WO2011053565A2 - Compositions and methods for detecting a tauopathy - Google Patents

Abstract

The invention provides antibodies that specifically bind human tau proteins and compositions containing the antibodies. Further provided are methods for obtaining the antibody, methods for detecting a tauopathy in a subject and methods for detecting an agent for treating a tauopathy in a subject.

Description

COMPOSITIONS AND METHODS FOR DETECTING

A TAUOPATHY

FIELD

[0001] The invention provides compositions and methods useful for detecting a tauopathy in a subject such as a human patient. Further provided are methods for obtaining the antibody, methods for detecting a tauopathy in a subject and methods for detecting an agent for treating a tauopathy in a subject.

BACKGROUND

[0002] Tau has been reported to bind axonal microtubules in Central Nervous Systems (CNS) and regulate their organization, stability and function. Six Tau isoforms arise in the human CNS by alternative splicing. They contain 3 or 4 of the microtubule-binding imperfect repeats (3R or 4R) carboxy -terminally, and none to two amino-terminal domains (ON, IN, 2N). This diversity is believed to be significant because 4RTau binds microtubules more efficiently and isoforms exhibit differential distribution.

[0003] In humans, elevated wild type (WT) Tau in the CNS characterizes a wide variety of tauopathies like Alzheimer's (AD), Pick's disease and Progressive Supranuclear Palsy among others. In contrast, mutations affecting microtubule binding or increasing 4RTau levels, are causal of Frontotemporal-Dementia-with-Parkisonism linked to chromosome- 17 (FTDP-17). Enhanced phosphorylation on particular sites, in patterns characteristic of different tauopathies, is thought causal of decreased microtubule binding, mimicking Tau loss of function. Free Tau is believd to form toxic cytoplasmic aggregates thought resulting in neuronal dysfunction and neurodegeneration.

[0004] Tau-dependent neuronal dysfunction, aggregate formation and neurodegeneration linked to hyper-phosphorylation have been modelled in vertebrate and invertebrate systems. There is emerging evidence that cognitive deficits characteristic of the different tauopathies may precede and be separable from neurodegeneration. However, hTau-dependent neuronal loss has also been reported in mice and flies. In Drosophila, WT and FTDP-17-linked mutations precipitate specific, often opposing effects in fly retina toxicity and CNS dysfunction.

[0005] It would be useful to have antibodies that can specifically bind human tau protein, particularly hyper-phosphorylated forms. It would be further useful to have cell lines that produce the antibody as well as compositions for making the antibody. Especially useful would be to have kits for detecting a tauopathy in a subject that include the antibody. Also useful would be to have methods for using the antibody, for example, to detect an agent capable of treating, preventing or reducing the severity of a tauopathy in a subject.

SUMMARY OF THE INVENTION

[0006] In one aspect, invention provides antibodies that specifically bind human tau protein phosphorylated at one or more of Ser 238 and Thr 245. Preferably, the antibody specifically binds an epitope contained within amino acids 210-275 of a full-length sequence of human tau protein as provided below; or an immunogenic fragment thereof.

[0007] The invention also encompasses a cell line that produces the antibody as well as immunogenic compositions and methods that can generate the antibody. In a preferred embodiment, the immunogenic composition distinguishes between phosphorylated and dephosphorylated human tau that includes (a) a human tau peptide of between about 5 to 20 amino acid residues of residues 210-275 of SEQ ID NO: 1 in which at least one of SER²³⁸ and Thr²⁴⁵ is phosphorylated. Preferably, human tau peptide is conjugated to (b) a carrier molecule in which the carrier molecule induces or enhances an immune response to the human tau peptide.

[0008] In another aspect, the invention provides a kit for detecting a tauopathy in a subject that includes the antibody.

[0009] Further provided by the invention is a method for obtaining the antibody described herein which method includes the steps of administering the immunogenic composition of to an animal, obtaining a biological sample from the animal and detecting presence of an immune complex comprising the tau polypeptide and an antibody in the sample; and isolating the antibody from the animal.

[0010] Also provided by the present invention is a method for detecting presence or susceptibility to a tauopathy in a subject. In one embodiment, the method includes at least one of and preferably all of the following steps: a) contacting the antibody of the invention with a biological sample obtained from the subject under conditions sufficient to form an immune complex between the antibody and any tau protein phosphorylated at one or more of

Ser 238 and Thr 245 in the sample; and b) detecting presence of the immune complex as being indicative of the presence of or susceptibility to the tauopathy in the subject. Further provided by the invention is a method for detecting an agent capable of treating, preventing or reducing the severity of a tauopathy in a subject.

[0011] In one embodiment, the method includes at least one of and preferably all of the following steps: (a) contacting a candidate agent with a transgenic fly expressing human tau protein comprising phosphorylated amino acids at one or more of Ser 2 "38° and Thr 2^{^}45^J; and (b) observing a selected phenotype of the transgenic fly; wherein a difference in the observed phenotype between the transgenic fly contacted with the candidate agent and (i) a first control transgenic fly not contacted with the candidate agent and preferably also (ii) a second control transgenic fly comprising human tau protein incapable of being phosphorylated at one or more of Ser 238 and Thr 245 is indicative of an agent active in treating, preventing or reducing the severity of the tauopathy in the subject.

BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is a set of 24 photographs showing that animals accumulating hTau 1N4R protein harbor aberrant or missing MBs.

[0013] Figure 2 is a photograph of a gel (A), graph (B), tissue sections (C) and a graph (D) showing differential effects on MB integrity of WT and mutant Taus.

[0014] Figure 3 is a photograph of tissues sections (A), gel (B), graph (C) and tissue sections (D) showing MB defects upon pan-neuronal accumulation of hTau arise during embryogenesis.

[0015] Figure 4 is a photograph of tissue sections (A, B) showing loss of embryonic MB neuroblasts upon hTAu accumulation.

[0016] Figure 5 is a photograph of tissue sections (A, B) showing that. hTau phosphorylation is essential for MB ablation.

[0017] Figure 6 is a photograph of tissue sections (A), gel and graph (B), and graphs (C, D) showing behavioral deficits in animals accumulating Tau variants that do not perturb MB structure.

[0018] Figure 7 is a photograph of a gel (A), graph (B) and gel (C) showing enhanced phosphorylation at specific disease-specific sites in 2N4RSTA-accumulating animals.

[0019] Supplemental Figure 1 is a photograph of tissue sections showing the ellipsoid body and antennal lobes remain unaltered in hTau accumulating animals.

[0020] Supplemental Figure 2 is a photograph of antibody stained tissue sections showing loss of MB in larval brains.

[0021] Supplemental Figure 3 is a photograph of antibody stained tissue sections (A, B) showing expression of driver OKI 07 in embryonic MBs.

[0022] Supplemental Figure 4 is a photograph of a gel (A), tissue sections (B, D) and gel (C) showing enhanced pan-neuronal accumulation of hTau 1N4R-R406WS2A does not affect MB integrity.

[0023] Supplemental Figure 5 is a drawing (5A) and graphs (5B, C) showing a sequence alignment of human (SEQ ID NO: l) and bovine tau proteins (SEQ ID NO:2) (5 A). Functional tests results are shown in the graphs (5B, C).

DETAILED DESCRIPTION

[0024] As discussed, the present invention relates to antibodies (preferably monoclonal) that specifically bind human tau protein phosphorylated at one or more of Ser²³⁸ and Thr²⁴⁵. Preferably, the antibody specifically binds an epitope contained within amino acids 210-275 of a full-length sequence of human tau protein; or an immunogenic fragment thereof. A preferred human tau sequence can be found in the Swiss-Prot ((EMCS): P10636-8 Isoform Tau-F 441 aminoacids) or Genbank (nucleotide sequence XI 4474) databases. Included within the definition of preferred human tau proteins are allelic variants of the sequences provided by Swiss-Prot P10636-8 and Genbank X14474.

[0025] By the phrase "specifically bind" is meant that the antibody of the invention forms an immune complex essentially exclusively with the htau protein phosphorylated at one or more of Ser²³⁸ and Thr²⁴⁵ as determined by one or a combination of standard laboratory test such as a Western blot.

[0026] General methods for obtaining monoclonal antibodies of the invention are known. See E. Harlow and D. Lane (1998) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY. A preferred process typically involves obtention and isolation of hybridomas which secrete the monoclonal antibodies. Accordingly, it is an object of the invention to provide a hybridoma cell line that produces the monoclonal antibody.

[0027] A process for obtaining such a hybridoma involves: starting from spleen cells of an animal, e.g. mouse or rat, previously immunized in vivo or from spleen cells of such animals previously immunized in vitro with an antigen recognized by the monoclonal antibodies of the invention; fusing such immunized cells with myeloma cells under hybridoma-forming conditions; and selecting those hybridomas which secrete the monoclonal antibodies which specifically recognize an epitope of the above-said antigen and which form an immunological complex with the phosphorylated form of tau protein described herein or with the phosphorylated peptide comprising the epitope of tau protein.

[0028] A process for producing the corresponding monoclonal antibodies involves: culturing the selected hybridoma as indicated above in an appropriate culture medium; and recovering the monoclonal antibodies excreted by the selected hybridoma, or alternatively implanting the selected hybridoma into the peritoneum of a mouse and, when ascites have been produced in the animal, recovering the monoclonal antibodies then formed from such ascites.

[0029] The monoclonal antibodies of the invention can be prepared by conventional in vitro techniques such as the culturing of immobilized cells using, e.g., hollow fibers or microcapsules or the culturing of cells in homogeneous suspension using, e.g., airlift reactors or stirred bioreactors.

[0030] If desired, an immunogenic composition of the invention can be used to produce the hybridoma cell lines. In one embodiment, such a composition is capable of generating an antibody which distinguishes between phosphorylated and dephosphorylated human tau. Preferably, the immunogenic composition includes: (a) a human tau peptide of between about 5 to 20 amino acid residues of residues 210-275 of SEQ ID NO: 1 in which at least one of Ser²³⁸ and Thr²⁴⁵ is phosphorylated. Also preferably, the human tau peptide is conjugated to (b) a carrier molecule which is intended to induce or enhance an immune response to the human tau peptide. The immunogenic composition can be administered to an animal (eg., rodent, rabbit) and a biological sample obtained for detecting presence of an immune complex that includes the tau peptide and an antibody in the sample and then isolating the antibody from the animal.

[0031] A method for preparing the peptides of the invention involves: starting from the C-terminal amino acid, the successive aminoacyls in the requisite order, or aminoacyls and fragments formed beforehand and already containing several aminoacyl residues in the appropriate order, or alternatively several fragments prepared in this manner beforehand, are coupled successively in pairs, care being taken to protect all the reactive groups carried by these aminoacyls or fragments except for the amine groups of one and the carboxyl group of the other, which must normally participate in peptide bond formation, in particular after activation of the carboxyl group, according to methods known in peptide synthesis, and so on, proceeding stepwise up to the N-terminal amino acid. In this process, it is possible to use previously phosphorylated amino acids (See De Bont H. B. A. et al., 1990).

[0032] Antibodies of the invention have a wide spectrum of uses. In one aspect, the antibodies are used to detect the presence or susceptibility to a tauopathy in a subject, the method comprising the steps of: a) contacting the antibody of claim 1 with a biological sample obtained from the subject under conditions sufficient to form an immune complex between the antibody and any tau protein phosphorylated at one or more of Ser²³⁸ and Thr²⁴⁵ in the sample; and b) detecting presence of the immune complex as being indicative of the presence of or susceptibility to the tauopathy in the subject. Examples of tauopathies include, but are not limited to, Alzheimer's disease, Pick's disease, frontotemporal Dementia with Parkinsonism of chromosome 17 (FTDP-17), corticobasal Degeneration (CBD), progressive Supranuclear Palsy (PSP), and argyrophylic Grain Disease (AGD).

[0033] By "subject" is meant an animal (eg., rodent, rabbit, cat, dog, horse, pig, insect such as a fruit fly, etc) who has or is suspected of having a tauopathy or a human patient.

[0034] The monoclonal antibody of the invention can be used in an immobilized state on a suitable support such as a resin. The process for the detection of the antigen can then be carried out as follows: bringing a biological sample containing proteins and polypeptides (e.g., plasma, blood, cerebrospinal fluid) obtained from a subject that has or is suspected of having a tauopathy into contact with the monoclonal antibody under conditions that allow the formation of an immunological complex; washing the immobilized antibody-antigen complex so formed; treating that complex with a solution (e.g., 3 M potassium thiocyanate, 2.5 M magnesium chloride, 0.2 M citrate-citric acid, pH 3.5 or 0.1 M acetic acid) capable of producing the dissociation of the antigen-antibody complex; and recovering the antigen in a purified form.

[0035] As mentioned, the invention provides a method for detecting presence or susceptibility to a tauopathy in a subject. In a preferred embodiment, the method includes at least one of and preferably all of the following steps: a) contacting an antibody of the invention (preferably a monoclonal antibody) with a biological sample obtained from the subject under conditions sufficient to form an immune complex between the antibody and any tau protein phosphorylated at one or more of Ser 238 and Thr 245 in the sample; and b) detecting presence of the immune complex as being indicative of the presence of or susceptibility to the tauopathy in the subject. Illustrative tauopathies include, but are not limited to, Alzheimer's disease, Pick's disease, frontotemporal Dementia with Parkinsonism of chromosome 17 (FTDP-17), corticobasal Degeneration (CBD), progressive Supranuclear Palsy (PSP), argyrophylic Grain Disease (AGD).

[0036] The detection of the immunologically bound monoclonal antibody can be achieved according to one or a combination of conventional methodologies. Advantageously, the monoclonal antibody of the invention itself carries a marker or a group for direct or indirect coupling with a marker as exemplified hereinafter. Also, a polyclonal antiserum can be used which was raised by injecting the antigen of the invention in an animal, preferably a rabbit, and recovering the antiserum by immunoaffinity purification in which the polyclonal antibody is passed over a column to which the antigen is bound and eluting the polyclonal antibody in a conventional manner. Detection can also be achieved by competition binding of the antigen with a labeled peptide comprising the epitope of the invention.

[0037] A particularly advantageous embodiment of the process of the invention comprises contacting a sample of cerebrospinal fluid (containing the corresponding antigen) obtained from a patient to be diagnosed with the monoclonal antibody of the invention. As mentioned, the invention also relates to a kit for the diagnosis of tauopathy in a subject. These include, but are not limited to, Alzheimer's disease, Down's syndrome, frontotemporal Dementia with Parkinsonism of chromosome 17 (FTDP-17), corticobasal Degeneration (CBD), progressive Supranuclear Palsy (PSP), argyrophylic Grain Disease (AGD), Pick's disease, SSPE, traumatic encephalopathy, and other neurological disorders in which abnormally phosphorylated tau protein has been implicated or is suspected. Such a kit would contain: at least a microplate for deposition thereon of any monoclonal antibody of the invention; a preparation containing the sample to be diagnosed in vitro, possibly together with a labeled peptide containing the epitope of the invention and preferably with the peptides provided herein. In one embodiment, such a kit can also include a second antibody which can be a monoclonal antibody recognizing an epitope of normal tau as a control. Formation of an immune complex between the bound monoclonal antibody and any tau phosphorylated at Ser²³⁸ and/or Thr²⁴⁵ in the biological sample can be detected using conventional approaches. The labeled peptide mentioned above can be a peptide which has been labeled by standard means.

[0038] The invention also relates to a kit, as described above, also containing the antigen of the invention, the antigen of the invention being either a standard (for quantitative determination of an antigen which is sought) or a competitor, with respect to an antigen which is sought, whereby the kit can be used in a competition dosage process.

[0039] The invention is particularly useful in the detection of agents for treating, preventing or reducing the severity of a tauopathy in a subject, the method comprising the steps of: (a) contacting a candidate agent with a transgenic fly expressing human tau protein comprising phosphorylated amino acids at one or more of Ser"° and Thr^{^J}; and (b) observing a selected phenotype of the transgenic fly; wherein a difference in the observed phenotype between the transgenic fly contacted with the candidate agent and (i) a first control transgenic fly not contacted with the candidate agent and (ii) a second control transgenic fly comprising human tau protein incapable of being phosphorylated at one or more of Ser²³⁸ and Thr²⁴⁵ is indicative of an agent active in treating, preventing or reducing the severity of the tauopathy in the subject. [0040] As discussed, tauopathies are a heterogeneous group of neurodegenerative dementias involving perturbations in the levels, phosphorylation or mutations of the microtubule-binding protein Tau. The heterogeneous pathology in humans and model organisms suggests differential susceptibility of neuronal types to wild type (WT) and mutant Tau. WT and mutant human Tau-encoding transgenes expressed pan-neuronally in the Drosophila Central Nervous System (CNS) yielded specific and differential toxicity in the embryonic neuroblasts that generate the mushroom body neurons (MBs), suggesting cell type-specific effects of Tau in the CNS. Frontotemporal-Dementia with Parkinsonism- 17- linked mutant isoforms were significantly less toxic on MB development. Tau hyperphosphorylation was essential for these MB aberrations and two novel putatively phosphorylation sites Ser 238 and Thr 245 on WT hTau essential for its toxic effects on MB integrity were identified. Significantly, blocking putative Ser 238 and Thr 245 phosphorylation yielded animals with apparently structurally normal but profoundly dysfunctional MBs, as animals accumulating the mutant protein exhibited strongly impaired associative learning.

[0041] The mutant protein was hyperphosphorylated at epitopes typically associated with toxicity and neurodegeneration such as AT8, AT100 and the Par-1 targets Ser²⁶² and Ser³⁵⁶ suggesting that these sites in the context of adult intact MBs mediate dysfunction and occupation of these sites may precede the toxicity-associated Ser²³⁸ and Thr²⁴⁵ phosphorylation. The data shown below in the Examples section show that phosphorylation at particular sites rather than hyperphosphorylation per se mediates toxicity or dysfunction in a cell type-specific manner.

[0042] EXAMPLES

[0043] Example 1: Ablation of the mushroom bodies upon pan-neuronal accumulation of human Tau.

[0044] To investigate whether elevated Tau might affect particular Drosophila CNS neurons differentially, the human 1N4R isoform with the pan-neuronal driver Elav were expressed This driver is an appropriate tool to address this question because it is active apparently uniformly in all adult CNS neurons (Robinow and White, 1988, 1991) and transiently in some embryonic neuroblasts and glia (Berger et al., 2007). Neuroanatomical evaluation of the CNS was performed initially with Hematoxylin and Eosin-stained paraffin sections of 2-5 day old adult heads. Surprisingly, it was noted that although the overall structure and morphology of the brain appeared unaltered, one major structure, the mushroom bodies (MBs), seemed severely reduced or entirely absent in the majority of animals (Figure 1.1- 1.3). This is demonstrated in the figure at the level of the dendrites of MB neurons, known as calyces. These structures were prominent in controls (arrow in Figure 1.1), but not apparent in \ AS-htau^1N4R expressing animals (arrowhead in Figure 1.2). Other neuropils such as the protocerebral bridge (arrow in Figure 1.2) in the posterior of the head and the fan- shaped body (arrow in Figure 1.3) appeared normal. The MBs are bilateral clusters in the dorsal and posterior cortex of the brain, each comprised of about 2500 neurons. Their dendrites form the spherical neuropil of the calyx ventral to the cell bodies (Kenyon cells- KCs), while the axons fasciculate into the pedunculus. In the anterior of the brain the pedunculus bifurcates with processes forming the medial β, β', γ and the dorsally-projecting a and a'vertical lobes (Crittenden et al., 1998; Strausfeld et al., 2003). These neurons are essential for olfactory learning and memory in Drosophila and other insects (Menzel, 2001; Heisenberg, 2003; Davis, 2005).

[0045] To verify these observations, the anti-Leo antibody, which is highly preferential for most adult MB neurons (Skoulakis and Davis, 1996; Crittenden et al., 1998; Raabe et al., 2004), was used. Serial sections from heads of htau^1N4R -expressing animals from independent crosses revealed that all brains displayed defective MBs (Figure 1). The defects could be classed on the basis of severity into two main categories. Compared with sections from controls (Figure 1.4, 1.7, 1.10, 1.13, 1.16) processed in parallel, animals with Type 1 defects displayed severely reduced, often bilaterally asymmetrical MBs (Figure 1.5, 1.8, 1.11, 1.14 and 1.17). Nevertheless, at least one well-discernible calyx was present (arrowhead in Figure 1.5) and although much reduced, the pedunculus (arrowhead in Figures 1.8 and 1.11) and an apparently intact γ lobe were present (arrowhead in Figure 1.17).

[0046] In contrast, animals displaying the much more severe Type 2 defects lacked nearly all calycal structures (arrowhead in Figure 1.6), the pedunculus was nearly absent (arrowhead in Figure 1.9 and 1.12) and the γ lobes were severely malformed and rudimentary (arrowhead in Figure 1.18). These differences could arise not because the MBs were actually malformed, but because the Leo protein used as an antigenic marker could be reduced upon Tau accumulation. Thus, an additional unrelated antigenic marker, the adaptor protein Drk, which is also preferentially expressed in α β and γ lobes of the MBs (Crittenden et al., 1998; Moressis et al., 2009), was used. Again, remnants of few a and β neurons (compare Figure 1.19 with Figure 1.20) and nearly absent γ lobes were observed (compare Figure 1.21 with Figure 1.22) in Type 2 animals, indicating loss of the structures rather than loss of the antigenic markers. To ascertain this further, the number of corresponding MB cell bodies (KCs), focusing on the subpopulation that express the transcription factor Dac (Martini et al., 2000; Martini and Davis, 2005), was used. Clearly the cells displaying staining were dramatically reduced in Type 2 animals (Figure 1.24) compared to controls (Figure 1.23), verifying rarefaction and loss of MB neurons. Therefore, pan-neuronal accumulation of 1N4R hTau disrupts specifically and to near ablation the MB neurons.

[0047] In contrast, neuropils of the Central Complex (Strausfeld, 1976), such as the protocerebral bridge (Figure 1.5 and 1.6), FSB (Figure 1.8 and 1.9), EB (Figure 1.11 and 1.12 and Supplemental Figure 1) and antennal lobes (Figure 1.17 and 1.18 and Supplemental Figure 1) remained apparently intact and reasonably well organized. Similar results were obtained with an independent 1N4R WT-hTau transgenic line and the also independently generated 2N4R WT-hTau and 2N4R-FLAG WT-hTau (see below), strongly supporting the notion that these structural deficits are not consequences of positional effects of transgene insertion. In congruence with this conclusion, homozygotes for all of the transgene insertions utilized did not exhibit aberrant CNS neuroanatomy. Furthermore, identical MB defects were obtained if the crosses were performed in the reverse orientation (using Elav males and scoring the MBs in female progeny) and with an independent Elav driver inserted on the third chromosome (Lin and Goodman, 1994), confirming that the effects on MB structure are independent of GAL4 driver, insertion locus and maternal genotype.

[0048] Figure 1 is explained in more detail as follows: Panels 1-3 are 4-5 μιη formalin-fixed paraffin-embedded frontal sections of control (1) and hTau accumulating animals under the pan-neuronal driver £7av-Gal4 (2 and 3) stained with Hematoxylin and Eosin (H&E) in the posterior (1, 2), or middle (3) of the head. Arrow in 1 points to the calyces which are not apparent (arrowhead) in hTau-accumulating animals. In contrast the protocerebral bridge (arrow in 2) and fan-shaped body and noduli (arrow in 3) appear intact in the latter. Panels 4-18 are Carnoy's-fixed paraffin-embedded frontal sections stained with anti-Leonardo. Equivalent sections from control and hTau-accumulating brains are arranged from posterior (Calyx) to anterior (y-lobes) in rows labelled on the left according to the most prominent identifiable brain structure included. FSB: Fan-Shaped Body; EB: Ellipsoid Body. The arrows and arrowheads in sections labelled FSB and EB point to the MB pedunculi. Arrows in sections of control brains indicate the normal morphology of MB structures, whereas arrowheads point to the corresponding aberrations in the sections from experimental brains. Type 0 refers to the normal MBs in control animals (panels 4, 7, 10, 13 and 16). Type 1 deficits describe aberrations with still discernable MBs and Type 2 defects describe the near or total loss of MBs. Panels 19-22 are sections at the level of α/β lobes (19, 20) and γ lobes (21, 22) of control (19, 21) and 1N4R hTau accumulating animals (20,22) stained with an independent antibody, anti-Drk. Again , arrows point to normal MBs while arrowheads to defects. Panels 23 and 24 show sections at the level of the calyces and Kenyon Cells from control and 1N4R hTau-accumulating brain respectively stained for the transcription factor Dac. The arrow in 23 indicates the abundant Kenyon cells in control animals which are nearly absent in the experimental brain (arrowhead in 24).

[0049] Supplemental Figure 1 is explained in more detail as follows: Frontal paraffin sections from two different animals of the indicated genotypes stained with anti-Leonardo. Arrows point to the ellipsoid body in the left column and antennal lobes on the right. Both of these brain structures appear unaffected and similar to those of control animals.

[0050] Example 2: Wild type and mutant Tau isoforms affect MB structure differentially

[0051] Differential effects of WT and mutant isoforms of human Tau on neurodegeneration in Drosophila have been reported previously (Wittmann et al., 2001). differential effects on retinal degeneration and associative learning of various human WT and mutant isotypes have been proposed (Grammenoudi et al., 2008). Therefore, it was the aim to extend these studies by investigating the effects of Tau isoforms on adult MB integrity. The quantification of MB phenotype at at 25°C is shown in Table 1.

[0052] Transgenic lines expressing relatively similar levels of vertebrate Tau (Figure 2A) were selected. Nevertheless, compared to 1N4R arbitrarily assigned as 100% level, accumulation of 0N3R hTau was higher and that of 2N4R and bTau lower. The level of the latter two proteins may be somewhat underestimated because they are larger and may transfer less efficiently during blotting. Of the two mutant proteins, V377M hTau accumulated equally with the 1N4R control, while the R406W variant accumulated at reduced levels (Figure 2B).

[0053] At 25°C, pan-neuronal expression of Drosophila Tau (dtau) and &tow-encoding transgenes did not yield appreciable effects on the MBs (Figure 2C). Of the WT hTau isoforms, 0N3R did not affect the MBs appreciably, in contrast to the 1N4R and 2N4R isoforms that resulted in severe defects of these neurons (Figure 2C). Again, other areas of the brain remained unaffected (Supplemental Figure 1). Of the two FTDP-17-linked mutant proteins, V377M hTau yielded milder deficits in approximately half of the brains examined. Deficits consisted mainly of an overall reduction in the size of the MBs, but curiously in most of the affected animals the effect appeared largely unilateral (Figure 2C and Table 1).

[0054] In contrast, the R406W protein precipitated significantly more severe defects generally exhibiting bilateral symmetry (Figure IB and Figure 5B), that clearly remained restricted to the MBs (Supplemental Figure 1). Similar results were obtained with an independent htau^R406W transgenic line (not shown). The collective results of the histological analysis presented above are summarized quantitatively on Table 1. Differences in phenotypic severity between WT and mutant hTau proteins are unlikely a consequence of reduced mutant protein accumulation, because steady state protein levels appeared equivalent, at least comparing 1N4R to V377M hTau and 2N4R to R406W (Figure 2B). Furthermore, the 2N4R protein precipitated more severe deficits (Figure 2C, Table 1 and see below), although it appeared less abundant than 1N4R. This contrasts with the more severe effects of the mutant proteins on the integrity of the retina than their WT counterparts as described previously (Wittmann et al., 2001; Khurana et al., 2006).

[0055] Referring now to Table 1, the data shows quantification of MB aberrations upon pan-neuronal Tau accumulation. Collective data from all experimental animals raised at 25°C examined the survey detailed in Figure 2C. The asterisks indicate bilaterally asymmetric MB defects.

[0056] Furthermore, to demonstrate that the effects on the MBs are dosage dependent, levels of hTau isoforms that yielded defects by raising the flies at 18°C (Grammenoudi et al., 2006) were lowered. The results presented quantitatively in Figure 2D indicate that reducing the dosage of WT Tau isoforms diminished the proportion of animals exhibiting the more severe Type 2 phenotype, but still nearly 100% of the individuals harbored MB defects. Thus the effects of reducing expression of those WT isoforms that yield phenotypes were largely quantitative with respect to phenotype severity. In contrast, reducing the levels of the two mutant Tau isoforms had both quantitative and qualitative effects, as it diminished the severity of the defects and the number of animals harboring them in the case of R406W and nearly eliminated the deficits in animals accumulating V377M (Figure 2D). Therefore, the effects of hTau on MB integrity were dose dependent and consistently more severe upon accumulation of WT proteins rather than the two FTDP-17 linked mutations. However, it should be noted that simply increasing the amount of any Tau protein does not suffice to yield MB defects as the highest accumulation level of 0N3R did not affect integrity of these neurons. However, 0N3R accumulation can cause structural and functional deficits in larval motor neurons (Mudher et al., 2004; Chee et al., 2005). This is a consequence of the reduced number of microtubule binding repeats alone or in combination with the lack of amino- terminal extensions. In addition, although 2N4R appeared at slightly lower levels than 1N4R (Figure 2A), its effects were consistently more severe. Similar difference in the effectiveness of 2N versus IN transgenic hTaus in the retina was suggested recently by the work of Chatterjee et al (Chatterjee et al., 2009), indicating that the amino -terminal extension seems to influence hTau toxicity. Collectively then, differences in the consequences of WT and FTDP-17-linked mutant hTau in the Drosophila CNS are not the result of the relatively small deviations in expression levels or transgene position effects. It appears therefore that phenotypic consequences of WT and mutant Tau accumulation are largely isoform and mutation specific.

[0057] Figure 2 is explained in more detail as follows: (A) A representative Western blot demonstrating the levels of WT and mutant Tau accumulation under £7av-GAL4 probed with the T46 anti-Tau antibody. The anti-Syntaxin antibody (Syx) was used to ascertain equivalent loading of the samples. (B) Quantification of the Tau species as indicated in the blot above, relative to the level of 1N4R (black bar) from 3 independent blots. Dunnett's tests indicated that the differences in accumulation of 0N3R, 2N4R, R406W and BTau were significantly different (p<0.005) from the level of 1N4R as indicated by the asterisks. (C) Carnoy's-fixed paraffin-embedded 5 μιη frontal sections at the level of the α/β lobes from control (Elav/+) and animals expressing the indicated WT and mutant Tau isoforms stained with anti-Leonardo demonstrating MB deficits in animals expressing htau transgenes. The two panels designated a and b display sections from two different animals. (D) The degree of MB aberrations depends on the type of hTau protein and the levels of its accumulation. The bars display the percent of animals harboring MB defects, while the shaded portion of the bar indicates the fraction of them displaying the more severe Type 2 deficits. At least 15 sections per genotype were evaluated in a single large experiment where all of the indicated experimental animals were processed in parallel to minimize experimental errors.

[0058] Example 3: Integrity is compromised by hTau in the embryonic MBs.

[0059] The effects of Tau accumulation under Elav are reminiscent of the previously described Hydroxyurea-dependent ablation of MB neurons by mitotic poisoning of their neuroblasts in young first instar larvae (de Belle and Heisenberg, 1994). In fact, it was observed loss of KCs in third instar larval brains (Supplemental Figure 2) expressing htau^1N4R pan-neuronally, while neurons in other parts of the CNS appeared unaffected. In addition, parental transmission and early embryonic accumulation of GAL4 under the Elav drivers has been reported (Tzortzopoulos and Skoulakis, 2007), suggesting that Tau accumulation in the embryo may in fact precede formation of embryonic MB neuroblasts, which also express this driver (Berger et al., 2007).

[0060] To determine the developmental period when MB integrity is affected by hTau, expression of the tau transgenes spatiotemporally using the TARGET system (McGuire et al., 2003; McGuire et al., 2004) was controlled. Transcription of tau transgenes was suppressed by performing crosses at 18°C and was induced by shifting eggs, larvae, pupae or adults to the permissive temperature of 29-30°C (McGuire et al., 2003). Type 1 and Type 2 MB defects were observed in 75% of the adults expressing \JA -tau^1N4R under Elav- GAL4; 7w£-GAL80^ts throughout development on to adulthood (Figure 3A-3C). This decrease in affected adults from 100% routinely obtained with the £7av-GAL4 driver, reflects incomplete inactivation of the GAL80^ts, or inadequate hTau at the time window necessary to exert maximal effects due to transcriptional delays inherent in the TARGET system.

[0061] Similarly, 70% of adults expressing htau^1N4R exclusively through embryogenesis (see Materials and Methods) harbored MB defects (Figure 3A, 3C), although as expected Tau was absent from adult brains at the time of histological evaluation (Figure 3B). In contrast, presence of the protein post-hatching, from early larvae to adulthood (Figure 3B), yielded mild Type 1 defects in less than 5% of the animals examined (Figure

3 A, 3C). Trans gene expression exclusively in pupae did not yield detectable defects and the effects of raising transgene-harboring animals at the restrictive temperature were negligible (Figure 3A, 3C). Therefore, hTau appears to yield defective adult MBs likely because it interferes with their development during embryogenesis.

[0062] To establish with more precision the phenocritical period for hTau toxicity on the MBs, embryos collected at the permissive temperature were shifted to restrictive conditions at particular times and then allowed to proceed to the end of embryogenesis. Clearly, presence of 1N4R (Figure 3D.1, 3D.3) or 2N4R hTau (Figure 3D.2, 3D.4) in the first

4 hours of embryogenesis at 29°C did not affect adult MB structure significantly. In contrast, continued presence of hTau 8 hours into embryogenesis, yielded adults exhibiting Type 1 and Type 2 deficits (Figure 3D.5-3D.10). Continued Tau accumulation at 29°C up to 14 hours after egg lay did not yield more severe deficits (not shown). Because hTau in the first 4 hours of embryogenesis did not have obvious effects, the results suggest its toxicity on the MBS not a consequence of the reported maternally supplied Gal4 (Tzortzopoulos and Skoulakis, 2007), but rather it requires zygotic transgene transcription. Moreover, because the full effect on MB integrity is observed early in embryogenesis, it suggests that hTau may affect MB neuroblast formation, survival or proliferation.

[0063] To investigate how hTau affects the embryonic MBs, anti-Dac antibody was used to track cells of the MB neuroectoderm (MBne), known to give rise to MB neuroblasts (MBNBs) and eventually the embryonic MB (Younossi-Hartenstein et al., 1996; Noveen et al., 2000). Although Dac is not expressed only in the MB lineage, it is an excellent marker for this purpose because its stereotypical expression pattern is well mapped (Noveen et al., 2000) and it is clearly expressed in the neuroblasts that delaminate from the procephalic ectoderm (MBne). Furthermore, because it marks additional lineages of the embryonic head ectoderm, the relative effects of hTau on different cell types can be determined. Compared to control embryos, cells at the stereotypical MBne location in the head of stage 9-12 hTau ^1N4R -expressing embryos were not apparent by Dac staining. However, adjacent cells of the unrelated paraMB neuroectoderm (paraMBne) remained Dac -positive (Figure 4A.1-4A.5). By stage 14 (Figure 4A.6), the location in the posterior CNS expected to be occupied by Dac- positive embryonic KCs was devoid of signal, while other Dac positive groups of cells such as those of the optic lobe primordium appeared unaffected. This was also readily apparent by stage 16, where few if any, Dac -positive cells appeared in the dorsal posterior brain of hTau ^7A¾ff-expressing embryos where the KCs normally reside (Figure 4A.7-4A.9). In contrast, other CNS cell types did not show obvious defects, at least as revealed by the neuroanatomy and Dac staining of transgene-expressing embryos (Figure 4A), larvae (Supplemental Figure 2) and adults (Figure 1).

[0064] The data are consistent with previous reports utilizing time-restricted expression of the activated Notch intracellular fragment (Nintra) during stages 9-10. This treatment abolished neuroblast delamination resulting in significant reduction or loss of Dac- positive MB neurons (Struhl et al., 1993; Hartenstein et al., 1994; Noveen et al., 2000). These specific effects, along with our data likely reflect the unique developmental program of MB intrinsic neurons. All MB neurons per brain hemisphere arise from four MBNBs and their progeny Ganglion Mother Cells (GMCs) (Ito et al., 1997a). MB neuroblasts are exceptional because unlike the rest of the CNS neuroblasts, they maintain their proliferative activity throughout development (Ito and Hotta, 1992). This predicts that early interference with the survival or developmental program of MBNBs would grossly alter MB intrinsic neuron number resulting in adults with vestigial and aberrant MBs. In agreement, expression of hTau transgenes throughout development does not yield significantly enhanced MB aberrations compared to its presence strictly during embryogenesis, indicating that MBNBs, GMCs or early embryonic MB neurons are specifically affected. The results indicate that hTau may promote MBNB quiescence, suppress their survival, or alter the fate of MBNBs and perhaps GMCs. Because the area typically occupied by the MBs in the embryo or the adult, appears devoid of cells exhibiting the characteristic "collapsed" morphology especially in the presumptive calycal area (Figure 1.2, 1.6, 1.24), it is unlikely that hTau alters the fate of MBNBs and early neurons.

[0065] In agreement, anti-Repo staining did not reveal supernumerary glia in that location (not shown). Loss of Dac -positive cells as early as from the MBne suggests that hTau accumulation may in fact result in their death. However, co-expression of the baculovirus anti-apoptotic protein p35 (Zhou et al., 1997) with 1N4R, or 2N4R did not alter perceptively the MB aberration phenotype (not shown). This indicates that apoptotic cell death of MBNBs or MB neurons is an unlikely explanation of the phenotype. Therefore, it appears that the hTau-dependent MB defects may result from suppression of MB progenitor cell proliferation. In agreement with the embryonic origin of the phenotype, 1N4R or other hTau isoforms expressed in MBs of late pupae and adults under c772, were not toxic (Figure 4B.1-4B.2). Similarly, the MBs appeared unaffected under 201 Y, a Gal4 driver expressed mostly during larval stages (Tettamanti et al., 1997).

[0066] In contrast, when htau ^1N4R was expressed in MBNBs and their progeny under the embryonic MBNB-expressing OK107 ((Zhu et al., 2006) and Supplemental Figure 3), animals with obvious deficits were obtained (Figure 4B). However, the MBs were not affected as grossly as under Elav, perhaps because of comparatively lower protein accumulation or delayed accumulation in MBNBs under OKI 07. As expected, 1N4R hTau limited to the ellipsoid body under driver c232 was not toxic for these neurons (Figure 4B.7- 4B.8). Similar results were obtained with the apparently more pathogenic (see below and Supplemental Figure 3), pseudo-hyper-phosphorylated E14 mutant of the 1N4R protein (Khurana et al., 2006).

[0067] hTau ^m4R~E14 and hTau ^2N4R, which consistently yielded Type 2-defects in the majority of animals, could be used experimentally as a non-chemical method of MB ablation (de Belle and Heisenberg, 1994) yielding earlier and possibly more extensive deficits.

[0068] Figure 3 is explained in more detail as follows: Carnoy's-fixed paraffin- embedded 5 μιη frontal sections are shown for all histological evaluations. (A) The transcriptional repressor GAL80 ^S in combination with Elav-Ga\4 was utilized to drive expression of \ AS-htau^1N4R specifically during the distinct Drosophila life stages as detailed in Materials and Methods. The morphology of the MBs in these animals was evaluated with the anti-Leonardo antibody and sections at the levels indicated on the left are shown. The sections on the top and bottom rows are from different sibling animals.

[0069] The \ AS-htau^1N4R was expressed throughout life (A), or only during embryogenesis (E), or from larval (L) or pupal (P) stages onwards as indicated. (B) Western blot indicating the presence of 1N4R hTau in the heads of animals expressing it from larval stages onward (L) or throughout life (A) and its distinct absence in adult animals which had expressed the transgene only during embryogenesis. The level of Syntaxin (Syx) was used as loading control. (C) Quantification of aberrant MB phenotypes upon limited hTau accumulation in animals raised as detailed in A. n> 20 animals examined per condition. (D) Determination of the critical period of 1N4R hTau or 2N4R hTau accumulation during embryogenesis which result in defective or ablated MBs. Severely aberrant MBs were observed in adult flies generated from embryos expressing hTau after the 4^th hour of embryogenesis at 29°C and becomes slightly more severe if accumulation of the protein continues up till 8 hours of embryogenesis at that temperature.

[0070] Figure 4 is explained in more detail as follows: (A) Embryos accumulating 1N4R hTau under £7av-Gal4 were stained with the anti-Dac to visualize the MB neuroectoderm (MBne) and their lineage during CNS development. Equivalent stacks of confocal images are shown after conversion to grayscale and inversion for clarity. Anterior to the Left. Expected location and identity of Dac -positive cells are as described by Noveen et al. (Noveen et al., 2000). Arrows point to Dac -positive cells (1, 4 and 7), while arrowheads (2, 3, 5, 6, 8, 9) indicate their absence or severe reduction. Absence of MBne cells and their progeny was apparent in hTAu accumulating stage 9 embryos in contrast to controls (Elav/+). Note that the adjacent cluster of Dac accumulating cells "para-MB neuroectoderm" (paraMBne) appeared largely unaffected.

[0071] Similar differences between control and experimental embryos were observed at stage 11-12 and 14, where there is marked absence of signal where the MBs (MB) were expected. However cells of the optic lobe (OL) primordium retain Dac staining and are found in their expected location. By stage 16 the MBs are apparent as Dac -positive clusters in the posterior of the CNS of control embryos (arrows), while they are severely reduced or nearly absent (arrowheads) in embryos accumulating 1N4R hTau. (B) Adult MB morphology examined in dissected brains co-expressing 1N4R hTau along with mCD80-GFP, or mCD80- GFP alone (+) under the indicated Gal4 drivers. The earliest known expression in the MBs under the relevant drivers is indicated. Stacked confocal images of GFP fluorescence were converted to gray scale and inverted to reveal detail.

[0072] Supplemental Figure 2 is explained in more detail as follows: Control 3^rd instar larval brains (top panels) stained with anti-Leonardo (green) and anti-Dac showing normal structure of the larval calyces (arrows) and abundance of Kenyon Cells (arrowheads).

In contrast, calyces and Kenyon Cells are not apparent in this 3 rd instar larva accumulating 1N4R hTau.

[0073] Supplemental Figure 3 is explained as follows: (A) Accumulation of mcD8GFP in the developing embryonic MBs under OKI 07 shown in these stacks of confocal images after conversion to grayscale and inversion for clarity. Anterior to the Left. Large arrows point to large cells likely MB neuroblasts and smaller arrows to their apparent progeny. Arrowhead indicates axonal-like tracks projecting anteriorly, consistent with early embryonic pedunculus formation. (B) Consistent with the early expression of OK107, severe deficits in adult MBs were observed upon expression of the phosphomimic mutant 1N4R^E14 hTau, but not under other late-expressing MB drivers and the ellipsoid body driver. Adult MB morphology was examined in dissected brains co-expressing 1N4R^E14 hTau and mCD80- GFP under the indicated Gal4 drivers. The stacked confocal images of GFP fluorescence were converted to gray scale and inverted to reveal detail.

[0074] Example 4: hTau hyper-phosphorylation disrupts MB development.

[0075] Previous reports suggest that as in human patients (Buee et al., 2000; Augustinack et al., 2002), hTau hyper-phosphorylation is necessary for its pathogenic effects in Drosophila (Khurana et al., 2006; Steinhilb et al., 2007a; Steinhilb et al., 2007b). To assess whether hTau hyper-phosphorylation is required to be toxic to the MBs, two highly modified 1N4R hTau transgenes were advantageously used. In the htau^1N4R~E14 transgene, 14 Serines and Threonines, most typically phosphorylated in cases of human pathology have been mutated to Glutamate mimicking permanent phosphorylation at these sites (Khurana et al., 2006; Steinhilb et al., 2007b). In contrast, the same Serines and Threonines have been mutated to Alanines in htau^^411'^ (Fulga et al., 2007), rendering these sites phosphorylation incompetent. Both mutant hTau transgenes were expressed under Elav at 25°C, or 29°C and MB morphology was assessed in 1-3 day old adults. The MBs were normal in control animals under both conditions (Figure 5A.1 and 5Α. Γ versus Figure 5A.2 and 5A.2'), but as expected 1N4R yielded modest and severe deficits at 25°C and 29°C respectively. 1N4R^E14 hTau at 25°C resulted in severe Type 2 phenotypes similar to those exhibited by elevated 1N4R at 29°C (Figure 5A.5 and 5A.5') and more extreme phenotypes displaying very few Leo-positive cells where the MBs would be expected (Figure 5A.6 and 5A.6'). Similar results were obtained if 1N4R^EM hTau was restricted specifically to early embryos using the TARGET system.

[0076] In contrast, the phosphorylation-suppressed 1N4R^AP protein did not precipitate any appreciable deficits at either temperature (Figure 5A.7, 5A.7', 5A.8, 5A.8'), although transgene expression was generally higher than that of htau^1N4R~E14. The extreme phenotypes observed with 1N4R^E14 compared to those yielded by 1N4R suggest that the WT hTau protein may be less extensively phosphorylated, at least on these 14 sites, during the phenocritical period, or the Glu subsitutions render the 1N4R^E14 protein more toxic. These results indicate that hyper-phosphorylation of hTau is essential for toxicity on developing MBs. However, even in the more extreme cases of 1N4R^E14 accumulation few MB neurons remained.

[0077] This indicates that as suggested above for WT hTau isoforms, MBNB proliferation seems to be suppressed rather than their survival. Toxicity of hTau in Drosophila is affected by Par-1 because it phosphorylates Ser²⁶² and Ser³⁵⁶, whose occupation facilitates (primes) phosphorylation at additional sites (Nishimura et al., 2004). This is particularly evident on Thr²¹² and Ser²¹⁴ (AT100 epitope), whose hyperphosphorylation is typically associated with human neurodegenerative conditions (Buee et al., 2000; Lee et al., 2001). Therefore, the contribution of these sites on MB toxicity was investigated by using transgenes where Ser²⁶² and Ser³⁵⁶ were mutated to Alanines (R406WS2A).

[0078] However, transgenes bearing these mutations were available in the 1N4R^R406W hTau mutant background (Nishimura et al., 2004), so the latter transgenics were used as controls. As expected, R406W accumulation precipitated deficits at 29°C (Figure 5B.1- 5B.4). In contrast, accumulation of R406WS2A was not toxic on MB development, even at 29°C, where transgene expression was elevated as expected (Figure 5B.5-5B.8). Therefore, phosphorylation of Ser²⁶² and Ser³⁵⁶ by Par-1 appears requisite for MB toxicity as is in the retina (Nishimura et al., 2004; Chatterjee et al., 2009). Furthermore, the MBs were examined in animals homozygous for the Elav driver and the UAS- htau^R406WS2A insertion, which contain R406WS2A levels far exceeding that in Elav/+; \ AS-htau^1N4R /+ animals (Supplemental Figure 4A).

[0079] Even these Elav; UAS- htau^R406WS2A animals retained normal MB morphology (Supplemental Figure 4B). Therefore, MB defects are not precipitated simply from a large hTau excess, arguing against non-specific toxicity as causal of the phenotype. Rather it seems that Tau toxicity on MBNBs depends strongly on its phosphorylation potentially on particular residues.

[0080] In addition, at the completion of this study, transgenic flies carrying the S262A and S356A mutations on 2N4R WT hTau (Chatterjee et al., 2009) were obtained. In agreement with the results with R406WS2A, pan-neuronal accumulation of 2N4RS2A at equal levels with the 2N4R controls (Supplemental Figure 4C), did not affect MB morphology (Supplemental Figure 4D). Therefore, phosphorylation of these two Par-1- targeted Serines seems critical for wild type and mutant hTau toxicity in the MBNBs.

[0081] Figure 5 is explained in more detail as follows: Carnoy's-fixed paraffin- embedded 5 μιη frontal sections are shown for all histological evaluations. (A) The left side columns display sections at the indicated levels from animals raised at 25°C, while the right column at from animals raised at 29°C. MBs remained intact in control flies raised at either temperature (1, ) versus (2, 2'). In contrast, the phenotype of 1N4R hTau was more severe at 29°C (4, 4') consistent with higher accumulation of the protein than in flies raised at 25°C (3, 3'). Flies accumulating the phosphomimic mutant 1N4R^E14 hTtau displayed severe MB perturbation at 25°C (5, 5') becoming even more severe at 29°C (6, 6').

[0082] In contrast, accumulation of the underphosphorylated 1N4R^AP hTau variant did not yield MB perturbations at 25°C (7, 7'), or at 29°C (8, 8'). (B) Type 1 MB alterations in a typical 1N4R^R406W hTau-accumulating animal and complete reversal of the phenotype in animals accumulating the 1N4R^R406WS2A hTau variant. Sections at the level the calyces (1 and 5), the Fan-Shaped Body (2 and 6), the Ellipsoid Body (3 and 7) and the lobes (4 and 8) are shown.

[0083] Supplemental Figure 4 is explained in more detail as follows: (A) Western blot from head lysates of Elav; \ AS- 1N4R^R406WS2A homozygotes (homo) expressing the mutant protein permanently displaying vast accumulation of the protein compared to Elav/+; U AS- 1N4R^R406WS2A /+ (het) and Elav; OAS-1N4R/+ animals. Syntaxin (Syx) was used as a loading control. (B) Frontal paraffin sections of Elav; U AS- 1N4R^R406WS2A heads challenged with anti-Leonardo do not exhibit structural alterations in the MBs. (C). Western blot from head lysates of Elav driven UAS-2N4R, compared with the \ AS-2N4R^S2A. The levels of the two proteins were equivalent in the lysates. (D). Frontal paraffin sections of Elav driven \JAS-2N4R^S2A heads challenged with anti-Leonardo do not exhibit structural alterations in the MBs.

[0084] Example 5: Novel mutations on 2N4R hTau suppress toxicity, but yield dysfunctional MBs. [0085] In contrast to WT hTau proteins, roughly equivalent expression of the btau transgene under Elav (Mershin et al., 2004; Grammenoudi et al., 2006), did not precipitate obvious MB defects (Figure 2 and (Mershin et al., 2004)). However, targeting bTau specifically to the adult MBs yielded learning and memory deficits, consistent with functional disruption of these neurons (Mershin et al., 2004). Sequence alignment of these two Tau proteins revealed high amino acid conservation, with differences largely concentrated at the amino-termini and the amino-terminal part of the Proline-Rich Domain (PRD). The remaining sequence appeared invariant except that in bTau, Alanines replaced Ser²³⁸ and

Thr 245 while a Gly replaced Val 248 in the carboxy-terminal part of the PRD and microtubule binding domain 1 of hTau respectively (Supplemental Figure 5 A). Because phosphorylation is essential for Tau-dependent MB toxicity, the studies concentrated initially on the potentially phosphorylatable residues Ser 238 and Thr 245.

[0086] Both residues are predicted targets of the atypical PKC-δ (http://networkin.info/search.php), but Thr²⁴⁵ has also been suggested a target of Rho-kinase in PC12 cells (Amano et al., 2003). Ser 238 and Thr 245 have actually been reported phosphorylated in samples from human AD patients by mass spectrometry (Sergeant et al., 2008), suggesting that they may play a role in neuronal dysfunction or degeneration. Nevertheless, these are novel sites inasmuch as they have not been studied functionally and were not altered in the 1N4R^E14 (Khurana et al., 2006), lN4R^AP(Steinhilb et al., 2007a) or the 2N4R^S11A (Chatterjee et al., 2009) trans genes. Therefore, these two amino-acids were changed in a FLAG-tagged WT 2N4R hTau to non-phosphorylatable Alanines yielding the 2N4R-STA FLAG-tagged protein. Histological evaluation of the MBs in adults expressing htau ^N4R~STA throughout development did not reveal obvious morphological defects, in contrast to animals harbouring the control 2N4R-FLAG-tagged protein (Figure 6A), although both proteins accumulated equivalently (Figure 6B). This surprising result demonstrates that blocking putative phosphorylation at two novel sites, previously not associated with Tau dependent pathogenesis, was sufficient to fully suppress 2N4R hTau toxicity on the MBs. Therefore it appears that Ser and Thr and potentially their phosphorylation are important for the toxic effects of hTau on the MBNBs. These results are also consistent with the lack of toxicity upon bTau accumulation, since these residues are Alanines in the bovine protein.

[0087] Although structurally intact, the MBs of htau^2N4R'STA -expressing flies could be dysfunctional as they are upon bTau accumulation (Mershin et al., 2004). Because the MBs are essential for learning and memory (Heisenberg, 2003; Davis, 2005), disruption of these processes constitutes a sensitive measure of their functional integrity (Skoulakis and Grammenoudi, 2006). Therefore, these animals were subjected to an olfactory associative learning task (Mershin et al., 2004).

[0088] Performance in this task was severely impaired for animals accumulating bTau compared to Elav and btau/+ heterozygous controls (Figure 6C). Heterozygotes did not exhibit behavioural deficits, demonstrating that transgene insertions are not causal of the phenotype. Significantly, accumulation of 2N4R^STA at equal levels with bTau also precipitated highly deficient learning compared to STA/+ animals, albeit not to the degree exhibited by flies expressing btau. A similar deficit was exhibited by an independent UAS- 2N4R^STA line (Supplemental Figure 5B). Test animals expressing htau ^N4R~FLAG were not tested because their structurally aberrant MBs were not expected to support associative learning (de Belle and Heisenberg, 1994), as shown for animals expressing other WT htau transgenes (Grammenoudi et al., 2008). Flies expressing htau^R406W, which harbour defective MBs were also reported (Grammenoudi et al., 2008) defective in this task. In contrast, although equally abundant in the CNS, animals accumulating the R406WS2A variant performed equally well with controls (Figure 6C). These results demonstrate that despite their apparent structural integrity, the presence approximately equal levels of bTau and 2N4R^STA, but not R406WS2A resulted in MB dysfunction.

[0089] Animals expressing btau and all other experimental strains exhibited normal avoidance of the electric foot-shock unconditioned stimulus (Supplemental Figure 5C), a necessary precondition for normal learning in this paradigm (Tully and Quinn, 1985). In contrast, £tow-expressing animals exhibited significantly lower avoidance of Octanol and somewhat elevated avoidance of Benzaldehyde. Octanol avoidance of flies accumulating 2N4R^STA was somewhat lower, but not significantly different from controls and responses to Benzaldehyde were normal (Figure 6D). It is not entirely clear whether and how enhanced Benzaldehyde avoidance may affect associative learning in this paradigm.

[0090] Nevertheless, the results suggest that at least part of the strong learning deficit of £tow-expressing animals is the result of impaired or altered olfactory responses. Since bTau accumulates pan-neuronally and given that its accumulation specifically within MBs results in their dysfunction (herein and Mershin et al., 2004), it is not surprising that it may also result in dysfunction of the olfactory system or higher order neurons mediating direct response to odours (Tanaka et al., 2004). The functional consequences of 2N4R^STA in the olfactory system were marginal if any. The greater dysfunction precipitated by bTau may also be the result of the additional differences between the two proteins, especially in their amino-terminal halves including the extensions, as illustrated in Supplemental Figure 5A. Nevertheless, it appears that replacing Ser and Thr with non-phosphorylatable residues rendered the effects of 2N4R-hTau more like those of bTau, yielding intact but dysfunctional MBs.

[0091] Figure 6 is explained in more detail as follows: (A) Carnoy's-fixed paraffin- embedded 5 μιη frontal sections are shown for all histological evaluations. MB morphology is shown in animals expressing pan-neuronally the pUAS-htau^2N4R~FLAG trans gene (WT) or the pUAS-htau^2N4R-^STA-^FLAG variant (STA) at the levels of the calyces (1, 2), pedunculus and ellipsoid body (3, 4), α/β lobes (5, 6) and the γ lobes (7, 8). The deficits in MB morphology in animals accumulating 2N4R-FLAG hTau were not apparent upon accumulation of the 2N4R-STA-FLAG protein. (B) A representative Western blot of head lysates from animals expressing the indicated Tau proteins pan-neuronally probed with the T46 anti-Tau antibody. Syntaxin (Syx) was used as loading control.

[0092] Quantification of the protein levels relative to that of WT (black bar arbitrarily set to 1) from three independent such blots. Statistical analysis did not reveal significant differences in the levels of these proteins. (C) Associative olfactory learning performance of animals accumulating Tau pan-neuronally that lack MB structural aberrations (gray bars) and their matching genetic controls of transgene insertion heterozygotes without the £7av-Gal4 driver (respective black bars) and driver heterozygotes alone (open bars), n > 8 for all genotypes. ANOVA indicated significant differences in performance (F₆, 68= 192.1491, pO.0001) and subsequent contrast analysis between control and experimental strains as indicated by the lines revealed highly significant differences (pO.0001 -asterisks) in the performance of bTau and htau^{2N4R~STA~FLAG} -expressing animals from their non-expressing respective controls, but not between animals expressing htau^R406W~S2A and their controls. (D) Olfactory acuity of Tau expressing animals relative to the Elav/+ controls measured as avoidance of the 3-Octanol and Benzaldehyde odors used in conditioning,. ANOVA for 3- Octanol avoidance indicated significant differences (F_{3; 32}= 5,4252, p<0.05). Subsequent Tukey HSD analysis at a=0.05 indicated that relative to controls only the performance of BTau accumulating animals was significantly different (asterisk). In contrast, ANOVA for Benzaldehyde avoidance did not indicate significant differences in performance (F_{3j 3}o = 2,6299, p<0.096).

[0093] Supplemental Figure 5 is explained in more detail as follows: (A) Protein sequence alignment of human and bovine Tau proteins. The first 10 residues at the amino- terminus of 2N4R which are unique to the human protein are not shown. Stars below the sequence denote conserved residues. The sequence for the microtubule binding domains is highlighted by gray shading. The two amino-acids changed in hTau to generate 1N4R-STA are in red and pointed out by the arrows. (B) Associative learning performance of two independent STA lines with n> 8. The performance of both STA lines was highly significantly different from that of control animals (p<0.001; ANOVA: F_2j 26 = 27,6544, p< 0.0001). (C) Avoidance of electric foot-shock as an assessment of acuity to that stimulus, n > 8. ANOVA did not indicate performance differences (F₃, ₃₄ = 0,8798, p< 0.4412).

[0094] Example 6: Effects of mutation on Tau PhosphorylationdTo investigate potential the effects of mutating Ser 238 and Thr 245 on Tau phosphorylation, 2N4R STA was tested for occupation of key sites typically involved in pathology and possibly pathogenesis in humans (Augustinack et al., 2002; Geschwind, 2003; Stoothoff and Johnson, 2005) and Drosophila (Nishimura et al., 2004; Steinhilb et al., 2007a; Steinhilb et al., 2007b). Given the lack of MB morphological deficits upon htau ^N4R~STA expression and the association of hyper- phosphorylation with toxicity and pathology, it was hypothesized that 2N4R^STA may be under-phosphorylated relative to 2N4R. Multiple independent quantitative Western blots represented in Figure 7A were quantified in Figure 7B. A different antibody (TAU5) targeting the PRD was used rather than the carboxy-terminus targeted T46 used previously (Figure 6B) to assess independently the levels of the two proteins.

[0095] The steady state level of 2N4R^STA was not significantly different than that of the 2N4R control (Figure 7B). The blots also demonstrate that as expected (Grammenoudi et al., 2006), the 2N4R protein was phosphorylated at epitopes at the AT8, AT100, pS262, pS356 and PHF (Figure 7A). Surprisingly however, phosphorylation of 2N4R^STA appeared significantly elevated over that of 2N4R at the AT8, AT100, pS262 and pS356 sites, while no change was detectable at the PHF epitope. Thus, in contrast to our hypothesis, the S238A and T245A mutations resulted in hyper-phosphorylation at the sites defined by the AT8, pS262 and pS356 antigenic sites, but also increased abnormal phosphorylation as detected by the AT 100 antibody which is typically associated with AD pathology in humans (Matsuo et al., 1994; Mailliot et al., 1998; Buee et al., 2000; Sergeant et al., 2005). Of the hTau isoforms that do not precipitate MB structural defects only R406WS2A was inefficiently phosphorylated at AT 100, in addition to the lack of phosphates at the mutated Ser²⁶² and Ser³⁵⁶ (Nishimura et al., 2004; Grammenoudi et al., 2006).

[0096] Interestingly, AT 100 and Ser³⁵⁶ are the sites which exhibited the highest phosphorylation on 2N4R^STA. Given the lack of learning deficits in R406WS2A and the strong impairment of htau ^N4R~STA expressing animals, it is possible that hyper- phosphorylation at these sites may result in dysfunction rather than toxicity of MB neurons. Consistent with this notion, bTau which contains Alanines at positions 238 and 245 is also phosphorylated at the epitopes with enhanced occupancy on 2N4R^STA. Notably, the AT 100 epitope is also occupied in bTau, strengthening the interpretation that this abnormal phosphorylation in the MBs is correlated with dysfunction rather than toxicity since neurons accumulating it appear intact.

[0097] These results then, are congruent with the notion that the mutations at Ser²³⁸ and Thr²⁴⁵ render the 2N4R hTau functionally similar to bTau (Figure 7C). Therefore, these mutations dissociate hTau toxicity on MB neuroblasts and dysfunction of adult MBs. Although in progress, the antibodies to unequivocally demonstrate occupation of Ser²³⁸ and Thr²⁴⁵ in the Drosophila CNS are currently lacking. Nevertheless, our data suggest that Ser²³⁸ and Thr²⁴⁵phosphorylations are required, probably in addition to hyper-phosphorylation at the known sites mentioned above, in the genesis of MB morphological defects. Hence, two novel sites on hTau likely implicated in the pathogenesis of Tauopathies were defined.

[0098] Figure 7 is explained in more detail as follows: (A) Representative Western blots from head lysates of flies accumulating 2N4R-FLAG (WT) and 2N4R-STA-FLAG (STA) probed with the antibodies indicated on the right. The level of Syntaxin (Syx) in the lysates was used as control for quantifications. The TAU-5 antibody measures total Tau in the lysates, while all others target particular phosphorylated residues. (B) Quantification of at least three independent blots and extracts as those shown in A. The syntaxin-normalized level of 2N4R-FLAG for each quantification was fixed to 1 and represented by the horizontal line. The bars then represent the mean relative levels (+ SEM) of 2N4R-STA-FLAG phosphorylated at the given sites, over that of the 2N4R-FLAG control. ANOVA indicated significant differences (F_{5; 18} = 358.527, pO.0001) and subsequent Tukey HSD at a=0.05 demonstrated that means marked by asterisks were significantly different from controls, except for those for the anti-TAU5 (total) and anti-PHF. (C) Representative Western blots from head lysates of animals accumulating BTau pan-neuronally in comparison to similar lysates from 2N4R-STA-accumulating animals, probed with the antibodies detecting enhanced occupation of particular sites in the latter protein.

[0099] The following materials and methods were used as needed in the Examples.

[00100] Drosophila culture and strains. Drosophila were cultured in sugar- wheat flour food supplemented with soy flour and CaC12 (Acevedo et al., 2007), at 25 C unless noted otherwise. All strains were treated with tetracycline for at least two generations prior to use (Clark et al., 2005) to be free of potential Wolbachia infection. The following fly strains were used: the pan-neural driver Elav^cl5t '-GAL4 (Robinow and White, 1988; Lin and Goodman, 1994) and £7av^//7-GAL4 on chromosome 3 were obtained from the Stock Centre, the GFP-expressing ellipsoid body driver (Yeh et al., 1995) c232:UAS- mCD80-GFP and MB driver UAS-mCD80-GFP; OKI 01 '-GAL4 were gifts of J-M Dura (University of Montpellier). Elav^C155- GAL4; tubGal80^ts was constructed by standard crosses. The human Tau transgenic strains UAS-htau^1N4R, UAS-htau^R406W , UAS-htau^V337M (Wittmann et al., 2001), UAS-htau^1N4R- ^E14 and UAS-htau^1N4R-^AP were provided by M. Feany (Harvard Medical School). UAS- htau^2N4R was a gift from J. Botas (Baylor College of Medicine), UAS-htau^0N3R (Mudher et al., 2004)was obtained from A. Mudher (University of Southampton), UAS-htau^R406WS2A (Nishimura et al., 2004) was obtained from B. Lu (Stanford University), while UAS- htau^2N4RS2A (Chatterjee et al., 2009) was a gift from G. R. Jackson (University of Texas Medical Branch) and UAS-btau was from K. Ito (Tokyo University) (Ito et al., 1997b). UAS- dtau transgenics were described previously (Mershin et al., 2004). To generate pUAS- htau^2N4R~FLAG , a fragment coding for the entire 2N4R hTAU was amplified from a human tau cDNA template using the GoTaq polymerase (Promega) and cloned into the Notl and Xbal sites of the pUAST-Flag vector. pUAST-Flag was generated by annealing the oligos: 5'AATTCATGGATTATAAGGACGA CGATGACAAGGC-3 ' and 5'-

GGCCGCCTTGTCATCGTCGTCCTTATAATCCATG-3 ' and inserting them between the EcoKl and Notl sites of pUAST (Brand and Perrimon, 1993). The pUAS-htau^{2N4R'STA ~FLAG} mutant was generated by replacing Ser 238 and Thr 245 with Ala using the QuickChange XL site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. The mutagenic oligonucleotides

[00101]

5 ' -CCAAGTCGCCGTCAGCTGCCAAGAGCCGCCTGCAGGCAGCCCCCG and

5 ' -CGGGGGCTGCCTGCAGGCGGCTCTTGGCAGCTGACGGCGACTTGG were annealed onto the pUAS-htau^2N4R~FLAG plasmid template and contained a silent PvuII restriction site for effective screening of positive clones. The sequence of the mutant was confirmed by dsDNA sequencing (Lark technologies). Transgenic flies were obtained with standard methods.

[00102] Spatiotemporal control of hTau accumulation. Eggs were collected on standard food at 20°C for 2 hours. After transferring the parents, the vials were immediately placed at 29°C for 14-15 hours to inactivate the Gal80^te protein and expression of the htau transgenes throughout embryogenesis. Following this transgene induction period, larvae and pupae were allowed to develop until adulthood without additional transgenic protein at 20°C. To induce the transgene specifically during larval stages, egg collection and embryonic development were allowed to proceed at 20°C as described above, then upon hatching and throughout larval development animals were kept at 29°C and switched back to 20°C upon pupariation. To determine the stage of embryonic development critical for MB ablation, flies were kept at 29°C and transferred to a new pre -warmed vial every hour. The vials containing eggs collected for 1 hour at 29°C, kept at that temperature for the prescribed time and then moved to 20°C and animals were allowed to develop at that temperature until adulthood. The MBs of resultant animals were examined in 2-5 day old adult flies, unless otherwise specified.

[00103] Histology. Immunohistochemistry on paraffin sections was performed essentially as described (Philip et al., 2001; Mershin et al., 2004). Rabbit anti-LEO (Skoulakis and Davis, 1996) was used at 1:4000 and anti-DRK at 1 : 1500. Sections from all strains were obtained and processed in parallel in each experiment and were evaluated for MB morphology without knowledge of the genotype. The anti-ELAV (Developmental Studies Hybridoma Bank) was used at 1:200 and anti-DAC at 1:8. For GFP detection in whole mount preparations, brains of adult flies were processed as described in Leyssen et al. (Leyssen et al., 2005) with minor modifications. Briefly, brains of C02 anesthetized flies or third instar larvae were dissected in PBS (0.04M NaH₂P0₄, 1M NaCl, pH 7.4), fixed for 20 min in 4% paraformaldehyde in PBS at room temperature, washed 3 times with PBS and mounted with DAKO Mounting medium (Dako Corp). Individual 2-3 μιη confocal sections were used to construct z-stacks. Control brains not expressing GFP, were used to set the iris and gain such as to eliminate auto-fluorescence. Embryos were fixed and stained according to standard protocols (Patel, 1994) and image z-stacks were obtained as described above.

[00104] Western blotting and Antibodies. For western blotting, Drosophila tissue (adult heads, embryos or larvae) were homogenized in lx Laemli buffer (50mM Tris pH 6.8, lOOmM DTT, 5% 2-mercaptoethanol, 2% SDS, 10% glycerol and 0,01% bromophenol blue), the extracts heated for 10 min at 95 C, centrifuged at 8000xg for 5 min and separated in SDS-acrylamide gels. Proteins were transferred to PVDF membranes and probed with mouse monoclonal anti-Tau 46 (Zymed laboratories), which targets the coarboxy -terminus of the protein at 1 :3000 and TAU5 (CalBiochem), which targets the PRD at 1 : 1000, AT100 (Pierce Endogen) at 1:250, the polyclonal antibodies anti-pS262, anti pS356 and PHF (Biosource) were used at 1:2000, while monoclonal antibody AT8 kindly provided by A. Mudher was used at 1 :200. To normalize for sample loading, the membranes were concurrently probed with an anti-syntaxin primary antibody (8C3, Developmental Studies Hybridoma Bank, University of Iowa) at a 1 :2000 dilution or anti-Tubulin at 1:500. Proteins were visualized with chemiluminescence.

[00105] Behavioral analyses. All experiments were performed balanced, so all genotypes involved in an experiment were tested per day and the experimenter was blind to the genotype. Olfactory learning and memory in the negatively reinforced paradigm coupling aversive odors as conditioned stimuli (CS+ and CS-) with the electric shock unconditioned stimulus (US) (Tully and Quinn, 1985) was performed essentially as described previously (Philip et al., 2001; Mershin et al., 2004). Olfactory and shock avoidance assays were performed as described (Mershin et al., 2004; Acevedo et al., 2007). The "3-minute memory" earliest post-training performance assessment is referred to as learning (Skoulakis and Davis, 1996). Data were analyzed parametrically with the JMP statistical package (SAS Institute Inc., Cary, NC) as described before (Philip et al., 2001; Mershin et al., 2004) and described in the text or figure legends.

[00106] The above results show, among other things, a novel type of hTau- dependent toxicity which occurs within a narrow temporal window early in embryogenesis and specifically targets MBNBs. Additionally, the results show that the ellipsoid body and remaining central brain neuropils were not affected by hTau in young flies. The anti-LEO antibody (Skoulakis and Davis, 1996) was used for the analysis, which unlike mass histology methods affords enhanced resolution of these neurons. Finally, based on previous observations (Grammenoudi et al., 2008), the effects of WT hTaus were the initial focus. In contrast, studies that concentrated on CNS vacuolization employed largely the R406W mutant (Wittmann et al., 2001; Dias-Santagata et al., 2007; Fulga et al., 2007), which precipitates milder MB phenotypes in a smaller proportion of animals (Table 1).

[00107] The data shown above (Figure 4 and Supplemental Figures 2, 3), show that accumulation of particular hTau isoforms in MBNBs does not seem to lead to apoptosis, or a change of developmental fate. The data show that hTau accumulation in MBNBs or their precursors disrupt protein complexes and processes requisite for asymmetric cell division, which permits MBNBs to continue generating GMCs and eventually the 2500 neurons of each MB. Premature normal cell cycle activation in the MBNBs and the consequent symmetrical divisions then result in loss of their stem cell properties (Doe, 2008), resulting in fewer GMCs and rarefaction of their descendant MB neurons. This is consistent with reports that hTau in the adult retina and the brain activates the cell cycle ectopically, resulting in apoptosis, a potential explanation of vacuolization (Khurana et al., 2006).

[00108] It is intriguing that blocking putative phosphorylation of the potential atypical PKC targets, Ser 238 and Thr 245 suppressed hTau MB toxicity. Atypical PKC is involved in establishing cell polarity, essential for the asymmetric divisions required to regulate self renewal as opposed to differentiation (Doe, 2008). The results are consistent with MBNBs in which hTau sequesters atypical PKC away from complexes requisite to maintain polarity and their self-renewal, or it interferes directly with the process. hTau toxicity on MBNBs may represent an analogous phenomenon in the fly, but manifested in the embryo because of their unique developmental properties (Ito et al., 1997a).

[00109] The data also show that phosphorylation on specific sites mediates Tau-dependent toxicity and dysfunction of the MBs. Hyper-phosphorylation of Tau, especially at particular sites, often used as diagnostic in human tauopathies is requisite for pathogenesis (Avila et al., 2004; Sargeant et al., 2008). Similarly, MBNB toxicity appears to require Tau hyper-phosphorylation as it is enhanced by the highly pathogenic phosphomimic 1N4R^E14 protein and suppressed by the under-phosphorylated 1N4R^AP (Figure 5). The data suggest that phosphorylation at specific sites, rather than hyper-phosphorylation per se, appears differentially implicated in Tau-mediated MB toxicity and dysfunction.

[00110] MBNB toxicity appears to require phosphorylation at Ser²⁶² and Ser³⁵⁶, possibly by Par-1 (Nishimura et al., 2004; Chatterjee et al., 2009) ,because blocking it in the context of the R406W mutation (Figure 5B and Supplemental Figure 4B), or WT 2N4R (Supplemental Figure 4D) yielded normal MBs. Par- 1 -targeted sites may also act as facilitators of further phosphorylation in the MBNBs.

[00111] The data also show that hTau-dependent MBNB toxicity requires novel phosphorylations at Ser 238 and Thr 245 , because blocking them by substituting alanines eliminated MB aberrations. Congruently, the equivalent sites in bTau, which is not toxic on the MBNBs, lack phosphorylatable residues further underscoring the importance of these phosphorylations for pathology. However these sites appear implicated in Tau-mediated dysfunction because although the MBs are intact in flies accumulating 2N4R^STA, they are unable to support normal associative learning (Figure 6B). Surprisingly, phosphorylation at epitopes typically associated with toxicity and neurodegeneration such as AT8, AT 100 and the Par-1 targets Ser²⁶² and Ser³⁵⁶, was elevated in these animals (Figure 7A).

[00112] Therefore, it appears that putative phosphorylation on Ser 238 and Thr 245 normally suppresses at least in part, phosphorylation at these epitopes and therefore their blockade by alanines yields the observed enhanced phosphorylation on 2N4R^STA. Nevertheless, hyperphosphorylation at these sites though necessary (Nishimura et al., 2004; Chatterjee et al., 2009), was not sufficient for MBNB toxicity without the putative Ser²³⁸ and Thr²⁴⁵ occupation. Therefore, two novel putatively phosphorylated residues apparently essential for the toxicity and neurodegeneration associated with excess Tau accumulation in Drosophila and possibly in human patients as well were identified. Tau toxicity was also disassociated from dysfunction in Drosophila by blocking Ser²³⁸ and Thr²⁴⁵ phosphorylation. These sites are involved in pathology or behavioural deficits associated with human Tauopathies.

[00113] Interestingly, these results suggest that hyperphosphorylation of AT8, AT 100, pS262 and pS356 does not always precipitate toxicity and neurodegeneration. Rather their effects may depend on positive and negative contribution of additional Tau phosphorylations, possibly the temporal order of phosphorylations and the neuronal type where they occur. In the absence of Ser²³⁸ and Thr²⁴⁵ phosphorylation enhanced occupation of these sites leads to dysfunctional MBs. In the context of the intact adult MB neurons of 2N4R -accumulating flies, the data suggest that augmented phosphorylation at Ser /Ser and the consequent AT 100 occupation are involved in the Tau-mediated learning deficits. This is supported by the lack of learning deficits by animals accumulating R406WS2A protein (Figure 6C), where blockade of Ser²⁶² and Ser³⁵⁶ phosphorylation results in suppressed phosphorylation at AT 100 (Grammenoudi et al., 2006). Thus, these sites whose phosphorylation has been linked to toxicity in the fly retina and are thought of clinical relevance in human AD patients, may have distinct roles in dysfunction and degeneration in the context of additional Tau phosphorylation at particular sites and the cellular context where these occur. It is possible that if fly and human neurons accumulating Tau, phosphorylation at Ser 23 § /Thr 245 may follow occupation of Ser 202 /Ser 35ό and AT 100, perhaps reflecting the transition from dysfunctional to degenerating neurons, or they may occur independently.

[00114] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments of the invention have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments of the invention can be practiced with modification within the spirit and scope of the appended claims.

[00115] Each of the applications and patents cited in this text, as well as each document or reference cited in each of the applications and patents (including during the prosecution of each issued patent; "application cited documents"), and each of the PCT and foreign applications or patents corresponding to and/or claiming priority from any of these applications and patents, and each of the documents cited or referenced in each of the application cited documents, are hereby expressly incorporated herein by reference in their entirety. More generally, documents or references are cited in this text, either in a Reference List before the claims; or in the text itself; and, each of these documents or references ("herein-cited references"), as well as each document or reference cited in each of the herein- cited references (including any manufacturer's specifications, instructions, etc.), is hereby expressly incorporated herein by reference.

References

Acevedo S, Froudarakis E, Tsiorva A, Skoulakis EMC (2007) Distinct neuronal circuits mediate experience-dependent, non-associative osmotactic responses in Drosophila. Mol Cell Neurosci 34:378-389.

Alonso Adel C, Mederlyova A, Novak M, Grundke-Iqbal I, Iqbal K (2004) Promotion of hyperphosphorylation by frontotemporal dementia tau mutations. J Biol Chem 279:34873- 34881.

Amano M, Kaneko T, Maeda A, Nakayama M, Ito M, Yamauchi T, Goto H, Fukata Y, Oshiro N, Shinohara A, Iwamatsu A, Kaibuchi K (2003) Identification of Tau and MAP2 as novel substrates of Rho-kinase and myosin phosphatase. J Neurochem 87:780-790.

Augustinack JC, Schneider A, Mandelkow EM, Hyman BT (2002) Specific tau phosphorylation sites correlate with severity of neuronal cytopathology in Alzheimer's disease. Acta Neuropathol (Berl) 103:26-35.

Avila J, Lucas JJ, Perez M, Hernandez F (2004) Role of tau protein in both physiological and pathological conditions. Physiol Rev 84:361-384.

Berger C, Renner S, Luer K, Technau GM (2007) The commonly used marker ELAV is transiently expressed in Neuroblasts and glial cells inthe Drosophila embryonic CNS. Dev Dynamics 236:3562-3568.

Brand AH, Perrimon N (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415.

Buee L, Bussiere T, Buee-Scherrer V, Delacourte A, Hof PR (2000) Tau protein isoforms, phosphorylation and role in neurodegenerative disorders. Brain Res Brain Res Rev 33:95- 130.

Chatterjee S, Sang TK, Lawless GM, Jackson GR (2009) Dissociation of tau toxicity and phosphorylation: role of GSK-3beta, MARK and Cdk5 in a Drosophila model. Hum Mol Genet 18: 164-177.

Chee F, Mudher A, Cuttle MF, Newman TA, MacKay D, Lovestone S, Shepherd D (2005) Overexpression of tau results in defective synaptic transmission in Drosophila neuromuscular junctions. Neurobiol Dis 20:918-928.

Clark ME, Anderson CL, Cande J, Karr TL (2005) Widespread Prevalence of Wolachia in laboratory stocks and the implications for Drosophila research. Genetics 170: 1667-1675.

Crittenden JR, Skoulakis EM, Han KA, Kalderon D, Davis RL (1998) Tripartite mushroom body architecture revealed by antigenic markers. Learn Mem 5:38-51.

Davis RL (2005) Olfactory memory formation in Drosophila: From Molecular to systems Neuroscience. Annu Rev Neurosci 28:275-302. de Belle JS, Heisenberg M (1994) Associative odor learning in Drosophila abolished by chemical ablation of mushroom bodies. Science 263:692-695.

Delacourte A (2005) Tauopathies: recent insights into old diseases. Folia Neuropathologica 43:244-257.

DeTure M, Ko L, Yen S, Nacharaju P, Easson C, Lewis J, van Slegtenhorst M, Hutton M (2000) Missense tau mutations identified in FTDP-17 have a small effect on tau-microtubule interactions. Brain Res 853:5-14.

Dias-Santagata D, Fulga TA, Duttaroy A, Feany MB (2007) Abnormal bundling and accumulation of F-actin mediates tau-induced neuronal degeneration in vivo. J Clin Invest 117:236-245.

Doe CQ (2008) Neural stem cells: balancing self-renewal with differentiation. Development 135: 1575-1587.

Fulga TA, Elson-Schwab I, Khurana V, Steinhilb ML, Spires TL, Hyman BT, Feany MB (2007) Abnormal bundling and accumulation of F-actin mediates tau-induced neuronal degeneration in vivo. Nat Cell Biol 9: 139-148.

Geschwind DH (2003) Tau phosphorylation, tangles, and neurodegeneration: the chicken or the egg? Neuron 40:457-460.

Ghosh S, Feany MB (2004) Comparison of pathways controlling toxicity in the eye and brain in Drosophila models of human neurodegenerative diseases. Hum Mol Genet 13:2011-2018.

Goedert M (2005) Tau gene mutations and their effects. Mov Disord 20 Suppl 12:S45-52.

Grammenoudi S, Kosmidis S, Skoulakis EM (2006) Cell type-specific processing of human Tau proteins in Drosophila. FEBS Lett 580:4602-4606.

Grammenoudi S, Anezaki M, Kosmidis S, Skoulakis EMC (2008) Modeling Cell and Isoform type specificity of Tauopathies in Drosophila In: SEB Exp. Biol. Ser. (Mudher A, Chapman T, eds), pp 39-56: Taylor and Francis.

Hartenstein V, Younosi-Hartenstein A, Levken A (1994) Delamination and division in the Drosophila neuroectoderm: Spatio-temporal pattern, cytoskeletal dynamics, and common control by neurogenic and segment polarity genes. Dev Biol 165:480-499.

Heisenberg M (2003) Mushroom body memoir: from maps to models. Nat Rev Neurosci 4:266-275.

Ishihara T, Zhang B, Higuchi M, Yoshiyama Y, Trojanowski JQ, Lee VM (2001) Age- dependent induction of congophilic neurofibrillary tau inclusions in tau transgenic mice. Am J Pathol 158:555-562.

Ito K, Hotta Y (1992) Proliferation pattern of postembryonic neuroblasts in the brain of Drosophila melanogaster. Dev Biol 149: 134-148.

Ito K, Awano W, Suzuki K, Hiromi Y, Yamamoto D (1997a) The Drosophila mushroom body is a quadruple structure of clonal units each of which contains a virtually identical set of neurones and glial cells. Development 124:761-771.

Ito K, Sass H, Urban J, Hofbauer A, Schneuwly S (1997b) GAL4-responsive UAS-tau as a tool for studying the anatomy and development of the Drosophila central nervous system. Cell Tissue Res 290: 1-10.

Jackson GR, Wiedau-Pazos M, Sang TK, Wagle N, Brown CA, Massachi S, Geschwind DH (2002) Human wild-type tau interacts with wingless pathway components and produces neurofibrillary pathology in Drosophila. Neuron 34:509-519. Khurana V (2008) Modeling Tauopathy in the fruit fly Drosophila melanogaster. J Alzheimers Dis 15:541-553.

Khurana V, Lu Y, Steinhilb ML, Oldham S, Shulman JM, Feany MB (2006) TOR-mediated cell-cycle activation causes neurodegeneration in a Drosophila tauopathy model. Curr Biol 16:230-241.

Kimura T, Yamashita S, Fukuda T, Park JM, Murayama M, Mizoroki T, Yoshiike Y, Sahara N, Takashima A (2007) Hyperphosphorylated tau in parahippocampal cortex impairs place learning in aged mice expressing wild-type human tau. EMBO J 26:5143-5152.

Lee VM-Y, Goedert M, Trojanowski JQ (2001) Neurodegenerative tauopathies. Annu Rev Neurosci 24: 1121-1159.

Lee VM, Kenyon TK, Trojanowski JQ (2005) Transgenic animal models of tauopathies. Biochim Biophys Acta 1739:251-259.

Leyssen M, Ayaz D, Hebert S, Reeve S, De Strooper B, Hassan BA (2005) Amyloid precursor protein promotes post-developmental neurite arborization in teh Drosophila brain. EMBO J 24:2944-2955.

Lin DM, Goodman CS (1994) Ectopic and increased expression of Fasciclin II alters motoneuron growth cone guidance. Neuron 13:507-523.

Mailliot C, Bussiere T, Caillet-Boudin ML, Delacourte A, Buee L (1998) Alzheimer-specific epitope of AT 100 in transfected cell lines with tau: toward an efficient cell model of tau abnormal phosphorylation. Neurosci Lett 255: 13-16.

Martini SR, Davis RL (2005) The dachshund gene is required for the proper guidance and branching of mushroom body axons in Drosophila melanogaster. J Neurobiol 64: 133-144.

Martini SR, Roman G, Meuser S, Mardon G, Davis RL (2000) The retinal determination gene, dachshund, is required for mushroom body cell differentiation. Development 127:2663- 2672.

Matsuo ES, Shin R-W, Billingsley ML, Van deVoorde A, O'Connor M, Trojanowski JQ, Lee VM-Y (1994) Biopsy-derived adult human brain tau is phosphorylated at many of the same sites as Alzheimer's disease paired helical filament tau. Neuron 13:989- 1002.

McGuire SE, Mao Z, Davis RL (2004) Spatiotemporal gene expression targeting with the TARGET and gene-switch systems in Drosophila. Sci STKE 2004:pl6.

McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL (2003) Spatiotemporal rescue of memory dysfunction in Drosophila. Science 302: 1765-1768.

Menzel R (2001) Searching for the memory trace in a mini-brain, the honeybee. Learn Mem 8: 173-181.

Mershin A, Pavlopoulos E, Fitch O, Braden BC, Nanopoulos DV, Skoulakis EM (2004) Learning and memory deficits upon TAU accumulation in Drosophila mushroom body neurons. Learn Mem 11 :277-287.

Moressis A, Friedrich AR, Pavlopoulos E, Davis RL, Skoulakis EMC (2009) A dual role for the adaptor protein DRK in Drosophila olfactory learning and memory. J Neurosci 29:2611- 2625.

Mudher A, Shepherd D, Newman TA, Mildren P, Jukes JP, Squire A, Mears A, Drummond JA, Berg S, MacKay D, Asuni AA, Bhat R, Lovestone S (2004) GSK-3beta inhibition reverses axonal transport defects and behavioural phenotypes in Drosophila. Mol Psychiatry 9:522-530.

Nishimura I, Yang Y, Lu B (2004) PAR-1 kinase plays an initiator role in a temporally ordered phosphorylation process that confers tau toxicity in Drosophila. Cell 116:671-682.

Noveen A, Daniel A, Hartenstein V (2000) Early development of the Drosophila mushroom body: the roles of eyless and dachshund. Development 127:3475-3488.

Patel NH (1994) Imaging neuronal subsets and other cell types in whole-mount Drosophila embryos and larvae using antibody probes. Methods Cell Biol 44:445-487.

Philip N, Acevedo S, Skoulakis EMC (2001) Conditional rescue of olfactory learning and memory defects in mutants of the 14-3-3 gene leonardo. J Neuroscience 21 :8417-8425.

Plattner F, Angelo M, Giese KP (2006) The roles of cyclin-dependent kinase 5 and glycogen synthase kinase 3 in tau hyperphosphorylation. J Biol Chem 281 :25457-25465.

Raabe T, Clemens-Richter S, Twardzik T, Ebert A, Gramlich G, Heisenberg M (2004) Identification of mushroom body miniature, a zinc-finger protein implicated in brain development of Drosophila. Proc Natl Acad Sci U S A 101 : 14276-14281.

Reed LA, Wszolek ZK, Hutton M (2001) Phenotypic correlations in FTDP-17. Neurobiol Aging 22:89-107.

Robinow S, White K (1988) The locus elav of Drosophila melanogaster is expressed in neurons at all developmental stages. Dev Biol 126:294-303.

Robinow S, White K (1991) Characterization and spatial distribution of the ELAV protein during Drosophila melanogaster development. J Neurobiol 22:443-461.

Sang TK, Jackson GR (2005) Drosophila models of neurodegenerative disease. NeuroRx 2:438-446.

Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson M, Guimaraes A, DeTure M, Rams den M, McGowan E, Forster C, Yue M, Orne J, Janus C, Mariash A, Kuskowski M, Hyman B, Hutton M, Ashe KH (2005) Tau suppression in a neurodegenerative mouse model improves memory function. Science 309:476-481.

Schindowski K, Bretteville A, Leroy K, Begard S, Brion JP, Hamdane M, Buee L (2006) Alzheimer's disease-like tau neuropathology leads to memory deficits and loss of functional synapses in a novel mutated tau transgenic mouse without any motor deficits. Am J Pathol 1691215991616.

Sergeant N, Delacourte A, Buee L (2005) Tau protein as a differential biomarker of tauopathies. Biochim Biophys Acta 1739: 179-197.

Sergeant N, Bretteville A, Hamdane M, Caillet-Boudin ML, Grognet P, Bombois S, Blum D, Delacourte A, Pasquier F, Vanmechelen E, Schraen-Maschke S, L. B (2008) Biochemistry of Tau in Alzheimer's disease and related neurological disorders. Expert Rev Proteomics 5:207- 224.

Shiarli AM, Jennings R, Sh iJ, Bailey K, Davidson Y, Tian J, Bigio EH, Ghetti B, Murrell JR, Delisle MB, Mirra S, Crain B, Zolo P, Arima K, Iseki E, Murayama S, Kretzschmar H, Neumann M, Lippa C, Halliday G, Mackenzie J, Khan N, Ravid R, Dickson D, Wszolek Z, Iwatsubo T, Pickering-Brown SM, Mann DM (2006) Comparison of extent of tau pathology in patients with frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), frontotemporal lobar degeneration with Pick bodies and early onset Alzheimer's disease. Neuropathol Appl Neurobiol 32:374-387.

Skoulakis EM, Davis RL (1996) Olfactory learning deficits in mutants for leonardo, a Drosophila gene encoding a 14-3-3 protein. Neuron 17:931-944.

Skoulakis EMC, Grammenoudi S (2006) Dunces and da Vincis: the genetics of learning and memory in Drosophila. Cell Mol Life Sci 63:975-988.

Steinhilb ML, Dias-Santagata D, Fulga TA, Felch DL, Feany MB (2007a) Tau phosphorylation sites work in concert to promote neurotoxicity in vivo. Mol Biol Cell 18:5060-5068.

Steinhilb ML, Dias-Santagata D, Mulkearns EE, Shulman JM, Biernat J, Mandelkow EM, Feany MB (2007b) S/P and T/P phosphorylation is critical for tau neurotoxicity in Drosophila. J Neurosci Res 85: 1271-1278.

Stoothoff WH, Johnson GV (2005) Tau phosphorylation: physiological and pathological consequences. Biochim Biophys Acta 1739:280-297.

Strausfeld NJ (1976) Atlas of an Insect Brain. New York: Springer-Verlag.

Strausfeld NJ, Sinakevitch I, Vilinsky I (2003) The mushroom bodies of Drosophila melanogaster: an immunocytological and golgi study of Kenyon cell organization in the calyces and lobes. Microsc Res Tech 62: 151-169.

Struhl G, Fitzgerald K, Greenwald I (1993) Intrinsic activity of the Lin-12 and Notch intracellualr domains in vivo. Cell 74:331-345.

Tanaka NK, Awasaki T, Shimada T, Ito K (2004) Integration of chemosensory pathways in the Drosophila second-order olfactory centers. Curr Biol 14:449-457.

Tettamanti M, Armstrong JD, Endo K, Yang MY, Furukubo-Tokunaga K, Kaiser K, Reichert H (1997) Early development of the Drosophila mushroom bodies, brain centres for associative learning and memory. Dev Genes Evol 207 242—252.

Thomas BJ, Wassarman DA (1999) A fly's eye view of biology. Trends Genet 15: 184-190.

Thompson A, Boekhoorn K, Van Dam AM, Lucassen PJ (2008) Changes in adult neurogenesis in neurodegenerative diseases: cause or consequence? Genes Brain Behav Suppl 1:28-42.

Trojanowski JQ, Lee VM (2005) Pathological tau: a loss of normal function or a gain in toxicity? Nat eurosci 8: 1136-1137.

Tully T, Quinn WG (1985) Classical conditioning and retention in normal and mutant Drosophila melanogaster. J Comp Physiol [A] 157:263-277.

Tzortzopoulos A, Skoulakis EMC (2007) Paternally and maternally transmitted GAL4 transcripts contribute to UAS transgene expression in early Drosophila embryos. Genesis 177:239-253.

Wittmann CW, Wszolek MF, Shulman JM, Salvaterra PM, Lewis J, Hutton M, Feany MB (2001) Tauopathy in Drosophila: neurodegeneration without neurofibrillary tangles. Science 293:711-714.

Yeh E, Gustafson K, Boulianne GL (1995) Green fluorescent protein as a vital marker and reporter of gene expression in Drosophila. Proc Natl Acad Sci U S A 92:7036-7040.

Younosi-Hartenstein A, Nassif C, Hartenstein V (1996) Early neurogenesis of the Drosophila brain. J Comp Neur 370:313-329.

Zhou L, Schnitzler A, Agapite J, Schwartz LM, Steller H, Nambu JR (1997) Cooperative functions of the reaper and head involution defective genes in the programmed cell death of Drosophila central nervous system midline cells. Proc Natl Acad Sci U S A 94:5131-5136.

Zhu S, Lin S, Kao CF, Awasaki T, Chiang AS, Lee T (2006) Gradients of the Drosophila Chinmo BTB-zinc finger protein govern neuronal temporal identity. Cell 127:409-422.

Claims

1. An isolated antibody that specifically binds human tau protein phosphorylated at one or more of Ser²³⁸ and Thr²⁴⁵ , wherein the antibody specifically binds (i) an epitope contained within amino acid residues 210-275 of SEQ ID NO: 1 in which at least one of Ser²³⁸ and Thr²⁴⁵ is phosphorylated; or (ii) an epitope contained within an immunogenic fragment thereof.

2. A hybridoma cell line that produces the antibody of claim 1.

3. An immunogenic composition capable of generating an antibody which distinguishes between phosphorylated and dephosphorylated human tau comprising: (a) a human tau peptide of between about 5 to 20 amino acid residues of residues 210-275 of SEQ ID NO: 1 in which at least one of Ser and Thr is phosphorylated, wherein the human tau peptide is conjugated to (b) a earner molecule, wherein the carrier molecule induces or enhances an immune response to the human tau peptide.

4. A kit for detecting a tauopatby in a subject, the kit comprising the antibody of claim 1 and directions for using the kit.

5. A method for obtaining the antibody of claim 1 , the method comprising the steps of administering the immunogenic composition of claim 3 to an animal, obtaining a biological sample from the animal and detecting presence of an immune complex comprising the tau polypeptide and an antibody in the sample; and isolating the antibody from the animal.

6. A method for detecting presence or susceptibility to a tauopathy in a subject, the method comprising the steps of: a) contacting the antibody of claim 1 with a biological sample obtained from the subject under conditions sufficient to form an immune complex between the antibody and any tau protein phosphorylated at one or more of Ser³⁸ and Thr²⁴⁵in the sample; and b) detecting presence of the immune complex as being indicative of the presence of or susceptibility to the tauopathy in the subject.

7. The method according to claim 6. wherein the tauopathy is Alzheimer's disease, Pick's disease, frontotemporal Dementia with Parkinsonism of chromosome 17 (FTDP- 17), corticobasal Degeneration (CBD), progressive Supranuclear Palsy (PSP), argyrophylic Grain Disease (AGD).

8. A method for detecting an agent capable of treating, preventing or reducing the severity of a tauopathy in a subject, the method comprising the steps of: (a) contacting a candidate agent with a transgenic fly expressing human tau protein comprising phosphorylated amino acids at one or more of Ser²³⁸ and Thr²⁴⁵; and (b) observing a selected phenotype of the transgenic fly; wherein, a difference in the observed phenotype between the transgenic fly contacted with the candidate agent and (i) a first control transgenic fly not contacted with the candidate agent and (ii) a second control transgenic fly comprising human tau protein incapable of being phosphorylated at one or more of SER²³⁸ and Thr²⁴⁵ is indicative of an agent active in treating, preventing or reducing the severity of the tauopathy in the subject.