WO2011042547A1

WO2011042547A1 - Myometrial-derived mesenchymal stem cells and uses thereof

Info

Publication number: WO2011042547A1
Application number: PCT/EP2010/065119
Authority: WO
Inventors: Beatriz GONZÁLEZ GÁLVEZ; Juan Carlos RODRÍGUEZ CIMADEVILLA
Original assignee: Projech Science To Technology, S.L.
Priority date: 2009-10-08
Filing date: 2010-10-08
Publication date: 2011-04-14
Also published as: EP2558570A1

Abstract

The present invention relates to methods of isolating adult stem cells, to the cells thus isolated and to applications thereof. More specifically, the invention relates to isolated adult stem cells which are derived from the myometrium, which can be differentiated into many different mesoderm tissues types, including smooth muscle, adipocytes,osteoblasts, skeletal muscle and neural tissue thus, making them suitable for regenerative medicine.

Description

MYOMETRIAL-DERIVED MESENCHYMAL STEM CELLS AND USES

THEREOF

FIELD OF THE INVENTION

The invention relates to methods of isolating adult stem cells, to the cells thus isolated and to applications thereof. More specifically, the invention relates to isolated adult stem cells which are derived from the myometrium, which can be differentiated and give rise to a series of cell lineages and which present specific markers, such as cell surface antigens. The cells provided by the present invention can be used, for example, in cell therapy and in the search for and development of novel medicaments.

BACKGROUND OF THE INVENTION

Currently, technological development in the field of stem cell research has led them to be considered a promising source of organs and tissues for those types of pathologies requiring organ or tissue transplants. Indeed, stem cell therapy holds tremendous promise for repair and/or regeneration of aging and damaged tissue.

Theoretically, the stem cells can undergo cellular division for self-maintenance during an unlimited period of time to originate phenotypically and genotypically identical cells. Furthermore, they have the capacity to differentiate between one or several cell types in the presence of certain signals or stimuli.

The generation of organs and cells from the stem cells of the patient or from immunocompatible heterologous cells, so that the immune system of the recipient does not recognise them as foreign, offers a series of associated advantages that solve the problems brought on by the scarcity of donors and the risk of rejection. The use of stem cells for organ and tissue regeneration constitutes a promising alternative therapy for diverse human pathologies including: chondral, bone and muscular lesions, neurodegenerative diseases, immunological rejection, cardiac disease and skin disorders.

In addition to cellular therapy applications, stem cells have many other potential applications related to biomedical technologies that can help to facilitate biopharmaceutical research and development activities. One of these applications lies in the development of cellular models of human and animal diseases that can help to substantially improve the celerity and efficacy of the process of searching for and developing new drugs. At this time, the methods most commonly used to measure the biological activity of a new compound before it goes into clinical trials consist of incomplete biochemical techniques or costly and inadequate animal models. Stem cells could be a potential source of virtually unlimited quantities of cells, both undifferentiated and differentiated, for conducting in vitro tests to search for and develop new therapeutic compounds and to determine their activity, metabolism and toxicity. The development of such tests, particularly high-throughput screening (HTS), would reduce the time and money needed to develop compounds with therapeutic activity, eliminate, to a large extent, the need to use animals for experimentation and would also reduce the exposure of patients to the adverse effects of the compounds during clinical trials. In addition, the availability of different types of cells from various individuals would provide a better understanding of the effects of a potentially therapeutic compound on a specific individual, leading to the full development of the pharmacogenomic field, where the activity of a compound would be correlated with the individual's genetic structure. The stem cells and their differentiated progeny are also very valuable in the process of searching for and characterising new genes involved in a wide variety of biological processes including development, cellular differentiation and neoplastic processes.

Depending on the origin of the stem cells, we can differentiate between embryonic stem cells (ES cells) and adult stem cells. The ES cells come from the internal cellular mass of the blastocyte and their most relevant feature is the fact that they are pluripotential, which means that they can give rise to any adult tissue derived from the three embryonic layers. Adult stem cells are partially compromised cells present in adult tissue which can remain in the human body for decades although they become scarcer with the passage of time.

Despite the high pluripotentiality of ES stem cells, therapies based on the use of adult stem cells offer a series of advantages over those based on ES cells. First of all, it is complicated to control the culturing conditions of ES cells without inducing their differentiation, which raises the economic cost and the work required to use these types of cells. Furthermore, ES cells must go through several intermediate stages before they become the specific cell type needed to treat a particular pathology, a process that is controlled by chemically complex compounds. There are also problems related to the safety of the therapeutic use of ES cells due to the high probabilities that the undifferentiated stem cells from embryonic tissue will produce a type of tumour known as teratocarcinoma. Finally, the cells derived from ES cells are usually rejected by the immunological system due to the fact that the immunological profile of such cells differs from that of the recipient. Although this problem could be addressed by using a process known as "therapeutic cloning", in which autologous ES cells can be obtained by transferring the nucleus of a somatic cell from a patient to the ovocyte of a female donor, this technique has not yet been developed in humans and poses serious ethical and legal problems. Another solution could be the generation of "universal" cellular lines with generalised immune compatibility, but there is no technology at this time that allows obtaining such cells.

On the contrary, adult stem cells are not rejected by the immune system if obtained by autologous transplant. Furthermore, the fact that they are partially compromised reduces the number of differentiation stages necessary to generate specialised cells. In addition, the use of this type of cells is not associated with any type of legal or ethical controversy. Moreover, although these types of cells have less differentiation potentiality than ES cells, most of them are really multipotent which means that they can be differentiated to more than one type of tissue. What this suggests is that if an adequate source of adult stem cells is obtained, we could provide different cell types capable or covering multiple therapeutic applications.

A new type of mammal stem cell called "Multipotent Adult Progenitor Cell" (MAPC) was recently isolated from bone marrow and other tissues. This type of stem cells appears to be the progenitor of the so-called mesenchymal stem cells and shows a great deal of multipotentiality. However, the process of isolating and cultivating them is long and costly, and it includes the use of large quantities of diverse growth factors. In the last several years many different types of mesoderm stem cells have been isolated from both mouse and human tissues and characterized to different extent. These include endothelial progenitor cells (EPC), multipotent adult progenitor cells (MAPC), side population cells (SP), mesoangioblasts, stem/progenitor cells from muscle endothelium, sinovia, dermis, and adipose tissue. Different experimental procedures, different sources and partial characterization still prevent a complete understanding of the heterogeneity of these cells; even less is known on their origin and possible lineage relationships. Whatever the case, many of these cells, such as MDSC or MAPC have been shown to differentiate into skeletal muscle in vitro. Some of these cells grow extensively in vitro but others such as EPC and SP do not; on the other hand EPC and SP can circulate whereas systemic delivery has not been tested for most of the other cell types. For example, it was recently shown that cells isolated from adipose tissue can be grown in vitro extensively, differentiate into several tissues including skeletal muscle and give rise to human dystrophin expressing fibers. But few of these cells can differentiate efficiently to other cells types or be obtained and grow easily.

There is, therefore, a need to obtain an easily available source of multipotent stem cells. In particular, cells that can be easily isolated from a live subject without involving significant risk or pain, without high isolation and culturing costs and with minimal contamination from other cell types and not possessing the fear of karyotypic abnormalities during culture and possibility of oncogenesis.

Document EP 1876233 describes the isolation of a cell population which originate in an endometrial tissue or from an endometrial tissue isolated from a menstrual blood, a cord blood or an appendage of a fetus. These cells can differentiate into cardiac muscle cells. Masanori O. et al (PNAS, 2007. vol. 104, 47: 18700-18705) have described the isolation of a side population in human uterine myometrium with phenotypic and functional characteristics of stem cells. Said cells are positive for the surface markers CD90, CD73, CD105, CD34 and STRO-1 and negative for CD44. Said cells were able to differentiate into adipocyte, osteocyte and smooth muscle cells. The isolation of said cell population is carried out by means of hysterectomy, i.e. by surgical removal of the uterus.

SUMMARY OF THE INVENTION

The authors of the present invention have isolated a new cell population from the mouse adult uterine wall, in particular, from the myometrial tissue, by means of using a simple and non-invasive approach. These cells are able to differentiate into many different mesoderm tissues types, including smooth muscle, adipocytes, osteoblasts, skeletal muscle and neural tissue thus, making them suitable for regenerative medicine.

Thus, in a first aspect, the invention relates to a method for promoting the proliferation of a myometrial-derived mesenchymal stem cell population characterized in that the cells of said cell population are positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81 surface markers wherein said method comprises contacting the stem cell population with a hormone selected from the group of an estrogen and a progestagen.

In another aspect, the invention relates to an isolated myometrial-derived mesenchymal stem cell population characterized in that the cells of said population are positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR 5 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81 surface markers for use in the treatment of a myometrial tissue degenerative condition.

In a further aspect, the invention relates to an isolated myometrial-derived mesenchymal stem cell population characterized in that the cells of said population are positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR 5 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81 surface markers for use in method of improving reproductive capacity in a female subject in need thereof.

In yet another aspect, the invention relates to a method for the preparation of smooth muscle cells comprising contacting an isolated stem cell population from myometrial tissue with a composition comprising TGFp, wherein the cells of said stem cell population are characterized in that they are positive for CD31 , CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81.

In a further aspect, the invention relates to a method for the preparation of osteoblasts comprising contacting an isolated stem cell population from myometrial tissue with an osteogenic factor wherein the cells of said stem cell population are characterized in that they are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81.

In another aspect, the invention relates to a method for the preparation of neural cells comprising contacting an isolated stem cell population from myometrial tissue with a neurogenic factor or with a neurogenic differentiation medium, wherein the cells of said stem cell population are characterized in that are positive for CD31, CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

In another aspect, the invention relates to a method for the preparation of cardiac muscle cells comprising contacting an isolated stem cell population from myometrial tissue with a 5-azacytidine or with a cardiomyogenic differentiation medium, wherein the cells of said stem cell population are characterized in that they are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

In yet another aspect, the invention relates to a method for the determination of the reproductive capacity of a female subject comprising the determination of the number of cells that are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA- lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl-81 in a myometrial sample obtained from said subject, wherein a reduced number of said cells in the myometrial sample with respect to a reference sample is indicative that the female subject shows low reproductive capacity.

In another aspect, the invention relates to a culture supernatant or an extract of an isolated stem cell population wherein said isolated cell population is characterised in that the cells are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl-81.

In further aspects, the invention relates to a pharmaceutical composition comprising a culture supernatant or an extract of the cells of the invention as well as to the use thereof in medicine and for the treatment of an inflammatory disease or of a degenerative process.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Effect of sexual hormones on the proliferation rates of human and mouse adult myometrial precursors. A. Growing curve of mesenchymal stem cells (MSC) after treatment with control solution (♦), estrogens (■) or progesterone B. Growing curve of MAMps after treatment with control solution (♦), estrogens (■) or progesterone C. Growing curve of HAMps after treatment with control solution (♦), estrogens (■) or progesterone

Figure 2: Surface markers expression analyzed by flow cytometry. FACS analysis using a panel of antibodies: CD13, CD31, CD34, CD44, CD45, CD80, CD90, CD117, CD133, CD146, PAL, HLA-DR, TRAl-60, TRA1-81, SSEA-4, WGA and TMRM.

Figure 3. Expression of MAMps markers analyzed by PCR. RNA extracted from the different clones cells was analyzed for the presence of markers genes like Sox2, hTERT, MEF2a/2c and Tbx2/5 by PCR.

Figure 4: Analysis of pluripotency of MAMPs. mAMPs differentiated into: A. adipocytes, stained with oil red, bar, 25 μηι; B. smooth muscle stained with alpha- smooth actin antibody (red), bar 50 μηι; Nuclei were stained in blue with Hoescht; C. skeletal muscle stained with myosin (red), bar 50 μηι; Nuclei were stained in blue with Hoescht; D), osteocytes stained with alizarin red, bar 100 μιη;

Figure 5: Cardiac differentiation of MAMPs in the presence of 5-azactytidine. Lower panel indicates the detection by RT-PCR of cardiac actin. A. cardiomyocytes differentiated after treatment with 5 or 10 μΜ 5-azacytidine observed by light microscope, bars, 10 μιη and 5 μιη, respectively. B. RT-PCR for cardiac actin of mAMPs cultivated for 48h with 5 or 10 μΜ 5-azacytidine.

Figure 6: EMSCs immuno staining for nestin after one week in culture in neural stem cell proliferation medium. Phase contrast (left panel), Nestin (middle panel), nuclei (right panel). (Microphotographs taken with a Nikon camera in a Nikon Fluorescence Inverted Microscope with a 20x objective).

Figure 7: Analysis of neural differentiation capabilities of MAMPs A. mAMPs immuno staining for nestin after one week in culture in neural stem cell proliferation medium. Bar, 50 μιη. B, D and E. Markers of mAMPs after neuronal proliferation medium. Phase contrast (left panel), primary antibody (middle panel) and nuclei (right panel). Bar, 50, 100 and 50 μηι, respectively. C. Phosphatase-alkaline reaction on mAMPs monolayer. Bar, 100 μιη.

Figure 8: Skeletal muscle regeneration mediated by MAMPs A. Graphic showing the percentage of GFP-mAMPs found inside the damaged muscles. GFP primers used for the quantitative RT-PCR. B. Functional recovering of atrophic muscle mice after mAMPs injection.

Figure 9: MAMPs reconstitute damaged uterus during healing. mAMPs regenerate uterine wound healing. mAMPs are stained in violet as PAL-positive cells (see arrows for muscle fibers; asterisks for vessels). Bar, 150 μιη.

Figure 10: MAMps can generate vessels in vitro. mAMPs can generate new vessels. mAMPs were seeded onto matrigel coated-plates and the number of new capillaries was counted. Bar, 150 μιη.

Figure 11. Localization during pregnancy. A. MAMps localized around the control myometrium tissue, close to vessels. B, C and D. Number of MAMps in uterus is increased with days of pregnancy (7, 14 and 19 days, respectively).

Figure 12. Number of MAMps clones during pregnancy. Note the increased number of isolated MAMps after 14-19 days of pregnancy.

Figure 13: Supernatants of AMPs (adult myometrial precursors, both mouse and human) have an anti-inflamatory effect. Supernatants block the differentiation of macrophages in vitro.

DETAILED DESCRIPTION OF THE INVENTION Adult myometrial precursor cells of the invention

The present invention refers to a new mesenchymal stem cell population which has been isolated from myometrial tissue, said stem cell population showing capability to differentiate into multiple cell types in vitro. These cells are hereinafter generally referred to as adult myometrial precursor cells (AMPs) or, depending on the source, MAMPs (mouse adult myometrial precursor cells) or HAMPs (human adult myometrial precursor cells).

Thus, in a first aspect, the present invention refers to an isolated, myometrial- derived mesenchymal stem cell population, hereinafter referred to as "cell population of the invention", characterized in that the cells of said cell population are positive for CD31, CD34, CD44, CD1 17, SSEA-4 (Stage-specific embryonic antigen-4), HLA-DR and WGA-lectin (wheat germ agglutinin- lectin) surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 (Tumor Rejection Antigen 1) surface markers.

As used herein, the term "MHC" (major histocompatibility complex) refers to a subset of genes that encodes cell-surface antigen-presenting proteins. In humans, these genes are referred to as human leukocyte antigen (HLA) genes. Herein, the abbreviations MHC or HLA are used interchangeably.

As used herein, the term "isolated" applied to a cell population refers to a cell population, isolated from the human or animal body, which is substantially free of one or more cell populations that are associated with said cell population in vivo or in vitro.

The cells of the cell population of the invention, hereinafter referred to as the "cells of the invention", derive from the myometrial tissue. The term "myometrial tissue" refers to tissue derived from the middle layer of the uterine wall. The term "uterus" as used herein, encompasses the cervical canal and uterine cavity. Hence, it is noted that throughout the specification and claims, the term "uterine tissue" refers to any material in the cervical canal and uterine cavity.

The cells of the invention can be obtained from any suitable source of myometrial tissue from any suitable animal, including humans. In general, said cells are obtained from non-pathological post-natal mammalian myometrial tissue. In a particular embodiment, the cells of the cell population of the invention are from a mammal, e.g , a rodent, primate, etc, preferably, from a human.

As mentioned above, the cells of the invention are characterized in that are positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers.

As used herein, "negative" with respect to cell surface markers means that, in a cell population comprising the cells of the invention, less than 10%, preferably 9%, 8%, 7%), 6%), 5%), 4%), 3%), 2%), 1 % or none of the cells show a signal for a specific cell surface marker in flow cytometry above the background signal, using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art).

In a particular embodiment, the cells of the invention are characterised in that they express the following cell surface markers CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-lectin, i.e., the cells of the invention are positive for said cell surface markers. Preferably, the cells of the invention are characterised in that they have significant expression levels of said cell surface markers. As used herein, the expression "significant expression" means that, in a cell population comprising the cells of the invention, more than 10%, preferably 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or all of the cells show a signal for a specific cell surface marker by flow cytometry above the background signal using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art). The background signal is defined as the signal intensity given by a non-specific antibody of the same isotype as the specific antibody used to detect each surface marker in conventional FACS analysis Thus for a marker to be considered positive the specific signal observed is stronger than 10%>, preferably 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 500%, 1000%, 5000%, 10000% or above, than the background signal intensity using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art).

The term "positive for WGA-lectin", as used herein, refers to cells which express in the surface binding sites for the WGA, a lectin recognizing N- acetylglucosamine as receptor sugar,.

Commercially available and known monoclonal antibodies against said cell- surface markers (e.g., cellular receptors and transmembrane proteins) can be used to identify the cells of the invention. In a particular embodiment of the invention, the cells of the cell population of the invention are characterized in that they express at least one of the following genes: MefZc (myocyte enhancer factor 2C), Sox2 (SRY (sex determining region Y)-box 2), Tbx5 (T-box 5) and hTERT (telomerase reverse transcriptase catalytic subunit). In a more particular embodiment, said cells do not express Mef2a (myocyte enhancer factor 2A) and Tbx2 (T-box 5) genes.

The term "gene" as used herein, may be a gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non- translated sequences (e.g., introns, 5'- and 3 '-untranslated sequences). The coding region of a gene may be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA or antisense RNA. A gene, may also be an mRNA or cDNA corresponding to the coding regions (e.g., exons and miRNA) optionally comprising 5'- or 3 '-untranslated sequences linked thereto. A gene may also be an amplified nucleic acid molecule produced in vitro comprising all or a part of the coding region and/or 5'- or 3 '-untranslated sequences linked thereto.

The term "gene expression" refers to a process that involves transcription of the DNA code into mRNA, translocation of mRNA to ribosomes, and translation of the RNA message into proteins. The determination of the expression levels of said genes can be carried out by any standard method known in the state of the art. As an illustrative, non limitative, example, said methods include measuring the expression levels of the mRNA encoded by the above mentioned genes. For this purpose, a biological sample comprising the cells of the invention may be treated to physically or mechanically disrupt cell structure, to release intracellular components into an aqueous or organic solution to prepare nucleic acids for further analysis. The nucleic acids are extracted from the sample by procedures known to the skilled person and commercially available. RNA is then extracted by any of the methods typical in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd ed.), Cold Spring Harbor Laboratory Press, New York, (1989). Preferably, care is taken to avoid degradation of the RNA during the extraction process.

While all techniques of gene expression profiling are suitable for use in performing the foregoing aspects of the invention, the gene mRNA expression levels are often determined by reverse transcription polymerase chain reaction (RT-PCR). In order to normalize the values of mRNA expression among the different samples, it is possible to compare the expression levels of the mRNA of interest in the test samples with the expression of a control RNA. Preferably, the control RNA is mRNA derived from housekeeping genes and which code for proteins which are constitutive ly expressed and carry out essential cellular functions. Preferred housekeeping genes for use in the present invention include β-2-microglobulin, ubiquitin, 18-S ribosomal protein, cyclophilin, GAPDH and actin.

Preferably, in the various embodiments of the invention, the detection method provides an output (i.e., readout or signal) with information concerning the presence, absence of the marker(s) in a sample. According to the present invention, the output may be qualitative (e.g., "positive" or "negative"). In this sense, "positive gene expression" is considered when an amplification product of said gene using any standard amplification reaction is obtained. Means for evaluating or detecting said amplification product are well known in the state of the art. In an illustrative way, said methods include, for example, visualisation of a band in an agarose gel as shown in the Example 1 accompanying the present invention. In order to carry out said amplification reaction, specific amplification oligonucleotides for said genes are used.

The terms "oligonucleotide primers" or "amplification oligonucleotides" are herein used indistinguishably and refer to a polymeric nucleic acid having generally less than 1,000 residues, including those in a size range having a lower limit of about 2 to 5 residues and an upper limit of about 500 to 900 residues. In preferred embodiments, oligonucleotide primers are in a size range having a lower limit of about 5 to about 15 residues and an upper limit of about 100 to 200 residues. More preferably, oligonucleotide primers of the present invention are in a size range having a lower limit of about 10 to about 15 residues and an upper limit of about 17 to 100 residues. Although oligonucleotide primers may be purified from naturally occurring nucleic acids, they are generally synthesized using any of a variety of well known enzymatic or chemical methods. The term "amplification oligonucleotide" refers to an oligonucleotide that hybridizes to a target nucleic acid, or its complement, and participates in a nucleic acid amplification reaction. Amplification oligonucleotides include primers and promoter primers in which the 3' end of the oligonucleotide is extended enzymatically using another nucleic acid strand as the template. In some embodiments, an amplification oligonucleotide contains at least about 10 contiguous bases, and more preferably about 12 contiguous bases, that are complementary to a region of the target sequence (or its complementary strand). Target-binding bases are preferably at least about 80%, and more preferably about 90% to 100% complementary to the sequence to which it binds. An amplification oligonucleotide is preferably about 10 to about 60 bases long and may include modified nucleotides or base analogues. Illustrative, non limitative, amplification oligonucleotides for use according to the present invention, include the ones disclosed in the Example 1 accompanying the present invention.

In another particular embodiment of the invention, the cells of the invention express alkaline phosphatase protein.

Alkaline phosphatase (ALP) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. Alkaline phosphatase is a stem cell membrane marker and elevated expression of this enzyme is associated with undifferentiated pluripotent stem cell. All primate pluripotent stem cells, like Embryonic stem (ES), embryonic germ (EG) and embryonal carcinoma (EC) cells, express alkaline phosphatase activity.

There are different methods known in the state of the art for the detection of ALP such as methods based on enzymatic reaction followed by colorimetric or fast red violet dye, fluorescent detection and immuno staining.

According to the present invention, any standard technique of protein expression profiling is suitable for use in performing the foregoing aspects of the invention. In particular, alkaline phosphatase protein expression may be detected by means of flow cytometry technique using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system used with commercially available antibodies and standard protocols known in the art). Alternatively, alkaline phosphatase protein expression can be determined by means standard protein expression assays in which specific antibodies against said protein are used. Such assays include radioimmunoassays, enzyme immunoassay (e.g., ELISA), immunofluorescence, immunoprecipitation, latex agglutination, hemagglutination, and histochemical tests. As an illustrative, non limitative, example alkaline phosphatase protein expression is determined as described in the Example 1 accompanying the present invention. The mitochondrial membrane potential (ΔΨιη) i s a key indic ator o f mitochondrial function and the characterization of ΔΨιη in situ allows for an accurate determination of mitochondrial bioenergetics and cellular metabolism. Methods for measuring ΔΨιη include using monovalent cationic fluorescent dyes such as tetramethylrho damine methyl ester (TMRM) due to their non-invasive nature. The fluorescent membrane-permeant cationic probe TMRM has become one of the more readily used probes in the analysis of ΔΨιη in intact cells. The ability to measure ΔΨηι paralleled to cellular and mitochondrial physiology, protein localization and real time enzymatic kinetics enables the characterization of the progression of necrotic and apoptotic cell death as well as cell survival following the addition of stimuli and drugs.

In a particular embodiment, the cells of said cell population present a low mitochondrial membrane potential. According to the present invention, the term "low mitochondrial membrane potential" means that, in a cell population comprising the cells of the invention, less than 10%, preferably 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 % or none of the cells show a signal for a specific mitochondrial membrane marker in flow cytometry above the background signal, using conventional methods and apparatus (for example a Calibur (Becton Dickinson) FACS system).

Advantageously, the cells of the invention lack in vivo tumorigenic activity. Thus, in another particular embodiment of the invention, the cell population of the invention does not present tumorigenic activity. The expression "tumorigenic activity" as used here in refers to an altered behaviour or proliferative phenotype which gives rise to a tumour cell.

The tumorigenic activity of the cells of the invention can be tested by performing animal studies using immunodeficient mice strains. In these experiments, several million cells are implanted subcutaneously in the recipient animals, which are maintained for several weeks and analyzed for tumour formation. A particular assay is disclosed in the examples accompanying the present invention.

Methods for proliferation of the adult myometrial precursor cells

The cells of the invention are also capable of being expanded ex vivo. That is, after isolation, the cells of the invention can be maintained and allowed to proliferate ex vivo in culture medium. Such medium is composed of, for example, Dulbecco's Modified Eagle's Medium (DMEM), with antibiotics (for example, lOOunits/ml Penicillin and 100 μ§/ι 1 Streptomycin) or without antibiotics, and 5 mM glutamine, and supplemented with 2-20% fetal bovine serum (FBS). It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as necessary for the cells used. Sera often contain cellular and non-cellular factors and components that are necessary for viability and expansion. Examples of sera include FBS, bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), porcine serum, sheep serum, rabbit serum, rat serum (RS), etc. Also contemplated is, if the cells of the invention are of human origin, supplementation of cell culture medium with a human serum, preferably of autologous origin. It is understood that sera can be heat- inactivated at 55-65 °C if deemed necessary to inactivate components of the complement cascade. Modulation of serum concentrations, withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. Preferably, cells of the invention will benefit from FBS concentrations of about 2% to about 25 %. In another embodiment, the cells of the invention can be expanded in a culture medium of definite composition, in which the serum is replaced by a combination of serum albumin, serum transferrin, selenium, and recombinant proteins including but not limited to insulin, platelet-derived growth factor (PDGF), and basic fibroblast growth factor (bFGF) as known in the art.

Many cell culture media already contain amino acids, however some require supplementation prior to cultunng cells. Such amino acids include, but are not limited to, L-alanine, L- arginine, L-aspartic acid, L-asparagine, L cysteine, L-cystine, L- glutamic acid, L-glutamine, L-glycine, and the like.

Antimicrobial agents are also typically used in cell culture to mitigate bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to amphotericin (Fungizone(R)), ampicillin, gentamicin, bleomycin, hygromacin, kanamycin, mitomycin, etc.

Hormones can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, β-estradiol, hydrocortisone, insulin, prolactin, progesterone, somato statin/human growth hormone (HGH), etc.

The cells of the present invention show improved proliferation capability when the cells are contacted with an estrogen or a progestagen. Thus, in another aspect, the invention relates to a method for the proliferation of a myometrial-derived mesenchymal stem cell population characterized in that the cells of said cell population are positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl-81 surface markers wherein said method comprises contacting the stem cell population with a hormone selected from the group of an estrogen and a progestagen.

The term "estrogen", as used herein, refers to any natural or synthetic steroidal compound exhibiting estrogenic activity. Such compounds encompass inter alia conjugated estrogens, and phytoestrogens. The term is further meant to encompass all isomeric and physical forms of the estrogens including hydrates, solvates, salts and complexes, such as complexes with cyclodextrins. Suitable estrogens include, without limitation, natural estrogens such as estrone, estrone sulfate, estrone sulfate piperazine salt, estradiol and estriol, and their esters, as well as ethinyl estradiol, mestranol, conjugated equine estrogen, esterified estrogens, estropipate, 17[alpha]- ethinylestradiol, esters and ethers of 17 [alpha] -ethinylestradiol such as, for example, 17 [alpha] -ethinylestradiol 3-dimethylamino propionate, 17 [alpha] -ethinylestradiol 3- cyclopentyl ether (quinestrol) and 17 [alpha] -ethinylestradiol 3-methyl ether (mestranol), estradiol- 17beta, estradiol valerate, piperazine estrone sulphate, estriol succinate, and polyestrol phosphate and other estrogen equivalents and estrogen agonists and antagonists. In a preferred embodiment, the estrogen is estradiol.

The term "progestagen" includes but is not limited to progesterone, synthetic progestagens (which are sometimes referred to in the art as "progestins"), medroxyprogesterone acetate (medrysone), norethindrone (or norethisterone), norethindrone acetate, megestrol acetate, 17-a-hydroxyprogesterone caproate, and norgestrel, and derivatives thereof. In a preferred embodiment, the progestagen is progesterone.

The maintenance conditions of the cells of the invention can also contain cellular factors that allow cells to remain in an undifferentiated form. Existing methods used for increasing the number of stem cells include culturing cells on 2-D stromal layers and growing them in the presence of various cytokine cocktails (Rebel, VI., et al. (1994) Blood, 83(1): 128-136) which usually include the cytokine LIF. It is apparent to those skilled in the art that prior to differentiation; supplements that inhibit cell differentiation must be removed from the culture medium. It is also apparent that not all cells will require these factors. In fact, these factors may elicit unwanted effects, depending on the cell type.

Tissue progenitor cells and/or mature tissue cells cultured on culture ware may be harvested by methods known in the art. Generally, the cultured cells are released from the surface to which they are adhered and concentrated by centrifugation. The cells may then be further cultured or used for transplant. Typically, cells are released from the surface to which they are adhered by treatment with a proteolytic enzyme, e.g. trypsin, or by treatment with EDTA.

In another particular embodiment of the invention, said cells present a limited proliferation rate. Indeed, the data herewith presented demonstrate that the cells of the invention can be grown extensively but not indefinitely in vitro. These cells undergo senescence after approximately 30 passages in vitro.

The cells of the invention can be transfected or genetically engineered to express, at least, one polypeptide of interest. Thus, in another particular embodiment, the cells of the invention are genetically modified.

A cell is said to be "genetically modified", "transfected", or "genetically transformed" when a polynucleotide has been transferred into the cell by any suitable means of artificial manipulation, or where the cell is a progeny of the originally altered cell that has inherited the polynucleotide. The polynucleotide will often comprise a transcribable sequence encoding a protein of interest, which enables the cell to express the protein at an elevated level. The genetic alteration is said to be "inheritable" if progeny of the altered cell have the same alteration. "Transformed cell" means a cell into which (or into predecessor or an ancestor of which) a nucleic acid molecule encoding a polypeptide of the invention has been introduced, by means of, for example, recombinant DNA techniques or viruses. "Nucleic acid" or "nucleic acid molecule" refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double- stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but which functions in a manner similar to a naturally occurring amino acid.

Methods for the generation of differentiated cells from the adult myometrial precursor cells of the invention

The cells of the invention present the capacity to differentiate into ectoderm, mesoderm, and endoderm lineage cells. Thus, by contacting the cell population of the invention with an adequate induction, differentiation or transformation agent for a given cell lineage, the invention provides a method for obtaining differentiated cells of the different lineages.

Suitable induction, differentiation/transformation agents for endoderm cell lineage include, without limitation, hepatocyte growth factor, oncostatin-M, epidermal growth factor, fibroblast growth factor-4, basic-fibroblast growth factor, insulin, transferrin, selenius acid, BSA, linoleic acid, ascorbate 2-phosphate, VEGF, and dexamethasone, for the following cell types: liver, lung, pancreas, thyroid, and intestine cells.

Suitable induction, differentiation/transformation agents for mesoderm cell lineage include, without limitation, the following agents: insulin, transferrin, selenous acid, BSA, linoleic acid, TGF-beta 1, TGF-beta 3, ascorbate 2-phosphate, dexamethasone, β-glycerophosphate, ascorbate 2-phosphate, BMP, and indomethacine, for the following cell types: cartilage, bone, adipose, muscle, and blood cells.

Suitable induction, differentiation/transformation agents for ectoderm cell lineage include the following agents: dibutyryl cyclin AMP, isobutyl methylxanthine, human epidermal growth factor, basic fibroblast growth factor, fibroblast growth factor- 8, brain-derived neurotrophic factor, and/or other neurotrophic growth factor, for the following cell types: neural, skin, brain, and eye cells.

In a preferred embodiment, the cells of the invention present capacity to be differentiated into at least two, more preferably three, four, five, six, seven or more cell lineages. In this sense, the cells of the invention can proliferate and differentiate into cells of other lineages by conventional methods.

In a particular embodiment of the invention, the cells of the cell population of the invention present capacity to be differentiated into smooth muscle cells. Thus, in another aspect, the invention relates to a method for the preparation of smooth muscle cells comprising contacting an isolated stem cell population from myometrial tissue with a composition comprising TGFp, wherein the cells of said stem cell population are characterized in that they are positive for CD31 , CD34, CD44, CD 1 17, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRA1-81.

The term "TGF-beta" or "TGF-β", as used herein, can be any active mammalian

TGF-beta protein, e.g. human TGFbeta-1 (TGFB 1 ; NCIB GenelD: 7040), human TGFbeta-2 (TGFB2; NCIB GenelD: 7042), or human TGFbeta-3 (TGFB3; NCIB GenelD: 7043), or hererodimers thereof (see Massague J, et al. (1992) Cancer Surv. 12:81-103).

In another aspect, the invention relates to a method for the preparation of osteoblasts comprising contacting an isolated stem cell population from myometrial tissue with a composition comprising an osteogenic factor, wherein the cells of said stem cell population are characterized in that they are positive for CD31 , CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

The term "osteogenic factor", as used herein, refers to a compound which promotes bone formation and/or inhibits bone resorption. Suitable osteogenic factors include, without limitation, bone morphogenic factors, bone morphogenic proteins including BMP 1 , BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMPdb, BMP10 and BMP15, parathyroid hormones, noggin, osteogenic growth peptides, anti- resorptive agents, osteogenic factors, cartilage-derived morphogenic proteins, growth hormones, cytokines such as fibroblast growth factor (FGF), insulin-like growth factor-1 (IGF-I), transforming growth factors, estrogens, bisphosphonates, statin and calcitonin. In a preferred embodiment, the osteogenic factor is a bone morphogenetic protein. In a still more preferred embodiment, the bone morphogenetic protein is BMP2.

In another particular embodiment, the cells of said population present capacity to be differentiated into adipocytes. For this purpose, the cells are contacted with an adipogenic differentiation medium. This medium typically contains a cell culture medium, insulin, and 3-isobutyl-methylxanthine. In some embodiments of the invention, the adipogenic differentiation medium contains dexamethasone, 3-isobutyl-l- methylxanthine, insulin, and indomethacin.

In another particular embodiment, the invention relates to a method for the preparation of neural cells comprising contacting an isolated stem cell population from myometrial tissue with a neurogenic factor or with a neurogenic differentiation medium, wherein the cells of said stem cell population are characterized in that are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

The term "neurogenic factor", as used herein, refer to Examples of neurogenic factors include, without limitation, BDGF, GDNF, NICD, bFGF, BRINP, neurotrophin- 3, cardiotrophin-1, forskolin, and ciliary neurotrophic factor.

The term "neurogenic differentiation medium" refers to any medium which provides the necessary elements to allow differentiation of progenitor cells into neuronal-progenitor cells, or neurons, and expansion of those cells in vitro. Neurogenic differentiation medium for culturing and differentiation of the stem cells of the invention into neuronal progenitor cells typically contains a cell culture medium, a corticosteroid and a reducing agent. In some embodiments of the invention, the neurogenic differentiation medium contains a cell culture medium such as DMEM/F12 (1 : 1) medium, neurobasal medium or other common cell culture media, beta - mercaptoethanol, MEM non-essential amino acids, basic fibroblast growth factor (FGF), epidermal growth factor (EGF), nerve growth factor (NGF), brain-derived growth factor (BDGF), neurotrophin-3, N2, B27 supplements, insulin, transferrin, selinate, dimethylsulfoxide (DMSO), butylated hydroxyanisole (BHA), all-trans retinoic acid (RA), forskolin, valproic acid and KC1.

Cardiomyogenic differentiation medium typically contains a cell culture medium and 5-azacytidine. In some embodiments of the invention, the cardiomyogenic differentiation medium contains bFGF, human and/or bovine serum, and 5-azacytidine.

Methods for identifying and subsequently isolating differentiated cells from their undifferentiated counterparts can be also earned out by methods well known in the art.

In addition to the components as described above, the cell differentiation media that are used in accordance with the present invention may contain one or more additional components, if necessary. Such additional components can include a growth factor, a cytokine, a scaffold, an extracellular matrix protein (ECM), demineralized bone matrix, horse or human serum, or antibiotics and antifungal agents, including penicillin G, streptomycin sulfate, amphotericin B, gentamycin and nystatin, which can be added to prevent microorganism contamination.

In some embodiments of the invention, the ECM is selected from collagen, fibronectin, vitronectin, and laminin of a human origin. Typically, the ECM is derived from human peripheral blood, bone marrow or umbilical cord blood.

Generally, the scaffold is selected from synthetic polymers, biological polymers of a human origin, ceramics, gels, alginates, nanofibers, mineralized and demineralized bone matrix. More specifically, scaffolds could be made of natural polymers, such as collagen (or demineralized bone matrix, which is mostly collagen I with attached growth factors), hyaluronic acid, fibrin, etc., or scaffolds could be synthetic polymers such as poly-L-lactide, polyglycolide, lactide-glycolide copolymer, caprolactone-lactide copolymer, poly-caprolactone. Scaffolds also could be inorganic such as ceramics, alumina (AI₂O₃), hydroxyapatite, beta -tricalcium phosphate (TCP), which is chemical derivative of hydroxyapatite or corals that could be transformed into hydroxyapatite, and polyurethanes. Scaffolds could combine ceramics and polymers. Finally scaffolds could be nano-scaffolds that are produced by electrospinning of synthetic and natural polymers. Typically, the conditions for culturing of the precursor cells of the invention comprise a temperature of about 4-37 degrees C, a humidity of atmospheric to 100 percent humidity, a carbon dioxide level of 0-5 percent C0₂ and an oxygen level of 1 percent oxygen to atmospheric level. Culture conditions for differentiation can be optimized by one skilled in the art. The ratio of myometrial cells to differentiation medium is between 1 : 1 and 1 :50.

Therapeutic methods of the invention

In recent years, MSC have been increasingly given a role in tissue repair and regeneration. In different models of tissue damage, MSC improve the recovery of injured tissues.

The cells of the invention express some of the proteins that leukocytes use to adhere to and cross the endothelium (CD44) and thus can diffuse into the interstitium of the skeletal muscle, inside the osteogenic tissue and between the adypocytes, when delivered intra-arterially. On the other hand, the data presented herein demonstrate that the cells of the invention can be grown extensively but not indefinitely in vitro, which is of vital importance considering that an additional concern for future cell therapy protocols is the risk that extensive expansion in vitro may compromise differentiation and/or self-renewal ability or even lead to malignant transformation. Indeed, as mentioned above, said cells undergo senescence after approximately 30 passages in vitro. Additionally, these cells maintain a diploid karyotype and are not tumorigenic in immune deficient mice.

The term "karyotype" as used herein, refers to the chromosome characteristics of an individual cell or cell line of a given species, as defined by both the number and morphology of the chromosomes. Typically, the karyotype is presented as a systematized array of prophase or metaphase (or otherwise condensed) chromosomes from a photomicrograph or computer-generated image. Alternatively, interphase chromosomes may be examined as histone-depleted DNA fibres released from interphase cell nuclei. It is considered a normal karyotype when the number of chromosomes is not altered compared to the number of chromosomes of the specie.

Therefore, in a further aspect, the present invention refers to the isolated stem cell population of the invention for use as a medicament. In a particular embodiment, the cell population of the invention is used as a medicament for the treatment or prevention of a tissue degenerative condition. Alternatively, the invention relates to a method for the treatment or prevention of tissue degenerative condition comprising the administration of the cells of the invention. Alternatively, the invention relates to the use of the cell population of the invention for the manufacture of a medicament for the treatment or prevention of a tissue degenerative condition.

The term "tissue degenerative condition" as used herein, refers to tissue which exhibits a pathological condition. Thus, according to the present invention, said cell population or composition of the invention can be used as a medicament for tissue repair and/or regeneration. In this sense, the cell population of the invention can be used for enhancing the proliferation, regeneration and/or engrafting of stem cells in said tissue, i.e. for the repair and/or regeneration of aging and/or damaged tissue.

In a more particular embodiment, said tissue degenerative condition is skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, lung degeneration, liver degeneration, kidney degeneration, myometrial degeneration or more than one of said tissue degenerative conditions simultaneously.

As used herein, the terms "treat", "treatment" and "treating" refer to the amelioration of one or more symptoms associated with a disorder that results from the administration of the cell population of the invention or a pharmaceutical composition comprising same, to a subject in need of said treatment. Thus, "treatment" as used herein covers any treatment of a disorder, disease or condition of a mammal, particularly a human, and includes: (a) preventing the disease or condition from occurring in a subject which may be predisposed to the disease or condition but has not yet been diagnosed as having it; (b) inhibiting the disease or condition, i.e., arresting its development; or (c) relieving the disease or condition, i.e., causing regression of the disease or condition or amelioration of one or more symptoms of the disease or condition. The population of subjects treated by the method includes a subject suffering from the undesirable condition or disease, as well as subjects at risk for development of the condition or disease. As used herein, the terms "disorder" and "disease" are used interchangeably to refer to an abnormal or pathological condition in a subject that impairs bodily functions and can be deadly. The term "subject" refers to an animal, preferably a mammal including a non- primate (e.g. a cow, pig, horse, cat, dog, rat, or mouse) and a primate (e.g. a monkey or a human). In a preferred embodiment, the subject is a human.

While it is possible for the active agent, i.e. the cell population of the invention, to be administered alone, it is preferable to present it as part of a pharmaceutical formulation or composition, comprising as active ingredient an effective amount of a cell population according to the invention. The pharmaceutical formulation or composition in the context of the invention is intended to mean a combination of the active agent(s), together or separately, with a pharmaceutically acceptable carrier as well as other additives. Thus, in another aspect, the present invention refers to a pharmaceutical composition comprising an isolated stem cell population of the invention and an acceptable pharmaceutical vehicle or carrier.

In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the US Pharmacopeia, or European Pharmacopeia, or other generally recognized pharmacopeia for use in animals and, more particularly, in humans.

The term "carrier" in the context of the present invention denotes any one of inert, non-toxic materials, which do not react with the cell population of the invention and which can be added to formulations as diluents, adjuvants, excipients, or vehicle or to give form or consistency to the formulation. The carrier may at times have the effect of the improving the delivery or penetration of the active ingredient to the target tissue, for reducing undesired side effects etc. The carrier may also be a substance that stabilizes the formulation (e.g. a preservative), for providing the formulation with an edible flavor, etc. For examples of carriers, stabilizers and adjuvants, see E. W. Martin, REMINGTON'S PHARMACEUTICAL SCIENCES, MacK Pub Co (June, 1990). The composition, if desired, can also contain minor amounts of pH buffering agents.

Such compositions will contain a prophylactic or therapeutically effective amount of a prophylactic or therapeutic agent preferably in purified form, together with a suitable amount of earner so as to provide the form for proper administration to the subject. The formulation should suit the mode of administration. In a preferred embodiment, the pharmaceutical compositions are sterile and in suitable form for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.

The pharmaceutical composition of the invention may be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as lyophilized preparations, liquids solutions or suspensions, injectable and infusible solutions, etc. The preferred form depends on the intended mode of administration and therapeutic application.

The administration of the cell population of the invention, or the pharmaceutical composition comprising same, to the subject in need thereof can be earned out by conventional means. In a particular embodiment, said cell population is administered to the subject by a method which involves transferring the cells to the desired tissue, either in vitro (e.g., as a graft prior to implantation or engrafting) or in vivo, to the animal tissue directly. The cells can be transferred to the desired tissue by any appropriate method, which generally will vary according to the tissue type. For example, cells can be transferred to graft by bathing the graft (or infusing it) with culture medium containing the cells. Alternatively, the cells can be seeded onto the desired site within the tissue to establish a population. Cells can be transferred to sites in vivo using devices such as catheters, trocars, cannulae, stents (which can be seeded with the cells), etc.

In addition, the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, or have another action. The compounds, i.e. the cell population of the invention, may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients, such as, for example other agents useful in the treatment of a tissue degenerative condition. Hence, the cell population and composition of the invention may be administered in a combination therapy. The term "combination therapy" refers to the use of the cell populations of the present invention with other active agents or treatment modalities, in the manner of the present invention for the amelioration of one or more symptoms associated with a disorder. These other agents or treatments may include known drugs and therapies for the treatment of such disorders. The combined use of the agents of the present invention with other therapies or treatment modalities may be concurrent, or given sequentially, that is, the two treatments may be divided up such that a cell population or a pharmaceutical composition comprising same of the present invention may be given prior to or after the other therapy or treatment modality. The attending physician may decide on the appropriate sequence of administering the cell population, or a pharmaceutical composition comprising same, in combination with other agents, therapy or treatment modality.

In other aspect, the present invention relates to the use of the cells of the invention for the preparation of a medicament for preventing, treating or ameliorating one or more symptoms associated with a tissue degenerative condition including, but not limited to, skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, myometrial degeneration, lung degeneration, liver degeneration, kidney degeneration or more than one of said tissue degenerative conditions simultaneously. The present invention also relates to a method for preventing, treating or ameliorating one or more symptoms associated with a tissue degenerative condition including, but not limited to, skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, myometrial degeneration, lung degeneration, liver degeneration, kidney degeneration or more than one of said tissue degenerative conditions simultaneously wherein said method comprises the administration of the adult myometrial precursor cells of the invention.

In another embodiment, the adult myometrial precursor cells of the invention are suitable for improving the reproductive capacity in a female subject.

By "reproductive capacity" is meant the ability of a female subject to conceive a pregnancy, carry the pregnancy to term, and/or deliver a healthy neonate.

For this purpose, the adult myometrial precursor cells are preferably obtained from one subject and administered to the same subject. For example, the adult myometrial precursor cells are obtained from a subject during the course of her reproductive life. In one embodiment, a myometrial sample may be harvested at any time following puberty and prior to menopause, for example, between the ages of about 15 and about 50. In another embodiment, a myometrium is harvested from a subject during the peak of the subject's reproductive potential, for example, between the ages of about 18 and about 30. In other embodiments, myometrium is harvested from a subject at the age of 24, 25, 26, 27, 28, 29, 30, 31, and 32. The myometrium derived precursor cells are subsequently administered to the subject to maintain, improve, or restore her fertility. In one approach, myometrium-derived cells are administered to a subject at risk of a reduction in fertility. For example, a myometrium derived cell is administered to a subject between 30 and 40 years of age to prevent a loss or reduction in fertility. In one embodiment, a myometrium derived cell is administered to a 30, 31, 32, 33, 34, or 35 year old subject to maintain her fertility, to prevent a reduction in fertility (e.g., an age-related reduction in fertility), or to promote the health or survival of prospective progeny. In another embodiment, the cell is administered at least about one, two, three, four, five, six or seven years prior to conception of prospective progeny. In another approach, a myometrium derived cell is administered to a subject diagnosed as having reduced fertility to increase fertility or to preserve remaining fertility. For example, a myometrium derived cell is administered to a subject between the ages of 34 and 55 to increase or preserve remaining fertility or to delay menopause. In one embodiment, the cell is administered to a 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45-year-old woman diagnosed as having reduced fertility. The adult myometrial precursor cells of the invention or their progeny (e.g., in vivo, ex vivo or in vitro derived) can be administered via localized injection, including catheter administration, systemic injection, localized injection, intravenous injection, intrauterine injection, or parenteral administration. When administering a therapeutic or prophylactic composition of the present invention (e.g., a cellular composition), it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion).

Compositions of the invention can be conveniently provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof. Sterile injectable solutions can be prepared by incorporating the cells utilized in practicing the present invention in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired. Such compositions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.

Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the bone marrow cells, their progenitors, or their progeny.

The compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and lacrimal fluid. The desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is preferred particularly for buffers containing sodium ions. Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose is preferred because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The preferred concentration of the thickener will depend upon the agent selected. The important point is to use an amount that will achieve the selected viscosity. Obviously, the choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form).

A method to potentially increase cell survival when introducing the cells into a subject in need thereof is to incorporate the myometrial adult cells or their progeny (e.g., in vivo, ex vivo or in vitro derived) of interest into a biopolymer or synthetic polymer. Depending on the subject's condition, the site of injection might prove inhospitable for cell seeding and growth because of scarring or other impediments. Examples of biopolymer include, but are not limited to, cells mixed with fibronectin, fibrin, fibrinogen, thrombin, collagen, and proteoglycans. This could be constructed with or without included expansion or differentiation factors. Additionally, these could be in suspension, but residence time at sites subjected to flow would be nominal. Another alternative is a three-dimensional gel with cells entrapped within the interstices of the cell biopolymer admixture. Again, expansion or differentiation factors could be included with the cells. These could be deployed by injection via various routes described herein.

Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert and will not affect the viability or efficacy of the bone marrow derived cells or their progeny or progenitors as described in the present invention. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein.

One consideration concerning the therapeutic or prophylactic use of myometrial derived cells of the invention is the quantity of cells necessary to achieve an optimal effect. In current human studies of autologous mononuclear peripheral blood cells, empirical doses ranging from 1 to 4 x 10⁷ cells have been used with encouraging results. However, different scenarios may require optimization of the amount of cells injected into a tissue of interest. Thus, the quantity of cells to be administered will vary for the subject being treated. In a preferred embodiment, between about 10⁴ to 10⁸, more preferably between about 10⁵ to 10⁷, and still more preferably, about 1 x 10⁶, 3 x 10^6* 5 x 10^6* 1 x 10⁷, 3 x 10⁷, or 5 x 10⁷ cells of the invention can be administered to a human subject.

Fewer cells can be administered, if the cells are administered directly to the abdomen or to the ovary. Preferably, between 10² to 10⁶, more preferably 10³ to 10⁵, and still more preferably, 10⁴ cells can be administered to a human subject. However, the precise determination of what would be considered an effective dose may be based on factors individual to each patient, including their size, age, sex, weight, and condition of the particular patient. As few as 100-1000 cells can be administered for certain desired applications among selected patients. Therefore, dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art.

Cells are administered in an amount that is effective to preserve, maintain, enhance, or restore fertility. For some patients, a single infusion may be sufficient to achieve this purpose. Typically, cellular compositions of the invention are provided in one or more infusions administered over the course of between one and ten years. In one embodiment, a cellular composition of the invention is administered to a subject every 3, 6, 9 or 12 months. In another embodiment, the administration continues over the course of between 1 and 10 years (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 years).

Preferable ranges of purity in populations comprising myometrium-derived precursor cells are about 50 to about 55 percent, about 55 to about 60 percent , and about 65 to about 70 percent. More preferably the purity is about 70 to about 75 percent , about 75 to about 80 percent , about 80 to about 85 percent ; and still more preferably the purity is about 85 to about 90 percent , about 90 to about 95 percent , and about 95 to about 100 percent. Purity of myometrium-derived stem cells can be determined according to the genetic marker profile within a population. Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage).

The skilled artisan can readily determine the number of cells and optional additives, vehicles, and/or carrier in compositions and to be administered in methods of the invention. Typically, any additives (in addition to the active stem cell(s) and/or agent(s)) are present in an amount of 0.001 to 50 percent (weight) solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as about 0.0001 to about 5 wt percent , preferably about 0.0001 to about 1 wt percent , still more preferably about 0.0001 to about 0.05 wt percent or about 0.001 to about 20 wt percent , preferably about 0.01 to about 10 wt percent , and still more preferably about 0.05 to about 5 wt percent . Of course, for any composition to be administered to an animal or human, and for any particular method of administration, it is preferred to determine therefore: toxicity, such as by determining the lethal dose (LD) and LD₅₀ in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be ascertained without undue experimentation.

Cellular compositions of the invention may be administered together with any reproductive therapy known to the skilled artisan, including but not limited to, in vitro fertilization.

Methods for the isolation of the adult myometrial precursor cells of the invention

In another aspect, the present invention refers to a method, hereinafter referred to as the "method of the invention", for isolating a stem cell population from myometrial tissue, wherein the cells of said cell population are characterized in that are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81 surface markers, said method comprising the steps of:

i) incubating a myometrial tissue sample in a suitable cell culture medium on a solid surface under conditions allowing cells of said sample to adhere to said solid surface;

ii) recovering the cells from said cell culture which do not adhere to said solid surface or which present low adherence capacity; and

iii) confirm that the selected cell population presents the phenotype of interest. As used herein, the term "solid surface" refers to any material that allows cells to adhere. In a particular embodiment said material is gelatin. As shown in the Example 1 accompanying the present invention, myometrial tissue samples were transferred to a Petri dish coated with gelatin 1% as previously described for other cell types (Minasi, M.G., et al cited supra; Sampaolesi M, et al. 2003. Science. 301 :487-492). These samples were cultured for 15 days and after the initial outgrowth of fibroblast-like cells, small round and refractile cells appeared. . Those cells, which adhered poorly to the substratum and floated, were easily collected by gently pipetting from the original culture. Said floating cells were either grown as a polyclonal population or, in some cases, cloned by limited dilution. Thus, according to step ii) of the method of the invention, the expression "low adherence capacity" as used herein, refers to cells which, under standard conditions allowing cells (such as, for example, fibroblast) adhere to said solid surface, either do not adhere to said solid surface and thus, float in the culture medium, or can easily be collected from said culture medium by means, for example, of gently pipetting.

The cells of the invention can be obtained by conventional means from any suitable source of myometrial tissue from any suitable animal, including humans. In a particular case, myometrial tissue samples are obtained from the lower uterine segment of the corpus uteri by uterine exfolation. Sampling involves collecting exfoliated cells from the endocervical uterine canal with an appropiate tool as explained in the Example 1 accompanying the present invention. In general, said cells are obtained from non- pathological post-natal mammalian myometrial tissue. In a particular embodiment, the cells of the cell population of the invention are from a mammal, e.g, a rodent, primate, etc, preferably, from a human. The animal can be alive or dead, so long as myometrial tissue cells within the animal are viable. Typically, human myometrial cells are obtained from living donors, using well-recognized protocols as explained above.

The sample of miometrial tissue is, preferably, washed before being processed to separate the cells of the invention from the remainder of the material. The remaining cells generally will be present in clumps of various sizes, and the protocol can proceed using steps gauged to degrade the gross structure while minimizing damage to the cells themselves. The lumps of cells can be degraded using treatments, such as mechanical agitation, sonic energy, thermal energy, etc.

Following the final isolation, the cells can be cultured and, if desired, assayed for number and viability to assess the yield. Desirably, the cells will be cultured without differentiation, on a solid surface, using a suitable cell culture media, at the appropriate cell densities and culture conditions. Thus, in a particular embodiment, cells are cultured without differentiation on a solid surface, usually made of gelatin in the presence of a suitable cell culture medium [e g , DMEM, typically supplemented with 5-15% (e g , 10%) of a suitable serum, such as fetal bovine serum or human serum], and incubated under conditions which allow cells to adhere to the solid surface and proliferate.

The cells are maintained in culture in the same medium and under the same conditions until they reach the adequate confluence, typically, about 80%> cell confluence, with replacement of the cell culture medium when necessary. After reaching the desired cell confluence, the cells can be expanded by means of consecutive passages using a detachment agent such as trypsin and seeding onto a bigger cell culture surface at the appropriate cell density (usually 2,000- 10,000 cells/cm²) Thus, cells are then passaged at least twice in such medium without differentiating, while still retaining their developmental phenotype, and more preferably, the cells can be passaged at least 10 times (e g , at least 15 times or even at least 20 times) without losing developmental phenotype Typically, the cells are plated at a desired density such as between about 100 cells/cm2 to about 100,000 cells/cm2 (such as about 500 cells/cm2 to about 50,000 cells/cm2, or, more particularly, between about 1,000 cells/cm2 to about 20,000 cells/cm ) If plated at lower densities (e g , about 300 cells/cm ), the cells can be more easily clonally isolated. For example, after a few days, cells plated at such densities will proliferate into an homogeneous population In a particular embodiment, the cell density is between 2,000-10,000 cells/cm2. As a result of the above method, a homogeneous cell population having the phenotype of interest is obtained. Example 1 describes in a detailed manner the isolation of the cells of the invention from mouse myometrial tissue.

Confirmation of the phenotype of interest can be carried out by using conventional means. Cell-surface markers can be identified by any suitable conventional technique, usually based on a positive/negative selection, for example, monoclonal antibodies against cell-surface markers, whose presence/absence in the cells has to be confirmed, can be used, although other techniques can also be used. Thus, in a particular embodiment, monoclonal antibodies against one, two, three, four, five, six, seven of or preferably all of CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl-81 surface markers are used in order to confirm the absence of said markers in the selected cells, and monoclonal antibodies against one, two, three, four, of or preferably all of CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-lectin are used in order to confirm the presence thereof or detectable expression levels of, at least one of and preferably all of, said markers. Said monoclonal antibodies are known, commercially available or can be obtained by a skilled person in the art by conventional methods.

The cells and cell populations provided by the instant invention can be clonally expanded, if desired, using a suitable method for cloning cell populations. For example, a proliferated population of cells can be physically picked and seeded into a separate plate (or the well of a multi-well plate). Alternatively, the cells can be subcloned onto a multi- well plate at a statistical ratio for facilitating placing a single cell into each well (e.g., from about 0,1 to about 1 cell/well or even about 0,25 to about 0,5 cells/well, such as 0,5 cells/well). Of course, the cells can be cloned by plating them at low density (e.g., in a Petri dish or other suitable substrate) and isolating them from other cells using devices such as a cloning rings. The production of a clonal population can be expanded in any suitable culture medium. In any event, the isolated cells can be cultured to a suitable point when their developmental phenotype can be assessed.

Any of the steps and procedures for isolating the cells of the cell population of the invention can be performed manually, if desired. Alternatively, the process of isolating such cells can be facilitated and/or automated through one or more suitable devices, examples of which are known in the art.

Diagnostics methods of the invention

The authors of the present invention have observed that the number of myometrial precursor cells increases in the myometrium of pregnant females during pregnancy, being this increase higher as pregnancy proceeds (see example 5 of the present invention). Moreover, the authors have also observed that it is not possible to obtain the myometrial precursors of the invention from females which are no longer in fertile age (see example 5 of the present invention). This observation opens the possibility that the number of myometrial cells in the myometrium of a female subject can be used to determine the fertility status or the reproductive capacity of said female subject. Thus, in another aspect, the invention relates to a method for the determination of the reproductive capacity of a female subject comprising the determination of the number of cells that are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 in a myometrial sample obtained from said subject, wherein a reduced number of said cells in the myometrial sample with respect to a reference sample is indicative that the female subject shows low reproductive capacity.

The term "determination of the reproductive capacity" as used herein, relates to the assessment of the probability according to which a female subject can get pregnant after sexual intercourse or after implantation of in vitro generated blastocysts. As will be understood by those skilled in the art, such an assessment, although preferred to be, may usually not be correct for 100% of the subjects to be diagnosed or evaluated. The term, however, requires that a statistically significant portion of subjects can be identified as having an increased probability of being fertile. Whether a subject is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools, e.g., determination of confidence intervals, p-value determination, Student's t-test, Mann- Whitney test, etc. Details are found in Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York 1983. Preferred confidence intervals are at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95%. The p-values are, preferably, 0.2, 0.1 or 0.05.

The term "female subject" refers to a female mammal and include, but are not limited to the Order Rodentia, such as mice; Order Logomorpha, such as rabbits; more particularly the Order Carnivora, including Felines (cats) and Canines (dogs); even more particularly the Order Artiodactyla, Bovines (cows) and Suines (pigs); and the Order Perissodactyla, including Equines (horses); and most particularly the Order Primates, Ceboids and Simoids (monkeys) and Anthropoids (humans and apes). The mammals of preferred embodiments are humans.

The expression "determination of the number of cells that are positive for CD31, CD34, CD44, CD 1 17, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81", as used herein, refers to the qualitative or quantitative determination of the number or presence of cells in the myometrium in the subject under study. The number of adumlt myometrial precursors can be expressed as the amount of precursors per unit weight of the tissue or as a portion (e.g., a percentage) of the total number of cells present in the sample.

The skilled person will appreciate that the determination step can be carried out using any method known in the art for determining the presence of a given cell within a biological sample. In a preferred embodiment, the presence of the adult myometrial precursors according to the invention is carried out by carrying out the isolation process as defined above and which comprises the steps of:

ii) recovering the cells from said cell culture which do not adhere to said solid surface or which show low adherence capacity; and

iii) confirm that the selected cell population presents the phenotype of interest. Once the isolation process is carried out, the number of cells obtained can be counted whereby a number of cells below a given reference level is indicative that the female subject shows low reproductive capacity. Cells can be counted using standard methods such as spectrophotemtrically or by visual inspection using an hemocytometer. In a particular embodiment, the subject is considered as non fertile wherein no cells are detected after carrying out the isolation method defined above but normally, the subject is considered as non fertile when the number of cells is below the number of cells in a reference sample.

Alternatively, it is possible to determine the number of the cells of the invention by counting the number of cells expressing one or more of the markers which are positive for the cells of the invention or by counting the cells which do not express the markers which are absent in the cells of the invention. As used herein, the term "marker" refers to a protein, glycoprotein or other molecule expressed on the surface of a cell or into a cell, and which can be used to help identify the cell (e.g., identify the type of cell). A marker can generally be detected by conventional methods. Specific non-limiting examples of methods that can be used for the detection of a cell surface marker are immunohistochemistry, fluorescence activated cell sorting (FACS), and enzymatic analysis. Alternatively, it is possible to determine whether a given cell expresses the marker of the invention by determining whether said cell expresses the corresponding mR A using RT-PCR or other standard methods.

The results obtained in the determination method can be compared with the value obtained from a reference sample. The term "reference sample", as used herein, refers to a biological sample taken from one or more individuals with a known fertility status. Preferably, the reference sample is taken form a female subject which is fertile, whereby a lower level of cells isolated from the subject under study is indicative that the subject shows low reproductive capacity. The term "lower level" refers to a level that is statistically significant or significantly below the levels found in the reference sample. In one embodiment, the number of cells in the reference sample exceeds the test sample by at least 2 fold, by at least 3 fold, by at least 4 fold, by at least 8 fold, by at least 10 fold, by at least 12 fold, by at least 15 fold, by at least 20 fold, by at least 25 fold, by at least 30 fold or more. The number of fold that the number of cells in the reference sample exceeds that of the test sample can vary from 2 to 30 to 100, and can even be well beyond 100. Intermediate folds between 2 and 100 are included.

In a preferred embodiment, the reference sample is a myometrial sample from a fertile female subject. In a more preferred embodiment, the reference sample is a pool of myometrial samples from a population of fertile female subject

Culture supernatants and extracts of the cells of the invention and uses thereof

The authors of the present invention have found that a conditioned media from the human adult myometrial precursors (AMP) cells according to the invention are capable of effectively decreasing macrophage differentiation in vitro. As shown in example 6 of the present invention, macrophage differentiation is inhibited when contacted with a conditioned medium from either human or mouse adultl myometrial precursors. Thus, in another aspect, the invention relates to a culture supernatant of an isolated stem cell population or an extract of an isolated cell population wherein said isolated cell population is characterised in that the cells are positive for CD31 , CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81. The term "supernatant", as used herein, refers to the liquid remaining when cells grown in broth or agar are harvested in another liquid from an agar plate and are removed by centrifugation, filtration, sedimentation, or other means well known in the art.

The term "extract" or "cell lysate" is used herein to refer to the solution produced when cells are destroyed by disrupting the cellular membrane, containing cellular proteins, nucleic acids, organelles, and/or lipids and refers to both the crude solution produced after cellular rupture as well as to a solution purified or separated by means such as centrifugation. Suitable means for obtaining a cell lysate according to the invention include, without limitation, mechanical lysis using a Waring Blender or a Polytron, liquid homogenization using a Dounce Homogenizer, a Potter-Elvehjem homogenizer or a French press, sonication, freeze/thaw or manual grinding.

The inhibitory effect of the culture supernatants and extracts of the cells of the invention on macrophage differentiation allows the use of said supernatants and extracts for the treatment of diseases wherein an inhibition of macrophage differentiation is desired. Since macrophage differentiation is a hallmark of many inflammatory as well as degenerative processes, the supernatants and lysates of the cells of the invention can be used for the treatment of inflammatory diseases and degenerative processes.

Thus, in another aspect, the invention relates to a pharmaceutical composition comprising an extract or a lysate of the adult myometrial precursors according to the invention. In another aspect, the invention relates to the culture supernatant and/or extract of the cells of the invention for use in the treatment of a disease selected from an inflammatory disease and a degenerative process. Alternatively, the invention relates to the use of the culture supernatant and/or extract of the cells of the invention for the manufacture of a medicament for the treatment of a disease selected from an inflammatory disease and a degenerative process. Alternatively, the invention relates to a method for the treatment of a disease selected from an inflammatory disease and a degenerative process comprising the administration to a patient in need thereof of a culture supernatant and/or a extract of the cells of the invention.

The expression "pharmaceutical composition" has been described in detail before in the context of the pharmaceutical compositions comprising the cells of the invention. The expression "inflammatory disease" or "inflammatory disorder" is used to refer to abnormalities associated with inflammation, including, but not limited, to chronic inflammation and acute inflammation. Inflammatory disease that can be treated with the compositions of the present invention include, without limitation, transplant rejection; chronic inflammatory disorders of the joints, such as arthritis, rheumatoid arthritis, juvenile idiopathic arthritis, ankylosing spondylitis, psoriatic arthritis, osteoarthritis and bone diseases associated with increased bone resorption; inflammatory bowel diseases, such as ileitis, ulcerative colitis, Barrett's syndrome, and Crohn's disease; inflammatory lung disorders, such as asthma, adult respiratory distress syndrome (ARDS), chronic obstructive pulmonary disease (COPD) or chronic obstructive airway disease; inflammatory disorders of the eye, such as corneal dystrophy, trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and endophthalmitis; chronic inflammatory disorders of the gum, such as gingivitis and periodontitis; tuberculosis; leprosy; inflammatory diseases of the kidney, such as uremic complications, glomerulonephritis and nephrosis; inflammatory diseases of the liver, such as viral hepatitis and autoimmune hepatitis; inflammatory disorders of the skin, such as sclerodermatitis, psoriasis, erythema, eczema, or contact dermatitis; inflammatory diseases of the central nervous system, such as stroke, chronic demyelinating diseases of the nervous system, multiple sclerosis, AIDS-related neurodegeneration and Alzheimer's disease, infectious meningitis, encephalomyelitis, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis and viral or autoimmune encephalitis; autoimmune diseases, such as diabetes mellitus, immune- complex vasculitis, systemic lupus erythematosus (SLE); inflammatory diseases of the heart, such as cardiomyopathy, ischemic heart disease, hypercholesterolemia, and atherosclerosis; as well as inflammation resulting from various diseases such as preeclampsia, chronic liver failure, brain and spinal cord trauma, and cancer Inflammatory diseases treatable as described herein further include systemic inflammations of the body

More particularly, inflammatory diseases treatable as described herein include inflammatory rheumatoid or rheumatic disease, especially of manifestations at the locomotor apparatus, such as rheumatoid arthritis, juvenile arthritis or psoriasis arthropathy; paraneoplastic syndrome or tumor-induced inflammatory diseases; turbin effusion; collagenosis, such as systemic Lupus erythmatosus, polymyositis, dermato- myositis; systemic sclerodermia or mixed collagenosis; postinfectious arthritis (where no living pathogenic organism can be found at or in the infected part of the body); seronegative spondylarthritis, such as spondylitis ankylosans; and vasculitis.

The therapy with the culture supernatant or the extract from the adult myometrial precursor according to the invention may be supplemented with additional anti-inflammatory therapy. Non-limiting examples of anti-inflammatory agents include non-steroidal antiinflammatory drugs (NSAIDs), steroidal anti-inflammatory drugs, anticholinergics (e.g., atropine sulfate, atropine methylnitrate, and ipratropium bromide (ATROVENT™)), beta₂-agonists (e.g., abuterol (VENTOLIN™ and PROVENTIL™), bitolterol (TORNALATE™), levalbuterol (XOPONEX™), metaproterenol (ALUPENT™), pirbuterol (MAXAIR™), terbutlaine (BRETHAIRE™ and BRETHINE™), albuterol (PROVENTIL™, REPETABS™, and VOLMAX™), formoterol (FORADIL AEROLIZER™), and salmeterol (SEREVENT™ and SEREVENT DISKUS™)), and methylxanthines (e.g., theophylline (UNIPHYL™, THEO-DUR™, SLO-BID™, AND TEHO-42™)). Examples of NSAIDs include, but are not limited to, aspirin, ibuprofen, celecoxib (CELEBREX™), diclofenac (VOLTAREN™), etodolac (LODINE™), fenoprofen (NALFON™), indomethacin (INDOCIN™), ketoralac (TORADOL™), oxaprozin (DAYPRO™), nabumentone (RELAFEN™), sulindac (CLINORIL™), tolmentin (TOLECTIN™), rofecoxib (VIOXX™), naproxen (ALEVE™, NAPROSYN™), ketoprofen (ACTRON™) and nabumetone (RELAFEN™). Such NSAIDs function by inhibiting a cyclooxygenase enzyme (e.g., COX-I and/or COX-2). Examples of steroidal anti-inflammatory drugs include, but are not limited to, glucocorticoids, dexamethasone (DECADRON™), corticosteroids (e.g., methylprednisolone (MEDROL™)), cortisone, hydrocortisone, prednisone (PREDNISONE™ and DELTASONE™), prednisolone (PRELONE™ and PEDIAPRED™), triamcinolone, azulfidine, and inhibitors of eicosanoids (e.g., prostaglandins, thromboxanes, and leukotrienes. Other examples of anti-inflammatory agents can be found, e.g., in U.S. Publ'n No. 005/0002934 Al at paragraphs 290-294, which is incorporated by reference in its entirety. In other embodiments, the therapy(ies) used in accordance with the invention is not an anti-inflammatory agent. The expressions "degenerative process", "degenerative disorder" "degenerative disease" and "degenerative condition", as used herein, the terms "degenerative disorder" "degenerative disease" and "degenerative condition" are directed to any disorder, disease or condition characterized by inappropriate cell proliferation or inappropriate cell death or in some cases, both, or aberrant or disregulated apoptosis. These conditions also include conditions in which, although appropriate and regulated at the level of a single cell, excessive apoptosis is associated with organ dysfunction or failure. Degenerative disorders for which it is contemplated that one or more cytoprotective compounds disclosed herein will provide therapeutic benefit include chronic, acute and/or remitting/relapsing disorders, and thus also include: neurodegenerative disorders, for instance, disorders that are characterized by a progressive loss of neurons in the peripheral nervous system and/or in the central nervous system; neurological and neurodegenerative diseases and conditions such as Alzheimer's disease, Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), peripheral neuropathy, shingles, stroke, traumatic injury, cognitive impairment, mild cognitive impairment, traumatic and other brain injury, Huntington's disease, age-related dementia and memory impairment, peripheral nerve damage, cerebral edema, hematoma; various neurological and other degenerative consequences of neurological and chest surgeries, schizophrenia and epilepsy, Down's Syndrome, Turner's Syndrome, spinal cord injury, hypoglycemia; degenerative conditions associated with acquired immune deficiency syndrome (AIDS); alcohol- induced dementia, Wernicke-Korsakoff related dementia; various disorders of bone, joint, connective tissue and/or cartilage, such as bone disorders including osteoporosis, osteomyelitis, ischemic bone disease, fibrous dysplasia, rickets, Cushing's syndrome and osteoarthritis, other types of arthritis and conditions of bone, joint, connective tissue and/or cartilage degeneration including rheumatoid, psoriatic arthritis; muscle wasting disorders such as muscular dystrophy, Duchenne Muscular Dystrophy, and the like.

Diseases that could be candidates to be treated with AMP cells and/or their derivatives include, without limitation, human conditions associated with tissue damage such as acute tissue damage (trauma, ischemic damage, tissue damage caused by toxic substances, tissue damage caused by microorganisms, etc), chronic tissue damage (chronic ischemia like in diabetes, degenerative diseases like in Alzheimer disease, chronic inflammatory diseases like in the rheumatoid arthritis or in Crohn disease, skin diseases like psoriasis). Importantly, uterine cells and derivatives can also be of therapeutic value for human cancer. Also, said uterine cells can be used to benefit the clinical outcome of transplants of allogenic cell, tissue or organs.

The invention will now be described in more detail, by way of examples which in no way are meant to limit the scope of the invention, but, rather, these examples will serve to illustrate the invention with reference to the accompanying figures.

EXAMPLES

Isolation, in vitro expansion and differentiation of mouse adult myometrial precursors (MAMps) from the uterine tissue

I. Materials and Methods Uterine and myometrial explants

Myometrial explants were taken from the lower uterine segment of the corpus uteri by uterine exfolation. Sampling involves collecting exfoliated cells from the endocervical uterine canal with an appropiate tool. All explants were trimmed of endometrial, serosal, fat and fibrous tissue prior to use. Technique would be similar to a cervical cytology.

Myometrial tissue can be maintained for up to 24 hours post-obtention in oxygenated (95% 0₂, 5% CO₂) physiological salt solution (PBS) at room temperature. Samples were transferred to a Petri dish coated with gelatin 1% in presence of 10% FBS-DMEM plus 5 mM glutamine and antibiotics. These samples were cultured for 15 days and after the initial outgrowth of fibroblast-like cells, small round and refractile cells appeared. This cell population was easily collected by gently pipeting of the original culture, counted and cloned by limited dilution on gelatin 1% coated p96-well dishes.

Myometrial precursors were also obtained from uterine explants. Myometrial tissue pieces (10-30mg) obtained from 4 months C57 mice were kept in DMEM w/o FCS (fetal calf serum), with antibiotics. Each piece was then rinsed in PBS with Ca/Mg and sharply dissected into 1-2 mm diameter pieces with a scalpel. Fragments containing small vessels were transferred to a Petri dish coated with gelatin 1% in presence of 10% FBS-DMEM plus 5 mM glutamine and antibiotics. These fragments were cultured for 15 days and after the initial outgrowth of fibroblast-like cells, small round and refractile cells appeared. This cell population was easily collected by gently pipeting of the original culture, counted and cloned by limited dilution on gelatin 1% coated p96well dishes.

Different valid clones were selected by phase contrast morphology and then characterized by surface markers expression.

Differentiation assays

Differentiation into different cell types was induced following already well-known published protocols.

Cultures were shifted to differentiation medium (DMEM supplemented with 2% horse serum). Differentiation into smooth muscle cells and osteoblasts was induced by treatment with TGF i and BMP2 respectively, as previously described (Minasi, M.G., et al. 2002. Development 129, 2773-2783). Differentiation into skeletal muscle cells was induced by co-culturing MAMps with C2C12 mouse myoblasts.

Differentiation into cardiac cells was analyzed after treatment with 10 microM 5- azacytidine for 48 hours. After 5 days cultures were fixed and stained with colour solutions or with antibodies against striated myosin (MF20).

Immunofluorescence for cardiac differentiation

Cells were grown on glass coverslips, washed with PBS and fixed with 4% paraformaldehyde for 10 minutes. Cells were permeabilized with 0.25% Triton X-100,

1% BSA in PBS for 30 minutes at RT, while tissue sections were incubated without detergent. Cells and tissue sections were incubated with BSA5% for 30 minutes a RT, and incubated overnight at 4°C with monoclonal anti actin cardiac antibody (Sigma A

9357) at 1/100 dilution.

After incubation, samples were washed twice with the permeabilization buffer and then incubated with Anti-mouse Alexa 488 for 45 minutes at RT. After three final washes, and staining with Hoescht, the cover slips were mounted on glass slides using

PBS/Glicerol and analyzed under a fluorescent microscope (Nikon). Gene expression analysis for cardiac differentiation

R A was extracted by using trizol method, treated with DNAse, and reverse transcribed (superscript, invitrogen) from cells after 48h of azacitidine treatment and five days later, reverse transcriptase was performed for analyzing the expression of different genes involved in cardiac differentiation (Actin cardiac, GATA 4, nkx2.5). The conditions for the PCR were general for all primers: 94 °C for 5 minutes. 40 cycles of 94°C, 1 min; 60°C, lmin; 72°C, 2 min. And a final step of 72 °C for 10 minutes. The primers used were:

Cardiac actin primer forward GTGCCAGGATGTGTGACGA SEQ ID NO: l Cardiac actin primer reverse CTGTCCCATACCCACCATGAC SEQ ID NO:2 Nkx2.5 primer forward CAGTGGAGCTGGACAAAGCC SEQ ID NO:3 NKX2.5 primer reverse TAGCGACGGT TCTGGAACCA SEQ ID NO:4 GATA 4 primer forward CTGTCATCTCACTATGGGCA SEQ ID NO:5 GATA 4 primer reverse CCAAGTCCGAGCAGGAAT T T SEQ ID NO:6

Neural differentiation

Differentiation into neural cells consist on changing the culture medium to a neural stem cell proliferation medium: DMEM:F12 medium (Sigma) supplemented with D-Glucose (Sigma) to a final concentration of 4.5 mg/ml, N2 Supplement (Gibco -Invitrogen), B27 Supplement (Gibco -Invitrogen), 20μg/ml insulin (Sigma), 2 μg/ml heparin (Sigma), 20 ng/ml FGF (Sigma), 10 ng/ml EGF (Sigma). The neural stem cell proliferation medium was changed twice and after one week in culture, the cells were processed for immuno cytochemistry. Further, cells were grown for another week in neural stem cell differentiation medium (DMEM:F12 (Sigma), supplemented with D-Glucose (Sigma) to a final concentration of 4,5 mg/ml, N2 Supplement (Gibco-Invitrogen), B27 Supplement (Gibco-Invitrogen), 2 μg/ml heparin (Sigma) and 1% FBS (Sigma)) and for another week in specific medium for neuronal culture (Neurobasal-A (Gibco- Invitrogen), B27 (Gibco-Invitrogen), Glutamax-I (Gibco-Invitrogen), P/S (Sigma)) and oligodendrocyte differentiation (DMEM (Sigma), 4.5 mg/mL D-glucose, 100 μg/mL BSA (Sigma), 100 U/mL penicillin, 100 μg/mL streptomycin (Sigma), 2 mM L- glutamine (Sigma), 60 μg/mL N-acetyl-L-cysteine (Sigma), N2 Supplement (Gibco- Invitrogen), 20 ng/mL bFGF (PeproTech) and 10 ng/mL PDGF-AA (PeproTech). After this time, the cells were processed for inmuno cytochemistry. Identification of human nuclei was confirmed by Hoechst. Percentage of differentiation was calculated by counting the number of differentiated MAMps.

Angiogenesis

10 x 10³ AMP were seeded on matrigel-coated p24w plates. After 6h, the number of vessels was counted and photographs were taken at the microscope. Mesenchymal stem cells (MSC) from obese mice were used as negative control. These cells have the same origin as AMPs (as both are mesenchymal stem cells) but cannot form vessels in vitro (Galvez BG et al., 2009, PLoS ONE 4(2): e4444. doi: 10.1371/journal.pone.0004444). In contrast, AMPs can generate vessels in vitro as shown figure. Analysis of cell proliferarion

Cells were plated at a density of 3 x 10³ cells/cm² in different media and passed on average every three days. At each passage, the number of cells was counted in triplicate in a hemocytometer. For the growing curve of the clones, cells were plated initially at 1 x 10⁴ cells/cm² in complete DMEM or embryonic media and passed every five days. At each passage, the number of cells was counted in triplicate in the hemocytometer.

Karyotype analysis

Cells, plated at 1/3 confluence 72 hours before analysis, were processed with the Karyomax kit (Invitrogen) according to the manufacturer's instructions. For each of the karyotypes analyzed, 5 different metaphase spreads were examined.

Tumorigenicitv

To test for possible tumor formation, 5 nude mice were injected subcutaneously with 10⁷ MAMps. After 4 months, the mice were sacrificed and analyzed for the presence of macro scopically detectable tumors. Immunofluorescence

Cells were grown on gelatin coated glass coverslips, washed with PBS and fixed with 4% paraformaldehyde for 10 minutes. Samples were frozen in liquid nitrogen cooled isopentane and serial 8 μιη thick sections were cut with a Leyca cryostat. Cells were permeabilized with 0.2% Triton X-100, 1% BSA in PBS for 30 minutes at RT, while tissue sections were incubated without detergent. Cells and tissue sections were incubated with 10% donkey serum for 30 minutes a RT, and incubated overnight at 4°C with primary antibodies at the appropriate dilution. After incubation, samples were washed twice with the permeabilization buffer and then incubated with the appropriate FITC or TRiTC conjugated anti-mouse or anti-rabbit IgG and Hoechst for 45 minutes at RT. After three final washes, the cover slips were mounted on glass slides using mowiol in PBS and analyzed under a fluorescent microscope (Nikon). Other tissue sections or cells were stained with X-Gal as described (Sampaolesi M, et al. 2003. Science. 301 :487-492).

Antibodies

The following antibodies were used: anti-laminin monoclonal or polyclonal antibodies (Sigma) at 1 : 100 dilution; MF20 antibody at 1 : 5 dilution, anti Smooth Alpha actin 1 :300 dilution from Sigma, polyclonal anti-nestin antibody (Abeam), beta-III- tubulin (anti- TUJl antibody, Abeam), doublecortin (anti- Dcx antibody, Abeam), and MAP2 (Sigma) as neuronal marker, GFAP (Sigma) as astrocyte marker and RIP (Developmental Studies Hybridoma Bank) as oligodendrocyte marker. Nuclei were stained with bisbenzimide (Sigma). For FACS analysis (FACS Calibur (Becton Dickinson)) the following antibodies were used CD44, CD34, CD45, CD117, CD133 from BD Biosciences, CD31, CD13, from ID labs Inc, CD146 from Biocytes, CD80, CD90, SSEA-4, WGA from Abeam, TRA1-60 and TRAl-81 from Biotech, TMRM from Molecular Probes. Gene expression analysis

RNA was extracted from the different MAMps clones cells while growing. RT- PCR was performed for analyzing the expression of different genes involved in development or differentiation previously described by other groups (MefZc, Sox2, Tbx5, hTERT, Mef2a and Tbx2).

The conditions for the PCR were general for all primers: 94 °C for 4 minutes. 30 cycles of 94 °C, 45 s; 55 °C, 45 s; 72 °C, 45 s. And a final step of 72 °C for 10 minutes. List of used primers:

Mef2a primer forward T TGAGGCTCT G AAC AAG AAG G SEQ ID NO:7

Mef2a primer reverse GCAT TGCCAGTACT TGGTGG SEQ ID NO:8

Mef2c primer forward AACACGGGGACTATGGGGAGAAA SEQ ID NO:9

Mef2c primer reverse TATGGCTGGACACTGGGATGGTA SEQ ID NO: 10

Tbx2 primer forward GGTGCAGACAGACAGTGCGT SEQ ID NO: 11

Tbx2 primer reverse AGGCCAGTAGGTGACCCATG SEQ ID N012

Tbx5 primer forward CCAGCTCGGCGAAGGGATGT T T SEQ ID NO: 13

Tbx5 primer reverse CCGACGCCGTGTACCGAGTGAT SEQ ID NO: 14

Sox2 primer forward GGCAGCTACAGCATGATGCAGGAGC SEQ ID NO: 15

Sox2 primer reverse CTGGTCATGGAGT TGTACTGCAGG SEQ ID NO: 16 mTERT human/mouse TERT primer pair

(R&D systems)

Alkaline Phospatase (AP) reaction

MAMps were cultured for five days on plates prior to analyzing AP activity, at high density.

On the fifth day, media was aspirated and cells fixed with 4% paraformaldehyde in PBS for 3 min. Then, fixative was aspirated and rinsed with PBS lx.

Stain solution was added (mix fast red violet with naphthol, phosphatase solution and water in a 2: 1 : 1 ratio. Detection kit, (Millipore) covering each well and incubated for 15 min at room temperature in dark. Aspirate solution, rinse plates with PBS lx and count and analyze under microscope the number of violet cells.

Results

Example 1

Isolation and in vitro expansion of cells from primary mouse uterine biopsies

As mentioned above, uterus biopsies were dissected under the microscope; fragments of vessels and surrounding mesenchymal tissue were dissected and plated on gelatin coated dish as previously described for other cell types (Minasi, M.G., et al cited supra; Sampaolesi M, et al. 2003. cited supra). After the initial outgrowth of fibroblast- like cells, small round and refractile cells appeared. Those cells adhered poorly to the substratum and were thus collected by gently pipetting. Floating cells were either grown as a polyclonal population or, in some cases, cloned by limited dilution. The large majority of the cells in the population acquired a triangular, refractile morphology and maintained a high proliferation rate for approximately 30 passages with a doubling time of approximately 36 hours. MAMps can be maintained and allowed to proliferate ex vivo in culture medium. Such medium is composed of, for example, Dulbecco's Modified Eagle's Medium (DMEM), with antibiotics (for example, lOOunits/ml Penicillin and 100 mg/ml Streptomycin) or without antibiotics, and 5 mM glutamine, and supplemented with 2-20% fetal bovine serum (FBS). Indeed, the data herewith presented demonstrate that these cells can be grown extensively but not indefinitely in vitro. These cells undergo senescence after approximately 30 passages in vitro.

Proliferation rate was largely independent from the age of the mice (ranging from 4 to 8 months). This proliferation rate leads to a final number of approximately 3 xlO⁹ cells, starting from 10.000 cells outgrown. This number of cells would be suitable for injections. After 30 passages (approximately 60 PD), large flat cells appeared at increasing frequency that did not divide any more and after few more passages the whole population underwent senescence. At both early and late passages, cells were maintained a normal diploid karyotype.

To test for tumorigenicity, 10⁷ MAMps were injected subcutaneously SCID/beige mice. 10 injected mice were maintained up to 6 months after the injection and none of them developed any visible tumor that could be detected macroscopically at autopsy.

To confirm the efficiency of the protocol for the isolation of stem cells in other mammals. We demonstrated that these cells can be obtained by conventional means from any suitable source of myometrial tissue from any suitable animal, including humans. In the human case, myometrial tissue samples are obtained from the lower uterine segment of the corpus uteri by uterine exfoliation. Sampling involves collecting exfoliated cells from the endocervical uterine canal with an appropriate tool. In general, cells are obtained from non-pathological post-natal mammalian myometrial tissue. As Figure shown, human adult myometrial precursors (HAMps) can be isolated easily, following a similar protocol used for MAMps. HAMps are similar morphologically to MAMps. The kinetic for the isolation of these cells is faster than with mouse samples. After only seven days, refractile rounded cells come out from the human explant. Policlonal population was collected and again growth curve and kariotype assays were made (data not shown). It is interesting that 10 out 99 patients did not provide MPs; those patients where older than 50 years old. Age can consume the pool of MPs present at the myometrium layer.

In order to test the hormone sensitivity of the MAMps to hormonal treatment cells were pre-treated with a control solution (♦), estrogens (■) or progesterone (^A) (Figure 1). MAMps increased their number after treatment with estrogens or progesterone.

Example 2

Phenotvpe of mouse myometrial precursors

MAMps were further characterized by flow cytometry and PCR gene expression and their ability to differentiate to different cell types was analyzed.

Characterization of surface markers and gene expression

MAMps clones were analyzed by flow cytometry for the expression at the cell surface of the following stem cells markers: CD31, CD34, CD44, CD 1 17, alkaline phosphatase (PAL), HLA-DR, SSEA-1, HLA-DR, WGA, CD13, CD45, CD80, CD90, CD133, CD146, TRAl-60/81 and Tetramethyl Rhodamine Methyl Ester (TMRM). All clones were positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA- lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRAl-81 surface markers. See Table 1 below for percentage and Figure 2 for FACS profiles. The background signal is defined as the signal intensity given by a nonspecific antibody of the same isotype as the specific antibody used to detect each surface marker in conventional FACS analysis. HAMps expressed also similar surface markers in all patients tested.

R A was extracted from the different MAMps clones cells while growing. RT- PCR was performed for analyzing the expression of different genes involved in development or differentiation previously described by other groups. MAMps were positive for MefZc, Sox2, Tbx5 and hTERT, while negative for MefZa and Tbx2 (see Figure 3). HAMps expressed similar genes after testing different patients. Example 3

Differentiation potency of MAMps.

To complete the in vitro characterization of MAMps, their ability to undergo terminal differentiation into different mesoderm cell types was tested. MAMps readily differentiate into smooth muscle, adipocytes or osteoblasts, when treated with, respectively, transforming growth factor beta (TGFP), insulin-dexamethasone or bone morphogenetic protein 2 (BMP2) (see figure 4). When skeletal muscle differentiation was induced by co-culturing MAMps with mouse myogenic cells, a very high percentage (more than 50%) fused into hybrid myo tubes (Figure 4). When cardiac muscle differentiation was induced by adding 5μΜ 5-azacytidine each 48 hours, less than 1% of the MAMps survived. Those cells interestingly expressed sarcomeric myosin (see Figure 5), showing that these cells have the ability to undergo cardiomyogenesis.

MAMps were also able to differentiate into neural tissue after changing to neural stem cells proliferation medium (see methods). After one day in the neural stem cell proliferation medium, and during one week, the cells slowed down the proliferation rate and started changing their shape. Some cells presented long and thin processes and others formed rosettes than resembled neurospheres. Most cells were positive for Nestin (Figure 6). Further, the cells showed positive staining for the three neuronal markers (Tuj-1 , Dcx and MAP2), for the astrocyte marker GFAP as well as for the oligodendrocyte marker, RIP (Figure 7). Furthermore, the morphology of the Tuj-1 positive cells was very similar to that of neuroblasts. Additionally, MAMps were naturally positive for the phosphatase alkaline reaction (Figure 7). Akaline phosphatase (ALP) associated with undifferentiated pluripotent stem cell. Interestingly, myometrial precursors as well as pluripotent stem cells express alkaline phosphatase activity.

Example 4

In vivo differentiation and regeneration

MAMps were injected intra-muscularly into cardiotoxin-damaged muscle of C57 mice. After 1 month, MAMps could be detected in all injected muscles by quantative RT-PCR against GFP. Around 15% of the new fibers were formed by MAMps. When muscles were analyzed by immunohistology, MAMps could be found inside the muscle fibers, regenerating new muscle tissue (see figure 8). We measured the functional recovering of these mice by the trailing running method. MAMps injected mice improve their mobility and running velocity (see figure 8). Animals were used following standard protocols in accordance with institutional guidelines. Uterine tissue regeneration

AMPs can also regenerate uterine tissue in vivo. After damaging the uterine wall with scrapers (in vivo wound healing assay), PAL-positive myometrial precursors increase their number and can be found distributed around the myometrium layer (Figure 9). As evident in the same figure, myometrial precursors tend to form new muscle fibers and new vessels within the myometrim layer (see arrows and asterisks). Vascular tissue regeneration

Figure 10 provides additional proof of mAMPs angiogenic potential: myometrial precursors, in contrast to other mesenchymal precursors, can generate new capillaries in vitro when cultured in the presence of an artificial matrix (Matrigel) for 6h. MSC from obese are used as controls.

Niche of MPs

MPs seem to be localized around the muscle layer of the myometrium, usually close to the vessels. MPs can be localized as double positive stem cells (CD31+, CD34+) around capillaries in the uterus. The number of cells is low and distributed all over the layer under normal conditions.

Example 5

Involvement of MAMPs in pregnancy

Samples from control and pregnant mouse uterus were analyzed by immunohistology. As shown in figure 9, the number of MAMps increased as the pregnancy proceeded. Interestingly, MAMps appeared distributed at day 14 and 19 all over the myometrial uterus. The number of MAMPs at days 0, 7, 14 and 19 were determined and the results shown in Figure 12.

The lower table shows human myometrial samples. The highlighted cells show human patients older than 50 years from which no human myometrial precursors were obtained. From the rest of the human patients, we obtained human myometrial precursors similar to their mouse counterparts.

Example 6

Role of MAMPs supernatants in preventing macrophage differentiation

Supernatant isolation

Mouse myometrial adult precursors according to the invention were washed five times with PBS in order to eliminate the quantity of BSA attached to cells. Next, the cells were cultivated with medium DMEM without serum for 24h. After the 24h, supernatants of the cells were collected in 50 ml Falcon tubes and centrifuged at 1500rpm for 5 min. The supernatant was separated from the remaining pellet and filtered with 0.2 micrometer filters. Filtered supernatants were frozen in liquid nitrogen and kept at -80°C.

In order to test the immunosuppressive capabilities of the cell culture supernatants, the Supernatants were thawed on ice and after 1 hour, were used to grow macrophages. The activation of macrophages was analyzed by studying the expression of their receptors by flow cytometry.

DISCUSSION

The present invention shows the isolation of myometrial precursors from mouse adult uterine tissue. Said precursors can grow until 30 passages and express stem cells surface markers and genes. Besides, these precursors are able to differentiate into different mesoderm tissues types which could make them suitable for regenerative medicine.

Myometrial precursors can be easily isolated from the very biopsy that is used for diagnosis, with no need of additional surgical intervention. The source of cells is important not only for practical reasons. Multipotent mesoderm progenitors, receive some sort of local commitment that favours recruitment into the cell types of the tissue where they reside. So, it is interesting to have a source of mesoderm progenitors that still remain with the multipotency property. A comparison with other stem cells of the mesoderm

In the last several years many different types of mesoderm stem cells have been isolated from both mouse and human tissues and characterized to different extent. These include endothelial progenitor cells (EPC), multipotent adult progenitor cells (MAPC), side population cells (SP), mesoangioblasts, stem/progenitor cells from muscle endothelium, sinovia, dermis, and adipose tissue. Different experimental procedures, different sources and partial characterization still prevent a complete understanding of the heterogeneity of these cells; even less is known on their origin and possible lineage relationships. Whatever the case, many of these cells, such as MDSC or MAPC have been shown to differentiate into skeletal muscle in vitro. Some of these cells grow extensively in vitro but others such as EPC and SP do not; on the other hand EPC and SP can circulate whereas systemic delivery has not been tested for most of the other cell types. For example, it was recently shown that cells isolated from adipose tissue can be grown in vitro extensively, differentiate into several tissues including skeletal muscle and give rise to human dystrophin expressing fibers. But few of these cells can differentiate efficiently to other cells types or be obtained and grow easily. MPs shown in this article can be differentiated into distinct cell types of the three lineages (endoderm, ectoderm and mesoderm).

Perspectives for a clinical trial

In future clinical protocols, systemic delivery appears as an obligate choice. The myometrial precursors of the invention express some of the proteins that leukocytes use to adhere to and cross the endothelium and thus can diffuse into the interstitium of the skeletal muscle, inside the osteogenic tissue and between the adypocytes, when delivered intra-arterially.

Finally, two protocols appear now as alternative choices for cell therapy: autologous cells after gene correction in vitro or normal donor cells in the presence of immune suppression or, hopefully induced adoptive tolerance. Donor cell transplantation would overcome these problems but faces the need for a life long immune suppression that would also start early in life.

The data presented here demonstrate that these cells can be grown extensively but not indefinitely in vitro. These cells maintain a diploid karyotype, are not tumorigenic in immune deficient mice and undergo senescence after approximately 30 passages in vitro. The cell population can be used for enhancing the proliferation, regeneration and/or engrafting of stem cells in any damaged tissue. Myometrial precursors could be used to treat tissue degenerative conditions, such as skeletal muscle degeneration, cardiac tissue degeneration, bone tissue degeneration, neural tissue degeneration, or more than one of the tissue degenerative conditions simultaneously. The possibility of easily isolation of HAMps from the same patient to be treated for regenerative therapies is a promising fact for future clinical trials.

Claims

1. Method for promoting the proliferation of a myometrial-derived mesenchymal stem cell population characterized in that the cells of said cell population are positive for CD31 , CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 surface markers wherein said method comprises contacting the stem cell population with a hormone selected from the group of an estrogen and a progestagen.

2. Method according to claim 1 wherein the estrogen is estradiol and the progestagen is progesterone.

3. Method for the preparation of smooth muscle cells comprising contacting an isolated stem cell population from myometrial tissue with a composition comprising TGFbeta, wherein the cells of said stem cell population are characterized in that they are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

4. Method for the preparation of osteoblasts comprising contacting an isolated stem cell population from myometrial tissue with an osteogenic factor wherein the cells of said stem cell population are characterized in that they are positive for CD31, CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

5. Method according to claim 6 wherein the osteogenic factor is BMP2.

6. Method for the preparation of neural cells comprising contacting an isolated stem cell population from myometrial tissue with a neurogenic factor or with a neurogenic differentiation medium, wherein the cells of said stem cell population are characterized in that are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

7. Method for the preparation of cardiac muscle cells comprising contacting an isolated stem cell population from myometrial tissue with a 5-azacytidine or with a cardiomyogenic differentiation medium, wherein the cells of said stem cell population are characterized in that they are positive for CD31, CD34, CD44, CD 117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81.

8. Isolated myometrial-derived mesenchymal stem cell population characterized in that the cells of said population are positive for CD31, CD34, CD44, CD117, SSEA-4, HLA-DR 5 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81 surface markers for use in the treatment of a myometrial tissue degenerative condition.

9. Isolated myometrial-derived mesenchymal stem cell population characterized in that the cells of said population are positive for CD31, CD34, CD44, CD 117, SSEA-4, HLA-DR 5 and WGA-lectin surface markers and negative for CD 13, CD45, CD80, CD 133, CD146, TRAl-60 and TRAl-81 surface markers for use in method of improving reproductive capacity in a female subject in need thereof.

10. Method for the determination of the reproductive capacity of a female subject comprising the determination of the number of cells that are positive for CD31, CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD13, CD45, CD80, CD133, CD 146, TRAl-60 and TRAl-81 in a myometrial sample obtained from said subject, wherein a reduced number of said cells in the myometrial sample with respect to a reference sample is indicative that the female subject shows low reproductive capacity.

11. Method according to claim 10 wherein the reference sample is a myometrial sample from a fertile female subject.

12. A culture supernatant or an extract of an isolated stem cell population wherein said isolated cell population is characterised in that the cells are positive for CD31 , CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative for CD 13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81.

13. A pharmaceutical composition comprising a culture supernatant or an extract as defined in claim 12.

14. A culture supernatant or an extract as defined in claim 12 for use in medicine.

15. A culture supernatant or an extract as defined in claim 14 for use in the treatment of an inflammatory disease or of a degenerative process.