WO2009067191A2 - Methods and compositions for the treatment of hepatitis c virus (hcv) infection - Google Patents

Abstract

The invention features methods and compositions for treating HCV infection. Compositions include peptides (e.g., modified peptides) that specifically bind to HCV IRES.

Description

METHODS AND COMPOSITIONS FOR THE TREATMENT OF HEPATITIS C VIRUS (HCV) INFECTION

Background of the invention

This application relates to compositions useful in treating HCV infections in mammals.

Hepatitis C virus (HCV) is a persistent flavivirus that infects —3% of the human population, making it the most common chronic blood-borne infection. Among six genotypes of the virus, genotype 1 is the most common in Europe and North America. Approximately 75% of HCV-infected individuals develop a largely asymptomatic chronic infection, whereas =25% of patients eventually develop liver cirrhosis or hepatocellular carcinoma. At present, HCV infection is treated by IFN α/ribavirin therapy until sustained viral response (SVR) is reached. This treatment is effective in =50% of patients. Resistance to IFN and ribavirin, and HCV persistence after SVR in the form of "occult" hepatitis C makes HCV frequently incurable. The virus effectively avoids the host immune response and no vaccine for hepatitis C is currently available. Significant effort is being put into the development of specifically targeted antiviral therapies for HCV treatment (STAT-C), aimed at different stages of the viral life cycle, including inhibitors of NS3/4 protease, NS5B replicase, etc., as well as discovery of an anti-HCV vaccine based on E1/E2 fusion proteins. Emerging drug resistance has already been observed with anti-HCV compounds in clinical trials, highlighting the need for new approaches to HCV therapies.

The 340-nt 5' untranslated region (UTR) is among the most conserved parts of the HCV genome. It contains a highly structured internal ribosomal entry site (IRES) that mediates the initiation of translation of the viral polyprotein by a cap- and poly(A)-independent mechanism. Translation initiation from the HCV IRES does not require the eIF4F complex: the IRES is recognized directly by the 4OS ribosomal subunit and eIF3, recruits eIF2/GTP/Met-tRNA, and the resulting 48S complex assembles at the initiation codon. It is noteworthy that the pathway of IFN inhibition of viral replication occurs via an IRES-dependent mechanism. Both the IRES structure and the mechanism of HCV translation initiation have been the subject of intense research in recent years as a therapeutic target. As an example, the synthetic steroid mifepristone specifically inhibits in vitro translation initiation from the HCV IRES. Unfortunately, mifepristone did not meet the efficacy endpoint for treating HCV infection in a Phase II clinical trial.

Accordingly, because HCV is a major causative agent of serious liver disease, new treatment modalities are urgently needed. There is also an urgent need in the art for compositions, including peptide therapeutics, and methods employing the same, to prevent or inhibit infections due to HCV, including inhibiting translation and/or pathogenesis due to HCV, with minimal or no adverse side effects.

Summary of the invention

In one aspect, the invention features a peptide of 30 or fewer amino acids, wherein the peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 50 nM or less. Preferably, such a peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 10 nM or less or with a Kd of 0.1 nM or less. Such a peptide, if desired, may be in a modified (e.g., modified to have increased stability) or in cyclic form.

In another aspect, the invention features a peptide that includes the amino acid sequence of SEQ ID NO: 16, wherein said peptide is 30 or fewer amino acids. Preferably, the peptide includes SEQ ID NO:1 or SEQ ID NO:3. Such peptides specifically bind to HCV IRES (SEQ ID NO: 172).

In still other aspects, the invention features a peptide that includes the amino acid sequence of any one of SEQ NOs: 22-163. Such peptides specifically bind to an HCV IRES (SEQ ID NO: 172) with a Kd of 50 nM or less; with a Kd of 10 nM or less; with a Kd of 1 nM or less; or with a Kd of 0.1 nM or less. Preferably, the peptide is a modified peptide (e.g., modified to have increased stability) or in cyclic peptide. In preferred embodiments, the peptide is modified to include a modification selected from the group consisting of D-amino acids, N-methyl amino acids, peptoids, side chain amino acid analogs, or any combination of such modifications. In still other embodiments, the peptide is a fusion protein. In another aspect, the invention features a pharmaceutical composition that includes any of the aforementioned peptides.

In yet another aspect, the invention features a method of treating a subject having, or at risk of developing, a Hepatitis C virus infection, the method includes administering to the subject any of the aforementioned pharmaceutical compositions or peptides.

The invention further features the use of any of the aforementioned peptides in the manufacture of a medicament for the prevention or treatment of an HCV infection, as well as for use their use as medicaments.

In still other aspects, the invention features the use of such peptides in the inhibition of HCV replication or in the blocking of the translation of HCV mRNA or both.

By "peptide" or "protein" is meant any chain of two or more natural or unnatural amino acids, regardless of post-translational modification (e.g., glycosylation or phosphorylation), constituting all or part of a naturally-occurring or non-naturally occurring peptide or peptide, as is described herein.

As used herein, a natural amino acid is a natural α-amino acid having the L- configuration, such as those normally occurring in natural proteins. Unnatural amino acid refers to an amino acid, which normally does not occur in proteins, e.g., an epimer of a natural α-amino acid having the L configuration, that is to say an amino acid having the unnatural D-configuration ("D-amino acids"); or a (D,L)-isomeric mixture thereof; or a homologue of such an amino acid, for example, a β-amino acid, an α,α-disubstituted amino acid, or an α-amino acid wherein the amino acid side chain has been shortened by one or two methylene groups or lengthened to up to 10 carbon atoms, such as an α-amino alkanoic acid with 5 up to and including 10 carbon atoms in a linear chain, an unsubstituted or substituted aromatic (α-aryl or α-aryl lower alkyl), for example, a substituted phenylalanine or phenylglycine.

The term "peptide" also includes peptide derivatives. Such derivatives may be linear or cyclic, and include peptides having unnatural amino acids. Derivatives also include molecules wherein a peptide is non-covalently or preferably covalently modified by substitution, chemical, enzymatic or other appropriate means with another atom or moiety including another peptide or protein. The moiety may be "foreign" to a peptide of the invention as defined above in that it is an unnatural amino acid, or in that one or more natural amino acids are replaced with another natural or unnatural amino acid. Conjugates including a peptide or derivative of the invention covalently attached to another peptide or protein are also encompassed herein. Attachment of another moiety may involve a linker or spacer, e.g., an amino acid or peptidic linker. Derivatives of the invention also included peptides wherein one, some, or all potentially reactive groups, e.g., amino, carboxy, sulfhydryl, or hydroxyl groups are in a protected form.

The atom or moiety derivatizing a peptide of the invention may serve analytical purposes, e.g., facilitate detection of the peptide of the invention, favor preparation or purification of the peptide, or improve a property of the peptide that is relevant for the purposes of the present invention. Such properties include binding of HCV IRES or inhibition of translation from HCV IRES, particularly solubility or stability against enzymatic degradation. Derivatives of the invention include a covalent or aggregative conjugate of a peptide of the invention with another chemical moiety, the derivative displaying essentially the same activity as the underivatized peptide of the invention, and a "peptidomimetic small molecule" which is modeled to resemble the three-dimensional structure of any of the amino acids of the invention. Examples of such mimetics are retro-inverso peptides (Chorev et al., Ace. Chem. Res. 26: 266 (1993)). The designing of mimetics to a known pharmaceutically active compound is a known approach to the design of drugs based on a "lead" compound. This may be desirable, e.g., where the "original" active compound is difficult or expensive to synthesize, or where it is unsuitable for a particular mode of administration, e.g., peptides are considered unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal.

By "fusion protein" is meant peptides or derivatives thereof that are fused or attached to another protein or peptide, e.g., as a glutathione-S-transferase (GST) fusion polypeptide. Other commonly employed fusion polypeptides include, but are not limited to, maltose-binding protein, Staphylococcus aureus protein A, polyhistidine, and cellulose-binding protein.

By "peptoid" is meant a protease stable peptidomimetic that contains N- substituted glycines.

By "side chain analogs" are meant amino acids within non-naturally occurring side chains. Examples of side chain analogs can be found in Hartman et al., PLoS ONE 2:e972 (2007).

The term "modified" as used herein refers to a composition that has been operably changed from one or more predominant forms found naturally to an altered form by any of a variety of methods, including genetic alteration or chemical substitution or degradation and comprising addition, subtraction, or alteration of biological components or substituents such as amino acid or nucleic acid residues, as well as the addition, subtraction or modification of protein post-translational modifications such as, without limitation, glycan, lipid, phosphate, sulfate, methyl, acetyl, ADP-ribosyl, ubiquitinyl, sumoyl, neddoyl, hydroxyl, carboxyl, amino, or formyl. "Modified" also comprises alteration by chemical or enzymatic substitution or degradation to add, subtract, or alter amino acids or chemical moieties to provide a form not found in the composition as it exists in its natural abundance comprising a proportion of greater than 10%, or greater than 1 %, or greater than 0.1 %. The term "modified" is not intended to refer to a composition that has been altered incidentally as a consequence of manufacturing, purification, storage, or expression in a novel host and for which such alteration does not operably change the character of the composition.

By "modified to have increased stability" is meant a modification to a peptide such that the peptide retains its biological activity (e.g., HCV IRES binding) when therapeutically administered at the site of desired activity (e.g., in a particular cell type). These modifications can, for example, increase the resistance of the peptide to proteolysis, intracellular modification, and increase the solubility of the peptide under physiological conditions. By "HCV IRES" is meant HCV IRES RNA, genotype Ib, nucleotides 1-395

(GCCAGCCCCCGAUUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUG AGGAACUACUGUCUUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAU GAGUGUCGUGCAGCCUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGG UCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGACGACCGGGUCCUU UCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCGA GACUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGC CUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCACC AUGAGCACGAAUCCUAAACCUCAAAGAAAAACCAAACGUAACACC AACCGCCG CCCACAG (SEQ ID NO: 172)). With regard to the binding of a peptide to a target molecule, the term

"specifically binds to" a particular HCV IRES means binding that is measurably different from a non-specific interaction (e.g., a non-specific interaction is binding to bovine serum albumin). Specific binding can be measured, for example, by determining binding of a molecule compared to binding of a control molecule. For example, specific binding can be determined by competition with a control molecule that is similar to the target, for example, an excess of non-labeled target. The term "specifically binds to" a particular HCV IRES as used herein can be exhibited, for example, by a molecule having a Kd for the target of at least about 200 nM, alternatively at least about 150 nM, alternatively at least about 100 nM, alternatively at least about 60 nM, alternatively at least about 50 nM, alternatively at least about 40 nM, alternatively at least about 30 nM, alternatively at least about 20 nM, alternatively at least about 10 nM, alternatively at least about 8 nM, alternatively at least about 6 nM, alternatively at least about 4 nM, alternatively at least about 2 nM, alternatively at least about 1 nM, or greater. In one embodiment, the term "specifically binds to" refers to binding where a molecule binds to a particular HCV IRES without substantially binding to any other viral or host RNA sequence. By "subject" is meant any animal (e.g., a mammal such as a human). Exemplary animals that can be treated using the methods and compositions include horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish, and birds.

Brief description of the drawings Figure 1 shows a schematic overview of the mRNA display selection procedure. mRNA is conjugated by psoralene photocrosslinking to an oligonucleotide with a 3'-puromycin residue; in vitro translation results in peptide synthesis; peptidyl transferase of the ribosome transfers the nascent peptide chain to the puromycin resulting in a covalent mRNA-peptide fusion. The mRNA peptide fusion is then treated with dibromo-m-xylene, which results in a cysteine-cyclized derivative of the peptide. cDNA is synthesized by reverse transcription resulting into cDNA-mRNA hybrid. Cyclic peptides that bind to the HCV IRES are selected, and the attached cDNA is PCR- amplified and mRNA is synthesized by transcription using T7 RNA polymerase to initiate the next round of selection. Figure 2A shows the secondary structure of HCV IRES RNA, genotype Ib, nucleotides 1-395 used as the selection target (SEQ ID NO: 166). Light grey portions were added to the original clone 40-372 by PCR. The 5'-terminal 40 nucleotides were added to facilitate cotranscriptional folding of IRES. The 3'-terminal 23 nucleotides were added to provide higher stability and to increase the activity of the IRES as well as for the translation of an N-terminal 18-mer peptide of the HCV core protein used for preliminary tests of IRES function. The inset is an image of a gel showing translation of a peptide encoding for first 18 aa of the HCV core protein cloned under the control of the IRES construct in rabbit reticulocyte lysate (rrl) and labeled by 35S methionine. For the control the same sequence was cloned under the control of the TMV enhancer.

Figure 2B shows the design of the library and primers used for the selection procedure. For the cross-linking puromycin-terminated oligonucleotide: X = psoralen C6, (lowercase) = 2'OMe ribonucleotides, Z = spacer 9, P = puromycin, stretch of A's and ACC are deoxyribonucleotides.

Figure 3 shows a graph depicting the progress of the selection procedure, indicating the fraction of 35S-radiolabeled input library specifically eluted from the selection column in each round. Selection stringency was increased after round 8. Peptide 6B4 is shown (SEQ ID NO:3).

Figure 4A shows the mass spectra of in vitro translated peptides, which are cotranslationally formylated at N-terminus, resulting into additional increase of mass by 28 Da. Lower plot represents: linear 27-mer 6B4, 3,053.85 observed, 3,054.5 expected. Upper plot represents cyclic 6B4C, 3,258.6 observed, 3,258.5 expected for a bicyclic peptide derivative. The mass peak at 3,495 (+ve ion mode) is the insulin B chain calibration standard.

Figure 4B shows the possible configurations of bicyclic 6B4C peptide (SEQ ID NO:3), assuming that one cyclization event involves two cysteines, and the second cyclization involves the remaining cysteine and one histidine. Only the C1-C2, C3-H configuration will be cleaved into two separate cyclic peptides by pepsin digestion. Predicted masses are shown.

Figures 4C shows the MALDI-TOF mass spectra of synthetic, cyclized 6B4C peptide (top plot, observed 3,230.48, expected 3,230.5), pepsin-digested 6B4C (middle plot, note absence of uncleaved peptide at mass peak 3,230.5, and presence of predicted C1-C2 fragment (observed 1 ,495.4, expected 1 ,495.7)) and C3-H fragment (observed 1,753.5, predicted 1,753.8). The greater intensity of the peak corresponding to the N-terminal C1-C2 fragment may reflect enhanced ionization due to the presence of cationic residues in the N-terminal peptide loop. The lower plot is the spectrum of a pepsin self-digest, showing that some of the peaks in the peptide digest originate from pepsin (external mass calibration standard with insulin B chain mass peak, 3,495).

Figure 5 A shows the MALDI-TOF spectra of the synthetic (GenScript) 6B4 peptide used in the study. Because the peptide lacks N-terminal formylation, the mass is 28 units lower than that of in vitro translated 6B4. Two xylene moieties are added by reaction with dibromo-m-xylene. The lower plot shows the linear peptide (observed mass, 3,026.58; expected mass, 3,026.6). The upper plot shows the cyclic peptide (observed mass, 3,230.48; expected mass, 3,230.6). The peak at mass 3,495.39 is an internal standard (insulin chain B).

Figure 5B the MALDI-TOF spectra of 6B48 (KCSRGIRC SEQ ID NO: 1) in linear and cyclic form. The peptide was cyclized in solution by reaction with dibromo-m-xylene. The cyclic product (observed mass, 1,024.38; expected mass, 1,024.13) and a TCEP adduct (observed mass, 1,274.99; expected mass, 1,274.2) are observed.

Figure 5C shows the MALDI-TOF spectra of 6B413 (KCSRGIRCAGVLC SEQ ID NO:2) in linear and cyclic forms. The peptide represents the random portion of the selected 6B4 peptide. The cyclization of 6B413 was performed with tribromo mesitylene (Aldrich) to engage all three cysteine moieties without producing a mixture of products, under conditions similar to the dibromo-m-xylene reaction.

Upper plot: linear 6B413 peptide (observed mass, 1 ,364.7; expected, 1,365.72); lower plot: bicyclic 6B413C (observed mass, 1,731.65; expected, 1,482.7+250=1,732.72 as TCEP adduct). All solution cyclization reactions produced mass spectra containing a TCEP adduct (+250), whereas cyclization of the peptide immobilized on a Ni- NTA column did not show a TCEP adduct on the mass spectrum.

Figure 6A shows the binding of peptides to HCV IRES RNA plotted as fraction bound vs. concentration of IRES or competitor peptides. Direct binding of 5S-labeled linear (triangles, interrupted line) and cyclic (circles, solid line) 6B4 peptide to HCV IRES RNA, yielding observed K_& of 6.5 ± 1.8 nM (linear peptide) and 0.70 ± 0.14 nM (cyclic peptide).

Figure 6B shows the competitive binding of linear (triangles, interrupted line) and cyclic (circles, solid line) synthetic 6B48 peptide to IRES, measured as competition with the fluorescent F1-6B4 peptide. Observed IC₅₀S are 32 nM for cyclic 6B48C and 102 nM for linear 6B48. K_& as calculated from competition with 0.625 nM F1-6B4 peptide and 15 nM IRES RNA are 3.3 ± 0.8 nM (linear peptide) and 0.65 ± 0.12 nM (cyclic peptide). Values are the mean and standard deviation of three to five K_d measurements in each experiment. Figure 7 A shows a series of graphs depicting dissociation constants measured by equilibrium ultrafiltration using F1-6B4. (Right) Binding of HCV IRES RNA to F1-6B4 (2 nM). (Left) Competitive binding of 6B4 (open circles) and 6B4C (filled squares) to IRES RNA (15 nM) by using F1-6B4 (2 nM) as a tracer.

Figure 7B shows a series of graphs depicting examples of spectra collected in equilibrium ultrafiltration assay by using F1-6B4 as a tracer: Competition of 8-mer cyclic 6B48C with F1-6B4 (0.4 nM) + IRES (15 nM). Concentration of the competitor peptide is indicated in titles of the graphs (nM).

Figure 8 shows peptide aggregation measured by N-phenyl 1 -naphthylamine fluorescence. A stock solution of N-phenyl 1 -naphthylamine (NPN, Aldrich) in ethanol was diluted with a buffer (20 rnM KHEPES, pH 7.4, 30OmM NaCl, 5mM MgCl₂, 2mM CaCl₂) to a final concentration of 50 nM. Different concentrations of peptides were added to the solutions and incubated at room temperature for 45 min. Spectra were recorded on a Cary spectrofluorimeter in the range of 380-550 nm (emission slit width, 10 nm) at excitation wavelength of 340 nm (slit width, 5 nm) filtered at 360-1,100 nm, PMT voltage high (800 V), smoothing by running-average method, factor 6. (Upper line) A change of fluorescence behavior of NPN in the presence of the cyclic 27-mer 6B4C indicated aggregation of the peptide. (Lower line) At the same range of concentrations of cyclic 8-mer 6B48C no changes in NPN fluorescence occurs, indicating a lack of aggregation of 6B48C. Figure 9A shows Gaussia Luciferase reporter constructs. (Left) HCV IRES-

Gluc construct, (Right) control capped Glue mRNA.

Figures 9B and 9C show graphs depicting translation of IRES-GLuc (9B) and capped leader-GLuc (9C) in HeLa S 10 extract in the presence of linear 6B4 and cyclic 6B4C, plotted as percent of GLuc luminescence relative to the untreated control. Figures 9D and 9E show graphs depicting translation of IRES-Gluc (D) and capped leader-GLuc (E) in HeLa SlO extract, in the presence of linear 8-mer (6B48) and the cyclized 8-mer (6B48C) plotted as percent of GLuc luminescence relative to the untreated control. Figure 1OA shows translation of IRES-GLuc and uncapped or capped GLuc mRNA in HeLa S 10 extract. Uncapped GLuc mRNA translates poorly, whereas capped GLuc and IRES-Gluc construct translate well. The slightly lower translation yield of capped GLuc mRNA compared with IRES-GLuc may reflect the 50-70% efficiency of cap analog incorporation during in vitro transcription of the construct by T7 RNA polymerase.

Figure 1OB shows translation of 50 nM IRES-GLuc mRNAin HeLa SlO extract in the presence of a linear 13-mer 6B413 or cyclic 6B413C peptides KCSRGIRCAGVLC (SEQ ID NO:2) and mifepristone (MF). Figure 1 OC shows translation of 100 nM capped leader-GLuc in HeLa extract in the presence of different concentrations of 6B413 peptide in linear and cyclic form and mifepristone (MF).

Figure 1 IA shows a photomicrograph produced using optical microscopy showing human lung carcinoma A-549 cells incubated with a fluorescently labeled 6B4C peptide and then fixed on the slide.

Figure 1 IB shows a fluorescent photomicrograph of the same field as depicted in Figure 1 IA, showing fluorescence inside the cells in form of granules resembling lysosomal distribution of the fluorescent peptide, and suggesting endocytosis as a major mechanism of the cellular uptake and further degradation of the peptide in lysosomes.

Detailed description of the invention

As is discussed above, HCV is a positive strand RNA flavivirus that is a major causative agent of serious liver disease. Because HCV translation initiation occurs by a mechanism that is fundamentally distinct from that of host mRNAs, it is an attractive target for drug discovery. The translation of HCV mRNA is initiated from an internal ribosomal entry site (IRES), independent of cap and poly(A) recognition and bypassing eIF4F complex formation. We have accordingly used mRNA display selection technology combined with a simple and robust cyclization procedure to screen a peptide library of >10¹³ different sequences and isolate cyclic peptides that bind with high affinity and specificity to HCV IRES RNA. The best peptide binds the IRES with subnanomolar affinity, and a specificity of at least 100-fold relative to binding to several other RNAs of similar length. The peptide specifically inhibits HCV IRES-initiated translation in vitro with no detectable effect on normal cap- dependent translation initiation. An 8-aa cyclic peptide retains most of the activity of the full-length 27-aa bicyclic peptide. These peptides can be useful tools for the study of HCV translation and are useful as anti-HCV drugs. Additional peptides were identified with specific binding to HCV IRES. The invention features the use of these peptides, along with modified versions of these peptides, for the treatment HCV infection.

INHIBITORS The invention features an 8-mer peptide or a fragment thereof that binds HCV

IRES at high affinity. The sequence of this 8-mer, referred to as "6B48," is KCSRGIRC (SEQ ID NO:1). 6B48 was identified as part of a 27 amino acid peptide, referred to as "6B4," having the sequence KCSRGIRCAGVLCGSVGHHHHHHHRL (SEQ ID NO:3). This sequence was identified during a selection experiment based on a large library of cyclic peptides. The invention therefore also features SEQ ID NO:3 or a fragment thereof.

The invention also features other peptides that specifically bind to HCV IRES. The sequences of these peptides are shown in Tables 5 and 6 below. Given the selection procedure conditions, affinities of these peptides to HCV IRES are expected to be in the range of 1 -50 nM or less.

These peptides feature an N-terminal methionine, two cysteines separated by a range of 10 amino acids, which were used for the dibromoxylene cyclization; and the C-terminal portion contains an GSVG spacer and histidine- tag, used for the purification. As shown in Table 1 (below), select peptides shown in Tables 5 and 6 are readily aligned. Table 1 (SEQ ID NOs: 4-15)

Platel_70-F9-M13F_127_BlD. SGVGAARTWG- 10

Platel_91-C12-M13F_119_1FO6156 GLGRARTDVA 10

Platel_86-Fll-M13F_1 SRGIRC 6 Platel_47-G6-M13F_127_5D3. NKSLIAIRYD 10

Platel_13-E2-M13F_11 IASSGRAGGV— 10

YPlatel_32-H4-M13F_l VGYSRIGLSV- 10

Platel_19-C3-M13F_118_14B4 HVTQHPYSRA 10

Platel_82-Bll-M13F_127_576. KGFVGFFSRA 10 Platel_2-Bl-M13F_107 VYSRLKVFAD 10

YPlatel_94-F12-M13F_ LCYSYAGSCR- 10

Platel_36-D5-M13F_12 GYRKIARMVM 10

Platel_20-D3-M13F_12 RVCNRMEGVL-10

This alignment supports the following consensus sequence:

X1-S-R-X2-X3-R (SEQ ID NO:16), where Xl can be Y, F, or C, including covalently modified C (such as a bromo xylene modification), X2 can be A, G, or I, and X3 can be one or two additional amino acids, preferably selected from A, I, V, L and G. Based on this alignment, other peptides, when in cyclic form, that specifically bind to HCV IRES binding peptides are as follows: Platel_36-D5-M13F_12,

CGYRKIARMVMC (SEQ ID NO: 17), YPlatel_32-H4-M13F_l, CVGYSRIGLSVC (SEQ ID NO:19), Platel_20-D3-M13F_12, CRVCNRMEGVLC (SEQ ID NO:20), and Platel_91-C12-M13F_119JF06156, CGLGRARTDVAC (SEQ ID NO:21).

The invention also features peptides of 30 or fewer amino acids (e.g., 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acids) that bind the HCV IRES at an affinity of less than 50 nM (e.g., 40 nm, 30 nm, 20 nm, 10 nm, 5 nM, 3 nM, 1 nM, 0.9 nM, 0.8 nM, 0.7 nM, 0.65 nM, 0.5nM, 0.1 nM, or less). Binding is determined using standard methods such as the equilibrium ultrafiltration method described below. Inhibition of HCV IRES- dependent protein translation is also measured using standard methods, for example, the luciferase assay described below.

The invention also features the 6B48 or 6B4 peptide, or any of the peptides shown Tables 5 and 6, with amino acid substitutions. 6B48 was generated by an in vitro selection process and is a ribosomal peptide, in which cyclization is achieved by a posttranslational chemical modification. The cyclization of 6B48 is advantageous for binding to HCV IRES, as compared to a linear peptide of the same sequence. Cyclization is achieved, for example, by dibromoxylene reaction with cysteines, as described below. Several other cyclization strategies are known in the art, including reaction of the N-terminal amino group with C-terminal carboxyl (i.e., N-C terminal cyclization). In this case at least the C-terminal cysteine can be omitted from the sequence and the N-terminal cysteine can be replaced with another amino acid, e.g. methionine, glycine, serine, phenyl alanine, tyrosine, and tryptophane.

Dibromoxylene cyclization, for example, introduces an additional benzene ring into a peptide structure. A variant of N-C- terminal cyclization can include introduction of a benzene ring into the peptide which is achieved by replacing the N- terminal cysteine with phenylalanine or tyrosine.

Other possible amino acid substitutions include replacement of an arginine with a lysine and vice-versa, preserving the cationic nature of the residues at those positions. Also, substitutions with one or more of histidine, asparagine, or glutamine can be made according to standard methods known in the art. Glycine and isoleucine are, for example, substituted to preserve aliphatic hydrophobic side chain at either position. Glycine, for example, is substituted with alanine, leucine, isoleucine, valine, or proline. Isoleucine, for example, is substituted with valine, leucine, alanine, and glycine. Either can be substituted with phenylalanine or tryptophane. Serine may be substituted with threonine, cysteine, or tyrosine, or serine can be replaced, for example, with glutamine or aparagine. Additional substitutions include amino acid analogs.

Table 2 (below) shows exemplary substitutions to 6B48.

Table 2

Any of the peptides described herein may also include modifications to increase peptide stability, decrease peptide degradation, or modulate bioavailability or any combination thereof.

Such peptides may include one or more of the following modifications: 1) D-amino acids (for example, a peptide which includes all D-amino acids or peptides containing a mixture of D- and L-amino acids) 2) Peptide backbone analogs: a) N-methyl amino acids b) Peptoids

3) Side chain analogs.

These modifications are described in more detail below.

D-amino acids

Peptides including D-amino acids result in a protease/peptidase stable compound, improving pharmacodynamic properties of the peptide. Peptides including D-amino acids may have different binding properties due to their mirror- image structure. Reversing or reshuffling the sequence(s) of D-amino acids the peptide may desirable. N-methyl amino acids

N-methyl backbone analogs are useful to engineer peptides of essentially same structure, but are resistant to proteolysis. Additionally, N-methyl backbone analogs generate fewer backbone hydrogen bonds and improving pharmacokinetic properties of the peptide. Peptoids

Peptoids are protease stable peptidomimetic that contains N-substituted glycines. Peptoids would have similar properties to N-methyl amino acid.

Side chain analogs Peptides described herein may be modified to include side chain analogs according to methods known in the art. Such methods include, for example, the addition of a side chain analog during chemical synthesis of a peptide. Chemically synthesized peptides, for example, allow for the addition of virtually any amino acid side chain analog. Such chemically synthesized peptides are, in turn, screened for binding affinity to HCV IRES according to the methods described herein.

Alternatively, a side chain analog can be added using the PURE system, as described, for example, in Josephson et al. (J. Am. Chem. Soc. 127:1 1727 (2005)) and Shimizu et al. (Nat. Biotechnol. 19:751 (2001)). The PURE system is a variant of mRNA display-based in vitro selection, featuring the incorporation of multiple side chain analogs into a peptide. In the PURE system, side chain analogs are incorporated into a peptide at a relatively high efficiency using a reconstituted E. coli translation extract. Aminocyl tRNA synthesases (AARS) charge side chain analogs onto tRNAs, and ribosomes incorporate the charged amino acids into peptides. Some amino acid side chain analogs may require the use of mutated AARS. Examples of useful side chain analogs are arginine and tryptophan analogs (such as canavanine and 7-aza tryptophan) and cationic side chain analogs (e.g., 4-aza leucine and/or pyridyl alanine). Additional exemplary side chain analogs are summarized in Table 3. Table 3

2 and 3 -pyridyl-L-phenylalanine are charged onto tRNA by the same PheRS A294G with similar efficiencies.

Side chain analogs may be further modified postranslationally (e.g., modification by cyclization, glycosylation, and conjugation with lipids). For example, side chain analogs having alkyne and azide amino acid side chains (such as azidohomoalanine, 2-aminohex-5-ynoic acid, p-azido, and p-ethynyl phenylalanine) may be modified through cycloaddition in the presence of Cu(I).

Side chain analogs may also be posttranslationally modified by glycosylation. This modification can be achieved by reacting alkyne side chains of peptides with azido-saccharides (e.g. α-D-mannopyranosyl azide or 1-Azido-l-deoxy-β-D- glucopyranoside).

Additional modifications

Peptides described herein may be detectably labeled with an enzyme, a fluorescent marker, a chemiluminescent marker, a metal chelate, paramagnetic particles, biotin, or the like. In such derivatives, the peptide is bound to the conjugation partner directly or by way of a spacer or linker group, e.g., a (peptidic) hydrophilic spacer. Advantageously, the peptide is attached at the N- or C-terminal amino acid. For example, biotin may be attached to the N-terminus of a peptide of the invention via a serine residue or the tetramer Ser-Gly-Ser-Gly.

Peptides described herein may carry one or more protecting groups at a potentially reactive side group, such as amino-protecting group, e.g., acetyl, or a carboxy-protecting group. For example, the C-terminal carboxy group of a compound of the invention may be present in form of a carboxamide function. Suitable protecting groups are known in the art (e.g., polyethylene glycol). Such groups may be introduced, for example, to enhance the stability of the compound against proteolytic degradation.

ADMINISTRATION Therapy according to the invention may be performed alone or in conjunction with another therapy and may be provided at home, the doctor's office, a clinic, a hospital's outpatient department, or a hospital. Treatment optionally begins at a hospital so that the doctor can observe the therapy's effects closely and make any adjustments that are needed, or it may begin on an outpatient basis. The duration of the therapy depends on the type of disease or disorder being treated, the age and condition of the patient, the stage and type of the patient's disease, and how the patient responds to the treatment. Additionally, a person having a greater risk of developing an proliferative disease may receive treatment to inhibit or delay the onset of symptoms. Routes of administration for the various embodiments include, but are not limited to, topical, transdermal, transcranial, nasal, and systemic administration (such as, intravenous, intramuscular, subcutaneous, inhalation, rectal, buccal, vaginal, intraperitoneal, intraarticular, ophthalmic, otic, or oral administration). As used herein, "systemic administration" refers to all nondermal routes of administration, and specifically excludes topical and transdermal routes of administration.

DOSAGES

The dosage of peptides of the invention depends on several factors, including: the administration method, the disease to be treated, the severity of the disease, whether the disease is to be treated or prevented, and the age, weight, and health of the person to be treated. Additionally, pharmacogenomic (the effect of genotype on the pharmacokinetic, pharmacodynamic or efficacy profile of a therapeutic) information about a particular patient may affect dosage used. Continuous daily dosing with the peptides of the invention may not be required. A therapeutic regimen may require cycles, during which time a drug is not administered, or therapy may be provided on an as needed basis during periods of acute inflammation.

EXPERIMENTAL

We have isolated specific inhibitors of HCV IRES-initiated translation. In the below results, we describe the selection of high-affinity peptide binders to the HCV IRES from a cyclic peptide-mRNA fusion library of 10 trillion individual sequences. After 1 1 rounds of selection, we isolated a bicyclic peptide that binds the HCV IRES tightly and specifically, and selectively inhibits the IRES-initiated translation of a reporter gene in vitro.

RESULTS

In vitro Selection The scheme that we used to select for cyclic peptides that bind specifically to the HCV IRES is outlined in Fig. 1 and the secondary structure of HCV IRES RNA is shown in Fig. 2 A. We started the selection with —17 μg of a double stranded DNA library (2.5 x 10¹⁴ individual sequences) designed to code for his-tagged peptides containing 10 random residues flanked by cysteines as shown in Fig. 2B. After the transcription of mRNA, photo-cross-linking to the peptide-accepting 3'-puromycin oligonucleotide, and purification by denaturing PAGE, —7 μg of the mRNA- oligonucleotide-puromycin library was obtained (2 x 10¹⁴ individual sequences). After translation, purification, and peptide cyclization, -6.5% of the library was converted into mRNA fusions to cyclic peptides, for an initial library complexity of ~1.3 x 10¹³ sequences.

The selection procedure was divided into three phases of gradually increasing stringency (Table 4). Rounds 1 and 2 were designed to decrease the complexity of the starting library while retaining all possible IRES binders. During these rounds Torula yeast RNA (TYR) was used as a binding competitor, and all column matrix bound material was eluted nonspecifically with 50 mM NaOH (followed by immediate neutralization of the eluate) or 8 M urea. Rounds 3-7 were designed to select more specifically for IRES binders by eluting column bound mRNA-peptide fusions competitively with soluble IRES. Following seven rounds of selection, —50% of the input library was eluted from IRES column with soluble IRES RNA in 2 h (Fig. 3). The output cDNA of rounds 6 and 7 was cloned and sequenced, revealing the high complexity of the remaining library (Table 6). We then further increased the stringency of the selection by using additional selection steps in rounds 8-1 1, aimed at the selection of peptides with slower dissociation rates, and improved IRES selectivity. Cloning and sequencing of the library after round 1 1 (Table 5) revealed that the sequence 6B4, encoding the peptide

MKCSRGIRCAGVLCGSVGHHHHHHHRL (SEQ ID NO:3), accounted for >30% of the clones. The same sequence was observed in only 2 of 105 sequences from rounds 6 and 7.

Table 4

Table 5

CLUSTAL 2.0.3 multiple sequence alignment Round 11 matrix: Identity Plate No. SEQUENCE SEQ

ID No.

Platel_40-H5-M13F_127_68E. —MGCGSCPVCHGYPCGSVGHHHHHHHRL- 22

Platel_89-A12-M13F_127_57C. —MGCGGTEGHIGRGCGSVGHHHHHHHRL- 23 Platel_78-F10-M13F_124_B9. —MGCCWTAAMAGTSCGSVGHHHHHHHRL- 24

Platel_14-F2-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_18-B3-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_21-E3-M13F —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_23-G3-M13F_119_137E. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3 Platel_42-B6-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_43-C6-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_44-D6-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_45-E6-M13F_119_137E. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_49-A7-M13F_119_137E. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3 Platel_53-E7-M13F_119_137E. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_10-B2-M13F_127_66B. —MKCSRGIRCAGVRCGSVGHHHHHHHRL- 3

Platel_56-H7-M13F_127_860. —MKCSRGIRCAGVLXGSVGHHHHHHHRL- 25

Platel_68-D9-M13F —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_9-A2-M13F_127_7A3. --MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3 Platel_37-E5-M13F_127_B9E. —MKCSRGIRCAGVLCGSVGXHHHHHHRL- 26

Platel_73-A10-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_93-E12-M13F_127_7A3. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3

Platel_66-B9-M13F_127_C0E. —MKCSRGIRCAGVLCGSVGXXHHHHHRL- 27

Platel_86-Fll-M13F_125_2197. —MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3 Platel_12-D2-M13F_127_85B. —MGCTACDRMYLVCCGSVGHHHHHHHRL- 28

Platel_20-D3-M13F_127_1421NNBl —MGCRVCNRMEGVLCGSVGHHHHHHHRL- 29

Platel_46-F6-M13F_127_1206NNC5 --MGCLYLWRQGGLACGSVGHHHHHHHRL- 30

Platel_27-C4-M13F_127_D16. —MRCIDHQYSWLCYCGSVGHHHHHHHRL- 31

YPlatel_7-Gl-M13F_127_CEB. —MECGCSHPVFLCYCGSVGHHHHHHHRL- 32 Platel_ll-C2-M13F_127_C1C. —MRCWESYVDHLDLCGSVGHHHHHHHRL- 33

YPlatel_63-G8-M13F_127_914. —MGCQSYGPGDLCLCGSVGHHHHHHHRL- 34

YPlatel_32-H4-M13F_127_126D. —MGCVGYSRIGLSVCGSVGHHHHHHHRL- 35

Platel 17-A3-M13F 127 E84. —MGCWISISACFKSCGSVGHHHHHHHRL- 36 Platel_2-Bl-M13F_107_8F0. --MGCVYSRLKVFADCGSVGHHHHHHHRL- 37

Platel_28-D4-M13F_127_B25. —MGCWVEMRGSWKRCGSVGHHHHHHHRL- 38

Platel_39-G5-M13F_119_1E3C. —MGCWGCMLSPEFRCGSVGHHHHHHHRL- 39

Platel_13-E2-M13F_119_1747. —MECIASSGRAGGVCGSVGHHHHHHHRL- 40

Platel_67-C9-M13F_127_7B1. --MGCRAASSVSWMWCGSVGHHHHHHHRL- 41

Platel_15-G2-M13F_119_F04. --MKCKKPGSARWSKCGSVGHHHHHHHRL- 42

Platel_47-G6-M13F_127_5D3. —MRCNKSLIAIRYDCGSVGHHHHHHHRL- 43

Platel_36-D5-M13F_127_8A9. —MECGYRKIARMVMCGSVGHHHHHHHRL- 44

YPlatel_59-C8-M13F_127_3F6. --MRCPSEGYHRRTGCGSVGHHHHHHHRL- 45

Platel_72-H9-M13F_124_2163. —MECCQSGRPRDGGCGSVGHHHHHHHRL- 46

Platel_70-F9-M13F_127_BlD. —MGCSGVGAARTWGCGSVGHHHHHHHRL- 47

Platel_35-C5-M13F_109_E2D. —MGCTFGTQPRHWCCGSVGHHHHHHHRL- 48

Platel_19-C3-M13F_118_14B4 —MECHVTQHPYSRACGSVGHHHHHHHRL- 49

Platel_82-Bll-M13F_127_576. —MKCKGFVGFFSRACGSVGHHHHHHHRL- 50

Platel_55-G7-M13F_127_93B. —MECTDCYLALSSYCGSVGHHHHHHHRL- 51

YPlatel_90-B12-M13F_127_876. —MECRRCFAELSYACGSVGHHHHHHHRL- 52

YPlatel_94-F12-M13F_127_FCBNND —MECLCYSYAGSCRCGSVGHHHHHHHRL- 53

Platel_33-A5-M13F_119_1A4O. —MKCTLFKAAGGPFCGSVGHHHHHHHRL- 54

Platel_61-E8-M13F MRYGSFDDMSCG—ECGSVGHHHHHHHRL- 55

Platel_74-B10-M13F —MGCYDRMPGGTHSCGSVGHHHHHHHRL- 56

Platel_91-C12-M13F_119_1FO6156 —MGCGLGRARTDVACGSVGHHHHHHHRL- 57

YPlatel_96-H12-M13F_127_597. —MRCEGCVHYMGLSCGSVGHHHHHHHRL- 58

Platel_81-All-M13F_127_7E5. —MGCDRWSAGCV-VCGSVGHHHHHHHRL- 59

Platel 4-D1-M13F 127 15E8NN10A —MRCAFCDFLTRXLCGSVGHHHHHHHRL- 60

Table 6

CLUSTAL 2.0.3 multiple sequence alignment Rounds 6 and 7, Matrix: Identity

Plate No. SEQUENCE SEQ

ID No. rf_l_SASHA7_AMP-14-F2-M13R MECGSDGRELRYGCGSVGHHHHHHHRL- 61 rf_l_SASHA7_KAN-l-A7-M13R MRCGACGHVCRYTCGSVGHHHHHHHRL- 62 rf_l_SASHA7_KAN-41-A12-M13R MECGARGLECAGACGSVGHHHHHHHRL- 63 rf_l_SASHA7_AMP-ll-C2-M13R MGCIVALWLVFQICGSVGHHHHHHHRL- 64 rflSASHA_AMP-7-Gl-M13F_C MGCSVAGLLHAVGCGSVGHHHHHHHRL- 65 rf_l_SASHA7_KAN-27-C10-M13R MGCAFARXLXKVFCGSVGHHHHHHHRL- 66 rf_l_SASHA7_KAN-24-H9-M13R MGCFHVRMLTARGCGSVGHHHHHHHRL- 67 rflSASHA_AMP-18-B3-M13F_C MECRLLRGHGEARCGSVGHHHHH 68 rflSASHA_KAN-26-B10-M13F_C MECRKPRGGYRDACGSVGHHHHHHHRL- 69 rflSASHA_KAN-17-A9-M13F MGCTALEGGRTAHCGSVGHHHHHHHRL- 70 rflSASHA_KAN-23-G9-M13F_C MGCGAAREGGADRCGSVGHHHHHHHRL- 71 rf_l_SASHA7_AMP-13-E2-M13R MGCMFCRSGDFASCGSVGHHHHHHHRL- 72 rflSASHA_KAN-ll-C8-M13F_C MGCLVGDLGACAVCGSVGHHHHHHHRL- 73 rflSASHA_KAN-3-C7 -M13F_C MGCLVGDLGACAVCGSVGHHHHHHHRL- 74 rf_l_SASHA7_AMP- 12-D2-M13R MGCTVGCRNAAEPCGSVGHHHHHHHRL- 75 rflSASHA_AMP- l -Al -M13F_C MGCTPRSLDSYGGCGSVGHHHHHHHRL- 76 rf_l_SASHA7_KAN-26-B10-M13R MGCNVPTCQAPRRCGSVGHHHHHHHRL- 77 rf_l_SASHA7_KAN- 4 6- F12-M13R MGCATKMVGAPRCCGSVGHHHHHHHRL- 78 rflSASHA_AMP-12-D2-M13F_C MGCYRWPVEKPLDCGSVGHHHHHHHRL- 79 rf_l_SASHA7_AMP-16-H2-M13R MGCCGSGFSLEEVCGSVGHHHHHHHRL- 80 rf_l_SASHA7_KAN-3-C7-M13R MGCRNSGVSAGGKCGSVGHHHHHHHRL- 81 rf_l_SASHA7_AMP-7-Gl-M13R MGCRGGADYTTSYCGSVGHHHHHHHRL- 82 rf_l_SASHA7_KAN-2-B7-M13R MGCCGGVRHTGFTCGSVGHHHHHHHRL- 83 rf_l_SASHA7_KAN-40-Hll-M13R MGCDRGVELVNGVCGSVGHHHHHHHRL- 84 rf_l_SASHA7_AMP-2-Bl-M13R MGCSRGKKKWVIRCGSVGHHHHHHHRL- 85 rflSASHA_AMP-5-El-M13F_C MGCGGILKVWLVACGSVGHHHHHHHRL- 86 rf 1 SASHA7 AMP-6-F1-M13R MGCLGFDDQGIGRCGSVGHHHHHHHRL- 87 rf lSASHA_KAN-43-C12-M13F_C MGCSTTDIQGLLYCGSVGHHHHHHHRL- 88 rf_l_SASHA7_AMP-37-E5-M13R MGCSAWADLELDTCGSVGHHHHHHHRL- 89 rf_l_SASHA7_KAN-43-C12-M13R MRCGAWQMLLLLGCGSVGHHHHHHHRL- 90 rflSASHA_KAN-22-F9-M13F_C MRCDASHALKKLHCGSVGHHHHHHHRL- 91 rf_l_SASHA7_AMP- l-Al-M13R MGCGHGAAADALHCGSVGHHHHHHHRL- 92 rf_l_SASHA7_AMP-29-E4 -M13R MKCHGCTCREWDHCGSVGHHHHHHHRL- 93 rflSASHA_KAN-30-F10-M13F MKCDGVECVAVEKCGSVGHHHHHHHRL- 94 r f _1_SASHA7_KAN- 18-B9-M13R MKCGWNAIKSEGGCGSVGHHHHHHHRL- 95 rf_l_SASHA7_AMP-25-A4 -M13R MRCTCLGLHHFIKCGSVGHHHHHHHRL- 96 rf lSASHA_KAN-25-A10-M13F_C MRCIVNGPVTRILCGSVGHHHHHHHRL- 97 rf_l_SASHA7_AMP-43-C6-M13R MRCRLEPPDCRTRCGSVGHHHHHHHRL- 98 rf_l_SASHA7_KAN-4 -D7 -M13R MGCVIEGRYFRCRCGSVGHHHHHHHRL- 99 r f _1_SASHA7_AMP- 39-G5-M13R MRCRWGGVSGFFLCGSVGHHHHHHHRL- 100 rf_l_SASHA7_AMP-40-H5-M13R MRCRASGAGACMLCGSVGHHHHHHHRL- 101 rf_l_SASHA7_KAN-39-Gl l-M13R MRCRLYDMLAVCLCGSVGHHHHHHHRL- 102 r f _1_SASHA7_KAN- 19-C 9-Ml 3R MRCRQIGCALVGQCGSVGHHHHHHHRL- 103 rf_l_SASHA7_KAN-44 -D12-M13R MRCSQIAVSIIGPCGSVGHHHHHHHRL- 104 rf_l_SASHA7_AMP-33-A5-M13R MRCLRAGLPCSNSCGSVGHHHHHHHRL- 105 rf_l_SASHA7_AMP-4 6-F6-M13R MRCRHRFLRFVASCGSVGHHHHHHHRL- 106 rf_l_SASHA7_KAN-38-Fl l-M13R_R MRCLSALTCKMALCGSVGHHHHHHHRL- 107 rf_l_SASHA7_KAN-47-G12-M13R MRCLSALTCKMALCGSVGHHHHHHHRL- 108 rf_l_SASHA7_AMP-38-F5-M13R_r MRCLSALTCKMALCGSVGHHHHHHHRL- 109 rflSASHA_KAN-34 -Bl l-M13F_C MRCMLILRCYSAGCGSVGHHHHHHHRL- 110 rflSASHA_AMP-36-D5-M13F_D MGCESVSRTPHAGCGSVGHHHHHHHRL- 111 rflSASHA_KAN-27-C10-M13F_C MRCLTGTFAPWAFCGSVGHHHHHHHRL- 112 rf_l_SASHA7_AMP-4 8-H 6-M13R MRCVGVIWDSEARCGSVGHHHHHHHRL- 113 rflSASHA_AMP-39-G5-M13F_C MRCLQSRWDGFPWCGSVGHHHHHHHRL- 114 rf_l_SASHA7_KAN-21-E 9-M13R MRCRSSQTATASRCGSVGHHHHHHHRL- 115 rflSASHA_KAN-45-E12-M13F_C MRCVHSSTAVWFRCGSVGHHHHHHHRL- 116 rf_l_SASHA7_KAN-4 8-H12-M13R MRCATIRAVYAHSCGSVGHHHHHHHRL- 117 rflSASHA_AMP-37-E5-M13F_C MRCDGNRVVFAVICGSVGHHHHHHHRL- 118 rflSASHA_KAN-32-H10-M13F MRCSTRAEAAREGCGSVGHXHHHHXRL- 119 rflSASHA_KAN-32-H10-M13F_D MRCSTRAEAAREGCGSVGHLHHHHHRL- 120 rflSASHA_KAN-47-G12-M13F_C MRCFSQASRDAEVCGSVGHHHHHHHRL- 121 rf_l_SASHA7_KAN- 10-B8-M13R MRCGCGRSSSLFNCGSVGHHHHHHHRL- 122 rf_l_SASHA7_AMP- 15-G2-M13R MECVLVAWFDVRECGSVGHHHHHHHRL- 123 rflSASHA_AMP-41-A6-M13F_C MECWEDLVDDWRDCGSVGHHHHHHHRL- 124 rflSASHA_AMP- 17-A3-M13F MECDRRCKFKFRACGSVGHHHHHHHRL- 125 rf_l_SASHA7_AMP-21-E3-M13R MGCRSRSMLSMRMCGSVGHHHHHHHRL- 126 rflSASHA_KAN-42-B12-M13F_C MRCGSREGLSFLQCGSVGHHHHHHHRL- 127 rf_l_SASHA7_AMP-28-D4 -M13R MECVEGIDANPVACGSVGHHHHHHHRL- 128 rf_l_SASHA7_AMP-31-G4 -M13R MRCVGRVDKNKFLCGSVGHHHHHHHRL- 129 rf_l_SASHA7_KAN-25-A10-M13R MGCVLAITRRSVWCGSVGHHHHHHHRL- 130 rf_l_SASHA7_KAN-8 -H7 -M13R MGCVGGGTLSSLNCGSVGHHHHHHHRL- 131 rf_l_SASHA7_AMP-32-H4 -M13R MGCVDPCTCVRPGCGSVGHHHHHHHRL- 132 rf_l_SASHA7_KAN-7 -G7 -M13R MGCQQEHGCHRYSCGSVGHHHHHHHRL- 133 rf lSASHA_KAN-44 -D12-M13F MGCWMAVGNHEVSCGSVGHHHHHHHRL- 134 rf_l_SASHA7_AMP- 4 -Dl -M13R MGCVLFVSTREYVCGSVGHHHHHHHRL- 135 rf_l_SASHA7_KAN-34 -Bl l-M13R_R MGCLSRVCVRYSACGSVGHHHHHHHRL- 136 rf_l_SASHA7_AMP- 4 1-A6-M13R MRCCLDVVFWQVPCGSVGHHHHHHHRL- 137 rf_l_SASHA7_KAN-28-D10-M13R MGCWTDVSYWSFFCGSVGHHHHHHHRL- 138 rf lSASHA_KAN- 10-B8-M13F_C MECAVDVFVYMVSCGSVGHHHHHHHRL- 139 rf_l_SASHA7_AMP-8-Hl-M13R MKCVRNLANGGAVCGSVGHHHHHHHRL- 140 rf lSASHA_KAN-37-El l-M13F MKCCRTLQHAVWRCGSVGHHHHHHHRL- 141 rf_l_SASHA7_KAN-33-Al l-M13R MGCVRAIVFGIYICGSVGHHHHHHHRL- 142 rf lSASHA_AMP-26-B4 -M13F_C MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3 rf lSASHA_AMP-30-F4 -M13F_C MKCSRGIRCAGVLCGSVGHHHHHHHRL- 3 rf_l_SASHA7_KAN- 32-H 10-M13R MKCALVFRSDGVLCGSVGHHHHHHHRL- 143 rf_l_SASHA7_AMP-26-B4 -M13R MECWCIIRPVEPCCGSVGHHHHHHHRL- 144 rflSASHA_KAN-7-G7-M13F_C MECCGISRGVRTXCGSVGHHHHHHHRX- 145 rf 1 SASHA7 KAN-12-D8-M13R MECTLWDSREQPTCGSVGHHHHHHHRL- 146 rf_l_SASHA7_KAN-15-G8-M13R MECCLWKSGHGSMCGSVGHHHHHHHRL- 147 rf_l_SASHA7_AMP-44-D6-M13R MECARVVPGLMGYCGSVGHHHHHHHRL- 148 rf_l_SASHA7_KAN-20-D9-M13R MECGHGSRGGPGCCGSVGHHHHHHHRL- 149 rf_l_SASHA7_KAN-37-Ell-M13R MECGFLTEADCGSCGSVGHHHHHHHRL- 150 rflSASHA_KAN-l-A7-M13F_C MECRRVPLAPQGSCGSVGHHHHHHHRL- 151 rflSASHA_AMP-24-H3-M13F_C MECLKKIEVSQLSCGSVGHHHHHHHRL- 152 rflSASHA_KAN-13-E8-M13F_C MECQCRIFSKRSSCGSVGHHHHHHHRL- 153 rf_l_SASHA7_AMP-19-C3-M13R MKCFLTSGSWVSACGSVGHHHHHHHRL- 154 rf_l_SASHA7_KAN-16-H8-M13R MKCWLCYGGLYNYCGSVGHHHHHHHRL- 155 rf_l_SASHA7_KAN-9-A8-M13R MKCWLSFAPYAGCCGSVGHHHHHHHRL- 156 rflSASHA_KAN-39-Gll-M13F_C MECKLHGGSCSCACGSVGHHHHHHHRL- 157 rf_l_SASHA7_AMP-36-D5-M13R MRCWGTRMGQRGTCGSVGHHHHHHHRL- 158 rflSASHA_KAN-4-D7-M13F MKCNFAVLSGDLVCGSVGHHHHHHHRL- 159 rf_2_SASHA7_KAN-14-F8-Ml3R GAGERFNVWCGSVGHHHHHHHRL- 160 rf_l_SASHA7_KAN-30-F10-M13R MGCNWLILDAAFSCSSVGHHHHHHHRL- 161 rflSASHA_AMP-19-C3-M13F_C MECCEAYHLYLTPCGSVGHHHHHHHRL- 162 rf 2 SASHA7 KAN-13-E8-M13R WDATVCSRVWSSHCGSVGHHHHHHHRL- 163

Structure of Peptide 6B4

Inspection of the peptide 6B4 sequence reveals 3 cysteines, of which 2 originate from the library design, and an additional one from the random region. This suggests the possibility of double cyclization of the peptide in the reaction with dibromoxylene, an additional acceptor of the alkylation reaction being one of the histidine moieties. To test this hypothesis, the 6B4 peptide was translated in vitro by using the PURE system (Seebeck et al., J Am Chem Soc 128:7150 (2006)) and the dibromoxylene cyclization reaction was performed during peptide purification on a Ni-NTA column. MALDI TOF analysis revealed a molecular weight of 3,054 for the linear peptide (formylated) and 3,258 for the cyclic peptide (6B4C), corresponding to the addition of two xylene moieties to the peptide (Fig. 4A). When the 6B4 peptide was synthesized by F-moc chemistry, it exhibited a similar double-cyclization product after treatment with dibromoxylene on a Ni-NTA resin (Fig. 5). The synthetic 6B4 was not formylated at the N terminus and the molecular weight of the peptide, which is 3,026 for linear form and 3,230 for the cyclic form, is therefore 28 lower than that of the corresponding in vitro translated peptide (Fig. 5). Configuration of Cyclic Peptide 6B4C

Because peptide 6B4 contains three cysteine moieties, multiple double- cyclization variants of the peptide are possible, assuming histidine reactivity (Fig. 4B). Examining the sequence of 6B4 we found a unique pepsin cleavage site, GVL, between the second and third cysteines. Only one bicyclic configuration, denoted Cl- C2, C3-H (Fig. 4B) would produce two separate cyclic peptides with molecular weights of 1 ,495.7 and 1,753.8 after pepsin cleavage at pH < 2; no other configuration would generate two separate products. MALDI-TOF analysis confirmed that the mass peak of 3,230 completely disappeared from the spectrum, whereas new peaks of 1,495.4 and 1,753.5 appeared (Fig. 4C). We conclude that the major configuration of the peptide is C1-C2, C3-H, although other variants may be present at substantially lower quantities in the peptide mixture.

Binding to HCV IRES RNA

Radiolabeled peptide in both cyclic and linear forms was used to measure binding affinity to HCV IRES RNA and other nonspecific RNAs by equilibrium ultrafiltration (Fig. 6A and Table 7; see also Figs. 7 and 8). The K_d of the linear peptide for HCV IRES RNA was 6.5 nM, whereas the K_d of the cyclic peptide was 0.70 nM. Affinities of the cyclic peptide 6B4C to nonspecific RNA targets such as TYR and a 319-nt-long mRNA (CW mRNA) were 140 and 98 nM, respectively.

Table 7

Compound M_x IRES K_d, nM RRE K₀, Class 1 ligase IC₅₀ nM Ka, nM HeLa, nM

3,026.4

6B4 3.3 ± 0.8⁺ (6.5 ± 27 ± 4 219 ± 20 95 3,053.9* 1.8*)

3,230.5 0.65 ± 0.12^T (0.70

6B4C 114 ± 5 228 ± 24 64 3,258.6* ± 0.14^J)

6B48 923.4 17.5 ± 2.7^t 206 ± 1 818 ± 81 125 6B48C 1,024.99 3.7 ± 0.5^f 118 ± 9 l,109 ± 109 76

Mifepristone 429.6 N/A N/A N/A 1,200

*Formylated peptide synthesized by in vitro translation.

^Measured by competitive binding by using fluorescent F1-6B4 peptide.

⁺Measured by direct binding using radiolabeled 6B4 peptide.

We then prepared a linear fluorescein-labeled peptide F1-6B4 for use in competitive binding experiments to allow for the measurement of affinities of unlabeled synthetic peptide variants of the selected peptide. Equilibrium ultrafiltration experiments by using F1-6B4 and varying concentrations of HCV IRE RNA revealed a K_d of 3.0 nM. The /Cd values obtained by competitive binding assays for chemically synthesized 6B4 in linear and cyclic form were 3.3 nM and 0.65 nM (Tables 5 and 6), respectively, similar to the values obtained by the direct binding assay by using radiolabeled 6B4 and 6B4C. We also measured the affinities of 6B4 and 6B4C for RRE and class I ligase RNAs, which were not used during the selection (Table 7). The linear 6B4 peptide exhibited only moderate specificity (8- and 70-fold tighter IRES binding vs. RRE and class I ligase, respectively), whereas the cyclic 6B4C peptide was highly specific (-150- and 300-fold, respectively). Inhibition of IRES-Mediated Translation Initiation In vitro To determine whether the selected peptide can specifically inhibit translation initiated from the HCV IRES, we prepared two constructs with Gaussia Luciferase (GLuc) as a reporter gene. In one construct translation of the GLuc gene was placed under the control of the HCV IRES and, in the other construct, translation was controlled by a generic consensus leader sequence carrying a 5' m7GpppG cap analog (Fig. 9A). In HeLa cell translation extract the IRES-GLuc and the m7GpppG cap analog leader-GLuc mRNA constructs exhibited similar levels of translation, whereas the uncapped mRNA construct was translated very inefficiently (Fig. 10A). The linear and cyclic peptides 6B4 and 6B4C were found to selectively inhibit IRES- initiated translation of GLuc with IC₅₀S of 95 and 64 nM, respectively, at an mRNA concentration of 50 nM (Fig. 9B and Table 7). Translation of capped leader-GLuc was not inhibited by up to 5 μM peptide (Fig. 9C). Thus, the inhibition of translation by 6B4C in vitro was specific for IRES-initiated translation. As a positive control for both experiments we used 1-2 μM mifepristone, which has previously been shown to inhibit HCV IRES-mediated translation. Mifepristone produced -50% inhibition of Gaussia Luciferase translation from the IRES-GLuc construct while not affecting the translation of the leader-GLuc constructs.

Minimal Active Structure of 6B4 Peptide To identify the minimal region of the selected 6B4 peptide responsible for the

HCV IRES binding and translation inhibition properties, we performed experiments with shorter synthetic versions of the 6B4 peptide. Based on the results of pepsin digestion of the 6B4C, we synthesized the N-terminal loop of this peptide, an 8-mer KCSRGIRC (SEQ ID NO:1) (referred to as 6B48), and performed the cyclization reaction in solution (to generate 6B48C). We studied the affinity of the purified linear and cyclic peptides for HCV IRES RNA and their potential as inhibitors of IRES- initiated translation (Table 7). The 8-mer peptide was 3- to 5-fold weaker in affinity for the IRES than the full-length 27-mer 6B4 or 6B4C, with a K_Λ of 17.5 nM in linear and 3.7 nM in cyclic form (Fig. 6B and Table 7). The specificity of this shorter-cyclic peptide is similar to that of full-length 6B4C. K^ measured by competitive binding for 6B48C to a 319-mer mRNA and ribosomal RNA were found to be 161 and 276 nM, respectively. Affinities to RRE RNA and class I ligase were -120 nM and 0.8 μM, respectively (Table 7). Both linear 6B48 and cyclic 6B48C peptides specifically inhibit IRES-initiated translation in HeLa extracts (Figs. 9D and 9E). The IC₅₀ of linear 6B48 for IRES-initiated translation inhibition was found to be 125 nM, and for 6B48C it was 76 nM, at an mRNA concentration of 50 nM (Table 7 and Fig. 9D). The translation of leader-GLuc and capped leader-GLuc constructs was not inhibited in HeLa extracts by up to 2 μM these peptides (Fig. 9E). The similar IC₅₀ values observed for all peptides in translation inhibition assays reflect the fact that the IRES- mRNA construct used in the translation reactions was present at a concentration well above the K_d for the peptides.

Uptake of the 8-mer peptide into the cells The uptake of the full length 27-mer bicyclic 6B4C peptide was studied as follows and is shown in Fig. 11. FITC-6B4C conjugate was prepared by the reaction of 6B4C peptide with fluoresceine isothiocyanate (FITC) in water/DMF mixture (1 :1) at pH 6.9 (50 mM Na phosphate buffer). The compound was purified by gel filtration on a Sephadex G- 10 spin column. A549 cells were incubated with FITC-6B4C 30 min in Ix PBS supplemented with 0.1% BSA at room temperature, then washed and fixed on the slide. The images were observed using optical and fluorescent microscopy at 488 excitation wavelenth, 2Ox magnification, cells fixed on the slide.

Materials and Methods HCV IRES RNA

Cloned HCV IRES of genotype Ib (nucleotides 40-372) was a gift from J. Doudna (Berkeley). The 5 '-terminal 40 nucleotides (a stem-loop) were added by PCR to ensure cotranscriptional folding of IRES RNA. A minimum of 1 mM Mg²⁺ was maintained in all IRES dilution buffers to stabilize the folded state of the RNA. Twenty-three nucleotides were added by PCR on the 3' end of the construct to ensure synthesis of the fully functional IRES (Fig. 2A). IRES RNA (nucleotides 1-395), including the complete HCV 5' UTR and 54 nucleotides of the HCV coding region, was prepared by in vitro transcription by using T7 RNA polymerase. The immobilized IRES RNA selection column was generated by transcription of IRES 1-395 with GTP-γ-S followed by covalent attachment to iodoacetyl-activated cross-linked acrylamide resin (Pierce); the resin was then quenched by reaction with mercaptoethanol. The concentration of IRES immobilized on the column was estimated by immobilization of radiolabeled IRES to be 7.5-10 nmol/ml of resin. HIV RRE RNA and Class I Ligase Ribozyme

HIV Rev responsive element (RRE, 247-mer) template was PCR-amplified from the pNL4— 3 plasmid (National Institutes of Health AIDS Research & Reference Reagent program) that contains a full HIV pro virus copy, using primers T7RRE5, GCTAATACGACTCACTATAGAGCAGTGGGAATAGGAGC (SEQ ID NO: 164) and 3RRE, AGGAGCTGTTGATCCTTTAGGTATC (SEQ ID NO: 165). RRE RNA was in vitro transcribed by using T7 RNA polymerase from the PCR template. Purified 140-nt-long class I ligase ribozyme RNA was a generous gift from David M. Shechner and Dr. David P. Bartel (Whitehead Institute, Massachusetts Institute of Technology). Affinities of the peptides to noncognate RNA targets such as HIV RRE RNA, class I ligase ribozyme, as well as rRNA, tRNA, and CW mRNA, were measured as described above.

Selection Library Synthesis

The DNA library included a random 30-nt region flanked by cysteine codons (see Fig. 2B for details) and was synthesized by the Keck facility at Yale University. Transcription, in vitro translation, and mRNA-peptide fusion formation were done essentially as described in Liu et al. Methods Enzymol 318.268 (2000), with minor modifications as follows. For round 1, 2 nmol of cross-linked mRNA was translated in vitro in 4 ml of wheat germ (WG) extract (Promega), instead of 10 ml of RRL, for 1 h at 30°C. Cyclization was performed on an oligo(dT) cellulose (NEB) column equilibrated with cyclization buffer [660 mM KCl, 20 mM Tris, pH 8.0, 0.2 mM TCEP, and 3 mM /?,./? '-dibromo-w-xylene (Aldrich) in 30% acetonitrile/70% water mixture] and incubated for 1 h with gentle shaking. The cyclized fusions were eluted, concentrated, and then purified on a Ni-NTA column (Qiagen) under denaturing conditions. The purified fusions were ethanol precipitated and reverse transcribed (Fig. 2B). In subsequent rounds, translation and fusion formation were performed in 1-2 ml of WG extract and all purification procedures were done in proportionally smaller volumes. The DNA library encodes a T7 promoter, TMV enhancer, start codon ATG, X-codon RRR (which could translate into Arg, Lys, GIu, Asp, or GIy). It also includes a random 30-nt region (NNB)IO, encoding a random 10-mer peptide, flanked by cysteine codons TGC. The choice of NNB random triplets decreases the number of stop codons in the random portion. The 3' constant region encodes a GSVG spacer and 6 histidines (his6-tag). The nine nucleotides downstream of the his6-tag are complementary to the 2'-0-Me RNA portion of the cross-linking puromycin- terminated oligonucleotide. They encode the tripeptide HRL, which is followed by a TAG stop codon. We have found that the mRNA is translated up to the stop codon, so all peptide sequences contained the HRL tripeptide at their C termini. The 3' constant region contains two additional out-of-frame stop codons. The double- stranded DNA library was prepared by primer extension by using the 3LIBHIS primer and purified by 10% native PAGE. The DNA library was in vitro transcribed by T7 RNA polymerase to generate the mRNA library. The puromycin oligo (25 μM) was annealed to the mRNA library (10 μM) in 2 ml of buffer, containing 20 mM Hepes, pH 7.4, 100 mM KCl, 1 mM spermidine, and 1 mM EDTA, and was cross-linked by UV 365-nm irradiation. Photo-cross-linked mRNA was purified by 8% denaturing 8 M urea PAGE. For round 1 in vitro translation and fusion formation was performed in 4 ml of wheat germ (WG) extract (Promega) with 0.5 μM cross-linked mRNAfor 1 h at 30°C. The translation reaction was then stopped by dilution with 940 μl of 2.5 M KCl and 260 μl of 1 M MgC12, incubated for 15 min at room temperature, and then frozen at -20°C to facilitate fusion formation. The sample (5.2 ml), containing an estimated 0.2 nmol of fusions, was then diluted to 20 ml with buffer A [I M NaCl, 20 mM Tris HCl, pH 8.0, 0.2% Tween-20, 0.2 mM Tris(carboxyethyl)-phosphine (TCEP), 20 mMEDTA] and applied to 500 mg of oligo(dT) cellulose (NEB), soaked in 15 ml of buffer A for 30 min at 4°C with gentle shaking. The resin with the absorbed fusions was loaded on a 15-ml disposable plastic column (Bio-Rad) and washed extensively with buffer A. The column was equilibrated with the cyclization buffer (660 mM KCl, 20 mM Tris, pH 8.0, 0.2 mM TCEP, and 3 mM dibromo-m- xylene in 30% acetonitrile/70% water mixture) and was incubated for 1 h with gentle shaking. After cyclization, the column was washed with 3 column volumes of 300 mM KCl, 20 mM Tris HCl, pH 7.2, and eluted with 2 mM Tris, pH 7.2, in 500-μl fractions. The cyclized fusion were collected, concentrated, and then dissolved in 6 M guanidine HCl/50 mM sodium phosphate buffer, pH 8.0, and applied to a Ni-NTA column (Qiagen). The column was washed with the same buffer, then with 50mMsodium phosphate, pH 8.0, 2OmM imidazole buffer, and finally eluted with 400 mM imidazole. The fusions were ethanol-precipitated and reverse-transcribed by using RT primer (Fig. 2B). In all rounds of selection, PCR amplification of the eluate was performed with 5T7TMVLib and 3LIBHIS primers, as indicated in Fig. 2. Selection of IRES RNA Binders

Cyclic peptide-mRNA fusions were applied to an IRES selection column and incubated for 15-20 min in selection buffer S (20 mM Hepes, pH 7.5, 5 mM MgCl₂, 1 mM DTT, 0.05% Tween 20, 10 units/ml RNasin), supplemented with different concentrations of NaCl, arginine, and Torula Yeast RNA (TYR) (see below and Table 4). The column was washed with 10-20 column volumes of the same buffer and then eluted. The eluted material was PCR-amplified and used to initiate the next round of selection (summarized in Table 4). In rounds 1 and 2 buffer S was supplemented with 0.75 M NaCl, 10 mM arginine, and 20 μM TYR. After washing, mRNA-peptide fusions captured on the column were eluted by either 10 mM NaOH (round 1) or 8 M urea (round 2). For rounds 3-7, buffer S was supplemented with 0.5 M NaCl, 15 mM arginine, and 80 μM TYR. Preelution was performed in the same buffer with 100 μM TYR for 2 h and this eluate was discarded. Specific elution was performed with 10 μM freshly transcribed soluble IRES in buffer S + 200 mM NaCl for 2—4 h at room temperature. In rounds 8-1 1, the preelution was performed in buffer S containing 0.5 M NaCl supplemented with up to 30 μg/μl of additional competitor RNA, such as Escherichia coli 16S and 23S RNA (Roche), phenol-extracted rabbit ribosomes, obtained by gel filtration of RRL on a Sepharose-6B column (Aldrich), a 319-nt-long mRNA derived from an unrelated selection, and a Tetrahymena intron RNA in vitro transcribed by T7 RNA polymerase. This eluted material was discarded. The first specific elution was done with 10-12 μM soluble IRES in buffer S + 200 mM NaCl for 1-2 h; this eluate was also discarded. The second specific elution was carried out by using 10 μM IRES in buffer S + 200 mM NaCl for 12-16 h at +4°C and only this eluted sample was used for the initiation of the next round of selection. PCR products obtained after rounds 6, 7, and 1 1 were cloned into the TOPO-TA vector (Invitrogen) and sequenced. The selection stopped after 1 1 rounds. In vitro Translation and Cyelization of Peptide 6B4

In vitro translation of the 6B4 peptide was performed in a reconstituted E. coli translation mixture (PURE system) in the presence of ³⁵S methionine, with cyelization on a Ni-NTA column, and analyzed by MALDI TOF as previously described. Briefly, in vitro translation of the 6B4 peptide was performed in a reconstituted E. coli translation mixture (PURE system; 3) in the presence of 35S methionine, with cyelization on a Ni-NTA column. Translation buffer contained: 1 OmMTris HCl, 10mMMg(OAc)2, 100 mMNH4Cl, pH 7.5 (at 37°C), and reactions (50μl) were typically incubated for 1 h at 37°C. The reactions were diluted with 100 μl of wash buffer (50 mM Tris HCl, 300 mM NaCl, pH 8) and 50 μl of NTA-agarose beads (Qiagen) were added. After incubation (30 min) the agarose beads were washed (wash buffer +0.2 mM TCEP) then treated with 5 mM dibromo-m-xylene (Aldrich) and 0.2 mM TCEP in a 1 :3 acetonitrile/50 mM Tris HCl buffer, pH 8.0, for 1 h at room temperature. The peptides were eluted with 0.2% TFA and the yield was quantified by liquid scintillation counting of 35S methionine. Typical yields were

10-15 pmol from a 50-μl reaction. For MALDI-TOF analysis, peptides were desalted and concentrated by reversephase microchromatography (C 18 Zip Tips, Millipore) and eluted with a 55% acetonitrile, 0.1% TFA solution saturated with α-cyano-4- hydroxycinnamic acid. We used oxidized insulin chain B (Mr 3,495) as a mass standard.

Synthetic 6B4 Peptide

The 27-residue peptide MKCSRGIRCAGVLCGSVGHHHHHHHRL (SEQ ID NO:3) (6B4), the 8-residue variant of 6B4 referred to as 6B48, KCSRGIRC, and the 27-mer 6B4 labeled at its N terminus with the 6-isomer of fluorescein isothiocyanate (F1-6B4) were synthesized by using F-moc chemistry and purified by GenScript Corp. Full-length 6B4 was cyclized with dibromo-m-xylene on a Ni-NTA column as described above, producing a bicyclic derivative of the peptide, 6B4C. The mass spectra of the peptides were determined by MALDI-TOF MS. Peptide 6B48 was cyclized by reaction with 1.1 equiv of dibromo-m-xylene in 1 :3 acetonitrile/50mMTris HCl buffer, pH 8.0, 0.2 mM TCEP for 1 h at room temperature, producing monocyclic 6B48C. The peptides were purified on a 250 x 4.6 mm reverse-phase C-18 HPLC column in a gradient of 10-50% acetonitrile with 0.1% TFA (6B4C and 6B48C) or a 10-70% acetonitrile gradient in 0.1 M TEAB, pH 7.8 (F1-6B4). The molecular weight of the peptides were determined by MALDITOF MS.

Pepsin Digestion of 6B4C

Linear 6B4 and bicyclic 6B4C peptides were digested to completion with 0.1 % pepsin for 30 min at 30°C in 0.1 % TFA at pH < 2. The reaction was desalted and concentrated by using Cl 8 Zip Tips (Millipore) and was analyzed by MALDI- TOF.

Solution Binding Assays

The ³⁵S-labeled peptide 6B4 was synthesized by in vitro translation, cyclized on a Ni-NTA column when necessary, desalted on a Sephadex G-IO spin column, and purified on a PepClean C-18 spin-column (Pierce). For each data point, 200 μl of 1 nM linear 6B4 or 0.5 nM cyclic 6B4C peptide in buffer (20 mM Tris HCl, pH 7.5, 200 mM KCl, 5 mM MgCl₂, 0.05% Triton X-100) was incubated for 1 h with freshly transcribed and purified HCV IRES RNA. RNA concentration was measured by UV absorption (Cary UV spectrometer). Equilibrium ultrafiltration measurements of dissociation constants were performed as described in Davis et al. Proc Natl Acad Sci 99:11616 (2002).

The fluorescein-labeled peptide F1-6B4 was used as a probe for solution binding and competition experiments. Briefly, Fluorescent peptide F1-6B4 was used as a probe for solution binding and competition experiments. A sample of 200 μl of 0.4-2 nM F1-6B4 in a buffer (20 mM KHEPES, pH 7.4, 300 mM NaCl, 5 mM MgC12, 2 mM CaC12, 0.025% Triton X-100, and 0.5% DMSO), was incubated for 1 h with an increasing concentration of freshly transcribed and purified HCV IRES RNA. Equilibrated solutions (200 μl) were transferred to YM-30 spin filters (Millipore) and centrifuged for 15 s at 13,500 X g to yield about 10 μl of filtrate, which was discarded. After an additional spin of 1.5 min, top and bottom samples (about 90 μl each) were transferred into a 80-μl quartz cuvette, and fluorescence spectra were collected in a range of 505-550 nm (slit width, 10 nm) on a Cary Eclipse spectrofluorimeter (Varian) at excitation wavelength 495 nm (slit width, 5 nm) at high PMT voltage (800 V); smoothing, using the moving average method with factor 6. The spectrum of buffer without fluorescent tracer was collected each time and subtracted from a fluorescence spectrum. The average value was calculated for the emission range of 517-522 nm and was used to quantify the amount of fluorescent peptide in each sample. Seven to fifteen values for the fraction of bound ligand were measured and plotted against IRES concentration. The solution binding data then were fit to the following binding equation by using KaleidaGraph (5): Y = B + F * 1/(1 + K), where Y = the fraction of labeled peptide bound to IRES RNA, I = the HCV IRES concentration, B = nonspecific binding of the peptide to filter, F = maximum fraction of counts that can be bound, K = the dissociation constant (ml, F and K are parameters fitted through nonlinear regression). For competitive binding experiments, to 200 μl of 0.4-0.625 nM F1-6B4 and 15-18 nM IRES (determined to give approx. 70% binding), preequilibrated for 1 h in the same buffer, increasing concentrations of competing peptides were added and incubated for an additional 1 h. The samples were then treated as described above. The solution binding data using unlabeled competitor peptides were fit to the following binding equation: Y = {K/[IF - 0.5*{(IF + C + X) - ((IF + C + X)² - 4IFC)^I/2}] + I }^"1, where Y = the fraction of Fl- 6B4 bound to IRES (normalized to 1 at the absence of competitor peptides), K = the determined dissociation constant for F1-6B4, X = the dissociation constant for the competitor peptide, I = the IRES concentration, C = the unlabeled competitor concentration, and F =the fraction of the IRES that is correctly folded.

A sample of 200 μl of 2 nM F1-6B4 in buffer (20 mM Hepes, pH 7.4, 300 mM NaCl, 5 mM MgCl₂, 2 mM CaCl₂, 0.025% Triton X-100, and 0.5% DMSO), was incubated for 1 h with a series of increasing concentrations of HCV IRES RNA.

Equilibrium ultrafiltration was performed by using YM-30 spin filters (Millipore) and fluorescence spectra of top and bottom chambers were collected on a Varian Cary Eclipse spectrofluorimeter (see Fig. 5 for examples). The K^ of F1-6B4 was calculated as described in Davis et al. Proc. Natl. Acad. Sci. USA 99:1 1616 (2002). For competitive binding experiments, 200 μl of 0.4-0.6 nM F1-6B4 and 15-18 nM IRES (determined to give —70% binding), was preequilibrated for 1 h in binding buffer, then increasing concentrations of competing peptides were added and incubated for an additional 1 h. Samples were then treated as described above. IRES-Reporter Gene Constructs The HCV IRES (1-371) sequence, including 30 nucleotides of the core protein coding region, was added in frame to a Gaussia luciferase (GLuc, NEB) reporter gene. Control reporter gene constructs were prepared by PCR by using the same GLuc sequences downstream of a 32-mer leader sequence (Fig. 9A). The constructs were PCR amplified and used for the transcription of mRNA by T7 RNA polymerase. Capped constructs were prepared by transcription in the presence of 10 mM cap analog m⁷GpppG (NEB).

HeLa SlO Extract Preparation and In Vitro Translation in HeLa SlO HeLa SlO translation extract was prepared as described in Otto et al. Cell

119:369-380 (2004) from a 6-ml HeLa S3 cell pellet obtained from the National Cell Culture Center. HeLa cell extract translation reactions were carried out as described (ibid). For the measurement of luciferase activity, 50-μl reactions containing 10—50 nM reporter construct mRNAs were incubated for 1 h at 30°C. Different concentrations of peptides were premixed with measured amounts of mRNA before addition to in vitro translation extracts. For the visualization of GLuc translation, the Renilla luciferase assay kit (Promega) was used, because coelenterazine is the substrate for both Renilla and Gaussia luciferases. Samples of 10-15 μl of translation reactions were transferred into black 96-well plates (Corning) and mixed with an equal volume of 1 x lysis buffer. The coelenterazine solution in the assay buffer was added and the light output was measured on a TopCount NXT luminometer plate reader (Perkin-Elmer).

SUMMARY As is described above, we have isolated effective and specific inhibitors of

HCV IRES-initiated translation. We have described the selection of high-affinity peptide binders to the HCV IRES from a cyclic peptide-mRNA fusion library of 10 trillion individual sequences (Roberts et al., Proc. Natl. Acad. Sci. USA 94: 12297 (1997); Liu et al., Methods. Enzymol. 318:268 (2000)). After 1 1 rounds of selection, we isolated a bicyclic peptide that binds the HCV IRES tightly and specifically, and selectively inhibits the IRES-initiated translation of a reporter gene in vitro.

We have selected peptide aptamers from a very large library of cyclic peptide- mRNA fusions under conditions that stringently select against nonspecific binding. We used cyclized peptides to minimize the entropic cost of peptide binding to the target RNA. To ensure high affinity and specificity of the selected peptide aptamers, the binding selection was carried out in the presence of high concentrations of salt and arginine to reduce nonspecific electrostatic interactions, along with high concentrations of competitor RNA to minimize nonspecific binding. We also used competitive elution of the fusions from the selection column with soluble IRES RNA as a further selection for specific binding. After seven rounds of the selection, we observed a large number of peptide sequences (including 6B4) allowing for high- affinity IRES RNA binding (Barrick et al., Proc. Natl. Acad. Sci. USA 98: 12374 (2001)), and after four more rounds of selection the highly specific peptide 6B4 accounted for 30% of the surviving sequences.

The selected 6B4 peptide has several noteworthy features. Most striking is the presence of a cysteine residue at a position in the peptide derived from the random region of the original peptide library. This additional cysteine moiety allows for double cyclization after reaction with dibromoxylene: two of the cysteines form one loop, whereas the third cysteine and a histidine (Rogers et al., J. Biol. Chem. 251 :5711 (1976)) form the second. A unique pepsin cleavage site in the 6B4 sequence allowed for unambiguous assignment of the structure of the bicyclic 6B4C: the first loop is between the first two cysteines, and the second loop is between the third cysteine and one of the histidine residues of the his-tag. The factors that drive cyclization into this particular structure are unknown, but may include preorganization of the peptide structure, or greater steric accessibility of the N- terminal region of the peptide when the peptide is immobilized on a Ni-NTA resin via its C-terminal his-tag. A chemically synthesized N-terminal 8-mer peptide bound to IRES RNA almost as well as the full-length 27-mer peptide, suggesting that the N- terminal region contains essentially all of the specificity determinants of the selected peptide. The N-terminal 8-mer peptide contains three basic residues, which are likely to contribute to binding by interaction with specific phosphates in the folded RNA structure. The approximately threefold weaker IRES binding of the 8-mer vs. the original 27-mer may reflect the loss of interactions with the his-tag portion of the peptide. The approximately fivefold tighter IRES binding of the cyclic compared with the linear peptides probably reflects an entropic binding advantage for the conformational Iy constrained cyclic peptides. The cyclic peptides also exhibited much greater IRES specificity than the corresponding linear peptides, based on a comparison of binding to IRES RNA and to two highly structured RNA molecules that were not used in the selection (rre RNA and class I ligase ribozyme RNA) (Table 7). These observations reinforce the need for cyclization to obtain highly specific RNA-binding peptides. The cyclic 6B4C peptide was selected solely on the basis of high affinity and specificity binding to the IRES RNA; it is therefore quite striking that binding does indeed lead to the specific inhibition of IRES-mediated translation initiation. This suggests that the IRES RNA contains a highly structured region that is essential for function, and that acts as an epitope that is particularly suitable for binding to a structured ligand. Peptide binding could inhibit translation initiation by simple steric blockade of interaction with the translational apparatus. Alternatively, ligand binding could prevent an essential conformational transition of the IRES RNA. Our results demonstrate that high-affinity, high-specificity peptide aptamers can be isolated from a sufficiently large starting library by in vitro selection as long as stringent and selective enrichment procedures are used. The relatively small size of 6B48 peptide (Mr of 923 for the linear and 1,025 for the cyclic form), makes it and modified forms of the 6B48 a useful molecule for treating HCV.

Other embodiments Various modifications and variations of the described methods and compositions of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific desired embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the fields of medicine, immunology, pharmacology, endocrinology, or related fields are intended to be within the scope of the invention.

All publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent publication was specifically and individually incorporated by reference.

What is claimed is:

Claims

Claims

1. A peptide of 30 or fewer amino acids, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 50 nM or less.

2. The peptide of claim 1, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 10 nM or less.

3. The peptide of claim 1, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 1 nM or less.

4. The peptide of claim 1, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 0.1 nM or less.

5. The peptide of claim 1, wherein said peptide is modified.

6. The peptide of claim 5, wherein said peptide is modified to have increased stability.

7. The peptide of claim 1, wherein said peptide is cyclic.

8. A peptide comprising the amino acid sequence of SEQ ID NO: 16, wherein said peptide is 30 or fewer amino acids.

9. The peptide of claim 8, wherein said peptide comprises the amino acid sequence of SEQ ID NO: 1.

10. The peptide of claim 1 , wherein said peptide comprises the amino acid sequence of SEQ ID NO:3.

1 1. A peptide comprising the amino acid sequence of any one of SEQ NOs:

22-163.

12. The peptide of claims 8 or 1 1, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 50 nM or less.

13. The peptide of claim 12, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 10 nM or less.

14. The peptide of claim 13, wherein said peptide specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 1 nM or less.

15. The peptide of claim 14, wherein said specifically binds to HCV IRES (SEQ ID NO: 172) with a Kd of 0.1 nM or less.

16. The peptide of claims 8 or 11 , wherein said peptide is cyclic.

17. The peptide of claims 8 or 11 , wherein said peptide is modified.

18. The peptide of claim 17, wherein said peptide is modified to have increased stability.

19. The peptide of claim 17, wherein said peptide is modified to include a modification selected from the group consisting of D-amino acids, N-methyl amino acids, peptoids, and side chain analogs.

20. The peptide of claims 8 or 11, wherein said peptide is a fusion protein.

21. A pharmaceutical composition comprising the peptide of claims 1, 8, or 1 1.

22. A method of treating a subject having, or at risk of developing, a Hepatitis C virus infection, said method comprising administering to said subject the composition of claim 21.

23. Use of a peptide according to any one of claims 1 to 20 in the manufacture of a medicament for the prevention or treatment of an HCV infection.

24. A peptide according to any of claims 1 to 20 for use as a medicament.

25. Use of a peptide according to any one of claims 1 to 20 in the inhibition of HCV replication.

26. Use of a peptide according to any one of claims 1 to 20 in the blocking of the translation of HCV mRNA.