore said polymeric Fc-fusion may by nature of crosslinking many more copies of FcgRIIB induce negative responses from cells expressing this receptor. Binding to inhibitory receptors e.g. CD22 and SignRI may also be decreased by reducing the number of sialic acid groups bound to the polymeric fusion protein. Conversely, if the polymeric fusion protein is for use as a therapeutic agent where an immune response is undesirable, the affinity of the Fc binding portion of the polymeric fusion protein for CD22 or SignRI may be increased. The increase in affinity may be achieved by increasing the amount of sialic acid groups bound to the polymeric fusion protein.

Other mutations may suitably be made to improve the efficacy of the Fc receptor binding portions. Suitably, each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence which is modified compared to the amino acid sequence of a native heavy chain constant region, to increase the in vivo half life of the polymeric antigen fusion protein, suitably by increasing the affinity of the Fc receptor binding portion for neonatal Fc receptor. Increasing the serum persistence allows higher circulating levels, less frequent administration and reduced doses. This can be achieved by enhancing the binding of the Fc region to neonatal FcR (FcRn). FcRn, which is expressed on the surface of endothelial cells, binds the Fc in a pH-dependent manner and protects it from degradation. The amino acid substitutions M252Y/S254T/T256E H433K/N434F may be introduced into the Fc receptor binding portion to increase in vivo half life of IgG without unduly affecting FcyR interactions (Vaccaro C, ei al (2005) Nat. Biotech. 23: 1283-1288). Interestingly, FcRn is also expressed in phagolysosomes, where it enhances phagocytosis in a pH-dependent manner (Vidarsson G, ef at (2006) Blood 108:3573-3579), and is involved in antigen presentation (Mi W ei a/ (2008) J Immunol 181 (1 1 ):7550-61 ; Qiao SW ei al (2008) Proc Natl Acad Sci U S A 105(27):9337-42). Fc-fusions have been developed specifically to target antigen to this receptor (Qiao SW ei al (2008) supra)

According to the first aspect of the invention, the polypeptide monomer units also comprise a tailpiece region fused C-terminal to each of the two immunoglobulin heavy chain constant regions; wherein the tailpiece region of each polypeptide monomer unit causes the monomer units to assemble into a polymer. Suitably, the tailpiece region is an IgM or IgA tailpiece, or fragment or variant thereof.

Where a region is described as being fused C-terminal to another region, the former region may be fused directly to the C-terminus of the latter region, or it may be fused to an intervening amino acid sequence which is itself fused to the C-terminus of the latter region. N-terminal fusion may be understood analogously.

An intervening amino acid sequence may be provided between the heavy chain constant region and the tailpiece, or the tailpiece may be fused directly to the C-terminus of the heavy chain constant region. For example, a short linker sequence may be provided between the tailpiece region and immunoglobulin heavy chain constant region. Linker sequences are discussed below in relation to the second aspect of the invention.

A preferred tailpiece region is the tailpiece region of human IgM, which is PTLYNVSLVMSDTAGTCY (Rabbitts TH et al, 1981. Nucleic Acids Res. 9 (18), 4509- 4524; Smith ei al (1995) J Immunol 154; 2226-2236)]. Suitably, this tailpiece may be modified at the N-termtnus by substituting Pro for the initial Thr, thus generating the sequence PPLYNVSLVMSDTAGTCY. This does not affect the ability of the tailpiece to promote polymerisation of the monomer. Further suitable variants of the human IgM tailpiece are described in S0rensen et al (1996) J Immunol 156: 2858-2865. A further IgM tailpiece sequence is GKFTLYNVSLIMSDTGGTCY from rodents (Abbas and Lichtman, Cellular and Molecular Immunology, Elsevier Saunders, 5^th Edn, 2005). An alternative preferred tailpiece region is the tailpiece region of human igA, which is PTHVNVSVVMAQVDGTCY (Putnam FW et al, 1979, J. Biol. Chem 254: 2865-2874)] Other suitable tailpieces from IgM or IgA of other species, or even synthetic sequences which cause the monomer units to assemble into a polymer, may be used. It is not necessary to use an immunoglobulin tailpiece from the same species from which the immunoglobulin heavy chain constant regions are derived, although it is preferred to do so.

"Variants" and "fragments" are as defined above. A variant of an IgM tailpiece typically has an amino acid sequence which is identical to PPLYNVSLVMSDTAGTCY in 8, 9, 0, 1 1 , 12, 13, 14 , 15, 16 or 17 of the 18 amino acid positions. A variant of an IgA tailpiece typically has an amino acid sequence which is identical to PTHVNVSVVMAQVDGTCY in 8, 9, 10, 1 1 , 12, 13, 14 ,15, 16 or 17 of the 18 amino acid positions. Fragments of these IgM or IgA tailpieces typically comprise 8, 9, 10, 1 1 , 12, 13, 14 , 15, 16 or 17 amino acids. Fragments of variants are also envisaged. Typically, fragments and variants of the IgM or IgA tailpiece retain the penultimate cysteine residue, as this is believed to form a disulphide bond between two monomer units in a polymeric fusion protein.

The ability of a given tailpiece region to cause the monomer units to assemble into a polymer may be tested by comparing the native molecular size of monomer units lacking a tailpiece with monomer units comprising a tailpiece. The latter will form polymers under native conditions. Native molecular weights can be determined by size-exclusion chromatography, for example on Sephadex-200 columns on an AKTA FPLC (Amersham). Alternatively, non-reducing gel electrophoresis may be used, as described in Smith et al (supra) or S0rensen ef al (supra).

Suitably, in the polymeric fusion protein, and in particular in the polymeric antigen fusion protein or the polymeric therapeutic fusion protein, each of the immunoglobulin heavy chain constant regions or variants thereof comprises an amino acid sequence that is modified compared to the amino acid sequence of a native heavy chain constant region, to increase the tendency of the monomer units to assemble into a polymer. The effect of modifying the amino acid sequence may be tested in the context of a monomer unit which comprises a tailpiece region known to be effective in causing polymer formation, such as either of the preferred IgM and IgA tailpieces described above. Because IgM and IgA are naturally polymeric, whereas IgG is naturally monomeric, the ability of monomer units based on IgG heavy chain constant regions to form polymers may be improved by modifying the parts of the IgG heavy chain constant regions to be more like the corresponding parts of IgM or IgA. Suitably, each of the immunoglobulin heavy chain constant regions or variants thereof is an IgG heavy chain constant region comprising an amino acid sequence which comprises a cysteine residue at position 309 according to the EU numbering system, and preferably also a leucine residue at position 310. The EU numbering system for IgG is described in Kabat EA et al, 1983 Sequences of proteins of immunological interest. US Department of Health and Human Services, National Institutes of Health, Washington DC. S0rensen ei al (supra) describes the mutation of Leu 309 to Cys 309 in a human igG3 molecule comprising a IgM tailpiece, to promote polymer formation. Leu 309 corresponds by sequence homology to Cys 414 in IgM and Cys 309 in igA. Other mutations may also be advantageous.

When the monomer units have assembled into a polymer, the Fc receptor binding portions are arranged in a polymeric structure which is spatially orientated to allow each Fc receptor binding portion to bind to an Fc receptor. IgM is naturally pentameric or hexameric and IgA naturally forms dimers, trimers or tetramers. These properties appear to be determined, at least in part, by the ability of the tailpiece to cause the monomers to associate into polymers. Pentameric IgM is formed when the IgM associates with the J chain, although it is typically hexameric in the absence of the J chain. The J chain may or may not be included as a further component of the polymeric antigen fusion protein of the invention. Pentameric IgM may bind to five IgM receptors on a cell surface, and IgA may bind to two, three or four igA receptors. Secretory IgM or IgA found at mucosal surfaces also contains secretory component (SC), part of the polymeric Ig-receptor used to translocate them from blood to secretions. The SC may or may not be included as a further component of the polymeric fusion protein of the invention.

Suitably, the polymeric fusion protein, including the polymeric antigen fusion protein, comprises five, six or seven or more polypeptide monomer units, although dimers, trimers and tetramers are also envisaged. The fusion proteins may naturally associate into polymers having different numbers of monomer units. Polymers having the required number of monomer units can be separated according to molecular size, for example by gel filtration.

The binding of multiple Fc receptors may cause different intracellular signalling phenomena than the binding of a single Fc receptor. For example, the delivery of the antigen by the polymeric antigen fusion protein to ceils expressing Fc receptors will typically provide for a more effective immune response than would the delivery of the antigen by a monomeric unit which does not form polymers (for example because it lacks the tailpiece). Similarly, the delivery of a therapeutic agent by the polymeric therapeutic fusion protein to cells expressing Fc receptors will typically provide for a more effective therapeutic response than would the delivery of the therapeutic agent by a monomeric unit which does not form polymers {for example because it lacks the tailpiece and Cys309 mutation).

The efficacy of the polymeric antigen fusion protein of the invention can be compared against the efficacy of a monomeric unit which does not form polymers, in many ways. In such tests, it is typica! for the monomeric units of the polymeric antigen fusion protein to, individually, have the same affinity for a given Fc receptor as the monomeric unit which does not form polymers. Both polymeric and monomeric proteins should be covalently linked to the antigen, in the same way. In other words, they are functionally equivalent, except for the number of Fc receptors to which they can bind.

Polymeric fusion proteins will have greater avidity for Fc receptors than wil! the control monomeric units. Avidity is the overall binding strength of a polyvalent interaction. The interaction between Fc binding region and receptor has a characteristic affinity, whereas the avidity of the interaction increases almost geometrically for each interaction. For low affinity Fc receptors, the increase in binding strength may allow a biologically relevant interaction with a polymeric antigen fusion protein, which could not be achieved by a monomeric unit. Multivalent binding by polymeric antigen fusion proteins results in a considerable increase in stability as measured by the equilibrium constant (L/mol), compared to binding of a control monomeric fusion. For example, a typical monovalent interaction between an Fc portion and an Fc receptor may have an equilibrium constant of about 10⁴ L/mol. A pentavalent interaction may provide for an equilibrium constant of about 10¹¹ L/mol. The equilibrium constant may vary depending on the Fc portion and the Fc receptor. However, a pentameric antigen fusion protein will typically exhibit an increase in the binding energy compared to a control monomeric antigen fusion protein of up to about 10⁴, 10⁵ or 10⁶ fold, or even greater than 10⁶ fold. For description of avidity and affinity see textbook immunology by Roitt, Brostoff and Male, 2^nd edition 1989, page 7.3).

The avidity for Fc receptors of the polymeric fusion protein may be compared to that of the monomeric unit which does not form polymers by Surface Plasmon Resonance Analysis (Biacore), as described above. A suitable assay to characterise the increased avidity is rosetting analysis. Human erythrocytes are amide coupled to varying concentrations of control monomeric units or polymeric antigen fusion proteins using commonly available coupling kits from Pierce. Coating levels for each monomer or polymeric antigen fusion protein is compared by reactivity with anti-Fc fluorescein isothiocyanate conjugate (FITC) as assessed by flow cytometry. Human neutrophils or dendritic cells known to express Fcy-receptors are isolated as described previously from healthy human volunteers (Pieass RJ et al, 1996 Biochem Journal 318: 771-777). Rosetting of sensitized erythrocytes to these human cells is performed as previously described (Walker MR et al, Vox Sang 55, 222-228). A rosette is defined as a neutrophil surrounded by three or more erythrocytes. Erythrocytes opsonized with polymeric antigen fusion proteins will typically form rosettes at lower molar concentrations than erythrocytes opsonized with monomers, because the poiymeric antigen fusion proteins will bind to Fcy-receptors on neutrophils or DCs with high avidity. Rosetting assays have been used by the inventor (Pieass RJ et al, Journal of Biological Chemistry 1 999, 274: 23508-23515) to compare strength of binding of various antibodies for their Fc-receptors. Rosetting analysis using IgM is described in Ghumra A et al, J. Immunol. 2008.

An assay to characterise the biological effects of increased avidity of the polymeric fusion protein is a chemiluminescence assay of respiratory burst. Wells of a chemiluminesence microtiter plate (Dynatech) are coated with control monomer or polymeric antigen fusion protein at equimolar concentrations and incubated overnight at 4°C. After washing three times with PBS, 100 μΙ of luminol (67 mg/ml in Hanks buffered saline solution (HBSS) containing 20 mM HEPES and 0.1 g/100ml globulin-free bovine serum albumin (HBSS/BSA)) is added to each well. After the addition of 50 μ! of neutrophils (1 million / ml in HBSS/BSA) to each well, the plate is transferred to a Microlumat LB96P luminometer, and the chemiluminescence measured at regular intervals for 1 hour. Typically, the poiymeric antigen fusion proteins will induce greater peak and longer bursts than control monomers. This assay has been used by the inventor to compare the functional properties of antibodies which interact with Fc-receptors (Pieass RJ et al, Journal of Biological Chemistry 1999, 274: 23508-23515).

In the polymeric antigen fusion protein of the first aspect of the invention, at least one of the polypeptide monomer units is covalently linked to at least one antigen. Thus, the polymeric antigen fusion protein will not only bind cell surface Fc receptors with high avidity, and cause activation of suitabie Fc receptors, but will also deliver the antigen to the cell. In other embodiments the binding of the polymeric antigen fusion protein to the Fc receptors may cause inactiivation of the receptors. Typically, Fc receptors are internalised by endocytosis following polyvalent interactions with antibodies, and deliver their antigen cargo into subcellular compartments in which it will be processed for antigen presentation.

An "antigen" is a molecule that binds specifically to an antibody or a TCR. Antigens that bind to antibodies include all classes of molecules, and are called B cell antigens. Suitable types of molecule include peptides, polypeptides, glycoproteins, polysaccharides, gangliosides, lipids, phospholipids, DNA, RNA, fragments thereof, portions thereof and combinations thereof. TCRs bind only peptide fragments of proteins complexed with MHC molecules; both the peptide iigand and the native protein from which it is derived are called T cell antigens. "Epitope" refers to an antigenic determinant of a B cell or T cell antigen. Where a B cell epitope is a peptide or polypeptide, it typically comprises three or more amino acids, generally at least 5 and more usually at least 8 to 10 amino acids. The amino acids may be adjacent amino acid residues in the primary structure of the polypeptide, or may become spatially juxtaposed in the folded protein. T cell epitopes may bind to MHC Class I or MHC Class II molecules. Typically MHC Class l~binding T cell epitopes are 8 to 1 1 amino acids long. Class II molecules bind peptides that may be 10 to 30 residues long or longer, the optimal length being 12 to 16 residues. Peptides that bind to a particular allelic form of an MHC molecule contain amino acid residues that allow complementary interactions between the peptide and the allelic MHC molecule. The ability of a putative T cell epitope to bind to an MHC molecule can be predicted and confirmed experimentally. Suitably, the at least one antigen comprises a B cell epitope and/or a T cell epitope and the at least one antigen suitably comprises a peptide, polypeptide, carbohydrate, lipid, DNA or RNA. it is preferred to include a T cell epitope when it is desired to raise antibodies against a B cell epitope. A T cell epitope may be provided in a carrier peptide, such as serum albumin, myoglobin, bacterial toxoid or keyhole limpet haemocyanin. More recentiy developed carriers which induce T-celi help in the immune response include the hepatitis-B core antigen (also called the nucleocapsid protein), presumed T-celi epitopes such as Thr-Ala-Ser-Gly~Val-A(a-Glu-Thr-Thr-Asn-Cys, beta-galactosidase and the 163-171 peptide of interleukin-1. Different epitopes can be provided in different antigens or the same antigens. Multiple antigens may be used. Where a natural antigen is particularly large, it may be simpler to provide the B and or T cell epitopes in the polymeric antigen fusion protein. The polymeric antigen fusion protein comprises at least one antigen. Typically both immunoglobulin heavy chain constant regions of a given monomer unit are linked to an antigen and/or each monomer unit in the polymeric antigen fusion protein is linked to an antigen. Suitably, the ratio of antigens to immunoglobulin heavy chain constant regions is 1 :1 , or close to 1 : 1 , such as 6, 8 or 10 : 12 , 14 (for heptameric polymers). A ratio of 1 antigen per immunoglobulin heavy chain constant region corresponds to 2 antigens per Fc portion. Increasing the quantity of antigen may increase the efficacy of the polymeric antigen fusion protein. More that one antigen may be linked to a given immunoglobulin heavy chain constant region, for example 2, 3, 4 or 5 antigens may be linked to an immunoglobulin heavy chain constant region. These may be the same or different antigens. In that case, the ratio of antigen to heavy chain constant regions in a polymeric antigen fusion protein may be greater than 1.

The antigen is covalently linked to at least one of the peptide monomer units.

It is preferred that the at least one antigen comprises a peptide or a polypeptide, which is preferably fused N-terminal or C-terminal to at least one immunoglobulin heavy chain constant region. The use of a peptide or polypeptide antigen allows for the covalent linkage to be provided by protein expression of the monomer unit and the antigen as a genetic fusion. Fusion N-terminal to or at the N-terminus of the monomer unit is preferred, so that the antigen does not sterically hinder the polymerization process driven by the tailpiece. Nevertheless, if the antigen is particularly small, such as a T cell epitope or a small B ceil epitope of fewer than 20 amino acids, it may be possible to fuse it C- terminal to the immunoglobulin heavy chain constant region, for example at the C- terminus of the immunoglobulin heavy chain constant region or at the C-terminus of the tailpiece without affecting polymerization. A short linker sequence may be provided between the antigen and the tailpiece region or immunoglobulin heavy chain constant region. Linker sequences are discussed below in relation to the second aspect of the invention.

Suitably, at least one of the monomer units comprises at least one antigen fused N- terminal to at least one and preferably each of the two immunoglobulin heavy chain constant regions, such as at the N-terminus of the immunoglobulin heavy chain constant region or regions. Suitably each of the monomer units comprises at least one antigen fused N-terminal to at least one and preferably each of the two immunoglobulin heavy chain constant regions, such as at the N-terminus of the immunoglobulin heavy chain constant region or regions. Alternatively, the polypeptide antigen may be linked to the monomer unit by any of the conventional ways of cross-linking polypeptides, such as those generally described in O'Sullivan er al Anal. Biochem. (1979) 100, 100-108. For example, the first portion may be enriched with thiol groups and the second portion reacted with a bifunctional agent capable of reacting with those thiol groups, for example the N-hydroxysuccinimide ester of iodoacetic acid (NHIA) or N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), a heterobifunctional cross-linking agent which incorporates a disulphide bridge between the conjugated species. Amide and thioether bonds, for example achieved with m- maleimidobenzoyl-N-hydroxysuccinimide ester, are generally more stable in vivo than disulphide bonds. {PRIVATE } Further useful cross-linking agents include S- acetylthioglyco!ic acid N-hydroxysuccinimide ester (SATA) which is a thioiating reagent for primary amines which allows deprotection of the sulphydryl group under mild conditions (Julian et al (1983) Anal. Biochem. 132, 68), dimethylsuberimidate dihydrochloride and N,N'-o-phenylenedimaleimide.

If the at least one antigen comprises a peptide, polypeptide, carbohydrate, lipid, DNA or RNA, the antigen may be chemically conjugated to at least one and preferably each of the monomer units, suitably to the N-terminus, using techniques known in the art. Suitable cross-linking agents include those listed as such in the Sigma and Pierce catalogues, for example glutaraldehyde, carbodiimide and succinimidy! 4-(N- maleimidomethyl)cyclohexane-1-carboxylate.

Suitable antigens may be derived from prions, parasites, helminths, nematodes, protozoans, viruses, bacteria, insects, fungi, plants, allergens or venoms etc or any other potential pathogen, and also tumour antigens.

Examples of protozoal and other parasitic antigens include, but are not limited to antigens from Plasmodium species which cause malaria, such as P. falciparum. Suitable antigens include merozoite surface antigens, such as merozoite surface protein 1₁₉ (MSPI ₁₉) or AMA1 , sporozoite circumsporozoite antigens, gametocyte/ such as gamete surface antigens, blood-stage antigen other plasmodiai antigen components; toxoplasma antigens; Schistosoma antigens such as cercarial elastase, glutathione-S transferase, paramyosin, and other schistosomal antigens; Leishmania major and other leishmaniae antigens; Trypanosoma cruzi antigens such as the 75-77 kDa antigen and other trypanosomai antigen. Suitable Plasmodium antigens are described in Florens L et al 2002; Nature 419: 520-526. Examples of viral antigens include human immunodeficiency virus (HIV) antigens such as products of the gag, pol, and env genes, the Nef protein, reverse transcriptase, and other HIV components; hepatitis, e.g., hepatitis A, B, and C, hepatitis viral antigens such as the S, M, and L proteins of hepatitis, the pre-S antigen of hepatitis B virus, hepatitis C viral RNA; influenza viral antigens hemagglutinin and neuraminidase and other influenza viral antigens; measles viral antigens such as SAG-1 or p30; rubella viral antigens such as proteins El and E2 and other rubella virus components; rotaviral antigens such as VP7sc components and other rotaviral components; cytomegaloviral antigens such as envelope glycoprotein B and other cytomegaloviral proteins; respiratory syncytial viral antigens, such as the RSV fusion protein, the M2 protein; variceila zoster viral antigens such as gpl, gpll, and telomerase.

Examples of bacterial antigens include pertussis bacterial antigens such as pertussis toxin; diptheria bacterial antigens such as diptheria toxin or toxoid erythematosis, and other diptheria bacterial antigen components; tetanus bacterial antigens such as tetanus toxin or toxoid and other bacterial antigen components; streptococcal bacterial antigens such as M proteins and other streptococcal bacterial antigen components; gram-negative bacilli bacterial antigens such as lipopolysaccharides and other gramnegative bacterial antigen components, Mycobacterium tuberculosis bacterial antigens such as mycolic acid, heat shock protein 65 (HSP65), the 30 kDa major secreted protein, antigen 85A and other mycobacterial antigen components; Helicobacter pylori bacterial antigen components; pneumococcal bacterial antigens such as pneumolysis pneumococcal capsular polysaccharides and other pneumococcal bacterial antigen components; haemophilus influenza bacterial antigens such as capsular polysaccharides and other haemophilus influenza bacterial antigen components; anthrax bacterial antigens such as anthrax protective antigen and other anthrax bacterial antigen components; rickettsiae bacterial antigens such as rompA and other rickettsiae bacterial antigen component. Also included with the bacterial antigens described herein are any other bacterial mycobacterial, mycoplasmal, rickettsial, or chlamydial antigens.

Fungal antigens which can be used include, but are not limited to Candida fungal antigen components; histoplasma fungal antigens, coccidiodes fungal antigens such as spherule antigens and other coccidiodes antigens; cryptococcal fungal antigens such as capsular polysaccharides and other antigens fungal antigens. Cancer antigen or tumour antigens may be used in accordance with the immunogenic compositions of the invention including, but not limited to dystroglycan, KS [1/4] pan- carcinoma antigen, ovarian carcinoma antigen (CA125), prostatic acid phosphate, prostate specific antigen, melanoma-associated antigen p97, melanoma antigen gp75, high molecular weight melanoma antigen (H W- AA), prostate specific membrane antigen, carcinoembryonic antigen (CEA), polymorphic epithelial mucin antigen, human milk fat globule antigen, colorectal tumor-associated antigens such as: CEA, TAG-72, C017-1A; GICA 19-9, CTA-1 and LEA, Burkitt's lymphoma antigen-38.13, CD19, human B-lymphoma antigen-CD20, CD33, melanoma specific antigens such as ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, tumor-specific transplantation type of cell-surface antigen (TSTA) such as virally-induced tumor antigens including T-antigen DNA tumor viruses and Envelope antigens of RNA tumor viruses, oncofetal antigen-alpha-fetoproiein such as CEA of colon, bladder tumor oncofetal antigen, differentiation antigen such as human lung carcinoma antigen L6, L20, antigens of fibrosarcoma, human leukemia T cell antigen-Gp37, neoglycoprotein, sphingolipids, breast cancer antigen such as EGFR, EGFRvlll, FABP7, doublecortin, brevican, HER2 antigen, polymorphic epithelial mucin (PEM), malignant human iymphocyte antigen-APO-1 , differentiation antigen such as I antigen found in feta! erythrocytes, primary endoderm, I antigen found in adult erythrocytes, preimplantation embryos, I (Ma) found in gastric adenocarcinomas, M18, M39 found in breast epithelium, SSEA-1 found in myeloid cells, VEP8, VEP9, Myl, VIM-D5, D156-22 found in colorectal cancer, TRA-1 -85 (blood group H), C14 found in colonic adenocarcinoma, F3 found in lung adenocarcinoma, AH6 found in gastric cancer, Y hapten, Ley found in embryonal carcinoma cells, TL5 (blood group A), EGF receptor found in A431 cells, E1 series (blood group B) found in pancreatic cancer, FC10.2 found in embryona! carcinoma cells, gastric adenocarcinoma antigen, CO-5 4 found in Adenocarcinoma, NS-10 found in adenocarcinomas, CO-43, G49 found in EGF receptor of A431 cells, MH2 found in colonic adenocarcinoma, 19.9 found in colon cancer, gastric cancer mucins, T5A7 found in myeloid cells, R24 found in melanoma, 4.2, GD3, D1.1 , OFA-1 , GM2, OFA-2, GD2, and M1 :22:25:8 found in embryonal carcinoma cells, SSEA-3 and SSEA-4 found in 4 to 8-cell stage embryos, a T cell receptor derived peptide from a Cutaneous T cell Lymphoma, and variants thereof.

The polymeric antigen fusion protein delivers the antigen to the immune system in such a way as to increase, or in some embodiments decrease, its immunogenicity. Thus, even natural antigens which are not naturally very immunogenic can be used as the antigen. Weak antigens are preferred. Such antigens are not immunogenic if administered alone, i.e. in the absence of an adjuvant. An example of a weak antigen is MSP1 -19. Strong antigens include superantigens such as SSL10 or cholera toxin, which cause nonspecific activation of T and/or B ceils resulting in polyclonal T and/or B cell activation. Although the polymehc antigen fusion proteins may deliver a superantigen or other strongly immunogenic antigen in such a way as to increase its immunogenicity, it may not be necessary to increase the immunogenicity of such antigens.

The efficacy of the polymeric antigen fusion protein in inducing an immune response to the antigen can be determined using animal experiments. For example, a mouse can be immunized with a polymeric antigen fusion protein comprising a viral antigen according to the methods detailed herein. After the appropriate period of time to allow immunity to develop against the antigen, for example two weeks, a blood sample is tested to determine the level of antibodies, termed the antibody titre, using ELISA. In some instances the mouse is immunized and, after the appropriate period of time, challenged with the virus to determine if protective immunity against the virus has been achieved.

For an animal model to be suitable, it is important that the Fc receptors in the animal are capable of binding to the Fc receptor binding portions of the polymehc antigen fusion protein. It is known that human immunoglobulins can bind to mouse Fc receptors. For example human Ig binds to the mouse FcM-receptor. Pleass RJ, 2009 Parasite Immunology 31 : 529-538 reports which Fc receptors and can bind which antibodies from which species. Nevertheless, where the polymehc antigen fusion protein comprises Fc binding portions derived from human immunoglobulin heavy chain sequences, it may be advantageous to use transgenic mice which express human Fc receptors. A suitable transgenic mouse expresses the human FcyRI receptor (CD64) which binds to human lgG1 and lgG3 (Heijnen IA, van Vugt MJ, Fanger NA, Graziano RF, de Wit TP, Hofhuis FM, Guyre PM, Capel PJ, Verbeek JS, van de Winkel JG. J Clin Invest. 1996 Jan 15;97(2):331 -8). Such mice have been used to show a role for human FcRs in controlling malaria by the inventor (Mcintosh RS, Shi J, Jennings RM, Chappel JC, de Koning-Ward TF, Smith T, Green J, van Egmond M, Leusen JH, Lazarou M, van de Winkel J, Jones TS, Crabb BS, Holder AA, Pleass RJ. PLoS Pathog. 2007 May 18;3(5):e72). Transgenic mice expressing low affinity FcRs are also available, such as FcyRIIA (CD32) (McKenzie SE 2002, Blood Rev 16:3-5). FcsRI, and FcaRI (CD89) transgenics are also available.

In typical animal tests, quantities of polymehc antigen fusion proteins are compared against control monomeric or dimeric subunits, such that each provides an equimolar dose of antigen. Typically, the antigen-specific antibody titre resulting from immunization with the polymeric antigen fusion protein is greater than the antigen-specific antibody titre resulting from immunization with the control monomeric subunits. Particularly, the antigen-specific IgG titre wilf be increased. There are several subtypes of IgG. Sn humans, lgG1 and lgG3 are associated with T helper 1-type responses, complement fixation, phagocytosis by high affinity FcRs and are indicative of protective immunity, whereas lgG2 and !gG4 responses tend to be less effective.

In the mouse, it is the lgG2 subtypes (lgG2a, lgG2b and in certain strains of mice, lgG2c) which are associated with complement fixation, phagocytosis by high affinity FcRs and are indicative of protective immunity, whereas lgG1 and lgG4 are less effective. Typical antibody responses driven by polymeric antigen fusion proteins are biased towards protective IgG subtypes, in comparison with antibody responses driven by monomeric subunits. Suitably, in a mouse experiment, the titre of lgG2 subtypes may be at least as great as the titre of !gG1 , and typically at least 1.5 fold, at least 2 fold, at least 5 fold or at least 10 fold greater.

The polymeric antigen fusion protein may be designed to elicit a protective immune response but not to induce an IgE response, in such cases the polymeric antigen fusion protein may be used as a vaccine for allergic conditions such as hay fever, rhinitis, asthma, eczema, and food or drug allergies.

In one embodiment the polymeric antigen fusion protein delivers the antigen to the immune system in such a way as to increase its immunogenicity, and thus it is typically possible to generate an immune response by administering the polymeric antigen fusion protein in the absence of an adjuvant, or to use a reduced amount of adjuvant, or a less toxic adjuvant. Typically, the antigen-specific antibody response to the polymeric antigen fusion protein is biased towards protective IgG subtypes even in the absence of adjuvant. Typically, the titre of protective IgG subtypes is as great following immunisation with the polymeric antigen fusion protein than with the monomeric subunits plus adjuvant; or, to achieve the same titre of protective IgG subtypes it is necessary to use less adjuvant with the polymeric antigen fusion protein, suitable only 80%, only 60%, only 50%, only 25%, only 10%, only 5%, only 1 % of the amount of adjuvant used with the monomeric subunits.

In another embodiment the polymeric antigen fusion protein delivers the antigen to the immune system in such a way as to decrease its immunogenicity Generaliy accepted animal models can be used for testing of immunization against cancer using a tumour or cancer antigen. For example, cancer cells (human or murine) can be introduced into a mouse to create a tumour, and one or more cancer associated antigens can be delivered by the methods described herein. The effect on the cancer cells (e.g., reduction of tumor size) can be assessed as a measure of the effectiveness of the immunization. The tests also can be performed in humans, where the end point is to test for the presence of enhanced levels of circulating cytotoxic T lymphocytes against cells bearing the antigen, to test for levels of circulating antibodies against the antigen, to test for the presence of cells expressing the antigen and so forth.

A "therapeutic agent" may be any agent that can be used for therapy. The therapy may be prophylactic or curative. A therapeutic agent may be a drug, a small molecule, an isolated protein, an isolated peptide, an isolated nucleic acid or any other suitable agent. The therapeutic agent may target a protein in a subject.

The therapeutic agent may be a protein which is a ligand, a receptor, an enzyme or an antibody, in particular, a monoclonal antibody. Depending on the subject, the antibody may be genetically adapted to the organism to be applied to. That is, for a human being, the monoclonal antibody, typically derived from mice, is humanised according to methods known in the art. Preferably, the monoclonal antibody is a fully humanized antibody for application in human subjects.

Alternatively, the therapeutic agent may be an isolated nucleic acid, like DNA or RNA or modified DNA or RNA molecules with modifications known in the art. The nucleic acid molecule may be a DNA oligonucleotide or a modified version (e.g. morpholinos), silencer RNA, an interfering RNA, an antisense RNA, an artificial micro RNA, ribozyme, etc. The term "isolated nucleic acid" or "isolated nucleic acid molecule" refers to a nucleic acid molecule DNA or RNA that has been removed from its native environment. For example, recombinant nucleic acid molecules contained in a vector are considered isolated for the purpose of the present invention.

The therapeutic agent may be a small molecule. In this context, the term "small molecule" particularly refers to small organic molecules. Typically, said small molecules are part of screening libraries comprising chemical, typically organic, synthetic compounds. The invention may be applied to other proteins in which the desired outcome is polymerization, although it is particularly suited to Fc-fusion molecules in which the immunoglobulin Fc is fused genetically to a protein of interest, such as an extracellular domain of a receptor, receptor agonist, ligand, lipid, carbohydrate, enzyme, peptide, peptide mimetic, TRAPs, other antibody fragments e.g. scFvs, or any multiligand binding domain, !n particular, the invention may apply to Fc-fussons to chemokines, cytokines, Toll like receptors (TLRs), acute phase proteins, complement components, allergens, immune receptors, red ceil receptors & blood group antigens, CD molecules, growth factors, clotting proteins and signal transduction molecules. The invention may also be used with known Fc-fusions which are used therapeutically as monomers to create more effective polymeric fusions e.g. etanercept, alefacept, abatacept, belatacept, atacicept, briobacept, rilonacept, afilbercept.

In another embodiment the therapeutic agent may be a marker, for example, a fluorophore, to allow visualisation of the polymeric fusion protein.

A second aspect of the invention provides nucleic acid molecule comprising a coding portion encoding a polypeptide monomer unit of a polymeric fusion protein according to the first aspect of the invention, wherein the polypeptide monomer unit comprises at least one functional factor fused N-terminai or C-terminal to the immunoglobulin heavy chain constant region, such as at the N-terminus or the C-terminus of the immunoglobulin heavy chain constant region.

Preferably the invention provides a nucleic acid molecule comprising a coding portion encoding a polypeptide monomer unit of a polymeric antigen fusion protein according to the first aspect of the invention, wherein the polypeptide monomer unit comprises at least one peptide or polypeptide antigen fused N-terminal or C-terminal to the immunoglobulin heavy chain constant region, such as at the N-terminus or the C-terminus of the immunoglobulin heavy chain constant region.

Conventional recombinant DNA methodologies may be exploited for generating the polymeric antigen fusion proteins of the invention systems, as described, for example in (Sambrook et al, "Molecular cloning: A laboratory manual", 2001 , 3^rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). The monomer unit constructs preferably are generated at the DNA level, and the resulting DNAs integrated into expression vectors, and expressed to produce the monomer units which assemble to form the polymeric antigen fusion protein. The nucleic acid molecule of the second aspect of the invention comprises a coding portion which comprises, in a 5' to 3' direction, a peptide or polypeptide antigen coding sequence fused in frame with a coding sequence for an immunoglobulin heavy chain constant region, which is itself fused in frame with a coding sequence for a tailpiece region; or an immunoglobulin heavy chain constant region fused in frame with a coding sequence for a tailpiece region, which is itself fused in frame with a coding sequence of a peptide or polypeptide antigen. DNA encoding the coding sequences may be in its genomic configuration or its cDNA configuration. It will be appreciated that further coding sequences may be provided between the antigen coding sequence and the heavy chain or tailpiece coding sequences, to allow these components to be separated from each other in the expressed protein by linker sequences. Typical linker sequences are of between 1 and 20 amino acids in length, typically 2, 3, 4, 5, 6 or up to 8, 10, 12, or 16 amino acids in length. Nucleic acids encoding Sinker sequences may be included, for example, to allow the inclusion of useful restriction sites and/or to allow the antigen, heavy chain region and tailpiece coding regions to be transcribed in frame. A suitable linker to include between the heavy chain region and tailpiece region encodes for Leu- Val-Leu-Gly. Suitable coding regions can be amplified by PCR and manipulated using standard techniques (Sambrook er a/, supra). Mutations compared to native nucleic acid sequences can be made by SOEing PCR or site directed mutagenesis.

If it is desired to produce polymeric antigen fusion proteins or polymeric therapeutic fusion proteins comprising monomer units to which an antigen or therapeutic agent is not fused, a further nucleic acid molecule is required for expression of such monomer units.

Suitably, the coding portion of the nucleic acid molecule of the second aspect of the invention encodes a signal peptide, which is contiguous with the polypeptide monomer unit. This facilitates isolation of the expressed monomer units from a host ceil. The nucleic acid molecule will therefore comprise a coding portion which comprises, in a 5' to 3' direction, a signal sequence fused in frame with the coding sequence of the monomer unit. Similarly, a nucleic acid molecule encoding a monomer unit which is not fused to an antigen may also be provided with a signal sequence.

The portion of the DNA encoding the signal sequence preferably encodes a peptide segment which directs the secretion of the monomer unit and thereafter is cleaved away from the remainder of the monomer unit. The signal sequence is a polynucleotide which encodes an amino acid sequence which initiates transport of a protein across the membrane of the endoplasmic reticulum. Signal sequences which are usefui in the invention include antibody light chain signal sequences, e. g., antibody 14.18 (Gillies et al. (1989) J. OF IMMUNOL. METH., 125: 191 ), antibody heavy chain signal sequences, e. g., the MOPC141 antibody heavy chain signal sequence (Sakano et al. (1980) NATURE 286: 5774), and any other signal sequences which are known in the art (see, for example, Watson (1984) NUCLEIC ACIDS RESEARCH 12: 5145). Signal sequences have been well characterized in the art and are known typically to contain 16 to 30 amino acid residues, and may contain greater or fewer amino acid residues. A typical signal peptide consists of three regions: a basic N~terminal region, a central hydrophobic region, and a more polar C-terminal region. The central hydrophobic region contains 4 to 12 hydrophobic residues that anchor the signal peptide across the membrane lipid bilayer during transport of the nascent polypeptide. Following initiation, the signal peptide usually is cleaved within the lumen of the endoplasmic reticulum by cellular enzymes known as signal peptidases. Potential cleavage sites of the signal peptide generally follow the "(-3,-1 ) rule". Thus a typical signal peptide has small, neutral amino acid residues in positions -1 and -3 and lacks proline residues in this region. The signal peptidase will cleave such a signal peptide between the -1 and +1 amino acids. Thus, the signal sequence may be cleaved from the amino-terminus of the monomer unit during secretion. This results in the secretion of the monomer unit. As would be apparent to one of skill in the art, the suitability of a particular signal sequence for use in the secretion cassette may require some routine experimentation.

A third aspect of the invention provides an expression vector comprising the nucleic acid molecule according to the second aspect of the invention. If it is desired to produce polymeric antigen or therapeutic fusion proteins comprising monomer units to which an antigen or therapeutic agent is not fused, a further vector comprising a suitable nucleic acid molecule is required for expression of such monomer units.

As used herein, the term "vector" is understood to mean any nucleic acid comprising a nucleotide sequence competent to be incorporated into a host cell and to be recombined with and integrated into the host cell genome, or to replicate autonomously as an episome. Such vectors include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors and the like. Non-limiting examples of a viral vector include a retrovirus, an adenovirus and an adeno-associated virus. As used herein, the term "gene expression" or "expression" of monomer unit, is understood to mean the transcription of a DNA sequence, translation of the mRNA transcript, and optionally also secretion of a monomer unit. Suitably expression construct are disclosed in WO 01/07081. Basic vectors useful in the practice of the invention include a selectable marker, for example, a gene encoding dihydrofolate reductase (DHFR), driven by transcriptional regulatory sequences, derived, for example, from the SV40 virus, and bacterial plasmid sequences for selection and maintenance of the plasmid in E. coli. Expression of the monomer unit protein sequences are driven by promoter and optionally enhancer sequences, for example, the cytomegalovirus (CMV) promoter and enhancer sequences.

A fourth aspect of the invention provides a host cell comprising the expression vector of the third aspect of the invention. The ceil can be a mammalian, avian, insect, reptilian, bacterial, plant or fungal cell. Examples of mammalian cells include, but are not limited to, human, rabbit, chicken, rodent (e.g. mouse, rat) cells. Typical mammalian cells include a myeloma cell, a Sp2/0 cell, a CHO cell, L cell, COS cell, fibroblast, MDCK cell, HT29 cell or a T84 cell. A preferred host cell is CHO-K1. Expression vectors may be introduced into host cells using standard techniques, including calcium phosphate transfection, nuclear microinjection, DEAE-dextran transfection, bacterial protoplast fusion and e!ectroporation. If it is desired to prepare monomer units in which each chain has a different amino acid sequences, e.g. with and without antigen or therapeutic agent, host cells may be co-transfected with two appropriate expression vectors.

The polymeric fusion proteins may be prepared by methods including (1 ) preparing a vector (or vectors) comprising the nucleic acid molecule(s) encoding the monomer units; (2) transfecting a host eel! with the vector(s); (3) culturing the host ceil to provide expression; and (4) recovering the polymeric fusion protein.

If the fusion protein is secreted by the host cell it can conveniently be recovered by affinity chromatography utilising its affinity for Fc binding agents, such as Protein A or Protein G, suitably Protein-G HiTrap (GE healthcare) coiumns. Antigen-fusion proteins comprising Fc portions from immunoglobulins other than IgG, e.g. IgM, may be recovered from supernatant using Fc-specific monoclonal Abs fused to sepharose. Proteins may be eluted from such coiumns by Sow pH into neutral buffer. Dialysis may subsequently be performed for buffer exchange, if the host cell does not secrete the fusion protein, it may be recovered by lysing the cells followed by affinity chromatography.

A fifth aspect of the invention provides a vaccine composition comprising the polymeric antigen fusion protein according to the first aspect of the invention or the expression vector according to the third aspect of the invention and a pharmaceutically acceptable carrier.

A sixth aspect of the invention provides a therapeutic composition comprising the polymeric therapeutic fusion protein according to the first aspect of the invention or the expression vector according to the third aspect of the invention and a pharmaceutically acceptable carrier.

Any method of preparation of vaccines and immunizing agents can be used, as exemplified by U .S. Pat. Nos. 4,608,251 ; 4,601 ,903; 4,599,231 ; 4,599,230; 4,596,792; and 4,578,770. Typically, such vaccines are prepared as injectables either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. The preparation may also be emulsified. In addition, if desired, the vaccine may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants that enhance the effectiveness of the vaccines.

Any method of preparation of therapeutic compositions can be used. The carrier may be preferably a liquid formulation, and is preferably a buffered, isotonic, aqueous solution. Suitably, the vaccine composition has a pH thai is physiologic, or close to physiologic. Suitably it is of physiologic or close to physiologic osmolarity and salinity and/or is sterile and endotoxin free. It may contain sodium chloride and/or sodium acetate. Pharmaceutically acceptable carriers may also include excipients, such as diluents, and the like, and additives, such as stabilizing agents, preservatives, solubi!izing agents, and the like. As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of US or EU or other government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in humans. The composition can be for example a suspension, emulsion, sustained release formulation, cream , gel or powder. Pharmaceutical compositions may additionally comprise, for examp!e, one or more of water, buffers {e.g., neutral buffered saline or phosphate buffered saline), ethanol, mineral oil, vegetable oil, dimethylsulfoxide, carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, adjuvants, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione and/or preservatives. Furthermore, one or more other active ingredients may (but need not) be included in the pharmaceutical compositions provided herein.

Pharmaceutical compositions may be formulated for any appropriate manner of administration, including, for example, topical (e.g., transdermal or ocular), oral, buccal, nasal, vaginal, rectal or parenteral administration. The term parenteral as used herein includes subcutaneous, intradermal, intravascular [e.g., intravenous), intramuscular, spinal, intracranial, intrathecal, intraocular, periocular, intraorbital, intrasynovial and intraperitoneal injection, as well as any similar injection or infusion technique. Forms suitable for oral use include, for example, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Compositions provided herein may be formulated as a lyophilizate.

Aqueous suspensions contain the active ingredient(s) in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients include suspending agents (e.g., sodium carboxymethyicel!ulose, methylcellulose, hydropropylmethylce!iulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia); and dispersing or wetting agents (e.g., naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with fatty acids such as polyoxyethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as heptadecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyethylene sorbitan monooleate). Aqueous suspensions may also comprise one or more preservatives, for example ethyl, or n-propy! p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin. The formulations may be for local or topical administration, such as for topical application to the skin, wounds or mucous membranes, such as in the eye. Formulations for topical administration typicaliy comprise a topical vehicle combined with active agent(s), with or without additional optional components. Suitable topical vehicles and additional components are well known in the art, and it will be apparent that the choice of a vehicle will depend on the particular physical form and mode of delivery. Topical vehicles include water; organic solvents such as alcohols (e.g., ethanol or isopropyl alcohol) or glycerin; glycols (e.g., butylene, isoprene or propylene glycol); aliphatic alcohols (e.g., lanolin); mixtures of water and organic solvents and mixtures of organic solvents such as alcohol and glycerin; lipid-based materials such as fatty acids, acylglycerols (including oils, such as mineral oil, and fats of natural or synthetic origin), phosphoglycerides, sphingolipids and waxes; protein-based materials such as collagen and gelatin; silicone-based materials (both non-volatile and volatile); and hydrocarbon-based materials such as microsponges and polymer matrices. A composition may further include one or more components adapted to improve the stability or effectiveness of the applied formulation, such as stabilizing agents, suspending agents, emulsifying agents, viscosity adjusters, gelling agents, preservatives, antioxidants, skin penetration enhancers, moisturizers and sustained release materials. Examples of such components are described in Martindale - The Extra Pharmacopoeia (Pharmaceutical Press, London 1993) and Martin (ed.), Remington's Pharmaceutical Sciences. Formulations may comprise microcapsules, such as hydroxymethyScelluiose or gelatin-microcapsules, liposomes, albumin microspheres, microemulsions, nanoparticles or nanocapsules.

A pharmaceutical composition may be formulated as inhaled formulations, including sprays, mists, or aerosols, For inhalation formulations, the compounds provided herein may be delivered via any inhalation methods known to those skilled in the art. Such inhalation methods and devices include, but are not limited to, metered dose inhalers with propellants such as CFC or HFA or propellants that are physiologically and environmentally acceptable. Other suitable devices are breath operated inhalers, multidose dry powder inhalers and aerosol nebulizers. Aerosol formulations for use in the subject method typically include propellants, surfactants and co-solvents and may be filled into conventional aerosol containers that are closed by a suitable metering valve.

Inhalant compositions may comprise liquid or powdered compositions containing the active ingredient that are suitable for nebulization and intrabronchial use, or aerosol compositions administered via an aerosol unit dispensing metered doses. Suitable liquid compositions comprise the active ingredient in an aqueous, pharmaceutically acceptable inhalant solvent, e.g., isotonic saline or bacteriostatic water. The solutions are administered by means of a pump or squeeze-actuated nebulized spray dispenser, or by any other conventional means for causing or enabling the requisite dosage amount of the liquid composition to be inhaled into the patient's lungs. Suitable formulations, wherein the carrier is a liquid, for administration, as for example, a nasal spray or as nasal drops, include aqueous or oily solutions of the active ingredient. Formulations or compositions suitable for nasal administration, wherein the carrier is a solid, include a coarse powder having a particle size, for example, in the range of 20 to 500 microns which is administered in the manner in which snuff is administered (i.e., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose). Suitable powder compositions include, by way of illustration, powdered preparations of the active ingredient thoroughly intermixed with lactose or other inert powders acceptable for intra bronchial administration. The powder compositions can be administered via an aerosol dispenser or encased in a breakable capsule which may be inserted by the patient into a device that punctures the capsule and blows the powder out in a steady stream suitable for inhalation.

Pharmaceutical compositions may be formulated as sustained release formulations (i.e., a formulation such as a capsule that effects a slow release of modulator following administration). Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Carriers for use within such formulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of modulator release. The amount of modulator contained within a sustained release formulation depends upon, for example, the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.

Though intravenous delivery of the polymeric fusion protein or expression vector of the present invention may be possible a non-intravenous route is preferred, particularly subcutaneous, intra-muscular, nasal, buccal, oral or pulmonary delivery. Intraperitoneal (i.p.) delivery may also be used.

The vaccine composition of the invention may further comprise an adjuvant, although it is envisaged that an adjuvant may not be necessary, or may be necessary only in a quantity that is lower than would be required if the antigen were provided by means other than in the polymeric antigen fusion protein, or that a less toxic adjuvant only may be required. Thus vaccine compositions which lack an adjuvant are also envisaged, as are those which contain only an adjuvant which is appropriate for human use, such as alum. Adjuvants are any substance whose admixture into the vaccine composition increases or otherwise modifies the immune response to an antigen. Adjuvants can include but are not limited to AiK{S0₄)_2l AINa(S0₄)₂, AINH(SO„)₄, silica, alum, AI(OH)₃, Ca3(P0₄)_2l kaolin, carbon, aluminum hydroxide, muramyl dipeptides, N-acetyl-muramyl-L-threonyl- D-isoglutamine (thr-DMP), N-acetyl-nornuramyl-L-alanyi-D-isoglutamine (CGP 1 1687, also referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-aianine-2~ (r2'-dipalmitoyl-s-n-glycero-3-hydroxphosphoryloxy)-ethylamine (CGP 19835A, also referred to as MTP-PE), RIBI (MPL+TDM+CWS) in a 2% squalene/Tween-80(R) emulsion, lipopolysaccharides and its various derivatives, including lipid A, Freund's Complete Adjuvant (FCA), Freund's Incomplete Adjuvants, Merck Adjuvant 65, polynucleotides (for example, poly !C and poly AU acids), wax D from Mycobacterium tuberculosis, substances found in Corynebacterium parvum, Bordetella pertussis, and members of the genus Brucella, liposomes or other lipid emulsions, Titermax, ISCOMS, Qui! A, ALUN (see U.S. Pat. Nos. 58,767 and 5,554,372), Lipid A derivatives, choleratoxin derivatives, HSP derivatives, LPS derivatives, synthetic peptide matrixes or GMDP, Interieukin 1 , Interleukin 2, Montanide ISA-51 and QS-21. Additional adjuvants or compounds that may be used to modify or stimulate the immune response include ligands for Toll-like receptors (TLRs). In mammals, TLRs are a family of receptors expressed on DCs that recognize and respond to molecular patterns associated with microbial pathogens. Several TLR ligands have been intensively investigated as vaccine adjuvants. Bacterial !ipopolysaccharide (LPS) is the TLR4 !igand and its detoxified variant mono-phosphoryl lipid A (MPL) is an approved adjuvant for use in humans. TLR5 is expressed on monocytes and DCs and responds to flagellin whereas TLR9 recognizes bacterial DNA containing CpG motifs. Oligonucleotides (OLGs) containing CpG motifs are potent ligands for, and agonists of, TLR9 and have been intensively investigated for their adjuvant properties. There are malaria antigens that also behave as TLR agonist that may be used as antigen in the polymeric antigen fusion protein of the invention. For example, the TLR9 iigand CpG promotes the acquisition of Plasmodium falciparum-specific memory B cells in malaria-naive individuals (Crompton PD, Mircetic M, Weiss G, Baughman A, Huang CY, Topham DJ, Treanor J J, Sanz I, Lee FE, Durbin AP, iura K, Narum DL, Ellis RD, Maikin E, Mullen GE, Miller LH, Martin LB, Pierce SK. J Immunol. 2009 Mar 1 ; 182(5):3318-26).

Other agents that stimulate the immune response can also be administered to the subject, typically by including them in the vaccine composition. For example, other cytokines are also useful in vaccination protocols as a result of their lymphocyte regulatory properties. Many other cytokines useful for such purposes are known, including interleukin-12 (IL- 2) that has been shown to enhance the protective effects of vaccines, GM-CSF and !L-18. Suitable vectors according to the third aspect of the invention which may be incorporated into a vaccine composition according to the fifth aspect of the invention include viral vectors (Draper SJ, Heeney JL. Viruses as vaccine vectors for infectious diseases and cancer. Nat Rev Microbiol. 2009 Dec 7. [Epub ahead of print].) Delivery of vectors by bacteria, such as probiotic bacteria, or other suitable organisms is also envisaged.

A vaccine composition according to the present invention may comprise more than one different adjuvant. Furthermore, the invention encompasses a therapeutic composition further comprising any adjuvant substance including any of the above or combinations thereof.

A seventh aspect of the invention provides the polymeric fusion protein, and in particular the polymeric antigen fusion protein or the polymeric therapeutic fusion protein, according to the first aspect of the invention; the expression vector according to the third aspect of the invention; or the vaccine composition according to the fifth aspect of the invention or the therapeutic composition according to the sixth aspect of the invention, for use in medicine. An eighth aspect of the invention provides the polymeric fusion protein, and in particular the polymeric antigen fusion protein, according to the first aspect of the invention; the expression vector according to the third aspect of the invention; or the vaccine composition according to the fifth aspect of the invention for use in vaccinating a subject. Typical subjects are mammalian, particularly human subjects.

A ninth aspect of the invention provides the polymeric fusion protein, and in particular the polymeric therapeutic fusion protein according to the first aspect of the invention; the expression vector according to the third aspect of the invention; or the therapeutic composition according to the sixth aspect of the invention for use in treating a subject. Typical subjects are mammalian, particularly human subjects.

Methods of treatment corresponding to the seventh, eighth and ninth aspects of the invention are also envisaged. It is contemplated that a number of different modes of administration of the polymeric antigen fusion proteins or expression vector encoding same may be used to immunize a recipient against an antigen. The injection of protein antigens typically is used to elicit immune responses in mammals.

Methods of delivering antigen to APCs by DNA injection are known. A commonly used technique is to inject DNA expression vectors, encoding an antigenic protein, into muscle. Reports suggest that the protein antigen is expressed by muscle cells but that the antigen is not presented to the immune system by these cells, instead, it is believed that specialized APCs, for example, macrophages and dendritic cells, migrate to the site of injection and internalise the antigen. One consequence of the DNA injection approach is that it can often result in the generation of both humoral and cellular responses.

Combinations of DNA immunization and protein immunization also can work synergisticaSly to first prime the immune system and then boost the level of response in the form of both antibody production and cytotoxic cellular responses.

Suitable animal tests may be used to develop an appropriate combination of antigen and other vaccine components, such as adjuvant. Testing in humans can be contemplated after efficacy is demonstrated in animal models. Any known methods for immunization, including formulation of a vaccine composition and selection of doses, route of administration and the schedule of administration (e.g. primary and one or more booster doses) can be used (e.g. see Vaccines; From concept to clinic, Paoletti and Mclnnes, eds, CRC Press, 1999).

The actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1 % of an active compound. In other embodiments, an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. In other non- limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microg ram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 miiligram/kg/body weight, about 100 miiligram/kg/body weight, about 200 mil!igram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.

It is contemplated that maximal immunization may be achieved by performing numerous separate immunizations, for example, one to three inoculations about 3 weeks to six months apart. Optimal modes of administration, dosages and booster regimes may be determined by routine experimentation well within the level of skill in the art.

Figures

Figure 1 - Schematic illustration of how a polymeric fusion protein according to the invention is made.

Figure 1 (a) shows how monomeric Fc-fusion proteins produce a polymeric structure. Figures 1 b and 1 c detail molecular models of monomeric and heptameric PflvlSP 1 i9- hlgG1 - Fc-TP-LH 309/31 0CL. Figure 2: Behaviour of polymeric Fc~fusion- SP1-19 protein in size exclusion chromatography

Purification and characterization of PfMSP1₁₉-hlgG1 -Fc-TP-LH309/310CL expressed in CHO-K1 cells, (a) Sandwich ELISA with poiyclonal anti-human IgG-Fc or mAb 12.10 to capture and an HRP-conjugated anti-human IgG-Fc mAb to detect high secreting CHO- K1 clones. Red bars are negative control supernatants and green bars positive control dilutions of human lgG1 . (b) Size-exclusion chromatography (SEC) analysis on Superdex-200 10/300GL column showing P/MSPl ₁₉-hlgG1 -Fc-TP~LH309/310CL (left panel) or the hlgG1 -Fc-TP-LH309/310CL empty cassette devoid of Ag (right panel), running with approximate molecular weights of 630 (H2) and 364 (H1 ) kDa respectively (representing heptamers) and with molecular weights of 160 (D2) and 104 (D1 ) kDa representing dimers (red trace). Eiution profiles of molecular weight standards are indicated by the black trace, (c) of higG1 (lane 1 ), Pflv1SP1₁₉-hlgG1 ~Fc-TP- LH309/310CL (lane 2) or hlgG1-Fc-TP-LH309/31 OCL (lane 3) were run on 6% Tris- g!ycine gels, transferred to nitrocellulose, and detected with an anti-human igG conjugated to HRP. Corresponding bands on the SEC are arrowed. .

Figure 3: Antibody titres following immunisation

Malaria antigen (PfMSP1 -19)-specific IgG antibody titres in mice immunised with PfMSP1 19-hlgG1 Fc fusion (Groups 1 and 2) or with h!gG1 Fc fusion control (Groups 3 and 4). Groups 1 and 3 are mice transgenic for human FcyRI (CD64) and groups 2 and 4 are wild type mice. Antibody levels were determined by ELISA for different dilutions of mouse plasma, namely 1 :100, 1 :1000 and 1 :10000.

Figure 4: A summary of Fc-fusion proteins generated

The table details a number of Fc-fusion protein produced by the method described herein and the results of immunisation studies using those proteins.

Figure 5: Plasmodium falciparum SP1₁₉-specific !gGl antibody titres induced by immunization with heptameric or dimeric PfiVISP1 ₉-hlgG1-Fc-TP»LH309/310CL.

(a) Each group represents 2 mice immunized with 3 doses of 10

at fortnightly intervals in the absence of adjuvant. Experiments were undertaken in human CD64 transgenic Balb/c mice or their wildtype (WT) control littermates. (b) A repeat experiment using 4 animals per group and a total dose of 75

of either hepiamer or dimer in a 1 :1 volume with Alum or PBS, in the human CD64 transgenic Balb/c mice. Each point represents the mean optical density (+/-SD) of duplicate wells for each mouse within a given group.

Figure 6; Illustrates the PAV1SP1 19-specific Ab responses.

The monomers also induced high titres of Ag-specific igG1 when injected into mice. Similar Ag-specific titres were obtained if PMSPI^ was fused to human lgG1-Fc or mouse lgG2a-Fc in immunizations of either wildtype or human FcyRI transgenic animals P/MSP1 _ig-specific Ab responses. Mice were immunized with (a) PflvlSP1₁₉-mlgG2a-Fc- TP (open symbols) or mlgG2a-Fc-TP (closed symbols) (b) P/MSP1_1B-hlgG1-Fc-TP (group 1 CD64 Tg & group 2 WT Balb/c) or hlgG1-Fc-TP (groups 3 CD64 Tg and group 4 WT Balb/c). Each point represents mean optical densities (+/-SD) from duplicate wells of sera from individual animals.

Figure 7; Dose response curves and effects of Alum.

illustrates dose response curves and effects of Alum co-administration on Ag- specific Ab-titres generated by immunization with P/MSP1 i9-mlgG2a-Fc in the presence (open symbols) or absence (closed symbols) of Alum, (a) Pre- and (b) Post- chalienge total IgG responses are shown. Each point represents mean optical densities (+/ - SD) of pooled serum from 4 animals per group.

Figure 8: Cercarial elastase (CE)-specific Ab titres.

Baib/c mice were immunized with x3 25 ug doses of CE-mlgG2a-Fc or with a recombinant histidme tagged CE (CE-His) per animal. Each curve represents best-fit lines through mean optical densities obtained from duplicate wells at each dilution of sera. Each curve represents the mean of 5 animals per group.

Figure 9:

Figure 9 demonstrates that mice immunized with an IgM-Fc -fusion to PfMSP119 (30microgram total dose) can be protected from challenge with Plasmodium berghei malaria. Two out of 6 animals had undetectable parasites and four remaining animals had significantly delayed parasitemias.

Figure 10: Sialic acid content of polymeric fusion proteins

Approximateiy

of various proteins were run on 4-12% Bis-Tris gels, and either stained with coomassie blue (A) or transferred onto a PVDF membrane and detected with biotinylated Sambucus nigra bark lectin and streptavidin HRP (B). Reduced protein samples utilised in both A) and B): 1) Plasmodium Yoelii MSP119-GST, 2) the human lgG1 antibody G1/C1, 3) IgG enriched serum from malaria exposed Malawians, 4) PfMSP119-lgMFc, 5) PfMSP1-mlgG2aFc, 6) heptameric fraction of PfMSPI 19-hlgG1Fc- TP-LH309/310CL, 7) dimeric fraction of PfMSP1 19-hlgGl Fc-TP~LH309/310CL, 8) PfMSPI 19-higG1 Fc-TP. Markers are SeeBlue2 pre -stained molecular weight markers.

Example 1 : DNA constructs for human lgG1 Fc - antigen fusion proteins and control monomeric units

A commercially available pFUSE-hlgG1 -Fc2 vector was obtained from InvivoGen, sourced via Autogen Bioclear, Wiltshire, UK. This is an expression vector for fusion proteins comprising an upstream polypeptide and a downstream Fc portion from human IgGl The expression vector allows one to clone in an insert of a DNA sequence coding for an upstream polypeptide. The vector also has a coding sequence for a signal sequence from IL2, upstream of the cloning site for the insert. Fc-fusion constructs were generated containing the P. falciparum antigen Pf SP _g. The codon-optimized MSP1₁₉ coding sequence was sub-cloned as an EcoRUBglU fragment into pFUSE-hlgGl -Fc2. This generated the vector pFUSE-PfMSP1 -19-hlgG1- Fc, which encodes control monomeric units which do not assemble into polymers. To generate a polymeric antigen fusion protein, two changes to the coding sequence of the human lgG1 Fc-portion were made. The 18 amino-acid tailpiece from IgM was sub- cioned onto the C-terminus of the Fc portion, and an additional mutation in the Ομ3 domain to convert residues 309 and 310 (EU numbering throughout) to cysteine and leucine respectively.

In order to insert the IgM tailpiece sequence into the commercially available vector, primers were designed which would, when annealed together, form a double stranded sequence with overhanging bases encoding a Nhe1 restriction site to allow subcioning C-terminal to the Fc. In order to maintain the reading frame of the protein encoded by the plasmid, remove an existing stop codon, and allow for convenient restriction sites, an extra DNA base was inserted. The IgM tailpiece sequence is preceded by a short 5' linker which encodes for four amino acids Leu-Val-Leu-Gly; the linker does not affect the function of the IgM tailpiece. The following primers were designed 1 : 5'-CTAGGACCCCCCCTGTACAACGTGTCCCTGGTCATGTCCGACACAGCTGGC- ACCTGCTACTGAG-3'

2: 5'-CTAGCTCAGTAGCAGGTGCCAGCTGTGTCGGACATGACCAGGGACACGTT- GTACAGGGGGGGTC-3'

Primers 1 and 2 were annealed together via a temperature gradient to form the double stranded IgM-tailpiece containing Nhe1 insert. GTAGGACCCCCCCTGTACAACGTGTCCCTGGTCATGTCCGACACAGCTGGCACCTGCTACTGAG

CTGGGGGGGACATGTTGCACAGGGACCAGTACAGGCTGTGTCGACCGTGGACGATGACTCGATC

The pFUSE vector was then digested with the restriction enzyme Nhel, and the IgM tailpiece insert above ligated to create an intermediary plasmid. In order to allow the IgM tailpiece to be translated after the Fc region, the stop codon present was mutated in a subsequent step, via site directed mutagenesis, utilising the Quick Change !l Kit (Stratagene, La Jolla, CA, USA). Primers 3 and 4 were designed to remove this stop codon and create an Avrll restriction enzyme site between the Fc region and the IgM tailpiece.

3: CTGTCTCCGGGTAAATTAGTCCTAGGACCCCCCCTG

4: CAGGGGGGGTCCTAGGACTAATTTACCCGGAGACAG This created the plasmid termed pFUSE-h!gG 1-Fc-TP. When transfected into mammalian cells this construct did not induce polymerization; therefore we made additional changes to mimic IgM by mutating the cysteine at position 309, involved in forming a disulphide bridge between two monomers of IgM within the pentamer. In order to better mimic the protein sequence of human IgM, primers 5 & 6 were designed to introduce a cysteine residue at position 309, again by site-directed mutagenesis, as before. Upon alignment of the nucleotide sequence encoding the protein sequence of human IgM with that of human lgG1 -Fc, it was decided to, in addition, replace the neighbouring histidine residue at position 310 with a neutrai leucine residue. The final plasmid incorporating both mutations and the PfMSP1 -19 Ag was named pFUSE-PfMSP1 -19-h!gG1 -Fc-TP-LH309/310CL Primer 5: 5'-GTGGTCAGCGTCCTCACCGTCTGCCTCCAGGACTGGCTGAATGGCAAG-3'

Primer 6: 5'-CTTGCCATTCAGCCAGTCCTGGAGGCAGACGGTGAGGACGCTGACCAC-3'

The nucleic acid coding sequence for the control monomeric units was as foilows: atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt caegaattcc 60 aacattgccc aacaccaatg cgt aagaag caatgtccac aaaactccgg atgtttcaga 120 catctggacg agagagaaga atgtaagtgt ctgttgaac acaagcagga aggtgataag 180 tgtg tgaga acccaaaccc tacctgtaac gagaacaacg gtggatgcga cgctgacgct 240 aagtgcaccg aagaagactc tggttctaac ggaaagaaga 'tacttgcga atgtactaag 300 ccagactctt accctttgtt cgatggaatc ttctgttctt cctctaacag atctgacaaa 360 actcacacat gcccaccgtg cccagcacct gaactcctgg gcjggaccgtc agtct tcctc 420 ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg 480 gtggtggacg tgagccacga agaccctgag gtcaagttca ac ggtacgt ggacggcgtg 540 gagcjtgcata atgccaagac aaagccgcgg gaggageagt acaacagcac gtaccgtgtg 600 g cagcgtcc tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag 660 g ctccaaca aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag 720 ccccgagaac cacaggtgta caccctgccc cca cccggg aggagatgac caagaaccag 780 gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag 840 agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 900 tccttcttcc tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtic 960 ttctcatgct ccgtgatgca cgaggctctg cacaaccact acacgcagaa gagcctctcc 1020 ctgtctccgg gtaaatga 1038

The above coding sequence has the following regions:

1 -60 coding sequence for IL2 signai peptide

61 -354 coding sequence for PfMSPI -19 antigen

335555--11003388 ccooddiinngg sseeqquueennccee ffoorr FFcc--rreeggiioonn ooff hhuummaann llggGG11 ((iinncciiuuddiinngg ssttoopp ccoodon)

The amino acid sequence of the control monomehc units was as follows:

Met Tyr Arg Met Gin Leu Leu Ser Cys lie Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser Asn lie Ala Gin His Gin Cys Val Lys Lys Gin Cys

20 25 ^' 30

Pro Gin Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu Glu Cys

35 40 45^'

Lys Cys Leu Leu Asn Tyr Lys Gin Glu Gly Asp Lys Cys Val Glu Asn

50 55 60

Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala Asp Ala

65 70 75 80

Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys lie Thr Cys

85 90 95

Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly lie Phe Cys

100 105 110 Ser Ser Ser Asn Arg Ser Asp Lys hr His Thr Cys Pro Pro Cys Pro

115 120 125

Ala Pro Glu Leu Leu G.l.y Gly Pro Ser Va.l Phe Leu Phe Pro Pro Lys

130 ^' 135 140

P o Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr Cys Val.

145 150 155 160

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

165 170 175

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

180 185 190

Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His

195 200 205

Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys

210 215 220

Ala Leu Pro Ala Pro lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin

225 230 235 ^' 240

Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met

245 250 ^" 255

Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

260 265 270

Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn

275 280 285

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu

290 295 300

Tyr Ser Lys Leu Thr Va.l Asp Lys Ser Arg Trp Gin Gin Gly Asn Val

305 310 315 320

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin

325 330 335

Lys Ser Leu Ser Leu Ser Pro Gly Lys

340 345

The above amino acid sequence has the following regions:

1 -20 IL2 signal peptide

21 -1 18 Pf SP1-19 antigen

1 19-345 Fc-region of human lgG1

During expression, the !L2 signal peptide is cleaved off and so the final protein product has 325 amino acids. The nucleic acid coding sequence for the monomeric units which assemble into polymers was as follows: atgtacagga tgcaactcct gtct.tgcar.t gcactaagtc t'cgcacttgt cacgaattcc 60 aacat gccc aacaccaatg cg taagaag caatgtccac aaaactccgg atgtttcaga 120 catctggacg agagagaaga atgtaagtgt ctgt tgaact acaagcagga aggtgataag 180 tgtgttgaga acccaaaccc tacctg aac gagaacaacg gtggatgcga cgctgacgct 240 aagtgcaccg aagaagactc tggttctaac ggaaagaaga ttactUgcga atgfcactaag 300 ccagactctt accctttgtt cgatggaatc ttctgttctt cctctaacag atctgacaaa 360 actcacacat gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtettcctc 420 t ccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgcg 480 gtggtggacg tgagccacga agaccctgag gtcaagttca actggtacgt ggacggcg g 540 gaggtgcata atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg 600 gtcagcgtcc tcaccgtcCg cctccaggac tggctgaatg gcaaggagta caagtgcaag 660 gtctccaaca aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag 720 ccccgagaac cacaggtgta caccctgccc ccatcccggg aggagatgac caagaaccag 780 gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag 840 agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 900 tcct.tcttcc tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc 960 ttctcatgct ccgtgatgca cgaggctctg cacaaccact acacgcagaa gagcctctcc 1020 ctgtctccgg gtaaattagt cctaggaccc cccctgtaca acgtgtccct ggtcatgtcc 1080 gacacagctg gcacctgcta ctga 1104

The above coding sequence has the following regions:

1 -60 coding sequence for IL2 signal peptide

61 -354 coding sequence for PfMSPI -19 antigen

355-1047 coding sequence for Fc-region of human lgG1

619-624 cys-309 and lys-310 mutations

048-1104 coding seqeunce for fgM tai!piece (including stop codon)

TThhee aammiinnoo aacciidd sseeqquueennccee ooff tthhee mmoonnoommeerriicc uunniittss wwhhiicchh aasssseemmbbllee iinnttoo ppoollyymmers was as follows:

Met yr Arg Met Gin Leu Leu Ser Cys He Ala Leu Ser Leu Ala Leu

1. ^{' "} 5 10 15

Val Thr Asn Ser Asn He Ala Gin His Gin Cys Val Lys Lys Gin Cys

20 25 30

Pro Gin Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu Glu Cys

35 40 45

Lys Cys Leu Leu Asn Tyr Lys Gin Glu Gly Asp Lys Cys Val Glu Asn

50 55 60

Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala Asp Ala

65 70 75 80

Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys He Thr Cys

85 90 95 Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp G.l.y lie Phe Cys 100 105 110

Ser Ser Ser Asn Arg Ser Asp Lys Thr His Thr Cys Pro Pro Cys Pro

115 120 125

Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 130 135 140

Pro Lys Asp Thr Leu Met He Ser Arg Thr Pro Glu Val Thr Cys Val 145 ^' 150 155 160

Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

165 170 175

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu

180 185 190

Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Cys Leu

195 200 205

Gin Asp Trp Leu Asn G.ly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 210 ^{' "} 215 ^' 220

Ala Leu Pro Ala Pro He Glu Lys Thr lie Ser Lys Ala Lys Gly Gin 225 230 235 240

Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met

245 250 255

Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro

260 265 270

Ser Asp He Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn

275 280 285

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 290 295 300

Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val 305 310 315 320

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin

325 330 335

Lys Ser Leu Ser Leu Ser Pro Gly Lys Leu Val Leu Gly Pro Pro Leu

340 345 350

Tyr Asn Val Ser Leu Val Met Ser Asp Thr Ala Gly Thr Cys Tyr

355 360 365

The above amino acid sequence has the following regions:

1 -20 I L2 signal peptide

21 -1 18 PfMSPI -19 antigen

1 19-345 Fc-region of human lgG1

205-206 cys-309 and Sys-310 mutations 346-349 Four amino acid linker

350-367 Ig tailpiece

During expression, the IL2 signal peptide is cleaved off and so the final protein product has 347 amino acids.

Example 2: Protein production of polymeric antigen fusion proteins and control monomeric units Mammalian Chinese hamster ovary (CHO-K1 ) cell lines at 60-80% confluence on petri- dishes were transfected with 8 g of plasmid DNA coding for either the monomeric or polymeric antigen fusion proteins utilizing the FuGene6 transfection solution (Roche) in DMEM culture medium. After 24 h, the solution was replaced with DMEM containing 400 mg/ml Zeocin antibiotic for selection of monomer or polymer transfected cells. Medium was replaced as needed until colonies formed (2-3 weeks). Colonies were transferred to 48 welt plates and allowed to grow to confluence.

Cell lines secreting monomer or polymer were determined by sandwich ELISAs. Briefly, monoclonal Abs directed to PfMSP1 -19, as described in Mcintosh et ai 2007 (The importance of human FcgRI in mediating protection to malaria. PLoS Pathogens may 18;3(5):e72) were coated onto the bottom of ELISA plates and plates blocked overnight with PBS/Tween/milk. After washing, plates were incubated with 100 μί of cloned culture supernatant to allow fusion proteins to bind. After further washing, the monomer or polymer was detected with another enzyme-labelled (Horse-radish peroxidase) monoclonal antibody specific for human IgG-Fc. Individual high secreting positive clones were grown up in 1 -2 litre cultures for enrichment of polymers or monomers.

Monomers or polymers were purified from this culture supernatant by affinity chromatography on Protein-G HiTrap (GE healthcare) columns used commonly by the Biotech sector. Proteins were elu ed from these columns by low pH into neutral HBSS buffer followed by dialysis against PBS ready for functional analyses.

1 -2 mg monomer from 2 litres of culture supernatant were commonly obtained with the monomeric Fc-fusion~MSP1 -19, and similar concentrations of protein obtained with the equivalent polymer, to date. Purity of proteins was assessed by SDS-PAGE gel analysis and western blotting with Fc-specific or PfMSP1 -19 antigen specific reagents prior to functional assays. Native molecular weights were determined by size-exclusion chromatography on Sephadex-200 columns on an AKTA FPLC (Amersham). Figure 2 shows the appearance of the polymeric Fc-fusion-MSP1 -19 protein in size exclusion chromatography. The majority runs as a large molecular weight complex of approximately 650 kDa as would be expected for a hep amer of the monomer units. A proportion of the polymer also appears as a dimer.

Example 3: immunisation experiments

Monomeric Fc-fusions (with and without malarial antigen) or polymeric Fc-fusions {with and without malarial antigen) will be injected subcutaneously on 3 occasions into human Fcy-receptor transgenic mice (e.g. CD64 transgenic) or non-transgenic littermates on days -42, -28 and -14. On each occasion animals will be inoculated with 10 pg of protein in the presence or absence of conventional adjuvants e.g. Alum. A preferred antigen is MSP1-19.

On day -1 animals will be bled for determining pre-chal!enge levels of antibodies specific for the malarial antigen. On day 0 animals will be challenged with 5,000 infected erythrocytes (from P. berghei transgenic for MSP1 -19 from P. falciparum) and the development of fulminant parasitemias monitored by microscopy on Geimsa reagent stained blood smears on microscope slides on a daily basis. Other experiments may use adifferent rodent malaria, P. yoelii. Differences between groups will be analyzed over replicate experiments using appropriate statistical tests e.g. the Mann-Whitney test. A p value <0.01 will be considered significant. Animals must be terminated by a schedule 1 method when their body weights drop to below 20% of original or show significant illness.

Outcomes can be measured as delay in onset of parasitemia, or prevention of death, or reduction in pathology e.g. weight; and also by half life to 50% mortality. Also we can monitor for the production of antigen specific antibodies.

As compared to animals immunized with monomeric antigen fusion proteins, animals immunized with polymeric antigen fusion proteins are expected to a) show a significant delay in the development of parasitemias or be fully protected (i.e. No parasites detectable); b) survive longer or be fully protected; c) develop higher titres of antigen- specific antibodies assayed by ELISA from the pre-challenge bleed or from the terminal bleed. Fusion proteins without antigens act as negative controls. An experiment has already been conducted to test PfMSPI 19-hlgG1 Fc fusion monomer in an active immunisation experiment in human CD64 transgenic (Tg) and non-Tg mice. CD64 transgenic mice express the human FcyRI receptor that binds to human lgG1 (Heijnen IA, van Vugt MJ, Fanger NA, Graziano RF, de Wit TP, Hofhuis FM, Guyre PM, Capel PJ, Verbeek JS, van de Winkel JG. J Clin Invest. 1996 Jan 15;97(2):331-8.)

Animals used: 4 animals per group, 4 groups, 16 animals in total.

Group 1 PfMSPI 19-hlgG1 Fc fusion

4 x CD64 Tg

Group 2 PfMSPI 19-hlgG1 Fc fusion

4 x wildtype non-Tg

Group 3 h!gG1 Fc fusion control

4 x CD64 Tg

Group 4 hlgG1 Fc fusion control

4 x wildtype non-Tg

Experimental animals (CD64 Tg and wildtype non-Tg littermates) were immunised three times subcutaneously with a dose of 10 pg fusion protein in 200 pL filter sterilised PBS at two weekly intervals. Two weeks after the last immunisation (day 0), each group was tail bled to allow in vitro assessment of antibody responses. Animals were infected with parasites (10 x 10³ parasitized red blood cells in 200 pi saline intra peritoneally) on day + 1 .

Weigh all animals, immunise all animals

with Fc fusion (10 ^ig of fusion in 200 pi PBS by s.c. injection).

Weigh all animals. Immunise all animals

with Fc fusion (10 ^ig of fusion in 200 μΙ PBS by s.c. injection).

Weigh all animals. Immunise all animals

with Fc fusion (10 ^ig of fusion in 200 μΙ PBS by s.c. injection).

Weigh all animals. Tail bleed all animals aiming for 30 μΙ blood per sam for determining pre-challenge antibody titres.

Infect all animals with parasites and follow course of parasitemia.

10 x 10³ parasitised red blood cells in 200 μΙ PBS by i,p, injection).

Weigh and prepare blood smears from ail parasite-infected animals. Day X (as determined by parasitemias). Schedule 1 (kill) and bleed all animals.

Antigen-specific IgG antibody titres were determined for all animals at day 0. Typical results are shown in Figure 3. Higher titres were obtained in Groups 1 and 2 animals that received the MSP1 -19-Fc-fusion than in animals receiving the control Fc-fusion (groups 3 and 4), Higher titres were also obtained in Group 1 compared to Group 2. It is likely that this is because the human CD64 is the natural receptor for the human lgG1 -Fc portions of the fusion proteins. Groups 3 and 4 animals had no antigen-specific antibodies, as expected. Although no animals were protected from parasitemia, there were often correlations with parasite antigen specific titres and overall animal wellbeing after infection with malaria. Subsequent experiments have shown that including alum as adjuvant in the immunisations with the monomeric Fc fusion protein does not increase antibody titres above those observed when immunising with the monomeric Fc fusion protein alone.

The table in Figure 4 further demonstrates the immunogenicity of polymeric antigen fusion proteins according to the invention, in particular dimeric and heptameric polymers of a fusion of PfMSPI and hlgGL Higher titres of Ag-specific lgG1 were induced when a dimeric form was injected into mice compared with a heptameric form (Figures 4 and 5). Similar Ag-specific titres were obtained if PfMSP1 19 was fused to human lgG1 -Fc or mouse JgG2a-Fc in immunizations with monomers of either wildtype or human FcRI transgenic animals (Figure 6). The fusions were also demonstrated to be self- adjuvantizing since no dramatic improvement in Ab titres was obtained when Fc-fusions were co- administered with clinically relevant adjuvants e.g. Alum (Figure 7), and this effect was maintained even post challenge with parasites.

Similar titres were observed with a monomeric mlgG2a fusion to cercarial elastase (CE) from Schistosoma mansoni, another non- immunogenic Ag fitting Waksman's postulate, and to which investigators have consistently failed to produce specific Ab against (Figure 8). Interestingly, these fusions failed to generate an IgE response, suggesting that the mouse lgG2a-Fc was preventing an Ag specific IgE response. This may be a useful property where the desired result is inhibition of potentially dangerous antibody subclasses e.g. IgE that is responsible for anaphylaxis and atopic responses. All the target Ags examined herein on a monomeric Fc backbone drove a predominantly mouse igG1 response despite having markedly different structures. To ascertain if a heptamehc conformation could be accomodated by the human lgG1 -Fc backbone when fused to Ag, PfMSP1 19- hlgG1 -LH309/310CL-TP was modelled onto a recently determined structure of polymeric human lgM13 (Figure 1 b,c). This analysis revealed that the most energy favorable structure adopted by these heptamers would be a barrel shape as depicted in Figure 1 b, and not a star shape as with pentameric IgM. Only a barrel-like structure would allow for binding to crucia! Fc-receptors and protein G used for their purification. The model clearly demonstrates that there may be width limits to the Ag used for incorporation into RICs to form heptamers without the Fc's clashing. For example in vaccine applications it may be more useful to tag multiple Ags to the Fc, and in these instances it may be more approriate to attach multiple peptides to the Fc instead of the whole Ag. Importantly, the model ailowed it to be confirmed that both the protein-G, TRIM- 21 , FcRn, C1 q and FcR binding sites used to either purify the heptamer or allow binding to potent effector molecules are not occluded in the heptamer. Example 4: DNA construct for human IgM Fc - antigen fusion proteins

The hlgG1 -Fc2 portion of the pFUSE-hlgG1 -Fc2 vector was replaced with a coding sequence for human IgM Fc, and the pfMSP1₁₉ antigen. The vector so constructed is called pFUSE-lgM-Fc-pfMSP1₁₉.

The nucleic acid coding sequence for the pfMSP1 i₉ IgM-Fc fusion protein was is beiow: atgtacagga tgcaac cct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcc 60 aacattgccc aacaccaatg cgttaagaag caatgtccac aaaactccgg atgtttcaga 120 catctggacg agagagaaga atgtaag gt ctgttgaact acaagcagga aggtgataag 180 tgtgt gaga acccaaaccc tacctgtaac gagaacaacg gtggatgcga cgctgacgct 240 aagtgcaccg aagaagactc tggt ctaac ggaaagaaga ttacttgcga atgtactaag 300 ccagactctt accctttgtt cgatggaatc ttctgttctt cctctaacag atctattgcc 360 gagctgcctc ccaaag gag cgtcttcgtc ccaccccgcg acggc ctt cggcaacccc 420 cgcaagtcca agctcatctg ccaggccacg ggtt cagtc cccggcagat tcaggtgtcc 480 tggctgcgcg aggggaagca ggtggggtct ggcgtcacca cggaccagg gcaggctgag 540 gccaaagagt ctgggcccac gacctacaag gtgaccagca cactgaccat caaagagagc 600 gactggctcg gccagagcat gttcacctgc cgcgtggatc acaggggcct gaccttccag 660 cagaatgcgt cctccatgtg tgtccccggt gagtgacctg tccctcaggg gcagcaccca 720 ccgacacaca ggggtccact: cgggtctcga ttcgccaccc cggatgcagc catctaclicc 780 ctgagcctcg gcttcccaga gcggccaagg gcaggggctc gggcggcagg acccctgggc 840 tcggcagagg cagttgctac tctttgggtg ggaaccatgc ctccgcccac atccacacct 900 gccccacctc tgactccctt ctcttgactc cagatcaaga cacagccatc cgggtcttcg 960 ccatcccccc atcctttgcc agcatcttcc tcaccaagtc caccaagttg acctgcctgg 1020 tcacagacct gaccaccta gacagcgtga ccatctcctg gacccgccag aatggcgaag 1080 c gtgaaaac ccacaccaac atciiccgaga gccaccccaa tgccactttc agcgccgtgg 1140 gtgaggccag catctgcgag gatgactgga attccgggga gaggttcacg tgcaccgtga 1200 cccacacaga cctgccctcg ccactgaagc agaccatctc ccggcccaag ggtaggcccc 1260 actcttgccc ctcttcctgc actccctggg acctcccttg gcctctgggg catggtggaa 1320 agcacccctc actcccccgt tgtctgggca actggggaaa aggggactca accccagccc 1380 acaggctgtc cccccactgc cccgccc'cca ccaccatctc tgttcacagg ggtggccctg 1440 cacaggcccg atgtctactt gctgccacca gcccgggagc agctgaacct gcgggagtcg 1500 gccaccatca cgtgcc ggt: gacgggcttc tctcccgcgg acgtcttcgt gcagtggatg 1560 cagagggggc agcccttgtc cccggagaag tatgtgacca gcgccccaat gcctgagccc 1620 caggccccag gccggtactt cgcccacagc atcctgaccg tgtccgaaqa ggaatggaac 1.680 acgggggaga cctacacctg cgtggcccat: gaggccctgc ccaacagggt caccgagagg 1740 accgtggaca agtccaccgcj taaacccacc c gtacaacg tgtccctggt catgtccgac 1800 acagctggca cctgctactg a 1821

The above coding sequence has the following regions: 1 -60 coding sequence for IL2 signal peptide

61-354 coding sequence for PfMSP1 ~19 antigen

355-1821 coding sequence for Fc-region of human IgM (Cp2, Cp3 and Cp4 domains) and tailpiece (including stop codon)

687-935 intron

1253-1431 intron

IgM-Fc exons code for 1038 bp coding for a mature protein of 346 amino acids. PfMSP1 -19-lgM-Fc codes for 1326 bp coding for 442 amino acids in total in the mature protein.

The amino acid sequence of the control monomeric units was as follows:

Met Tyr Arg Met Gin Leu Leu Ser Cys He Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser Asn He Ala Gin His Gin Cys Val Lys Lys Gin Cys

20 25 30

Pro Gin Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu Glu Cys

35 40 45

Lys Cys Leu Leu Asn Tyr Lys Gin Glu Gly Asp Lys Cys Val Glu Asn

50 55 60

Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala Asp Ala

65 70 75 80

Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys He Thr Cys

85 90 95

Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly He Phe Cys

100 105 110

Ser Ser Ser Asn Arg Ser He Ala Glu Leu Pro Pro Lys Val Ser Val

115 120 1.25

Phe Val Pro Pro Arg Asp Gly Phe Phe Gly Asn Pro Arg Lys Ser Lys

130 135 140

Leu He Cys Gin Ala Thr Gly Phe Ser Pro Arg Gin He Gin Val Ser

145 150 155 160 Trp Leu Arg Glu Gly Lys Gin Val Gly Ser Gly Val Thr Asp Gl

165 170 175

Val Gin Ala Glu Ala Lys Glu Ser Gly Pro Thr Thr Lys Val Th

180 185 190

Ser Thr Leu Thr Glu Ser Asp Trp Leu Gly Gin Ser Met Phe

195 200 205

Thr Cys Arg Val Asp His Arg Gly Leu Thr Phe Gin Gin Asn Ala Ser

210 215 220

Ser Met Cys Val Pro Gin Asp Thr Ala lie Arg Val Phe Ala lie Pro

225 230 235 240

Pro Ser Phe Ala Ser lie Phe Leu Thr Lys Ser Thr Lys Leu Thr Cys

245 250 255

Leu Val Thr Asp Leu Thr Thr Tyr Asp Ser Val Thr He Ser Trp Thr

260 265 270

Arg Gin Asn Gly Glu Ala Val Lys Thr His Thr Asn He Ser Glu Ser

275 280 285

His Pro Asn Ala Thr Phe Ser Ala Val Gly Glu Ala Ser He Cys Glu

290 295 300

Asp Asp Trp Asn Ser Gly Glu Arg Phe Thr Cys Thr Val Thr His Thr

305 310 315 320

Asp Leu Pro Ser Pro Leu Lys Gin Thr He Ser Arg Pro Lys Gly Val

325 330 335

Ala Leu His Arg Pro Asp Val Tyr Leu Leu Pro Pro Ala Arg Glu Gin

340 345 350

Leu Asn Leu Arg Glu Ser Ala Thr He Thr Cys Leu Val Thr Gly Phe

355 360 365

Ser Pro Ala Asp Val Phe Val Gin Trp Met Gin Arg Gly Gin Pro Leu

370 375 380

Ser Pro Glu Lys Tyr Val Thr Ser Ala Pro Met Pro Glu Pro Gin Ala

385 390 395 ^00

Pro Gly Arg Tyr Phe Ala His Ser He Leu Thr Val Ser Glu Glu Glu

405 410 415

Trp Asn Thr Gly Glu Thr Tyr Thr Cys Val Ala His Glu Ala Leu Pro

420 425 430

Asn Arg Val Thr Glu Arg Thr Val Asp Lys Ser Thr Gly Lys Pro Thr

435 440 445

Leu Tyr Asn Val Ser Leu Val Met Ser Asp Thr Ala Gly Thr Cys Tyr

450 455 460

The PfMSP1 -19-lgM-Fc protein was prepared essentially as described in Example 2 and tested in an animal experiment essentially as described in Example 3. As can be seen in Figure 9a when the Pf SP1 -19-lgM-Fc protein was administered to mice two from six animals were protected from challenge infection and the onset of parasitemia was significantly delayed in the remaining four animals. These animals also lost significantly less in body weight indicative of protection than animals receieving control reagents (Figure 9b). Because receptors for IgM are found on different subsets of immune cells to many of the FcyRs, e.g. the

are uniquely expressed by adaptive immune ceils, including B, T (CD4+ and CD8+) and NK cells (Kubagawa et al, J. Exp. Med. 2009), this result is interpreted as indicating that fusion proteins that deliver antigens to adaptive immune APCs, e.g. B cells and T cells, may make better vaccines than those based on the Fc of IgG that deliver antigen to monocyte/macrophage type DCs.

Example 5: Sialic acid

To investigate if the invention affects the ability of the Fc to be sialated, the carbohydrate composition of both dimers and heptamers was examined by lectin blotting. Samples were reduced utilising NuPAGE sample recuing agent (Invitrogen: NP004) and were heated at 80°C for 10 minutes before being loaded onto SDS-PAGE 4-12% Bis-Tris Novex gels (Invitrogen: EC6035BOX). The gel contents were then transferred onto PVDF membranes utilising the Novex sure-lock mini cell transfer system (Invitrogen: EI0002) following the manufactures instructions. The PVDF membrane was firstly blocked in a 1 % solution of western block reagent (Roche: 1 1921673001 ) overnight at 4°C before being incubated with a 1/200 dilution of biotinylated Sambucus nigra bark lectin (Vector Laboratories: B-1305) for 2 hours at RT. The membrane was then washed 5 times in PBS before being incubated with a 1 /500 dilution of streptavidin HRP (Serotech: Star5b) for a further 2 hours at RT. The membrane was then developed for HRP. As can be seen from Figure 10, both the dimer (lane 6) and heptamer (lane 8) are sialated when compared with other antibodies and monomeric Fc-fusion proteins implying that these reagents may be able to engage inhibitory receptors such as CD22, SignRI or other siglecs.

Claims

1 A polymeric fusion protein comprising two or more polypeptide monomer units; wherein each polypeptide monomer unit comprises: an Fc receptor binding portion comprising two immunoglobulin heavy chain constant regions which are covalentiy linked to each other by at least one disulphide bond; and a tailpiece region fused C-termina! to each of the two immunoglobulin heavy chain constant regions; wherein the tailpiece region of each polypeptide monomer unit causes the monomer units to assemble into a polymer; and wherein at least one of the polypeptide monomer units is covalentiy linked to at least one functional factor,

2. The polymeric fusion protein of Claim 1 wherein each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence of a IgG, IgM, or igA heavy chain constant region; or variant thereof.

3. The polymeric fusion protein of Claim 1 or 2 wherein each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence of a mammalian heavy chain constant region, preferably a human heavy chain constant region; or variant thereof.

4. The polymeric fusion protein of any preceding claim wherein each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence of a IgG heavy chain constant region, preferably a human IgG, preferably human lgG1 .

5. The polymeric fusion protein of any preceding claim wherein each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence that is modified compared to the amino acid sequence of a native heavy chain constant region, to increase the tendency of the monomer units to assemble into a polymer,

6. The polymeric fusion protein of Claim 5 wherein each of the immunoglobulin heavy chain constant regions is an IgG heavy chain constant region comprising an amino acid sequence which comprises a cysteine residue at position 309 according to the EU numbering system, and preferably also a leucine residue at position 310.

7. The polymeric fusion protein of any preceding claim comprising five, six or seven polypeptide monomer units.

8. The polymeric fusion protein of any preceding claim wherein each of the immunoglobulin heavy chain constant regions is an IgG heavy chain constant region comprising an amino acid sequence which is modified compared to the amino acid sequence of a native IgG heavy chain constant region, to increase the affinity of the Fc receptor binding portion for at least one activatory Fc receptor and/or to decrease the affinity of the Fc receptor binding portion for at least one inhibitory Fc receptor,

9. The polymeric fusion protein of any preceding claim wherein each of the immunoglobulin heavy chain constant regions comprises an amino acid sequence which is modified compared to the amino acid sequence of a native heavy chain constant region, to increase the in vivo half life of the polymeric antigen fusion protein, suitably by increasing the affinity of the Fc receptor binding portion for neonatal Fc receptor.

10. The polymeric fusion protein of any preceding claim wherein the tailpiece region is an IgM or IgA tailpiece, or fragment or variant thereof.

1 1 . The polymeric fusion protein of any preceding claim wherein the functional factor is an antigen.

12. The polymeric fusion protein of claim 1 1 wherein the at least one antigen comprises a B cell epitope and/or a T cell epitope and the at least one antigen suitably comprises a peptide, polypeptide, carbohydrate, lipid, DNA or RNA,

1 3. The polymeric fusion protein of Claim 12 wherein the at least one antigen comprises a peptide or a polypeptide, which is preferably fused N-terminal or C-terminal to at least one immunoglobulin heavy chain constant region.

14. The polymeric fusion protein of Claim 1 3 wherein at least one of the monomer units comprises at least one antigen fused N-terminal to at least one and preferably each of the two immunoglobulin heavy chain constant regions.

15. The polymeric fusion protein of Claim 13 or 14 wherein each of the monomer units comprises at least one antigen fused to N-terminal to at least one and preferably each of the two immunoglobulin heavy chain constant regions.

16. The polymeric fusion protein of Claim 12 wherein the at least one antigen comprises a peptide, polypeptide, carbohydrate, lipid, DNA or RNA which is chemically conjugated to at least one and preferably each of the monomer units, suitably to the N- terminus.

17, The polymeric fusion protein of any of claims 1 to 10 wherein the functional factor is a therapeutic agent.

18. The polymeric fusion protein of claim 17 wherein the therapeutic agent is drug, a small molecule, a protein, a peptide, a nucleic acid or any other suitable agent.

19. The polymeric fusion protein of claim 17 or 18 wherein the therapeutic agent is one or more of etanercept, alefacept, abatacept, be!atacept, atacicept, briobacept, rilonacept and afilbercept.

20. A nucleic acid molecule comprising a coding portion encoding a polypeptide monomer unit of a polymeric fusion protein as defined in any preceding claim wherein the polypeptide monomer unit comprises at least one peptide or polypeptide functional factor fused N-terminal or C-terminal to the immunoglobulin heavy chain constant region.

21. The nucleic acid molecule of Claim 20 wherein the coding portion encodes a signal peptide which is contiguous with the polypeptide monomer unit.

22. An expression vector comprising the nucleic acid molecule of Claim 20 or 21.

23. A host cell comprising the expression vector of Claim 22.

24. A vaccine composition comprising the polymeric fusion protein of any one of Claims 1 to 16 or the expression vector of Claim 22 and a pharmaceutically acceptable excipient.

25. The vaccine composition of Claim 24 further comprising an adjuvant.

26. A therapeutic composition comprising the polymeric fusion protein of any one of Claims 17, 18 or 19, or the expression vector of Claim 22 and a pharmaceutically acceptabie excipient.

27. The polymeric fusion protein of any one of Claims 1 to 17; the expression vector of Claim 22, the vaccine composition of Claim 24 or 25, or the therapeutic composition of Claim 26 for use in medicine.

28. The polymeric fusion protein of any one of Claims 1 to 16; the expression vector of Claim 22 or the vaccine composition of Claim 24 or 25, for use in vaccinating a subject.

29. The polymeric protein of any one of Ciaims 17, 18 or 19, the expression vector of Claim 22 or the therapeutic composition of Claim 24 or 25, for use as a therapy in a subject.