WO2011032100A1

WO2011032100A1 - Inhibitors of kshv vil6 and human il6

Info

Publication number: WO2011032100A1
Application number: PCT/US2010/048651
Authority: WO
Inventors: Zhi-Ming Zheng; Jeong-Gu Kang
Original assignee: Government Of The U.S.A., As Represented By The Secretary, Department Of Health And Human Services
Priority date: 2009-09-11
Filing date: 2010-09-13
Publication date: 2011-03-17

Abstract

The invention features compositions comprising microRNAs that are capable of repressing vIL6 or hIL6, and related methods of using the microRNAs for treating Kaposi's sarcoma- associated herpes virus (KSHV) infections or diseases caused by KSHV.

Description

INHIBITORS OF KSHV vIL6 AND HUMAN IL6

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to US Provisional Patent Application Serial No.

61/241,678 filed on September 11, 2009. The application is incorporated herein by reference in its entirety.

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY

SPONSORED RESEARCH

Research supporting this application was carried out by the United States of America as represented by the Secretary, Department of Health and Human Services. This research was supported by the Intramural Research Program of the NIH, HIV and AIDS Malignancy Branch, Nanobiology Program, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20852, USA. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Kaposi sarcoma-associated herpesvirus (KSHV) infection leads to development of Kaposi sarcoma, body cavity-based B cell lymphoma, and multicentric Castleman's disease. During virus lytic infection, KSHV encodes a multifunctional protein from its open reading frame 57 (ORF57) that is essential for virus production. ORF57 functions primarily at the post- transcriptional level and enhances mRNA transcript accumulation (thus giving ORF57 the name MTA) and RNA splicing. The mRNA transcripts that accumulate in response to ORF57 function and the mechanisms underlying the transcript accumulation are unknown and represent interesting targets for treating KSHV infections and the diseases caused by KSHV.

SUMMARY OF THE INVENTION

As described below, the present invention features compositions and methods for the treatment and diagnosis of Kaposi's sarcoma-associated virus (KSHV) infection and diseases caused by KSHV. The invention provides- compositions, uses, and methods featuring microRNAs capable of repressing vIL6 or hIL6, and methods treating KSHV infections or diseases caused by KSHV by increasing the expression of the microRNAs in the infected cells. Compositions and articles defined by the invention were isolated or otherwise manufactured in connection with the examples provided below. Other features and advantages of the invention will be apparent from the detailed description, and from the claims.

In one aspect, the invention generally features a method of treatment of a Kaposi's sarcoma-associated herpes virus (KSHV) infection in a subject, involving administering a microRNA capable of repressing viral IL6 (vIL6) or human IL6 (hIL6) to the subject.

In another aspect, the invention features a method of inhibiting replication of KSHV involving contacting a KSHV infected cell with a microRNA capable of repressing vIL6 or hIL6.

In yet another aspect, the invention features a method of inhibiting a disease caused by KSHV in a subject, involving contacting a tumor with an effective amount of a microRNA capable of repressing vIL6 or hIL6.

In another aspect, the invention features a method of ameliorating a disease caused by

KSHV in a subject, involving administering to the subject an effective amount of a microRNA capable of repressing vIL6 or hIL6.

In another aspect, the invention features a method of inhibiting or ameliorating a disease caused by KSHV in a subject, involving administering to the subject an effective amount of a microRNA capable of repressing vIL6 or hIL6 and co-administering one or more

chemotherapeutic agents where the one or more chemotherapeutic agents is selected from the group consisting of abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5,6-pentafluoro-N-(3- fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L-valyl- L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t-butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'-deoxy-8'-norvin- caleukoblastine, docetaxol, doxetaxel, cyclophosphamide, carboplatin, carmustine (BCNU), cisplatin, cryptophycin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, dasatinib, daunorubicin, dolastatin, doxorubicin (adriamycin), erlotinib, etoposide, 5- fluorouracil, finasteride, flutamide, hydroxyurea and hydroxyureataxanes, ifosfamide, imatinib, irinotecan, lenalidomid, liarozole, lonidamine, lomustine (CCNU), mechlorethamine (nitrogen mustard), melphalan, mivobulin isethionate, rhizoxin, sertenef, streptozocin, mitomycin, methotrexate, 5-fluorouracil, nilutamide, onapristone, paclitaxel, panitumumab, pazopanib, prednimustine, procarbazine, rituximab, RPR109881, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, transtuzumab, tretinoin, vinblastine, vincristine, vindesine sulfate, vinflunine, and vorinostat.

In another aspect, the invention features a method of inhibiting or ameliorating a disease caused by KSHV in a subject, involving administering to the subject an effective amount of a microRNA capable of repressing vIL6 or hIL6 and co-administering one or more therapeutic antibodies.

In another aspect, the invention features the use of a microRNA capable of repressing vIL6 or hIL6 for the preparation of a medicament for inhibiting or ameliorating diseasae caused by KSHV in a subject. In certain embodiments, the microRNA for use as a medicament can be used in conjunction with one or more chemotherapeutic agents. In certain embodiments, the microRNA for use as a medicament can be used in conjunction with one or more therapeutic antibodies.

In another aspect, the invention features a kit for the treatment of a disease caused by KSHV, the kit containing an effective amount of a microRNA capable of repressing vIL6 or hIL6 and directions for using the kit for the treatment of a neoplasia.

In another aspect, the invention features a pharmaceutical composition for the treatment of a disease caused by KSHV comprising an effective amount of a microRNA capable of repressing vIL6 or hIL6 and a pharmaceutically acceptable excipient.

In another aspect, the invention features a pharmaceutical composition for the treatment of a disease caused by KSHV comprising an effective amount of a microRNA capable of repressing vIL6 or hIL6 and a pharmaceutically acceptable excipient, where the pharmaceutical composition also contains one or more chemotherapeutic agents.

In another aspect, the invention features a pharmaceutical composition for the treatment of a disease caused by KSHV comprising an effective amount of a microRNA capable of repressing vIL6 or hIL6 and a pharmaceutically acceptable excipient, where the pharmaceutical composition also contains one or more chemotherapeutic agents where the one or more chemotherapeutic agents is selected from the group consisting of abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5, 6-pentafluoro-N-(3-fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t- butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'-deoxy-8'-norvin- caleukoblastine, docetaxol, doxetaxel, cyclophosphamide, carboplatin, carmustine (BCNU),cisplatin, cryptophycin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, dasatinib, daunorubicin, dolastatin, doxorubicin

(adriamycin), erlotinib, etoposide, 5-fluorouracil, finasteride, flutamide, hydroxyurea and hydroxyureataxanes, ifosfamide, imatinib, irinotecan, lenalidomid, liarozole, lonidamine, lomustine (CCNU), mechlorethamine (nitrogen mustard), melphalan, mivobulin isethionate, rhizoxin, sertenef, streptozocin, mitomycin, methotrexate, 5-fluorouracil, nilutamide, onapristone, paclitaxel, panitumumab, pazopanib, prednimustine, procarbazine, rituximab, RPR109881, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, transtuzumab, tretinoin, vinblastine, vincristine, vindesine sulfate, vinflunine, and vorinostat.

In another aspect, the invention features a method of characterizing the aggressiveness of a disease caused by KSHV, involving determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample, wherein a decreased level of expression relative to a reference indicates that the disease caused by KSHV is aggressive, whereas a decreased level of expression relative to a reference indicates that the disease is dormant.

In another aspect, the invention features a method of monitoring a subject diagnosed with a disease caused by KSHV, the method comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample, wherein an alteration in the level of expression relative to the level of expression in a reference indicates the severity of Kaposi's sarcoma in a subject.

In another aspect, the invention features a method of monitoring a subject being treated for a disease caused by KSHV, the method comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample, wherein an alteration in the level of expression relative to the level of expression in a reference indicates the efficacy of the treatment in the subject. In another aspect, the invention features a method of selecting a treatment regimen for a subject diagnosed with a disease caused by KSHV, the method comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample relative to a reference, wherein the level of expression of the microRNA indicates an appropriate treatment regimen for the subject.

In antother aspect, the invention features the use of a microRNA capable or repressing vIL6 or hIL6 in a diagnostic method for diagnosis or monitoring of a disease caused by KSHV, or for selecting a treatment regimen for a disease caused by KSHV.

In another aspect, the invention features a diagnostic kit for the diagnosis of a disease caused by KSHV in a subject comprising a nucleic acid probe capable of detecting a microRNA capable or repressing vIL6 or hIL6 and written instructions for use of the kit for diagnosis of Kaposi's sarcoma.

In another aspect, the invention features a method of altering the expression of a microRNA capable of repressing vIL6 or hIL6 in a cell, the method comprising contacting the cell with an effective amount of an agent capable of altering the expression of the microRNA.

In another aspect, the invention features a method of identifying a compound that inhibits a disease caused by KSHV, the method comprising contacting a cell that does not express a microRNA capable of repressing vIL6 or hIL6 with a candidate agent, and comparing the level of expression of the microRNA in the cell with the level present in a control cell not contacted by the agent, wherein an increase in expression of the microRNA identifies the agent as inhibiting a Kaposi's sarcoma.

In another aspect, the invention features a method of identifying a candidate agent that inhibits a disease caused by KSHV, the method involving: a) contacting a cell containing a reporter molecule under control of a promoter with a candidate compound, wherein the promoter controls the expression of a mircoRNA capable of repressing vIL6 or hIL6; b) detecting the level of the reporter molecule expressed in the cell contacted with the candidate agent; and c) comparing the level of the reporter molecule expressed in the cell contacted with the candidate compound with the level of the reporter molecule expressed in a control cell not contacted with the candidate compound, where an alteration in the level of the reporter molecule expression identifies the candidate compound as a agent that inhibits neoplasia. In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the microRNA is selected from the group consisting of hsa-miR-608 and hsa- miR-1293.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, involves administering to the subject an effective amount of a combination of hsa-miR-608 and hsa-miR-1293.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the microRNA is expressed by a viral vector.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the viral vector is selected from the group consisting of lenti viral vector, adenoviral vector, adeno-associated viral vector, and retroviral vector.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the microRNA is delivered using a cationic liposome.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the microRNA is delivered using a cationic dendrimer.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the microRNA is delivered using a nanoparticle.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the disease caused by KSHV is selected from the group consisting of Kaposi's sarcoma, body cavity-based B cell lymphoma, and Castleman's disease.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, the reference is the level of microRNA found in tissue uninfected with KSHV.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, an increased level of the microRNA indicates that conservative treatment is appropriate.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, conservative treatment is selected from the group consisting of continued monitoring of the patient's condition, less aggressive surgery, less aggressive chemotherapy, radiotherapy, radiofrequency ablation, thermoablation via focused ultrasound, and intraartiral embolisation techniques. In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, a decreased level of the microRNA indicates that aggressive treatment is appropriate.

In various embodiments of any of the above aspects or any other aspect of the invention delineated herein, aggressive treatment is selected from the group consisting of high dose chemotherapy, surgery, radiotherapy, radiofrequency ablation, thermoablation via focused ultrasound, and intraartiral embolisation techniques.

In various embodiments of the therapeutic methods, diagnostic methods, and monitoring methods further include the method of identifying a subject suspected of suffering from or suffereing from a disease caused by KSVH.

In various embodiments, therapeutic methods further include monitoring a subject for amelioration of the disease caused by KSHV.

Definitions

By "KSHV associated microRNA" is meant a microRNA that represses vIL6 or hIL6.

By "a disease caused by Kaposi's sarcoma-associated herpes virus (KSHV)" is meant any disease caused by infection with KSHV including but not limited to Kaposi's sarcoma, body cavity-based B cell lymphoma, and Castleman's disease.

By "represses vIL6 or hIL6" is meant to prevent or block the natural or normal expression of vIL6 or hIL6.

By "capable of repressing vIL6 or hIL6" is meant the capacity to prevent or block the natural or normal expression of vIL6 or hIL6.

By "hsa-miR-608" is meant a microRNA having at least about 85% sequence identity to NCBI Accession No. NR_030339 (Accession No. available at the time of filing) or a fragment thereof that represses vIL6 or hIL6. An exemplary sequence of human hsa-miR-608 is:

GGGCCAAGGUGGGCCAGGGGUGGUGUUGGGACAGCUCCGUUUAAAAAGGCAUCUCCAAGAGCUUCCAUCA AAGGCUGCCUCUUGGUGCAGCACAGGUAGA

Another exemplary sequence of human has-miR-608 is the mature sequence which is:

16- aggggugguguugggacagcuccgu -40 Another exemplary sequence of human has-miR-608 suitable for the construction of an expression vector is:

1 gggccaaggt gggccagggg tggtgttggg acagctccgt ttaaaaaggc atctccaaga

61 gcttccatca aaggctgcct cttggtgcag cacaggtaga

Yet another exemplary sequence of human has-miR-608 suitable for the construction of an expression vector is:

16- aggggtggtgttgggacagctccgt -40

By "hsa-miR-1293" is meant a microRNA having at least about 85% sequence identity to NCBI Accession No. NR_031625 (Accession No. available at the time of filing) or a fragment thereof that represses vIL6 or hIL6. An exemplary sequence of human hsa-miR-1293 is:

AGGUUGUUCUGGGUGGUCUGGAGAUUUGUGCAGCUUGUACCUGCACAAAUCUCCGGACCACUUAGUCUUUA

10- uggguggucuggagauuugugc -31

Another exemplary sequence of human has-miR-608 suitable for the construction of an expression vector is:

1 aggttgttct gggtggtctg gagatttgtg cagcttgtac ctgcacaaat ctccggacca

61 cttagtcttt a

10- tgggtggtctggagatttgtgc -31

By "agent" is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.

By "ameliorate" is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease. By "alteration" is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein. As used herein, an alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels. "

By "analog" is meant a molecule that is not identical, but has analogous functional or structural features. For example, a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding. An analog may include an unnatural amino acid.

"Cationic dendrimer" refers to branched polymers having a positively charged surface that are used to deliver nucleic acid molecules into cells.

"Cationic lipid" refers to positively charged lipids used to deliver nucleic acid molecules into cells.

As used herein, "changed as compared to a control" sample or subject is understood as having a level of the analyte or diagnostic or therapeutic indicator to be detected at a level that is statistically different than a sample from a normal, untreated, or control sample. By "control" is meant a standard or reference condition. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods to select and test control samples are within the ability of those in the art. An analyte can be a naturally occurring substance that is characteristically expressed or produced by the cell or organism (e.g., microRNA levels, viral load, cytokine levels, e.g., IL-6 levels) or a substance produced by a reporter construct (e.g, β-galactosidase or luciferase). The presence or severity of one or more signs or symptoms of a disease can be changed relative to a control, as determined by methods provided herein or by those known in the art. Depending on the method used for detection the amount and measurement of the change can vary. Determination of statistical significance is within the ability of those skilled in the art.

"Chemotherapeutic agent" means any agent useful for treating neoplasia in a subject. A chemotherapeutic agent includes but is not limited to abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5, 6-pentafluoro-N-(3-fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t- butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'-deoxy-8'-norvin- caleukoblastine, docetaxol, doxetaxel, cyclophosphamide, carboplatin, carmustine (BCNU),cisplatin, cryptophycin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, dasatinib, daunorubicin, dolastatin, doxorubicin

(adriamycin), erlotinib, etoposide, 5-fluorouracil, finasteride, flutamide, hydroxyurea and hydroxyureataxanes, ifosfamide, imatinib, irinotecan, lenalidomid, liarozole, lonidamine, lomustine (CCNU), mechlorethamine (nitrogen mustard), melphalan, mivobulin isethionate, rhizoxin, sertenef, streptozocin, mitomycin, methotrexate, 5-fluorouracil, nilutamide,

onapristone, paclitaxel, panitumumab, pazopanib, prednimustine, procarbazine, rituximab, RPR109881, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, transtuzumab, tretinoin, vinblastine, vincristine, vindesine sulfate, vinflunine, and vorinostat.

The phrase "in combination with" is intended to refer to all forms of administration that provide a KSHV associated microRNA molecule together with a second agent, such as a second KSHV associated microRNA or a chemotherapeutic agent, where the two are administered concurrently or sequentially or in any order.

In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean " includes," "including," and the like; "consisting essentially of" or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

"Contacting a cell" is understood herein as providing an agent to a test cell e.g., a cell to be treated in culture, ex vivo, or in an animal, such that the agent can interact with the test cell or cell to be treated, potentially be taken up by the test cell or cell to be treated, and have an effect on the test cell or cell to be treated. The agent or isolated cell can be delivered to the cell directly (e.g., by addition of the agent to culture medium or by injection into the cell or tissue of interest), or by delivery to the organism by an enteral or parenteral route of administration for delivery to the cell by vascular, lymphatic, or other means. Contacting can include circulation of the agent in a carrier through the tissue.

As used herein, "detecting", "detection" and the like are understood that an assay performed to determine one or more characteristics of a sample. For example, detection can include identification of a specific analyte in a sample, a product from a reporter construct or heterologous expression construct (e.g., viral vector) in a sample, or an activity of an agent in a sample. Detection can include the determination of nucleic acid or protein expression or dye uptake in a cell or tissue, e.g., as determined by PCR, immunoassay, microscopy. Detection can include determiniation of the presence of abnormal tissue (e.g., sarcoma). The amount of analyte or activity detected in the sample can be none or below the level of detection of the assay or method.

By "detectable label" is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens.

By "disease" is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.

By "effective amount" is meant the amount of a required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.

"Expression construct" as used herein is understood as a nucleic acid sequence including a sequence for expression as a nucleic acid (e.g., microRNA, pre-microRNA, pre-pro- microRNA) operably linked to a promoter and other essential regulatory sequences to allow for transcription of the RNA in at least one cell type. In a preferred embodiment, the promoter and other regulatory sequences are selected based on the cell type in which the expression construct is to be used. Selection of promoter and other regulatory sequences for protein expression are well known to those of skill in the art. In certain embodiments, an expression construction also includes sequences to allow for the replication of the expression construct, e.g., plasmid sequences, viral sequences, etc. For example, expression constructs can be incorporated into replication competent or replication deficient viral vectors including, but not limited to, adenoviral (Ad) vectors, adeno-associated viral (AAV) vectors of all serotypes, self- complementary AAV vectors, and self-complementary AAV vectors with hybrid serotypes, self- complementary AAV vectors with hybrid serotypes and altered amino acid sequences in the capsid that provide enhanced transduction efficiency, lentiviral vectors, or plasmids for bacterial expression.

By "fragment" is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.

"Hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.

By "inhibits Kaposi's Sarcoma" is meant decreases the propensity of a cell to develop into Kaposi's Sarcoma or slows, decreases, or stabilizes the growth or proliferation of a Kaposi's Sarcoma.

By "inhibit IL-6" is understood as to decrease the level or activity of IL-6, viral and/or IL-6 of the subject or cell infected with the virus (e.g., human IL-6). The level or activity of IL-6 can be decreased, for example, by inhibiting transcription or translation of IL-6, or by decreasing the stability of IL-6 message or protein.

By "isolated polynucleotide" is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.

By "marker" is meant any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder.

By "modification" is meant any biochemical or other synthetic alteration of a nucleotide, amino acid, or other agent relative to a naturally occurring reference agent.

By "microRNA" is meant a nucleobase sequence having biological activity that is independent of any polypeptide encoding activity. MicroRNAs may be synthetic or naturally occurring, and may include one or more modifications described herein. MicroRNAs include pre-microRNAs, hairpin microRNAs, and mature microRNAs.

As used herein, "nucleic acid" as in a nucleic acid for delivery to a cell is understood by its usual meaning in the art as a polynucleotide or oligonucleotide which refers to a string of at least two base-sugar-phosphate combinations. Nucleotides are the monomeric units of nucleic acid polymers. The term includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) in the form of an oligonucleotide messenger RNA, anti-sense, plasmid DNA, parts of a plasmid DNA or genetic material derived from a virus. An oligonucleotide is distinguished, here, from a polynucleotide by containing less than 120 monomeric units. Polynucleotides include nucleic acids of at least two monomers. Nucleic acid as used herein is understood to include a non- natural polynucleotide (not occurring in nature), for example: a derivative of natural nucleotides such as phosphothionates or peptide nucleic acids (such as modified nucleic acids described in the patents and applications WO02/44321, WO/2003/099298, US 20050277610, US

20050244858; and US Patents 7,297,786, 7,560,438 and 7,056,704, all of which are incorporated herein by reference). A nucleic acid can be delivered to a cell in order to produce a cellular change that is therapeutic. The delivery of a nucleic acid or other genetic material for therapeutic purposes is gene therapy. The nucleic acid may express a protein or polypeptide, e.g., a protein that is missing or non-functional in the cell or subject. The nucleic acid may be single or double stranded, may be sense or anti- sense, and can be delivered to a cell as naked DNA, in combination with agents to promote nucleic acid uptake into a cell (e.g., transfection reagents), or in the context of a viral vector. The nucleic acid can be targeted to a nucleic acid that is endogenous to the cell (mRNA or microRNA), or a nucleic acid of a pathogen (e.g., viral gene, e.g., hepatitis viral gene). Delivery of a nucleic acid means to transfer a nucleic acid from a container outside a mammal to within the outer cell membrane of a cell in the mammal.

As used herein, "obtaining" as in "obtaining an agent" includes synthesizing, purchasing, or otherwise acquiring the agent.

By "oligonucleotide" is meant any molecule comprising a nucleobase sequence. An oligonucleotide may, for example, include one or more modified bases, linkages, sugar moieties, or other modifications.

As used herein, "operably linked" is understood as joined, preferably by a covalent linkage, e.g., joining an amino-terminus of one peptide, e.g., expressing an enzyme, to a carboxy terminus of another peptide, e.g., expressing a signal sequence to target the protein to a specific cellular compartment; joining a promoter sequence with coding or non-coding nucleic acid sequence, in a manner that the two or more components that are operably linked either retain their original activity, or gain an activity upon joining such that the activity of the operably linked portions can be assayed, colocalized, and/or have detectable activity, e.g., enzymatic activity, protein expression activity, nucleic acid levels, etc.

The term "pharmaceutically-acceptable excipient" as used herein means one or more compatible solid or liquid filler, diluents or encapsulating substances that are suitable for administration into a human.

"Primer set" or "probe set" means a set of oligonucleotides. A primer set may be used, for example, for the amplification of a polynucleotide of interest. A probe set may be used, for example, to hybridize with a polynucleotide of interest. A primer set would consist of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 80, 100, or more primers or probes.

By "reduces" is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%.

By "reference" is meant a standard or control condition.

A "sample" as used herein refers to a biological material that is isolated from its environment (e.g., blood or tissue from an animal, cells, or conditioned media from tissue culture) and is suspected of containing, or known to contain an analyte, such as a virus, an antibody, or a product from a reporter construct. A sample can also be a partially purified fraction of a tissue or bodily fluid. A reference sample can be a "normal" sample, from a donor not having the disease or condition fluid, or from a normal tissue in a subject having the disease or condition. A reference sample can also be from an untreated donor or cell culture not treated with an active agent. A reference sample can also be taken at a "zero time point" prior to contacting the cell or subject with the agent or therapeutic intervention to be tested.

"Small molecule" as used herein is understood as a compound, typically an organic compound, having a molecular weight of no more than about 1500 Da, 1000 Da, 750 Da, or 500 Da, 250 Da, 100 Da; or any molecular weight bracketed by those values. In an embodiment, a small molecule does not include a polypeptide or nucleic acid.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.

Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e^"3 and e^"100 indicating a closely related sequence.

A subject "suffering from or suspected of suffering from" a specific disease, condition, or syndrome has a sufficient number of risk factors or presents with a sufficient number or combination of signs or symptoms of the disease, condition, or syndrome such that a competent individual would diagnose or suspect that the subject was suffering from the disease, condition, or syndrome. Methods for identification of subjects suffering from or suspected of suffering from a disease resulting from KSHV infection is within the ability of those in the art. Subjects suffering from, and suspected of suffering from, a specific disease, condition, or syndrome are not necessarily two distinct groups. As used herein, "susceptible to" or "prone to" or "predisposed to" a specific disease or condition and the like refers to an individual who based on genetic, environmental, health, and/or other risk factors is more likely to develop a disease or condition than the general population. An increase in likelihood of developing a disease may be an increase of about 10%, 20%, 50%, 100%, 150%, 200%, or more.

By "subject" is meant a mammal, including, but not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, or feline.

"Therapeutic antibody" means any antibody or antigen-binding fragment thereof useful for treating a subject suffering from a disease.

As used herein, the terms "treat," treating," "treatment," and the like refer to reducing or ameliorating a disorder and/or at least one sign or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated. Treatment can include providing more than one dose of a therapeutic agent.

As used herein, the term "viral vector" refers to a virus or a fragment thereof that has been modified for the purpose of expressing a nucleic acid construct into a target cell, including but not limited to lentiviral vectors, adenoviral vectors, adeno-associated viral vector, and retroviral vector.

By "vector" is meant a nucleic acid molecule, for example, a plasmid, cosmid, or bacteriophage, that is capable of replication in a host cell. In one embodiment, a vector is an expression vector that is a nucleic acid construct, generated recombinantly or synthetically, bearing a series of specified nucleic acid elements that enable transcription of a nucleic acid molecule in a host cell. Typically, expression is placed under the control of certain regulatory elements, including constitutive or inducible promoters, tissue-preferred regulatory elements, and enhancers.

Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms "a", "an", and "the" are understood to be singular or plural.

Unless specifically stated or obvious from context, as used herein, the term "about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.

The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1 A - IF illustrate the effect of ORF57 on the expression of vIL6 and hIL6. Figure 1 A shows that vIL6 RNA interacts with ORF57 during lytic KSHV infection. RT-PCR was performed by using a vIL6- specific primer pair on RNA isolated from the CLIP complexes obtained with a polyclonal anti-ORF57 antibody from butyrate-treated JSC- 1 cells. Figures IB and 1C demonstrate that the expression of vIL6 mRNA and protein depends on ORF57 during lytic KSHV infection. Figure IB is a northern blot performed on total RNA obtained from BCBL-1 and JSC-1 cells induced with butyrate (Bu, 3 mM) or from Bac36 cells with a wt KSHV genome and Bac36-A57 with an ORF57-null KSHV genome (3) induced with valproate (VA, 1 mM). Figure 1C is a western blot performed with a polyclonal anti-vIL6 antibody on total cell proteins from the corresponding cells with the same treatment. Figures ID and IE show the induction of vIL6 expression by ORF57 in HEK293 cells (Figure ID) and HeLa and HCT116 cells (Figure IE). Figure IF shows the induction of hIL6 expression by ORF57 in HEK293 cells by cotransfection. Figures 2A - 2G show the interaction of ORF57 with Ago2. Figure 2A is a diagram of vIL6 mRNA and its MRE (line above) identified by CLIP assay. The numbers are the nucleotide (nt) position in the KSHV genome. MRE-A (striped box) and -B (black box and its sequence) are depicted. Figure 2B is a comparison of protein and mRNA levels between the wild type (wt) and a MRE-B deletion mutant (AD) of vIL6 in the presence or absence of ORF57 in HEK293 cells. Figure 2C shows the relative protein RNA ratio of the vIL6 wt and AD in the absence of ORF57 in HEK293 cells. Bars represent mean + SD (n=3). *, P<0.05 (t- test). Figure 2D shows that the MRE-B of vIL6 RNA interacts with ORF57 and Ago2. JSC-1 cell lysates prepared after 24 h induction with butyrate were used for MRE-B and MRE-B mt (mutated nts underlined) RNA pulldown assays. The proteins in the pulldowns were blotted with anti- ORF57 or anti-Ago2 antibodies. Figures 2E and 2F show that ORF57 interacts with Ago2 and RHA in vivo. The JSC-1 lysate described above (Figure 2E) and an HEK293 cell lysate obtained from cotransfection of HA-Ago2 and FLAG-ORF57 expression vectors (Figure 2F) were used for IP western blotting with the corresponding antibodies. Figure 2G shows that the N- terminal half (1-251 aa) of ORF57 interacts with endogenous Ago2. Cell lysates from HEK293 cells transfected with 3x FLAG only or the FLAG-tagged N-terminal half of ORF57 was used for anti-FLAG IP and then blotted with an anti-Ago2 antibody.

Figures 3 A - 3G show the inhibition of vIL6 and hIL6 expression by hsa-miR-1293 and Ago2. Figure 3 A is a diagram showing that the MRE-B of vIL6 mRNA contains a seed match to hsa-miR-1293. Figures 3B and 3C demonstrate the repression of vIL6 expression by Ago2 (Figure 3B) and miR-1293 (Figure 3C) in HEK293 cells. The cells used in Figure 3C were pretreated with 10 nM miR-1293 or a nonspecific control (NC) miRNA for 48 h before

cotransfection. Figures 3D and 3E demonstrate the repression of vIL6 translation by miR-1293 and Ago2 in an in vitro translation assay. Figure 3D is one representative gel out of three run.

Numbers below the gel, relative levels of vIL6 protein normalized to internal control firefly luciferase protein. Figure 3E is a graph showing the translational repression by miR-1293 and HA- Ago2 from 5 separate reactions. Bars represent mean + SD (n=5). **, P<0.01 (t-test). Figure 3F shows the repression of hIL6 protein production by ectopic HA-Ago2 in HEK293 cells. Figure 3G contains a diagram of illustrating that the region of hIL6 mRNA corresponding to the MRE-B region of vIL6 contains a functional seed match to miR-608. Figure 3G also contains a western blot of hIL6 protein in HeLa cells pretreated for 48 h with 10 nM miR-608, miR-1293, or NC miRNA.

Figures 4A - 41 show that ORF57 prevents the miRNA-mediated translational repression of IL6. Figure 4A is a western blot and northern blot showing that cytoplasmic vIL6 protein and RNA levels from HEK293 cells cotransfected with wt and mt ORF57 (1-251) along with 10 nM miR-NC (negative control) or miR-1293. Figure 4B is a graph illustrating the relative protein RNA ratio of vIL6 in the corresponding lanes of Figure 4A. Figures 4C and 4D show that ORF57 prevents vIL6 from miR-1293-mediated translational repression in an in vitro translation assay. Figure 4C is representative of multiple gels. Figure 4D is a graph illustrating the relative levels of vIL6 protein normalized to firefly luciferase. Bars represent mean + SD (n=3). **, p<0.01; *, P<0.05 (t-test). Figures 4E, 4F, and 4G show that ORF57 prevents the association of miR-1293 with vIL6 mRNA in vivo. HEK293 cells were

cotransfected with HA-Ago2 plus the indicated expression vectors and UV irradiated 48 h after cotransfection. The RNA-protein complexes isolated were used as total RNA to detect relative levels of vIL6 mRNA (Figure 4E) in transfected cells or used for anti-Ago2 pulldown to detect Ago2-associated vIL6 mRNA (Figure 4F) or miR-1293 (Figure 4G) in the IP complexes by qRT- PCR. Figures 4H and 41 show that ORF57 prevents recruitment of RNA targets into the RISC. RNA-protein pulldown assays were conducted with a biotinylated RNA oligomer, oNP44, which harbors a vIL6 miR-1293 binding site (Figure 4H), or oJGK50, which contains an hIL6 miR-608 binding site (Figure 41). The cell lysates for the pulldown were prepared from HEK293 cells transfected with miR-NC (negative control), miR-1293 (Figure 4H), or miR-608 (Figure 41). ORF57 protein was added to the cell lysate before the pulldown. ORF57 and endogenous Ago2 in the pulldowns were blotted with anti-ORF57 or anti-Ago2 antibodies.

Figures 5 A and 5B show that the expression of both viral (vIL6) and human (hIL6) IL6 increases during KSHV lytic infection. TREx BCBLl-Rta cells carrying an episomal KSHV genome and a tetracycline-inducible Rta (ORF50) expression vector were cultivated in the presence of doxycycline (1 μg/ml) to induce KSHV lytic infection. After 12 h of induction, the culture medium and cells were separated by centrifugation. (Figure 5A) The pelleted cell lysates were immunoblotted for vIL6 and ORF57. β-tubulin served as a control for sample loading. (Figure 5B) The level of secreted hIL6 and hIL12 in the culture medium was determined by using Multi-Analyte ELISArray kit. Figures 6A and 6B show the sequences of 18 vIL6 cDNA clones (Figure 6A) and the secondary structure of the identified vIL6 MRE (MTA response element; Figure 6B). Numbers above the sequences are the nt positions in the KSHV genome. Lines immediately below the sequences, along with dotted red vertical lines, are where biotin-labeled RNA oligomers oNP41-44 used in the pulldown assays were derived and where the deletions were made in the corresponding plasmids to create the mutants shown in individual figures. The MRE core A (MRE- A) and core B (MRE-B) are labeled in the corresponding positions, respectively.

Figures 7A and 7B show the function of the MRE in vIL6 expression in response to ORF57. Figure 7A is a diagram of wt vIL6 and its mutants with nt positions of the deletions indicated. Figure 7B shows expression of wt vIL6 and its deletion mutants at the protein and RNA levels in response to ORF57. Total protein and RNA from HEK293 cells transfected with each mutant were analyzed for vIL6 expression by western (WB) and northern (NB) blot, respectively.

Figures 8 A, 8B, and 8C show that the MRE in vIL6 RNA interacts with KSHV ORF57 and Ago2. Figure 8 A is the biotinylated RNA oligomer sequences. See Figure 6A for the nt position of each sequence in the KSHV genome. oJGK9 is an oNP44 mutant with the mutated nts underlined. Figure 8B shows the proteins detected in biotinylated RNA pulldown assays. Cell lysates from HEK293 cells transfected with an ORF57- FLAG expression vector or from JSC-1 cells induced with 3 mM butyrate for 24 h were used for the RNA pulldown and ORF57, Ago2, and RHA immunoblot assays. Figure 8C shows the sequence specificity of vIL6 MRE-B RNA in interactions with Ago2 and ORF57. A cytoplasmic fraction from HEK293 cells ectopically expressing HA/FLAG-hAgo2 and ORF57 was used for the RNA pulldown and immunoblot assays.

Figures 9A, 9B, 9C, 9D, 9E, and 9F show the involvement of the miRNA pathway in the regulation of vIL6 expression. Figure 9A shows the reduction of endogenous Ago2 expression by siRNA promotes vIL6 production in HEK 293 cells. The cell lysates were immunoblotted 24 h after transfection of HEK293 cells pretreated with Ago2 siRNA (40 nM) for 24 h. Figures 9B and 9C show the increased expression of vIL6 and hIL6 in Dicer- deficient RKO cells. Both wt RKO and Dicer-knockout RKO cells (RKO^^" were transfected with a vIL6 (Figure 9B) or hIL6 (Figure 9C) expression vector and were immunoblotted for vIL6 or hIL6 expression. The upper band of hIL6 is modified hIL6 (14). Figure 9D shows that the ectopic expression of HA-Ago2 in HeLa cells inhibits production of wt vIL6, but not miR-1293-resistant vIL6 (miR-re vIL6). HeLa cell lysates 24 h after cotransfection were used for the western blot. Figure 9E shows the reduction of vIL6 RNA production by ectopic expression of HA-Ago2. Total RNA isolated from the corresponding samples in Figure 3B was used for the northern blot. Relative vIL6 RNA levels after normalization to GAPDH RNA (loading control) in the cells without HA-Ago2 cotransfection were set to 0% change. Figure 9F shows that the increased Ago2 expression by cotransfection does not affect vIL6 production in RKO^^" cells.

Figures 10A and 10B show that miR-1293 mediates specific association of Ago2 with the

MRE-B of vIL6 RNA. The 3' halves of vIL6 RNAs with (wt and AF) or without (ΔΕ and AD) the miR- 1293 binding site in the MRE-B (Figure 10A, see also Figure 6A) transcribed in vitro were mixed at 10⁶ cpm with miR-1293 or a negative control (NC) miRNA (300 nM) in the same volume of HEK293 lysate containing HA/FLAG- Ago2. The mixture was incubated at 30°C for 2 h to allow RISC formation of miR-1293 and its targeted vIL6 RNA. Figure 10B shows that after UV cross-linking, the protein- RNA complexes were immunoprecipitated with an anti-HA antibody and digested with RNase Tl and then with proteinase K. The digested RNA was extracted and resolved in a 15% denatured PAGE gel. M, 5-10 bp ladders.

Figures 11 A, 1 IB, and 11C show the conversion of miR-1293-resistant hIL6 to miR-1293- sensitive hIL6 by vIL6 MRE swap. Figure 11 A is a diagram of the strategy for swapping vIL6 MRE (red box) into hIL6. Figure 1 IB is a sequence alignment between vIL6 MRE (bold) and the corresponding region in hIL6 (italic). Conserved nts are marked with stars. Figure 11C shows that the vIL6 MRE functions in hIL6 in response to miR-1293-mediated translational repression. HEK293 cells transfected with a negative control Pre-miR NC or Pre-miR-1293 for 48 h were transfected again with the indicated IL6-FLAG expression vector. Twenty-four hours later, the cell lysates were

immunoblotted with monoclonal anti-FLAG M2 and β-tubulin antibodies.

Figures 12A, 12B, and 12C shows that the enhancement of vIL6 expression by ORF57 relies on the miRNA pathway. Figure 12A shows the expression of vIL6 in RECO*" ^" is independent of ORF57. The N-terminal half of ORF57 (aa 1-300) was used for cotransfections and immunoblotting in wt RKO and RKO^dicer~ cells. Figure 12B shows that the miR-1293-mediated translational repression of vIL6 in HEK293 cells requires an intact miR1293 seed match (binding site) and introduction of point mutations into the seed match (miR-re vIL6) leads to increased vIL6 expression. Figure 12C shows that ORF57 promotes accumulation of vIL6 mRNA with or without the miR-1293 binding site in HEK293 cells. Total RNA from transfected cells was analyzed for vIL6 RNA by northern blot. The bar graph shows relative levels of vIL6 RNA in panel B after being normalized to GAPDH RNA (sample loading control). Error bars represent mean + SD (n=3).

Figure 13 shows that a cytoplasmic version of ORF57 prevents miRNA-mediated translational repression of vIL6. HEK293 cells pre-transfected with 10 nM miR-NC (negative control miRNA) or miR-1293 were cotransfected with a vIL6 expression vector (100 ng) along with increasing amounts of an N-terminal ORF57 mt expression vector that has mutations in the 3 ORF57 nuclear localization signals (NLSs) and expresses mainly a cytoplasmic ORF57. Immunoblotting for vIL6, ORF57, and β-tubulin protein was performed 24 h after transfection.

Figure 14 shows that ORF57 inhibits the association of Ago2 with the MRE-B of vIL6 RNA. The experimental conditions and procedures are identical to those in Figure 10 except for the addition of BSA or ORF57 (10 μg) to the indicated reactions and the use of in vitro- transcribed 3' halves of vIL6 RNA with (AF) or without (ΔΕ) an miR-1293 binding site. M, 5-10 bp ladders.

Figure 15 shows that miR-1293 does not mediate the association of Ago2 with the MRE-A of vIL6 RNA, which contains no miR-1293 seed match. An RNA oligomer of MRE-A (Figure 6A) was used for the pulldown. See more details in Figures 4H and 41.

Figures 16A-16E show the enhancement of vIL6 or hIL6 expression by specific miRNA inhibitors. Figures 16A and 16B show that the inhibition of endogenous miR-1293 and miR-608 in HEK293 cells promotes expression of vIL6 and hIL6, respectively. HEK293 cells were co-transfected with 200 nM of indicated anti-miRs along with 100 ng of FLAG-vIL6 (Left) or FLAG-hIL6 (Right). Protein samples and total RNA were prepared 24 h after transfection. Protein samples were analyzed by western blot with anti-FLAG antibody for vIL6 expression or anti- -tubulin antibody for sample loading (Figure 16A). The amount of vIL6 or hIL6 RNA in the corresponding RNA samples was analyzed by qRT-PCR assays. Bars represent means ± SD (n=3). ** and * indicate P<0.01 and P<0.05 (t-test), respectively (Figure 16B). Figure 16C shows that the blockade of miR-1293 function by an anti-miR-1293 inhibitor increases vIL6 expression in KSHV-infected cells. KSHV⁺ JSC-1 cells and Bac36 cells with a wild type KSHV genome (Bac36 wt) were transfected, respectively, with 400 nM and 200 nM of indicated anti-miRs. Protein samples prepared 3 days after transfection were immunoblotted with anti-vIL6 or anti-β- tubulin antibodies. The numbers below panels indicate a relative level of vI16 expression after being normalized to β-tubulin. Figure 16D shows that the blockade of miR-608 function by anti-miR-608 inhibitor increases hIL6 expression in KSHV⁺ JSC-1 cells. JSC-1 cells were transfected with indicated amount of anti-miRs. Culture media were collected 3 days after transfection. An ELISA assay was conducted to detect secreted hIL6. Bars represent means ± SD (n=3). ** indicates P<0.01 (t-test). Figure 16E is a set of confocal microscopy images of increased vIL6 expression in KSHV⁺ Bac36 wt cells transfected with an anti-miR-1293 inhibitor. Immunofluoresence assay using an anti-vIL6 antibody was carried out over the cells transfected with an indicated anti-miR. Bac36 cells with a wt KSHV genome expressing GFP were merged with the cells expressing vIL6 (red) shown in the bottom panels. Scale bar represents 10 μηι.

Figures 17A-17F show the distribution of endogenous miR-1293 in lymph nodes. In situ hybridization was performed on lymph node sections by using no probe (Figures 17A-17C) or a miR-1293 detection probe (Figures 17D-17F). The purple color indicates miR-1293 labeling. After NBT BCIP reaction, tissue sections were counterstained with the FastRed nuclear staining reagent. MZ, mantle zone; GC, germinal center. Figures 17B and 17E show a representative region showing both MZ and GC from (Figure 17A) and (Figure 17D), respectively, was imaged at higher magnification. Figures 17C and 17F show the regions in the box of (Figure 17B) and (Figure 17E) were further enlarged, respectively. Scale bar represents 50 μηι.

DETAILED DESCRIPTION OF THE INVENTION

The invention features compositions and methods that are useful for the treatment of Kaposi's sarcoma-associated virus (KSHV) infections and diseases caused by KSHV (e.g.

Kaposi's sarcoma, body cavity-based B cell lymphoma, and Castleman' s disease).

The invention is based, at least in part, on the identification of microRNAs which regulate expression of IL6, and the observation that inhibition of these microRNAs leads to an increased expression of vIL6 and hIL6 in cells infected with KSHV. The increased expression of vIL6 and hIL6 promotes KSHV infection and the growth of KSHV infected cells.

Kaposi's sarcoma-associated herpesvirus (KSHV) infection leads to development of a number of neoplastic diseases including e.g., Kaposi sarcoma, body cavity-based B cell lymphoma, and multicentric Castleman' s disease. KSHV infection was found to increase the expression of both viral IL6 (vIL6) and human IL6 (hIL6), which maintain cancer cell proliferation and thus promote KSHV associated diseases. During virus lytic infection, KSHV encodes a multifunctional protein from its open reading frame 57 (ORF57) that is essential for virus production. ORF57 functions primarily at the post-transcriptional level and enhances mRNA transcript accumulation (thus giving ORF57 the name MTA) and RNA splicing. ORF57 was found to increase the expression of both vIL6 and hIL6 by interfering with microRNAs that repress vIL6 and hIL6. In particular, hsa-miR-1293 and hsa-miR-608 were found to repress vIL6 and hIL6, respectively. KSHV ORF57 was found to interact with regions in the vIL6 and hIL6 transcripts that correspond to hsa-mir-1293 and hsa-mir-608 seed matches. ORF57 promoted both vIL6 and hIL6 expression by preventing miRNA-mediated recruitment of IL6 mRNA into the RISC, and thereby relieve the translational repression and microRNA-mediated IL6 RNA instability.

The present invention provides microRNAs and anti-ORF57 that can be used to block KSHV infection and prevent or inhibit diseases caused by KSHV infection by repressing vIL6 and hIL6. In addition, has-miR-608 can be used to treat any diseases associated with hIL6 without KSHV infection.

KSHV Associated Polynucleotides

In general, the invention provides KSHV associated microRNAs (e.g., hsa-miR-608 and hsa-miR-1293) and other target RNAs. An isolated nucleic acid molecule can be manipulated using recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known, or for which polymerase chain reaction (PCR) primer sequences have been disclosed, is considered isolated, but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid molecule that is isolated within a cloning or expression vector may comprise only a tiny percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein, because it can be manipulated using standard techniques known to those of ordinary skill in the art. KSHV associated microRNA Polynucleotide Therapy

As described herein, microRNAs that repress vIL6 or hIL6 are useful for inhibiting, blocking KSHV infection, or slowing the growth or proliferation of diseased cells resulting from KSHV infection or other unknown causes. In certain embodiments, KSHV associated microRNAs inhibit the growth of a cell or tumor infected with KSHV. Accordingly, the invention provides compositions and methods for over-expressing a microRNA in a KSHV infected cell or neoplastic cell or tumor resulting from a disease caused by KSHV. In one embodiment, a KSHV associated microRNA is provided directly to a neoplastic cell or tumor to inhibit KSHV infection or the growth, survival, or proliferation of cells infected with KSHV. In another embodiment, a vector encoding a KSHV associated microRNA is expressed in a cell or tumor to repress vIL6 or hIL6.

Polynucleotide therapy featuring a polynucleotide encoding a KSHV associated microRNA, variant, or fragment thereof is one promising therapeutic approach for treating a neoplasia. Such nucleic acid molecules can be delivered to cells of a subject having a KSHV infection or a disease caused by KSHV. The nucleic acid molecules must be delivered to the cells of a subject in a form in which they can be taken up so that therapeutically effective levels of a KSHV associated microRNA (e.g., hsa-miR-608 and hsa-miR-1293) or fragment thereof can be produced.

Transducing viral (e.g., retroviral, lentiviral, adenoviral, and adeno-associated viral) vectors can be used for somatic cell polynucleotide therapy, especially because of their high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. U.S.A. 94:10319, 1997). For example, a polynucleotide encoding a KSHV associated microRNA, variant, or a fragment thereof, can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest. Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus (also see, for example, the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al.,

BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; Le Gal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346).

Compositions and methods for gene delivery to various organs and cell types in the body are provided, for example in US Patents7,459,153; 7,282,199; 7,259,151; 7,172,893; 7,041,284; 6,849,454; 6,410,011; 6,027,721; and 5,705,151, all of which are incorporated herein by reference. Expression constructs provided in the listed patents and any other known expression constructs for gene delivery can be used in the compositions and methods of the invention.

In preferred embodiments, a viral vector is used to administer a KSHV associated microRNA polynucleotide systemically or specifically to deliver to any tissues or cells expressing hIL6 or endothelial cells, B cells, or B lymphoma cells with KSHV infections.

Non-viral approaches can also be employed for the introduction of a KSHV associated microRNA to a cell of a patient diagnosed as having a KSHV infection or disease caused by KSHV. For example, a KSHV associated microRNA or a nucleic acid molecule encoding a KSHV associated microRNA can be introduced into a cell by administering the nucleic acid in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989;

Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by micro-injection under surgical conditions (Wolff et al., Science 247:1465, 1990). Preferably the nucleic acids are administered in combination with a liposome and protamine.

Polynucleotide transfer can also be achieved using non- viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA or RNA into a cell.

cDNA expression for use in polynucleotide therapy methods can be directed from any suitable promoter [e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters or human U6 and HI promoter], and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell- specific enhancers. Alternatively, if a genomic clone is used as a therapeutic construct, regulation can be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.

Another therapeutic approach included in the invention involves administration of a recombinant therapeutic, such as a recombinant KSHV associated microRNA polynucleotide, variant, or fragment thereof, either directly to the site of a potential or actual disease-affected tissue or systemically (for example, by any conventional recombinant protein administration technique). The dosage of the administered polynucleotide depends on a number of factors, including the size and health of the individual patient. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the

professional judgment of the person administering or supervising the administration of the compositions.

Diagnostics

KSHV associated microRNAs repress the expression of vIL6 or hIL6 and thus correlate with the growth of neoplasia associated with diseases caused by KSHV. Accordingly, expression levels of KSHV associated microRNAs are correlated with a particular disease state (e.g., KSHV infection, Kaposi's sarcoma, body cavity-based B cell lymphoma, and Castleman's disease), and thus are useful in diagnosis. Accordingly, the present invention provides a number of diagnostic assays that are useful for the identification or characterization of KSHV infection and diseases caused by KSHV.

In one embodiment, a patient having a KSHV infection or disease caused by KSHV will show an alteration in the expression of a microRNA that is differentially regulated in KSHV infection versus uninfected. Alterations in gene expression are detected using methods known to the skilled artisan and described herein. Such information can be used to diagnose a KSHV infection or disease caused by KSHV. In another embodiment, an alteration in the expression of a KSHV associated microRNA is detected using real-time quantitative PCR (Q-RT-PCR).

Primers used for amplification of an KSHV associated microRNA molecule, including but not limited to those primer sequences described herein, are useful in diagnostic methods of the invention. The primers of the invention embrace oligonucleotides of sufficient length and appropriate sequence so as to provide specific initiation of polymerization on a significant number of nucleic acids. Specifically, the term "primer" as used herein refers to a sequence comprising two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and most preferably more than 8, which sequence is capable of initiating synthesis of a primer extension product, which is substantially complementary to a locus strand. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent for polymerization. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition. The oligonucleotide primer typically contains between 12 and 27 or more nucleotides, although it may contain fewer nucleotides. Primers of the invention are designed to be "substantially" complementary to each strand of the genomic locus to be amplified and include the appropriate G or C nucleotides as discussed above. This means that the primers must be sufficiently complementary to hybridize with their respective strands under conditions that allow the agent for polymerization to perform. In other words, the primers should have sufficient complementarity with the 5' and 3' flanking sequences to hybridize therewith and permit amplification of the genomic locus. While exemplary primers are provided herein, it is understood that any primer that hybridizes with the target sequences of the invention are useful in the method of the invention for detecting KSHV associated microRNA molecules.

In one embodiment, KSHV associated microRNA- specific primers amplify a desired reverse transcribed RNA target using the polymerase chain reaction (PCR). The amplified product is then detected using standard methods known in the art. In one embodiment, a PCR product (i.e., amplicon) or real-time PCR product is detected by probe binding. In one embodiment, probe binding generates a fluorescent signal, for example, by coupling a fluorogenic dye molecule and a quencher moiety to the same or different oligonucleotide substrates (e.g., TaqMan® (Applied Biosystems, Foster City, CA, USA), Molecular Beacons (see, for example, Tyagi et al., Nature Biotechnology 14(3):303-8, 1996), Scorpions® (Molecular Probes Inc., Eugene, OR, USA)). In another example, a PCR product is detected by the binding of a fluorogenic dye that emits a fluorescent signal upon binding (e.g., SYBR® Green (Molecular Probes)). Such detection methods are useful for the detection of a KSHV associated microRNA PCR product.

In another embodiment, hybridization with PCR probes that are capable of detecting a

KSHV associated microRNA molecule, or closely related molecules, may be used to hybridize to a nucleic acid sequence derived from a patient having a neoplasia. The specificity of the probe determines whether the probe hybridizes to a naturally occurring sequence, allelic variants, or other related sequences. Hybridization techniques may be used to monitor expression levels of these genes (for example, by Northern analysis (Ausubel et al., supra).

In general, the measurement of a KSHV associated microRNA molecule in a subject sample is compared with a diagnostic amount present in a reference. A diagnostic amount distinguishes between dormant tumor tissue and fast-growing tumor tissue. The skilled artisan appreciates that the particular diagnostic amount used can be adjusted to increase sensitivity or specificity of the diagnostic assay depending on the preference of the diagnostician. In general, any significant increase or decrease (e.g., at least about 30% - 50%) in the level of a KSHV associated microRNA molecule in the subject sample relative to a reference may be used to diagnose a neoplasia, or to characterize a neoplasia as dormant or fast-growing. In one embodiment, the reference is the level of KSHV associated microRNA molecule present in a control sample of a corresponding dormant tumor. In another embodiment, the reference is the level of KSHV associated microRNA present in a corresponding tissue sample obtained from a patient that does not have a KSHV infection. In another embodiment, the reference is a baseline level of KSHV associated microRNA present in a biologic sample derived from a patient prior to, during, or after treatment for a KSHV infection or disease caused by KSHV. In yet another embodiment, the reference is a standardized curve.

Types of biological samples

The level of a KSHV associated microRNA molecule can be measured in different types of biologic samples. In one embodiment, the biologic sample is a tissue sample that includes cells of a tissue or organ. Such tissue is obtained, for example, from a biopsy. In another embodiment, the biologic sample is a biologic fluid sample (e.g., blood, urine, seminal fluids, plural effusion fluids, saliva, ascites, or cerebrospinal fluid).

Kits

The invention also provides kits for the diagnosis or monitoring of a neoplasia in a biological sample obtained from a subject. In one embodiment, the kit detects an increase in the expression of a KSHV associated microRNA relative to a reference level of expression. In another embodiment, the kit detects an alteration in the sequence of an KSHV associated microRNA molecule derived from a subject relative to a reference sequence. In related embodiments, the kit includes reagents for monitoring the expression of an KSHV associated microRNA molecule, such as primers or probes that hybridize to a KSHV associated microRNA molecule.

Optionally, the kit includes directions for monitoring KSHV associated microRNA levels in a biological sample derived from a subject. In other embodiments, the kit comprises a sterile container which contains the primer, probe, antibody, or other detection regents; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container form known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding nucleic acids. The instructions will generally include information about the use of the primers or probes described herein and their use in diagnosing a neoplasia. Preferably, the kit further comprises any one or more of the reagents described in the diagnostic assays described herein. In other embodiments, the instructions include at least one of the following: description of the primer or probe; methods for using the enclosed materials for the diagnosis of a neoplasia; precautions; warnings; indications; clinical or research studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.

The invention also provides kits for the treatment of a neoplasia in a subject. In one embodiment, the kit includes an effective amount of a KSHV associated microRNA molecule and directions for using the kit for the treatment of KSHV infection or a disease caused by KSHV. In another embodiment, the kit includes an effective amount of two or more KSHV associated microRNA molecules. In other embodiments, the kit comprises a sterile container which contains the KSHV associated microRNA molecules; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container form known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding nucleic acids. The instructions will generally include information about the use of the KSHV associated microRNA molecules herein and their use in treating a subject with a neoplasia. In other embodiments, the instructions include at least one of the following: methods for using the enclosed materials for the treatment of a neoplasia; precautions; warnings; indications; clinical or research studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.

Patient Monitoring

The disease state or treatment of a patient having a KSHV infection or disease caused by KSHV can be monitored using the methods and compositions of the invention. In one embodiment, a probe that hybridizes to a differentially regulated microRNA is used to quantify microRNA levels, in another embodiment, a microarray is used to assay expression levels of one or more KSHV associated microRNAs. Such monitoring may be useful, for example, in assessing the efficacy of a particular drug or therapeutic regimen in a patient. In one

embodiment, the expression levels of one or more KSHV associated microRNAs is monitored in KSHV infected cells of a subject being treated for a KSHV infection. In one embodiment, an increase in the levels of such microRNAs indicates that the subject's treatment is effective, and no change in the levels of such microRNAs, or an increase in the levels of the microRNAs indicates the subject's treatment is ineffective.

In another embodiment, the expression levels of microRNAs expressed at increased levels in therapeutics that increase the expression of a KSHV associated microRNA are taken as a particularly useful in the invention.

Screening Assays

As reported herein, the expression of a microRNAs of the invention (e.g., KSHV associated microRNAs) repress vIL6 or hIL6. Agents that increase the expression of KSHV associated microRNAs are useful for decreasing the levels of vIL6 or hIL6 in a KSHV infected cell or tumor, or for otherwise inhibiting the growth, survival, or proliferation of a cell associated with a disease caused by KSHV. Accordingly, agents that modulate the expression or activity of a KSHV associated microRNAs, or fragments thereof are useful in the methods of the invention for the treatment or prevention of KSHV infection or a disease caused by KSHV. Any number of methods are available for carrying out screening assays to identify agents that alter the expression of a KSHV associated microRNAs. In one working example, candidate agents are added at varying concentrations to the culture medium of cultured cells expressing one of the microRNAs of the invention. MicroRNAs expression is then measured, for example, by microarray analysis, Northern blot analysis (Ausubel et al., supra), or RT-PCR, using any appropriate fragment prepared from the nucleic acid molecule as a hybridization probe. The level of microRNAexpression in the presence of the candidate agent is compared to the level measured in a control culture medium lacking the candidate molecule. An agent that promotes an alteration in the expression of the target KSHV associated microRNA, or a functional equivalent thereof, is considered useful in the invention; such an agent may be used, for example, as a therapeutic to treat KSHV infection or a disease caused by KSHV in a human patient.

In another embodiment, an expression construct is prepared whereby a detectable reporter is placed under the control of the endogenous promoter that drives KSHV associated microRNA expression. The cell expressing the expression construct is then contacted with a candidate agent, and the expression of the detectable reporter in that cell is compared to the expression of the detectable reporter in an untreated control cell. A candidate compound that alters the expression of the detectable reporter is an agent that is useful for the treatment of KSHV infection or a disease caused by KSHV. In one embodiment, the compound increases the expression of the reporter under the control of a KSHV associated microRNA promoter sequence.

The invention also includes novel compounds identified by the above-described screening assays. Optionally, such compounds are characterized in one or more appropriate animal models to determine the efficacy of the compound for the treatment of a KSHV infection or disease caused by KSHV. Desirably, characterization in an animal model can also be used to determine the toxicity, side effects, or mechanism of action of treatment with such a compound. Furthermore, novel compounds identified in any of the above-described screening assays may be used for the treatment of a KSHV infection or disease caused by KSHV in a subject. Such agents are useful alone or in combination with other conventional therapies known in the art.

Test Compounds and Extracts

In general, agents capable of inhibiting KSHV infection or the growth or proliferation of a neoplasia caused by KSHV infection by altering the expression or biological activity of a KSHV associated microRNA, variant, or fragment thereof are identified from large libraries of either natural product or synthetic (or semi- synthetic) extracts or chemical libraries according to methods known in the art. Numerous methods are also available for generating random or directed synthesis (e.g., semi- synthesis or total synthesis) of any number of chemical

compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, N.H.) and Aldrich Chemical (Milwaukee, Wis.). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor

Branch Oceangraphics Institute (Ft. Pierce, Fla.), and PharmaMar, U.S.A. (Cambridge, Mass.).

In one embodiment, candidate agents of the invention are present in any combinatorial library known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckermann, R.N. et al., J. Med. Chem. 37:2678-85, 1994); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the One-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90:6909, 1993; Erb et al, Proc. Natl. Acad. Sci. USA 91:11422, 1994; Zuckermann et al., J. Med. Chem. 37:2678, 1994; Cho et al., Science 261:1303, 1993; Carrell et al., Angew. Chem. Int. Ed. Engl. 33:2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33:2061, 1994; and Gallop et al., J. Med. Chem. 37:1233, 1994.

Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:412-421, 1992), or on beads (Lam, Nature 354:82-84, 1991), chips (Fodor, Nature 364:555- 556, 1993), bacteria (Ladner, U.S. Patent No. 5,223,409), spores (Ladner U.S. Patent No. 5,223,409), plasmids (Cull et al, Proc Natl Acad Sci USA 89:1865-1869, 1992) or on phage (Scott and Smith, Science 249:386-390, 1990; Devlin, Science 249:404-406, 1990; Cwirla et al. Proc. Natl. Acad. Sci. 87:6378-6382, 1990; Felici, J. Mol. Biol. 222:301-310, 1991; Ladner supra.).

In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their anti-neoplastic activity should be employed whenever possible.

Those skilled in the field of drug discovery and development will understand that the precise source of a compound or test extract is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds.

When a crude extract is found to alter the expression or biological activity of a KSHV associated microRNA, variant, or fragment thereof, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having anti-neoplastic activity. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for the treatment of a KSHV infection or disease caused by KSHV are chemically modified according to methods known in the art.

Pharmaceutical Compositions

The present invention contemplates pharmaceutical preparations comprising agents of the invention that modulate the expression of a microRNA that represses vIL6 or hIL6 (e.g., a KSHV associated microRNA or vectors over-expressing KSHV associated microRNAs) together with a pharmaceutically acceptable carrier. Agents of the invention may be administered as part of a pharmaceutical composition. The compositions should be sterile and contain a

therapeutically effective amount of the nucleic acid molecules in a unit of weight or volume suitable for administration to a subject. These compositions ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10 mL vials are filled with 5 mL of sterile-filtered 1% (w/v) aqueous KSHV associated microRNA polynucleotide solution, and the resulting mixture can then be lyophilized. The infusion solution can be prepared by

reconstituting the lyophilized material using sterile physiological saline solution (0.9% NaCl) or buffered solutions. In addition, KSHV associated microRNAs might be formulated with carrier proteins, lipids, or other organic/inorganic solutions/conjugates that facilitates tumor delivery after systemic administration. Further, alternative routes of administration, e.g. intratumoral, intrathecal, or intraaterial injections could be employed to deliver the KSHV associated microRNAs to target organs/tumor sites.

The agents of the invention (e.g., KSHV associated microRNA polynucleotide or analogs) may be combined, optionally, with a pharmaceutically acceptable excipient. The term "pharmaceutically-acceptable excipient" as used herein means one or more compatible solid or liquid filler, diluents or encapsulating substances that are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate administration. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction that would substantially impair the desired pharmaceutical efficacy.

The compositions can be administered in effective amounts. The effective amount will depend upon the mode of administration, the particular condition being treated and the desired outcome. It may also depend upon the stage of the condition, the age and physical condition of the subject, the nature of concurrent therapy, if any, and like factors well known to the medical practitioner. For therapeutic applications, it is that amount sufficient to achieve a medically desirable result.

With respect to a subject having an neoplastic disease or disorder, an effective amount is sufficient to stabilize, slow, or reduce the proliferation of the neoplasm. Generally, doses of active polynucleotide compositions of the present invention would be from about 0.01 mg/kg per day to about 1000 mg/kg per day. It is expected that doses ranging from about 50 to about 2000 mg/kg will be suitable. For administration of viral particles, dosages are typically provided by number of virus particles (or viral genomes) and effective dosages would range from about 1 x 10⁹ to 1 x 10¹⁵ particles. The methods herein contemplate administration of an effective amount of compound or compound composition to achieve the desired or stated effect. Lower doses will result from certain forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of the compositions of the present invention (e.g., compositions comprising a KSHV associated microRNA).

A variety of administration routes are available. The methods of the invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Other modes of administration include oral, rectal, topical, intraocular, buccal, intravaginal, intracisternal, intracerebroventricular, intratracheal, nasal, transdermal, within/on implants, e.g., fibers such as collagen, osmotic pumps, or grafts comprising appropriately transformed cells, etc., or parenteral routes. Other useful approaches are described in Otto, D. et al., J. Neurosci. Res. 22: 83-91 and in Otto, D. and Unsicker, K. J. Neurosci. 10: 1912-1921. Combination Therapies for the Treatment of a Disease Caused by KSHV

Compositions and methods of the invention may be used in combination with any conventional therapy known in the art. In one embodiment, a composition of the invention (e.g., a composition comprising a KSHV associated microRNA polynucleotide) having anti-neoplastic activity may be used in combination with any anti-neoplastic therapy known in the art for the treatment of a disease caused by KSHV. Exemplary anti-neoplastic therapies include, for example, chemotherapy, cryotherapy, hormone therapy, radiotherapy, and surgery. A KSHV associated microRNA polynucleotide composition of the invention may, if desired, include one or more chemotherapeutic agents typically used in the treatment of a neoplasm, such as abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5, 6-pentafluoro-N-(3-fluoro-4- methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L-valyl-L-valyl-N- methyl-L-valyl-L-proly- 1-Lproline-t-butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'-deoxy-8'-norvin- caleukoblastine, docetaxol, doxetaxel, cyclophosphamide, carboplatin, carmustine (BCNU),cisplatin, cryptophycin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, dasatinib, daunorubicin, dolastatin, doxorubicin (adriamycin), erlotinib, etoposide, 5-fluorouracil, finasteride, flutamide, hydroxyurea and hydroxyureataxanes, ifosfamide, imatinib, irinotecan, lenalidomid, liarozole, lonidamine, lomustine (CCNU), mechlorethamine (nitrogen mustard), melphalan, mivobulin isethionate, rhizoxin, sertenef, streptozocin, mitomycin, methotrexate, 5-fluorouracil, nilutamide, onapristone, paclitaxel, panitumumab, pazopanib, prednimustine, procarbazine, rituximab, RPR109881, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, transtuzumab, tretinoin, vinblastine, vincristine, vindesine sulfate, vinflunine, and vorinostat. Other examples of chemotherapeutic agents can be found in Cancer Principles and Practice of Oncology by V. T. Devita and S. Hellman (editors), 6th edition (Feb. 15, 2001), Lippincott Williams & Wilkins Publishers.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology" "Handbook of Experimental

Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention. EXAMPLES

Example 1: ORF57 interacts with and regulates the expression of vIL6 and hIL6.

The interaction between vIL6 mRNA and ORF57 was measured by CLIP RT-PCR (Figure 1A). vIL6 expression was increased in lymphoma-derived B cell lines (BCBL-1 and JSC-1) with lytic KSHV infection (Figs. IB and 1C), but not in cells in which the KSHV genome is disrupted in the ORF57 locus (Figs. IB and 1C), suggesting that ORF57 is crucial for vIL6 expression. To address whether the ORF57-mediated enhancement of vIL6 expression is independent of other viral factors, a vIL6 expression vector and an ORF57 expression vector were co-transfected into several human epithelial cell lines. Because the vIL6 region identified in ORF57 CLIP assays was in the coding region (Figure 6A), only the ORF region of vIL6 mRNA was included in the expression vector. ORF57 by itself was capable of efficiently promoting vIL6 production in HEK293, HeLa, and HCTl 16 cells (Figs. ID and IE), but not the production of control GFP in HEK293 cells (Figure ID). Lytic KSHV infection also induces hIL6 expression in B cells and in TREx BCBLl-Rta cells (Figure 5B). Consistent with this, ORF57 itself also promoted hIL6 expression in HEK293 cells (Figure IF). Together, these data demonstrate that expression of both vIL6 and hIL6 depends on viral ORF57.

Example 2: The identification of a MTA Response Element ("MRE") in the vIL6 mRNA.

The ORF57 CLIP assay can identify not only RNA targets, but also their responsive regions, which are protected by bound protein(s) from partial RNase digestion after immunoprecipitation (IP). A vIL6 region that interacts with ORF57 was identified (Figure 6A), which was termed MRE (MTA response element). Based on the predicted RNA folding of the MRE (Figure 6B), various MRE deletion mutants of vIL6 were constructed for cotransfection into HEK293 cells and designed RNA oligomers for RNA-protein pulldown assays. Among the vIL6 deletion mutants, the ΔΒ mutant, which has a deletion of almost the entire MRE, showed a much-reduced response to ORF57 at both the protein and RNA levels (Figure 7), indicating that the MRE has a functional role in ORF57-mediated vIL6 expression. Unexpectedly, the 5' to 3' deletions of the MRE increased vIL6 expression in the absence as well as the presence of ORF57. This was most clearly seen for the AD mutant, which has deletion of the MRE-B (MRE core B; Figures 2A, 6A, and 7), yet, even in the absence of ORF57, expressed a remarkable amount of vIL6 protein that was almost comparable to the level in the presence of ORF57 (Figures 7 and 2B). The relative protein level of the AD mutant per unit RNA in the absence of ORF57 was >60% higher than that of wild-type (wt) vIL6 (Figure 2C),

demonstrating a role for MRE-B in translational repression, in contrast to the role of MRE-A (MRE core A) in vIL6 RNA stability as exhibited by the MRE-A deletion in the ΔΒ mutant but not in the AC (Figure 7).

RNA-protein pulldown assays showed that the MRE in vIL6 RNA contains multiple binding sites for cellular proteins and KSHV ORF57 (Figure 8). Both MRE-A (oNP42

oligomer) and MRE-B (oNP44 oligomer) displayed high affinity for ORF57 and Ago2, which contains RNA binding motifs and is an essential component in the siRNA and miRNA pathway, but an MRE-B mutant (oJGK9 oligomer) had weak affinity (Figures 2D, 8B, and 8C). MRE-A also interacts with RNA helicase A ("RHA")(Figure 8B). Because a specific

ORF57-RNA interaction requires cellular proteins, the ORF57 in the MRE pulldowns was assumed to be associated with Ago2. An IP western blot verified that an anti-ORF57 antibody specifically pulls down Ago2 and a lower amount of RHA or vise versa (Figures 2E and 2F), and the N-terminal 251 aa residues of ORF57 are required for the Ago2 interaction (Figure 2G).

Example 3: IL6 expression is regulated by hsa-miR-1293.

To address how the ORF57-Ago2 interaction contributes to KSHV infection-mediated enhancement of IL6 expression, endogenous Ago2 was depleted from HEK293 cells by RNAi. vIL6 protein increased in the Ago2 depleted cells (Figure 9A), indicating that IL6 expression is subject to miRNA regulation. This was confirmed in RKO^^61" cells, which have a global reduction of mature miRNAs; both vIL6 and hIL6 expression were remarkably higher in RKO^^61" cells than in wt RKO cells (Figures 9B and 9C). Because Ago2 binds the MRE-B of vIL6 in a sequence- specific manner (Figure 2D), it is possible that this binding is mediated by an miRNA seed match in the MRE-B. By searching an miRNA database, we identified an hsa-miR- 1293 seed match in the MRE-B (Figure 3A). To examine the role of miR-1293 in

translational repression of vIL6, we mutated the miR-1293 seed match in the MREB of vIL6 (Figure 3 A) and introduced the miR-1293-resistant vIL6 plasmid (miR-re vIL6) into HEK293 (Figure 3B) and HeLa (Figure 9D) cells in the absence or presence of ectopically expressed hemaglutinin- tagged Ago2 (HA-Ago2). Ectopic HA-Ago2 inhibited the expression of vIL6 protein, but not of miR-re vIL6 (Figures 3B and 9D), despite similar reductions in the amounts of each RNA (Figure 9E). When expressed in RKO^^061" cells, HA-Ago2 showed no effect on vIL6 expression (Figure 9F). Collectively, these results indicate an important role for Ago2 and miRNA in the translational repression of vIL6.

To confirm that miR-1293 inhibits vIL6 translation, vIL6 and miR-re vIL6 were separately introduced into HEK293 cells pretransfected with a negative control (NC) miRNA or miR-1293. vIL6 expression was specifically blocked by miR-1293 whereas expression of miR-re vIL6 was not (Figure 3C). To discriminate the miR-1293 specificity in vIL6 translation from any possible indirect effects by off -targets, the specificity was further verified using a rabbit reticulocyte lysate (RRL) in vitro cell-free translation. When HA-Ago2 and miR-1293 were added together to the modified translation assays, a specific translational repression (-25% - 30%) was observed for vIL6 RNA, but not for miR-re IL6 RNA (Figs. 3D and 3E).

The specific interaction of miR-1293 and its vIL6 seed region was examined using an in vitro RISC assembly and RNase protection assay on in vztro-transcribed vIL6 RNAs. The protein-RNA complexes mediated by miR-1293 in the presence of HA-Ago2 were UV cross- linked, immunoprecipitated with an anti-HA antibody, and digested by RNase Tl followed by proteinase K. Gel electrophoresis showed that the RNA fragments were protected by association with HA-Ago2 only in the presence of miR-1293 along with the MRE-B of vIL6 RNA (Figure 10, compare RNA wt to AF), indicating miR-1293-mediated specific association of Ago2 with the MRE-B. The vIL6 RNAs missing the entire MRE (ΔΕ) or part of the MRE-B region (AD) lack the miR-1293 binding site and were not protected by Ago2 and/or its associated proteins (Figure 10). In addition, the MRE-B of vIL6 RNA was also found to be required for the association of Ago2 with the MRE-A region of vIL6, independent of a specific miRNA (Figure 10, compare wt and AD for negative control NC miRNA). Because the MRE-A region, which does not contain miRNA seed matches, also binds RHA in addition to Ago2 and ORF57 (Figure 8B), this observation indicates that the efficiency of the interaction of RHA and its associated protein(s) with the MRE-A of vIL6 can be strengthened by Ago2 loaded on the MRE- B, delineating how MRE-A may contribute to vIL6 RNA stability. Example 4: hIL6 expression is regulated by Ago2 and hsa-miR-608.

The expression of hIL6 protein was also found to be under the control of Ago2 and a specific miRNA, hsa-miR-608. hIL6 expression was greatly increased in RKO^^61" cells (Figure 9C) and suppressed in HeLa cells by ectopic expression of HA-Ago2 (Figure 3F). Alignment of the hIL6 RNA sequence with vIL6 showed that miR-608 and miR- 1293 have overlapping seed matches in the corresponding region of vIL6 MRE-B (Figure 3G). Ectopic expression of miR- 608 and miR1293 demonstrated that only the miR-608 seed match of hIL6 is functional, and it is responsible for miR-608 repression of hIL6 expression (Figure 3G). When swapped into the corresponding region of hIL6, the vIL6 MRE converted miR-1293-resistant hIL6 into miR- 1293-sensitive hIL6 (Figure 11), indicating that each miRNA is specific for its target and that a highly conserved miRNA pathway in human cells regulates IL6-induced cell proliferation.

Given that ORF57 stimulates IL6 expression and interacts with Ago2 and the vIL6 MRE, ORF57 may function by disrupting the miR-1293-mediated repression of vIL6 translation. This hypothesis was supported by two additional pieces of evidence. First, ORF57 enhances vIL6 expression in wt RKO cells and does not so in RKO^ cells (Figure 12A). Second, miR-re vIL6, which contains point mutations in the miR- 1293 seed match, does not increase its protein expression in response to ORF57 (Figure 12B), but does increase RNA accumulation approximately 3- to 5-fold, similar to wt vIL6 (Figure 12C). Because the N-terminal half of ORF57 (1-251 aa or 1-300 aa) functions similarly to full-length ORF57 for Ago2 interaction (Figure 2G) and vIL6 protein expression (Figure 12A), whether the N-terminal half of ORF57 (1-251 aa) could disrupt miR-1293-mediated repression of vIL6 translation was examined. In cotransfection assays, ORF57 (1-251 aa) enhanced vIL6 expression and relieved the miR-1293- mediated translational repression (Figures 4 A and 4B).

Example 5: ORF57 interferes with miR-1293 activity in the cytoplasm. ORF57 is a nucleocytoplasmic shuttling protein that bears several well-characterized nuclear activities, including nuclear RNA accumulation and splicing, but RISC formation is mainly a cytoplasmic event. A cytoplasmic version of mutant ORF57 containing point mutations in all three of its nuclear localization signals was utilized to determine that the observed activity of ORF57 takes place in the cytoplasm (Figures 4 A, 4B, and 13). Although the mutant stabilized vIL6 RNA less than the wt (Figure 4A), it did not differ from the wt in relief of miR-1293-mediated repression of vIL6 translation when the protein/RNA ratio was taken into account (Figure 4B), and also increased vIL6 translation in a dose-dependent manner (Figure 13). To further separate RNA accumulation from the translational repression of ORF57, whether ORF57 directly interferes with the miR-1293-mediated repression of vIL6 translation was examined, using an in vitro translation assay in the presence of purified HA-Ago2. In this system, ORF57 relieved, in a dose-dependent manner, the miR-1293-mediated translational repression of a fixed amount of in vztro-transcribed vIL6 mRNA (Figures 4C and 4D).

Together, these data indicate that ORF57 exercises two major, but separable, functions in the promotion of vIL6 expression: nuclear RNA accumulation/stabilization and cytoplasmic disruption of miR-1293-mediated translational repression.

To understand the molecular mechanism by which ORF57 disrupts the miR-1293- mediated translational repression of vIL6, a CLIP assay was performed with an anti-HA antibody on HEK293 cells cotransfected with HA-Ago2 to quantify the vIL6 RNA and endogenous miR1293 associated with RISC in the presence or absence of ORF57. miR-re vIL6, which lacks the miR-1293 binding site, served as a negative control. Co-transfection with ORF57 promoted the accumulation of both vIL6 and miR-re IL6 RNA, but cotransfection with a luciferase vector did not (Figure 4E). Strikingly, vIL6 mRNA was found to be efficiently recruited into the RISC in the presence of luciferase, but with a much lower extent in the presence of ORF57 (Figure 4F, also compare with the corresponding level of total vIL6 RNA in Figure 4E). In contrast, more miR-1293 was found in the RISC in the presence of ORF57 than in the presence of luciferase (Figure 4G). Together, the data in Figs. 4F and 4G indicate that a large proportion of the RISCs had miR-1293 free from vIL6 RNA due to the presence of ORF57. Very little miR-re vIL6 RNA was present in the RISC (Figure 4F); this RNA showed little affinity for miR-1293 binding (Figure 4G) and no response to ORF57.

To further characterize the miRNA-dependent ORF57 inhibition of target RNA recruitment into the RISC, the ability of ORF57 to inhibit miR-1293 -mediated Ago2 association with vIL6 RNA in a cell-free condition was demonstrated (Figure 14). To confirm whether the association of Ago2 with vIL6 RNA is miRNA-specific and what role ORF57 plays in this specific association, the MRE-A (Figure 15) and MRE-B (Figure 4H) RNA of vIL6 were compared in RNA-protein pulldown assays by using HEK293 cell lysates with ectopically expressed miR-NC or miR-1293. Only the MRE-B, which has the miR-1293 binding site, was able to bind miR-1293-associated endogenous Ago2 (Figure 4H), and ORF57 blocked this binding in a dose-dependent manner. Similar Ago2-binding results were obtained when an miR-608 seed match-containing MRE (oJGK50) of hIL6 was used for the pulldown assay in the presence of miR-608 (Figure 41). The vIL6 MRE- A, which has no miRNA binding site (Figure 15), and the negative control miRNA in the MRE-B pulldown assay (Figure 4H) did not mediate Ago2 binding. Altogether, these data provide further evidence that ORF57 prevents recruitment of miR-1293- or miR-608-specified IL6 RNA into the RISC and therefore disrupts miRNA-mediated translational repression of the target, leading to increased expression of IL6.

Example 6: Anti-miR-1293 and anti-miR-608 interrupt miR-mediated repression of IL6 expression

The finding that miR-re vIL6 could be more efficiently expressed than wt vIL6 in transfected cells (Figure 3B) indicates that the endogenous miR-1293 in these cells could be a natural inhibitor for the expression of vIL6. To investigate whether miR-1293 or miR-608 expression may be sufficient to regulate vIL6 or hIL6 respectively, the copy numbers of miR-1293 and miR-608 in KSHV-positive JSC-1 and BCBL-1 PEL cells, and in KSHV-negative HEK293 cells was assessed by TaqMan real-time RT-PCR assays. The KSHV-positive PEL cells was found to contain -12 copies of miR-1293 and 40-50 copies of miR-608 per cell, while HEK293 cells have -45 copies of miR-1293 and 150 copies of miR-608 per cell. To assess the suppressive effects of endogenous miR-1293 and miR-608 on vIL6 or hIL6 expression, HEK293 cells were cotransfected with a vIL6 ORF expression vector along with anti-miR-1293 or a hIL6 ORF expression vector along with anti-miR-608. Western blot results demonstrated that the cotransfection with a miRNA- specific inhibitor led to remarkable increase of vIL6 or hIL6 expression (Figure 16A). Quantitative analyses of vIL6 and hIL6 RNAs also indicated that the cells cotransfected with a miRNA- specific inhibitor exhibited an increased level of the respective mRNA over the cells receiving a non-specific anti-miR control (Figure 16B). These data indicate that endogenous miR-1293 and miR-608 are highly potent in the control of vIL6 and hIL6 expression respectively, despite their relative low abundance in the cells. Considering that a low amount of vIL6 mRNA is constitutively expressed in a subset of PEL that do not express other KSHV lytic genes, KSHV-infected JSC-1 and Bac36 cells were analyzed for the expression of vIL6 and hIL6 in response to anti-miR-1293 and anti-miR-608 transfection. As shown in Figures 16C and 16D, increased expression of vIL6 (Figure 16C) and hIL6 (Figure 16D) was obtained in the cells transfected with anti-miR-1293 or anti-miR-608 when compared to the cells transfected with a non-specific anti-miR control. This observation could be duplicated in BCBL-1 cells. However, we noticed that hIL6 expression in JSC-1 cells was increased only by 10% in the presence of anti-miR-608 over the cells receiving a non-specific anti-miR control. Although the increase was significant, an narrow increase, as expected for hIL6, suggests that the 3' UTR of ML6 is targeted also by other miRNAs. Confocal microscopy analysis of vIL6 expression in KSHV-positive Bac36 cells also showed enhanced expression of vIL6 after transfection of anti-miR-1293, relative to the cells receiving a non-specific anti-miR control (Figure 16E). Together with the results from gain-of-function of miR-1293 and miR-608 (Figure 3), the data from the loss-of-function of miR-1293 and miR-608 in the presence of their corresponding inhibitors demonstrate that the PEL cells limit the expression of both vIL6 and hIL6, respectively, by low abundant miR-1293 and miR-608.

Example 7: miR -1293 is deficient in the mantle zone of lymph nodes

As assessed by immunohistochemical staining, vIL6 is mostly expressed in the mantle zones of lymph nodes in patients with MCD. This differential expression of vIL6 in lymph nodes might be associated with differential distribution of miR-1293. To address this question, in situ hybridization was used to determine miR-1293 distribution in lymph nodes. Tissue sections of lymph nodes not hybridized with any probe did not manifest any hybridization signal (Figures 17A-17C). In contrast, the lymph node sections hybridized with a miR-155 probe or a miR-1293 probe revealed several interesting observations: (1) miR-155 is mainly distributed in the mantle zone region; and (2) miR-1293 is primarily expressed in the germinal center (Figures 17D-17F), with the hybridization signals mainly in the cytoplasm (Figure 17F). The relative deficiency of miR-1293 in the mantle zones is consistent with a permissive environment for the expression of vIL6 in the specified region. Example 8: Testing of anti-IL6 compounds in vivo

There are no animal models available for KSHV infection for pre-clinical testing.

However, murine herpesvirus 68 and Rhesus monkey rhadinovirus are two closely related animal viruses which are infectious in their respective hosts. One of these viruses, or a similar virus, is identified as having a a miR- 1293 (or other mircoRNA) binding site. Similarly, a miR-608 (or other microRNA) binding site can be identified in the mouse and Rhesus monkey homologs of ML6.

A mammalian homolog of hIL6 containing a miR-608 binding site, or homolog thereof, can be identified, e.g., if the IL-6 homolog is in mouse, IL6 production in mice can be induced by LPS injection into mice. Systematic administration of miR-608, e.g., chemically modified to improve its stability and long half-life or an expression construct expressing miR-608 is tested for reduction of IL6 production, for example by IL6 ELISA. The animals receiving miR-608 treatment, but not in those animals receiving a control miRNA, have reduced IL-6. One or more IL6-related signs or symptoms, such as fever, weight loss, and altered blood leukocyte profiles, etc., should be reduced in those miR-608 treated animals.

Similar assays and methods can be used with miR-1293 constructs.

The results described above were obtained using the following methods and materials.

Cells

HEK293 and HeLa cells were grown in Dulbecco's modified Eagle's medium with 10% FBS. RKO, RKO^dicer" , and HCT116 cells were grown in McCoy's 5A medium with 10% FBS. JSC-1 cells (KSHV+/EBV+) and BCBL-1 cells (KSHV+) were cultured in RPMI 1640 containing 10% FBS and were induced with sodium butyrate (3 mM) for lytic infection. TREx BCBLl-Rta cells carrying an episomal KSHV genome and an inducible Rta (ORF50) expression vector under control of tetracycline -responsible promoter were cultivated as in the presence or absence of doxycycline (lug/ml). A HEK293 cell line stably harboring a wild-type KSHV genome (Bac36 wt) was maintained in Dulbecco's modified Eagle's medium with 10% FBS and hygromycin at 150 ng/ml. HEK293 cell lines stably harboring the KSHV Bac36-wt or Bac36- Δ57 null genome were induced with 1 mM valproate (VA) for lytic infection. Cross-linking immunoprecipitation ( CLIP) assay

Approximately 1 x 10 JSC-1 cells were induced with 3 mM butyrate for 24 h and were washed twice with lx PBS before UV-crosslinking at 480,000 μΐ/cm . Briefly, a cell lysate containing protein-RNA complexes was prepared from the cell pellet by direct lysis in 1 ml of lx RIPA buffer (Boston BIO Products). Protein A agarose beads (Upstate, Lake Placid, NY) were washed with lx immunoprecipitation (IP) buffer [25 mM HEPES (pH7.5); 150 mM NaCl; 0.5 mM EDTA; 1 mM EGTA; 10% glycerol; 0.1% NP40; 1 mM NaF; 1 mM 2-glycerophosphate; 1 mM Na3V04; lx Complete, Mini, EDTA-free protease inhibitor cocktail (Roche, Indianapolis, IN)] and were coated with an anti-ORF57 antibody or control IgG. The cell lysates were precleaned 3 times with the control IgG-coated beads and immunoprecipitated with anti-ORF57 antibody-coated beads at 4°C overnight. The protein-RNA complexes on the beads after IP were washed 3 times with lx IP buffer and were briefly (for a few seconds) digested with RNase Tl (0.005 unites; Ambion, Austin, TX), followed by treatment with proteinase K (0.2 mg/ml;

Roche). RNA was extracted with a phenokchloroform mixture and precipitated in ethanol. RNA was dephosphorylated with Antarctic phosphatase (obtained from New England Biolabs, Ipswich, MA) and ligated to a 3' linker (oNP 21, 5'- rUrUrU A ACCGCG A ATTCC AG/3 AmMC6/- 3 ' ; IDT, Coralville, IA) which was labeled with [γ-

32 P]ATP using T4 Polynucleotide Kinase (In vitro gen, Carlsbad, CA). The linker- ligated RNA was separated in a 15% denaturing polyacrylamide gel (PAGE) and eluted from the gel in probe elution buffer (obtained from Ambion). SMART RT was performed using BD Power Script RT (Clontech, Mountain View, CA) and a random primer (Applied Biosystems) in the presence of SMART primer

(5'-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3') as instructed in Clontech' s protocol. The cDNAs were amplified by PCR, cloned into pCR II-TOPO vectors (obtained from

Invitrogen), and sequenced by Agencourt Bioscience Corporation (Beverly, MA). The inserted sequences were extracted and aligned against the KSHV genome sequence.

Plasmids

pEGFP-Nl (Clontech) was used for GFP expression. ORF57-FLAG (pVM7), the N- terminal 1-251 amino acids (aa) of ORF57-FLAG (pVM24), N-terminal 1-251 aa of mutant ORF57-FLAG (pVM51), and N-terminal 1-300 aa of ORF57-FLAG (pNT3) were used for ORF57 expression (4). To create the KSHV vIL6 (K2) expression vector pNP4, KSHV K2 (nucleotides 17841 to 17227 of the KSHV genome) was amplified by PCR from JSC-1 cell DNA with a primer pair of oNP34

(5'-ATACGACGCGGCCGCACC/ATGTGCTGGTTCAAGTTGTGGTC-3') and oNP35 (5'- TACTCAGGATCC/CTTATCGTGGACGTCAGGAGTCA-3'), digested with BamHI and Noil, and cloned into a p3xFLAG-CMV-14 vector (Sigma, St. Louis, MO). The various vIL6 deletion mutants in Figure 6A were constructed from pNP4 by overlapping PCR and expressed as 3xFLAG-tagged proteins from the p3xFLAG-CMV-14 vector: plasmid pJGKl for ΔΒ, pJGK2 for AC, pJGK3 for AD, pJGK4 for AE, and pJGK5 for AF. To create the miR-re vIL6 (pJGKlO) plasmid, the C17423A, C17424G, C17425A, C17427G, and T17444C mutations were generated in vIL6 by overlapping PCR with the paired primers oNP34 and oNP35 on a mixture of two separate PCR products. The first PCR product was amplified from pNP4 by the primer pair of oJGK32 (5'-ACTGTAGTGCGTCTTGGTCAGCTTATTGA-3') and oNP34, and the second by the primer pair of oJGK33 (5'-CACTACAGTCGAAGAAAATTTGACCGCGGTCT-3') and oNP35. The overlapped PCR product was digested with BamHI and Noil and cloned into a p3xFLAG-CMV-14 vector. To express a 3x FLAG-tagged ML6 (pJGK6), the human IL6 ORF from the SC125236 plasmid (Origene, Rockville, MD) was amplified by PCR with the primer pair of oJGK24 (5'-ATACGACGCGGCCGCACC/ATGAACTCCTTCTCCACAAG-3') and oJGK25 (5'-TACTCAGGATCC/CATTTGCCGAAGAGCCCTCA-3'). The PCR product was then cloned into the p3xFLAG-CMV-14 vector. The HA/FLAG-hAgo2 plasmid was purchased from Addgene (Cambridge, MA). All plasmids were confirmed by sequencing.

ELISA

Before the assay the medium from KSHV-infected cells was cleared by centrifugation. The levels of individual cytokines were determined by a Multi-Analyte ELISArray kit

(SABiosciences, Frederick, MD).

Western blot analysis

Protein samples were prepared by lysis of cells in lx RIPA buffer and the same volume of 2x SDS-protein sample buffer containing freshly added 2-mercaptoethanol. The following antibodies were used in the western blot analysis: rabbit polyclonal or mouse monoclonal anti- ORF57 antibodies against synthetic peptide (amino acids 119 to 132 of ORF57), monoclonal anti-vIL6 antibody kindly provided by Dr. Giovanna Tosato (NCI/NIH), polyclonal anti-vIL6 antibody from Dr. John Nicholas (Johns Hopkins Univ.), polyclonal anti-Ago2 (Upstate), polyclonal anti-RNA helicase A (RHA; Abeam, Cambridge, MA), monoclonal anti-β -tubulin (Sigma), and monoclonal anti-FLAG (M2, Sigma), together with corresponding horseradish peroxidase-conjugated secondary antibodies (Sigma). The signal on blots was detected with a West Pico or Femto chemiluminescence substrate (Thermo Scientific, Rockford, IL).

Northern blot

Total RNA was isolated from butyrate-induced JSC-1 and BCBL-1 cells and VA-induced Bac36 stable cells with a wild-type (wt) or ORF57-null (Δ57) KSHV genome. Each sample, containing 5 μg of total RNA, was mixed with NorthemMax formaldehyde load dye (Ambion), denatured at 75°C for 10 min, separated on 1% agarose gel, and transferred onto a nylon membrane. After 1 h of prehybridization, hybridization was carried out for 24 h at 42 C in Super-Hyb hybridization buffer (Sigma). The antisense oligonucleotides oNP28 (5'- TGGGTGGACTGTAGTGCGTC -3') for vIL-6 and oZMZ270 (5'-

TGAGTCCTTCCACGATACCAAA -3') for GAPDH RNA were labeled with [γ-³²Ρ]ΑΤΡ and were used for the hybridizations. After hybridization, the membrane was washed once with a 2x SSPE/0.5% SDS solution for 5 min at room temperature and twice with 0.2x SSPE/0.1% SDS for 20 min at 42 C and exposed to a Phospholmager screen. To analyze transcripts from vIL6 deletion mutants, the 5' half of vIL6 amplified with oNP34 and oJGK20 (5'- CGCGGTCAAA/CATGACGTCCACGTTTATC-3' ) was labeled with [a-³²P]dCTP and DECA prime II kit (Ambion). Hybridization and washing were conducted at 65 C.

Transient cotransfection and protein purification

Cells were cotransfected with the indicated combinations of plasmids in each figure using Lipofectamine 2000 (Invitrogen) for western blot analysis 24 h after transfection. siRNA duplexes for Ago2 and miR-1293 were purchased from Dharmacon and transfected by using

Lipofectamine 2000. The Pre-miR-NC#l used as a negative control, Pre-miR-608, and PremiR- 1293 were purchased from Ambion. Pre-miRs were transfected using siPORT-NeoFX

(Ambion). Plasmids were transfected 48 h after pre-miR transfection.

Anti-miRs [Peptide nucleic acids (PNAs)-based miRNA inhibitors] for hsa-mir-1293, hsa-mir-608 and a negative control (NC), were purchased from Panagene Co. (Daejeon, South Korea). Cell transfection with each anti-miR was performed according to manufacturer's instruction by directly addition of the testing anti-miR to culture medium. Cell lysates were prepared and analyzed 3 days after transfection.

To purify human Ago2 (hAgo2), the plasmid expressing HA/FLAG-tagged hAgo2

(Addgene) was transfected into HEK 293 cells, and a cell lysate was prepared 48 h after transfection in lx RIPA buffer. HA/FLAG-hAgo2 was immunopurified first with an anti-HA affinity gel and then by elution with HA peptide (Sigma).

RNA-protein pulldown assay

RNA oligomers labeled with biotin at the 5' end (synthesized by IDT) were immobilized on NeutrAvidin beads (Thermo Scientific). The sequences of the RNA oligomers are presented in Figure 8. oJGK50 (5'-Biotin-AAGAAUCUAGAUGCAAUAACCACCCCUGA-3') is an RNA oligomer harboring a putative MRE of hIL6. The cell lysates indicated in each figure were applied to oligomer-immobilized beads in lx binding buffer [20 mM Tris (pH7.5), 200 mM

NaCl, 6 mM EDTA, 5 mM potassium fluoride, 5 mM β-glycerophosphate, and 1 tablet of protease inhibitors (Roche)/ 10ml]. Pulldown was conducted at 4 C overnight with rotation. Samples were washed 3 times with lx binding buffer. SDS sample buffer was directly applied to the beads.

Immunoprecipitation

The lysates of JSC-1 cells induced with 3 mM butyrate for 24 h were used for IP with an anti-ORF57 or anti-RHA antibody. Other IP conditions were the same as described for the CLIP assay. For IP using anti-FLAG M2 affinity gel (Sigma) or anti-HA affinity gel (Sigma), a lysate of HEK293 cells ectopically expressing ORF57-FLAG or HA/FLAG-hAgo2 was prepared in lx RIPA buffer.

In vitro transcription

DNA templates for in vitro transcription of full-length vIL6 were amplified from pNP4 by PCR using a primer pair of T7 chimeric oJGK46

(5'-TAATACGACTCACTATAGGG/AACAGCCACC/ATGTGCTGGTTCAAGTTG-3') and oJGK47 oligomer dT(T30/2 stop codons/vector sequence, 5'-

TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT/TCACTA/CTTGTCATCGTCATCCTT-3'), which provides a poly-A tail in mRNA. The 3' halves of wt and deletion-mutant vIL6 were prepared for in vitro transcription with the Riboprobe system (Promega, Madison, WI) from individual plasmids by PCR using a T7-chimeric primer pair, oJGK48 (5'- TAATACGACTCACTATAGGG/AACAGCCACCATG/TCAGTGATAAACGTGGACG-3') and oJGK47.

In vitro translation assay

In vitro translation in the presence of an miRNA duplex was performed using a modification of previously published protocols (J. Ule et al., Science 302, 1212 (2003); V. Majerciak et al., J. Virol. 82, 2792 (2008)). The 5' ends of the miR-1293 duplex and the nonspecific control siRNA (Dharmacon, Lafayette, CO) were phosphorylated with T4 kinase (Invitrogen). Equal amount (12.5 nM each) of vIL6 mRNA and firefly luciferase mRNA were mixed with 12.5 nM miRNA duplex, denatured at 70°C for 3 min, and cooled down to room temperature to anneal the miRNA to the target mRNA. Firefly luciferase mRNA served as an internal control. Translation mix [nuclease treated rabbit reticulocyte lysate (Promega), RNase inhibitor, amino acids (-Met) mix, and 3 ^J5^JS-Met (Perkin Elmer, Shelton, CT)] was added in accordance with the manufacturer's instructions. The total reaction volume was 10 μΐ.

Translation was performed at 30°C for 20 min and stopped on ice by the addition of SDS sample buffer. For the modified procedure used for the experiments shown in Figs. 3D, 3E, 4C, and 4D, the mRNA and miRNA duplex were denatured at 70°C for 3 min and quenched on ice. hAgo2 (25 nM) with or without ORF57 was then added and incubated at 30°C for 10 min. Each reaction was then mixed with translation mixture and incubated at 30°C for 20 min. The reaction was stopped on ice by the addition of SDS sample buffer. Translated proteins were separated in a 4%-12% SDS-PAGE gel (Invitrogen) and transferred onto a membrane for capturing images on a Phospholmager screen or X-ray film.

qRT-PCR

The primer pair for vIL6 amplification was previously described (V. Majerciak, K. Yamanegi, S. H. Nie, Z. M. Zheng, J.Biol.Chem. 281, 28365 (2006)). The primer pair oZMZ269 and oZMZ270 was used for GAPDH amplification. First-strand cDNA was synthesized from 100 ng of total RNA using random hexamers and Superscript II RT

(Invitrogen). The qPCR was carried out using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) and Cepheid Smart Cycler (Sunnyvale, CA).

For detection of endogenous miR-1293, a TaqMan microRNA assay (Applied

Biosystems) was used in accordance with manufacturer's protocol. The CT values of qRT-PCR data from 3 repeats were analyzed by the 2- ^"ΔΔΟΤ _or 2-AC T method and are presented as bar graphs with means + SD.

In vitro RISC assembly and RNA protection assay

The 3' halves of vIL6 RNAs with (wt and AF) or without (ΔΕ and AD) the miR-1293 binding site in the MRE-B (see Figures 2A and 10A) were transcribed in vitro in the presence of [a-³²P]GTP and gel-purified as described. Each vIL6 RNA at 10⁶ cpm was mixed with miR- 1293 or a nonspecific miRNA negative control (NC; 300 nM) in the same volume of HEK293 lysate prepared from cells transfected with an HA/FLAG-hAgo2 expression vector. The mixture was incubated at 30 C for 2 h to allow RISC formation of miR-1293 and its targeted vIL6 RNA. After UV cross-linking (480,000 μΐ), the protein-RNA complexes were immunoprecipitated with an anti-HA antibody. The IP complexes on the beads were washed 3 times with lx RIPA buffer and digested with RNase Tl (0.005 units) and then with proteinase K (0.2 mg/ml). The digested RNA was extracted and resolved in a 15% denatured PAGE gel. The gel image was captured using a Molecular Dynamics Phospho Imager Storm 860.

In situ hybridization

In situ hybridization was performed based on the published procedure (Nuovo GJ, Elton TS, Nana-Sinkam P et al. A methodology for the combined in situ analyses of the precursor and mature forms of microRNAs and correlation with their putative targets. Nature Protocols.

2009;4:107-115). DIG-labeled LNA miRCURY probes for detection of miR-155 (5'

DIG-labeling) and miR-1293 (5' and 3' double DIG labeling) were purchased from Exiqon (Woburn, MA). Lymph node tissue sections from patients with KSHV-associated MCD or HIV-associated follicular hyperplasia were deparaffinized with xylene for 5 min twice and hydrated with ethanol dilutions (100%, 70%, 30% and DEPC water) for 2 min each (twice for each step). After washing twice in PBS for 5 min each, the sections were deproteinated with proteinase K (10 ug/ml) at 37°C for 5 min. The sections were fixed for 10 min in 4% PFA (paraformaldehyde) and rinsed twice in PBS. Prehybridization was carried out for 1 h in IX hybridization buffer (Enzo [ENZ-33808, 1.25X cone], Plymouth Meeting, PA) at 37°C in humidified chamber and hybridization was performed with a probe (500 nM) at 37°C for 16 h in a humidified chamber. After hybridization, the slides were washed 2 times for 5 min each in ISH wash reagent (Enzo, ENZ-33809) at 4°C. For immunological detection, the slides were blocked for 30 min in antibody blocking buffer (in AP-NBT/BCIP detection system, ENZO, ENZ-32700) and then incubated for 1 h at 37°C with antibody (1:100 anti-DIG-AP Fab fragments [Roche, 11 093 274 910] in blocking buffer). The slides were washed for 1 min in AP buffer (SignaSure Wash buffer, Enzo kit) at RT. NBT/BCIP reaction mixture was applied to the slides until color development at RT. The slides were washed three times, 5 min each, in PBST, counterstained with FastRed nuclear staining reagent (in AP-NBT/BCIP detection system, ENZO, ENZ-32700), and washed in tap water. Slides were then dehydrated and mounted for microscopy. Brightfield images were acquired using a Axio Vision software (v. 4.6) controlling a Zeiss axiovert 200M microscope equipped with lOx plan-apochromat (N.A. 0.45) air and 63x plan-apochromat (N.A. 1.4) oil objective lenses and an Axiocam MRc5 color CCD camera (Carl Zeiss Microimaging Inc . , Thornwood, NY) .

Other Embodiments

From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:

1. Use of a microRNA capable of repressing viral IL6 (vIL6) or human IL6 (hIL6) for the preparation of a medicament for treatment of a Kaposi's sarcoma- associated herpes virus (KSHV) infection in a subject.

2. Use of a microRNA capable of repressing vIL6 or hIL6 for the preparation of medicament for inhibiting replication of KSHV.

3. Use of a microRNA capable of repressing vIL6 or hIL6 for the preparation of a medicament for preventing or treating a disease caused by KSHV in a subject.

4. Use of a micro RNA capable of repressing vIL6 or hIL6 for the preparation of a medicament for ameliorating a disease caused by KSHV in a subject.

5. The use of any one of claims 1-4, wherein the microRNA is selected from the group consisting of hsa-miR-608 and hsa-miR-1293.

6. The use of any one of claims 1-4, wherein the mircoRNA is a combination of hsa- miR-608 and hsa-miR-1293.

7. The use of any one of claims 1-6, wherein the microRNA is expressed by a viral vector.

8. The use of claim 7, wherein the viral vector is selected from the group consisting of lentiviral vector, adenoviral vector, adeno-associated viral vector, and retroviral vector.

9. The use of any one of claims 1-6, wherein the microRNA is delivered using a cationic liposome.

10. The use of any one of claims 1-6, wherein the microRNA is delivered using a cationic dendrimer.

11. The use of any one of claims 1-6, wherein the mircoRNA is delivered using a nanoparticle.

12. The use of claims 2 and 4, wherein the disease caused by KSHV is selected from the group consisting of Kaposi's sarcoma, body cavity-based B cell lymphoma, and Castleman's disease.

13. The use of any one of claims 3-5, further comprising the step of co-administering one or more chemo therapeutic agents.

14. The use of claim 12, wherein the one or more chemotherapeutic agents is selected from the group consisting of abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5,6- pentafluoro-N-(3-fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N- dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t-butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'-deoxy- 8'-norvin- caleukoblastine, docetaxol, doxetaxel, cyclophosphamide, carboplatin, carmustine (BCNU),cisplatin, cryptophycin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, dasatinib, daunorubicin, dolastatin, doxorubicin (adriamycin), erlotinib, etoposide, 5-fluorouracil, finasteride, flutamide, hydroxyurea and hydroxyureataxanes, ifosfamide, imatinib, irinotecan, lenalidomid, liarozole, lonidamine, lomustine (CCNU), mechlorethamine (nitrogen mustard), melphalan, mivobulin isethionate, rhizoxin, sertenef, streptozocin, mitomycin, methotrexate, 5-fluorouracil, nilutamide, onapristone, paclitaxel, panitumumab, pazopanib, prednimustine, procarbazine, rituximab, RPR109881, sorafinib, stramustine phosphate, sunitinib, tamoxifen, tasonermin, taxol, temozolomide, transtuzumab, tretinoin, vinblastine, vincristine, vindesine sulfate, vinflunine, and vorinostat.

15. The use of any one of claims 3-5, further comprising the step of co-administering one or more therapeutic antibodies.

16. A kit for the treatment of a disease caused by KSHV, the kit comprising an effective amount of a microRNA capable of repressing vIL6 or hIL6 and directions for using the kit for the treatment of a neoplasia.

17. The kit of claim 16, wherein the microRNA is selected from the group consisting of hsa-miR-608 and hsa-miR-1293.

18. The kit of claim 16, wherein the microRNA is hsa-miR-608.

19. The kit of claim 16, wherein the microRNA is hsa-miR-1293.

20. A pharmaceutical composition for the treatment of a disease caused by KSHV comprising an effective amount of a microRNA capable of repressing vIL6 or hIL6 and a pharmaceutically acceptable excipient.

21. The pharmaceutical composition of claim 20, wherein the microRNA is selected from the group consisting of hsa-miR-608 and hsa-miR-1293.

22. The pharmaceutical composition of claim 20, wherein the microRNA is hsa-miR-

608.

23. The pharmaceutical composition of claim 20, wherein the microRNA is hsa-miR-

1293.

24. The pharmaceutical composition of any of claims 20-23, further comprising one or more chemotherapeutic agents.

25. The pharmaceutical composition of claim 24, wherein the one or more

chemotherapeutic agents is selected from the group consisting of abiraterone acetate, altretamine, anhydrovinblastine, auristatin, azacitidin, bendamustin, bevacizumab, bexarotene, bicalutamide, BMS 184476, 2,3,4,5,6-pentafluoro-N-(3-fluoro-4-methoxyphenyl)benzene sulfonamide, bleomycin, bortezomib, N,N-dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-proly- 1-Lproline-t- butylamide, cachectin, capecitabin, cemadotin, cetuximab, chlorambucil, cyclophosphamide, 3',4'-didehydro-4'-deoxy-8'-norvin- caleukoblastine, docetaxol, doxetaxel, cyclophosphamide, carboplatin, carmustine (BCNU),cisplatin, cryptophycin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, dasatinib, daunorubicin, dolastatin, doxorubicin

26. A method of characterizing the aggressiveness of a disease caused by KSHV, comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample, wherein a decreased level of expression relative to a reference indicates that the disease caused by KSHV is aggressive, whereas a decreased level of expression relative to a reference indicates that the disease is dormant.

27. A method of monitoring a subject diagnosed with a disease caused by KSHV, the method comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample, wherein an alteration in the level of expression relative to the level of expression in a reference indicates the severity of Kaposi's sarcoma in a subject.

28. A method of monitoring a subject being treated for a disease caused by KSHV, the method comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample, wherein an alteration in the level of expression relative to the level of expression in a reference indicates the efficacy of the treatment in the subject.

29. A method of selecting a treatment regimen for a subject diagnosed with a disease caused by KSHV, the method comprising determining the level of expression of one or more microRNAs capable of repressing vIL6 or hIL6 in a subject sample relative to a reference, wherein the level of expression of the microRNA indicates an appropriate treatment regimen for the subject.

30. The method of claim 29, wherein an increased level of the microRNA indicates that conservative treatment is appropriate.

31. The method of claim 30, wherein conservative treatment is selected from the group consisting of continued monitoring of the patient's condition, less aggressive surgery, less aggressive chemotherapy, radiotherapy, radiofrequency ablation, thermoablation via focused ultrasound, and intraartiral embolisation techniques.

32. The method of claim 29, wherein a decreased level of the microRNA indicates that aggressive treatment is appropriate.

33. The method of claim 32, wherein aggressive treatment is selected from the group consisting of high dose chemotherapy, surgery, radiotherapy, radiofrequency ablation, thermoablation via focused ultrasound, and intraartiral embolisation techniques.

34. The method of any of claims 26-33, wherein the one or more microRNAs is selected from the group consisting of hsa-miR-608 and hsa-miR-1293.

35. The method of any of claims 26-34, wherein the reference is the level of microRNA found in tissue uninfected with KSHV.

36. A diagnostic kit for the diagnosis of a disease caused by KSHV in a subject comprising a nucleic acid probe capable of detecting a microRNA capable or repressing vIL6 or hIL6 and written instructions for use of the kit for diagnosis of Kaposi's sarcoma.