WO2010122164A1

WO2010122164A1 - VIRUS-LIKE PARTICLES OF BACTERIOPHAGE φCB5

Info

Publication number: WO2010122164A1
Application number: PCT/EP2010/055487
Authority: WO
Inventors: Martin Bachmann; Andrea Jegerlehner; Andris Kazaks; Alexander Link; Gerd Lipowsky; Kaspars Tars
Original assignee: Cytos Biotechnology Ag
Priority date: 2009-04-23
Filing date: 2010-04-23
Publication date: 2010-10-28

Abstract

The present invention relates to virus-like particles of bacteriophage φCb5 and to recombinant φCb5 proteins which are capable of forming virus-like particles. The virus-like particles according to the invention are useful as immunological carriers which can, for example, be linked to an antigen, e.g. by chemical coupling or by genetic fusion. Virus-like particles according to the invention are also useful for the delivery of immunostimulatory substances, e.g. of immunostimulatory nucleic acids, to the immune system. The invention further relates to compositions, vaccines and pharmaceutical compositions comprising the inventive virus-like particles, wherein said compositions, vaccines and pharmaceutical compositions are capable of inducing or enhancing an immune response. The compositions, vaccines and pharmaceutical compositions described herein can therefore be used as a medicament for the treatment of a disease, disorder or physiological condition.

Description

Virus-Like Particles of Bacteriophage φCb5

[0001] The present invention relates to virus-like particles of bacteriophage φCb5 and to recombinant φCb5 proteins which are capable of forming virus-like particles. The virus-like particles according to the invention are useful as immunological carriers which can, for example, be linked to an antigen, e.g. by chemical coupling or by genetic fusion. Virus-like particles according to the invention are also useful for the delivery of immuno stimulatory substances, e.g. of immuno stimulatory nucleic acids, to the immune system. The invention further relates to compositions, vaccines and pharmaceutical compositions comprising the inventive virus-like particles, wherein said compositions, vaccines and pharmaceutical compositions are capable of inducing or enhancing an immune response. The compositions, vaccines and pharmaceutical compositions described herein can therefore be used as a medicament for the treatment of a disease, disorder or physiological condition.

Related Art

[0002] Virus-like particles of RNA bacteriophages are known as effective immunological carriers which are capable of inducing strong immune responses against antigens which are conjugated to the carriers. Virus-like particles of RNA bacteriophages, and hereby in particular virus-like particles of the enterobacteriophage Qβ, have been developed as immunological carriers for a broad spectrum of pharmaceutical applications (see for example WO2002/056905A2 and WO2003/024481A2).

[0003] Immunization of a subject with an antigen which is conjugated to a virus-like particle does not only induce immunity against the antigen, but also against the carrier itself. Preexisting immunity against vaccine carrier proteins has been reported to inhibit the immune response against antigens conjugated to the same carrier by a process termed carrier induced epitopic suppression (Jegerlehner et al., Vaccine, 2010 Mar 20, epub ahead of print). For a broader application of virus-like particle based vaccines in the human population it is therefore desirable to broaden the spectrum of immunological carriers which are available for the development of therapeutic or prophylactic vaccines.

[0004] One alternative to virus-like particles of bacteriophage Qβ became available with virus-like particles of Acetinobacter phage AP205 which have first been described in WO2004/007538A2.

[0005] Potential candidates as further alternative RNA bacteriophage based carriers might be virus-like particles of RNA bacteriophage φCb5. Bendis & Shapiro (J. Virol, Dec. 1970, p. 847-854) studied bacteriophage φCb5 with respect to the physical an chemical properties of the phage itself and of its RNA. The authors identified structural similarities of bacteriophage φCb5 with E. coli RNA bacteriophages, but they also found certain differences, e.g. in salt sensitivity and in the amino acid composition of the coat protein.

[0006] However, virus-like particles of bacteriophage φCb5 are not known from the prior art. The prior art is also silent about the cloning and recombinant expression of the coat protein of bacteriophage φCb5. Also its amino acid sequence and crystal structure are not known from the prior art.

Summary of the Invention

[0007] The invention provides virus-like particles which comprise, essentially consist of, or consist of at least one φCb5 polypeptide. The virus-like particles of the invention are stable, in particular in the presence of low salt concentrations and still show sufficient stability in the presence of salt concentrations even slightly above the physiological range. This is demonstrated by the generally high thermal stability which was observed in Example 3. Furthermore, the virus-like particles are capable of inducing or enhancing strong immune responses, wherein the antibodies raised against the virus-like particles of the invention do not show detectable cross-reactivity with virus-like particles of other RNA bacteriophages (see Example 4). Vice versa, antibodies which are raised against virus-like particles of other RNA bacteriophages than bacteriophage φCb5 do not recognize the virus-like particles of the invention. It is demonstrated in Example 4 that a antigen can be efficiently coupled to different virus-like particles of the invention and that the coupling products are capable of inducing or enhancing strong immune responses against the antigen. Furthermore it was demonstrated that immunological compositions comprising virus-like particles of the invention are capable of inducing high antibody titers which show efficacy in animal models of multiple sclerosis (Example 5) and of Influenza A infection (Example 7). The virus-like particles of the invention are thus valuable immunological carriers which may serve as an alternative to carriers based on virus-like particles of other RNA bacteriophages. [0008] In one aspect, the invention provides a virus-like particle, wherein said virus-like particle comprises, essentially consists of, or alternatively consists of, at least one φCb5 polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of bacteriophage φCb5, or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %. In one embodiment said φCb5 polypeptide comprises or preferably consist of an amino acid sequence selected from the group consisting of: (a) the amino acid sequence encoded by the cDNA of SEQ ID NO:1; (b) SEQ ID NO:2; (c) SEQ ID NO:3; (d) the amino acid sequence encoded by the cDNA of SEQ ID NO:4; (e) SEQ ID NO:5; and (f) SEQ ID NO:6. In a further preferred embodiment said φCb5 polypeptide comprises or preferably consists of any one of SEQ ID NOs 7 to 10, and wherein preferably said φCb5 polypeptide comprises or still more preferably consists of SEQ ID NO:8, and wherein still further preferably said virus-like particle comprises a thermal stability (Tm) of at least 50 ⁰C, preferably of at least 55 ⁰C, wherein said thermal stability is determined in 200 mM NaCl.

[0009] In a further aspect the invention provides vaccines, composition and pharmaceutical compositions which are comprising a virus-like particle of the invention. [0010] In a further aspect the invention provides a recombinant φCb5 polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of bacteriophage φCb5, or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %.

[0011] In a further aspect the invention provides a method of immunization comprising administering the virus-like particle of the invention, the composition of the invention, the recombinant φCb5 polypeptide of the invention, the vaccine of the invention, or the pharmaceutical composition of the invention to an animal, preferably to a human. [0012] In a further aspect the invention provides a method of treating or preventing a disease, disorder or physiological condition in an animal said method comprising administering the virus-like particle of the invention, the composition of any one of the invention, the recombinant φCb5 polypeptide of the invention, the vaccine of the invention, or the pharmaceutical composition of the invention to an animal, wherein preferably said animal is a human.

[0013] In a further aspect the invention provides a virus-like particle of the invention, a composition of the invention, the recombinant φCb5 polypeptide of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention for use in a method for the treatment of a disease, disorder or condition in an animal, preferably in a human. [0014] In a further aspect the invention provides a nucleic acid sequence encoding the recombinant φCb5 polypeptide of the invention.

Description of Figures

[0015] Figure 1: Average clinical scores for mice which were immunized with φCb5- mIL17A and φCb5 as described in Example 5.

Detailed Description of the Invention

[0016] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0017] Polypeptide: The term "polypeptide" as used herein refers to a polymer composed of amino acid monomers which are linearly linked by peptide bonds (also known as amide bonds). The term polypeptide refers to a consecutive chain of amino acids and does not refer to a specific length of the product. Thus, peptides, and proteins are included within the definition of polypeptide. Post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations, and the like are also encompassed. [0018] Coat protein: The term "coat protein" refers to a viral protein, preferably to a structural protein occurring in a natural capsid of a virus, preferably of an RNA bacteriophage. Typically and preferably, the coat protein is capable of forming a viral capsid or a virus-like particle by self-assembly.

[0019] Coat protein of bacteriophage φCb5: Typically and preferably, the term coat protein of bacteriophage φCb5 refers the coat protein of bacteriophage φCb5, and to variants thereof which occur in nature. Two sequence variants of the coat protein of bacteriophage φCb5 are described herein which differ in only one single amino acid residue in position 21 of their amino acid sequence. These variants are referred to as R21 and K21, respectively. R21 is encoded by the cDNA of SEQ ID NO: 1 and comprises the amino acid sequence of SEQ ID NO:3. K21 is encoded by the cDNA of SEQ ID NO:4 and comprises the amino acid sequence of SEQ ID NO:6. Thus, the term coat protein of bacteriophage φCb5 preferably refers to a polypeptide encoded by SEQ ID NO: 1 or by SEQ ID NO:4. Most preferably, the term coat protein of bacteriophage φCb5 refers to any one of SEQ ID NOs 2, 3, 5 or 6. In a very preferred embodiment, said coat protein of bacteriophage φCb5 comprises or preferably consists of the amino acid sequence of SEQ ID NO:3 or of SEQ ID NO:6, most preferably of SEQ ID NO:3.

[0020] φCb5 polypeptide: The term φCb5 polypeptide as used herein refers to a polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of bacteriophage φCb5, or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %. φCb5 polypeptide as disclosed herein is forming the inventive virus-like particles, typically by self-assembly. Typically and preferably, the φCb5 polypeptide is capable of forming dimers by non-covalent interaction. Very preferably, φCb5 polypeptide comprising or consisting of a mutated amino acid sequence, wherein said mutated amino acid sequence comprises at least two cysteine residues, is forming dimers by covalent interaction via disulfide bonds. Very preferred φCb5 polypeptide is encoded by the cDNA of any one of SEQ ID NOs 1 or 4 or comprises or preferably consists of the amino acid sequence of any one of SEQ ID NOs 2, 3, and 5 to 10.

[0021] Recombinant polypeptide: In the context of the invention the term "recombinant polypeptide" refers to a polypeptide which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably, a recombinant polypeptide is produced in a prokaryotic expression system. It is apparent for the artisan that recombinantly produced polypeptides which are expressed in a prokaryotic expression system such as E. coli may comprise an N-terminal methionine residue. The N-terminal methionine residue is typically cleaved off the recombinant polypeptide in the expression host during the maturation of the recombinant polypeptide. However, the cleavage of the N-terminal methionine may be incomplete. Thus, a preparation of a recombinant polypeptide may comprise a mixture of otherwise identical polypeptides with and without an N-terminal methionine residue. Typically and preferably, a preparation of a recombinant polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant polypeptide with an N-terminal methionine residue.

[0022] Recombinant φCb5 polypeptide: The term recombinant φCb5 polypeptide refers to a φCb5 polypeptide as defined above which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably a preparation of a recombinant φCb5 polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant φCb5 polypeptide with an N-terminal methionine residue. Consequently, a recombinant virus-like particle of the invention may comprise otherwise identical recombinant polypeptides with and without an N-terminal methionine residue.

[0023] Recombinant virus-like particle: In the context of the invention the term "recombinant virus-like particle" refers to a virus-like particle which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably, a recombinant virus-like particle comprises at least one recombinant polypeptide, preferably a recombinant φCb5 polypeptide. Most preferably, a recombinant virus-like particle is composed of or consists of recombinant φCb5 polypeptide.

[0024] Mutated amino acid sequence: The term "mutated amino acid sequence" refers to an amino acid sequence which is obtained by introducing a defined set of mutations into an amino acid sequence to be mutated. In the context of the invention, said amino acid sequence to be mutated typically and preferably is an amino acid sequence of a coat protein of bacteriophage φCb5. Thus, a mutated amino acid sequence differs from an amino acid sequence of a coat protein of bacteriophage φCb5 in at least one amino acid residue, wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %. Typically and preferably said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 91 %, 92 %, 93 % 94 %, 95 %, 96 %, 97 %, 98 %, or 99 %. Preferably, said mutated amino acid sequence and said sequence to be mutated differ in at most 11, 10, 9, 8, 7, 6, 4, 3, 2, or 1 amino acid residues, wherein further preferably said difference is selected from insertion, deletion and amino acid exchange. Preferably, the mutated amino acid sequence differs from an amino acid sequence of a coat protein of bacteriophage φCb5 in least one amino acid, wherein preferably said difference is an amino acid exchange.

[0025] Position corresponding to residues...: The position on an amino acid sequence, which is corresponding to given residues of another amino acid sequence can be identified by sequence alignment, typically and preferably by using the blastp algorithm, most preferably using the standard settings. For example, the amino acid residues of a sequence to be mutated which are corresponding to the amino acid residues in positions 74 and 75 of an amino acid sequence of a coat protein of bacteriophage φCb5 are those amino acid residues of said amino acid sequence to be mutated, which align with amino acid residues 74 and 75 of an amino acid sequence of a coat protein of bacteriophage φCb5 when aligning both sequences. [0026] Sequence identity: The sequence identity of two given amino acid sequences is determined based on an alignment of both sequences. Algorithms for the determination of sequence identity are available to the artisan. Preferably, the sequence identity of two amino acid sequences is determined using publicly available computer homology programs such as the "BLAST" program provided on the NCBI homepage at http://www.ncbi.nlm.nih.gov/blast/blast.cgi, using the default settings provided therein. [0027] Amino acid exchange: The term amino acid exchange refers to the exchange of a given amino acid residue in an amino acid sequence by any other amino acid residue having a different chemical structure, preferably by another proteinogenic amino acid residue. Thus, in contrast to insertion or deletion of an amino acid, the amino acid exchange does not change the total number of amino acids of said amino acid sequence. Very preferred in the context of the invention is the exchange of an amino acid residue of said amino acid sequence to be mutated by a lysine residue or by a cysteine residue.

[0028] Thermal stability: the thermal stability of a virus-like particle of the invention is assessed by determining its melting temperature (Tm). Tm may be determined by incubating said VLPs at different temperatures and assessing the integrity of the VLPs by electron microscopy (c.f. Ashcroft et al. 2005, Journal of Nanoscience and Nanotechnology 5:2034- 2041). Tm is the lowest incubation temperature resulting in disintegrated particles. More preferably Tm is determined by gel electrophoresis as described previously (Axblom et al. 1998, Virology 249:80-88, in particular paragraph bridging pages 85 and 86, and Figure 5; and Persson et al., J MoI Biol, Vol. 383(4) pp. 914-22, 2008). Tm of a virus-like particle of the invention is influenced by the salt conditions (see Example 3). Typically and preferably, the Tm value of a virus-like particle of the invention is determined in 20 mM Tris or in 200 mM NaCl, most preferably in 200 mM NaCl, wherein further preferably Tm is assayed under experimental conditions as set forth in Example 3.

[0029] Coupling efficiency: The coupling efficiency of a virus-like particle with a specific antigen is determined by SDS-PAGE of the coupling reactions. The intensities of Coomassie Blue-stained bands corresponding to components of the coupling reaction are determined by densitometry and used to calculate coupling efficiency. Coupling efficiency is defined as the ratio of φCb5 polypeptide coupled to said antigen to the total amount of φCb5 polypeptide. [0030] Adjuvant: The term "adjuvant" as used herein refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine and pharmaceutical composition, respectively, of the present invention may provide for an even more enhanced immune response. Preferred adjuvants are complete and incomplete Freund's adjuvant, aluminum containing adjuvant, preferably aluminum hydroxide, and modified muramyldipeptide. Further preferred adjuvants are mineral gels such as aluminum hydroxide, surface active substances such as lyso lecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and human adjuvants such as BCG (bacille Calmette Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art. Further adjuvants that can be administered with the compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts (Alum), MF-59, OM- 174, OM- 197, OM-294, and Virosomal adjuvant technology. The adjuvants may also comprise mixtures of these substances. Virus-like particles have been generally described as an adjuvant. However, the term "adjuvant", as used within the context of this application, refers to an adjuvant not being the inventive virus-like particle. Rather "adjuvant" relates to an additional, distinct component of the inventive compositions, vaccines or pharmaceutical compositions.

[0031] Antigen: As used herein, the term "antigen" refers to a molecule capable of being bound by an antibody or a T-cell receptor (TCR) if presented by MHC molecules. The term "antigen", as used herein, also refers to T-cell epitopes. An antigen is additionally capable of being recognized by the immune system and/or being capable of inducing a humoral immune response and/or cellular immune response leading to the activation of B- and/or T- lymphocytes. This may, however, require that, at least in certain cases, the antigen contains or is linked to a Th cell epitope and is given in adjuvant. An antigen can have one or more epitopes (B- and T-epitopes). The specific reaction referred to above is meant to indicate that the antigen will preferably react, typically in a highly selective manner, with its corresponding antibody or TCR and not with the multitude of other antibodies or TCRs which may be evoked by other antigens. Antigens as used herein may also be mixtures of several individual antigens. The polypeptide of the invention which is forming the inventive virus-like particles, may comprise the antigen. In particular, the inventive polypeptide may be a fusion product comprising the antigen. However, the term antigen does not encompass said mutated amino acid sequence which is comprised by said polypeptide. Typically and preferably, the term "antigen" as used herein does not encompass the virus-like particle according to the invention. Typically and preferably the term "antigen" rather refers to an additional component of the compositions, vaccines and pharmaceutical compositions of the invention having antigenic properties, wherein the antigen may be associated, bound, mixed with or linked to the virus- like particle by any means described herein. [0032] Epitope: The term epitope refers to continuous or discontinuous portions of an antigen, preferably a polypeptide, wherein said portions can be specifically bound by an antibody or by a T-cell receptor within the context of an MHC molecule. With respect to antibodies, specific binding excludes non-specific binding but does not necessarily exclude cross-reactivity. An epitope typically comprise 5-10 amino acids in a spatial conformation which is unique to the antigenic site.

[0033] Associated: The terms "associated" or "association" as used herein refer to all possible ways, preferably chemical interactions, by which two molecules are joined together. Chemical interactions include covalent and non-covalent interactions. Typical examples for non-covalent interactions are ionic interactions, hydrophobic interactions or hydrogen bonds, whereas covalent interactions are based, by way of example, on covalent bonds such as ester, ether, phosphoester, carbon-phosphorus bonds, carbon-sulfur bonds such as thioether, or imide bonds.

[0034] Attachment Site, First: As used herein, the phrase "first attachment site" refers to an element which is naturally occurring with the virus-like particle or which is artificially added to the virus-like particle, and to which the second attachment site may be linked. The first attachment site preferably is a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a guanidinyl group, histidinyl group, or a combination thereof. A preferred embodiment of a chemically reactive group being the first attachment site is the amino group of an amino acid residue, preferably of a lysine residue. The first attachment site is typically located on the surface, and preferably on the outer surface of the virus-like particle. Multiple first attachment sites are present on the surface, preferably on the outer surface of virus-like particle, typically in a repetitive configuration. In a preferred embodiment the first attachment site is associated with the virus-like particle, through at least one covalent bond, preferably through at least one peptide bond. In a further preferred embodiment the first attachment site is naturally occurring with the virus-like particle. Alternatively, in a preferred embodiment the first attachment site is artificially added to the VLP. In a very preferred embodiment said first attachment site is the amino group of a lysine residue of the amino acid sequence of said φCb5 polypeptide.

[0035] Attachment Site, Second: As used herein, the phrase "second attachment site" refers to an element which is naturally occurring with or which is artificially added to the antigen and to which the first attachment site may be linked. The second attachment site of the antigen preferably is a protein, a polypeptide, a peptide, an amino acid, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a guanidinyl group, histidinyl group, or a combination thereof. A preferred embodiment of a chemically reactive group being the second attachment site is a sulfhydryl group, preferably the sulfhydryl group of the amino acid cysteinem most preferably the sulfhydryl group of a cysteine residue. The term "antigen with at least one second attachment site" refers, therefore, to a construct comprising the antigen and at least one second attachment site. However, in particular for a second attachment site, which is not naturally occurring within the antigen, such a construct typically and preferably further comprises a "linker". In another preferred embodiment the second attachment site is associated with the antigen through at least one covalent bond, preferably through at least one peptide bond. In a further embodiment, the second attachment site is naturally occurring within the antigen. In another further preferred embodiment, the second attachment site is artificially added to the antigen through a linker, wherein said linker comprises or alternatively consists of a cysteine. Preferably, the linker is fused to the antigen by a peptide bond.

[0036] Linked: The terms "linked" or "linkage" as used herein, refer to all possible ways, preferably chemical interactions, by which the at least one first attachment site and the at least one second attachment site are joined together. Chemical interactions include covalent and non-covalent interactions. Typical examples for non-covalent interactions are ionic interactions, hydrophobic interactions or hydrogen bonds, whereas covalent interactions are based, by way of example, on covalent bonds such as ester, ether, phosphoester, carbon- phosphorus bonds, carbon-sulfur bonds such as thioether, or imide bonds. In certain preferred embodiments the first attachment site and the second attachment site are linked through at least one covalent bond, preferably through at least one non-peptide bond, and even more preferably through exclusively non-peptide bond(s). The term "linked" as used herein, however, shall not only refer to a direct linkage of the at least one first attachment site and the at least one second attachment site but also, alternatively and preferably, an indirect linkage of the at least one first attachment site and the at least one second attachment site through intermediate molecule(s), and hereby typically and preferably by using at least one, preferably one, heterobifunctional cross-linker. In other preferred embodiments the first attachment site and the second attachment site are linked through at least one covalent bond, preferably through at least one peptide bond, and even more preferably through exclusively peptide bond(s).

[0037] Linker: A "linker", as used herein, either associates the second attachment site with the antigen or already comprises, essentially consists of, or consists of the second attachment site. Preferably, a "linker", as used herein, already comprises the second attachment site, typically and preferably - but not necessarily - as one amino acid residue, preferably as a cysteine residue. A preferred linkers are an amino acid linkers, i.e. linkers containing at least one amino acid residue. The term amino acid linker does not imply that such a linker consists exclusively of amino acid residues. However, a linker consisting exclusively of amino acid residues is a preferred embodiment of the invention. The amino acid residues of the linker are, preferably, composed of naturally occurring amino acids or unnatural amino acids known in the art, all-L or all-D or mixtures thereof. Further preferred embodiments of a linker in accordance with this invention are molecules comprising a sulfhydryl group or a cysteine residue and such molecules are, therefore, also encompassed within this invention. Further linkers useful for the present invention are molecules comprising a C1-C6 alkyl-, a cycloalkyl such as a cyclopentyl or cyclohexyl, a cycloalkenyl, aryl or heteroaryl moiety. Moreover, linkers comprising preferably a C1-C6 alkyl-, cycloalkyl- (C5, C6), aryl- or heteroaryl- moiety and additional amino acid(s) can also be used as linkers for the present invention and shall be encompassed within the scope of the invention. Association of the linker with the antigen is preferably by way of at least one covalent bond, more preferably by way of at least one peptide bond.

[0038] Ordered and repetitive antigen array: As used herein, the term "ordered and repetitive antigen array" refers to a repeating pattern of antigen which typically and preferably is characterized by a high order of uniformity in spacial arrangement of the antigens with respect to the virus-like particle. In one embodiment of the invention, the repeating pattern may be a geometric pattern. Certain embodiments of the invention, such as antigens coupled to the inventive VLP, are typical and preferred examples of suitable ordered and repetitive antigen arrays which, moreover, possess strictly repetitive paracrystalline orders of antigens, preferably with spacing of 1 to 30 nanometers, preferably 2 to 15 nanometers, even more preferably 2 to 10 nanometers, even again more preferably 2 to 8 nanometers, and further more preferably 1.6 to 7 nanometers.

[0039] Immunostimulatory substance: As used herein, the term "immuno stimulatory substance" refers to a substance capable of inducing and/or enhancing an immune response. Immunostimulatory substances, as used herein, include, but are not limited to, toll-like receptor activating substances and substances inducing cytokine secretion. Toll-like receptor activating substances include, but are not limited to, immuno stimulatory nucleic acids, peptideoglycans, lipopolysaccharides, lipoteichonic acids, imidazoquinoline compounds, flagellins, lipoproteins, and immuno stimulatory organic substances such as taxol. [0040] Immunostimulatory nucleic acid: As used herein, the term immuno stimulatory nucleic acid refers to a nucleic acid capable of inducing and/or enhancing an immune response. Immunostimulatory nucleic acids comprise ribonucleic acids and in particular desoxyribonucleic acids, wherein both, ribonucleic acids and desoxyribonucleic acids may be either double stranded or single stranded. Preferred ISS-NA are desoxyribonucleic acids, wherein further preferably said desoxyribonucleic acids are single stranded. Preferably, immunostimulatory nucleic acids contain at least one CpG motif comprising an unmethylated C. Very preferred immunostimulatory nucleic acids comprise at least one CpG motif, wherein said at least one CpG motif comprises or preferably consist of at least one, preferably one, CG dinucleotide, wherein the C is unmethylated. Preferably, but not necessarily, said CG dinucleotide is part of a palindromic sequence. The term immunostimulatory nucleic acid also refers to nucleic acids that contain modified bases, preferably 4-bromo-cytosine. Specifically preferred in the context of the invention are ISS-NA which are capable of stimulating IFN- alpha production in dendritic cells. Immunostimulatory nucleic acids useful for the purpose of the invention are described, for example, in WO2007/068747A1.

[0041] Oligonucleotide: As used herein, the term "oligonucleotide" refers to a nucleic acid sequence comprising 2 or more nucleotides, preferably about 6 to about 200 nucleotides, and more preferably 20 to about 100 nucleotides, and most preferably 20 to 40 nucleotides. Very preferably, oligonucleotides comprise about 30 nucleotides, more preferably oligonucleotides comprise exactly 30 nucleotides, and most preferably oligonucleotides consist of exactly 30 nucleotides. Oligonucleotides are polyribonucleotides or polydeoxribonucleotides and are preferably selected from (a) unmodified RNA or DNA , and (b) modified RNA or DNA. The modification may comprise the backbone or nucleotide analogues. Oligonucleotides are preferably selected from the group consisting of (a) single- and double-stranded DNA, (b) DNA that is a mixture of single- and double-stranded regions, (c) single- and double-stranded RNA, (d) RNA that is mixture of single- and double-stranded regions, and (e) hybrid molecules comprising DNA and RNA that are single-stranded or, more preferably, double- stranded or a mixture of single- and double-stranded regions. Preferred nucleotide modifications/analogs are selected from the group consisting of (a) peptide nucleic acid, (b) inosin, (c) tritylated bases, (d) phosphorothioates, (e) alkylphosphorothioates, (f) 5-nitroindole desoxyribofliranosyl, (g) 5-methyldesoxycytosine, and (h) 5,6-dihydro-5,6- dihydroxydesoxythymidine. Phosphothioated nucleotides are protected against degradation in a cell or an organism and are therefore preferred nucleotide modifications. Unmodified oligonucleotides consisting exclusively of phosphodiester bound nucleotides, typically are more active than modified nucleotides and are therefore generally preferred in the context of the invention. Most preferred are oligonucleotides consisting exclusively of phosphodiester bound deoxinucleo tides, wherein further preferably said oligonucleotides are single stranded. Further preferred are oligonucleotides capable of stimulating IFN-alpha production in cells, preferably in dendritic cells. Very preferred oligonucleotides capable of stimulating IFN-alpha production in cells are selected from A-type CpGs and C-type CpGs.

[0042] CpG motif: As used herein, the term "CpG motif refers to a pattern of nucleotides that includes an unmethylated central CpG, i.e. the unmethylated CpG dinucleotide, in which the C is unmethylated, surrounded by at least one base, preferably one or two nucleotides, flanking (on the 3' and the 5' side of) the central CpG. Typically and preferably, the CpG motif as used herein, comprises or alternatively consists of the unmethylated CpG dinucleotide and two nucleotides on its 5 ' and 3 ' ends. Without being bound by theory, the bases flanking the CpG confer a significant part of the activity to the CpG oligonucleotide. [0043] unmethylated CpG-containing oligonucleotide: As used herein, the term "unmethylated CpG-containing oligonucleotide" or "CpG" refers to an oligonucleotide, preferably to an oligodesoxynucleotide, containing at least one CpG motif. Thus, a CpG contains at least one unmethylated cytosine, guanine dinucleotide. Preferred CpGs stimulate/activate, e.g. have a mitogenic effect on, or induce or increase cytokine expression by, a vertebrate bone marrow derived cell. For example, CpGs can be useful in activating B cells, NK cells and antigen-presenting cells, such as dendritic cells, monocytes and macrophages. Preferably, CpG relates to an oligodesoxynucleotide, preferably to a single stranded oligodesoxynucleotide, containing an unmethylated cytosine followed 3' by a guanosine, wherein said unmethylated cytosine and said guanosine are linked by a phosphate bond, wherein preferably said phosphate bound is a phosphodiester bound or a phosphothioate bound, and wherein further preferably said phosphate bond is a phosphodiester bound. CpGs can include nucleotide analogs such as analogs containing phosphorothio ester bonds and can be double-stranded or single-stranded. Generally, double- stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity. Preferably, as used herein, a CpG is an oligonucleotide that is at least about ten nucleotides in length and comprises at least one CpG motif, wherein further preferably said CpG is 10 to 60, more preferably 15 to 50, still more preferably 20 to 40, still more preferably about 30, and most preferably exactly 30 nucleotides in length. A CpG may consist of methylated and/or unmethylated nucleotides, wherein said at least one CpG motif comprises at least one CG dinucleotide wherein the C is unmethylated. The CpG may also comprise methylated and unmethylated sequence stretches, wherein said at least one CpG motif comprises at least one CG dinucleotide wherein the C is unmethylated. Very preferably, CpG relates to a single stranded oligodesoxynucleotide containing an unmethylated cytosine followed 3' by a guanosine, wherein said unmethylated cytosine and said guanosine are linked by a phosphodiester bound. The CpGs can include nucleotide analogs such as analogs containing phosphorothioester bonds and can be double-stranded or single-stranded. Generally, phosphodiester CpGs are A-type CpGs as indicated below, while phosphothioester stabilized CpGs are B-type CpGs. Preferred CpG oligonucleotides in the context of the invention are A-type CpGs.

[0044] A-type CpG: As used herein, the term "A-type CpG" or "D-type CpG" refers to an oligodesoxynucleotide (ODN) comprising at least one CpG motif. A-type CpGs preferentially stimulate activation of T cells and the maturation of dendritic cells and are capable of stimulating IFN-alpha production. In A-type CpGs, the nucleotides of the at least one CpG motif are linked by at least one phosphodiester bond. A-type CpGs comprise at least one phosphodiester bond CpG motif which may be flanked at its 5' end and/or, preferably and, at its 3' end by phosphorothioate bound nucleotides. Preferably, the CpG motif, and hereby preferably the CG dinucleotide and its immediate flanking regions comprising at least one, preferably two nucleotides, are composed of phosphodiester nucleotides. Preferred A-type CpGs exclusively consist of phosphodiester (PO) bond nucleotides. Typically and preferably, the poly G motif comprises or alternatively consists of at least one, preferably at least three, at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 Gs (guanosines), most preferably by at least 10 Gs. Preferably, the A-type CpG of the invention comprises or alternatively consists of a palindromic sequence.

[0045] palindromic sequence: A palindromic sequences is a nucleotide sequence which, when existing in the form of a double stranded nucleic acid with regular base pairing (A/T; C/G), would consist of two single strands with identical sequence in 5 '-3' direction. [0046] Packaged: The term "packaged" as used herein refers to the state of a polyanionic macromolecule or immuno stimulatory substances in relation to the VLP. The term "packaged" as used herein includes binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc. The term also includes the enclosement, or partial enclosement, of a polyanionic macromolecule. Thus, the polyanionic macromolecule or immuno stimulatory substances can be enclosed by the VLP without the existence of an actual binding, in particular of a covalent binding. In preferred embodiments, the at least one polyanionic macromolecule or immuno stimulatory substances is packaged inside the VLP, most preferably in a non-covalent manner. In case said immuno stimulatory substances is nucleic acid, preferably a DNA, the term packaged implies that said nucleic acid is not accessible to nucleases hydrolysis, preferably not accessible to DNAse hydrolysis (e.g. DNaseI or Benzonase), wherein preferably said accessibility is assayed as described in Examples 11-17 of WO2003/024481A2.

[0047] Virus-like particle (VLP): The term virus-like particle as used herein, refers to a non-replicative or non-infectious, preferably a non-rep licative and non-infectious virus particle, or refers to a non-replicative or non-infectious, preferably a non-replicative and noninfectious structure resembling a virus particle, preferably a capsid of a virus. The term "non- replicative", as used herein, refers to being incapable of replicating the genome comprised by the VLP. The term "non-infectious", as used herein, refers to being incapable of entering the host cell. A virus-like particle in accordance with the invention is non-replicative and noninfectious since it lacks all or part of the viral genome or genome function. A virus-like particle in accordance with the invention may contain nucleic acid distinct from their genome. Recombinantly produced virus-like particles typically contain host cell derived RNA. A typical and preferred embodiment of a virus-like particle in accordance with the present invention is a viral capsid composed of polypeptides of the invention. A virus-like particle is a macro molecular assembly composed of viral coat protein which typically comprises 60, 120, 180, 240, 300, 360, or more than 360 protein subunits per virus-like particle. Typically and preferably, the interactions of these subunits lead to the formation of viral capsid or viral- capsid like structure with an inherent repetitive organization. One feature of a virus-like particle is its highly ordered and repetitive arrangement of its subunits. [0048] Virus-like particle of bacteriophage φCb5: The terms "virus-like particle of bacteriophage φCb5"or φCb5 VLPs refer to a virus-like particle comprising, or preferably consisting essentially of, or preferably consisting of at least one φCb5 polypeptide. Preferably, a virus-like particle of bacteriophage φCb5 comprises said φCb5 polypeptide as the major, and even more preferably as the sole protein component of the capsid structure. Typically and preferably, virus-like particles of bacteriophage φCb5 resemble the structure of the capsid of bacteriophage φCb5. Virus-like particles of bacteriophage φCb5 are non replicative and/or non-infectious, and lack at least the gene or genes encoding for the replication machinery of the RNA bacteriophage, and typically also lack the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host. This definition includes also virus-like particles in which the aforementioned gene or genes are still present but inactive. Preferred methods to render a virus-like particle of RNA bacteriophage φCb5 non replicative and/or non-infectious is by physical or chemical inactivation, such as UV irradiation, formaldehyde treatment. Typically and preferably non replicative and/or noninfectious virus-like particles are obtained by recombinant gene technology. Recombinantly produced virus-like particles of bacteriophage φCb5 according to the invention preferably do not comprise the viral genome. Virus-like particles comprising more than one species of polypeptides, often referred to as mosaic VLPs are also encompassed by the invention. Thus, in one embodiment, the virus-like particle according to the invention comprises at least two different species of polypeptides, wherein at least one of said species of polypeptides is a φCb5 polypeptide.

[0049] The invention provides, inter alia, virus-like particles which comprise, essentially consist of, or consist of at least one φCb5 polypeptide. In one aspect, the invention relates to a virus-like particle, wherein said virus-like particle comprises, essentially consists of, or alternatively consists of, at least one φCb5 polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of bacteriophage φCb5, or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %. Thus, in a preferred embodiment, said virus-like particle is a virus-like particle of bacteriophage φCb5. In a further preferred embodiment said virus-like particle is a virus-like particle of bacteriophage φCb5 coat protein. In a still further preferred embodiment said virus-like particle is a virus-like particle of φCb5 polypeptide. Typically and preferably, said virus-like particles and/or said at least one φCb5 polypeptide are recombinantly produced. Thus, in a preferred embodiment said virus-like particle is a recombinant virus-like particle, preferably a recombinant virus-like particle of bacteriophage φCb5.

[0050] The φCb5 polypeptide of the invention is preferably produced by expression of a recombinant gene, preferably in a prokaryotic host, and most preferably in E. coli. Thus, in a preferred embodiment said least one φCb5 polypeptide is a recombinant φCb5 polypeptide. As indicated above, recombinantly produced polypeptides may comprise an N-terminal methionine residue. In one embodiment said φCb5 polypeptide therefore comprises an N- terminal methionine residue. However, typically and preferably said N-terminal methionine residue is cleaved off said φCb5 polypeptide.

[0051] In one embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 is the amino acid sequence of a naturally occurring variant of the coat protein of bacteriophage φCb5. In a preferred embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 comprises or preferably consists of the amino acid sequence of SEQ ID NO:3 or SEQ ID NO:6. In very preferred embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 is SEQ ID NO:3 or SEQ ID NO:6, wherein preferably said amino acid sequence of a coat protein of bacteriophage φCb5 is SEQ ID NO:3. In a further preferred embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 is an amino acid sequence encoded by the cDNAs of SEQ ID NO:1 or SEQ ID NO:4. [0052] In a preferred embodiment, said at least one φCb5 polypeptide comprises or preferably consists of said amino acid sequence of a coat protein of bacteriophage φCb5. In a further preferred embodiment said φCb5 polypeptide comprises or preferably consist of an amino acid sequence selected from the group consisting of: (a) the amino acid sequence encoded by the cDNA of SEQ ID NO:1; (b) SEQ ID NO:2; (c) SEQ ID NO:3; (d) the amino acid sequence encoded by the cDNA of SEQ ID NO:4; (e) SEQ ID NO:5; and (f) SEQ ID NO:6.

[0053] In a further preferred embodiment said φCb5 polypeptide comprises or preferably consist of the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:3, wherein preferably said φCb5 polypeptide comprises or preferably consists of the amino acid sequence of SEQ ID NO:3. In a very preferred embodiment said φCb5 polypeptide consists of SEQ ID NO:3. In a still further preferred embodiment said virus-like particle is a virus-like particle of the polypeptide of SEQ ID NO:3.

[0054] In a further preferred embodiment said φCb5 polypeptide comprises or preferably consist of the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6, wherein preferably said φCb5 polypeptide comprises or preferably consists of the amino acid sequence of SEQ ID NO:6. In a very preferred embodiment said φCb5 polypeptide consists of SEQ ID NO:6. In a still further preferred embodiment said virus-like particle is a virus-like particle of the polypeptide of SEQ ID NO:6.

[0055] The invention also encompasses virus-like particles, wherein said at least one φCb5 polypeptide comprises or preferably consists of a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, or 99 %.

[0056] Mutations may be introduced into an amino acid sequence to be mutated in order to modify certain features of the virus-like particles such as stability and/or coupling efficiency. Naturally occurring φCb5 coat protein does not comprise cysteine residues. The inventors demonstrated that the presence of a pair of cysteine residues in the φCb5 polypeptide significantly enhances the thermal stability of the virus-like particles of the invention, most likely because the presence of cysteine residues in the φCb5 polypeptide allows the formation of inter-subunit disulfide bridges.

[0057] Furthermore, the coupling density and/or the coupling efficiency of the virus-like particles and an antigen may be enhanced by increasing the number of first attachment sites which are exposed on the outer surface of the virus-like particle. Thus, one possibility of enhancing the coupling density and/or the coupling efficiency of the virus-like particles and an antigen is to increase the number of lysine residues which are exposed on the surface of the virus-like particles.

[0058] It is also contemplated that the capacity of the virus-like particles of binding nucleic acids can be modified by increasing or reducing the number of arginine residues of said φCb5 polypeptide.

[0059] Mutations may be introduced into an amino acid sequence to be mutated by insertion, deletion or exchange of amino acid residues. In order to preserve the functional properties of the φCb5 polypeptide, mainly its capability of forming virus-like particles, amino acid exchange is generally the preferred method for mutation, because it does not change the total number of amino acid residues in the sequence to be mutated. The inventors gained detailed knowledge of the three-dimensional molecular structure by resolving the crystal structure of a virus-like particle formed by the polypeptide of SEQ ID NO:3. This allows the identification of specific amino acid residues on the sequence to be mutated which are most suitable to be exchanged by other amino acid residues, preferably by lysine and/or cysteine residues.

[0060] In one embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11 , 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, wherein preferably these differences are selected from (i) insertion, (ii) deletion, (iii) amino acid exchange, and (iv) any combination of (i) to (iii). In a preferred embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11 , 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, wherein each of these differences is an amino acid exchange. In a further preferred embodiment said amino acid exchange is an exchange of an amino acid residue of said amino acid sequence to be mutated by a lysine residue or by a cysteine residue, preferably by a cysteine residue. In a further preferred embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 3 amino acid residues, wherein each of these differences is an amino acid exchange, preferably by cysteine residue and/or by a lysine residue. In a very preferred embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in exactly 2 amino acid residues, wherein each of these differences is an amino acid exchange by a cysteine residue.

[0061] In a preferred embodiment said mutated amino acid sequence comprises exactly two or exactly four cysteine residues, wherein preferably the amino acid residues of said amino acid sequence to be mutated which are corresponding to the amino acid residues in positions 1 and 4 and/or in positions 74 and 75 of SEQ ID NO:3 or SEQ ID NO:6 are exchanged by cysteine residues.

[0062] In a further preferred embodiment said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, wherein preferably the amino acid residues in positions 1 and 4 and/or the amino acid residues in positions 74 and 75 of said amino acid sequence to be mutated are exchanged by cysteine residues.

[0063] In a further preferred embodiment said mutated amino acid sequence comprises exactly two cysteine residues, wherein said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, and wherein preferably the amino acid residues in positions 74 and 75 of said amino acid sequence to be mutated are exchanged by cysteine residues. [0064] In a further preferred embodiment said mutated amino acid sequence comprises exactly two cysteine residues, wherein said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, and wherein the amino acid residues in positions 1 and 4 of said amino acid sequence to be mutated are exchanged by cysteine residues. [0065] In a further preferred embodiment said φCb5 polypeptide comprises or preferably consists of any one of SEQ ID NOs 7 to 10, wherein preferably said φCb5 polypeptide comprises or still more preferably consists of SEQ ID NO:8. Thus, in a very preferred embodiment said φCb5 polypeptide consists of the amino acid sequence of SEQ ID NO:8. In a still further preferred embodiment said virus-like particle is a virus-like particle of the polypeptide of SEQ ID NO:8.

[0066] In a further preferred embodiment at least one and at most 9, 8, 7, 6, 5, 4, 3, or 2 non- lysine residues of said amino acid sequence to be mutated are exchanged by a lysine residue. In a preferred embodiment said non-lysine residues are selected from the amino acid residues which are corresponding to the amino acid residues in positions 5, 7, 13, 16, 17, 19, 96, 110 and/or 112 of SEQ ID NO:3 or SEQ ID NO:6, and wherein said non-lysine residues are exchanged by lysine residues. In a further preferred embodiment the amino acid residue which is corresponding to the amino acid residue in positions 13 of SEQ ID NO: 3 or SEQ ID NO: 6 is exchanged by a lysine residue.

[0067] In a further preferred embodiment said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, wherein at least one and at most 9, 8, 7, 6, 5, 4, 3, or 2 non-lysine residues of said amino acid sequence to be mutated are exchanged by a lysine residue, and wherein preferably said non-lysine residues are selected from the amino acid residues in positions 5, 7, 13, 16, 17, 19, 96, 110 and/or 112 of said amino acid sequence to be mutated. [0068] In a further preferred embodiment said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, wherein the amino acid residue in position 13 of said amino acid sequence to be mutated is exchanged by a lysine residue.

[0069] Virus like particles of the invention are generally stable as indicated by Tm values determined in Example 3. In a preferred embodiment said virus-like particle comprises a thermal stability (Tm) of at least 40 ⁰C, preferably at least 45 ⁰C, more preferably at least 50 ⁰C, still more preferably at least 55 ⁰C, and most preferably of at least 60 ⁰C, wherein said thermal stability is determined in 200 mM NaCl.

[0070] In a further preferred embodiment said φCb5 polypeptide comprises or preferably consists of the amino acid sequence of any one of SEQ ID NOs 2, 3, 5, or 6, wherein said virus-like particle comprises a thermal stability (Tm) of at least 40 ⁰C, wherein said thermal stability is determined in 200 mM NaCl.

[0071] In a further preferred embodiment said φCb5 polypeptide comprises or preferably consists of the amino acid sequence of any one of SEQ ID NOs 7 to 10, preferably of SEQ ID NO:8, wherein said virus-like particle comprises a thermal stability (Tm) of at least 55 ⁰C, wherein said thermal stability is determined in 200 mM NaCl.

[0072] In a further aspect, the invention relates to a virus-like particle, wherein preferably said virus-like particle is a virus-like particle of bacteriophage φCb5, wherein said virus-like particle and preferably said virus-like particle of bacteriophage φCb5, comprises, essentially consists of, or alternatively consists of, at least one φCb5 polypeptide comprising or preferably consisting of the amino acid sequence of any one of SEQ ID NOs 2, 3, and 5 to 10, wherein preferably said φCb5 polypeptide is a recombinant φCb5 polypeptide. [0073] In a further aspect, the invention relates to a virus-like particle of bacteriophage φCb5, wherein said virus-like particle of bacteriophage φCb5 comprises, essentially consists of, or alternatively consists of, at least one recombinant φCb5 polypeptide, wherein said recombinant φCb5 polypeptide comprises or preferably consists of the amino acid sequence of any one of SEQ ID NOs 3, 6, and 8.

[0074] In a further aspect, the invention relates to a virus-like particle of bacteriophage φCb5, wherein said virus-like particle of bacteriophage φCb5 comprises at least one recombinant φCb5 polypeptide, wherein said recombinant φCb5 polypeptide consists of the amino acid sequence of any one of SEQ ID NOs 3, 6, and 8, and wherein preferably said recombinant φCb5 polypeptide consists of the amino acid sequence of SEQ ID NO:8. [0075] In a further aspect, the invention relates to a recombinant φCb5 polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of bacteriophage φCb5, or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %.

[0076] In one embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 is the amino acid sequence of a naturally occurring variant of the coat protein of bacteriophage φCb5. In a preferred embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 comprises or preferably consists of the amino acid sequence of SEQ ID NO:3 or SEQ ID NO:6. In very preferred embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 is SEQ ID NO:3 or SEQ ID NO:6, wherein preferably said amino acid sequence of a coat protein of bacteriophage φCb5 is SEQ ID NO:3. In a further preferred embodiment said amino acid sequence of a coat protein of bacteriophage φCb5 is an amino acid sequence encoded by the cDNAs of SEQ ID NO:1 or SEQ ID NO:4. [0077] In a preferred embodiment, said recombinant φCb5 polypeptide comprises or preferably consists of said amino acid sequence of a coat protein of bacteriophage φCb5. In a further preferred embodiment said recombinant φCb5 polypeptide comprises or preferably consist of an amino acid sequence selected from the group consisting of: (a) the amino acid sequence encoded by the cDNA of SEQ ID NO:1; (b) SEQ ID NO:2; (c) SEQ ID NO:3; (d) the amino acid sequence encoded by the cDNA of SEQ ID NO:4; (e) SEQ ID NO:5; and (f) SEQ ID NO:6.

[0078] In a further preferred embodiment said recombinant φCb5 polypeptide comprises or preferably consist of the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:3, wherein preferably said recombinant φCb5 polypeptide comprises or preferably consists of the amino acid sequence of SEQ ID NO:3. In a very preferred embodiment said recombinant φCb5 polypeptide consists of SEQ ID NO:3.

[0079] In a further preferred embodiment said recombinant φCb5 polypeptide comprises or preferably consist of the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6, wherein preferably said recombinant φCb5 polypeptide comprises or preferably consists of the amino acid sequence of SEQ ID NO:6. In a very preferred embodiment said recombinant φCb5 polypeptide consists of SEQ ID NO:6.

[0080] The invention also encompasses recombinant φCb5 polypeptide comprising or preferably consisting of mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, or 99 %. [0081] In one embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11 , 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, wherein preferably these differences are selected from (i) insertion, (ii) deletion, (iii) amino acid exchange, and (iv) any combination of (i) to (iii). In a preferred embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, wherein each of these differences is an amino acid exchange. In a further preferred embodiment said amino acid exchange is an exchange of an amino acid residue of said amino acid sequence to be mutated by a lysine residue or by a cysteine residue, preferably by a cysteine residue. In a further preferred embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 3 amino acid residues, wherein each of these differences is an amino acid exchange, preferably by cysteine residue and/or by a lysine residue. In a very preferred embodiment said mutated amino acid sequence and said amino acid sequence to be mutated differ in exactly 2 amino acid residues, wherein each of these differences is an amino acid exchange by a cysteine residue.

[0082] In a preferred embodiment said mutated amino acid sequence comprises exactly two or exactly four cysteine residues, wherein preferably the amino acid residues of said amino acid sequence to be mutated which are corresponding to the amino acid residues in positions 1 and 4 and/or in positions 74 and 75 of SEQ ID NO:3 or SEQ ID NO:6 are exchanged by cysteine residues.

[0083] In a further preferred embodiment said amino acid sequence to be mutated is SEQ ID

NO:3 or SEQ ID NO:6, wherein preferably the amino acid residues in positions 1 and 4 and/or the amino acid residues in positions 74 and 75 of said amino acid sequence to be mutated are exchanged by cysteine residues.

[0084] In a further preferred embodiment said mutated amino acid sequence comprises exactly two cysteine residues, wherein said amino acid sequence to be mutated is SEQ ID

NO:3 or SEQ ID NO:6, and wherein preferably the amino acid residues in positions 74 and 75 of said amino acid sequence to be mutated are exchanged by cysteine residues.

[0085] In a further preferred embodiment said mutated amino acid sequence comprises exactly two cysteine residues, wherein said amino acid sequence to be mutated is SEQ ID

NO:3 or SEQ ID NO:6, and wherein the amino acid residues in positions 1 and 4 of said amino acid sequence to be mutated are exchanged by cysteine residues.

[0086] In a further preferred embodiment said recombinant φCb5 polypeptide comprises or preferably consists of any one of SEQ ID NOs 7 to 10, and wherein preferably said recombinant φCb5 polypeptide comprises or still more preferably consists of SEQ ID NO:8.

Thus, in a very preferred embodiment said recombinant φCb5 polypeptide consists of the amino acid sequence of SEQ ID NO:8.

[0087] In a further preferred embodiment at least one and at most 9, 8, 7, 6, 5, 4, 3, or 2 non- lysine residues of said amino acid sequence to be mutated are exchanged by a lysine residue, wherein preferably said non-lysine residues are selected from the amino acid residues which are corresponding to the amino acid residues in positions 5, 7, 13, 16, 17, 19, 96, 110 and/or

112 of said amino acid sequence of a coat protein of bacteriophage φCb5. In a further preferred embodiment said non- lysine residue is the amino acid residue which is corresponding to the amino acid residue in positions 13 of SEQ ID NO:3 or SEQ ID NO:6. [0088] In a further preferred embodiment said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, wherein at least one and at most 9, 8, 7, 6, 5, 4, 3, or 2 non-lysine residues of said amino acid sequence to be mutated are exchanged by a lysine residue, and wherein preferably said non-lysine residues are selected from the amino acid residues in positions 5, 7, 13, 16, 17, 19, 96, 110 and/or 112 of said amino acid sequence to be mutated. [0089] In a further preferred embodiment said amino acid sequence to be mutated is SEQ ID NO:3 or SEQ ID NO:6, wherein the amino acid residue in position 13 of said amino acid sequence to be mutated is exchanged by a lysine residue.

[0090] In a further preferred embodiment said virus-like particle comprises an antigen, wherein said antigen is bound to said at least one φCb5 polypeptide, preferably by way of a covalent bond. Said covalent bond may hereby be a peptide- or a non-peptide bond. In a preferred embodiment said virus-like particle comprises an antigen, wherein said antigen is fused to said φCb5 polypeptide, preferably by way of genetic fusion. Thus in a further preferred embodiment said antigen is bound to said amino acid sequence of a coat protein of bacteriophage φCb5 or to said mutated amino acid sequence by way of a peptide bond. In a further preferred embodiment said antigen is inserted into said amino acid sequence of said coat protein of bacteriophage φCb5 or inserted into said mutated amino acid sequence. In a further preferred embodiment said antigen is bound to the N-terminus or to the C- terminus of said amino acid sequence of a coat protein of bacteriophage φCb5, or of said mutated amino acid sequence, wherein said antigen is bound via a peptide bond. Said antigen may hereby be bound directly or via an amino acid linker. Typically and preferably φCb5 polypeptide according to the invention to which an antigen is bound is retaining its capability to self- assemble into a virus-like particle.

[0091] A further aspect of the invention is a composition comprising a recombinant φCb5 polypeptide of the invention.

[0092] A further aspect of the invention is a composition comprising a virus-like particle of the invention.

[0093] The invention encompasses compositions wherein said virus-like particle and/or said φCb5 polypeptide, preferably said recombinant φCb5 polypeptide of the invention, comprise any one of the technical features as described herein, either alone or in any possible combination. [0094] In one embodiment said composition further comprises an antigen, wherein said antigen is mixed with said virus-like particle.

[0095] In a further embodiment said composition comprises at least one immunostimulatory substance, preferably an unmethylated CpG containing oligonucleotide, wherein said immunostimulatory substance, and preferably said unmethylated CpG containing oligonucleotide, is packaged into said virus-like particle.

[0096] In a further embodiment said composition comprises at least one immunostimulatory substance, preferably an unmethylated CpG containing oligonucleotide, wherein said immunostimulatory substance, and preferably said unmethylated CpG containing oligonucleotide, is packaged into said virus-like particle, and wherein said composition further comprises an antigen, preferably an allergen, wherein said antigen, preferably said allergen, is mixed with said virus-like particle.

[0097] In a further preferred embodiment said composition comprises (a) at least one virus- like particle of the invention, wherein said virus-like particle comprises at least one first attachment site; and (b) at least one antigen, wherein said antigen comprises at least one second attachment site; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site. Methods for linking said virus-like particle and said antigen via said first and said second attachment site are described, for example, in WO2002/056905A2 and WO2004/084940A1.

[0098] In a further preferred embodiment said first attachment site is linked to said second attachment site via at least one covalent bond. In a further preferred embodiment said covalent bond is a non-peptide bond. In a further preferred embodiment said first attachment site is an amino group, preferably an amino group of a lysine.

[0099] Attachment between virus-like particles and antigenic proteins by way of disulfide bonds are labile, in particular, to sulfhydryl-moiety containing molecules, and are, furthermore, less stable in serum than, for example, thioether attachments (Martin FJ. and Papahadjopoulos D. (1982) J. Biol. Chem. 257: 286-288). Therefore, in a further very preferred embodiment of the present invention, the association or linkage of the VLP and the at least one antigen does not comprise a disulfide bond. Further preferred hereby, the at least one second attachment comprise, or preferably is, a sulfhydryl group. Moreover, the association or linkage of the VLP and the at least one antigen does preferably not comprise a sulphur-sulphur bond. Further preferred hereby, the at least one second attachment comprise, or preferably is, a sulfhydryl group. In a further very preferred embodiment, said at least one first attachment site is not or does not comprise a sulfhydryl group. In again a further very preferred embodiment, said at least one first attachment site is not or does not comprise a sulfhydryl group of a cysteine.

[00100] In a further preferred embodiment said second attachment site is a sulfhydryl group, preferably a sulfhydryl group of a cysteine.

[00101] In one preferred embodiment, said composition comprises or alternatively consists essentially of a virus-like particle with at least one first attachment site linked to at least one antigen with at least one second attachment site via at least one covalent bond, wherein preferably the covalent bond is a non-peptide bond. In a preferred embodiment of the present invention, the first attachment site comprises, or preferably is, an amino group, preferably the amino group of a lysine residue. In another preferred embodiment of the present invention, the second attachment site comprises, or preferably is, a sulfhydryl group, preferably a sulfhydryl group of a cysteine residue.

[00102] In a very preferred embodiment, the at least one first attachment site is an amino group, preferably an amino group of a lysine residue and the at least one second attachment site is a sulfhydryl group, preferably a sulfhydryl group of a cysteine residue. [00103] In a further preferred embodiment only one of said second attachment sites associates with said first attachment site through at least one non-peptide covalent bond leading to a single and uniform type of binding of said antigen to said virus-like particle, wherein said only one second attachment site that associates with said first attachment site is a sulfhydryl group, and wherein said antigen and said virus-like particle interact through said association to form an ordered and repetitive antigen array.

[00104] In one preferred embodiment of the invention, the antigen is linked to the VLP by way of chemical cross-linking, typically and preferably by using a heterobifunctional cross- linker. In preferred embodiments, the hetero-bifunctional cross-linker contains a functional group which can react with the preferred first attachment sites, preferably with the amino group, more preferably with the amino groups of lysine residue(s) of the VLP, and a further functional group which can react with the preferred second attachment site, i.e. a sulfhydryl group, preferably of cysteine(s) residue inherent of, or artificially added to the antigen, and optionally also made available for reaction by reduction. Several hetero-bifunctional cross- linkers are known to the art. These include the preferred cross-linkers SMPH (Pierce), Sulfo- MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB, Sulfo-SMCC, Sulfo-KMUS SVSB, SIA, and other cross-linkers available for example from the Pierce Chemical Company, and having one functional group reactive towards amino groups and one functional group reactive towards sulfhydryl groups. The above mentioned cross-linkers all lead to formation of an amide bond after reaction with the amino group and a thioether linkage with the sulfhydryl groups. Another class of cross- linkers suitable in the practice of the invention is characterized by the introduction of a disulfide linkage between the antigen and the VLP upon coupling. Preferred cross-linkers belonging to this class include, for example, SPDP and Sulfo-LC-SPDP (Pierce).

[00105] Linking of the antigen to the VLP by using a hetero-bifunctional cross-linker according to the preferred methods described above, allows coupling of the antigen to the VLP in an oriented fashion. Other methods of linking the antigen to the VLP include methods wherein the antigen is cross-linked to the VLP, using the carbodiimide EDC, and NHS. The antigen may also be first thiolated through reaction, for example with SATA, SATP or iminothiolane. The antigen, after deprotection if required, may then be coupled to the VLP as follows. After separation of the excess thiolation reagent, the antigen is reacted with the VLP, previously activated with a hetero-bifunctional cross-linker comprising a cysteine reactive moiety, and therefore displaying at least one or several functional groups reactive towards cysteine residues, to which the thiolated antigen can react, such as described above. Optionally, low amounts of a reducing agent are included in the reaction mixture. In further methods, the antigen is attached to the VLP, using a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce) or other known homo-bifunctional cross- linkers with functional groups reactive towards amine groups or carboxyl groups of the VLP. [00106] In very preferred embodiments of the invention, the antigen is linked via a cysteine residue, having been added to either the N-terminus or the C-terminus of, or a natural cysteine residue within the antigen, to lysine residues of the virus-like particle.

[00107] In a preferred embodiment, the composition of the invention further comprises a linker, wherein said linker associates said antigen with said second attachment site. [00108] Engineering of a second attachment site onto the antigen is achieved by the association of a linker, preferably containing at least one amino acid suitable as second attachment site according to the disclosures of this invention. Therefore, in a preferred embodiment of the present invention, a linker is associated to the antigen by way of at least one covalent bond, preferably, by at least one, preferably one peptide bond. Preferably, the linker comprises, or alternatively consists of, the second attachment site. In a further preferred embodiment, the linker comprises a sulfhydryl group, preferably of a cysteine residue. In another preferred embodiment, the amino acid linker is a cysteine residue. [00109] The selection of a linker will be dependent on the nature of the antigen, on its biochemical properties, such as pi, charge distribution and glycosylation. In general, flexible amino acid linkers are favored. In a further preferred embodiment of the present invention, the linker consists of amino acids, wherein further preferably the linker consists of at least one and at most 25, preferably at most 20, more preferably at most 15 amino acids. In an again preferred embodiment of the invention, the amino acid linker contains 1 to 10 amino acids. [00110] In a further preferred embodiment said linker comprises or alternatively consists of said second attachment site.

[00111] In a further preferred embodiment said linker is an amino acid linker, and wherein preferably said amino acid linker is selected from the group consisting of: (a) CGG; (b) N- terminal gamma 1 -linker; (c) N-terminal gamma 3 -linker; (d) Ig hinge regions; (e) N-terminal glycine linkers; (f) (G)kC(G)n with n=0-12 and k=0-5; (g) N-terminal glycine-serine linkers (h) (G)kC(G)m(S)l(GGGGS)n with n=0-3, k=0-5, m=0-10, 1=0-2; (i) GGC; (j) GGC-NH2; (k) C-terminal gamma 1 -linker; (1) C-terminal gamma 3-linker; (m) C-terminal glycine linkers; (n) (G)nC(G)k with n=0-12 and k=0-5; (o) C-terminal glycine-serine linkers; and (p) (G)m(S)l(GGGGS)n(G)oC(G)k with n=0-3, k=0-5, m=0-10, 1=0-2, and o=0-8. In general, glycine residues will be inserted between bulky amino acids and the cysteine to be used as second attachment site, to avoid potential steric hindrance of the bulkier amino acid in the coupling reaction.

[00112] In a further preferred embodiment the linker is added to the N-terminus of the antigen. In another preferred embodiment of the invention, the linker is added to the C- terminus of antigen.

[00113] In other embodiments of the present invention, the composition comprises or alternatively consists essentially of a virus-like particle linked to the antigen via chemical interactions, wherein at least one of these interactions is not a covalent bond. Linking of the VLP to the antigen can be effected by biotinylating the VLP and expressing the antigen as a streptavidin- fusion protein.

[00114] One or several antigen molecules can be attached to one subunit of the VLP, preferably through the exposed lysine residues of φCb5 polypeptide, if sterically allowable. A specific feature of the VLPs and in particular φCb5 polypeptide of the invention is the possibility to couple several antigens per subunit. This allows for the generation of a dense antigen array. Alternatively, said antigen is bound to said φCb5 polypeptide by way of genetic fusion as described above. [00115] In a further preferred embodiment said composition further comprises at least one immuno stimulatory substance. Immunostimulatory substances useful for the invention are generally known in the art and are disclosed, inter alia, in WO2003/024481A2.

[00116] In a further preferred embodiment said immunostimulatory substance is bound to said virus-like particle. In a further preferred embodiment said immunostimulatory substance is mixed with said virus-like particle. In a further preferred embodiment said immunostimulatory substance is packaged into said virus-like particle.

[00117] In a further preferred embodiment said immunostimulatory substance is selected from the group consisting of: (a) immunostimulatory nucleic acid; (b) peptidoglycan; (c) lipopolysaccharide; (d) lipoteichonic acid; (e) imidazoquinoline compound; (f) flagelline; (g) lipoprotein; and (h) any mixtures of at least one substance of (a) to (g).

[00118] In a further preferred embodiment said immunostimulatory substance is an immunostimulatory nucleic acid, wherein said immunostimulatory nucleic acid is selected from the group consisting of: (a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixture of (a), (b) and/or (c).

[00119] In a further preferred embodiment said immunostimulatory nucleic is a ribonucleic acid, and wherein said ribonucleic acid is host cell derived RNA. In a further preferred embodiment said immunostimulatory nucleic is poly-(LC) or a derivative thereof.

[00120] In a further preferred embodiment said immunostimulatory nucleic is a deoxyribonucleic acid, wherein said deoxyribonucleic acid is an unmethylated CpG- containing oligonucleotide. In a further preferred embodiment said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide. In a further preferred embodiment said unmethylated CpG-containing oligonucleotide is an A-type CpG.

[00121] In a further preferred embodiment said unmethylated CpG-containing oligonucleotide comprises a palindromic sequence. In a further preferred embodiment the

CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence. In a further preferred embodiment said palindromic sequence is GACGATCGTC

(SEQ ID NO: 19).

[00122] In a further preferred embodiment said palindromic sequence is flanked at its 5'- terminus and at its 3 '-terminus by guanosine entities. In a further preferred embodiment said palindromic sequence is flanked at its 5 '-terminus by at least 3 and at most 15 guanosine entities, and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 3 and at most 15 guanosine entities. [00123] In a further preferred embodiment said unmethylated CpG-containing oligonucleotide comprises or alternatively consists of the sequence selected from the group consisting of: (a) "G6-6" GGGGGGGACGATCGTCGGGGGG (SEQ ID NO:20); (b) "G7-7" GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO:21); (C) "G8-8" GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO:22); (d) "G9-9" GGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO:23); and (e) "GlO" GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:24). In a further preferred embodiment said unmethylated CpG-containing oligonucleotide comprises or alternatively consists of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:24).

[00124] In a further preferred embodiment said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides. [00125] In a further preferred embodiment said immuno stimulatory nucleic acid, preferably said unmethylated CpG-containing oligonucleotide, is not accessible to DNAse hydrolysis. [00126] In a further preferred embodiment said immunostimulatory nucleic acid is an unmethylated CpG-containing oligonucleotide, wherein said unmethylated CpG-containing oligonucleotide is not accessibly to Benzonase hydrolysis.

[00127] In a further preferred embodiment said immunostimulatory nucleic acid is an unmethylated Cp G containing oligonucleotide consisting o f the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:24), wherein said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides.

[00128] Antigens which are useful for the purpose of the invention are disclosed for example in WO2002/056905A2, WO2004/007538A2, WO2006/037787A2, WO2004/084940A1, and WO2006/032674A1. In one embodiment said antigen is derived from a source selected from the group consisting of: (a) viruses; (b) bacteria; (c) parasites; (d) prions; (e) tumors; (f) self- molecules; (g) non-peptidic hapten molecules (h) allergens; and (i) hormones. [00129] In a further preferred embodiment said antigen is a tumor antigen, wherein preferably said tumor antigen is selected from the group consisting of: (a) a polypeptide of breast cancer cells; (b) a polypeptide of kidney cancer cells; (c) a polypeptide of prostate cancer cells; (d) a polypeptide of skin cancer cells; (e) a polypeptide of brain cancer cells; and (f) a polypeptide of leukemia cells.

[00130] In a further preferred embodiment said antigen is a tumor antigen selected from the group consisting of: (a) Her2; (b) gangliosid GD2; (c) EGF-R; (d) carcino embryonic antigen (CEA); (e) CD52; (f) CD21; (g) human melanoma gplOO; (h) human melanoma melanA/MART-1; (i) Human melanoma melanA/MART-1 analogue; (j) tyrosinase; (k) NA17-A nt; (1) MAGE3; (m) p53 protein; and (n) antigenic fragments of any of the tumor antigens of (a) to (m).

[00131] In a further preferred embodiment said antigen is a self antigen, wherein said self antigen is a polypeptide selected from the group consisting of: (a) lymphotoxin, preferably lymphotoxin α (LTa) or lymphotoxin β (LTβ), or a mixture or combination of LTa and LTβ; (b) lymphotoxin receptor; (c) receptor activator of nuclear factor kB ligand (RANKL); (d) vascular endothelial growth factor (VEGF); (e) vascular endothelial growth factor receptor (VEGF-R); (f) interleukin-1 α; (g) interleukin-1 β; (h) interleukin-5; (i) interleukin-8; (j) inter leukin-13; (k) inter leukin-15; (1) interleukin-17 (IL- 17); (m) IL-23 pi 9; (n) Ghrelin; (o) angiotensin; (p) chemokine (C-C motif) (CCL21); (q) chemokine (C-X motif) (CXCL 12); (r) stromal cell derived factor 1 (SDF-I); (s) macrophage colony stimulating factor (M-CSF); (t) monocyte chemotactic protein 1 (MCP-I); (u) endoglin; (v) resistin; (w) gonadotropin releasing hormon (GnRH); (x) growt hormon releasing (GHRH); (y) lutenizing hormon releasing hormon (LHRH); (z) thyreotropin releasing hormon (TRH); (aa) macrophage migration inhibitory factor (MIF); (bb) glucose-dependent insulinotropic peptide (GIP); (cc) eotaxin; (dd) bradykinin; (ee) Des-Arg bradykinin; (ff) B-lymphocyte chemoattractant (BLC); (gg) macrophage colony stimulating factor M-CSF; (hh) tumor necrosis factor α (TNFα); (ii) amyloid beta peptide (Aβl-42); (jj) amyloid beta peptide (Aβl-6); (kk) human IgE; (11) CCR5 extracellular domain; (mm) CXCR4 extracellular domain; (nn) Gastrin; (oo) CETP; (pp) C5a; (qq) epidermal growth factor receptor (EGF-R); (rr) a fragment of any one of the polypeptides (a) to (qq); and (ss) an antigenic mutant or fragment of any one of the polypeptides (a) to (qq). [00132] In a further preferred embodiment said antigen is IL- 17, wherein further preferably said φCb5 polypeptide consist of SEQ ID NO:3 or SEQ ID NO:6, preferably of SEQ ID NO:3.

[00133] In a further preferred embodiment said antigen is a polypeptide of a pathogen, wherein preferably said pathogen is selected from the group consisting of: (a) Toxoplasma spp.; (b) Plasmodium spp; (c) P. falciparum; (d) P. vivax; (e) P. ovale; (f) P. malariae; and (g) Chlamydia spp.

[00134] In a further preferred embodiment said antigen is a viral antigen, wherein preferably said viral antigen is a polypeptide selected from the group consisting of: (a) a polypeptide of HIV; (b) a polypeptide of influenza virus, preferably influenza A M2 extracellular domain; (c) a polypeptide of Hepatitis B virus, preferably preSl; (d) a polypeptide of Hepatitis C virus; and (e) a polypeptide of HPV, preferably HPV16E7.

[00135] In a very preferred embodiment said antigen comprises or preferably consists of the extracellular domain of the Influenza A virus M2 protein, wherein preferably said e xtra c e l lu l ar dom ain o f th e In fluenz a A virus M2 protein is SLLTEVETPIRNEWGCRCNDSSDG (SEQ ID NO:25). In a further preferred embodiment said antigen comprises or preferably consists of a mutated amino acid sequence, wherein the amino acid sequence to be mutated is SEQ ID NO:25, and wherein at most 3, preferably at most 2, and most preferably at most 1 amino acid residue(s) is(are) deleted, internally added, or substituted. In a further preferred embodiment said antigen with said linker comprises or preferably consists of SEQ ID NO: 18 or of SEQ ID NO: 30, wherein preferably said antigen with said linker comprises or preferably consists of SEQ ID NO:30, wherein still further preferably said φCb5 polypeptide consist of SEQ ID NO: 3 or SEQ ID NO:6, preferably of SEQ ID NO:3.

[00136] In a further preferred embodiment said antigen is an allergen, wherein preferably said allergen is derived from the group consisting of: (a) pollen extract; (b) dust extract; (c) dust mite extract; (d) fungal extract; (e) mammalian epidermal extract; (f) feather extract; (g) insect extract; (h) food extract; (i) hair extract; (j) saliva extract; and (k) serum extract. [00137] In a further preferred embodiment said antigen is an allergen, wherein said allergen is selected from the group consisting of: (a) trees; (b) grasses; (c) house dust; (d) house dust mite; (e) aspergillus; (f) animal hair; (g) animal feather; (h) bee venom; (i) animal products; and (j) plant products.

[00138] In a further preferred embodiment said antigen is an allergen, wherein said allergen is selected from the group consisting of: (a) bee venom phospholipase A2; (b) ragweed pollen Amb a 1; (c) birch pollen Bet v I; (d) white faced hornet venom 5 DoI m V; (e) house dust mite Der p 1; (f) house dust mite Der f 2; (g) house dust mite Der p 2; (h) dust mite Lep d; (i) fungus allergen Alt a 1; (j) fungus allergen Asp f 1; (k) fungus allergen Asp f 16; and (1) peanut allergens.

[00139] In a further preferred embodiment said antigen is a hapten.

[00140] In a further preferred embodiment said hapten is a drug, wherein preferably said drug is selected from the group consisting of: (a) codeine; (b) fentanyl; (c) heroin; (d) morphine; (e) amphetamine; (f) cocaine; (g) methylenedioxymethamphetamine; (h) methamphetamine; (i) methylphenidate; (j) nicotine; (k) LSD; (1) mescaline; (m) psilocybin; and (n) tetrahydrocannabinol. [00141] In a further preferred embodiment said hapten is a hormone, wherein preferably said hormone is selected from the group consisting of: (a) progesterone; (b) estrogen; (c) testosterone; (d) follicle stimulating hormone; (e) melanin stimulating hormone; (f) adrenalin; and (g) noradrenalin.

[00142] In a further preferred embodiment said hapten is a toxin, wherein preferably said toxin is selected from the group consisting of: (a) aflatoxin; (b) ciguetera toxin; (c) tetrodotoxin; and (d) antibiotics.

[00143] In a further aspect the invention provides a vaccine comprising or alternatively consisting of the virus-like particle of the invention or of the composition of the invention. Encompassed are vaccines wherein said virus-like particle, said φCb5 polypeptide, preferably said recombinant φCb5 polypeptide, and/or said composition comprise any one of the technical features disclosed herein, either alone or in any possible combination. In one embodiment the vaccine further comprises an adjuvant. In a further embodiment the vaccine is devoid of an adjuvant. In a preferred embodiment said vaccine comprises an effective amount of the composition of the invention. An "effective amount" refers to an amount which needs to be administered to a subject in order to achieve an detectable physiological effect. [00144] In a further aspect, the invention relates to a pharmaceutical composition comprising: (a) a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, or a vaccine of the invention; and (b) a pharmaceutically acceptable carrier, diluent and/or excipient. Said diluent includes sterile aqueous (e.g., physiological saline) or non-aqueous solutions and suspensions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Pharmaceutical compositions of the invention may be in a form which contain salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the conjugate. Examples of materials suitable for use in preparation of pharmaceutical compositions are provided in numerous sources including Remington's Pharmaceutical Sciences (Osol, A, ed., Mack Publishing Co., (1990)). In one embodiment said pharmaceutical composition comprises an effective amount of the vaccine of the invention. An "effective amount" refers to an amount which needs to be administered to a subject in order to achieve an detectable physiological effect. [00145] A further aspect of the invention is a method of immunization comprising administering a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention to an animal, preferably to a human. In a preferred embodiment said method comprises administering a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention to an animal, preferably to a human.

[00146] A further aspect of the invention is a method of treating or preventing a disease, disorder or physiological condition in an animal said method comprising administering a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention to said animal, wherein preferably said animal is a human. In a preferred embodiment said method comprises administering a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention to said animal, wherein preferably said animal is a human. In a further preferred embodiment said polypeptide, said virus-like particle, said composition, said the vaccine, or said pharmaceutical composition is administered to said animal subcutaneously, intravenously, intradermally, intranasally, orally, or transdermally.

[00147] In one embodiment the invention provides a method of treating or preventing Influenza A virus infection in an animal said method comprising administering a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention to said animal, wherein preferably said animal is a human, and wherein said antigen comprises or preferably consists of the extracellular domain of the Influenza A virus M2 protein, and wherein still further preferably said φCb5 polypeptide consist of SEQ ID NO: 3 or SEQ ID NO:6, most preferably of SEQ ID NO:3. In a further preferred embodiment said antigen comprises or preferably consists of a mutated amino acid sequence, wherein the amino acid sequence to be mutated is SEQ ID NO:25, and wherein at most 3, preferably at most 2, and most preferably at most 1 amino acid residue(s) is(are) deleted, internally added, or substituted, and wherein further preferably said φCb5 polypeptide consist of SEQ ID NO: 3 or SEQ ID NO:6, most preferably of SEQ ID NO:3.

[00148] In a further embodiment the invention provides a method of treating or preventing a disease in an animal, wherein preferably said disease is multiple sclerosis, said method comprising administering a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention to said animal, wherein preferably said animal is a human, and wherein said antigen is IL- 17, and wherein still further preferably said φCb5 polypeptide consist of SEQ ID NO:3 or SEQ ID NO:6, most preferably of SEQ ID NO:3. [00149] A further aspect of the invention is a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention for use as a medicament. [00150] A further aspect of the invention is the use of a virus-like particle of the invention, of a recombinant φCb5 polypeptide of the invention, and/or of a composition of the invention in the manufacture of a medicament for the treatment of a disease, disorder or condition in an animal, preferably in a human.

[00151] A further aspect of the invention is a virus-like particle of the invention, a recombinant φCb5 polypeptide of the invention, a composition of the invention, a vaccine of the invention, or a pharmaceutical composition of the invention for use in a in a method for the treatment of a disease, disorder or condition in an animal, preferably in a human. [00152] In one embodiment the invention relates to a virus-like particle of the invention, to a recombinant φCb5 polypeptide of the invention, of a composition of the invention, to a vaccine of the invention, or to a pharmaceutical composition of the invention for use in a method of treating or preventing Influenza A virus infection in an animal, preferably in a human, wherein said antigen comprises or preferably consists of the extracellular domain of the Influenza A virus M2 protein, and wherein still further preferably said φCb5 polypeptide consist of SEQ ID NO:3 or SEQ ID NO:6, most preferably of SEQ ID NO:3. In a further preferred embodiment said antigen comprises or preferably consists of a mutated amino acid sequence, wherein the amino acid sequence to be mutated is SEQ ID NO:25, and wherein at most 3, preferably at most 2, and most preferably at most 1 amino acid residue(s) is(are) deleted, internally added, or substituted, and wherein further preferably said φCb5 polypeptide consist of SEQ ID NO:3 or SEQ ID NO:6, most preferably of SEQ ID NO:3. [00153] In one embodiment the invention relates to a virus-like particle of the invention, to a recombinant φCb5 polypeptide of the invention, of a composition of the invention, to a vaccine of the invention, or to a pharmaceutical composition of the invention for use in a method of treating or preventing a disease in an animal, wherein preferably said disease is multiple sclerosis, wherein said antigen is IL-17, and wherein still further preferably said φCb5 polypeptide consist of SEQ ID NO:3 or SEQ ID NO:6, most preferably of SEQ ID NO:3. [00154] A further aspect of the invention is a nucleic acid sequence encoding the recombinant φCb5 polypeptide. In a preferred embodiment said nucleic acid sequence comprises or preferably consists of SEQ ID NO: 1 or SEQ ID NO:4 The invention further relates to an expression vector comprising said nucleic acid sequence. In a preferred embodiment, said expression vector comprises or preferably consists of any one of SEQ ID NOs 26, 27, and 28.

EXAMPLE 1 Cloning of the φCb5 Coat Protein gene

[00155] Phage φCb5 was cultivated in and purified from C. crescentus bacteria. For phage multiplication bacteria were grown on shaker with a good aeration at 32⁰C in NZY broth (0.25 % w/v NZamineA, Sigma, 0.05 % w/v Yeast Extract Technical, Difco, 1 mM CaCl₂, 1 mM MgSO₄) until OD 0.3 - 0.4, phage was added at multiplicity of infection of 10, and cultivation was continued for 24 h. The phage titer was around 5-10 x 10¹¹ pfu/ml. The phage was sedimented from cleared lysates at 70,000 g for 2 h, the pellet was re-suspended in TM buffer (0.02 M Tris, 2xlO^"4 M MgCl₂, pH 7.8) and centrifuged to equilibrium in a 20-60 % sucrose gradient in TM buffer. The gradient was centrifuged for 18 h at 28,000 rpm in a SW 32 Ti rotor, 140,000 g. 1 ml fractions were collected from the bottom of the tube and presence of phage in each fraction was detected by SDS-PAGE. Phage-containing fractions were pooled, dialysed against TM buffer, concentrated with a 100 KDa MW cut-off Amicon concentrator and reapplied on the sucrose gradient. After the second purification, the phage was dialysed against 20 mM tris-HCl pH 8.0 and concentrated to about 10 mg/ml. [00156] Phage particles were disrupted with phenol in the presence of 0.5 % SDS and RNA was recovered by subsequent phenol/chloroform and chloroform extractions, followed by alcohol precipitation. First strand cDNA was synthesized by a random hexamer primer (kit #K1621; Fermentas, Lithuania). Resulting cDNA was used as a template for direct PCR amplification with a non-specific 21-mer primer SEQ ID NO:29) and the mixture of fragments was ligated into a pTZ57R/T vector (Fermentas, Lithuania) for sequencing. By homology with other small phages, one fragment was identified as a part of a gene encoding the putative replicase. Thereafter, series of PCRs were done to resolve phage genome sequence towards 5' end. The 369 nt-long ORF (SEQ ID NO:1) preceding the replicase gene and encoding a 13.5 kDa protein represented the coat protein gene. The CP protein gene was PCR-amplified from cDNA with primers Fw CbCP tttcatatggctctcggcgacactc (SEQ ID NO: 11) and Rv_CbCP ttctcgaggcttactccagaagtaagcacc (SEQ ID NO: 12). After NdellXhol restriction (sites underlined), the PCR fragment was cloned in the pET22b(+) vector (Novagen). This construct was named pET22b(+)_Cb5R21 (SEQ ID NO:26). [00157] During genome sequencing, cDNA was isolated from another phage φCb5 stock, which revealed a naturally occurring phage φCb5 CP variant encoding a lysine residue instead of the arginine residue at aa-position 21 of the mature CP. The CP gene of this variant was isolated and cloned in the same way as described above for the R21 variant and the resulting construct was termed pET22b(+)_Cb5K21 (SEQ ID NO:27). [00158] In order to improve VLP stability, an introduction of disulfide bonds via Cys-Cys crosslinking was proposed. According to the X-ray structure based on R21 coat protein (SEQ ID NO:3) assembled to VLPs, replacement of Gly74 and Ser75 to Cys74 and Cys75 was designed. The PCR fragment was generated from pET22b(+)_CbK21 as a template with primers Fw CbCP ( S E Q I D N O :11) and Rv_CbCP_C7475 gtaagcttggcggacgaactcgggcgtacagcaagagg (Hindlϊl site underlined, SEQ ID NO: 13). After Ndel/Hindlll restriction, the respective fragment was used to replace the parental fragment encoding the wtf-sequence Gly74 and Ser75 within pET22b(+)_Cb5K21, resulting in pET22b(+)_Cb5K21_C7475 plasmid (SEQ ID NO:28) now encoding a double cysteine mutant encoding cysteine residues at aa-positions 74 and 75 of the mature coat protein (SEQ ID N0:8).

EXAMPLE 2 Expression and Purification of Recombinant φCb5 VLP

[00159] All the three constructs (pET22b(+)_Cb5R21 , pET22b(+)_Cb5K21, and pET22b(+)_Cb5K21_C7475) were used to retransforme BL-AI cells (Invitrogen) and heterologous protein expression was essentially performed according to the recommendations of the manufacturer (Invitrogen). Briefly, the cells from fresh transformation plates were incubated in 2 x TY medium containing 50 mg/ml ampicillin at 37 ⁰C with aeration to an OD value of 0.5 - 0.7. Expression of the recombinant protein was induced by simultaneous addition of 0.1 mM IPTG and 0.2 % arabinose. 3 h post induction bacteria were harvested by centrifugation and the cells were stored at -20 ⁰C until use. For purification of φCb5 VLPs formed by spontaneous self-assembly, 1 g of cells was resuspended in 6 ml of lysis buffer (20 mM Tris-HCl, pH 8.0, 2 mg/ml lysozyme). After three cycles of freezing-thawing, the lysate was incubated 30 min with addition of 60 μg/ml DNAse I (Sigma) in the presence Of MgCl₂ and clarified by centrifugation (30 min, 15,500 g). The supernatant was applied onto a linear 45-10 % sucrose gradient in 20 mM Tris-HCl, pH 8.0, and subjected to two steps of ultracentrifugation and concentration as described above for purification of native phage (see Example 1). All protein manipulations were done at 4 ⁰C. Notably, presence of φCb5 VLPs composed of SEQ ID NO:3 or SEQ ID NO:6 can not be verified by electron microscopy (except for double Cys mutant), apparently due to their instability during fixation on grids. EXAMPLE 3 φCb5 particle stability measurements

[00160] Particle stability was measured as previously described (Persson et al., J MoI Biol, Vol. 383(4) pp. 914-22, 2008). For stability measurements, 10 μl aliquots of purified recombinant φCb5 VLPs (lmg/ml) in 20 mM Tris-HCl were incubated for 10 min at desired temperatures. For stability measurements in the presence of chelating agent, EDTA was added to 20 mM final concentration and for stability measurements in the presence of salt NaCl was added to 200 mM final concentration. After heating for 10 min, the samples were immediately loaded on 1 % agarose gel in 40 mM Tris-acetate buffer, pH 8.0 (1 x TA). After electrophoresis, the gel was stained with ethidium bromide first to visualize the RNA content in UV light. After documentation the same gel was stained with Coomassie-Blue next and either co-migration of RNA content and φCb5 derived protein band indicated the integrity of the VLPs, or release of the RNA from the dissociated particles by observation of faster migrating RNA or even by disappearance of nucleic acid stain confirmed the instability of a given φCb5 VLP at the incubation-temperature. As can be seen in Table 1 , in the absence of chelating agent φCb5 wt virus-like particles which were composed of coat proteins having an amino acid sequence as set forth in SEQ ID NO:3 or SEQ ID NO:6 disassemble at around 65 ⁰C, what roughly corresponds to melting temperatures of other small RNA phages. In the presence of EDTA, no RNA/protein co-migrating band characteristic of intact φCb5 VLPs could be observed when the temperature was raised to 45 ⁰C, indicating an important role of metal ions in for the stability of wt φCb5 VLPs assembled from coat proteins having an amino acid sequence as set forth in SEQ ID NO: 3 or SEQ ID NO:6. In order to confirm the particle sensitivity of wt φCb5 VLPs to salt, stability measurements were performed in the presence of 200 mM NaCl. Under these conditions wild-type VLPs disassembled at 40 ⁰C, confirming the earlier observations and indicating an important role of electrostatic interactions in particle stabilization. No differences between native phage virions and recombinantly expressed VLPs could be observed in the stability measurements. In contrast, when stability measurements were performed with the φCb5 K21 G74C-S75C VLPs (composed of the φCb5 polypeptide having an amino acid sequence as set forth in SEQ ID NO: 8), these VLPs disassembled only above 90 ⁰C when chelating agents like EDTA and NaCl were omitted from the reaction. Similarly, the stability of φCb5 K21 G74C-S75C VLPs was reduced to 55 ⁰C in the presence of EDTA, and to 50 ⁰C in the presence of NaCl. These stability measurements demonstrated the high stability of φCb5 K21 VLP which lack any cysteine residues and hence are not stabilized by disulfide-bonds. These data also demonstrate the superior stability of φCb5 K21 G74C-S75C VLPs. Furthermore, VLPs composed of coat proteins having an amino acid sequence as set forth in SEQ ID NO: 8 were successfully applicable to electron microscopy analysis, and an intact particle structure could be visualized.

Table 1: Melting temperatures of φCb5 VLPs.

EXAMPLE 4 A. Coupling of AngioXVIII peptide to φCb5 K21coat protein and φCb5 R21 coat protein

[00161] Coupling of AngioXVIII peptide containing a C-terminal Cys-linker (SEQ ID NO: 14) to either φCb5 K21coat protein (SEQ ID NO: 6) or to φCb5 R21coat protein (SEQ ID NO:3) was essentially performed in the same way. A solution of 1 ml of 1 mg/ml φCb5 coat protein (SEQ ID NO: 6 or SEQ ID NO:3, respectively) in 20 mM HEPES, 50 mM NaCl, pH 7.3 was reacted for 120 min at room temperature with 79.3 μl of a SMPH solution (10 mM in DMSO). Also, A solution of 1 ml of 1 mg/ml φCb5 coat protein (SEQ ID NO:6 or SEQ ID NO:3, respectively) in 20 mM HEPES, 50 mM NaCl, pH 7.3 was reacted for 120 min at room temperature with 79.3 μl of a Sulfo-KMUS solution (10 mM in 20 mM HEPES, pH 7.4). The reactions were dialysed at 4 ⁰C against three 2 1 changes of 20 mM HEPES, 50 mM NaCl, pH 7.3 for 2 h, 14 h and 2 h in a Slide-A-Lyzer dialysis cassette with a MWCO of 10 kDa. 800 μl of the derivatized and dialyzed φCb5 solutions were mixed with 21.5 μl of AngioXVIII- peptide (22.32 mg/ml) and incubated for 2 h at room temperature for chemical cross-linking at 500 rpm on a shaking Eppendorf Thermomixer. The coupling reactions were cleared by centrifugation at 20O00 x g for 10 min at 4 ⁰C. Derivatized φCb5 coat protein and coupled products were analyzed by SDS-PAGE analysis under reducing conditions on a NuP AGE^® 12 % Bis-Tris gel. Subsequently, a densitometric analysis of the Coomassie-stained gel was performed. Several bands showing increased molecular weight with respect to the φCb5 coat monomer were visible, clearly demonstrating the successful cross-linking of the AngioXVIII- peptide to the φCb5 VLP (Coomassie-stained NuP AGE^®, not shown). In all cases, coupling density was above 1.0 and coupling efficiency was around 70 % (see Table 2). To proof the integrity of the φCb5 VLP after derivatization and coupling, derivatized φCb5 coat protein and coupled products were analyzed by 1 % agarose gel electrophoresis in 1 x TA followed by Coomassie- and ethidium bromide-stain. Protein- and nucleic acid bands of derivatized and coupled φCb5 VLP, respectively, co-migrate and display a similar migration behavior as non-derivatized and non-coupled φCb5 VLP. The co-migration between coat protein and nucleic acids clearly demonstrated that the φCb5 VLPs were still intact and that no nucleic acid was released from the φCb5 VLPs.

B. Coupling of AngioXVIII peptide to φCb5 K21 G74C - S75C

[00162] Coupling of AngioXVIII peptide (SEQ ID NO: 14) to φCb5 K21 G74C - S75C coat protein (SEQ ID NO: 8) was essentially performed as described in Example 4 A. Before φCb5 K21 G74C - S75C VLPs were used for derivatization and coupling purposes, disulfide-bond formation between the cysteins at aa-position 74 and aa-position 75 of the mature φCb5 K21 G74C - S75C coat protein was induced by oxidation. A solution of 1.5 ml φCb5 K21 G74C - S75C coat protein was reacted for 20 min at room temperature with 1.5 μl of copper(II)- sulfate solution (10 mM in H₂O). After incubation, the oxidized φCb5 K21 G74C - S75C coat protein was dialyzed at 4 ⁰C against two 2 1 changes of 20 mM HEPES, 50 mM NaCl, pH 7.3. for two times 2 h. A solution of 500 μl of 1 mg/ml φCb5 K21 G74C - S75C coat protein in 20 mM HEPES, 50 mM NaCl, pH 7.3 was reacted for 120 min at room temperature with 39.6 μl of a SMPH solution (10 mM in DMSO). Also, a solution of 500 μl of 1 mg/ml φCb5 K21 G74C - S75C coat protein in 20 mM HEPES, 50 mM NaCl, pH 7.3 was reacted for 120 min at room temperature with 39.6 μl of a Sulfo-KMUS solution (10 mM in 20 mM HEPES, pH 7.4). The reactions were dialysed at 4 ⁰C against three 2 1 changes of 20 mM HEPES, 50 mM NaCl, pH 7.3 for 2 h, 14 h and 2 h in a Slide- A-Lyzer dialysis cassette with a MWCO of 10 kDa. 500 μl of the derivatized and dialyzed φCb5 K21 G74C - S75C solutions were mixed with 14 μl of AngioXVIII-peptide (22.32 mg/ml) and incubated for 2 h at room temperature for chemical cross-linking at 500 rpm on a shaking Eppendorf Thermomixer. The coupling reactions were cleared by centrifugation at 20O00 x g for 10 min at 4 ⁰C. Derivatized φCb5 K21 G74C - S75C coat protein and coupled products were analyzed by SDS-PAGE analysis under reducing conditions on a NuP AGE^® 12 % Bis-Tris gel. Subsequently, a densitometric analysis of the Coomassie-stained gel was performed. Several bands of increased molecular weight with respect to the φCb5 K21 G74C - S75C coat monomer are visible, clearly demonstrating the successful cross-linking of the AngioXVIII-peptide to the φCb5 K21 G74C - S75C VLP (Coomassie-stained NuP AGE^®, not shown). As obtained already with the φCb5 K21 and φCb5 R21 coat proteins, coupling density for chemical crosslinking of AngioXVIII- peptide to φCb5 K21 G74C - S75C was above 1.0 and coupling efficiency was around 70 % (see Table 2).

[00163] To proof the integrity of the φCb5 VLPs after derivatization and coupling, derivatized φCb5 coat protein and coupled products were analyzed by 1 % agarose gel electrophoresis in 1 x TA followed by Coomassie- and ethidium bromide-stain. Protein- and nucleic acid bands of derivatized and coupled φCb5 VLPs, respectively, co-migrate and display a similar migration behavior than non-derivatized and non-coupled φCb5 VLPs. The co-migration between coat protein and nucleic acids clearly demonstrated that the φCb5 VLPs were still intact and that no nucleic acid was released from the φCb5 VLPs.

Table 2A: Coupling density (x* (coupling x) + y* (coupling y) etc)/ Sum couplings) and coupling efficiency (Sum couplings/ Sum all bands in φCb5 monomer level) in coupling reactions where AngioXVIII-peptide was chemically cross-linked via SMPH to either φCb5K21- G74C - S75C, φCb5 R21, or φCb5 K21 VLPs.

Table 2B: Coupling densitiy (x* (coupling x) + y* (coupling y) etc)/ Sum couplings) and coupling efficiency (Sum couplings/ Sum all bands in φCb5 monomer level) in coupling reactions where AngioXVIII-peptide was chemically cross-linked via Sulfo-KMUS to either φCb5 K21- G74C - S75C, φCb5 R21, or φCb5 K21 VLPs.

C. Immunization of mice with AngioXVIII-peptide coupled to φCb5 coat protein [00164] Groups of four female Balb/c mice were either immunized with φCb5K21 VLPs coupled via SMPH or &//o-KMUS to the AngioXVIII-peptide, or with φCb5R21 VLPs coupled via SMPH or Sulfo-KMUS to the AngioXVIII-peptide, or with φCb5 K21 G74C - S75C VLPs coupled via SMPH or Sulfo-KMUS to the AngioXVIII-peptide. For comparison, groups of four female Balb/C mice were immunized with either Qβ VLPs coupled via SMPH or Sulfo-KMUS to the AngioXVIII-peptide, or AP205 VLPs coupled via SMPH or Sulfo- KMUS to the AngioXVIII-peptide. 50 μg of total protein were diluted in 20 mM HEPES, 50 mM NaCl, pH 7.3 to 200 μl and injected subcutaneously (100 μl on two ventral sides) on day 0 and day 14. Mice were bled on days 0 (pre-immune), day 14, and day 21, and sera were analyzed using AngioXVIII-, φCb5-, Qβ- and AP205 -specific ELISA.

D. ELISA

[00165] The AngioXVIII-peptide was coupled to bovine RNAse A using the chemical cross- linker sulfo-SPDP. ELISA plates were coated either with AngioXVIII-coupled RNAse preparations at a concentration of 10 μg/ml or φCb5 VLPs, or Qβ VLPs, or AP205 VLPs at a concentration of 2 μg/ml. The plates were blocked and then incubated with serially diluted mouse sera. Bound antibodies were detected with enzymatically labeled anti-mouse IgG. As a control, pre-immune sera of the same mice were also tested (data not shown). The results are shown in Table 3. Antibody titers of mouse sera were calculated as the average of those dilutions which led to half maximal optical density at 450 nm. At day 14, after one initial immunization, the average anti- AngioXVIII titer were 193 and 657 for mice which had been immunized with φCb5 K21 G74C - S75C VLPs coupled to the AngioXVIII-peptide via SMPH and Sulfo-KMUS, respectively. Mice immunized with φCb5 R21 VLPs coupled to the AngioXVIII-peptide either via SMPH or &//o-KMUS displayed an average anti- AngioXVIII titer of 220 and 487, respectively. In mice immunized with φCb5 K21 VLPs coupled to the AngioXVIII-peptide either via SMPH or &//o-KMUS an average anti- AngioXVIII titer of 401 and 777 was measured, respectively. In comparison, the average anti- AngioXVIII titer at day 14 were 152, 100, 330 and 155 for mice which had been immunized with AP205 VLPs and Qβ VLPs coupled to AngioXVIII-peptide via SMPH and Sulfo-KMXJS, respectively. Except for one group of mice, the titer in these animals could be boosted by a second immunization at day 14 with the corresponding VLPs coupled to the AngioXVIII-peptide either via SMPH or Sulfo-KMXJS to an average anti- AngioXVIII titer at day 21 of 5033 and 7812 for φCb5 K21 G74C - S75C VLPs, of 5057 and 3488 for φCb5 R21 VLPs, of 6472 and 10523 for φCb5 K21 VLPs, and in comparison of 6238 and 100 for AP205 VLPs and of 3433 and 1051 for Qβ VLPs, respectively. The exception was observed in mice immunized twice (at day 0 and day 14) with AP205 VLPs coupled via Sulfo-KMIJS to AngioXVIII peptide. The titer was not boostable by the second immunization at stayed at background level of 100. In contrast, the anti-VLP titers were boostable in all cases at day 21 by a second immunization with the corresponding VLP-AngioXVIII conjugate (see Table 3). There were no pre-existing anti-AngioXVIII nor VLP-specific antibodies detectable in pre-immune sera of non-immunized animals (data not shown). Neither φCb5-specific antibodies did show cross-reactivity with other RNA bacteriophages as shown by the Qβ-specific and AP205- specific ELISA nor did Qβ-specific and AP205 specific antibodies cross-react with φCb5 VLPs (see Table 3).

Table 3: Antibody titers in mice vaccinated against VLP-AngioXVIII conjugates

EXAMPLE 5 A. Coupling of mouse IL17A protein to φCb5 VLP

[00166] Coupling of murine IL17A protein (SEQ ID NO: 17) to φCb5 R21 coat protein (SEQ ID NO:3) was performed. The mIL-17 protein was covalently conjugated to φCb5 by a two- step procedure. First, φCb5 VLPs (2 mg/ml in 5OmM NaH₂PO₄, 10% glycerol, pH 7.4) were reacted at RT for 30 min with an equimolar amount of the heterobifunctional chemical cross- linker, succinimidyl-6-(β-maleimidopropionamido) hexanoate. Unreacted cross-linker was removed by gel filtration with a PD-10 desalting column using the same buffer (5OmM NaH₂PO₄, 10% glycerol, pH 7.4). Prior to the conjugation step, purified mIL-17 protein was incubated for 1 h at room temperature with a 10-fold excess of tri(2-carboxyethyl)phosphine hydrochloride (TCEP-HCl) to reduce any cysteine residues in the linker. Then mIL-17 protein was covalently linked to the derivatized VLPs by reacting equimolar amounts of mIL-17 protein and VLP for 4 h at RT. The vaccine was analyzed by SDS-PAGE followed by Coomassie- staining and immunblotting with anti-His antibodies. The intensities of Coomassie blue-stained bands corresponding to the various components of the coupling reaction are determined by densitometry and are used to calculate coupling efficiency. Monomeric, derivatized φCb5 migrated as a discrete 14 kDa band while the φCb5-mIL-17 conjugate migrated at 31 kDa (14 kDa φCb5 monomer + 17 kDa mIL-17 protein). The analysis by SDS- PAGE and Coomassie-staining visualized several bands of increased molecular weight with respect to the φCb5 coat protein indicating the successful cross-linking of the IL- 17 protein to the φCb5 VLP. Coupling efficiency was defined as the molar ratio of φCb5 monomers coupled to mIL-17 (31 kDa band) to total φCb5 monomers (sum of 14 and 31 kDa bands). Coupling efficiency was determined to be at least 15.3% equaling one molecule mIL-17 per 6.5 molecules φCb5. The coupling efficiency calculated in this way is a minimum estimate of the degree of coupling, because it does not take into account φCb5 monomers coupled to more than one mIL-17 molecule. Thus, proteins of interest such as IL- 17A can be efficiently coupled to φCb5 VLPs.

B. Immunization of mice with mouse IL17A protein coupled to φCb5 VLP

[00167] Nine female SJL mice were immunized with φCb5 coat protein coupled to mouse IL17A protein and ten female SJL mice with φCb5 coat protein alone. Fifty μg of total protein were diluted in PBS, pH 7.4 to 200 μl and injected subcutaneously (100 μl on two ventral sides) on day 0, day 14 and day 28. Mice were bled retro-orbitally on day 35 and sera were analyzed using mouse IL17A-specific ELISA.

C. ELISA

[00168] ELISA plates were coated with mouse IL17A, human IL-17A or φCb5 protein at a concentration of 1 μg/ml. The plates were blocked and then incubated with serially diluted mouse sera from day 0, 28, 35 and 62. Bound antibodies were detected with enzymatically labeled anti-mouse IgG antibody. Antibody titers of mouse sera were calculated as the average of those dilutions which led to half maximal optical density at 450 nm. Average antibody titers against mIL-17 and φCb5 were measured on day 35 as well as murine and human IL- 17 on day 62 in the mice immunized with φCb5 coat protein coupled to mouse IL 17A protein. Table 4: The average anti-murine IL- 17 A, anti- human IL- 17A and anti-φCb5 titers on day 35 of mice immunized as described. Values are given as average ± SEM.

[00169] Antibody titers against mIL-17 remained were not detected (n.d.) in the mice immunized with φCb5 coat protein alone. Antibody titers against human IL17A were low in sera of mice immunized with murine IL-17-φCb5. This demonstrates that immunization with φCb5 coupled to the mouse IL- 17 protein is inducing the production of antibodies which are highly specific for the target antigen murine IL- 17A.

D. Detection of neutralizing antibodies

[00170] Sera of mice immunized with mouse IL17 coupled to φCb5 as described above were then tested for their ability to inhibit the binding of mouse IL17A protein to IL- 17 receptor. ELISA plates were therefore coated with mouse IL- 17 receptor A protein at a concentration of 1 μg/ml. Serial dilutions of mouse sera from day 35 mouse were pre-incubated with 10 ng/ml biotinylated mouse IL- 17A for one hour and then added to the IL- 17 receptor A coated plates. Binding of IL 17 to the coated receptor was detected with horse radish peroxidase conjugated to streptavidin. Neutralizing antibody titers were calculated as the average of those serum dilutions which led to half maximal optical density at 450 nm.

Table 5: Average neutralizing antibody titers for murine IL- 17A on day 35 in sera of mice immunized as described. Values are given as average ± SEM.

All sera from mice immunized with φCb5-mIL-17A but not with φCb5 alone inhibited specifically the binding of mouse ILl 7A protein to its receptor IL-17RA. These data demonstrate that immunization with mouse IL 17 coupled to φCb5 VLP is able to yield antibodies which are able to specifically neutralize the interaction of mouse IL- 17A protein with its receptor.

E. Efficacy of φCb5-mIL17A by Amelioration of experimental autoimmune encephalitis in a mouse model for multiple sclerosis

[00171] Female SJL mice were immunized as described above and were injected subcutaneously with 100 μg PLP peptide (SEQ ID NO: 15) mixed with complete Freund's adjuvant one week after the last immunization. On the same day all mice were injected intraperitoneally with 400 ng of pertussis toxin. Mice were scored on a daily basis for development of neurological symptoms according to the following scheme: 0, no clinical disease; 0.5, end of tail limp; 1, tail completely limp; 1.5, limp tail and hind limb weakness (unsteady gait and poor grip of hind legs); 2, unilateral partial hind limb paralysis; 2.5, bilateral partial hind limb paralysis; 3, complete bilateral hind limb paralysis; 3.5, complete bilateral hind limb paralysis and unilateral front limb paralysis; 4, total paralysis of hind and front limbs. The average clinical scores were assessed for mice which were immunized with φCb5-mIL17A and φCb5 as described above. These data are depicted in Figure 1. One mouse in the control φCb5 -immunized group was sick and had to be sacrificed on day 52 without showing any prior EAE-related symptoms. This was considered as a non-experiment related death and excluded from the analysis. φCb5-mIL 17 A- immunized mice showed significantly reduced clinical symptoms between days 53 and 61 compared to φCb5 -immunized mice. This demonstrates that the anti-IL-17 antibodies generated by immunization with φCb5-mIL17A are able to improve the clinical symptoms in a mouse model of multiple sclerosis.

EXAMPLE 6 A. Coupling of murine TNFα (4-23) peptide to φCb5 coat protein

[00172] Coupling of TNFα (4-23) peptide (SEQ ID NO: 16) to either φCb5 K21 G74C - S75C coat protein, φCb5 K21 coat protein or φCb5 R21 coat protein is essentially performed in the same way. Before φCb5 K21 G74C - S75C VLPs are used for derivatization and coupling purposes, disulfide-bond formation between the cysteine residues at aa-position 74 and aa- position 75 of the mature φCb5 K21 G74C - S75C coat protein is induced by oxidation as described in Example 4 B. A solution of 3 ml of 3 mg/ml φCb5 coat protein in 20 mM HEPES, pH 7.4 is incubated for 60 min at room temperature with 99.2 μl of a SMPH solution (65 mM in DMSO). The reaction solution is dialyzed at 4 ⁰C against two 3 1 changes of 20 mM HEPES, pH 7.4 for 4 h and 14 h, respectively. Sixty-nine μl of the derivatized and dialyzed φCb5 solution is mixed with 265.5 μl 20 mM HEPES pH 7.4 and 7.5 μl of mTNFα (4-23) peptide (23.6 mg/ml in DMSO) and incubated for 2 h at 15 ⁰C for chemical cross-linking. Uncoupled peptide is removed by 2 x 2 h dialysis at 4 ⁰C against 20 mM HEPES, pH 7.4. Coupled products are analyzed on a 12 % SDS-polyacrylamide gel under reducing conditions. It is expected that the analysis by SDS-PAGE and Coomassie-staining will visualize several bands of increased molecular weight with respect to the φCb5 coat protein. This will clearly demonstrating the successful cross-linking of the mTNFα (4-23) peptide to the φCb5 VLP.

B. Immunization of mice with mTNFα (4-23) peptide coupled to φCb5 coat protein

[00173] Four female Balb/c mice are immunized with φCb5 coat protein coupled to the mTNFα (4-23) peptide. Twenty-five μg of total protein is diluted in PBS to 200 μl and injected subcutaneously (100 μl on two ventral sides) on day 0, day 16 and day 23. Two mice receive the vaccine without the addition of any adjuvant while the other two receive the vaccine in the presence of Alum. Mice are bled retroorbitally on days 0 and 32. Sera are analyzed using mouse TNFα- and human TNFα-specifϊc ELISA.

C. ELISA

[00174] ELISA plates are coated either with mouse TNFα protein or human TNFα protein at a concentration of 1 μg/ml. The plates are blocked and then incubated with serially diluted mouse sera from day 32. Bound antibodies are detected with enzymatically labeled anti- mouse IgG antibody. Antibody titers of mouse sera are calculated as the average of those dilutions which are leading to half maximal optical density at 450 nm. It is expected that the average anti-mouse TNFα titers for mice which are immunized in the absence of adjuvant and for mice which are immunized in the presence of Alum will be comparable. Furthermore it is expected, that measurement of anti-human TNFα titers in the same sera will result in similar values. These data will demonstrate that immunization with mTNFα (4-23) peptide coupled to φCb5 yields antibodies, which recognize mouse and human TNFα protein equally well.

D. Detection of neutralizing antibodies

[00175] To test whether the antibodies generated in mice have neutralizing activity, in vitro binding assays for both mouse and human TNFα and their cognate receptors, namely mouse TNFRI and human TNFRI, are established. ELISA plates are therefore coated with 10 μg/ml of either mouse or human TNFα protein and are incubated with serial dilutions of a recombinant mouse TNFRI-hFc fusion protein or a recombinant human TNFRI-hFc fusion protein, respectively. Bound protein is detected with a horse raddish peroxidase conjugated anti-hFc antibody. It is expected, that both TNFRI/hFc fusion proteins are found to bind with a high affinity to their respective ligands. Sera of mice immunized with mTNFα(4-23) coupled to φCb5 VLP are then tested for their ability to inhibit the binding of mouse and human TNFα protein to their respective receptors. ELISA plates are therefore coated with either mouse or human TNFα protein at a concentration of 10 μg/ml, and are co-incubated with serial dilutions of mouse sera from day 32 and 0.25 nM mouse or human TNFRI-hFc fusion protein, respectively. Binding of receptor to immobilized TNFα protein is detected with horse raddish peroxidase conjugated anti-hFc antibody. It is expected that all sera with high titers of anti-mouse TNFα antibodies will inhibit specifically the binding of mouse TNFα protein to its receptor. Furthermore it is expected that the same sera recognizing also human TNFα protein will also inhibit the binding of human TNFα protein to its cognate receptor with a similar efficacy. These data will demonstrate that immunization with mTNFα (4-23) peptide coupled to φCb5 VLP can yield antibodies which are able to neutralize the interactions of both mouse and human TNFα protein with their cognate receptors.

E. Efficacy of φCb5-mTNFα (4-23) in collagen-induced arthritis model

[00176] The efficacy of φCb5-mTNFα (4-23) immunization is tested in the murine collagen- induced arthritis (CIA) model. This model is reflecting most of the immunological and histological aspects of human rheumatoid arthritis and can therefore be routinely used to assay the efficacy of anti-inflammatory agents. Male DBA/1 mice are immunized subcutaneously three times (days 0, 14 and 28) with 50 μg of either φCb5-mTNFα (4-23) (n=15) or φCb5 alone (n=15), and are then injected twice intradermally (days 34 and 55) with 200 μg bovine type II collagen mixed with complete Freund's adjuvant. After the second collagen/CFA injection mice are examined on a regular basis and a clinical score ranging from 0 to 3 is assigned to each limb according to the degree of reddening and swelling, which is observed. It is expected that three weeks after the second collagen/CFA injection the average clinical score per limb will be still very low in the group which is immunized with φCb5-mTNFα(4-23), and significant higher in the group which is immunized with φCb5 alone. Moreover it is expected, that the majority of the mice receiving φCb5-mTNFα(4-23) will show no symptoms at all throughout the course of the experiment, as compared to only the minority of the mice receiving φCb5. We conclude that immunization with φCb5- mTNFα (4-23) will protect mice from clinical signs of arthritis in the CIA model.

EXAMPLE 7 A. Coupling of M2 peptide to Cb5 virus-like particles

[00177] A solution of 2 ml of 1 mg/ml Cb5 coat protein (SEQ ID NO:3) in PBS / 10 % glycerol pH 7.2 was reacted for 60 min at room temperature with 42.6 μl of a SMPH solution (50 mM in DMSO). The reaction solution was dialysed at 4 ⁰C against two 2 1 changes of 20 mM HEPES/10 % glycerol pH 7.2 over 12 and 4 hours. 0.6 ml of the derivatized and dialyzed Cb5 solution was mixed with 21.45 μl of a 10 mM DMSO solution of the influenza peptide M2 (SEQ ID NO:30) and incubated 4 h at room temperature for chemical crosslinking resulting in Cb5-M2 conjugate vaccine. Uncoupled peptide was removed by dialysis 2 x 2 1 against 20 mM HEPES / 10 % glycerol pH 7.2 for 12 h and 4 h, respectively. The coupled product was analyzed on a 12 % Bis-Tris-polyacrylamide gel under reducing conditions. Several bands of increased molecular weight with respect to the Cb5 capsid monomer were visible, clearly demonstrating the successful cross-linking of the influenza M2 peptide to the Cb5 capsid.

B. Immunization of mice with M2 peptide coupled to Cb5 capsids (Cb5-M2)

[00178] Four female Balb/c mice per group were immunized with 40 μg of Cb5-M2 vaccine formulated in 200 μl PBS and injected subcutaneously on day 0 and day 20. Mice were bled retroorbitally on day 34 and sera were analyzed using M2-specifϊc and Cb5-specifϊc ELISA.

C. Detection of anti-M2 antibodies by ELISA

[00179] ELISA plates were coated with M2 peptide (SEQ ID NO:30) at a concentration of 10 μg/ml or with Cb5 virus-like particles at a concentration of 10 μg/ml. The plates were blocked and then incubated with serially diluted mouse sera. Bound antibodies were detected with enzymatically labeled anti-mouse IgG antibodies. Antibody titers of mouse sera are defined as the reciprocals of the dilutions leading to 50 % of the OD measured at saturation (OD50). The average anti-M2 antibody titers and anti-Cb5 titers at day 34 of mice which were immunized as described and subsequently challenged with 4xLD50 of influenza virus A/PR/8/34 (HlNl) are shown in Table 6. The data demonstrate that coupling of M2 peptide to Cb5 capsids is strongly enhancing the immunogenicity of the M2 peptide as the M2 peptide alone is not immunogenic.

Table 6: Aerage anti-M2 antibody titers and anti-Cb5 titers at day 34.

E. Efficacy of Cb5-M2 in a mouse model of lethal influenza infection

[00180] The efficacy of Cb5-M2 immunization was tested in a murine model of influenza infection. Mice were challenged with a lethal dose of 4xLD50 of mouse adapted influenza A/PR/8/34 virus. The virus was diluted in PBS and administered (2 x 50 μl) via the nose under light anaesthesia with isofuran. Mice, which lost more than 30 % body weight or which showed a body temperature equal to or lower than 30 ⁰C, were euthanized. The survival of the mice in both groups is shown in Table 7. The result demonstrates that immunization of mice with M2 peptide coupled to Cb5 induces M2 specific antibodies which protect mice against a lethal infection with influenza A/PR/8/34 virus.

Table 7: Survival of mice immunized as described above and challenged with 4xLD50 of mouse adapted influenza virus A/PR/8/34 at day 41.

EXAMPLE 8 A. Coupling of Nicotine to φCb5 VLP

[00181] Coupling of nicotine to either φCb5 K21 G74C - S75C coat protein, φCb5 K21 coat protein or φCb5 R21 coat protein is essentially performed in the same way. Before φCb5 K21 G74C - S75C VLPs are used for derivatization and coupling purposes, disulfide-bond formation between the cysteine residues at aa-position 74 and aa-position 75 of the mature φCb5 K21 G74C - S75C coat protein is induced by oxidation as described in Example 4 B. A nicotine derivate suitable for coupling to VLPs is synthesized according to Langone and Van Vunakis (1982, Methods Enzymol, 84, 628-640). Trans-4'-carboxycotinine is available from commercial sources. The methylester of trans-4'-carboxycotinine is produced by reacting trans-4'-carboxycotinine with methanolic sulfuric acid. The solution is neutralized with sodium bicarbonate, extracted with chloroform, concentrated on a rotary evaporator and recrystallized from ether-acetone. Reduction of the methyl ester with lithium aluminium hydride in ether then produces trans-3 '-hydro xymethylnicotine. The O'-succinyl- hydroxymethylnicotine is then produced by the addition of succinic anhydride in benzene. The solution is concentrated on a rotary evaporator. Activation of the carboxyl group is subsequently achieved by addition of EDC (l-Ethyl-3-(3-dimethylaminopropyl)- carbodiimide) and N-hydroxysuccinimide (NHS) resulting in the N-hydroxysuccinimide ester of O '-succinyl- hydro xymethylnicotine (in the following abbreviated as "Suc-Nic"). The nicotine derivative Suc-Nic is dissolved in 20 mM HEPES, pH 8.0 at a concentration of 121 mM. It is added to a φCb5 VLP solution (0.14 mM) at 1 x, 5 x, 50 x, 100 x and 500 x molar excess and is incubated at room temperature for 2 h on a shaker. The reaction solution is then dialyzed against 20 mM HEPES, pH 7.4, (cut off 10'0OO Da), flash-frozen in liquid nitrogen and stored at -80 ⁰C. The nicotine derivative suc-nic reacts with lysine on the surface of φCb5 under formation of an amid bond. The resulting covalent conjugate is termed herein "Nic- φCb5". The dialyzed reactions are analyzed by SDS-PAGE. It is expected that with increasing molar excess of Suc-Nic a shift of the φCb5 monomer band to higher molecular weights will be apparent. The presence of nicotine in the coupling product is confirmed by a western blot using an anti-nicotine antiserum. It is expected that uncoupled φCb5 control and φCb5 coupled to nicotine at a 1 x and 5 x excess will not show anti-nicotine reactive bands while the bands at 50 x, 100 x and 500 x will clearly demonstrate covalent coupling of nicotine to φCb5. This is confirmed by an ELISA with nicotine-BSA coated on the wells and detection with an anti-nicotine antiserum. It is expected that a higher absorbance will be reached when φCb5 coupled with 500 fold excess nicotine is used and compared to a vaccine produced with an 50 fold excess. B. Immunization of Mice with Nic-CbS and Measurement of Anti-nicotine Antibody

Titers

[00182] 10 week-old female Balb/c mice are vaccinated twice with 30 μg of the nicotine- φCb5 (Nic-Cb5) resulting from the coupling using 50Ox excess of Suc-Nic. The vaccine is diluted in 20 mM HEPES, pH 7.4 and is given intranasally or injected subcutaneously with or without the addition of Alum (Imject, Pierce). 14 days after the first immunization the mice are boosted (Table 8). On day 29 the nicotine-specific antibody titers in serum are determined by ELISA.

Table 8: Immunization scheme of mice.

C. ELISA

[00183] Sera are analyzed in a nicotine-specific ELISA: Microtiter plates (Maxisorp, Nunc) are coated overnight with 5 μg/ml nicotine coupled to BSA (NAB03) in coating buffer (pH 9.6). After washing and blocking with 2 % BSA in PBS, sera are added at different dilutions in 2 % BSA / 1 % FCS in PBS. After 2 h incubation at room temperature the plates are washed (0.05 % Tween 20 / PBS) and HRPO-labeled antibodies specific for mouse antibody subclasses are added. After 1 h incubation the plates are washed and the color substrate OPD in citric acid buffer is added. After 5 min the color reaction is stopped with 5 % H₂SO₄. Optical densities at 450 nm are read in an ELISA Reader (Benchmark, Becton Dickinson). For the detection of IgE, sera are pre-incubated in Eppendorf tubes with Protein G beads (Pierce) for 30 min on a shaker before adding to the ELISA plate. It is expected that the Nic- Cb5 vaccine will induce high titers of nicotine-specific IgG antibodies. The ELISA titers are calculated for the total IgG response. The ELISA titers are defined as the dilution of the serum which gives a half-maximal optical density signal (OD 50 %) in the ELISA.

E. Evaluation of Nicotine Distribution in Plasma and Brain in Rats

Groups of rats are immunized with the nicotine-Cb5 vaccine, boosted at day 21. One group receives a second boost at day 35. Seven to 10 days after the last boost rats are anesthetized and catheters are placed in the femoral artery and vein for sampling and the jugular vein of the other leg for nicotine administration. Nicotine 0.03 mg/kg containing 3 microCi ³H-nicotine is infused in 1 ml/kg 0.9 % saline via the jugular vein over 10 s. The radiolabel is added to permit estimation of nicotine concentrations from very small volumes of blood. This becomes possible because metabolism of nicotine to cotinine over the first 90 s after nicotine administration in rats is negligible. Blood (0.3 ml) is removed from both the femoral artery and vein catheers every 15 s up to 90 s, centrifuged immediately and serum separated for assay. Rats are killed at 3 min by decapitation, the brain is removed quickly, rinsed with water and stored at -20 ⁰C until assayed. For measurement of ³H-nicotine concentration in serum, 100 μl serum is mixed with liquid scintillation fluid. Brain samples are digested in 5 volumes NaOH prior to extraction and are analyzed after addition of scintillation fluid. It is expected that nicotine-specific antibodies induced by the vaccination will be capable of binding H- nicotine in serum and will inhibit or lower its diffusion into the brain. Accordingly it is expected, that a decreased concentration of brain nicotine and an increased concentration of plasma nicotine will be measured.

F. Synthesis of Multi-hapten Vaccine Suitable for Treatment of Nicotine Addiction

[00184] A vaccine against nicotine addiction designed to target multiple epitopes of nicotine and also the pharmaceutically active metabolites cotinine and nornicotine is prepared. Individual 120 mM solutions in 20 mM HEPES, pH 8.0 of 6-(carboxymethylureido)-(±)- nicotine (CMUNic), trans-3' -amino methylnico tine succinate, O-succinyl-3 '-hydro xymethyl- nicotine, Trans-4'-carboxycotinine, N-[l-oxo-6-[(25)-2-(3-pyridyl)-l-pyrrolidinyl] hexyl]-β- alanine, 4-oxo-4-[[6-[(5S)-2-oxo-5-(3-pyridinyl)-l-pyrrolidinyl]]hexyl] amino] -butanoic acid, (2S)-2-(3-pyridinyl)-l-pyrrolidinebutanoic acid phenylmethyl ester, (2R)-2-(3-pyridinyl)-l- pyrrolidinebutanoic acid phenylmethyl ester, Cotinine 4'-carboxylic acid, N-succinyl-6- amino-(±)-nicotine; 6-(σ-aminocapramido)-(±)-nicotine- and 6-(σ-aminocapramido)-(±)- nico tine-conjugates; succinylated 3 ',4', and 5' amino methylnico tine, 5 and 6 amino nicotine and 3 ',4', and 5' acetyl derivatives of acetyl nicotine. The solutions are mixed with EDC and NHS to form activated forms which are added, in separate reactions, at 10-100 molar excess to φCb5 VLPs. Individual solutions of S-l-(β-aminoethyl) nicotinium chloride dihydro chloride and S-l-(β-aminoethyl) cotinium chloride hydrochloride solutions are coupled to φCb5 VLP with l-cyclohexyl-3-(2-morpholinoethyl)-carbodiimide metho-p- toluenesulfonate. From this selection of conjugates, eight of the nicotine hapten φCb5 VLP conjugates, a cotinine φCb5 VLP conjugate and a nornicotine conjugate φCb5 VLP are then admixed to form a vaccine composition, which is used to vaccinate individuals. After 2 doses, individuals are then boosted 3 times with parallel haptens coupled to Qβ VLP conjugates.

EXAMPLE 9

Packaging of Nucleic Acids into φCb5 VLPs A. Purification of dissassembled and dimeric φCb5 coat protein

[00185] The two constructs pET22b(+)_Cb5R21 and pET22b(+)_Cb5K21 were used to retransform BL-AI cells (Invitrogen) and heterologous protein expression was essentially performed according to the recommendations of the manufacturer (Invitrogen) and as described in Example 2. Purification of either φCb5 K21 coat protein or φCb5 R21 coat protein is essentially performed in the same way. Bacterial host cells were lysed in 6 ml 20 mM TrisHCl, pH 8.0 per 1 g cellular wet weight by sonication on ice and lysate was cleared by centrifugation for 30 min, at 15O00 x g. The supernatant was loaded onto a pre-packed HiPrep™ Q XL column (16/10, GE Healthcare) and bound molecules were eluted with a linear gradient (buffer A: 20 mM TrisHCl, pH 8.0; buffer B: 20 mM TrisHCl, 1 M NaCl, pH 8.0) at a flow rate of 4 ml/min and a length of 30 minutes. Dimers of φCb5 coat protein eluted in a first protein peak at around 250 mM NaCl. The RNA which got associated with φCb5 coat protein during the recombinant protein expression in E. coli cells started to elute only at 800 mM NaCl in a separate peak. Fractions containing dimeric φCb5 coat protein only were pooled and concentrated for further purification by size exclusion chromatography (SEC). The concentrated protein solution containing dimeric φCb5 coat protein was loaded onto a Superdex™ 200 GL column (10/300, GE Healthcare) which had been equlibrated with buffer C (20 mM TrisHCl, 250 mM NaCl, pH 8.0). The run was performed in buffer C with a flow rate of 0.5 ml/min and dimeric φCb5 coat protein eluted at around 17 ml. Note that intact VLPs would elute in the void volume at around 10 ml. Peak fractions containing pure and dimeric φCb5 coat protein were pooled and concentrated to around 5 mg/ml. Total salt- concentration was adjusted to 300 mM NaCl.

B. Reassembly of dimeric φCb5 coat protein in the presence of nucleic acid

[00186] Reassembly is performed either in the presence of E. coli total tRNA (Roche) or with the nucleic acid sequences of SEQ ID NO:24. φCb5 dimers (5 mg/ml in 20 mM TrisHCl, 300 mM NaCl) were either incubated with (i) H₂O only, (ii) H₂O and CaCl₂, (iii) E. coli tRNA only, (iv) E.coli tRNA and CaCl₂, or (v) GlO oligonucleotide (SEQ ID NO:24) and CaCl₂. Reactions were buffered with 20 mM Tris HCl, pH 8.0 and 10 % glycerol. NaCl concentration was finally 30 mM and CaCl₂ was adjusted to 5 mM in those reactions where indicated. Final concentration of φCb5 dimers was 0.5 mg/ml, of E. coli tRNA 0.5 mg/ml and of GlO oligonucleotide 0.1 mg/ml, per indicated reaction. Reactions were incubated for 1 hr and reassembly was analyzed by (i) 1 % agarose gel in 40 mM Tris-acetate buffer, pH 8.0 (l x TA, for details see also Example 3); (ii) by SEC (see section A above); and (iii) particle stability measurements (see Example 3). Analysis by 1 % agarose-gel electrophoresis revealed that (i) a portion of the used nucleic acid co-migrated with the coat protein (in the reactions where φCb5 coat protein dimers were mixed with nucleic acid) and (ii) that reassembled particles co-migrated with wtf-VLPs. This shows that VLPs reassemble when φCb5 coat protein dimers are mixed with nucleic acid. The presence of Ca²⁺ facilitated the reassembly reaction. Also, analysis by SEC showed that φCb5 coat protein dimers could not be detected any longer in those reactions were nucleic acids were present; instead the protein co-eluted in a peak together with the tRNA at around 11 ml. Finally, stability measurements showed that reassembled VLPs are as stable as wtf-VLPs.

Claims

1. A virus-like particle, wherein said virus-like particle comprises, essentially consists of, or alternatively consists of, at least one φCb5 polypeptide comprising or preferably consisting of:

(i) an amino acid sequence of a coat protein of bacteriophage φCb5, or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %.

2. The virus-like particle of claim 1, wherein said amino acid sequence of a coat protein of bacteriophage φCb5 is SEQ ID NO:3 or SEQ ID NO:6, and wherein preferably said amino acid sequence of a coat protein of bacteriophage φCb5 is SEQ ID NO:3.

3. The virus-like particle of any one of the preceding claims, wherein said φCb5 polypeptide comprises or preferably consist of an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence encoded by the cDNA of SEQ ID NO: 1 ;

(b) SEQ ID NO:2;

(c) SEQ ID NO:3;

(d) the amino acid sequence encoded by the cDNA of SEQ ID NO:4;

(e) SEQ ID NO:5; and

(f) SEQ ID NO:6.

4. The virus-like particle of any one of claims 1 to 3, wherein said at least one φCb5 polypeptide comprises or preferably consists of said mutated amino acid sequence, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, and wherein preferably these differences are selected from (i) insertion, (ii) deletion, (iii) amino acid exchange, and (iv) any combination of (i) to (iii).

5. The virus-like particle of claim 4, wherein said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, and wherein each of these differences is an amino acid exchange, and wherein preferably said amino acid exchange is an exchange of an amino acid residue of said amino acid sequence to be mutated by a lysine residue or by a cysteine residue.

6. The virus-like particle of any one of the preceding claims, wherein said φCb5 polypeptide comprises or preferably consists of any one of SEQ ID NOs 7 to 10, and wherein preferably said φCb5 polypeptide comprises or still more preferably consists of SEQ ID NO:8.

7. The virus-like particle of any one of the preceding claims, wherein said virus-like particle comprises a thermal stability (Tm) of at least 40 ⁰C, preferably of at least 45 ⁰C, wherein said thermal stability is determined in 200 mM NaCl.

8. The virus-like particle of any one of the preceding claims, wherein said virus-like particle comprises a thermal stability (Tm) of at least 50 ⁰C, preferably of at least 55 ⁰C, wherein said thermal stability is determined in 200 mM NaCl.

9. A composition comprising a virus-like particle of any one of the preceding claims.

10. The composition of claim 9, wherein said composition comprises:

(a) a virus-like particle of any one of claims 1 to 8, wherein said virus-like particle comprises at least one first attachment site; and

(b) at least one antigen, wherein said antigen comprises at least one second attachment site; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site.

11. The composition of claim 10, wherein said first attachment site and said second attachment site are linked via at least one covalent bond, wherein preferably said covalent bond is a non-peptide bond.

12. The composition of any of claims 10 or 11, wherein said first attachment site is an amino group, preferably an amino group of a lysine residue.

13. The composition of any of claims 10 to 12, wherein said second attachment site is a sulfhydryl group, preferably a sulfhydryl group of a cysteine residue.

14. The composition of any of claims 10 to 13, wherein said first attachment site is not a sulfhydryl group.

15. The composition of any of claims 10 to 14, wherein only one of said second attachment sites associates with said first attachment site through at least one non-peptide covalent bond leading to a single and uniform type of binding of said antigen to said virus-like particle, wherein said only one second attachment site that associates with said first attachment site is a sulfhydryl group, and wherein said antigen and said virus-like particle interact through said association to form an ordered and repetitive antigen array.

16. The composition of any one of claims 10 to 15 further comprising a linker, wherein said linker associates said antigen with said second attachment site, and wherein preferably said linker comprises or alternatively consists of said second attachment site.

17. The composition of any one of claims 9 to 16, further comprising at least one immunostimulatory substance, wherein preferably said immuno stimulatory substance is bound to, mixed with or packaged into said virus-like, and wherein preferably said immunostimulatory substance is packaged into said virus-like particle.

18. The composition of claim 17, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.

19. The composition of claim 18, wherein said unmethylated CpG-containing oligonucleotide comprises a palindromic sequence, and wherein preferably the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, and wherein further preferably said palindromic sequence is GACGATCGTC (SEQ ID NO: 19).

20. The composition of claim 19, wherein said palindromic sequence is flanked at its 5'- terminus by at least 3 and at most 15 guanosine entities, and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 3 and at most 15 guanosine entities.

21. The composition of any one of claims 18 to 20, wherein said unmethylated CpG- containing oligonucleotide comprises or alternatively consists of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:24), and wherein preferably said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides.

22. The composition of any of claims 10 to 21, wherein said antigen is a tumor antigen, a self antigen, a polypeptide of a pathogen, an allergen or a hapten.

23. The composition of any one of claims 10 to 21 , wherein said antigen is IL- 17.

24. The composition of any of claims 10 to 21, wherein said antigen is the extracellular domain of Influenza A virus M2 protein, or an antigenic fragment thereof.

25. A recombinant φCb5 polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of bacteriophage φCb5, or

(ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of bacteriophage φCb5, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %.

26. The recombinant φCb5 polypeptide of claim 31, wherein said recombinant φCb5 polypeptide comprises or preferably consists of any one of SEQ ID NOs 2, 3, 5, 6, 7, 8, 9, or 10.

27. A vaccine comprising or alternatively consisting of the virus-like particle of any one of claims 1 to 8, of the composition of any one of claims 9 to 24, or of the recombinant φCb5 polypeptide of any one of claims 25 or 26, wherein preferably said vaccine further comprises an adjuvant.

28. A pharmaceutical composition comprising:

(a) the virus-like particle of any one of claims 1 to 8, the composition of any one of claims 9 to 24, the recombinant φCb5 polypeptide of any one of claims 25 or 26, or the vaccine of claim 27; and

(b) a pharmaceutically acceptable carrier, diluent and/or excipient.

29. A method of immunization comprising administering the virus-like particle of any one of claims 1 to 8, the composition of any one of claims 9 to 24, the recombinant φCb5 polypeptide of any one of claims 25 or 26, the vaccine of claim 27, or the pharmaceutical composition of claim 28 to an animal, preferably to a human.

30. A method of treating or preventing a disease, disorder or physiological condition in an animal said method comprising administering the virus-like particle of any one of claims 1 to 8, the composition of any one of claims 9 to 24, the recombinant φCb5 polypeptide of any one of claims 25 or 26, the vaccine of claim 27, or the pharmaceutical composition of claim 28 to an animal, wherein preferably said animal is a human.

31. The method of any one of claims 29 or 30, wherein said virus-like particle, said composition, said recombinant φCb5 polypeptide, said the vaccine, or said pharmaceutical composition, is administered to said animal subcutaneously, intravenously, intradermally, intranasally, orally, or transdermally.

32. The virus-like particle of any one of claims 1 to 8, the composition of any one of claims 9 to 24, the recombinant φCb5 polypeptide of any one of claims 25 or 26, the vaccine of claim 27, or the pharmaceutical composition of claim 28 for use as a medicament.

33. Use of the virus-like particle of any one of claims 1 to 8, of the composition of any one of claims 9 to 24, of the recombinant φCb5 polypeptide of any one of claims 26 or 26, of the vaccine of claim 27, or of the pharmaceutical composition of claim 28 in the manufacture of a medicament for the treatment of a disease, disorder or condition in an animal, preferably in a human.

34. The virus-like particle of any one of claims 1 to 8, the composition of any one of claims 9 to 24, the recombinant φCb5 polypeptide of any one of claims 26 or 26, the vaccine of claim 27, or the pharmaceutical composition of claim 28 for use in a method for the treatment of a disease, disorder or condition in an animal, preferably in a human.

35. The composition of claim 23 for use in a method of treating multiple sclerosis in an animal, preferably in a human.

36. The composition of claim 24 for use in a method of treating or preventing influenza A virus infection in an animal, preferably in a human.

37. A nucleic acid sequence encoding the recombinant φCb5 polypeptide of any one of claims 25 or 26.