WO2010118188A2 - Production of an intact virus in a non-host cell system using a secondary host viral construct - Google Patents

Abstract

The present invention relates to constructs and methods for the production of recombinant proteins, viruses, and viral vaccines in heterologous culture systems by expressing intact genes or viral genomes under the control of a pantropic promoter in a culture system that is not considered a host to the virus so produced. The promoter/viral genome constructs are inserted into a baculovirus and expressed in host cells that are acceptable for infection by the baculovirus.

Description

PRODUCTION OF AN INTACT VIRUS IN A NON-HOST CELL SYSTEM USING A SECONDARY HOST VIRAL CONSTRUCT

CROSS-REFERENCE TO RELATED APPLICATION

[001] This application claims priority to U.S. Provisional Application No: 61/167,658 filed in the United States Patent and Trademark Office on April 8, 2009, the contents of which are hereby incorporated by reference herein for all purposes

BACKGROUND OF THE INVENTION

Field of the Invention

[002] The present invention relates generally to an expression system, and more specifically, to the expression of recombinant proteins, viruses, and viral vaccines in heterologous culture systems by expressing intact genes or viral genomes under the control of a pantropic promoter in a culture system that is not considered a host to the virus.

Related Background Art

[003] Shrimp represents an aquaculture crop of increasing importance, particularly to countries with coastal environments within 30 degrees North and South latitude from the equator. Accompanying the expansion and intensification of this industry, there has been a growing knowledge base on viral and bacterial diseases that can affect shrimp and potentially limit productivity. Since the first report of a viral disease in early 1970s, more than 20 viruses have been reported that infect shrimp (Lightner et al., 1996) and this list is growing rapidly. The four most important viruses of penaeid shrimp are white spot syndrome virus (WSSV), yellowhead virus (YHV), Taura syndrome virus (TSV), and the infectious hypodermal and hematopoietic necrosis virus (IHHNV). All four viruses have now been sequenced (Shike et al., 2000, van Hulten et al., 2000, Yang et al., 2001, Mari et al., 2002, Sittidilokratna et al., 2008). [004] Dhar and Allnutt, recently described how a promoter, identified from one of these shrimp viruses (IHHNV), could be used in conjunction with an Internal Ribosomal Entry Site (IRES) element to create an expression vector for the transient expression of foreign genes, and for the transfection of shrimp primary cell lines with foreign genes or modifiers of endogenous genes (Dhar and Allnutt, 2004). These vectors could be used (1) to express recombinant protein(s) with therapeutic potential using shrimp, (2) to express host gene or foreign gene in excess to determine their role in growth, development, and or disease resistance using shrimp, (3) to develop a transgenic shrimp, and (4) to study the role of virally encoded protein in viral pathogenesis in vitro and in vivo in shrimp

[005] The expression of genes in heterologous systems is generally more problematic than in homologous systems, particularly if the gene source and the heterologous system are far apart phylo genetically. Issues of codon usage, specific and unique regulatory sequences, and post-translational modifications all need to be considered when using heterologous systems production systems. Thus, it would be advantageous to develop a system to express genes in a heterologous system without the shortcomings of the prior art.

SUMMARY OF THE INVENTION

[006] The instant invention is based on the discovery of the pantropic nature of a known shrimp viral promoter and its use to express an entire viral genome in a heterologous system. This discovery leads to the development of a novel approach for the production of a shrimp virus in an insect cell culture using a heterologous expression system. Specifically, the invention involves the use of the viral promoter of Infectious Hypodermal and Hematopoetic Virus (IHHNV) to drive the expression of a shrimp single stranded RNA viral genome using a baculovirus vector in insect cell lines.

[007] In one aspect the present invention relates to the discovery that the pantropic nature of a viral promoter of (IHHNV) can be used to drive the expression of an entire viral genome when inserted into a second viral genome, thereby resulting in the simultaneous production of two viruses in one cell type. [008] In another aspect, the present invention relates to the expression of a viral genome that is non-infective to the cell type where the recombinant virus is being made.

[009] In yet another aspect, the present invention relates to the expression of a gene coding for proteins that are heterologous to the production cell type itself by using the pantropic promoter described herein.

[0010] In one aspect, the present invention relates to a viral construct comprising a carrier virus and at least one viral promoter of IHHNV operably linked to at least one inclusion viral genome, gene or fragments thereof, wherein the inclusion viral genome is different from that of the carrier virus. Preferably the viral promoter of IHHNV is selected from the group consisting of P2 (SEQ ID NO.: 1), P61 (SEQ ID NO.: 12) and MID (SEQ ID NO. 13) of AF273215. Other promoter regions for P2 of IHHNV include: 61-110 of AF27315; 217-266 of AyO95351; 289-338 of X74945; 261-310 of M37899; 152-203 of AY578734; and 133-181 of NC 007218. Other promoter regions for P61 of IHHNV include: 2398-2447 of AF273215; 2399-2448 of AY095351; 2499-2548 of NC 004285; 2363-2412 of M37899; 108-152 of DQ206403; and 3359-3431 of NC 007218.

[0011] In a preferred embodiment, the viral construct is a baculo virus and the inclusion viral genome is any virus that infects crustaceans.

[0012] In yet another aspect, the present invention provides for a method to produce a functional virus in a heterologous system, the method comprising: a. preparing a full or fragment of nucleotide sequence of a virus; b. linking an IHHNV promoter sequence upstream of the 5' end of the nucleotide sequence to drive the transcription of the nucleotide sequence; c. inserting the linked sequences into a transfecting carrier virus; and d. infecting and culturing a host cell for expression therein of the transfecting carrier virus and linked sequences.

[0013] The method can include both RNA and DNA viruses and the preferably the IHHNV promoter is selected from the group consisting of P2, P61 and MID. [0014] In yet another aspect, the present inventions provides for a method of expressing recombinant proteins in a heterologous culture system, the method comprising: a. preparing a nucleotide sequence encoding the proteins, b. linking an IHHNV promoter sequence upstream of the 5' end of the nucleotide sequence encoding the proteins to drive the transcription of the nucleotide sequence and forming a linked sequence; c. inserting the linked sequence into a transfecting carrier virus; and d. infecting and culturing a host cell for expression therein of the transfecting carrier virus and proteins.

[0015] In a further aspect, the present invention provides for a host virus that has the ability to express its own genomic material and that of a second virus, wherein the second virus genes or viral genomes are under the control of a pantropic promoter of IHHNV in a culture system that is not considered a host to the second virus.

[0016] These and other aspects of the present invention will be apparent from the detailed description of the invention provided hereinafter.

BRIEF DESCRIPTIONS OF THE FIGURES

[0017] Figure 1 shows genome organization of Taura syndrome virus (TSV) and cloning strategy for the Texas 2004 isolate. Panel A is a schematic diagram of the entire TSV genome organization and a linear map of the cloning strategy used in this study to obtain a full-length sequence of the viral genome. Panel B depicts the four segments that were cloned separately and then ligated to form the full-length clone of TSV. Panel C is photographs of agarose electrophoresis gels of RT-PCR products of TSV Texas 2004 isolate for produced for the cloning of the entire genome. Ma = 100 bp ladder (Invitrogen), Lane 1 = 5' RACE amplified cDNA -250 bp representing ABN008, Lane 2 = RT-PCR amplified cDNA -550 bp representing ABN006, Lane 3 = RT-PCR amplified cDNA -7.2 kb representing ABN002, Mb = 1 kb DNA ladder (Invitrogen), and Lane 4 = RT-PCR amplified cDNA -2.6 kb representing ABN003. [0018] Figure 2 shows a vector map of a shrimp IHHNV promoter, P2 cloned in a pFastBacl backbone.

[0019] Figure 3 shows the nucleotide sequence of the IHHNV P2 promoter region (SEQ ID NO.: 1). The promoter sequence is in bold and the regions overlapping vector for infusion are underlined.

[0020] Figure 4 shows a vector map of a full-length TSV clone in a pFastbacl vector. TSV genome was cloned downstream of a shrimp infectious hypodermal and hematopoietic necrosis virus, IHHNV, promoter P2.

[0021] Figure 5 shows cloning of a shrimp IHHNV promoter, P2, downstream of a baculovirus promoter PlO in a pFastBacDual vector.

[0022] Figure 6 shows the nucleotide sequence of the IHHNV P2 promoter region (SEQ ID NO.: 2). The promoter sequence is in bold and the regions overlapping vector for infusion are underlined. Note: the sequence is listed in the minus orientation (compared to Fig. 2), as this is the orientation in the vector construct.

[0023] Figure 7 shows cloning of Taura syndrome virus (TSV) ORFl downstream of IHHNV P2 promoter in a pFastBacDual vector.

[0024] Figure 8 shows cloning of Taura syndrome virus (TSV) ORFl downstream of an IHHNV promoter P2 and TSV ORF2 downstream of a baculovirus promoter PlO in a pFastBacDual vector.

[0025] Figure 9 shows western blot analysis of Sf9 cells infected with either recombinant baculovirus containing TSV full-length genome (lane 1), TSV ORFl (lane 2), TSV ORF1/ORF2 (Lane 3) and cells only (Lane 4). The western blot was hybridized with anti-TSV-antibody.

[0026] Figure 10 shows clinical sign of TSV in shrimp injected with recombinant TSV generated in Sf9 cells via baculovirus mediated infection. Melanized lesions on the exoskeleton, a hallmark of TSV chronic phase infection, are clearly visible on the virus- injected shrimp.

[0027] Figure 11 shows the acute phase TSV infection in P. vannamei shrimp (a representative sample from Bioassay #3). The panel on the left shows H&E of P. vannamei stomach epithelium, and the panel in the right shows ISH of P. vannamei stomach epithelium. The positive signal in ISH is indicated by black blue precipitations. Cells surrounding the black blue precipitation are healthy and did not react with TSV- specific probe.

[0028] Figure 12 shows (A) An agarose gel photograph of 5'-RACE using cDNAs derived from Sf9 cells, and representative tail muscle tissue samples from shrimp (Bioassays 1, 2 and 3). The arrow indicates the cDNA amplicons. (B). A schematic diagram indicating the origin of the transcripts in recombinant TSV as determined by 5'- RACE is shown. The alphabets indicate the coordinates of each transcript compared to the nucleotide 1 in TSV genome (see Table 2).

DETAILED DESCRIPTION OF THE INVENTION

[0029] In describing the present invention, the following terminology is used in accordance with the definitions set out below.

[0030] Following long-standing patent law convention, the terms "a" and "an" mean "one or more" when used in this application, including the claims.

[0031] The term "expression," as used herein, refers to the transcription and translation of a structural gene so that a protein is synthesized.

[0032] The term "linked," as used herein, refers to functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates transcription of nucleotide sequences of the second sequence. [0033] The term "polypeptide," as used herein, refers to peptides, polypeptides and proteins, unless otherwise noted. As used herein, the terms "protein," "polypeptide" and "peptide" are used interchangeably herein when referring to a gene product.

[0034] The term "polynucleotide," as used herein, means a sequence of nucleotides connected by phosphodiester linkages. A polynucleotide of the present invention can be a deoxyribonucleic acid (DNA) molecule or ribonucleic acid (RNA) molecule. Where a polynucleotide is a DNA molecule, that molecule can be a gene or a cDNA molecule. Nucleotide bases are indicated herein by a single letter code: adenine (A), guanine (G), thymine (T), cytosine (C), inosine (I) and uracil (U). A polynucleotide of the present invention can be prepared using standard techniques well known to one of skill in the art.

[0035] The term "promoter" includes all sequences capable of driving transcription of a coding sequence in a cell, e.g., a plant cell, animal cell, bacterial cell, fungal cell, and yeast cell. Thus, promoters used in the constructs of the invention include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene or genes. For example, a promoter can be a cis-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intron sequence, which are involved in transcriptional regulation. A promoter sequence can be "operably linked to" a coding sequence when RNA polymerase which initiates transcription at the promoter will transcribe the coding sequence into RNA, as discussed further, below.

[0036] The term "viral genome" includes all the viral nucleic acid that is required to produce a fully functional infective virus. The nucleic acid of the viral genome can be single or double stranded DNA or RNA.

[0037] The term "gene," as used herein, refers broadly to any segment of DNA associated with a biological function. A gene encompasses sequences including but not limited to a coding sequence, a promoter region, a cis-regulatory sequence, a non- expressed DNA segment is a specific recognition sequence for regulatory proteins, a non-expressed DNA segment that contributes to gene expression, a DNA segment designed to have desired parameters, or combinations thereof. A gene can be obtained by a variety of methods, including cloning from a biological sample, synthesis based on known or predicted sequence information, and recombinant derivation of an existing sequence.

[0038] The term "gene expression," as used herein, refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of a deoxyribonucleic gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through "translation" of mRNA. Gene expression can be regulated at many stages in the process. "Up- regulation" or "activation" refers to regulation that increases the production of gene expression products (ie., RNA or protein), while "down-regulation" or "repression" refers to regulation that decrease production. Molecules (e.g., transcription factors) that are involved in up-regulation or down-regulation are often called "activators" and "repressors," respectively.

[0039] The term "substantial identity," as used herein means that a polynucleotide or polypeptide comprises a sequence that has at least 80% sequence identity, preferably at least 90% or more preferably at least 97%, compared to a reference sequence over a comparison window.

[0040] In addition to a promoter sequence, the expression cassette may include a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.

[0041] The vector may also typically contain a selectable marker gene by which transformed cells can be identified in culture. Usually, the marker gene will encode antibiotic resistance. These markers include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamicin. After transforming the cells, those cells having the vector will be identified by their ability to grow in a medium containing the particular antibiotic. [0042] The vectors described above can be microinjected directly into cells by use of micropipettes to mechanically transfer the recombinant DNA. The genetic material may also be transferred into the cell using polyethylene glycol. Another method of introduction of polynucleotide sequences is particle acceleration of small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface. Yet another method of introduction is fusion of protoplasts with other entities, such as, minicells, cells, lysosomes or other fusible lipid-surfaced bodies. The DNA may also be introduced into the cells by electroporation wherein electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids.

[0043] All other terms are defined in the literature using Sambrook et al. (1989) as a guide.

[0044] It is an object of the invention to provide a genetic construct for the expression of a foreign virus, in a cell, tissue or whole organism-based production system that is not normally infected by that virus.

[0045] It is a further object of the invention to provide a genetic construct for the expression of a foreign gene or genes, including but not limited to entire viral genomes, in a cell, tissue or whole organism-based production system that is heterologous to the gene or genes and is not normally infected by the resulting virus.

[0046] It is a further object of the invention to provide a method by which large quantities of an attenuated viral vaccine are produced by transfection of a cell culture system with a virus carrying the attenuated viral genome whose expression is driven by a pantropic promoter.

[0047] It is a further object of the invention to provide a method by which attenuated viral vaccine constructs are rapidly produced for screening purposes by transfection of a cell culture system with a virus carrying a number of different attenuated viral genome constructs whose expression is driven by a pantropic promoter. [0048] Therefore, the invention provides a composition for expressing foreign gene(s) or entire viral genomes in a heterologous or typically non-infective cell culture system and a method of producing large quantities of such products that include, but are not limited to, vaccines, diagnostics, and therapeutic products.

[0049] Pantropic promoter from Infectious Hypodermal and hematopoetic Virus (IHHNV) of shrimp.

[0050] IHHNV is a major viral pathogen of penaeid shrimp. IHHNV virions are icosahedral, nonenveloped, and contain a single-stranded DNA genome of 4.1 kb size. It was first detected in 1981 by Lightener and colleagues (Lightner et al., 1983). The IHHNV genome contains three large open reading frames and the genome organization has many similarities to mosquito Brevidensoviruses (Shike et al., 2000). Further analysis of this gene sequence led to the identification by the inventor of two putative promoter elements, designated P2 and P61, detected upstream of Left Open reading Frame (L-ORF) and Right Open Reading Frame (R-ORF) of the IHHNV genome (Shike et al., 2000). Both of these promoters were shown to drive the expression of firefly luciferase reporter constructs in insect cells, fish cells and in shrimp tail muscle and are therefore referred to as pantropic promoters (Dhar et al., 2007). A third promoter (Mid) of IHHNV has also been described by one of the inventors and described in SEQ ID NO.: 13.

[0051] Pantropic promoters such as, but not limited to, the P2 P61or Mid promoters of IHHNV, can be used in the practice of the instant invention. Constructs containing such promoters can be prepared by functionally linking the identified promoter region to a gene or genes, or an entire viral genome such that the expression will result in the production of functional polypeptides or virus particles. Such constructs can then be incorporated into a second vectors system, such as, baculoviruses, resulting in the production of both the recombinant vector viruses as well as the constructed virus in the host organism of the second vector system. In such a way, a modified shrimp virus such as TSV could be manufactured in large quantity in a relatively short period of time in a baculovirus-based insect cell or insect larval production system, both of which are well known in the art. [0052] Taura Syndrome Virus (TSV) of shrimp.

[0053] The TSV genome is a single-stranded RNA of positive polarity with a 3'-poly(A) tail (Bonami et al. 1997). The genome is 10,205 nucleotides (not) long with a 5' untranslated region of 377 nt and a 3' untranslated region of 226 nt (Mari et al. 2002). There are two open reading frames (ORFs) in the TSV genome. ORFl is 6324 nt long, and encodes a 2107 amino acid (aa) polyprotein with a molecular mass of 234 kDa. ORF2 is 3036 nt long and encodes a 1011 aa polypeptide with a molecular mass of 112 kDa (Mari et al. 2002, Robles-Sikisaka et al. 2001, Figure IA). There is an intergenic region of 226 nt between the two ORFs. ORFl encodes non-structural proteins (helicase, a protease and a RNA-dependent RNA polymerase, RdRp), and ORF2 encodes the virion structural proteins (Mari et al. 2002, Robles-Sikisaka et al. 2001, Figure IA). TSV virions contain three major polypeptides, designated as VPl to VP3 (55, 40, and 24 kDa), and one minor polypeptide (58 kDa), designated as VPO (Bonami et al. 1997). The N-termini of VPl to VP3 have been sequenced, and the order of these proteins in ORF2 was found to be VP2, VPl and VP3 (Mari et al., 2002).

[0054] In order to produce functional dicistrovirus in a heterologous system (e.g., TSV in insect cells) a full length DNA clone of the virus is prepared and a pantropic promoter such as, but not limited to, the P2 or P61, or Mid promoters of IHHNV, is cloned upstream of the 5' end of the sequence in a fashion that will drive the transcription of the viral genome, and the sequence is inserted into a non-coding region of a transfecting virus such as baculo virus.

[0055] Baculovirus expression system with insect cells or larval culture.

[0056] Baculoviruses represent a family of large, rod-shaped enveloped viruses with a double stranded DNA genome size of from 80-180 Kb. Baculoviruses are considered to be species-specific among invertebrates with over 600 host species described, but they are not known to infect mammalian or other vertebrate animal cells (for a review of Baculoviruses see: http://en.wikipedia.org/wiki/Baculoviridae). In the 1940's they were used widely as biopesticides and since the 1990's they have been used for producing complex eukaryotic proteins in insect culture cells (e.g., sf9) or insect larvae (e.g., lepidopteran larvae). The most widely studied baculo virus is Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV), a 134 Kb genome virus with 154 open reading frames.

[0057] Commercially available viral expression systems, such as the baculovirus systems that are well know in the art, can be employed in the practice of the instant invention. The gene(s) or natural or attenuated viral genome/pantropic promoter constructs are inserted into the baculovirus genome in such a way that following infection of the host with the baculovirus, the heterologous viral genome is transcribed in parallel to the baculovirus genome. Upon transcription, both baculovirus RNAs as well as the heterologous viral RNA, will be translated to produce corresponding viral encoded proteins. Subsequently, mature virions of baculovirus and the RNA virus will be produced. Therefore, the product of such a system will, in fact, be two intact virons (the RNA virus and the baculovirus) but only the baculovirus and not the RNA virus will be able to infect new insect cells because insect cells are not the natural host of the RNA virus. In this way, however, the quantity of the active RNA virus is also amplified by the baculovirus cycle. If the RNA virus is an attenuated viral vaccine for use in a vertebrate, including man, the two viruses need not be isolated as the baculovirus will not infect vertebrate cells and only the attenuated viral vaccine will be effective.

[0058] EXAMPLES

[0059] The invention, as contemplated herein, is a composition comprising nucleotide sequence of an intact viral genome (the product virus) and a pantropic promoter, which is inserted into the genome of a second virus (the facilitating virus), which has a different host range than the product virus. The invention also provides methods for the production of a product virus, attenuated or otherwise, in a system that is not a host to the product virus and may or may not be a host to the facilitating virus. The following examples outline the invention and are used for exemplification purposes only and are not intended to limit the scope of the invention in any way. [0060] Example 1. Production of a Full-Length Clone of a RNA Virus (Taura syndrome virus, TSV).

[0061] The cloning of the TSV (Texas 2004 isolate, UsO4Pvl) genome (Fig IA) was done in four segments (Fig IB). In order to obtain clones ABN002, ABN003, and ABN006, cDNAs were synthesized from total RNA isolated from tail muscle tissue of UsO4Pvl -infected P. vannamei using the Monster Script lst-Strand cDNA Synthesis kit (Epicenter Biotechnologies, Madison, WI, Figures IB and 1C). RT-PCR was then performed using MasterAmp Extra-Long DNA Polymerase mix (Epicenter Biotechnologies) and TSV-specific primers (Table 1). The amplified cDNAs were cloned into the TOPO XL vector (Invitrogen, Carlsbad, California). Three clones were sequenced for each of the three constructs, ABN002, ABN003, and ABN006. The 5'- end of UsO4Pvl was captured using the First Choice RLM-RACE method (Ambion, Austin, TX; now part of Applied Biosystems) in construct ABN008 (Figure IB). The RT-PCR for the 5'-RACE was performed using a 5'RACE adaptor and TSV-specific primers (222R and 253R, Table 1). Four TSV clones (ABN002, ABN003, ABN006 and ABN008) were subsequently ligated to generate a full-length TSV clone by digesting the plasmid DNA with appropriate restriction enzymes overlapping the clones and ligating the fragments Figure 1C. The ligated plasmid was used to transform EClOO cells (Epicenter, Inc.). The plasmid DNA was isolated from recombinant clones and four full- length TSV clones (#33, 34, and 44) were sequence validated. The plasmid DNA of these clones was subsequently taken for cloning the TSV genome in a baculovirus vector (see Example 2).

[0062] Table 1. List of primers used to clone the TSV Texas 2004 isolate genome.

[0063] Example 2. Construction of a Baculovirus Containing a Full-Length Clone of an RNA Virus.

[0064] The cloning of a full-length TSV genome in a baculovirus backbone (pFASTBACl, Invitrogen, Inc., Carlsbad, CA) was done in two steps. First the IHHNV P2 promoter from a luciferase reporter vector (pGL3-P2-Luc) was amplified using the primers oJR271 (5'caccatcgggcgcggatcctgcgagcgcttcgcagaaaccgt 3')(SEQ ID NO.: 14) and oJR272 (5' gcgcttcggaccgggatcctttaccaacagtaccggaatgcc 3') (SEQ ID NO.: 15). The amplified DNA was then inserted by In-Fusion PCR (Clontech, Inc., Mountain View, CA) into a pFastBacl (Invitrogen) that had been digested with BamHI to create the plasmid pJR089 (Figure 2). The nucleotide sequence of the amplified IHHNV P2 promoter region is shown in Figure 3.

[0065] In the second step, the plasmid DNA from four full-length TSV clones (see Example 1) was pooled and amplified using the primers oJR273 (5' tccgaagcgcgcggaattaaatttaaaagtcgtgcg tggcttc3')(SEQ ID NO.: 16) and oJR245 (5' gacgtaggcctttgaattaggaatccgccgctttggaggtcatc 3') (SEQ ID NO.: 17). The resulting fragment was inserted by In-Fusion into pJR089 that had been digested with EcoRI to generate pJR090 (Figure 4). A total of 144 clones were screened by PCR, three of which contained the insert and two of which were confirmed by sequencing the cloning junctions.

[0066] Example 3. Construction of a Baculovirus Containing Sub-Genomic fragments of an RNA Virus.

[0067] In order to prime TSV infection process in shrimp with the viral encoded structural and non-structural proteins, a dual-expressing construct was made to express both ORFl and ORF2 of TSV under the P2 promoter. In one case, these poly-proteins could be co-expressed with the full-length TSV genome in insect cells to reconstitute TSV. Alternatively, they could be used to prime the infection process in shrimp if viral proteins provided by the incoming virus (and not provided by the baculovirus delivering the TSV genome) were required for efficient initiation of replication.

[0068] The cloning took place in several steps. First, P2 promoter was amplified from the P2-luc construct using the primers oJR274

(5'gatcacccgggatctcgactgcgagcgcttcgcagaaaccg 3')(SEQ ID NO.: 18) and oJR275 (5' ctagcaccatggctcgaacttggaatagcctcttcactcgtc3') (SEQ ID No.: 19) and inserted by In- Fusion PCR (Clonetech, Inc.) into a pFastBacDual vector (Invitrogen) digested with Xhol to generate pJR091 (Figure 5). This step resulted in the placement of the P2 promoter downstream of the PlO baculovirus promoter in the pFastBacDual vector. The nucleotide sequence of the promoter P2 is shown in Figure 6.

[0069] Next, TSV ORFl was amplified by PCR from full-length TSV clones (see Example 1) with primers oJR276 (5'cgagccatggtgctagagactggctcatatactatggcctc 3') (SEQ ID NO.: 20) and oJR234 (5' ctatgcatcagctgctagttagtttaagtccaatagctgact 3') (SEQ ID NO.: 21) and inserted by In-Fusion PCR (Clonetech, Inc.) into pJR091 (Figure 5) that had been digested with Nhel to make pJR092 (Figure 7). A total of 48 colonies were screened by PCR and 40 positives were identified. TSV ORF2 was then added to the dual-expressing constructs under control of the polyhedrin (Pol) promoter (Figure 8). [0070] Example 4. Transfection of Insect Cells (Sf9) Using Baculovirus Construct Containing either a Full-Length genome of an RNA Virus or genomic fragment(s) of the RNA virus.

[0071] Recombinant baculovirus carrying either a full-Length genome of an RNA Virus or genomic fragment(s) of the RNA virus was generated in two steps.

[0072] Step 1. Generation of baculovirus DNA stocks.

[0073] In order to recombine the plasmids described above (see Example 3) into the full baculovirus genome, the Bac-to-Bac (Invitrogen, Inc.) system was employed. DHlOBac cells were transformed with pools of clones of each construct:

Construct # of clones pJR090-pFastBacl-P2-TSV 2 pJR092-pFastBacDual-P2-ORFl 39 pJR094-pFastBacDual-P2-ORFl/P2-ORF2 4

[0074] Recombinant (white) colonies were picked and verified by restreaking on selective media. The following number of independent colonies was picked for each:

Construct # of colonies pJR090 8 pJR092 18 pJR094 12

[0075] The colonies were used to seed broth cultures and midi-preps (Machery-Nagel) were performed to isolate baculovirus bacmid DNA to trans feet insect cells. The bacmid DNA was confirmed to contain the appropriate inserts by PCR.

[0076] Step 2. Generation of baculovirus stocks. [0077] In order to generate recombinant baculovirus particles that express the TSV constructs, recombinant bacmid DNA constructs pJR090, pJR092, and pJR094 were transfected into SF9 insect cells, using CellFectin Reagent (Invitrogen, Inc.). At 72 hours post-transfection, cell supernatants containing viral particles were collected for later amplification. Transfected Sf9 cells, at 96 hours post-transfection, were lysed and used for western blot analysis, along with viral supernatants, to evaluate expression of TSV capsid proteins. The 55 kDa TSV VPl capsid protein was detected in both cell lysates and supernatants of Sf9 cells transfected with recombinant baculovirus DNA containing the full-length TSV genome and TSV ORFl and ORF2 (Figure 10). This indicated that the TSV genome transduced via baculovirus mediated infection was transcribed and translated in Sf9 cells and the polypeptide encoding structural protein was proteolytically cleaved to make TSV capsid protein. As expected, capsid proteins were not observed in cells transfected with the TSV ORFl construct that does not encode structural proteins, and in the untransfected Sf9 cells.

[0078] Virus from transfected Sf9 cells was amplified in a 50 ml Sf9 cultures in shake flasks. Cells at 2 x 10⁶ cells/ml were infected at -0.05 MOI with the transfected cell supernatants. At 72 hours post-infection cell supernatants were collected by centrifugation. Baculovirus titers were determined by plaque assay. The amplified Sf9 cell supernatants were used to infect monolayers of Sf9 cells at dilutions of 10-6 to 10-9. Infected cells were overlayed with agar and evaluated for plaque formation at 5 days post-infection. The baculovirus titers were 5 x 10⁷ to 1 x 10⁸ pfu/ml.

[0079] Example 5. Isolation and Purification of an Active RNA Virus from the Transfected Cells of Example 4.

[0080] Baculovirus stocks were used for infection of Sf9 cells for generation of an RNA containing virus, TSV and a baculovirus. Monolayers of Sf9 cells were infected with recombinant baculovirus containing a full-length TSV genome (see Example 4). Cells were infected at an MOI of 10 and incubated 72 hours to generate viral particles. Cell supernatants were removed and cells were lysed by freeze-thaw in PBS. Virus particles were isolated from supernatants as well as from cell lysates using a sucrose density gradient centrifugation. Two viral bands were obtained. One band contained predominantly rBV, and the other band contained predominantly rTSV, as seen by transmission electron microscopy.

[0081] Example 6. Trans fection of Insect Cells Using a Baculo virus Construct Containing a Full- Length Clone of an RNA Virus and a Baculovirus Construct Containing Sub-genomic fragment of the RNA Virus of Example 4.

[0082] Baculovirus stocks were used for infection of Sf9 cells for generation of TSV and baculovirus. Monolayers of Sf9 cells were infected with two recombinant baculoviruses, one containing the full-length genome of TSV, and the other containing the two genomic fragments, ORFl and ORF2, of TSV (see Example 4).

[0083] Cells were infected at an MOI of 10 and incubated 72 hours to generate viral particles. Cell supernatants were removed and cells were lysed by freeze-thaw in PBS. Virus particles were isolated from supernatants as well as from cell lysates using a sucrose density gradient centrifugation. Two viral bands were obtained. One band contained predominantly rBV, and the other band contained predominantly rTSV, as seen by transmission electron microscopy. The total yield of TSV was more when Sf9 cells were infected with two baculoviruses (one containing the full-length genome of TSV, and the other containing the ORFl and ORF2 of TSV) compared to when Sf9 cells were infected only with a baculovirus containing the full-length genome of TSV.

[0084] Example 7. Isolation of an Active RNA Virus from the Transfected Cells of Example 5 and 6.

[0085] In order to determine the infectivity of the recombinant TSV (rTSV) generated via baculovirus mediated transfection of Sf9 cells, the purified rTSV was injected into shrimp (P. vannamei, Kona line, Oceanic Institute, HI, Bioassay #1). Shrimp injected with 2% saline solution served as a control treatment. Animals started dying on day 3 post-injection and the mortality in the virus injected groups ranged from 90 to 100% by day 7 post-injection. There was no mortality in the control treatment. [0086] Injected shrimp showed clinical signs of TSV infection such as lethargy, loss of appetite, opaque musculature, and in some cases partial molting. Moribund animals also showed reddening of the roods/ antennae and darkening of the body. Surviving animals displayed variable sized multifocal melanized lesions throughout the body (Figure 11), typical of TSV transition phase infection. None of the animals in the control group displayed any clinical similar to those injected with purified rTSV. This confirmed the infectivity of rTSV generated in Sf9 cells via baculovirus mediated transfection.

[0087] Cephalothorax from moribund and surviving animals of rTSV injected group as well as control treatment group was preserved in Davidson's solutions for histopathology using hematoxylin and eosin (H&E) staining and in situ hybridizations using TSV- specific probe following standard protocol (Bell and Lightner, 1988). Hemolymph was drawn from the moribund and surviving animals before fixation. Hemolymph (Bioassay #2) and tail muscle samples (Bioassay #3) were preserved at -80 OC to prove River's postulates and for mapping of the 5 '-end of the recombinant RNA.

[0088] Routine histological analysis of representative negative control shrimp collected upon termination of each bioassay demonstrated that they were free of TSV as well as any other known shrimp viruses. In contrast, pathodiagnostic acute, transition or chronic phase TSV lesions were detected histologically in rTSV injected shrimp from all three bioassays (#1, 2 and 3). Briefly, acutely infected shrimp were characterized by the presence of multifocal epithelial necrosis within the stomach, appendages, general body cuticle, and gills; transition phase animals were those demonstrating both acute phase lesions (epithelial necrosis) and lymphoid organ spheroids with or without cuticular melanization, and chronic phase shrimp were those only demonstrating numerous lymphoid organ spheroids. In situ hybridization using TSV-specific probe confirmed TSV infection.

[0089] In order to prove River's postulates using hemolymph as a source of TSV inoculum, hemolymph collected from moribund and surviving shrimp was diluted to 1 :2 dilution using 2% saline solution. Thirty microliter of diluted hemolymph was injected into the third tail segment of a healthy P. vannamei shrimp (Specific Pathogen Free Kona line from Oceanic Institute, Hawaii, average size 1.0-1.5 gm). Animals injected with 30 μl of 2% saline served as control.

[0090] In order to prove River's postulates using tail muscle tissue from moribund animals, the virus inoculum was prepared by homogenizing tail muscle tissue using 2% saline 1 :10 volume. The tissue homogenate was filtered using a 0.45 μm filter before injecting the inoculum into shrimp. Thirty microliter of tail tissue homogenate was injected into the third tail segment of a healthy P. vannamei shrimp. Shrimp injected with tail tissue homogenate from healthy shrimp served as a control.

[0091] After injection, animals from each treatment were maintained in 20 L aquaria. Each aquarium contained artificial seawater (25 ppt) at 27-29°C, was supplied with continuous aeration through placement of a single airstone, and kept covered to prevent both shrimp escape and possible cross-contamination by aerosols. The shrimp were acclimated for 1 -2 days prior to the onset of each bioassay. Animals were fed a pelleted ration (SI35 pellet, Ziegler Brothers) ad libitum twice per day during the entire duration of the study. A 50-70% water exchange was conducted on each tank, following siphoning of organic debris, every 3 days during the course of each bioassay. The shrimp were observed two to four times daily to remove and preserve moribund and dead shrimp.

[0092] For the River's postulate study and using hemo lymph as an inoculum, animals started dying by day 1 post-injection with a mortality reaching 71 to 100% by day 3. Using tail muscle tissue inoculum, animals started dying by day 2 post-injection with a mortality reaching 77 to 93% by day 5.

[0093] In order to map the 5 '-end of the recombinant TSV and to differentiate the rTSV from wild type TSV, 5' Rapid Amplification of cDNA End (5' RACE, Clonetech, Inc.) was performed using the cell homogenates from Sf9 that was used to purify rTSV (see Example 6), and representative samples from Bioassay #1, #2 and #3. The primers used for the 5' RACE include a forward primer from the First Choice RLM-RACE Kit (Ambion, Inc) and a TSV-specific reverse primer (222R and 253R, Table 1). One amplicon, -250 bp, was obtained when RNA from shrimp tail muscle tissue was used for the RT-PCR and two amplicons, -550 bp and -325 bp were obtained when RNA isolated from Sf9 cells were used as template (Figure 12A). The amplified cDNAs were gel-purified and cloned into a pCR2.1-TOPO vector (Invitrogen, Inc.). Plasmid DNA was isolated from recombinant clones and sequenced.

[0094] Figure 12. (A) Agarose gel photographs of 5'-RACE RT-PCR using cDNAs derived from representative tail muscle tissue samples from shrimp Bioassay #1 and Sf9 cells infected with BVTSV or BVTSV and BVORF 1/2 constructs. M = 100 bp ladder (Invitrogen), lane 1 = Outer PCR using shrimp tail muscle cDNA as template, lane 2 = Inner PCR using shrimp tail muscle cDNA as template, lane 3 = Outer PCR using cDNA derived from Sf9 cells infected with BVTSV, lane 4 = Inner PCR using cDNA derived from Sf9 cells infected with BVTSV and lane 5 = Inner PCR using cDNA derived from Sf9 cells infected with BVTSV + BVORF 1/2 constructs. (B). A schematic diagram indicating the origin of the transcripts in recombinant TSV as determined by 5'-RACE is shown. The alphabets indicate the coordinates of each transcript compared to the nucleotide position 1 in the TSV genome. Only the predominant size classes of transcripts are shown in the schematic presentation.

[0095] The sequence data revealed that when RNA was derived from baculovirus infected Sf9 cell homogenates there were two classes of transcripts that originated from promoters, Pol and P2 (Table 2). This is expected considering that both Pol and P2 promoters are functional in Sf9 cells. The transcription from Pol and P2 promoters lead to the addition of 295 (Group A, Table 2, Figure 12) and 56 (Group B, Table 2, Figure 12) extra nucleotides at the 5 '-end of the TSV transcripts, respectively.

[0096] When 5' RACE was performed using RNA derived from purified rTSV, three classes of transcripts were identified (Table 2). A total of twenty 5' RACE clones were sequenced (Table 2). The predominant class of transcript (n = 15) showed 58 nucleotides deletion at the 5 '-end of TSV genome (Group D, Table 2, Fig 12). The second size class (n = 4) contained transcripts that retained 56 extra nucleotides at the 5'- end of the viral genome ((Group B, Table 2, Fig 12). It is possible that this size class include transcript that were transcribed from the P2 promoter. There was one transcript that had 141 nucleotides deletion at the 5' end of the viral genome. (Table 2). [0097] When 5' RACE was performed using RNA derived from the tail muscle tissue samples of bioassays #1, 2 and 3, the TSV transcripts showed varying levels of deletion (5 to 155 nucleotides) at the 5 '-end of the viral genome (Table 2). A summary of the number of clones sequenced and the corresponding origin of the transcript is given in Table 2, Figure 12. Irrespective of the nature of deletions at the 5 '-end of rTSV, the virus was very virulent and caused high mortality in the injected shrimp. A schematic presentation indicating the origin of the transcripts of rTSV in Sf9 cells, in purified rTSV and in shrimp bioassay samples is shown in Figure 12B.

[0098] Table 2. A summary of number of 5'-RACE clones sequenced from Sf9 cells, and shrimp tail muscle tissues from Bioassays #1, 2 and 3. The nucleotide 1 of TSV genome in the recombinant baculo virus was considered as +1. The nucleotide position of the transcripts is marked as "+" or "-" depending on whether they originated downstream or upstream of the first nucleotide position of TSV.

REFERENCES

[0099] The contents of all reference cited herein are hereby incorporated by reference herein for all purposes.

[00100] Bell, T. A. and Lightner, D. V. 1988. A handbook of normal penaeid shrimp histology. World Aquaculture Society, Baton Rouge, LA.

[00101] Bonami, J. R., Hasson, K. W., Mari, J., Poulos, B.T. and Lightner, D. V.

1997. Taura syndrome of marine penaeid shrimp: characterization of the viral agent. J. Gen. Virol. 78: 313-319.

[00102] Christian, P., Carstens, E., Domier, L., Johnson, J., Johnson, K.,

Nakashima, N., Scotti, P. & van der WiIk, F. (2006). Index of Viruses - Dicistroviridae. In: ICTVdB - The Universal Virus Database, version 4. Bϋchen-Osmond, C. (Ed), Columbia University, New York, USA. http:/M^rww^r.ncbi.nlm.nih.gov/lCTVdb/Ictv/fs__index.htm

[00103] Dhar, A. K., and Allnutt, F. CT. 2004. Crustacean expression vector,

International publication number WO 2005/102041 A2.

[00104] Dhar, A. K., Lakshman, D. K., Natarajan, S., Allnutt, F. C. T. and van

Beek, N. A. M. 2007. Functional characterization of putative promoter elements from infectious hypodermal and hematopoietic necrosis virus (IHFINV) in shrimp and in insect and fish cell lines. Virus Res. 127: 1-8.

[00105] Kuo et al. 1989. Science 244: 362-364.

[00106] Lightner, D. V. 1996b. A handbook of shrimp pathology and diagnostic procedures for diseases for cultured penaeid shrimp. World Aquaculture Society, Baton Rouge, LA.

[00107] Lightner, D.V., R.M. Redman, and T.A. Bell. 1983. Infectious

Hypodermal and Hematopoietic Necrosis a newly recognized virus disease of penaeid shrimp. J. Inv. Pathol. 42: 62 70.

[00108] Mari, J., Poulos, B. T., Lightner, D. V. and Bonami, J. R. 2002. Shrimp

Taura syndrome virus: genomic characterization and similarity with members of the genus Cricket paralysis-like viruses. J. Gen. Virol. 83: 915-926.

[00109] Robles-Sikisaka, R., Garcia, D. K., Klimpel, K. R. and Dhar, A. K. 2001.

Nucleotide sequence of 3 '-end of the genome of Taura syndrome virus of shrimp suggests that it is related to insect picornaviruses. Arch. Virol.146: 941-952.

[00110] Sambrook J, Fritsch E, Maniatis T. 1989. Molecular Cloning: A laboratory Manual, Second Edition, Cold Spring Harbor Press, Cold Spring Harbor. [00111] Shike, H., Dhar, A. K., Burns, J. C, Shimuzu, C, Jousset, F. X., Klimpel,

K. R., and Bergoin, M. 2000. Infectious hypodermal and hematopoietic necrosis virus of shrimp is related to mosquito brevidensoviruses. Virology 277: 167-177.

[00112] Sittidilokratna, N., Dangtip, S., Cowley, J. A., Walker, P. J. 2008. RNA transcription analysis and completion of the genome sequence of yellow head nidovirus. Virus Res. 136: 157-165.

[00113] Tani, H., Limn C-K., Yap, C-C, Onishi, M., Nozaki, M., Nishimune, Y.,

Okahashi, N., Kitagawa, Y., Watanabe, R., Mochizuki, R., Moriishi, K., and Matsuura, Y. 2003. In vitro and in vivo gene delivery by recombinant baculo viruses. J. Virol. 77: 9799-9808.

[00114] van Hulten, M. C. W., Witteveldt, J., Peters S., Kloosterboer, N.,

Tarchini, R., Fiers, M., Sandbrink, S., Lankhorst, R. K., and VaIk, J. M. 2001b. The white spot syndrome virus DNA genome sequence. Virology 286: 7-22.

[00115] van Regenmortel, M. H. V., Fauquet, C. M., Bishop, D. H. L., Carstens,

E. B., Estes, M. K., Lemon, S. M., Maniloff, J., Mayo, M. A., McGeoch, D. J., Pringle, C. R., and Wickner, R. B. (2000). Virus Taxonomy: The Classification and Nomenclature of Viruses. The Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, 1167pp.

[00116] Yang, F., He, J., Lin, X., Li, Q., Pan, D., Zhang, X., and Xu, X. 2001.

Complete genome sequence of the shrimp white spot bacilliform virus. J. Virol. 75:11811-11820.

[00117] Accession numbers for TSV isolates: AF277675, AY590471, GQ502201,

DQ 104696 and AY997025.

Claims

ClaimsThat which is claimed is:

1. A viral construct comprising a carrier virus, at least one viral promoter of IHHNV operably linked to at least one inclusion viral genome, gene or fragment thereof, wherein the inclusion viral genome is different from that of the carrier virus.

2. The viral construct of claim 1, wherein the viral promoter of IHHNV is selected from the group consisting of P2, P61 and MID.

3. The viral construct of claim 1, wherein the carrier virus is a baculo virus.

4. The viral construct of claim 1, wherein the inclusion viral genome is TSV.

5. A method to produce a functional virus in a heterologous system, the method comprising: preparing a nucleotide sequence of a virus; linking a IHHNV promoter sequence upstream of the 5 ' end of the nucleotide sequence to drive the transcription of the nucleotide sequence; inserting the linked sequences into a transfecting carrier virus; and infecting and culturing a host cell for expression therein of the transfecting carrier virus and linked sequences.

6. The method of claim 5, wherein the virus is an RNA or DNA virus.

7. The method of claim 5, wherein the IHHNV promoter is selected from the group consisting of P2, P61 and MID.

8. The method of claim 5, wherein the carrier virus is a baculovirus.

9. The method of claim 1 , wherein the inclusion viral genome is TSV.

10. A host cell comprising the viral construct of claim 1.

11. A method of expressing recombinant proteins in a heterologous culture system, the method comprising: preparing a nucleotide sequence encoding the proteins, linking a IHHNV promoter sequence upstream of the 5 ' end of the nucleotide sequence encoding the proteins to drive the transcription of the nucleotide sequence and forming a linked sequence; inserting the linked sequence into a transfecting carrier virus; and infecting and culturing a host cell for expression therein of the transfecting carrier virus and proteins.

12. The method of claim 11 , wherein the proteins are from a virus.

13. The method of claim 11, wherein the IHHNV promoter is selected from the group consisting of P2, P61 and MID.

14. The method of claim 11 , wherein the carrier virus is a baculovirus.

15. The method of claim 11 , wherein the encoded proteins are from the virus TSV.