WO2008137692A1 - Treatment of synucleinopathies - Google Patents

Treatment of synucleinopathies Download PDF

Info

Publication number
WO2008137692A1
WO2008137692A1 PCT/US2008/062437 US2008062437W WO2008137692A1 WO 2008137692 A1 WO2008137692 A1 WO 2008137692A1 US 2008062437 W US2008062437 W US 2008062437W WO 2008137692 A1 WO2008137692 A1 WO 2008137692A1
Authority
WO
WIPO (PCT)
Prior art keywords
synuclein
group
substituted
alkyl
disease
Prior art date
Application number
PCT/US2008/062437
Other languages
French (fr)
Inventor
Peter T. Lansbury, Jr.
Craig J. Justman
Original Assignee
Link Medicine Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Link Medicine Corporation filed Critical Link Medicine Corporation
Publication of WO2008137692A1 publication Critical patent/WO2008137692A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A61K31/497—Non-condensed pyrazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4985—Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems

Definitions

  • the present invention relates to the treatment of neurodegenerative diseases, particularly synucleinopathies, such as Parkinson's disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and various neuronal brain iron accumulation disorders including pantothenate kinase-associated neurodegeneration, using a farnesyl transferase inhibitor in combination with an ⁇ -synuclein aggregation inhibitor.
  • PD Parkinson's disease
  • DLBD diffuse Lewy body disease
  • MSA multiple system atrophy
  • pantothenate kinase-associated neurodegeneration using a farnesyl transferase inhibitor in combination with an ⁇ -synuclein aggregation inhibitor.
  • Synucleinopathies are a diverse group of neurodegenerative disorders that share common pathologic lesions including abnormal aggregates of insoluble ⁇ -synuclein protein in selectively vulnerable populations of neurons and glia. Certain evidence links the formation of filamentous aggregates to the onset and progression of clinical symptoms and the degeneration of affected brain regions in neurodegenerative disorders including Parkinson's disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl).
  • PD Parkinson's disease
  • DLBD diffuse Lewy body disease
  • MSA multiple system atrophy
  • PANKl pantothenate kinase-associated neurodegeneration
  • the current treatment options for these diseases include symptomatic medications such as carbidopa- levodopa, anticholinergics, and monoamine oxidase inhibitors, with widely variable benefit. Even for the best responders, i.e., patients with idiopathic Parkinson's Disease, an initial good response to levodopa is typically overshadowed by drug-induced complications such as motor fluctuations and debilitating dyskinesia, following the first five to seven years of therapy. For the rest of the disorders, the current medications offer marginal symptomatic benefit. Given the severe debilitating nature of these disorders and their prevalence, there is a clear need in the art for novel approaches towards treating and managing these diseases. Summary of the Invention
  • the present invention relates to novel therapeutic approaches to the treatment of synucleinopathies, such as Parkinson's disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl), using a combination of a farnesyl transferase inhibitor and an agent that inhibits the aggregation of ⁇ -synuclein.
  • PD Parkinson's disease
  • DLBD diffuse Lewy body disease
  • MSA multiple system atrophy
  • PANKl pantothenate kinase-associated neurodegeneration
  • ALS amyotrophic lateral sclerosis
  • HD Huntington's Disease
  • AD Alzheimer's Disease
  • the invention in part stems from the recognition that when both these agents are administered to a subject there is an unexpected synergy or additive effect between the two agents. That is, in certain embodiments, lower doses of these agents can be used than when the agents are administered individually.
  • the invention provides methods for treating a subject with a synucleinopathy or other neurodegenerative diseases by administering amounts of a farnesyl transferase inhibitor and an agent that inhibits the aggregation of ⁇ -synuclein, that are therapeutically effective when combined.
  • the agents i.e., the farnesyl transferase inhibitor and the ⁇ -synuclein aggregation inhibitor
  • the farnesyl transferase inhibitor is of one of the formulae disclosed herein, or a derivative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • the farnesyl transferase inhibitor is LNK-754 (OSI-754; CP-609,754). In certain embodiments, the farnesyl transferase inhibitor is Zarnestra. In certain embodiments, the farnesyl transferase inhibitor is SCH66336 (lonafarnib, Sarasar). In certain embodiments, the farnesyl transferase inhibitor is SCH44342. In certain embodiments, the farnesyl transferase inhibitor is Tipifarnab. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is nortriptyline, maprotiline, protriptyline, norclomipramine, sertraline, or indatraline.
  • the ⁇ -synuclein aggregation inhibitor is a tricyclic antidepressant (e.g., a tricyclic antidepressant that has been approved for use in humans).
  • the doses of one or both of the agents are lower than when the agents are used individually.
  • the additive and/or synergistic effect of the inventive combination may be particularly useful in the chronic treatment of a synucleinopathic subject in order to prevent undesired side effects.
  • the agents may be administered together or sequentially.
  • the invention also provides methods for treating a subject with a synucleinopathy or other neurodegenerative disease by administering the inventive combination with another therapeutic agent.
  • the agents may be administered as a combination composition comprising all of the agents.
  • the agents can be administered separately (e.g., as different compositions) either simultaneously, sequentially, or intermittently as described herein.
  • the other therapeutic agent may be, but is not limited to, dopamine agonists (e.g., pramipexole, apomorpine), monoamine oxidase inhibitors (e.g., rasagiline), glutamate antagonists (e.g., memantine), anticholinergic agents (e.g., trihexyphenidyl), acetylcholinesterase inhibitors (e.g., rivastigmine), cannabinoid antagonists, ampa antagonists, adenosine A2a antagonists, and GMl ganglioside.
  • Other therapeutic approaches the may be used in conjunction with the inventive combination therapy include surigical intervention to deliver vectors (such as viral vectors) or other materials directly into the brain or CNS.
  • the invention provides methods of treating cells in vitro by contacting cells with an effective amount of a combination of a farnesyl transferase inhibitor and an ⁇ -synuclein aggregation inhibitor to reduce the formation of ⁇ -synuclein aggregations.
  • the cells are human cells.
  • the cells are neurons (e.g., established neuronal cell lines or primary neural cells). The inventive method may be used to determine the effectiveness of a particular combination of farnesyl transferase inhibitor and ⁇ - synuclein aggregation inhibitor at reducing or preventing ⁇ -synuclein aggregation.
  • nortriptyline, indatraline, fluoxetine, norfluoxetine, norclomipramine, nordoxepin, maprotiline, and sertraline have been shown to bind ⁇ -synuclein and increase the rate of ⁇ -synuclein aggregation in 1,1,1, 3,3, 3-hexafluoroisopropanol (HFIP). Increased rates of ⁇ -synuclein aggregation in this artificial system have been found to be indicative of reducing ⁇ -synuclein aggregation in vivo.
  • HFIP 1,1,1, 3,3, 3-hexafluoroisopropanol
  • Nortriptyline, indatraline, and fluoxetine were found to reduce ⁇ -synuclein aggregation in an aqueous buffered solution relevant to physiological conditions.
  • Nortriptyline and indatraline were found to reduce ⁇ -synuclein neurotoxicity toward dopaminergic neurons.
  • Nortriptyline was found to reduce ⁇ -synuclein deposition or levels in an ⁇ -synuclein transgenic mouse model that have ⁇ -synuclein neuronal inclusions in the cortex, hippocampus, and the olfactory bulb.
  • compositions or preparations comprising a farnesyl transferase inhibitor and an ⁇ -synuclein aggregation inhibitor are provided.
  • the composition or preparation may optionally include a pharmaceutically acceptable excipient.
  • the farnesyl transferase inhibitor is any of the compounds described herein that have been found to inhibit farnesyl transferase.
  • the farnesyl transferase inhibitor is LNK-754 (OSI-754), Zarnestra, lonafarnib (Sarasar), or Tipifarnab.
  • the ⁇ -synuclein aggregation inhibitor is nortriptyline, maprotiline, protriptyline, norclomipramine, sertraline, or indatraline.
  • the inventive combination comprises LNK-754 as the farnesyl transferase inhibitor and nortriptyline as the ⁇ -synuclein aggregation inhibitor.
  • the inventive composition or preparation includes a therapeutically effective amount of each agent for the treatment of a synucleinopathy or other neurodegenerative disease. The amount of one or both of the agents may be lower than when either agent is administered alone.
  • the composition or preparation may also include other pharmaceutical agents for treating synucleinopathic subjects or subjects with neurodegenerative diseases.
  • kits including the inventive combination of a farnesyl transferase inhibitor and an ⁇ -synuclein aggregation inhibitor.
  • the agents may be packaged separately or together.
  • the kit optionally includes instructions for prescribing the combination.
  • the kit includes multiple doses of each agent.
  • the kit may include sufficient quantities of each component to treat a subject for a week, two weeks, three weeks, four weeks, or multiple months.
  • the present invention contemplates all such compounds, including cis- and trans -isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, the racemic mixtures thereof, and other mixtures thereof, as falling within the scope of the invention. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group. All such isomers, as well as mixtures thereof, are intended to be included in this invention. [0012] Isomeric mixtures containing any of a variety of isomer ratios may be utilized in accordance with the present invention.
  • mixtures containing 50:50, 60:40, 70:30, 80:20, 90:10, 95:5, 96:4, 97:3, 98:2, 99:1, or 100:0 isomer ratios are all contemplated by the present invention.
  • Those of ordinary skill in the art will readily appreciate that analogous ratios are contemplated for more complex isomeric mixtures.
  • a particular enantiomer of a compound of the present invention is desired, it may be prepared by asymmetric synthesis, or by derivation with a chiral auxiliary, where the resulting diastereomeric mixture is separated and the auxiliary group cleaved to provide the pure desired enantiomers.
  • diastereomeric salts are formed with an appropriate optically-active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means well known in the art, and subsequent recovery of the pure enantiomers.
  • protecting group it is meant that a particular functional moiety, e.g., O, S, or N, is temporarily blocked so that a reaction can be carried out selectively at another reactive site in a multifunctional compound.
  • a protecting group reacts selectively in good yield to give a protected substrate that is stable to the projected reactions; the protecting group should be selectively removable in good yield by readily available, preferably non-toxic reagents that do not attack the other functional groups; the protecting group forms an easily separable derivative (more preferably without the generation of new stereogenic centers); and the protecting group has a minimum of additional functionality to avoid further sites of reaction.
  • oxygen, sulfur, nitrogen, and carbon protecting groups may be utilized.
  • Hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p- methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1- methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydr
  • the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4- methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, /?-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1- methoxyethylidene ortho ester
  • Amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7- dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-( 10,10-dioxo- 10,10,10,10- tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2- phenylethyl carbamate (hZ), l-(l-adamantyl)-l-methylethyl carbamate (Adpoc), l,l-dimethyl-2- haloethyl carba
  • protecting groups are detailed herein, however, it will be appreciated that the present invention is not intended to be limited to these protecting groups; rather, a variety of additional equivalent protecting groups can be readily identified using the above criteria and utilized in the method of the present invention. Additionally, a variety of protecting groups are described in Protective Groups in Organic Synthesis, Third Ed. Greene, T.W. and Wuts, P.G., Eds., John Wiley & Sons, New York: 1999, the entire contents of which are hereby incorporated by reference.
  • the compounds, as described herein, may be substituted with any number of substituents or functional moieties.
  • substituted whether preceded by the term “optionally” or not, and substituents contained in formulae of this invention, refer to the replacement of hydrogen radicals in a given structure with the radical of a specified substituent.
  • the substituent may be either the same or different at every position.
  • substituted is contemplated to include all permissible substituents of organic compounds.
  • the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds.
  • heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms.
  • this invention is not intended to be limited in any manner by the permissible substituents of organic compounds.
  • Combinations of substituents and variables envisioned by this invention are preferably those that result in the formation of stable compounds useful in the treatment, for example, of synucleinopathies or other neurodegenerative diseases.
  • stable as used herein, preferably refers to compounds which possess stability sufficient to allow manufacture and which maintain the integrity of the compound for a sufficient period of time to be detected and preferably for a sufficient period of time to be useful for the purposes detailed herein.
  • alkyl refers to the radical of saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups.
  • a straight chain or branched chain alkyl has
  • cycloalkyls have from 3-10 carbon atoms in their ring structure, and more preferably have 5, 6, or 7 carbons in the ring structure.
  • lower alkyl as used herein means an alkyl group, as defined above, but having from one to ten carbons, more preferably from one to six carbon atoms in its backbone structure, and even more preferably from one to four carbon atoms in its backbone structure.
  • lower alkenyl and “lower alkynyl” have similar chain lengths.
  • Preferred alkyl groups are lower alkyls.
  • a substituent designated herein as alkyl is a lower alkyl.
  • halogen designates -F, -Cl, -Br or -I;
  • sulfhydryl means -SH; and
  • hydroxyl means -OH.
  • methyl refers to the monovalent radical -CH 3
  • methoxyl refers to the monovalent radical -CH 2 OH.
  • aralkyl or "arylalkyl”, as used herein, refers to an alkyl group substituted with an aryl group (e.g., an aromatic or heteroaromatic group).
  • alkenyl and alkynyl refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.
  • aryl as used herein includes 5-, 6- and 7-membered single-ring aromatic groups that may include from zero to four heteroatoms, for example, benzene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine, and the like.
  • aryl groups having heteroatoms in the ring structure may also be referred to as "aryl heterocycles" or “heteroaromatics.”
  • the aromatic ring can be substituted at one or more ring positions with such substituents as described above, for example, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, ester, heterocyclyl, aromatic or heteroaromatic moieties, -CF 3 , -
  • aryl also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings (the rings are "fused rings") wherein at least one of the rings is aromatic, e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls and/or heterocyclyls.
  • heterocyclyl or “heterocyclic group” or “heteroaryl” refer to 3- to 10- membered ring structures, more preferably 3- to 7-membered rings, whose ring structures include one to four heteroatoms. Heterocycles can also be polycycles.
  • Heterocyclyl groups include, for example, thiophene, benzothiophene, thianthrene, furan, pyran, isobenzofuran, chromene, xanthene, phenoxathiin, pyrrole, imidazole, pyrazole, isothiazole, isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, pyrimidine, phenanthroline, phenazine, phenarsazine, phenothiazine, furazan, phenoxazine,
  • the heterocyclic ring can be substituted at one or more positions with such substituents as described above, as for example, halogen, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, ketone, aldehyde, ester, a heterocyclyl, an aromatic or heteroaromatic moiety, -CF3, -CN, or the like.
  • substituents as described above, as for example, halogen, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl,
  • each expression e.g., alkyl, m, n, etc., when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.
  • animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to a human at any stage of development. In some embodiments, “animal” refers to a non-human animal at any stage of development. In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and/or worms. In certain embodiments, the animal is a vertebrate.
  • the non-human animal is a mammal (e.g., an ape, a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig).
  • an animal may be a transgenic animal, genetically-engineered animal, and/or clone.
  • Effective amount In general, the "effective amount" of an active agent or combination of agents refers to an amount sufficient to elicit the desired biological response.
  • the effective amount of an inventive combination may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the agents being delivered, the disease being treated, the mode of administration, and the patient.
  • the effective amount of an inventive combination e.g. , farnesyl transferase inhibitor and ⁇ -synuclein aggregation inhibitor
  • the effective amount of an inventive combination is the amount of each component that when given together results in reducing the ⁇ -synuclein aggregation and/or toxicity and/or symptoms and/or disease progression in a subject.
  • compositions which comprise a therapeutically effective amount of one or more of the compounds described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.
  • compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream or foam; sublingually; ocularly; transdermally; or nasally, pulmonary and to other mucosal surfaces.
  • oral administration for example, drenches (aqueous or non-aqueous solutions
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • “Pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
  • materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ring
  • “Pharmaceutically acceptable salt” The term “pharmaceutically acceptable salt” as used herein are meant to comprise the therapeutically active non-toxic acid and non-toxic base addition salt forms that the compounds are able to form.
  • the compounds that have basic properties can be converted into their pharmaceutically acceptable acid addition salts by treating the base form with an appropriate acid.
  • Appropriate acids include, for example, inorganic acids such as hydrohalic acids, e.g.
  • the salt is a tartrate salt.
  • the tartrate salt may be either L-tartric acid or D-tartric acid. Both tartric acids are available from Aldrich Chemical Company, Inc. (Milwaukee, Wisconsin).
  • the salts may be anhydrous or hydrous forms.
  • the compounds that have acidic properties can be converted into their pharmaceutically acceptable base addition salts by treating the acid form with a suitable organic or inorganic base.
  • Appropriate base salt forms include, for example, the ammonium salts, the alkali and earth alkaline metal salts, e.g., the lithium, sodium, potassium, magnesium, calcium salts and the like, salts with organic bases, e.g., the benzathine, N-methyl-D-glucamine, hydrabamine salts, and salts with amino acids such as, for example, arginine, lysine and the like.
  • the terms acid or base addition salt also comprise the hydrates and the solvent addition forms that the compounds are able to form. Examples of such forms are, e.g., hydrates, alcoholates, and the like.
  • certain embodiments of the present compounds may contain a basic functional group, such as amino or alkylamino, and are, thus, capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable acids.
  • pharmaceutically-acceptable salts in this respect refers to the relatively non-toxic, inorganic and organic acid addition salts of compounds of the present invention. These salts can be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting a purified compound of the invention in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed during subsequent purification.
  • Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like.
  • lactate lactate
  • phosphate tosylate
  • citrate maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like.
  • the pharmaceutically acceptable salts of the subject compounds include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from nontoxic organic or inorganic acids.
  • such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like.
  • the compounds of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable bases.
  • pharmaceutically-acceptable salts refers to the relatively non-toxic, inorganic and organic base addition salts of compounds of the present invention. These salts can likewise be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting the purified compound in its free acid form with a suitable base, such as the hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine.
  • a suitable base such as the hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine.
  • Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like.
  • Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like. (See, for example, Berge et ah, supra).
  • Small molecule As used herein, the term “small molecule” is used to refer to molecules, whether naturally-occurring or artificially created ⁇ e.g., via chemical synthesis) that have a relatively low molecular weight. Typically, a small molecule is an organic compound ⁇ i.e., it contains carbon). The small molecule may contain multiple carbon-carbon bonds, stereocenters, and other functional groups ⁇ e.g., amines, hydroxyl, carbonyls, heterocyclic rings, etc.). In some embodiments, small molecules are monomeric and have a molecular weight of less than about 1500 g/mol.
  • the molecular weight of the small molecule is less than about 1000 g/mol or less than about 500 g/mol.
  • Preferred small molecules are biologically active in that they produce a biological effect in animals, preferably mammals, more preferably humans.
  • Small molecules include, but are not limited to, radionuclides and imaging agents.
  • the small molecule is a drug.
  • the drug is one that has already been deemed safe and effective for use in humans or animals by the appropriate governmental agency or regulatory body.
  • drugs approved for human use are listed by the FDA under 21 C. F. R. ⁇ 330.5, 331 through 361, and 440 through 460, incorporated herein by reference; drugs for veterinary use are listed by the FDA under 21 CF. R. ⁇ 500 through 589, incorporated herein by reference. All listed drugs are considered acceptable for use in accordance with the present invention.
  • Synucleinopathic subject As used herein, the term “synucleinopathic subject” or “subject with a synucleinopathy” refers to a subject that is diagnosed with, affected by, or at risk of developing a synucleinopathy (e.g. , predisposed, for example genetically predisposed, to developing a synucleinopathy, or for whom biomarkers suggest a pre-clinical state) and/or any neurodegenerative disorder characterized by pathological synuclein aggregations.
  • a synucleinopathy e.g. , predisposed, for example genetically predisposed, to developing a synucleinopathy, or for whom biomarkers suggest a pre-clinical state
  • any neurodegenerative disorder characterized by pathological synuclein aggregations.
  • synucleinopathies Several neurodegenerative disorders including Parkinson's disease, diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl) are collectively grouped as synucleinopathies.
  • the synucleinopathy is Parkinson's disease.
  • the synucleinopathy is diffuse Lewy body disease (DLBD).
  • DLBD diffuse Lewy body disease
  • the synucleinopathy is multiple system atrophy.
  • the synucleinopathy is a disorder of brain iron concentration (e.g., pantothenate kinase-associated neurodegeneration).
  • the phrase "therapeutically effective amount” as used herein means that amount of a compound or composition which is effective for producing some desired therapeutic effect in a subject at a reasonable benefit/risk ratio applicable to any medical treatment. Accordingly, a therapeutically effective amount prevents, minimizes, slows, or reverses disease progression associated with a synucleinopathy or other neurodegenerative disease. Disease progression can be monitored by clinical observations, laboratory, and/or neuroimaging investigations apparent to a person skilled in the art.
  • a therapeutically effective amount can be an amount that is effective in a single dose or an amount that is effective as part of a multi-dose therapy, for example an amount that is administered in two or more doses or an amount that is administered chronically.
  • Treatment includes prophylaxis and therapy, and includes managing a subject's symptoms and halting the progression of the disease.
  • Treatment includes preventing, slowing, stopping, or reversing (e.g., curing) the development of a synucleinopathy or other neurodegenerative disease, and/or the onset of certain symptoms associated with a synucleinopathy or other neurodegenerative disease in a subject with, or at risk of developing, a synucleinopathy, a related disorder, or other neurodegnerative disease.
  • the therapy typically includes preventing, slowing, stopping or reversing (e.g.
  • Therapy also includes decreasing the amount of accumulated ⁇ -synuclein in a subject with a synucleinopathy or other neurodegenerative disorder.
  • Figure 1 shows that UCH-Ll membrane association is regulated by its farnesylation.
  • Figure 2 shows that C220S mutation abolished the inhibitory effect of UCH-Ll WT on ⁇ -synuclein degradation.
  • Figure 3 shows that farnesyl transferase inhibitor can rescue the ⁇ -synuclein toxicity in infected SH-SY5Y cells overexpressing ⁇ -synuclein.
  • Figure 4 shows that FTI-277 rescued ⁇ -synuclein toxicity in SH-SY5Y cells by reducing the amount of ⁇ -synuclein accumulation.
  • Figure 5 shows the formula of various exemplary farnesyl transferase inhibitors.
  • Figure 6 is a graph showing the number of cells positive for ⁇ -synuclein immunoreactivity in the cortex (top panel) and hippocampus (bottom panel) of 11 month old ⁇ - synuclein transgenic mice after 30 days of treatment with Zarnestra and control. P ⁇ 0.05,
  • Figure 7 shows the (A) frontal cortex of ⁇ -synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel); and (B) hippocampus of ⁇ -synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel). Immunofluorescence analysis of brain sections performed with a primary antibody to full-length human ⁇ -synuclein, then a seocndary Cy2-conjugated antibody. Magnification: 100 fold.
  • Figure 8 shows ubiquitin immunohistochemistry in the cortex and parts of the neuronal layer in the hippocampus of ⁇ -synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel). Magnification: 200 fold.
  • Figure 9 shows Campbell Switzer staining of the Lewy body-like inclusions in the hippocampus of ⁇ -synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel). Magnification: 400 fold.
  • Figure 10 shows the quantification of ⁇ -synuclein by ELISA in the cytoplasmic fraction from the cortex of non-transgenic (ntg) or ⁇ -synuclein transgenic (syn tg) mice treated for 30 days.
  • Figure 11 shows the quantification of ⁇ -synuclein by ELISA in the membrane fraction of the cortex of non-transgenic (ntg) or ⁇ -synuclein transgenic (syn tg) mice treated for
  • Figure 12 shows the quantification of farnesylated UCH-Ll in the membrane fraction from the cortex of non-transgenic (ntg) or ⁇ -synuclein transgenic (syn tg) mice treated for 30 days.
  • Figure 13 shows the quantification of ⁇ -synuclein by ELISA in the cytoplasmic fraction from the cortex of ⁇ -synuclein transgenic mice treated for 30 days.
  • Figure 14 shows the quantification of ⁇ -synuclein by ELISA in the membrane fraction from the cortex of ⁇ -synuclein transgenic mice treated for 30 days.
  • Figure 15 shows the quantification of UCH-Ll in the membrane fraction from the cortex of ⁇ -synuclein transgenic mice treated for 30 days.
  • Figure 16 shows the quantification of ⁇ -synuclein by ELISA in the cytoplasmic fraction from the cortex of ⁇ -synuclein transgenic mice treated for 90 days.
  • Figure 17 shows the quantification of ⁇ -synuclein by ELISA in the membrane fraction from the hippocampus of ⁇ -synuclein transgenic mice treated for 90 days.
  • Figure 18 demonstrates the number of cells positive for ⁇ -synuclein immunoreactivity in the cortex (top panel) and hippocampus (bottom panel) of 7 month old ⁇ - synuclein transgenic mice after 90 days of treatment.
  • Figure 19 shows the cortex and hippocampus of 7 month old ⁇ -synuclein transgenic mice after 90 days of treatment with vehicle or OSI-754. Immunofluorescence analysis of brain sections performed with a primary antibody to human ⁇ -synuclein, then a secondary Cy2- conjugated antibody. Magnification: 20 fold.
  • Figure 20 shows the cortex and hippocampus of 7 month old ⁇ -synuclein transgenic mice after 90 days of treatment with vehicle or OSI-754. Immunofluorescence analysis of brain sections performed with a primary antibody to NeuN. Magnification: 20 fold.
  • Figure 21 shows that nortriptyline binds to ⁇ -synuclein and affects the rate of structure formation in the presence of l,l,l,3,3,3-hexafluoro-2-propanol (HFIP).
  • Figure 22 shows that indatraline binds to ⁇ -synuclein and affects the rate of structure formation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP).
  • Figure 23 shows that fluoxetine and norfluoxetine bind to ⁇ -synuclein and affect the rate of structure formation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP).
  • HFIP 1,1, 1,3,3, 3-hexafluoro-2-propanol
  • Figure 24 shows that protriptyline and maprotiline bind to ⁇ -synuclein and affect the rate of structure formation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP).
  • HFIP 1,1, 1,3,3, 3-hexafluoro-2-propanol
  • Figure 25 shows that norclomipramine and nordoxepin bind to ⁇ -synuclein and affect the rate of structure formation in the presence of l,l,l,3,3,3-hexafluoro-2-propanol (HFIP).
  • HFIP l,l,l,3,3,3-hexafluoro-2-propanol
  • Figure 26 shows that sertraline binds to ⁇ -synuclein and affects the rate of structure formation in the presence of HFIP. Monitoring of Thioflavin T fluorescence. Solvent alone
  • Figure 27 shows that nortriptyline, indatraline, and fluoxetine delay aggregation of ⁇ - synuclein.
  • A Amount of ⁇ -synuclein monomer in solution.
  • B Monitoring of ⁇ -synuclein fluorescence polarization. Solvent alone (black bars), indatraline (gray bars), nortriptyline (white bars), and fluoxetine (hatched bars).
  • Figure 28 shows that nortriptyline, indatraline, and fluoxetine delay aggregation of ⁇ - synuclein in a dose-dependent manner.
  • A Indatraline.
  • Figure 30 is a graph showing quantification of ⁇ -synuclein by ELISA in the cytoplasmic (black bars) and membrane fraction (white bars) in 4 month old ⁇ -synuclein transgenic mice treated for 30 days.
  • Figure 31 is a graph showing the number of cells positive for ⁇ -synuclein immunoreactivity in 4 month old ⁇ -synuclein transgenic mice after 30 days of treatment with 25 mg/kg nortriptyline.
  • Figure 32 includes photomicrographs of the hippocampus of 4 month old ⁇ - synuclein transgenic mice after 30 days of treatment with vehicle or nortriptyline. Immunofluorescence analysis of brain sections immunostained for human ⁇ -synuclein fgreen) and NeuN (red).
  • Figure 33 is a graph showing the number of cells positive for human ⁇ -synuclein immunoreactivity in 7 month old ⁇ -synuclein transgenic mice after 30 days of treatment with nortriptyline at 0.5 mg/kg, 5 mg/kg, and 25 mg/kg.
  • Synucleins are small proteins (123 to 143 amino acids) characterized by repetitive imperfect repeats KTKEGV (SEQ ID NO: XX) distributed throughout most of the amino- terminal half of the polypeptide in the acidic carboxy-terminal region.
  • KTKEGV SEQ ID NO: XX
  • synuclein protein synoretin is closely homologous to ⁇ -synuclein and is predominantly expressed within the retina, ⁇ -synuclein, also referred to as the non-amyloid component of senile plaques precursor protein (NACP), SYNl or synelfm, is a heat-stable, "natively unfolded" protein of poorly defined function. It is predominantly expressed in the central nervous system (CNS) neurons where it is localized to pre-synaptic terminals.
  • CNS central nervous system
  • Electron microscopy studies have localized ⁇ -synuclein in close proximity to synaptic vesicles at axonal termini, suggesting a role for ⁇ -synuclein in neurotransmission or synaptic organization, and biochemical analysis has revealed that a small fraction of ⁇ -synuclein may be associated with vesicular membranes but most ⁇ -synuclein is cytosolic.
  • ⁇ -synuclein is the major component of several proteinaceous inclusions characteristic of specific neurodegenerative diseases. Pathological synuclein aggregations in Parkinson's disease are restricted to the ⁇ - synuclein isoforms, as ⁇ and ⁇ synucleins have not been detected in these inclusions. Lewy bodies, neuronal fibrous cytoplasmic inclusions that are histopathological hallmarks of Parkinson's disease (PD) and diffuse Lewy body disease (DLBD), are strongly labeled with antibodies to ⁇ -synuclein.
  • PD Parkinson's disease
  • DLBD diffuse Lewy body disease
  • Dystrophic ubiquitin-positive neurites associated with PD pathology termed Lewy neurites (LN) and CA2/CA3 ubiquitin neurites are also ⁇ -synuclein positive.
  • LN Lewy neurites
  • CA2/CA3 ubiquitin neurites are also ⁇ -synuclein positive.
  • pale bodies, putative precursors of LBs, thread-like structures in the perikarya of slightly swollen neurons and glial silver positive inclusions in the midbrains of patients with LB diseases are also immunoreactive for ⁇ -synuclein.
  • ⁇ -synuclein is likely the major component of glial cell inclusions (GCIs) and neuronal cytoplasmic inclusions in MSA and some types of brain iron accumulation including PANKl .
  • GCIs glial cell inclusions
  • PANKl neuronal cytoplasmic inclusions
  • ⁇ -synuclein immunoreactivity is present in some dystrophic neurites in senile plaques in Alzheimer's Disease (AD) and in the cord and cortex in amyotrophic lateral sclerosis (ALS). ⁇ -synuclein immunoreactivity is prominent in transgenic and toxin-induced mouse models of PD, AD, ALS, and HD.
  • ⁇ -synuclein is the actual building block of the fibrillary components of LBs, LNs, and GCIs. Immunoelectron microscopic studies have demonstrated that these fibrils are intensely labeled with ⁇ -synuclein antibodies in situ. Sarcosyl-insoluble ⁇ -synuclein filaments with straight and twisted morphologies can also be observed in extracts of DLBD and MSA brains. Moreover, ⁇ -synuclein can assemble in vitro into elongated homopolymers with similar widths as sarcosyl-insoluble fibrils or filaments visualized in situ.
  • Polymerization is associated with a concomitant change in secondary structure from random coil to anti-parallel ⁇ -sheet structure consistent with the Thioflavine-S reactivity of these filaments.
  • the PD-association with ⁇ -synuclein mutation, A53T may accelerate this process, as recombinant A53T ⁇ -synuclein has a greater propensity to polymerize than wild-type ⁇ -synuclein.
  • This mutation also affects the ultrastructure of the polymers; the filaments are slightly wider and are more twisted in appearance, as if assembled from two proto filaments.
  • the A30P mutation may also modestly increase the propensity of ⁇ -synuclein to polymerize, but the pathological effects of this mutation also may be related to its reduced binding to vesicles. Interestingly, carboxyl-terminally truncated ⁇ -synuclein may be more prone to form filaments than the full-length protein.
  • the proteosomal degradation of ⁇ -synuclein is a mediated by parkin and neuronal ubiquitin C-terminal hydrolase (UCH-Ll).
  • Parkin is an E3 ligase that ubiquitinylates ⁇ - synuclein and thereby tags it for degradation.
  • UCH-Ll acts in normal neuronal tissues to cleave the ubiquitinylated proteins that are products of the proteosomal degradation of the polyubiquitinylated proteins.
  • UCH-Ll is farnesylated in vivo.
  • UCH-Ll is associated with the membrane, and this membrane association is mediated by farnesylation.
  • Farnesylated UCH-Ll also stabilizes the accumulation of ⁇ -synuclein.
  • the invention relates to the prevention or inhibition of UCH-Ll farnesylation which would result in UCH-Ll membrane disassociation and acceleration of the degradation of ⁇ -synuclein.
  • ⁇ -synuclein accumulation is pathogenic in PD, DLBD, and MSA
  • an increased degradation of ⁇ -synuclein and/or inhibition of ⁇ -synuclein accumulation ameliorates the toxicity associated with a pathogenic accumulation of ⁇ -synuclein.
  • the modification of a protein by a farnesyl group can have an important effect on function for a number of proteins.
  • Farnesylated proteins typically undergo further C-terminal modification events that include a proteolytic removal of three C-terminal amino acids and carboxymethylation of C-terminal cystines. These C-terminal modifications facilitate protein- membrane association as well as protein-protein interactions.
  • Farnesylation is catalyzed by a protein farnesyltransferase (FTase), a heterodimeric enzyme that recognizes the CAAX motif present at the C-terminus of the substrate protein.
  • FTase protein farnesyltransferase
  • FTase transfers a farnesyl group from farnesyl pyrophosphate and forms a thioether linkage between the farnesyl and the cystine residues in the CAAX motif.
  • a number of inhibitors of FTase have been developed and are known in the art.
  • the invention provides novel methods for using certain farnesyl transferase inhibitors to treat subjects having symptoms associated with ⁇ -synuclein accumulation.
  • synucleionopathy typically refers to neurological disorders that are characterized by a pathological accumulation and/or aggregation of ⁇ -synuclein.
  • Parkinson's disease is a neurological disorder characterized by bradykinesia, rigidity, tremor, and postural instability.
  • the pathologic hallmark of PD is loss of neurons in the substantia nigra pars compacta (SNpc) and the appearance of Lewy bodies in remaining neurons. It appears that more than about 50% of the cells in the SNpc need to be lost before motor symptoms appear.
  • Associated symptoms often include small handwriting (micrographia), seborrhea, orthostatic hypotension, urinary difficulties, constipation and other gastrointestinal dysfunction, sleep disorders, depression and other neuropsychiatric phenomena, dementia, and smelling disturbances (occurs early).
  • Patients with Parkinsonism have greater mortality, about two times compared to general population without PD. This is attributed to greater frailty or reduced mobility.
  • synucleinopathic subject encompasses a subject that is affected by, or is at risk of developing a synucleinopathy such as PD, DLBD, MSA, and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl).
  • PD a synucleinopathy
  • MSA pantothenate kinase-associated neurodegeneration
  • PANKl pantothenate kinase-associated neurodegeneration
  • Diagnosis of PD at present, is mainly clinical and is based on the clinical findings listed above. Parkinsonism, refers to any combination of two of bradykinesia, rigidity, and/or tremor.
  • PD is the most common cause of parkinsonism.
  • Other causes of parkinsonism are side effects of drugs, mainly the major tranquilizers, such as haloperidol, strokes involving the basal ganglia, and other neurodegenerative disorders, such as Diffuse Lewy Body Disease (DLBD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), MSA, and Huntington's disease.
  • DLBD Diffuse Lewy Body Disease
  • PSP progressive supranuclear palsy
  • FTD frontotemporal dementia
  • Huntington's disease Huntington's disease.
  • the pathological hallmark of PD and DLBD is the Lewy body, an intracytoplasmatic inclusion body typically seen in affected neurons of the substantia nigra and to a variable extent, in the cortex in the former disease, and vice versa in the latter, ⁇ -synuclein has been identified as the main component of Lewy bodies in sporadic Parkinsonism.
  • parkinsonism can sometimes be attributed to viruses, stroke, or toxins in a few individuals, for the most part, the cause of Parkinson's disease in any particular case is unknown.
  • Environmental influences which may contribute to PD may include drinking well water, farming and industrial exposure to heavy metals (e.g. , iron, zinc, copper, mercury, magnesium and manganese), alkylated phosphates and other pesticides, and orthonal chlorines.
  • Paraquat a herbicide
  • Cigarette smoking is associated with a decreased incidence of PD.
  • the current consensus is that PD may either be caused by an uncommon toxin combined with high genetic susceptibility or a common toxin combined with relatively low genetic susceptibility.
  • a small percentage of subjects that are at risk of developing PD can be identified for example by genetic analysis. There is good evidence for certain genetic factors being associated with PD. Large pedigrees of autosomal dominantly inherited PDs have been reported. For example, three point mutations in the ⁇ -synuclein gene (SNCA gene) have been associated with autosomal dominant PD, as duplication and triplication of the wildtype SNCA gene.
  • SNCA gene three point mutations in the ⁇ -synuclein gene
  • the term "synucleinopathic subject” also encompasses a subject that is affected by, or is at risk of developing diffuse Lewy body disease (DLBD). These subjects can be readily identified by persons of ordinary skill in the art by symptomatic diagnosis, physical examination, or by genetic screening, brain scans, SPECT, PET imaging, etc.
  • DLBD is the second most common cause of dementia in older individuals; it effects 7% of the general population older than 65 years and 30% of those aged over 80 years. It is part of a range of clinical presentations that share a pathology based on abnormal aggregation of the synaptic protein ⁇ -synuclein. DLBD has many of the clinical and pathological characteristics of the dementia that occur late in the course of Parkinson's disease. A "one year rule" has been proposed to separate DLBD from PD. According to this rule, onset of dementia within 12 months of Parkinsonism qualifies as DLBD, whereas more than 12 months of Parkinsonism before onset of dementia qualifies as Parkinson's Disease with dementia (PDD).
  • PDD Parkinson's Disease with dementia
  • DLBD central features of DLBD include progressive cognitive decline of sufficient magnitude to interfere with normal social and occupational function and neuropsychiatry phenomena. Prominent or persistent memory impairment does not necessarily occur in the early stages, but it is evident with progression in most cases. Deficits on tests of attention and of frontal cortical skills and visual spatial ability can be especially prominent.
  • Core diagnostic features two of which are essential for diagnosis of probable and one for possible DLBD are fluctuating cognition with pronounced variations in attention and alertness, recurrent visual hallucinations that are typically well-formed and detailed, and spontaneous features of Parkinsonism.
  • Patients with DLBD do better than those with Alzheimer's Disease in tests of verbal memory, but worse on visual performance tests. This profile can be maintained across the range of severity of the disease, but can be harder to recognize in the later stages owing to global difficulties.
  • DLBD typically presents with recurring episodes of confusion on a background of progressive deterioration.
  • Typical patients with DLBD show a combination of cortical and subcortical neuropsychological impairments with substantial attention deficits and prominent frontal subcortical and visual spatial dysfunction. These help differentiate this disorder from Alzheimer's disease.
  • Rapid eye movement (REM), sleep behavior disorder is a parasomnia manifested by vivid and frightening dreams associated with simple or complex motor behavior during REM sleep. This disorder is frequently associated with the synucleinopathies, DLBD, PD, and MSA, but occurs less often in amyloidopathies and tauopathies.
  • the neuropsychological pattern of impairment in REM sleep behavior disorder/dementia is similar to that reported in DLBD and qualitatively different from that reported in Alzheimer's Disease.
  • Neuropathological studies of REM sleep behavior disorder associated with neurodegenerative disorder have shown Lewy body disease or multiple system atrophy.
  • REM sleep wakefulness disassociations (REM sleep behavior disorder, daytime hypersomnolence, hallucinations, cataplexy) characteristic of narcolepsy can explain several features of DLBD, as well as PD. Sleep disorders could contribute to the fluctuations typical of DLBD, and their treatment can improve fluctuations and quality of life. Subjects at risk of developing DLBD can be identified. Repeated falls, syncope, transient loss of consciousness, and depression are common in older people with cognitive impairment and can serve as (a red flag) to a possible diagnosis of DLBD. By contrast, narcoleptic sensitivity in REM sleep behavior disorder can be highly predictive of DLBD. Their detection depends on the clinicians having a high index of suspicion and asking appropriate screening questions.
  • Consensus criteria for diagnosing DLBD include ubiquitin immunohistochemistry for Lewy body identification and staging into three categories; brain stem predominant, limbic, or neocortical, depending on the numbers and distribution of Lewy bodies.
  • the recently-developed ⁇ -synuclein immunohistochemistry can visualize more Lewy bodies and is also better at indicating previously under recognized neurotic pathology, termed Lewy neurites.
  • Lewy neurites termed Lewy neurites.
  • Lewy bodies may form because ⁇ -synuclein becomes insoluble or more able to aggregate.
  • ⁇ -synuclein is abnormally processed, for example, by a dysfunctional proteasome system and that toxic "proto fibrils" are therefore produced. Sequestering of these toxic fibrils into Lewy bodies could reflect an effort by the neurons to combat biological stress inside the cell, rather than their simply being neurodegenerative debris.
  • Target symptoms for the accurate diagnosis of DLBD can include extrapyramidal motor features, cognitive impairment, neuropsychiatric features (including hallucinations, depression, sleep disorder, and associated behavioral disturbances), or autonomic dysfunction.
  • the term "synucleinopathic subject” also encompasses a subject that is affected by, or is at risk of developing multiple system atrophy (MSA). These subjects can be readily identified by persons of ordinary skill in the art by symptomatic diagnosis, physical examination, and neurological examination sometimes in conjunction with genetic screening, brain scans, SPECT, PET imaging, etc.
  • MSA is a neurodegenerative disease marked by a combination of symptoms; affecting movement, cognition, autonomic and other body functions, hence the label "multiple system atrophy".
  • the cause of MSA is unknown.
  • Symptoms of MSA vary in distribution of onset and severity from person to person. Because of this, the nomenclature initially included three distinct terms: Shy-Drager syndrome, striatonigral degeneration (SD), and olivopontocerebellar atrophy (OPCA). These terms have been replaced by the nomenclature MSA-C (MSA with a cerebellar phenotype) and MSA-P (MSA with a parkinsonian phenotype).
  • Shy-Drager syndrome the most prominent symptoms are those involving the autonomic system; blood pressure, urinary function, and other functions not involving conscious control. Striatonigral degeneration causes predominately parkinsonism (slowed movements and rigidity), while OPCA principally affects balance, coordination, and speech.
  • the symptoms for MSA typically include orthostatic hypotension, impotence, urinary difficulties, constipation, and speech and swallowing difficulties.
  • MSA MSA complex regional pain syndrome
  • MRI magnetic resonance imaging
  • PET positron emission tomography
  • SINEMET levodopa/carbidopa
  • a characteristic involvement of multiple brain systems with prominent autonomic dysfunction is a defining feature of MSA and one that at autopsy confirms the diagnosis.
  • the presence of glial cytoplasmic inclusions containing ⁇ -synuclein is pathognomic of MSA.
  • MSA glial cytoplasmic inclusions containing ⁇ -synuclein
  • postural instability low blood pressure on standing (orthostatic hypotension) and high blood pressure when lying down (supine hypertension)
  • urinary difficulties impotence, constipation, speech and swallowing difficulties out of proportion to slowness and rigidity.
  • the present invention provides a novel system for treating synucleinopathic subjects (e.g., Parkinson's disease) or patients with other neurodegenerative diseases.
  • the invention includes methods of treating a subject with a prototypic synucleinopathy, such as Parkinson's Disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and neuronal brain iron accumulation syndrome with ⁇ - synuclein deposition, with a combination of a farnesyl transferase inhibitor and an ⁇ -synuclein aggregation inhibitor.
  • a neurodegenerative disease such as amyotrophic lateral sclerosis (ALS), Huntington's Disease (HD), or Alzheimer's Disease (AD), with such a combination.
  • the methods of the invention are useful in preventing or decreasing the accumulation, aggregation, and/or toxicity of ⁇ -synuclein.
  • the treatments methods decrease the aggregation of ⁇ - synuclein.
  • the treatment methods inhibit the aggregation of ⁇ - synuclein.
  • the methods are useful in reducing the toxicity of aggregations of ⁇ -synuclein.
  • the methods are useful in decreasing levels of insoluble ⁇ -synuclein and/or increasing clearance of ⁇ -synuclein.
  • the invention provides methods for treating a subject with a synucleinopathy or other neurodegenerative disease, including the step of administering to the subject a therapeutically effective amount of a farnesyl transferase inhibitor and an agent that inhibits the aggregaton of ⁇ -synuclein.
  • the combination of these agents may lead to an additive or synergistic effect as described herein.
  • the subject is a vertebrate.
  • the subject is a mammal.
  • the subject is a human.
  • the human may be male or female, and the human may be at any stage of development.
  • Farnesyl transferase inhibitors have been shown to be useful in the treatment of synucleinopathies by reducing the levels and deposition of ⁇ -synuclein in cells (e.g., neurons). See, e.g., published U.S. applications, US 2006/0106060; US 2005/0272722; US 2005/0288298; and US 2005/0277629; each of which is incorporated herein by reference.
  • Agents such as nortriptyline, indatraline, fluoxetine, norfluoxetine, protriptyline, maprotiline, norclomipramine, nordoxepin, and sertraline that inhibit the aggregation of ⁇ -synuclein have been found to be particularly useful in combination with farnesyl transferase inhibitors in the treatment of synucleinopathies to prevent the accumulation, aggregation, and/or associated toxicity of aggregates of ⁇ -synuclein.
  • the invention provides methods of treating cells (e.g., neural cells) with the inventive combinations both in vitro and in vivo.
  • the cells are human neural cells.
  • the cells may be primary cells, or they may be derived from a cell line.
  • the invention also provides pharmaceutical compositions and preparations comprising the inventive combinations. Kits containing the inventive combinations are also provided.
  • any farnesyl transferase inhibitor known in the art may be combined with an agent that inhibits the aggregation of ⁇ -synuclein to form an inventive combination for the treatment of a synucleinopathy.
  • the farnesyl transferase inhibitor has been shown to be useful in the treatment of synucleinopathies or other neurodegenerative diseases.
  • Various farnesyl transferase inhibitors that have been found useful in the treatment of synucleinopathies or other neurodegenerative diseases are described in published U.S. patent applications, US 2006/0106060; US 2005/0272722; US 2005/0288298; and US 2005/0277629; each of which is incorporated herein by reference; U.S.
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula: or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • the tartrate salt of the compound is used. This compounds is also known by the names, LNK-754, OSI-754, and CP-609754.
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula:
  • R 1 is selected from H, Ci-Ci 0 alkyl, -(CR 13 R 14 ) q C(O)R 12 , -(CR 13 R 14 ) q C(O)OR 15 , -(CR 13 R 14 ) q OR 12 , -(CR 13 R 14 ) q SO 2 R 15 , -(CR 13 R 14 ),(C 3 -Ci 0 cycloalkyl), -(CR 13 R 14 ),(C 6 -Ci 0 aryl), and -(CR 13 R 14 )t(4-10 membered heterocyclic), wherein t is an integer from 0 to 5 and q is an integer from 1 to 5, said cycloalkyl, aryl and heterocyclic R 1 groups are optionally fused to a C 6 - Cio aryl group, a Cs-Cg saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R 1 groups, except H but including any
  • R 8 is H, -OR 12 , -NR 12 R 13 , -NR 12 C(O)R 13 , cyano, -C(O)OR 13 , -SR 12 , -(CR 13 R 14 ),(4-10 membered heterocyclic), wherein t is an integer from O to 5, or Ci-C 6 alkyl, wherein said heterocyclic and alkyl moieties are optionally substituted by 1 to 3 R 6 substituents;
  • R 9 is -(CR 13 R 14 )t(imidazolyl) wherein t is an integer from O to 5 and said imidazolyl moiety is optionally substituted by one or two R 6 substituents; each R 10 and R 11 is independently selected from the substituents provided in the definition of R 6 ; each R 12 is independently selected from H, Ci-Ci 0 alkyl, -(CR 13 R 14 ),(C 3 -Ci 0 cycloalkyl), -(CR 13 R 14 XC 6 -Ci 0 aryl), and -(CR 13 R 14 >(4-10 membered heterocyclic), wherein t is an integer from O to 5; said cycloalkyl, aryl and heterocyclic R 12 groups are optionally fused to a C 6 -Ci 0 aryl group, a C 5 -C 8 saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R 12 substituents, except H,
  • R , 15 is selected from the substituents provided in the definition of R 12 except R , 15 is not H;
  • R , 16 is selected from the list of substituents provided in the definition of R 12 and
  • R , 17 , R , 18 , and R , 19 are each independently selected from the substituents provided in the definition of R 12 except R 17 , R 18 , and R 19 are not H; and provided that at least one of R 3 , R 4 , and R 5 is -(CR 13 R 14 ) t C ⁇ CR 16 wherein t is an integer from 0 to 5 and R 13 , R 14 , and R 16 are as defined above; or a derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • a racemate is used in the invention.
  • an enantiomerically pure compound is used.
  • an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer).
  • the dashed line represents one bond of a double bond between C-3 and C -4 of the quinolin-2-one ring.
  • R 1 is H or Ci-C 6 alkyl.
  • R 1 is H, methyl, ethyl, ⁇ o-propyl, or n-propyl.
  • R 1 is methyl.
  • R 2 is H, halo, or Ci-C 6 alkyl. In certain compounds, R 2 is H.
  • R 6 is H.
  • R 7 is H.
  • R 8 is H, -OR 12 , or -NR 12 R 13 , wherein R 12 and R 13 are as defined above.
  • R 8 is hydroxy or amino. In other compounds, R 8 is hydroxy. In yet other componds, R 8 is amino.
  • R 9 is an imidazolyl moiety, optionally substituted with one or two R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 9 is
  • R is as defined above and t is an integer between 0 and 2, inclusive.
  • R 9 is , wherein R 0 is as defined above. In other compounds,
  • R 10 is H, C 1 -C 10 alkyl, halo, cyano, nitro, or amino.
  • R , 10 is halo, preferably chloro or fluoro.
  • R 10 is chloro.
  • at least one of R 10 and R 11 is H.
  • R 11 is H, C 1 -C 10 alkyl, halo, cyano, nitro, or amino.
  • R , 11 is halo, preferably chloro or fluoro. In certain particular compounds, R 11 is chloro.
  • Certain compounds of formula I include those wherein R 1 is H, Ci-C 6 alkyl, or cyclopropylmethyl; R 2 is H; R 3 is -C ⁇ CR 16 ; and R 8 is -NR 12 R 13 , -OR 12 , or a heterocyclic group selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl, wherein said heterocyclic group is optionally substituted by an R 6 group.
  • Other compounds of formula I include those wherein R 9 is imidazolyl optionally substituted by Ci-C 6 alkyl; R 8 is hydroxy, amino, or triazolyl; and R 4 ,
  • R 5 , R 10 and R 11 are each independently selected from H and halo.
  • R 1 is -(CR 13 R 14 ),(C 3 -Ci 0 cycloalkyl), wherein t is an integer from 0 to 3;
  • R 2 is H;
  • R 3 is -C ⁇ CR 16 ; and
  • R 8 is -NR 12 R 13 , -
  • OR 12 or a heterocyclic group selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl, wherein said heterocyclic group is optionally substituted by an R 6 group.
  • R 9 is imidazolyl, optionally substituted by Ci-C 6 alkyl;
  • R 8 is hydroxy, amino, or triazolyl;
  • R 4 , R 5 , R 10 and R 11 are each independently selected from H and halo; and
  • R 1 is cyclopropylmethyl.
  • R 16 is H.
  • R 16 is -SiR 17 R 18 R 19 .
  • R 16 is Ci-C 6 alkyl.
  • Compounds useful in the present invention include compounds of the formula (II): wherein R 1 , R 5 , R 6 , R 8 , and R 11 are defined as above.
  • R 1 , R 5 , R 6 , R 8 , and R 11 are defined as above.
  • R 1 , R 5 , R 6 , R 8 , and R 11 are defined as above.
  • Compounds useful in the present invention include compounds of the formula (V): wherein R 1 , R 5 , R 6 , R 8 , and R 11 are defined as above.
  • R 1 is H or Ci-C 6 alkyl.
  • R 1 is H, methyl, ethyl, ⁇ o-propyl, or n-propyl. In certain particular compounds, R 1 is methyl.
  • R 5 is -(CR 13 R 14 ),C ⁇ CR 16 , wherein t is an integer from 0 to 5, inclusive, and R 13 , R 14 , and R 16 are as defined above; and the other two R 3 and R 4 are H.
  • R 5 is -C ⁇ CR 16 .
  • R 5 is C 2 - C 6 alkynyl.
  • R 5 is -C ⁇ CH.
  • R 6 is H. In other classes of the compounds of formula H-V, R 6 is Ci-C 6 alkyl. In certain compounds, R 6 is methyl.
  • R 8 is H, -OR 12 , or -NR 12 R 13 , wherein R 12 and R 13 are as defined above. R 8 is hydroxy or amino. In other compounds, R 8 is hydroxy. In yet other componds, R 8 is amino.
  • R 11 is H, C 1 -C 10 alkyl, halo, cyano, nitro, or amino.
  • R 11 is halo, preferably chloro or fluoro. In certain particular compounds, R 11 is chloro.
  • R 1 , R 5 , R 6 , and R 11 are defined as above.
  • R 1 is H or Ci-C 6 alkyl.
  • R 1 is H, methyl, ethyl, ⁇ o-propyl, or n-propyl.
  • R 1 is methyl.
  • R 5 is -(CR 13 R 14 ),C ⁇ CR 16 , wherein t is an integer from 0 to 5, inclusive, and R 13 , R 14 , and R 16 are as defined above; and the other two of R 3 , R 4 , and R 5 are H.
  • R 5 is C 2 -C 6 alkynyl. In other compounds, R 5 is
  • R 11 is H, Ci-Cio alkyl, halo, cyano, nitro, or amino.
  • R 11 is halo, preferably chloro or fluoro. In certain particular compounds, R 11 is chloro.
  • Exemplary compounds useful in the present invention include the following:
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula (VII):
  • the compound of formula VII useful in accordance with the present invention is (+)-6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]- 4-(3-chloro-phenyl)-l -cyclopropylmethyl- lH-quinoline-2-one(LNK-427).
  • the compound of formula VII useful in the invention is (-)-6-[amino-(6-chloro- pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-chloro-phenyl)-l-cyclopropylmethyl- 1 H-quinoline-2-one.
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula: (VIII):
  • dashed line indicates an optional second bond connecting C-3 and C-4 of the quinolin-2-one ring
  • R 1 selected from H, Ci-Ci 0 alkyl, -(CR 13 R 14 ⁇ C(O)R 12 , -(CR 13 R 14 ⁇ C(O)OR 15 , — (CR 13 R 14 ⁇ C(O)R 12 , -(CR 13 R 14 ⁇ SO 2 R 15 , — (CR 13 R 14 >(C 3 -Ci 0 cycloalkyl), — (CR 13 R 14 ),(C 6 — Cio aryl), and — (CR 13 R 14 ) ⁇ (4 — 10 membered heterocyclic), wherein said cycloalkyl, aryl and heterocyclic R 1 groups are optionally fused to a C 6 -Ci O aryl group, a Cs-Cg saturated cyclic group, or a 4 — 10 membered heterocyclic group; and the foregoing R 1 groups, except H but including any optional fused rings referred to above, are optionally substituted by 1 to 4 R 6 groups;
  • Z is an aromatic 4 — 10 membered heterocyclic group, substituted by 1 to 4 R 6 substituents;
  • R 9 is — (CR 13 R 14 ),(imidazolyl) or — (CR 13 R 14 ),(pyridinyl) wherein said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R 6 substituents; each R 12 is independently selected from H, Ci-Ci 0 alkyl,— (CR 13 R 14 ),(C 3 Ci 0 cycloalkyl), -(CR 13 R 14 X(C 6 Cio aryl), and — (CR 13 R 14 ),(4-10 membered heterocyclic); said cycloalkyl, aryl and heterocyclic R 12 groups are optionally fused to a C 6 -CiO aryl group, a C 5 -Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R 12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo, cyano,
  • R 15 is selected from the substituents provided in the definition of R 12 except R 15 is not H;
  • R 16 is selected from the list of substituents provided in the definition of R 12 and — SiR 17 R 18 R 19 ;
  • R 17 , R 18 and R 19 are each independently selected from the substituents provided in the definition of R 12 except at least one of R 17 , R 18 and R 19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • a racemate is used in the invention.
  • an enantiomerically pure compound is used.
  • an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer).
  • the stereochemistry is defined as follows:
  • compounds of formula VIII are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R 6 substituents. In certain particular embodiments, compounds of formula VIII are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R 6 substituents. In certain embodiments, Z is a pyridine group substituted with 1 to 4 R 6 substituents. In certain particular embodiments, Z is a
  • Z is .
  • Z is a pyridine group substituted with one R 6 substituent, wherein the R 6 substituent is halo (e.g., chloro).
  • Z is
  • compounds of formula VIII are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R 6 substituents. Preferably, Z comprises from 1 to 3 heteroatoms selected from 0, S and N. [00140] In certain embodiments, compounds of formula VIII are those wherein R 1 is H, C 1 - Ce alkyl, or cyclopropylmethyl. In certain embodiments, R 1 is cyclopropylmethyl.
  • compounds of formula VIII are those wherein R is - NR 12 R 13 , —OR 12 , or — (CR 13 R 14 ),(4-10 membered heterocyclic) substituted with from 1 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl.
  • said heterocyclic is substituted with one R 6 group.
  • R 8 is hydroxy, amino, or triazolyl.
  • R 8 is hydroxy.
  • R 8 is amino.
  • compounds of formula VIII are those wherein R 8 is H, —
  • compounds of formula VIII are those wherein R 3 , R 4 , R 5 , and R 6 are independently selected from H, halo, and Ci-C 6 alkoxy.
  • R 3 , R 4 , and R 5 is halo (e.g., chloro), and the others are hydrogen.
  • compounds of formula VIII are those wherein R 6 and R 7 are both hydrogen.
  • compound of formula VIII are those wherein R 9 is an imidazolyl moiety, optionally substituted with one or two R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R is as defined above and t is an integer between 0 and 2, inclusive.
  • R 9 is , wherein R 6 is as defined above.
  • Compounds useful in the present invention include compounds of the formula: wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R 1 , R 2 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • Compounds useful in the present invention include compounds of the formula: wherein R 1 , R 5 , R 6 , and R 8 are defined as above.
  • Compounds useful in the present invention include compounds of the formula:
  • R 1 , R 5 , R 6 , and R 8 are defined as above.
  • Exemplary compounds useful in the present invention include:
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula (IX):
  • dashed line indicates an optional second bond connecting C-3 and C-4 of the quinoline ring
  • Z is an aromatic 4-10 membered heterocyclic group, substituted by 1 to 4 R 6 substituents;
  • R 8 is H, -OR 12 , -OC(O)R 12 , -NR 12 R 13 , -NR 12 C(O)R 13 , cyano, -C(O)OR 13 , -SR 12 , or - (CR 13 R 14 ) ⁇ (4-10 membered heterocyclic), wherein said heterocyclic R 8 groups are substituted by 1 to 4 R 6 groups;
  • R 9 is-(CR 13 R 14 ),(imidazolyl) or -(CR 13 R 14 ),(pyridinyl), wherein said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R 6 substituents; each R 12 is independently selected from H, Ci-Ci 0 alkyl, -(CR 13 R 14 ),(C 3 -Ci 0 cycloalkyl), -(CR 13 R 14 )XC 6 -Cio aryl), and -(CR 13 R 14 ),(4-10 membered heterocyclic); said cycloalkyl, aryl, and heterocyclic R 12 groups are optionally fused to a C 6 -CiO aryl group, a Cs-Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo
  • R 15 is selected from the substituents provided in the definition of R 12 except R 15 is not H;
  • R . 16 is selected from the list of substituents provided in the definition of R 12 and - o Si ⁇ R> 17r R> 18r R> 19 ; and J,
  • R 17 , R 38 and R 19 are each independently selected from the substituents provided in the definition of R 12 except at least one of R 17 , R 18 and R 19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • a racemate is used in the invention.
  • an enantiomerically pure compound is used.
  • an enantiomerically enriched mixture is used ⁇ e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer).
  • the stereochemistry is defined as follows:
  • compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R 6 substituents.
  • compounds of formula IX are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R 6 substituents.
  • Z is a pyridine group substituted with 1 to 4 R 6 substituents.
  • Z is a
  • Z is ⁇ ; .
  • Z is a pyridine group substituted with one R 6 substituent, wherein the R 6 substituent is halo (e.g., chloro).
  • Z is
  • compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R 6 substituents. Preferably, Z comprises from 1 to 3 heteroatoms selected from O, S, and N.
  • compounds of formula IX are those wherein R 8 is — NR 12 R 13 , —OR 12 , or — (CR 13 R 14 ),(4-10 membered heterocyclic) substituted with from 1 to 4 R 6 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl.
  • said heterocyclic is substituted with one R 6 group.
  • R 8 is hydroxy, amino, or triazolyl. In certain embodiments, R 8 is hydroxy. In certain other embodiments, R 8 is amino. [00157] In certain embodiments, compounds of formula IX are those wherein R 8 is H, —
  • compounds of formula IX are those wherein R 3 , R 4 , R 5 , and
  • R 6 are independently selected from H, halo, and Ci-C 6 alkoxy. In certain embodiments, one of
  • R 3 , R 4 , and R 5 is halo (e.g., chloro), and the others are hydrogen.
  • compounds of formula IX are those wherein R 6 and R 7 are both hydrogen.
  • compound of formula IX are those wherein R 9 is an imidazolyl moiety, optionally substituted with one or two R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 9 is ⁇ , wherein R 6 is as defined above.
  • R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R 2 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R > 5 3 , r R> 6 0 , and R ⁇ are defined as above.
  • Compounds useful in the present invention include compounds of the formula: wherein R 5 , R 6 , and R 8 are defined as above.
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula (X):
  • dashed line indicates an optional second bond connecting C-3 and C-4 of the quinoline ring
  • Z is an aromatic 4-10 membered heterocyclic group, substituted by 1 to 4 R 6 substituents;
  • R 8 is H, —OR 12 , -OC(O)R 12 , — NR 12 R 13 ,- NR 12 C(O)R 13 , cyano, -C(O)OR 13 , -SR 12 , or — (CR 13 R 14 )X4-10 membered heterocyclic), wherein said heterocyclic R 8 groups are substituted by 1 to 4 R 6 groups;
  • R 9 is — (CR 13 R 14 >(imidazolyl) or — (CR 13 R 14 >(pyridinyl) wherein said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R 6 substituents; each R 12 is independently selected from H, Ci-Ci 0 alkyl, — (CR 13 R 14 )XC 3 -Ci ⁇ cycloalkyl), — (CR 13 R 14 XC 6 - Ci 0 aryl), and — (CR 13 R 14 >(4-10 membered heterocyclic); said cycloalkyl, aryl, and heterocyclic R 12 groups are optionally fused to a C 6 -Ci 0 aryl group, a Cs-Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R 12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo,
  • R 16 is selected from the list of substituents provided in the definition of R 12 and — SiR R R ; and,
  • R 17 , R 18 and R 19 are each independently selected from the substituents provided in the definition of R 12 except at least one of R 17 , R 18 and R 19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • a racemate is used in the invention.
  • an enantiomerically pure compound is used.
  • an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer).
  • the stereochemistry is defined as follows:
  • compounds of formula X are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R 6 substituents. In certain particular embodiments, compounds of formula X are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R 6 substituents. In certain embodiments, Z is a pyridine group substituted with 1 to 4 R 6 substituents. In certain particular embodiments, Z is a pyridine group
  • Z is * ⁇ / .
  • Z is a pyridine group substituted with one R 6 substituent, wherein the R 6 substituent is halo (e.g., chloro).
  • Z is ⁇ / .
  • compounds of formula X are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R 6 substituents.
  • Z comprises from 1 to 3 heteroatoms selected from 0, S and N.
  • compounds of formula X are those wherein R 8 is — NR 12 R 13 ,
  • R 12 or — (CR 13 R 14 ),(4-10 membered heterocyclic) substituted with from 1 to 4 R 6 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl.
  • said heterocyclic is substituted with one R 6 group.
  • R 8 is hydroxy, amino, or triazolyl. In certain embodiments, R 8 is hydroxy.
  • R 8 is amino
  • compounds of formula X are those wherein R 8 is H, — OR 12 ,
  • compounds of formula X are those wherein R 3 , R 4 , R 5 , and
  • R 6 are independently selected from H, halo, and Ci-C 6 alkoxy. In certain embodiments, one of
  • R 3 , R 4 , and R 5 is halo (e.g., chloro), and the others are hydrogen.
  • compounds of formula X are those wherein R 6 and R 7 are both hydrogen.
  • compound of formula X are those wherein R 9 is an imidazolyl moiety, optionally substituted with one or two R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 6 is as defined above and t is an integer between 0 and 2, inclusive.
  • R 9 is ⁇ - , wherein R 6 is as defined above.
  • R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • Compounds useful in the present invention include compounds of the formula: wherein R 2 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R > 5 , r R> 6 , and R are defined as above.
  • the inventive combination comprises a farnesyl transferase inhibitor of the formula (XI):
  • dashed line indicates an optional second bond connecting C-3 and C-4 of the quinoline ring
  • R is Ci-C 6 alkyl
  • R 2 is halo, cyano, — C(O)OR 15 , or a group selected from the substituents provided in the definition of R 12
  • Z is an aromatic 4-10 membered heterocyclic group, substituted by 1 to 4 R 6 substituents;
  • R 8 is H, —OR 12 , -OC(O)R 12 , -NR 12 R 13 , -R 12 C(O) R 13 , cyano, -(O)OR 13 , — R 12 , or — (CR 12 R 14 ⁇ 4-10 membered heterocyclic), wherein said heterocyclic R 8 groups are subsituted by 1 to 4 R 6 groups; said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R 6 substituents; each R 12 is independently selected from H, Cl-C 10 alkyl, — (CR 13 R 14 ),(C 3 -Ci 0 cycloalkyl), — (CR 13 R 14 ),(C 6 -Cio aryl), and — (CR 13 R 14 >(4-10 membered heterocyclic); said cycloalkyl, aryl, and heterocyclic R 12 groups are optionally fused to a C 6 -CiO aryl group, a C
  • R 15 is selected from the substituents provided in the definition of R 12 except R 15 is not H;
  • R 16 is selected from the list of substituents provided in the definition of R 12 and — SiR 17 R 18 R 19 ; and,
  • R 17 , R 18 and R 19 are each independently selected from the substituents provided in the definition of R 12 except at least one of R 17 , R 18 and R 19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof.
  • a racemate is used in the invention.
  • an enantiomerically pure compound is used.
  • an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer).
  • compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R 6 substituents.
  • compounds of formula IX are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R 6 substituents.
  • Z is a pyridine group substituted with 1 to 4 R 6 substituents.
  • Z is a
  • Z is * ⁇ / .
  • Z is a pyridine group substituted with one R 6 substituent, wherein the R 6 substituent is halo (e.g., chloro).
  • Z is
  • compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R 6 substituents. Preferably, Z comprises from 1 to 3 heteroatoms selected from 0, S and N.
  • compounds of formula IX are those wherein R 8 is — NR 12 R 13 , —OR 12 , or — (CR 13 R 14 ),(4-10 membered heterocyclic) substituted with from 1 to 4 R 6 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl.
  • said heterocyclic is substituted with one R 6 group.
  • R 8 is hydroxy, amino, or triazolyl.
  • R 8 is hydroxy.
  • R 8 is amino.
  • compounds of formula IX are those wherein R 8 is H, —
  • compounds of formula IX are those wherein R 3 , R 4 , R 5 , and
  • R 6 are independently selected from H, halo, and Ci-C 6 alkoxy. In certain embodiments, one of
  • R 3 , R 4 , and R 5 is halo (e.g., chloro), and the others are hydrogen.
  • compounds of formula IX are those wherein R 6 and R 7 are both hydrogen.
  • compound of formula IX are those wherein R 9 is an imidazolyl moiety, optionally substituted with one or two R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is defined as above.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R 9 is an imidazolyl moiety substituted with one R 6 substituents, wherein R 6 is Ci-C 6 alkyl, preferably methyl.
  • R is as defined above and t is an integer between 0 and 2, inclusive.
  • R 9 is , wherein R 6 is as defined above.
  • Compounds useful in the present invention include compounds of the formula: wherein R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R 2 , R 5 , R 6 , R 7 , and R 8 are defined as above.
  • R 5 , R 6 , and R 8 are defined as above.
  • R > 5 , r R> 6 , and R are defined as above.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • This compound is also known by the name Zarnestra or Rl 15777.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • one of a, b, c and d represents N or N + O , and the remaining a, b, c, and d groups represent carbon, wherein each carbon has an R 1 or R 2 group bound to said carbon; or each of a, b, c, and d is carbon, wherein each carbon has an R 1 or R 2 group bound to said carbon; the dotted line ( — ) represents optional bonds;
  • X represents N or CH when the optional bond to Cl 1 is absent, and represents C when the optional bond to Cl 1 is present; when the optional bond is present between carbon atom 5 and carbon atom 6 then there is only one A substituent bound to C-5 and there is only one B substituent bound to C-6 and A or B is other than H; when the optional bond is not present between carbon atom 5 and carbon atom 6 then there are two A substituents bound to C-5, wherein each A substituent is independently selected, and two B substituents bound to C-6, wherein each B substituent is independently selected, and wherein at least one of the two A substituents or one of the two B substituents are H, and wherein at least one of the two A substituents or one of the two B substituents is other than H;
  • a and B are independently selected from the group consisting of: (1) H; (2) — R ; (3) — R 9 — C(O)-R 9 ; (4) — R 9 — CO 2 - R 9a ; (5) — (CH 2 ) P R 26 ; (6) — C(O)N(R 9 ) 2 , wherein each R 9 is the same or different; (7) -C(O)NHR 9 ; (8) -C(O)NH-CH 2 -C(O)-NH 2 ; (9) -C(O)NHR 26 ; (10) — (CH 2 ) P C(R 9 )— O— R 9a ; (11) — (CH 2 ) P (R 9 ) 2 , wherein each R 9 is the same or different; (12) — (CH 2 ) P C(O)R 9 ; (13) — (CH 2 ) P C(O)R 27 ,; (14) — (CH 2 ) P C(O)N(R 9
  • r R, 31 are the same or different, and each p is
  • each R 1 and R 2 is independently selected from the group consisting of: (1) H; (2) Halo; (3) -CF 3 , (4) —OR 10 ; (5) —COR 10 ; (6) -SR 10 ; (7) -S(O) 1 R 15 wherein t is 0, 1 or 2; (8) — N(R 10 ) 2 ; (9) -NO 2
  • R 3 and R 4 are the same or different and each independently represent H, and any of the substituents of R 1 and R 2 ;
  • R 8 is selected from the group consisting of: CT O (2.0), R 1 1 (3.0),
  • R 9 is selected from the group consisting of: (1) unsubstituted heteroaryl; (2) substituted heteroaryl; (3) arylalkoxy; (4) substituted arylalkoxy; (5) heterocycloalkyl; (6) substituted heterocycloalkyl; (7) heterocycloalkylalkyl; (8) substituted heterocycloalkylalkyl; (9) unsubstituted heteroarylalkyl; (10) substituted heteroarylalkyl; (11) unsubstituted heteroarylalkenyl; (12) substituted heteroarylalkenyl; (13) unsubstituted heteroarylalkynyl and (14) substituted heteroarylalkynyl; wherein said substituted R 9 groups are substituted with one or more substituents selected from the group consisting of: (1) —OH; (2) -CO 2 R 14 ; (3) -CH 2 OR 14 ; (4) halogen; (5) alkyl; (6) amino; (7) trityl; (8) hetero
  • R 14 is independently selected from the group consisting of: H; alkyl; aryl, arylalkyl, heteroaryl and heteroarylalkyl; R 9a is selected from the group consisting of: alky and arylalkyl;
  • R 10 is selected from the group consisting of: H; alkyl; aryl and arylalkyl;
  • R 11 is selected from the group consisting of: (1) alkyl; (2) substituted alkyl; (3) unsubstituted aryl; (4) substituted aryl; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl; (7) unsubstituted heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R 11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) fluoro; and (3) alkyl; and wherein said substituted aryl and substituted heteroaryl R 11 groups are substituted with one or more substituents independently selected from the group consisting of: (1) — OH; (2) halogen; and (3) alkyl;
  • R l la is selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) unsubstituted aryl; (6) substituted aryl; (7) unsubstituted cycloalkyl; (8) substituted cycloalkyl; (9) unsubstituted heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R l la groups are substituted with one or more substituents independently selected from the group consisting of: (1) — OH; (2) — CN; (3) — CF 3 ; (4) fluoro; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl;
  • R 12 is selected from the group consisting of: H, alkyl, piperidine Ring V, cycloalkyl, and - alkyl-(piperidine Ring V);
  • R 15 is selected from the group consisting of: alkyl and aryl
  • R 21 , R 22 and R 46 are independently selected from the group consisting of: (1) — H; (2) alkyl; (3) unsubstituted aryl; (4) substituted aryl substituted with one or more substituents independently selected from the group consisting of: alkyl, halogen, CF 3 and OH; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl substituted with one or more substituents independently selected from the group consisting of: alkyl, halogen, CF 3 and OH; (7) heteroaryl of the formula, and (8) heterocycloalkyl of the formula:
  • R 44 is selected from the group consisting of: (a) — H, (b) alkyl; (c) alkylcarbonyl; (d) alkyloxy carbonyl; (e) haloalkyl; and (f) -C(O)NH(R 51 );
  • R 26 is selected from the group consisting of: (1) H; (2) alkyl; (3) alkoxyl; (4) -CH 2 - CN; (5) R 9 ; (6) -CH 2 CO 2 H; (7) — C(O)alkyl; and (8) CH 2 C0 2 alkyl;
  • R 27 is selected from the group consisting of: (1) — H; (2) — OH; (3) alkyl; and (4) alkoxy;
  • R 27a is selected from the group consisting of: (1) alkyl; and (2) alkoxy;
  • R 50 is selected from the group consisting of: (1) alkyl; (2) unsubstituted heteroaryl; (3) substituted heteroary; and (4) amino; wherein said substituents on said substituted R 50 groups are independently selected from the group consisting of: alkyl, halogen, and — OH;
  • R 51 is selected from the group consisting of: H, and alkyl; provided that a ring carbon atom adjacent to a ring heteroatom in a substituted heterocycloalkyl moiety is not substituted with a heteroatom or a halo atom; and provided that a ring carbon atom, that is not adjacent to a ring heteroatom, in a substituted heterocycloalkyl moiety, is not substituted with more than one heteroatom; and provided that a ring carbon atom, that is not adjacent to a ring heteroatom, in a substituted heterocycloalkyl moiety, is not substituted with a heteroatom and a halo atom; and provided that a ring carbon in a substituted cycloalkyl moiety is not substituted with more than one heteroatom; and provided that a carbon atom in a substituted alkyl moiety is not substituted with more than one heteroatom; and provided that the same carbon atom in a substituted alkyl moiety is not substituted with both
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • R 1 to R 4 each may be independently selected from H or halo.
  • R 5 to R 7 may be H.
  • a may be N and the remaining b, c and d substituents may be carbon.
  • a, b, c, and d may be carbon.
  • the optional bond between C-5 and C-6 may be present.
  • the optional bond between C-5 and C-6 may be absent.
  • R 8 may be group 2.0, or 4.0.
  • One of A and B may be H and the other may be R 9 .
  • R 9 may be selected from the group consisting of: (1) heterocycloalkylalkyl of the formula — (CH2)n-heterocycloalkyl; (2) substituted heterocycloalkylalkyl of the formula — (CH 2 ) n - substituted heterocycloalkyl; (3) unsubstituted heteroarylalkyl of the formula — (CH 2 ) n - heteroaryl; and (4) substituted heteroarylalkyl of the formula — (CH 2 ) n - substituted heteroaryl; wherein n is 1, 2, or 3 and the substituents for said substituted R 9 groups are each independently selected from the group consisting of: (1) —OH; (2) -CO 2 R 14 ; (3) -CH 2 OR 14 , (3) halo, (4) alkyl; (5) amino; (6) trityl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroaryl and (10) heteroarylalkyl.
  • R 14 is independently selected from the group consisting of: H and alkyl.
  • R 9 may be selected from the group consisting of: (1) — (CH 2 ) n - imidazolyl; (2) — (CH 2 ) n -substituted imidazolyl; (3) — (CH 2 ) n -morpholinyl; (4) — (CH 2 ) n - substituted morpholinyl, (5) — (CH 2 ) n -piperazinyl, and (6) — (CH 2 ) n -substituted piperazinyl, wherein n is 1, 2, or 3.
  • R 11 may be selected from the group consisting of: alkyl, cycloalkyl and substituted cycloalkyl wherein the substituents are selected from the group consisting of: halo,
  • R , 11a a may be selected from: alkyl, unsubstituted aryl, and substituted aryl, cycloalkyl or substituted cycloalkyl, wherein the substituents on said substituted groups are selected from the group consisting of: halo, — CN or CF 3 ; (3) R 2 , R 2 , and R 22 are H; and (4) R 46 is selected from the group consisting of: unsubstituted aryl, 2247 substituted aryl wherein the substituents are selected from the group consisting of: alkyl, alkylcarbonyl and haloalkyl, and wherein R 44 is selected from the group consisting of: H or — C(O)NH 2 .
  • R 8 may be selected from the group consisting of: (1) group 2.0 wherein R 11 is selected from the group consisting of: t-butyl and cyclohexyl; (2) group 3.0 wherein R 11 is selected from the group consisting of: methyl and t- butyl; (3) group 4.0 wherein, R 12 is H, and R lla is selected from the group consisting of: t-butyl, cyanophenyl, chlorophenyl, fluorophenyl and cyclohexyl; (4) group 5.0 wherein R 21 and R 22 are
  • R 46 is selected from the group consisting of: wherein R 44 is -C(O)NH 2 .
  • R 8 may be group 4.0.
  • the optional bond between C5 and C6 may be present and A is H and B is R 9 .
  • R 1 to R 4 each may be independently selected from the group consisting of: H and halo; (2) R 5 , R 6 , R 7 , and R 7a are H; (3) a is N and the remaining b, c and d substituents are carbon; (4) the optional bond between C5 and C6 is present; (5) A is H; (6) B is R 9 ; (7) R 8 is group 2.0 or 4.0; (8) R 11 is selected from the group consisting of: alkyl, cycloalkyl and substituted cycloalkyl wherein the substituents are selected from the group consisting of: halo, alkyl and amino; (9) R lla is selected from the group consisting of: alkyl, unsubstituted aryl, substituted aryl, cycloalkyl or substituted cycloalkyl, wherein the substituents on said substituted groups are are selected from the group consisting of: halo, — CN and CF 3
  • R 1 to R 4 each may be independently selected from H, Br or Cl;
  • R 9 is selected from the group consisting of: (a) — (CH 2 ) n -imidazolyl; (b) — (CH 2 ) n - substituted imidazolyl; (c) — (CH2) n -morpholinyl; (d) — (CH 2 ) n -substituted morpholinyl, (e) — (CH 2 ) n -piperazinyl, or (f) — (CH 2 ) n -substituted piperazinyl, wherein n is 1, 2, or 3; (3) R 11 is selected from the group consisting of: t-butyl and cyclohexyl; (4) R 12 is H; and (5) R l la is selected from the group consisting of: t-butyl, cyanophenyl, chlorophenyl, fluorophenyl and
  • R 1 and R 2 are H; (2) R 3 is H; (3) R 4 is Cl; (5) R 8 is 4.0 wherein R l la is cyanophenyl; and R 12 is H; and (6) R 9 is selected from the group consisting of: — CH 2 -imidazolyl, and — CH 2 -imidazolyl wherein said imidazolyl moiety is substituted with a methyl group.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • X may be N.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • one of a, b, c and d represents N or N + O , and the remaining a, b, c, and d groups represent CR 1 wherein each R 1 group on each carbon is the same or different; or
  • each a, b, c, and d group represents CR 1 wherein each R 1 group on each carbon is the same or different;
  • X represents N or CH when the optional bond to C 11 is absent, and represents C when the optional bond to Cl 1 is present;
  • R 1 is selected from the group consisting of: (1) H; (2) halo; (3) -CF 3 ; (4) —OR 10 ; (5) COR 10 ; (6) -SR 10 ; (7) -S(O) 1 R 15 ; (8) — N(R 10 ) 2 ; (9) -NO 2 ; (10) -OC(O)R 10 ; (11) CO 2 R 10 ; (12) -OCO 2 R 10 ; (13) -CN; (14) -NR 10 COOR 15 ; (15) -SR 15 C(O)OR 15 ; (16) — SR 15 N(R 13 ) 2 wherein each R 13 is independently selected from the group consisting of: H and — C(O)OR 15 , and provided that R 15 in — SR 15 N(R 13 ) 2 is not — CH 2 ; (17) benzotriazol-1-yloxy; (18) tetrazol-5- ylthio; (19) substituted tetrazol-5-y
  • Each R is independently selected from the group consisting of: (1) halo; (2) — CF 3 ; (3) —OR 10 ; (4) COR 10 ; (5) -SR 10 ; (6) -S(O) 1 R 15 ; (7) — N(R 10 ) 2 ; (8) -NO 2 ; (9) -OC(O)R 10 ; (10) CO 2 R 10 ; (11) -OCO 2 R 10 ; (12) -CN; (13) -NR 10 COOR 15 ; (14) -SR 15 C(O)OR 15 ; (15) — SR 15 N(R 13 ) 2 wherein each R 13 is independently selected from the group consisting of: H and — C(O)OR 15 , and provided that R 15 in — SR 15 N(R 13 ) 2 is not -CH 2 ; (16) benzotriazol-1-yloxy; (17) tetrazol-5-ylthio; (18) substituted tetrazol-5-ylthio
  • (G) m is O, 1 or 2;
  • R 5 , R 6 , R 7 and R 7a are each independently selected from the group consisting of: (1) H; (2) — CF 3 ; (3) — COR 10 ; (4) alkyl; (5) unsubstituted aryl; (6) alkyl substituted with one or more groups selected from the group consisting of: —OR 10 , -SR 10 , -S(O) 1 R 15 , -NR 10 COOR 15 , — N(R 10 ) 2 , -NO 2 , -C(O)R 10 ; — OCOR 10 , -OCO 2 R 15 , CO 2 R 10 , and OPO 3 R 10 ; and (7) aryl substituted with one or more groups selected from the group consisting of: — OR 10 , — SR 10 , — S(O) 1 R 15 , -NR 10 COOR 15 , — N(R 10 )2'-NO 2 , -C(O)R 10 ;
  • (K) R 8 is selected from the group consisting of
  • (L) R , 10 is selected from the group consisting of: H; alkyl; aryl and arylalkyl;
  • (M) R , 11 is selected from: (1) alkyl; (2) substituted alkyl; (3) unsubstituted aryl; (4) substituted aryl; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl; (7) unsubstituted heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R 11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) fluoro; and (3) alkyl; and wherein said substituted aryl and substituted heteroaryl R 11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) halogen; and (3) alkyl;
  • R l la is selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) unsubstituted aryl; (6) substituted aryl; (7) unsubstituted cycloalkyl; (8) substituted cycloalkyl; (9) unsubstituted heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R 1 la groups are substituted with one or more substituents selected from the group consisting of: (1) —OH; (2) -CN; (3) -CF 3 ; (4) fluoro; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; and wherein
  • R 15 is selected from the group consisting of: alkyl and aryl;
  • R 21 , R 22 and R 46 are independently selected from the group consisting of: (1) H; (2) alkyl; (3) unsubstituted aryl; (4) substituted aryl substituted with one or more substituents selected from the group consisting of: alkyl, halogen, CF 3 or OH; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl substituted with one or more substituents selected from the group
  • R 44 is selected from the group consisting of: (a) H, (b) alkyl; (c) alkylcarbonyl; (d) alkyloxy carbonyl; (e) haloalkyl and (f) — C(O)NH(R 51 );
  • R 51 is selected from the group consisting of: — H and alkyl (e.g., methyl, ethyl, propyl, butyl and t-butyl);
  • (S) B is the group:
  • R 30 when p is one for the moiety then R 30 is selected from the group consisting of: — OH and — NH 2 , and R 31 is alkyl; (4) when p is 2 or 3 for the then: (1) for one -CR 30 R 31 - moiety, R 30 is selected from the group consisting of: — OH and — NH 2 , and R 31 is alkyl; and (2) for the remaining — CR 30 R 31 — moieties R 30 and R 31 are hydrogen; and (5) R 9 is unsubstituted heteroaryl or substituted heteroaryl, provided that when said heteroaryl group contains nitrogen in the ring, then said heteroaryl group is not bound by a ring nitrogen to the adjacent — CR 30 R 31 — moiety when R 30 is —OH or -NH 2 .
  • (4) a is N; (5) b, c and d are CR 1 groups wherein all of said R 1 substituents are H, or one R 1 substituent is halo and the remaining two R 1 substituents are hydrogen; (6) m is 1, and R 3A is halo, or m is 2 and each R 3A is the same or different halo (e.g., Br or Cl); and (7) R 5 , R 6 , R 7 , and R 7a are H.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • R 30 is selected from the group consisting of: — OH and — NH 2 , and R 31 is alkyl; (d) when p is 2 or 3 for the
  • R 30 is selected from the group consisting of: — OH and — NH 2 , and R 31 is alkyl; and (2) for the remaining — CR 30 R 31 — moieties R 30 and R 31 are hydrogen; and (e) R 9 is unsubstituted heteroaryl or substituted heteroaryl, provided that when said heteroaryl group contains nitrogen in the ring, then said heteroaryl group is not bound by a ring nitrogen to the adjacent — CR 30 R 31 — moiety when R 30 is —OH or -NH 2 ;
  • (D) b, c and d are CR 1 groups wherein all of said R 1 substituents are H, or one R 1 substituent is halo and the remaining two R 1 substituents are hydrogen;
  • R 5 , R 6 , R 7 , and R 7a are H;
  • R 8 is selected from the group consisting of:
  • R 11 is selected from: (1) alkyl; (2) substituted alkyl; (3) unsubstituted aryl; (4) substituted aryl; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl; (7) unsubstituted heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R 11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) fluoro; and (3) alkyl; and wherein said substituted aryl and substituted heteroaryl R 11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) halogen; and (3) alkyl;
  • R lla is selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) unsubstituted aryl; (6) substituted aryl; (7) unsubstituted cycloalkyl; (8) substituted cycloalkyl; (9) unsubstituted heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R 1 la groups are substituted with one or more substituents selected from the group consisting of: (1) —OH; (2) -CN; (3) -CF 3 ; (4) fluoro; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; and wherein
  • R 21 , R 22 and R 46 are independently selected from the group consisting of: (1) H; (2) alkyl; (3) unsubstituted aryl; (4) substituted aryl substituted with one or more substituents selected from the group consisting of: alkyl, halogen, CF 3 or OH; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl substituted with one or more substituents selected from the group
  • R 44 is selected from the group consisting of: (a) H, (b) alkyl; (c) alkylcarbonyl; (d) alkyloxy carbonyl; (e) haloalkyl and (f) — C(O)NH(R 51 ); and
  • R 51 is selected from the group consisting of: H and alkyl (e.g., methyl, ethyl, propyl, butyl and t-butyl). [00207] In certain embodiments, (A) in the B group: (1) p of the
  • moiety is 0; (2) p of the moiety is 1 to 2; (3) when p is
  • R 30 is selected from the group consisting of: — OH and — NH 2 , and R , 31 is Ci-C 2 alkyl; (4) when p is 2 or 3 for the moiety then:
  • R 30 is selected from the group consisting of: — OH and
  • R 31 is Ci-C 2 alkyl; and (2) for the remaining -CR 30 R 31 - moieties R 30 and R 31 are hydrogen; and (5) R 9 is imidazolyl or substituted imidazolyl, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR 30 R 31 — moiety when R 30 is — OH or — NH 2 ;
  • R 11 is alkyl
  • (E) b, c and d are CR 1 groups wherein all of said R 1 substituents are H;
  • R 30 is selected from the group consisting of: — OH and
  • R p of the moiety is 1 ; (3) R , 30 is — OH, and R 31 . is methyl; and (4) R is substituted imidazolyl wherein the substituent is a methyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR 30 R 31 — moiety; and (B) R 3A is Cl; and (C) R ⁇ is alkyl.
  • R 9 may be
  • R , 11 may be t-butyl.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula: wherein all substituents may be as defined above.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • (A) in the B group (1) p of the — (CH 2 ) P — moiety is 0; (2)
  • R 30 is —OH, and R 3 J is methyl; and (4) R 9 is substituted imidazolyl wherein the substituent is a methyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR 30 R 31 — moiety; and (B) R 3A is Cl; and (C) R ⁇ is alkyl.
  • R 9 may be
  • R . 11 may be t-butyl.
  • R 9 is substituted imidazolyl wherein the substituent is a methyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR 30 R 31 — moiety; and (B) R 3A is Cl; and (C) R ⁇ is alkyl.
  • R 9 may be
  • R 11 may be t-butyl.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • one of a, b, c and d represents N or N + O " , and the remaining a, b, c, and d groups represent carbon, wherein each carbon has an R 1 or R 2 group bound to said carbon; or each of a, b, c, and d is carbon, wherein each carbon has an R 1 or R 2 group bound to said carbon; the dotted lines ( — ) represent optional bonds;
  • X represents N or CH when the optional bond is absent, and represents C when the optional bond is present; when the optional bond is present between carbon atom 5 and carbon atom 6 then there is only one A substituent bound to carbon atom 5 and there is only one B substituent bound to carbon atom 6 and A or B is other than H; when the optional bond is not present between carbon atom 5 and carbon atom 6, then there are two A substituents bound to carbon atom 5 and two B substituents bound to carbon atom 6, wherein each A and B substituent is independently selected from the group consisting of:
  • NHR 9 ; (30) 30 and R , 31 are the same or different; (31)
  • R 30 , R 31 , R 32 and R 33 are the same or different; (32) - alkenyl-CO 2 R 9a ; (33) -alkenyl-C(O)R 9a ; (34) -alkenyl-CO 2 R 51 ; (35) -alkenyl-C(O)— R 27a ; (36)
  • each R 1 and R 2 is independently selected from H, Halogen, -CF 3 , —OR 10 , COR 10 , — SR 10 , -S(O), 15 wherein t is 0, 1 or 2, — N(R 10 ) 2 , -NO 2 , -OC(O)R 10 , CO 2 R 10 , -OCO 2 R 15 , -CN, -NR 10 COOR 15 , -SR 15 C(O)OR 15 — SR 15 N(R 13 ) 2 provided that R 15 in — SR 15 N(R 13 ) 2 is not — CH 2 , and wherein each R 13 is independently selected from H or — C(O)OR 15 , benzotriazol-1
  • R , R , R7 and R , 7a each independently represent H, -CF 3 , — COR 10 , alkyl or aryl, said alkyl or aryl optionally being substituted with —OR , 10, — SR 10 , — S(O) 1 R , 15 , — NR , 1 1 0X/- OOR , 15 , — N(R . 1 i 0 ⁇ ⁇ ) 2 ,
  • R 8 is selected from the group consisting of:
  • R 9 is selected from the group consisting of: (1) heteroaryl; (2) substituted heteroaryl; (3) arylalkoxy; (4) substituted arylalkoxy; (5) heterocycloalkyl; (6) substituted heterocycloalkyl; (7) heterocycloalkylalkyl; (8) substituted heterocycloalkylalkyl; (9) heteroarylalkyl; (10) substituted heteroarylalkyl; (11) heteroarylalkenyl; (12) substituted heteroarylalkenyl; (13) heteroarylalkynyl; (14) substituted heteroarylalkynyl; (15) arylalkyl; (16) substituted arylalkyl; (17) alkenyl, and (18) substituted alkenyl; wherein said substituted R 9 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) -CO 2 R 14 ; (3) -CH 2 OR 14 , (4) halogen; (5) alkyl;
  • R 14 is independently selected from the group consisting of: H; alkyl; aryl, arylalkyl, heteroaryl and heteroarylalkyl;
  • R 9a is selected from the group consisting of: alky and arylalkyl
  • R 10 is selected from the group consisting of: H; alkyl; aryl and arylalkyl
  • R 11 is selected from the group consisting of: (1) alkyl; (2) substituted alkyl; (3) aryl; (4) substituted aryl; (5) cycloalkyl; (6) substituted cycloalkyl; (7) heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted R 11 groups have 1, 2 or 3 substituents selected from the group consisting of: (1) — OH; (2) halogen and (3) alkyl;
  • R l la is selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) aryl; (6) substituted aryl; (7) cycloalkyl; (8) substituted cycloalkyl; (9) heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted R 1 la groups have one or more substituents selected from the group consisting of: (1) —OH; (2) -CN; (3) -CF 3 ; (4) halogen; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl, (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; R 12 is selected from the group consisting of: H, and alkyl; R 15 is selected from the group consisting of: alkyl and aryl;
  • R 21 , R 22 and R 46 are independently selected from the group consisting of: (1) — H; (2) alkyl; (3) aryl; (4) substituted aryl, optionally substituted with one or more substituents selected from the group consisting of: alkyl, halogen, CF 3 and OH; (5) cycloalkyl; (6) substituted cycloalkyl; optionally substituted with one or more substituents selected from the group consisting of: alkyl,
  • R 44 is selected from the group consisting of: (1) — H; (2) alkyl; (3) alkylcarbonyl; (4) alkyloxy carbonyl; (5) haloalkyl and (6) -C(O)NH(R 51 ); when R 21 , R 22 or R 46 is the heterocycloalkyl of the formula above, Ring V is
  • R 26 is selected from the group consisting of: (1) — H; (2) alkyl; (3) alkoxyl; (4) -CH 2 - CN;
  • R 27 is selected from the group consisting of: (1) — H; (2) —OH; (3) alkyl and (4) alkoxy; R 27a is selected from the group consisting of: (1) alkyl and (2) alkoxy;
  • R 30 through R 33 are independently selected from the group consisting of: (1) — H; (2) — OH; (3)
  • R 50 is selected from the group consisting of: (1) alkyl; (2) heteroaryl; (3) substituted heteroaryl and (4) amino; wherein said substituents on said substituted R 50 groups are independently selected from the group consisting of: alkyl; halogen; and — OH;
  • R 5Oa is selected from the group consisting of: (1) heteroaryl; (2) substituted heteroaryl and (3) amino; R 51 is selected from the group consisting of: — H, and alkyl.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • A represents N or N-oxide
  • X represents N, CH or C, such that when X is N or CH, there is a single bond to carbon atom 11 as represented by the solid line; or when X is C, there is a double bond to carbon atom 11 , as represented by the solid and dotted lines;
  • X I and X 2 are independently selected from bromo or chloro, and X 3 and X 4 are independently selected from hydrogen, bromo or chloro provided that at least one of X 3 and X 4 is hydrogen;
  • R 10 , R 19 and R 20 independently represent hydrogen, alkyl, alkoxy, aryl, aralkyl, heteroaryl, heteroarylalkyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl and heterocycloalkylalkyl, with the proviso that R 19 and R 20 are not both hydrogen; v is zero, 1, 2 or 3; and w is zero or 1.
  • X 1 is bromo
  • X 2 is chloro
  • X 3 is bromo
  • X 4 is hydrogen.
  • Z 0; v is 1, w is 1, and Y 1 and Y 2 are hydrogen.
  • R 19 and R 20 are independently selected from hydrogen, aryl and heterocycloalkyl wit h the proviso that R 19 and R 20 are not both hydrogen.
  • the aryl group is substituted with alkoxy; and the heterocycloalkyl group is substituted with — COOR 10 wherein R 10 is hydrogen or alkyl.
  • R 10 is hydrogen or alkyl.
  • X 1 is bromo
  • X 2 is chloro
  • X 3 is bromo
  • X 4 is hydrogen.
  • Z 0; v is 1, w is 1, and Y 1 and Y 2 are hydrogen.
  • R 19 and R 20 are independently selected from hydrogen, alkyl, aryl and heterocycloalkyl with the proviso that R 19 and R 20 are not both hydrogen.
  • the alkyl group is substituted with —OR 10 , alkoxy, -OCOR 10 , -CONR 10 R 12 or — COOR 10 , wherein R 10 and R 12 are independently selected from hydrogen, alkyl or alkoxy; the aryl group is substituted with alkoxy; and the heterocycloalkyl group is substituted with — COOR 10 wherein R 10 is hydrogen or alkyl.
  • X is CH
  • Z 0
  • R 5 , R 6 , R 7 and R 8 are hydrogen
  • X 1 is bromo
  • X 2 is chloro
  • X 3 is bromo
  • X 4 is hydrogen
  • v is 1
  • w is 1
  • Y 1 and Y 2 are hydrogen
  • R 19 and R 20 are independently selected from hydrogen, alkyl, aryl and heterocycloalkyl, wherein the alkyl group is substituted with — OR 10 , alkoxy, — OCOR 10 , —
  • R 10 and R 12 are independently selected from hydrogen, alkyl or alkoxy; the aryl group is substituted with alkoxy; the heterocycloalkyl group is substituted with — COOR 10 wherein R 10 is hydrogen or alkyl, with the proviso that R 19 and R 20 are not both hydrogen.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • R and R 2 are independently selected from halo
  • R 1 and R 3 are independently selected from the group consisting of H and halo, provided that at least one of R 1 and R 3 is H;
  • W is N, CH or C, when the double bond is present at the C-I l position;
  • R 6 and R 7 are independently selected from the group consisting of H, alkyl, substituted alkyl, acyl, aryl, aralkyl, heterocycloalkyl and heteroaryl;
  • X 0 and R 6 and R 7 are each hydrogen.
  • n 1 and n 3 is 0 or 1.
  • R is bromo and R 2 is chloro or bromo.
  • R is bromo, R 2 is chloro or bromo, R 1 is H, and R 3 is chloro or bromo.
  • R is bromo, R 2 is chloro or bromo, R 3 is H, and R 1 is chloro or bromo.
  • the compound may any one of the following:
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • a represents N and the remaining b, c and d groups represent CR 1 or CR 2 ;
  • R 1 is selected from H or halo
  • R 2 is selected from NO 2 , Br, Cl or I;
  • R 3 is Cl
  • R 4 is H or halo
  • R 5 , R 6 , R 7 and R 8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H 2 ;
  • R 20 and R 21 are independently selected from H or alkyl
  • R 46 is selected from: pyridyl, pyridyl N-oxide or piperidine Ring V:
  • R 50 represents alkyl, alkylcarbonyl, alkyloxycarbonyl, haloalkyl, or —
  • R 1 is H.
  • R 2 is selected from Br, Cl or I.
  • R 2 is Br at the C-3 position.
  • R 2 is Br at the C-3 position and R is at the C-8 position.
  • both R and R are hydrogen, or both R and R 21 are alkyl.
  • both R 20 and R 21 are hydrogen.
  • R 46 is 3-pyridyl, 4-pyridyl, 3-pyridyl N-oxide, 4-pyridyl N-oxide, 4-N-methyl piperidinyl, 3 -N- methylpiperidinyl, 4-N-acetylpiperidinyl or 3-N-acetylpiperidinyl.
  • R 46 is 3- pyridyl, 4-pyridyl, 3-pyridyl N-oxide, or 4-pyridyl N-oxide. In one embodiment, R 46 is 4-pyridyl or 4-pyridyl N-oxide. In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • R 1 is selected from H or halo
  • R 2 is selected from -CH 3 , Br, or I;
  • R 3 is Cl
  • R 4 is H or halo
  • R 5 , R 6 , R 7 and R 8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H 2 ;
  • R 20 and R 21 are H;
  • R 46 is selected from: pyridyl, pyridyl N-oxide, triazolyl, 1-N-methylpiperazinyl,
  • t is 0, 1 or 2, or piperidine Ring V: wherein R 50 represents alkyl, alkylcarbonyl, alkoxycarbonyl, haloalkyl, or — C(O)NH(R 10 ) wherein R 10 is H or alkyl; and Z represents O.
  • R 1 is H.
  • R 2 is selected from Br.
  • R 2 is Br and R 3 is at the C-8 position.
  • R 46 is selected from 3- pyridyl, 4-pyridyl, 3 -pyridyl N-oxide, 4-pyridyl N-oxide, 4-N-methyl piperidinyl, 3 -N- methylpiperidinyl, 4-N-acetylpiperidinyl or 3-N-acetylpiperidinyl.
  • R 46 is selected from: 3-pyridyl, 4-pyridyl, 3-pyridyl N-oxide, or 4-pyridyl N-oxide.
  • R 46 is selected from 4-pyridyl or 4-pyridyl N-oxide.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • R 1 is selected from H or halo
  • R 2 is Cl
  • R 3 is Cl
  • R 4 is H or halo
  • R 5 , R 6 , R 7 and R 8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H 2 ;
  • R 20 and R 21 are H;
  • R 46 is selected from: 4-pyridyl N-oxide, 4-pyridyl or piperidine Ring V: wherein R 50 represents alkyl, alkylcarbonyl, alkyloxycarbonyl, haloalkyl, or —
  • R 1 is H.
  • R 3 is at the C-8 position.
  • R 46 is 4-pyridyl N-oxide, 4-N-methyl piperidinyl, or 3-N-methylpiperidinyl.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula: wherein: a represents N and the remaining b, c and d groups represent CR 1 or CR 2 ;
  • R 1 and R 2 are independently selected from H, halo, -CF 3 , lower alkyl or benzotriazol-1- yloxy;
  • R 3 and R 4 are independently selected from H or halo
  • R 5 , R 6 , R 7 and R 8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H 2 ;
  • R , 25 represents pyridyl, pyridyl N-oxide, N-methyl-piperidinyl or phenyl;
  • R > 48 represents H or alkyl
  • R 1 is Cl or H; and R 2 is H, Cl or Br.
  • R 3 is Cl.
  • R 25 represents phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyridyl N- oxide, 3-pyridyl N-oxide, or 4-pyridyl N-oxide.
  • R 48 represents H or methyl.
  • R 25 represents phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyridyl N-oxide, 3- pyridyl N-oxide, or 4-pyridyl N-oxide; and R 48 represents H or methyl.
  • R 1 is Cl or H;
  • R 2 is Br, Cl, or I;
  • R 3 and R 4 independently represent H or halo;
  • R 25 represents phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyridyl N-oxide, 3-pyridyl N-oxide, or 4-pyridyl N-oxide; and
  • R 48 represents H or methyl.
  • R 3 is Cl at the C-8 position and R 4 is H.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • R 1 is selected from H or halo
  • R 3 is Cl
  • R 4 is H or halo; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H 2 ; and
  • R 65 represents H or —OR 66 wherein R 66 represents alkyl.
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
  • the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
  • This compound is also known by the name SCH66336 or Sarasar.
  • the therapeutically effective amount of the farnesyl transferase inhibitor included in the combination therapy will vary depending on the patient, the disease being treated, extent of disease, the route of administration, other medications being administered to the patient, desired outcome, etc.
  • the farnesyl transferase inhibitor is administered in the range of approximately 0.0001 mg/kg body weight to approximately 10 mg/kg body weight. In certain embodiments, the farnesyl transferase inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 1 mg/kg body weight. In certain embodiments, the farnesyl transferase inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 0.1 mg/kg body weight.
  • the farnesyl transferase inhibitor is administered in the range of approximately 0.01 mg/kg body weight to approximately 0.1 mg/kg body weight. As will be appreciated by one of skill in the art, depending on the form of the farnesyl transferase inhibitor being administered the dosing may vary. The dosages given herein are dose equivalents with respect to the active ingredient. In certain embodiments, the farnesyl transferase inhibitor is administered parenterally. In certain embodiments, the farnesyl transferase inhibitor is administered intravenously. In certain embodiments, the farnesyl transferase inhibitor is administered orally. In certain embodiments, the farnesyl transferase inhibitor is administered from once a week to 2-3 times per day.
  • the farnesyl transferase inhibitor is administered once per day. In certain embodiments, the farnesyl transferase inhibitor and synuclein aggregation inhibitor are administered together. In other embodiments, they are administered separately. In certain embodiments, the combination is administered long term to prevent the development of the synucleinopathy or other neurodegenerative diseases.
  • any agent that has been discovered to prevent the aggregation of ⁇ -synuclein may be used in combination with a farnesyl transferase inhibitor to treat synucleinopathies or other neurodegenerative diseases. Agents may be screened for their ability to prevent the aggregation of ⁇ -synuclein using techniques known in the art. Several assays for identifying compounds that prevent the aggregation of ⁇ -synuclein are described in the Examples section below. In certain embodiments, the assays involves testing for the aggregation of ⁇ -synuclein in hexafluoroisopropanol.
  • the assay invovles testing for the aggregation of ⁇ -synuclein in an aqueous solution.
  • the agent is a small molecule.
  • the agent is an organic compound.
  • the agent is a drug approved for use in humans by the U.S. Food and Drug Administration (FDA) or under consideration by the FDA.
  • the agent is an anti-depressant.
  • the agent used in combination with a farnesyl transferase inhibitor is a tricyclic antidepressant.
  • the agent is selected from the group consisting of nortriptyline, maprotiline, protriptyline, nordoxepin, and norclomipramine.
  • the agent is nortriptyline.
  • the agent is a monoamine reuptake inhibitor.
  • the reuptake inhibitor may block the re -uptake of neurotransmitters such as norepinephrine, dopamine, serotonin, or combinations thereof.
  • the reuptake inhibitor may be selective for a particular neurotransmitter, or it may be non-selective and block the reuptake of multiple neurotransmitters.
  • the agent is selective serotonin reuptake inhibitor (SSRI).
  • the agent is sertraline.
  • the agent is indatraline.
  • the agent is fluoxetine.
  • the agent is norfluoxetine.
  • any agent known to prevent the aggregation of ⁇ -synuclein may be used in the treatment of Parkinson's Disease.
  • nortriptyline, maprotiline, protriptyline, nordoxepin, and norclomipramine is used in the treatment of Parkinson's Disease with or without another therapy.
  • sertraline, indatraline, fluoxetine, or norfluoxetine is used in the treatment of Parkinson's Disease with or without another therapy.
  • Certain particular inventive combinations useful in accordance with the present invention include: LNK-754 and nortriptyline, LNK-754 and maprotiline, LNK-754 and protriptyline, LNK-754 and norclomipramine, LNK-754 and sertraline, LNK-754 and indatraline, LNK-754 and nordoxepin, LNK-754 and fluoxetine, LNK-754 and norfluoxetine, LNK-427 and nortriptyline, LNK-427 and maprotiline, LNK-427 and protriptyline, LNK-427 and norclomipramine, LNK-427 and sertraline, LNK-427 and indatraline, LNK-427 and nordoxepin, LNK-427 and fluoxetine, LNK-427 and norfluoxetine, Sarasar and nortriptyline, Sarasar and maprotiline, Sarasar and protriptyline, Sarasar and norclomipramine, Sarasar and sertraline, Sarasar and indatraline, Sarasar and nor
  • the therapeutically effective amount of the ⁇ -synuclein aggregation inhibitor included in the therapy will vary depending on the patient, the disease being treated, extent of disease, the route of administration, other medications being administered to the patient, desired outcome, etc.
  • the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 0.0001 mg/kg body weight to approximately 25 mg/kg body weight.
  • the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 1 mg/kg body weight to approximately 25 mg/kg body weight.
  • the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 10 mg/kg body weight to approximately 20 mg/kg body weight.
  • the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 1 mg/kg body weight to approximately 10 mg/kg body weight. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 1 mg/kg body weight to approximately 5 mg/kg body weight. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 1 mg/kg body weight. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 0.1 mg/kg body weight.
  • the ⁇ -synuclein aggregation inhibitor is administered in the range of approximately 0.01 mg/kg body weight to approximately 0.1 mg/kg body weight. In certain embodiments, approximately 1 mg to approximately 2000 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1000 mg to approximately 2000 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 1000 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 500 mg of the ⁇ -synuclein aggregation inhibitor is administered each day.
  • approximately 1 mg to approximately 100 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 50 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 10 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 10 mg to approximately 100 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 25 mg to approximately 100 mg of the ⁇ -synuclein aggregation inhibitor is administered each day.
  • approximately 10 mg to approximately 50 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 25 mg to approximately 75 mg of the ⁇ -synuclein aggregation inhibitor is administered each day. As will be appreciated by one of skill in the art, depending on the form of the ⁇ -synuclein aggregation inhibitor being administered the dosing may vary. The dosages given herein are dose equivalents with respect to the active ingredient. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is administered parenterally. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is administered intravenously.
  • the ⁇ -synuclein aggregation inhibitor is administered orally. In certain embodiments, the ⁇ -synuclein aggregation inhibitor is administered from once a week to four times per day. In certain particular embodiments, the ⁇ -synuclein aggregation inhibitor is administered once per day. In certain emboidments, the ⁇ -synuclein aggregation inhibitor is administered twice per day. In certain emboidments, the ⁇ -synuclein aggregation inhibitor is administered 3-4 times per day. In certain embodiments, the farnesyl transferase inhibitor and ⁇ - synuclein aggregation inhibitor are administered together (e.g., at the same time).
  • the combination is administered long term to prevent the development of the synucleinopathy or other neurodegenerative diseases.
  • the inventive combination therapy may be administered continuously or intermittently.
  • the combination or one of the components of the combination may be administered for a certain period of time (e.g., weeks, months) and the discontinued for a certain period of time (e.g., weeks, months).
  • the combination or a component is administered for 1 to 3 months followed by a year with none of the combination or component.
  • the combination or component is administered every other month, every other quarter, every other six months, or every other year.
  • the inventive combination therapy may be used in vitro or in vivo.
  • the combination is useful in treating diseases associated with the accumulation and/or aggregation of ⁇ -synuclein.
  • the inventive combination is particularly useful in treating or preventing synucleinopathies including Parkinson's disease, diffuse Lewy body disease, multiple system atrophy disorder, and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration.
  • other diseases which are associated with abnormal aggregations of ⁇ -synuclein may also be treated with the inventive combination.
  • the inventive combination may be used to treating the following diseases: amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and Alzheimer's disease (AD).
  • ALS amyotrophic lateral sclerosis
  • HD Huntington's disease
  • AD Alzheimer's disease
  • the disease being treated using the inventive combination therapy is Parkinson's disease.
  • the disease being treated using the inventive combination therapy is diffuse Lewy body disease.
  • the disease being treated using the inventive combination therapy is multiple system atrophy disorder.
  • the disease being treated using the inventive combination therapy is pantothenate kinase-associated neurodegeneration.
  • the disease being treated using the inventive combination therapy is amyotrophic lateral sclerosis (ALS).
  • the disease being treated using the inventive combination therapy is Huntington's disease.
  • the disease being treated using the inventive combination therapy is Alzheimer's disease.
  • the disease being treated using the inventive combination therapy is Parkinson's disease.
  • the disease being treated using the inventive combination therapy is frontotemporal dementia.
  • the disease being treated using the inventive combination is prion disease (e.g., Creutzfeldt Jakob Disease).
  • the disease being treated using the inventive combination is Niemann-Pick Type Cl disease.
  • the disease being treated using the inventive combination is Gaucher's disease.
  • the disease being treated using the inventive combination is progressive supranuclear palsy.
  • the inventive combination of agents may also be used with one or more other pharmaceutical agents.
  • the combination may be used with pharmaceutical agents currently used to treat synucleinopathies or other neurodegenerative diseases, or symptoms arising as side-effects of the disease or of the aforementioned medications.
  • Levodopa mainly in the form of combination products containing carbodopa and levodopa (Sinemet and Sinemet CR) is the mainstay of treatment and is the most effective agent for the treatment of PD.
  • Levodopa is a dopamine precursor, a substance that is converted into dopamine by an enzyme in the brain.
  • Carbodopa is a peripheral decarboxylase inhibitor that prevents side effects and lower the overall dosage requirement.
  • the starting dose of Sinemet is a 25/100 or 50/200 tablet prior to each meal. Dyskinesias may result from overdose and also are commonly seen after prolonged (e.g., years) use.
  • Direct acting dopamine agonists may have less of this side effect.
  • Stalevo (carbodopa, levodopa, and entacapone) is a new combination formulation for patients who experience signs and symptoms of "wearing-off.”
  • the formulation combines carbodopa and levodopa (the most widely used agents to treat PD) with entacapone, a catechol-O-methyltransferase inhibitor. While carbodopa reduces the side effects of levodopa, entacapone extends the time levodopa is active in the brain, up to about 10% longer.
  • Amantadine (SYMMETREL ® ) is a mild agent thought to work by multiple mechansims including blocking the re-uptake of dopamine into presynaptic neurons. It also activates the release of dopamine from storage sites and has a glutamate receptor blocking activity. It is used as early monotherapy, and the dosing is typically 200 to 300 mg daily. Amantadine may be particularly helpful in patients with predominant tremor. Side effects may occasionally include ankle swelling and red blotches. It may also be useful in later stage disease to decrease the intensity of drug-induced dyskinesia.
  • Anticholinergics do not act directly on the dopaminergic system.
  • Direct-acting dopamine agonists include bromocriptidine (Parlodel), pergolide (Permax), ropinirol (Requip), and pramipexole (Mirapex). These agents cost substantially more than levodopa (Sinemet), and additional benefits are controversial.
  • Dl and D2 agonist can exert anti-Parkinson effects by stimulating the Dl and D2 receptors, such as Ergolide. Mirapex and Requip are the newer agents.
  • Direct dopamine agonists in general, are slightly more likely to produce adverse neuropsychiatric side effects such as confusion than levodopa. Unlike levodopa, direct dopamine agonists do not undergo conversion to dopamine and thus do not produce potentially toxic free radical as they are metabolized. It is also possible that the early use of a direct dopamine agonist decreases the propensity to develop the late complications, associated with direct stimulation of the dopamine receptor by dopamine itself, such as the "on-off ' effect and dyskinesia.
  • MAO Monoaminoxidase-B inhibitors
  • selegiline Diprenyl, or Eldepryl
  • a neuroprotective effect for some members of the selectiv MAOB class of inhibitors remains ⁇ e.g., rasagiline).
  • Catechol-O-methyltransferase inhibitors can also be used in combination treatments of the invention.
  • Catechol-O-methyltransferase is an enzyme that degrades levodopa, and inhibitors can be used to reduce the rate of degradation.
  • Entacapone is a peripherally acting COMT inhibitor, which can be used in certain methods and compositions of the invention.
  • Tasmar or Tolcapone, approved by the FDA in 1997, can also be used in certain methods and compositions of the invention.
  • Psychiatric adverse effects that are induced or exacerbated by PD medication include psychosis, confusion, agitation, hallucinations, and delusions.
  • atypical antipsychotics such as clozapine or quetiapine.
  • the inventive combination therapy can also be used in conjunction with surgical therapies for the treatment of PD.
  • Surgical treatment is presently recommended predominantly for those who have failed medical management of PD.
  • Unilateral thalamotomy can be used to reduce tremor. It is occasionally considered for patients with unilateral tremor not responding to medication. Bilateral procedures are typically not advised.
  • Unilateral deep brain stimulation of the thalamus for tremor may also be a benefit for tremor.
  • Unilateral pallidotomy is an effective technique for reducing contralateral drug-induced dyskinesias.
  • the currently preferred neurosurgical intervention is, however, bilateral subthalamic nucleus stimulation.
  • the inventive combination therapy can be used in conjuction with one or more other medications for treating DLBD.
  • the lowest acceptable doses of levodopa can be used to treat DLBD.
  • D2-receptor antagonists particularly traditional neuroleptic agents, can provoke severe sensitivity reactions in DLBD subjects with an increase in mortality of two to three times.
  • Cholinsterase inhibitors dicussed herein may also be used in conjunction with the inventive treatment of DLBD.
  • Glutamate antagonists such as memantine may also be used
  • the inventive combinations can be used in conjunction with one or more alternative medications for treating the symptoms of MSA.
  • the drugs that can be used to treat various symptoms of MSA become less effective as the disease progresses.
  • Levodopa and dopamine agonists used to treat PD are sometimes partially effective for the slowness and rigidity of MSA.
  • Orthostatic hypertension can be improved with cortisone, midodrine, fludrocortisone, or other drugs that raise blood pressure.
  • Male impotence may be treated with penile implants or drugs.
  • Incontinence may be treated with medication or catheterization. Constipation may improve with increased dietary fiber or laxatives.
  • the combination of farnesyl transferase inhibitor and ⁇ -synuclein aggregation inhibitor may also be used in vitro to treat cells.
  • the treatment of cells with the inventive combination may be useful in studying the mechanism of action of the agents.
  • the method may also be used to test the efficacy of a particular combination of agents.
  • the cells used in the in vitro assay may be any type of cell.
  • the cells are mammalian cells.
  • the cells are human cells.
  • the cells are neural cells.
  • the cells typically express ⁇ -synuclein and may show the formation of ⁇ -synuclein aggregation.
  • the cells may be genetically engineered to express ⁇ - synuclein.
  • the present invention also provides pharmaceutical compositions, preparation, and kits comprising a farnesyl transferase inhibitor and an agent that inhibits the aggregation of ⁇ - synuclein, and optionally a pharmaceutically acceptable carrier or excipient.
  • the compositions, preparation, and kits typically include amounts of each agent appropriate for the administration to a subject.
  • the two agents are not mixed togeteher in the same composition.
  • the two agents may not be part of the same solution or tablet.
  • the two agents are kept in different compositions and are administered separately.
  • a kit may contain the inventive pharmaceutical composition as well as instructions for prescribing the combination.
  • the agents act synergistically and therefore the amount of one or both agents is lower than the amount administered when only one agent is used. In certain embodiments, the agents act additively and the amount of one or both agents is optionally lower than the amount administered when only one agent is used. In certain embodiments, the amount of both agents is lower.
  • the dosing of each of the farnesyl transferase inhibitor and the ⁇ -synuclein aggregation inhibitor is described in more detail above.
  • any pharmaceutical acceptable carrier or excipient may be part of the inventive pharmaceutical compositions.
  • Wetting agents, emulsif ⁇ ers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants may be present in the inventive compositions.
  • antioxidants examples include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin
  • Formulations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, and the particular mode of administration.
  • the amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, this amount will range from about 1% to about 99% of active ingredient, preferably from about 5% to about 70%, most preferably from about 10% to about 30%.
  • a formulation of the present invention comprises an excipient selected from the group consisting of cyclodextrins, liposomes, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters, polyacrylates, polyphosphazenes, and polyanhydrides; and a compound of the present invention.
  • an aforementioned formulation renders orally bioavailable a compound of the present invention.
  • Methods of preparing these formulations or compositions include the step of bringing into association a compound of the present invention with the carrier and, optionally, one or more accessory ingredients.
  • Formulations of the invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound of the present invention as an active ingredient.
  • a compound of the present invention may also be administered as a bolus, electu
  • the active ingredient is mixed with one or more pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; humectants, such as glycerol; disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; solution retarding agents, such as paraffin; absorption accelerators, such as quaternary ammonium compounds; wetting agents, such as, for example, cetylene glycol, glyceride
  • compositions may also comprise buffering agents.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
  • a tablet may be made by compression or molding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent.
  • Molded tablets may be made in a suitable machine in which a mixture of the powdered compound is moistened with an inert liquid diluent.
  • the tablets, and other solid dosage forms of the pharmaceutical compositions of the present invention may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be formulated for rapid release, e.g., freeze-dried.
  • compositions may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved in sterile water, or some other sterile injectable medium immediately before use.
  • These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner.
  • embedding compositions that can be used include polymeric substances and waxes.
  • the active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
  • Liquid dosage forms for oral administration of the compounds of the invention include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.
  • the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsif ⁇ ers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents
  • the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
  • adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
  • Suspensions in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • Formulations of the pharmaceutical compositions of the invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds of the invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
  • suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
  • Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
  • Dosage forms for the topical or transdermal administration of a compound of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants.
  • the active compound may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • the ointments, pastes, creams and gels may contain, in addition to an active compound of this invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • Powders and sprays can contain, in addition to a compound of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances.
  • Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
  • Transdermal patches have the added advantage of providing controlled delivery of a compound of the present invention to the body. Dissolving or dispersing the compound in the proper medium can make such dosage forms. Absorption enhancers can also be used to increase the flux of the compound across the skin. Either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel can control the rate of such flux. [00270] Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this invention.
  • compositions of this invention suitable for parenteral administration comprise one or more compounds of the invention in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • Prevention of the action of microorganisms upon the subject compounds may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin. [00274] In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution, which in turn, may depend upon crystal size and crystalline form.
  • various antibacterial and antifungal agents for example, paraben, chlorobutanol, phenol sorbic acid, and the
  • delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.
  • Injectable depot forms are made by forming microencapsule matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissue.
  • biodegradable polymers such as polylactide-polyglycolide.
  • Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissue.
  • a compound or pharmaceutical preparation is administered orally. In other embodiments, the compound or pharmaceutical preparation is administered intravenously. Alternative routs of administration include sublingual, intramuscular, and transdermal administrations.
  • the compounds of the present invention are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1% to 99.5% (more preferably, 0.5% to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.
  • the preparations of the present invention may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, etc. administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral administrations are preferred.
  • parenteral administration and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
  • systemic administration means the administration of a compound, drug, combination, pharmaceutical composition, or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
  • These compounds or compositions may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.
  • the compounds of the present invention which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art.
  • Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • a compound or pharmaceutical composition of the invention is provided to a synucleinopathic subject chronically.
  • Chronic treatments include any form of repeated administration for an extended period of time, such as repeated administrations for one or more months, between a month and a year, one or more years, or longer.
  • a chronic treatment involves administering a compound or pharmaceutical composition of the invention repeatedly over the life of the synucleinopathic subject.
  • Preferred chronic treatments involve regular administrations, for example one or more times a day, one or more times a week, or one or more times a month.
  • a suitable dose such as a daily dose of a compound of the invention will be that amount of the compound that is the lowest dose effective to produce a therapeutic effect.
  • Such an effective dose will generally depend upon the factors described above.
  • doses of the compounds of this invention for a patient, when used for the indicated effects will range from about 0.0001 to about 100 mg per kg of body weight per day.
  • the daily dosage will range from 0.001 to 50 mg of compound per kg of body weight, and even more preferably from 0.01 to 10 mg of compound per kg of body weight.
  • the dose administered to a subject may be modified as the physiology of the subject changes due to age, disease progression, weight, or other factors.
  • the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.
  • the compounds according to the invention may be formulated for administration in any convenient way for use in human or veterinary medicine, by analogy with other pharmaceuticals.
  • compounds for treating neurological conditions or diseases can be formulated or administered using methods that help the compounds cross the blood-brain barrier (BBB).
  • BBB blood-brain barrier
  • the vertebrate brain and CNS has a unique capillary system unlike that in any other organ in the body.
  • the unique capillary system has morphologic characteristics which make up the blood-brain barrier (BBB).
  • the blood-brain barrier acts as a system- wide cellular membrane that separates the brain interstitial space from the blood.
  • the unique morphologic characteristics of the brain capillaries that make up the BBB are: (a) epithelial-like high resistance tight junctions which literally cement all endothelia of brain capillaries together, and (b) scanty pinocytosis or transendothelial channels, which are abundant in endothelia of peripheral organs. Due to the unique characteristics of the blood-brain barrier, hydrophilic drugs and peptides that readily gain access to other tissues in the body are barred from entry into the brain or their rates of entry and/or accumulation in the brain are very low.
  • BBB are particularly useful for treating synucleinopathies.
  • farnesyl transferase inhibitors that are non-charged (e.g., not positively charged) and/or non- lipophilic may cross the BBB with higher efficiency than charged (e.g., positively charged) and/or lipophilic compounds. Therefore it will be appreciated by a person of ordinary skill in the art that some of the compounds of the invention might readily cross the BBB.
  • the compounds of the invention can be modified, for example, by the addition of various substitutuents that would make them less hydrophilic and allow them to more readily cross the
  • Another approach to increasing the permeability of the BBB to drugs involves the intra-arterial infusion of hypertonic substances which transiently open the blood-brain barrier to allow passage of hydrophilic drugs.
  • hypertonic substances are potentially toxic and may damage the blood-brain barrier.
  • Peptide compositions of the invention may be administered using chimeric peptides wherein the hydrophilic peptide drug is conjugated to a transportable peptide, capable of crossing the blood-brain barrier by transcytosis at a much higher rate than the hydrophilic peptides alone.
  • Suitable transportable peptides include, but are not limited to, histone, insulin, transferrin, insulin-like growth factor I (IGF-I), insulin-like growth factor II (IGF-II), basic albumin and prolactin.
  • Antibodies are another method for delivery of compositions of the invention.
  • an antibody that is reactive with a transferrin receptor present on a brain capillary endothelial cell can be conjugated to a neuropharmaceutical agent to produce an antibody- neuropharmaceutical agent conjugate (U.S. Patent 5,004,697, incorporated herein in its entirety by reference).
  • the method is conducted under conditions whereby the antibody binds to the transferrin receptor on the brain capillary endothelial cell and the neuropharmaceutical agent is transferred across the blood brain barrier in a pharmaceutically active form.
  • the uptake or transport of antibodies into the brain can also be greatly increased by cationizing the antibodies to form cationized antibodies having an isoelectric point of between about 8.0 to 11.0 (U.S. Patent 5,527,527, incorporated herein in its entirety by reference).
  • a ligand-neuropharmaceutical agent fusion protein is another method useful for delivery of compositions to a subject (U.S. Patent 5,977,307, incorporated herein in its entirety by reference).
  • the ligand is reactive with a brain capillary endothelial cell receptor.
  • the method is conducted under conditions whereby the ligand binds to the receptor on a brain capillary endothelial cell and the neuropharmaceutical agent is transferred across the blood brain barrier in a pharmaceutically active form.
  • a ligand-neuropharmaceutical agent fusion protein which has both ligand binding and neuropharmaceutical characteristics, can be produced as a contiguous protein by using genetic engineering techniques.
  • Gene constructs can be prepared comprising DNA encoding the ligand fused to DNA encoding the protein, polypeptide or peptide to be delivered across the blood brain barrier.
  • the ligand coding sequence and the agent coding sequence are inserted in the expression vectors in a suitable manner for proper expression of the desired fusion protein.
  • the gene fusion is expressed as a contiguous protein molecule containing both a ligand portion and a neuropharmaceutical agent portion.
  • the permeability of the blood brain barrier can be increased by administering a blood brain barrier agonist, for example bradykinin (U.S. Patent 5,112,596, incorporated herein in its entirety by reference), or polypeptides called receptor mediated permeabilizers (RMP) (U.S. Patent 5,268,164, incorporated herein in its entirety by reference).
  • a blood brain barrier agonist for example bradykinin (U.S. Patent 5,112,596, incorporated herein in its entirety by reference), or polypeptides called receptor mediated permeabilizers (RMP) (U.S. Patent 5,268,164, incorporated herein in its entirety by reference).
  • Exogenous molecules can be administered to the host's bloodstream parenterally by subcutaneous, intravenous or intramuscular injection or by absorption through a bodily tissue, such as the digestive tract, the respiratory system or the skin.
  • the form in which the molecule is administered depends, at least in part, on the route by which it is administered.
  • the administration of the exogenous molecule to the host's bloodstream and the intravenous injection of the agonist of blood-brain barrier permeability can occur simultaneously or sequentially in time.
  • a therapeutic drug can be administered orally in tablet form while the intravenous administration of an agonist of blood-brain barrier permeability is given later (e.g., between 30 minutes later and several hours later). This allows time for the drug to be absorbed in the gastrointestinal tract and taken up by the bloodstream before the agonist is given to increase the permeability of the blood-brain barrier to the drug.
  • an agonist of blood-brain barrier permeability e.g., bradykinin
  • compounds of the invention can be formulated as a prodrug with a fatty acid carrier (and optionally with another neuroactive drug).
  • the prodrug is stable in the environment of both the stomach and the bloodstream and may be delivered by ingestion. The prodrug passes readily through the blood brain barrier.
  • the prodrug preferably has a brain penetration index of at least two times the brain penetration index of the drug alone.
  • the prodrug which preferably is inactive, is hydrolyzed into the fatty acid carrier and the farnesyl transferase inhibitor (and optionally another drug).
  • the carrier preferably is a normal component of the central nervous system and is inactive and harmless.
  • the compound and/or drug, once released from the fatty acid carrier, is active.
  • the fatty acid carrier is a partially-saturated straight chain molecule having between about 16 and 26 carbon atoms, and more preferably 20 and 24 carbon atoms. Examples of fatty acid carriers are provided in U.S. Patents.
  • the administration of the agents of the present invention may be for either prophylactic or therapeutic purposes.
  • the agent is provided in advance of disease symptoms.
  • the prophylactic administration of the agent serves to prevent or reduce the rate of onset of symptoms of a synucleinopathy.
  • the agent is provided at (or shortly after) the onset of the appearance of symptoms of actual disease.
  • the therapeutic administration of the agent serves to reduce the severity and duration of the disease.
  • Tissue culture AU cell lines were obtained by ATCC. SH-SY5Y and Cos-7 were grown in 10% FBS DMEM (Sigma). Cells were split the day before experiments including transfection, metabolic labeling and drug treatment.
  • Proteins and antibodies were purified according to the published procedure. Synuclein antibody (SYN-I) was purchased from Signal Transduction Lab. Actin antibody and FLAG antibody (M2) were from Sigma. UCH-Ll antibody (anti-PGP 9.5) was from Chemicon. [00307] Chemicals: FTI-277 and lactacystin was purchased from Calbiochem. Crosslinking reagent DE was from Pierce. DMEM and MEM were purchased from Gibco. All the other material was purchased from Sigma.
  • Plasmids C220S cDNA was generated by PCR site-specific mutagenesis.
  • the 5' primer is uchforw SEQ ID NO: 1
  • the 5' primer is L3HindIII SEQ ID NO: 5 (CTAAAGCTT ATGGACTAC AAGGATGACGACGACAAAGATGGAGGGTCAACGCTGGCTG), the 3 'primer is L3XhoISAA SEQ ID NO: 6 (ATCCTCGAGCTATGCTGCAGAAAGAGCAATCGCA).
  • the 5' primer is L3 HindIII and the 3' primer is L3XhoICKAA SEQ ID NO: 7 (ATCCTCGAGCTATGCTGCCTTAGAAAGAGCAATCGCATTAAATC).
  • ⁇ -synuclein degradation assay Lipofectamine 2000 was used to transfect COS-7 cells according to the Invitrogen protocol. Transfected cells were cultured at 37 0 C for 48 hours before being treated with 35 ⁇ M lactacystin or DMSO. After 24 hours of incubation, the cells were lysed with Tris buffer (50 mM Tris, 2% SDS, 0.1% NP-40), and subjected to SDS-PAGE, followed by quantitative Western blotting.
  • Tris buffer 50 mM Tris, 2% SDS, 0.1% NP-40
  • SV fraction was prepared as describe elsewhere. SV was incubated with various salts at designed concentration for 30 minutes on ice, or 1% Triton X-100 or control without salts and detergent. Treated SV was pelleted at 100,000g for 30 minutes. Supernatants and pellets were subjected to SDS-PAGE and Western blotting.
  • Membrane fractionation Cells were harvested by scraping and washed with PBS. Cell pellet was suspended in lysis buffer (50 mM Tris-HCl, 1 mM EDTA) supplemented with protease inhibitor cocktail (Sigma) and homogenized by passing through 26G needles 10 times.
  • Suspension was clarified by spinning at 60Og for 5 minutes. Clarified suspension was ultracentrifuged at 100,00Og for 2 hours and separated into membrane and cytosol. Membrane fraction was washed with washing buffer (50 mM Tris-HCl, 1 mM EDTA 1 M NaCl), and pelleted each time with bench-top centrifuge.
  • washing buffer 50 mM Tris-HCl, 1 mM EDTA 1 M NaCl
  • 2D electrophoresis For the isolation of total cellular protein, cultured SH-S Y5 Y cells maintained as described above were rinsed with ice-cold PBS. Cells were lysed in ImI dSDS buffer (5OmM Tris-HCl, pH 8.0 0.1% SDS) supplemented with protease inhibitor cocktail. Lysates were boiled for 3 min, and were treated with Dnase and Rnase as described. Lysates were precipitated with ice-cold acetone for at least 2 hours, and pellets were resuspended in 2D sample buffer (8M urea, 0.5% CHAPS, 0.2% DTT, 0.5% IPG buffer, 0.002% bromophenol blue).
  • ImI dSDS buffer 5OmM Tris-HCl, pH 8.0 0.1% SDS
  • Lysates were boiled for 3 min, and were treated with Dnase and Rnase as described. Lysates were precipitated with ice-cold acetone for at
  • 2D electrophoresis was carried out according to manufacture's protocol (Amersham Life Science). 7cm pH 4-7 strips were used.
  • SH-SY5Y membrane fraction culture SH-SY5Y cells were rinsed with cold PBS and harvested with lysis buffer (5OmM Tris-HCl, pH 8.0, ImM ZnAc2, 25OmM sucrose). Lysate was passed through 25G needles for several times and spun at lOOOg for 5 min. Supernatant was centrifuged at 200,00Og for 2 hours. Pellet was extensively washed with lysis buffer and extracted with cold acetone. Pellet was resuspended in 2D sample buffer.
  • Viral Infection Viral infection and MTT assay in SH-SY5Y cells: The viruses were amplified and purified according to the published procedure. SH-SY5Y cells were grown on 100mm petri-dishes and induced with 10OnM retinoic acid for 3-5 days before the virus infection with M.I. O at 75. Viruses were diluted with DPBS to desired M.I.O.. After four hours of incubation, 10ml growth medium was added. On the second day, cells were splitted into 96-well plates and treated with compounds for next 48 hours. The growth medium in each well was replaced with growth medium with 5ug/ml MTT. Medium was removed after three hours incubation, and 200ul isopropyl (0.04N HCl) was added into each well. The signal was read at 570nm.
  • Viable cell counting At stated time poins, SH-SY5Y cells were trypsinized with lOOul trypsin-EDTA for 1 minute and neutralized with 400ul growth medium. Cell suspension was made up by mixing 0.2 ml of cells in growth medium, 0.3 ml of HBSS and 0.5 ml of 0.4% Trypan Blue solution. Viable cell numbers were counted by standard cell counting chamber.
  • Example 1 UCH-Ll is farnesylated in vivo and in cell culture
  • the UCH-Ll sequence contains the sequence CXXX, a consensus farnesylation site, at its C-terminus. This sequence is not present in UCH-L3. The possibility that this sequence was modified in vivo was investigated. First, the chemical nature of the previously reported association of UCH-Ll and synaptic vesicles from rat brain was probed. [00316] The results are shown in Figure 1, panel A: Effects of various amount of salt and non-ionic detergent on the dissociations of synapsin I, synaphysin and UCH-Ll from SV was analyzed by treating aliquots of SV fraction with either KCl, NaCl, MgCl 2 , or 1% Triton X-100.
  • Membrane fraction and soluble fraction was separated by centrifugation and each fraction was subjected to SDS-PAGE followed by Western blots, a (synapsin I), c (synaphysin) and e (UCH- Ll) are from pellet, and b (synapsin I), d (synaphysin) and f (UCH-Ll) are supernatant fractions.
  • a synaptophysin
  • UCH-Ll rows e and f
  • UCH-Ll could not be separated from the vesicular fraction by increasing salt concentration. Only treatment with detergent was sufficient to solubilize UCH-Ll, consistent with its farnesylation.
  • Example 3 Farnesylation and membrane association of UCH-Ll is required to promote accumulation of ⁇ -synuclein in COS-7 cells
  • the C220S mutation eliminated the ability of S 18 to promote ⁇ -synuclein accumulation in COS-7 cells but had no effect on the S18Y polymorph (Figure 2, panel C): the relative amount of 16kDa ⁇ -synuclein was quantified and normalized against the amount of actin in transfected COS-7 cells with the presence of UCH-Ll variants. 100% accumulation of ⁇ - synuclein was achieved in cells treated with the proteasome inhibitor lactacystin). This finding suggested that farnesylation and membrane attachment of UCH-Ll are both required.
  • a mutant form of UCH-L3 was constructed in which the UCH-Ll farnesylation sequence was added to the UCH-L3 C-terminus.
  • This protein did not cause accumulation of ⁇ -synuclein (panel D): The relative amount of ⁇ -synuclein in COS-7 cells transfected with UCH-Ll and UCH-L3 variants was compared), although it was farnesylated and incorporated into the membrane. Thus, membrane attachment of an active hydrolase was insufficient to cause accumulation of ⁇ -synuclein.
  • Example 4 Inhibition of farnesylation rescues cell death caused by ⁇ -synuclein overexpression in SH-SY5Y cells
  • Figure 3 shows SH-SY5Y cells infected by ⁇ - synuclein-expressing adenovirus treated with DMSO (A), FTI-277 (B), LDN57414 (C), FTI-277 and LDN57414 (D) .
  • E Viable cell numbers were quantified by counting the cells treated with either DMSO (lower dark circles), FTI-277 (upper dark circles), LDN57414 (light triangles) or LDN57414 and FTI-277 (dark triangles) that did not stain with trypan blue. The unit of y-axis is 10 5 /ml.
  • F Cell viability was assessed by the amount of metabolic activity using MTT assay.
  • Figure 4 shows: (A) the viability of SH-S Y5 Y cells infected by ⁇ - synuclein-expressing adenovirus after treatment of DMSO (closed triangles) or FTI-277 (open triangles), and of cells infected with lacZ-expressing adenovirus after treatment of DMSO (closed circles) or FTI-277 (open circles), and of cells infected with empty adenovirus after treatment of DMSO (closed squares) or FTI-277 (open squares) were assessed using MTT assay.
  • Example 5 Treatment with Zarnestra Decreases ⁇ -Synuclein Levels in the Brain
  • mice were orally administered either FTI in 20% cyclodextrin solution or the same volume of vehicle alone twice a day for 30 or 90 days. In some cases, non- transgenic mice also received vehicle twice a day for 30 to 90 days.
  • mice were sacrificed, and the brains removed and hemisected. One hemisphere of each was fixed in 4% paraformaldehyde/PBS (pH 7.4), cryoperserved, then sectioned for histology. The other hemisphere was subdivided into four brain regions, including the cortex and hippocampus, that were homogenized and processed into cytoplasmic and membrane fractions.
  • Ubiquitin is known to be a constituent of Lewy Bodies and in the ⁇ -synculein inclusions found in the transgenic mouse line used in the study (Masliah et al. "Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders" Science 287(5456): 1265-69, 2000; incorporated herein by reference).
  • Transgenic mice that received Zarnestra had fewer ubiquitin-immuoreactive inclusions than those treated with vehicle alone ⁇ Figure 8).
  • Campbell-Switzer staining is a general marker of Lewy Body type inclusions (Uchihara et al.
  • ⁇ - synuclein protein levels in the ⁇ -synuclein transgenic line are greater than in non-transgenic mice in both cytoplasmic ⁇ Figure 10) and membrane fractions ⁇ Figure 11).
  • Transgenic mice that received Zarnestra had lower ⁇ -synuclein protein levels than vehicle-treated transgenic mice and nearly the same as that detected in the non-transgenic group in both the cytoplasmic ⁇ Figure 10) and membrane fractions ⁇ Figure 11), which represent soluble and insoluble ⁇ -synuclein, respectively.
  • Farnesylated UCH-Ll in the cortex is contained in the membrane fraction. The amount of UCH-Ll was determined by quantitative Western Blot.
  • Transgenic mice that received OSI-754 at this dose had lower ⁇ -synuclein protein levels than vehicle-treated transgenic mice in both cytoplasmic ⁇ Figure 13) and membrane fractions ⁇ Figure 14).
  • the amount of farnesylated UCH-Ll was determined by quantitative Western Blot, then normalized to actin. Treatment with OSI-754 decreased the amount of farnesylated UCH-Ll in transgenic mice ⁇ Figure 15).
  • Transgenic ⁇ -synuclein mice treated with either 45 mg/kg OSI-754 twice a day or with 9 mg/kg OSI-754 twice a day for 90 days exhibited fewer inclusions than transgenic animals administered vehicle alone.
  • Formation of ⁇ -synuclein inclusions in the cortex and hippocampus was probed by immunostaining with an antibody for human ⁇ -synuclein. Cells positive for human ⁇ -synuclein were quantified.
  • transgenic mice that received OSI-754 at either dose had fewer ⁇ -synuclein-positive cells per mm 2 than those treated with vehicle ⁇ Figure 18).
  • Representative images from the cortex and hippocampus are shown in Figure 19.
  • OSI-754 treatment did not affect neuronal morphology or density in either region as shown by staining for Neuronal Specific Nuclear Protein (NeuN). Representative images from the cortex and hippocampus are shown in Figure 20.
  • HFIP 1,1, 1,3,3, 3-hexafluoro-2-propanol
  • Nortriptyline ( Figure 21) and indatraline (Figure 22) cause a dose-dependent increase in the rate of structure formation of ⁇ -synuclein in the presence of HFIP as determined by Thioflavin T fluorescence and fluorescence polarization. Dose-dependent effects on ⁇ -synuclein aggregation were also observed by Thioflavin T fluorescence measurements for fluoxetine, norfluoxetine ( Figure 23), protriptyline, maprotiline ( Figure 24), norclomipramine, nordoxepin ( Figure 25) and sertraline (Figure 26).
  • Nortriptyline, indatraline, and fluoxetine delay the onset of ⁇ -synuclein aggregation in a buffer system relevant to physiological conditions.
  • the rate of the ⁇ -synuclein aggregation was determined by monitoring the amount of ⁇ -synuclein monomer in solution and by fluorescence polarization.
  • Recombinant ⁇ -synuclein 70 ⁇ M, 20 mM Bis-tris propane, 100 mM LiCl, pH 7.4, 700 ⁇ l total volume was incubated at 37°C with gentle agitation.
  • Nortriptyline and indatraline decrease ⁇ -synuclein neurotoxicity toward dopaminergic neurons.
  • Midbrain cultures will be prepared from El 7 rat ventral mesencephalon as described in a published protocol (Xu et al. (2002) "Dopamine-dependent neurotoxicity of alph ⁇ -synuclein: a mechanism for selective neurodegeneration in Parkinson disease” Nat Med 8(6): 600-6).
  • Cultured cells were infected with a recombinant lentivirus encoding human A53T ⁇ -synuclein (A53T) or a control virus (none).
  • Nortriptyline was administered to mice of the ⁇ -synuclein transgenic line described in Masliah et al. ((2000) "Dopaminergic loss and inclusion body formation in alph ⁇ -synuclein mice: implications for neurodegenerative disorders" Science 287(5456): 1265-9). Animals from this line have ⁇ -synuclein neuronal inclusions in the cortex, hippocampus, and the olfactory bulb. Transgenic mice were administered Notriptyline in saline (0.9%) or the same volume of vehicle alone once a day intraperitoneally for 30 days. At the end of treatment, mice were sacrificed and the brains removed and hemisected.
  • One hemisphere of each was fixed in 4% paraformaldehyde/PBS (pH 7.4), cryoperserved, then sectioned for histology. From the other hemisphere, the cortex and hippocampus were dissected, homogenized, and processed into cytoplasmic and membrane fractions.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Methods and compositions useful in the treatment or prevention of synucleinopathies, such as Parkinson's disease, diffuse Lewy body disease, and multiple system atrophy, or other neurodegenerative diseases (e.g., amyotrophic lateral sclerosis, Huntington's disease, and Alzheimer's disease) are provided. The treatment including administering to a subject a farnesyl transferase inhibitor and an agent that inhibits the aggregation of α-synuclein (e.g., nortriptyline).

Description

TREATMENT OF SYNUCLEINOPATHIES
Related Applications
[0001] The present invention claims priority under 35 U. S. C. § 119(e) to U.S. provisional patent application, USSN 60/915,828, filed May 3, 2007, which is incorporated herein by reference.
Field of the Invention
[0002] The present invention relates to the treatment of neurodegenerative diseases, particularly synucleinopathies, such as Parkinson's disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and various neuronal brain iron accumulation disorders including pantothenate kinase-associated neurodegeneration, using a farnesyl transferase inhibitor in combination with an α-synuclein aggregation inhibitor.
Background of the Invention
[0003] Synucleinopathies are a diverse group of neurodegenerative disorders that share common pathologic lesions including abnormal aggregates of insoluble α-synuclein protein in selectively vulnerable populations of neurons and glia. Certain evidence links the formation of filamentous aggregates to the onset and progression of clinical symptoms and the degeneration of affected brain regions in neurodegenerative disorders including Parkinson's disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl). The current treatment options for these diseases include symptomatic medications such as carbidopa- levodopa, anticholinergics, and monoamine oxidase inhibitors, with widely variable benefit. Even for the best responders, i.e., patients with idiopathic Parkinson's Disease, an initial good response to levodopa is typically overshadowed by drug-induced complications such as motor fluctuations and debilitating dyskinesia, following the first five to seven years of therapy. For the rest of the disorders, the current medications offer marginal symptomatic benefit. Given the severe debilitating nature of these disorders and their prevalence, there is a clear need in the art for novel approaches towards treating and managing these diseases. Summary of the Invention
[0004] The present invention relates to novel therapeutic approaches to the treatment of synucleinopathies, such as Parkinson's disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl), using a combination of a farnesyl transferase inhibitor and an agent that inhibits the aggregation of α-synuclein. Other neurodegenerative diseases where abnormal synuclein metabolism or accumulation has been implicated such as amyotrophic lateral sclerosis (ALS), Huntington's Disease (HD), and Alzheimer's Disease (AD) (including Alzheimer's Disease with Lewy Bodies) may also be treated with a combination of farnesyl transferase inhibitor and an agent that inhibits the aggregation of α-synuclein. The invention in part stems from the recognition that when both these agents are administered to a subject there is an unexpected synergy or additive effect between the two agents. That is, in certain embodiments, lower doses of these agents can be used than when the agents are administered individually.
[0005] In one aspect, the invention provides methods for treating a subject with a synucleinopathy or other neurodegenerative diseases by administering amounts of a farnesyl transferase inhibitor and an agent that inhibits the aggregation of α-synuclein, that are therapeutically effective when combined. In certain embodiments, the agents (i.e., the farnesyl transferase inhibitor and the α-synuclein aggregation inhibitor) are small molecules. In certain embodiments, the farnesyl transferase inhibitor is of one of the formulae disclosed herein, or a derivative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, the farnesyl transferase inhibitor is LNK-754 (OSI-754; CP-609,754). In certain embodiments, the farnesyl transferase inhibitor is Zarnestra. In certain embodiments, the farnesyl transferase inhibitor is SCH66336 (lonafarnib, Sarasar). In certain embodiments, the farnesyl transferase inhibitor is SCH44342. In certain embodiments, the farnesyl transferase inhibitor is Tipifarnab. In certain embodiments, the α-synuclein aggregation inhibitor is nortriptyline, maprotiline, protriptyline, norclomipramine, sertraline, or indatraline. In certain embodiments, the α-synuclein aggregation inhibitor is a tricyclic antidepressant (e.g., a tricyclic antidepressant that has been approved for use in humans). In certain embodiments, the doses of one or both of the agents are lower than when the agents are used individually. The additive and/or synergistic effect of the inventive combination may be particularly useful in the chronic treatment of a synucleinopathic subject in order to prevent undesired side effects. The agents may be administered together or sequentially.
[0006] The invention also provides methods for treating a subject with a synucleinopathy or other neurodegenerative disease by administering the inventive combination with another therapeutic agent. The agents may be administered as a combination composition comprising all of the agents. Alternatively, the agents can be administered separately (e.g., as different compositions) either simultaneously, sequentially, or intermittently as described herein. In some embodiments, the other therapeutic agent may be, but is not limited to, dopamine agonists (e.g., pramipexole, apomorpine), monoamine oxidase inhibitors (e.g., rasagiline), glutamate antagonists (e.g., memantine), anticholinergic agents (e.g., trihexyphenidyl), acetylcholinesterase inhibitors (e.g., rivastigmine), cannabinoid antagonists, ampa antagonists, adenosine A2a antagonists, and GMl ganglioside. Other therapeutic approaches the may be used in conjunction with the inventive combination therapy include surigical intervention to deliver vectors (such as viral vectors) or other materials directly into the brain or CNS.
[0007] In another aspect, the invention provides methods of treating cells in vitro by contacting cells with an effective amount of a combination of a farnesyl transferase inhibitor and an α-synuclein aggregation inhibitor to reduce the formation of α-synuclein aggregations. In certain embodiments, the cells are human cells. In certain embodiments, the cells are neurons (e.g., established neuronal cell lines or primary neural cells). The inventive method may be used to determine the effectiveness of a particular combination of farnesyl transferase inhibitor and α- synuclein aggregation inhibitor at reducing or preventing α-synuclein aggregation. [0008] According to the invention, nortriptyline, indatraline, fluoxetine, norfluoxetine, norclomipramine, nordoxepin, maprotiline, and sertraline have been shown to bind α-synuclein and increase the rate of α-synuclein aggregation in 1,1,1, 3,3, 3-hexafluoroisopropanol (HFIP). Increased rates of α-synuclein aggregation in this artificial system have been found to be indicative of reducing α-synuclein aggregation in vivo. Nortriptyline, indatraline, and fluoxetine were found to reduce α-synuclein aggregation in an aqueous buffered solution relevant to physiological conditions. Nortriptyline and indatraline were found to reduce α-synuclein neurotoxicity toward dopaminergic neurons. Nortriptyline was found to reduce α-synuclein deposition or levels in an α-synuclein transgenic mouse model that have α-synuclein neuronal inclusions in the cortex, hippocampus, and the olfactory bulb. [0009] In yet another aspect, pharmaceutical compositions or preparations comprising a farnesyl transferase inhibitor and an α-synuclein aggregation inhibitor are provided. The composition or preparation may optionally include a pharmaceutically acceptable excipient. In certain embodiments, the farnesyl transferase inhibitor is any of the compounds described herein that have been found to inhibit farnesyl transferase. In certain particular embodiments, the farnesyl transferase inhibitor is LNK-754 (OSI-754), Zarnestra, lonafarnib (Sarasar), or Tipifarnab. In certain embodiments, the α-synuclein aggregation inhibitor is nortriptyline, maprotiline, protriptyline, norclomipramine, sertraline, or indatraline. In certain particular embodiments, the inventive combination comprises LNK-754 as the farnesyl transferase inhibitor and nortriptyline as the α-synuclein aggregation inhibitor. The inventive composition or preparation includes a therapeutically effective amount of each agent for the treatment of a synucleinopathy or other neurodegenerative disease. The amount of one or both of the agents may be lower than when either agent is administered alone. The composition or preparation may also include other pharmaceutical agents for treating synucleinopathic subjects or subjects with neurodegenerative diseases. Such agents may include drugs for treating the symptoms of the diseases rather than the disease itself. The invention also provides kits including the inventive combination of a farnesyl transferase inhibitor and an α-synuclein aggregation inhibitor. The agents may be packaged separately or together. The kit optionally includes instructions for prescribing the combination. In certain embodiments, the kit includes multiple doses of each agent. The kit may include sufficient quantities of each component to treat a subject for a week, two weeks, three weeks, four weeks, or multiple months.
Definitions
[0010] Definitions of specific functional groups and chemical terms are described in more detail below. For purposes of this invention, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999, the entire contents of which are incorporated herein by reference. [0011] Certain compounds of the present invention may exist in particular geometric or stereoisomeric forms. The present invention contemplates all such compounds, including cis- and trans -isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, the racemic mixtures thereof, and other mixtures thereof, as falling within the scope of the invention. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group. All such isomers, as well as mixtures thereof, are intended to be included in this invention. [0012] Isomeric mixtures containing any of a variety of isomer ratios may be utilized in accordance with the present invention. For example, where only two isomers are combined, mixtures containing 50:50, 60:40, 70:30, 80:20, 90:10, 95:5, 96:4, 97:3, 98:2, 99:1, or 100:0 isomer ratios are all contemplated by the present invention. Those of ordinary skill in the art will readily appreciate that analogous ratios are contemplated for more complex isomeric mixtures. [0013] If, for instance, a particular enantiomer of a compound of the present invention is desired, it may be prepared by asymmetric synthesis, or by derivation with a chiral auxiliary, where the resulting diastereomeric mixture is separated and the auxiliary group cleaved to provide the pure desired enantiomers. Alternatively, where the molecule contains a basic functional group, such as amino, or an acidic functional group, such as carboxyl, diastereomeric salts are formed with an appropriate optically-active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means well known in the art, and subsequent recovery of the pure enantiomers.
[0014] One of ordinary skill in the art will appreciate that the synthetic methods, as described herein, utilize a variety of protecting groups. By the term "protecting group", as used herein, it is meant that a particular functional moiety, e.g., O, S, or N, is temporarily blocked so that a reaction can be carried out selectively at another reactive site in a multifunctional compound. In preferred embodiments, a protecting group reacts selectively in good yield to give a protected substrate that is stable to the projected reactions; the protecting group should be selectively removable in good yield by readily available, preferably non-toxic reagents that do not attack the other functional groups; the protecting group forms an easily separable derivative (more preferably without the generation of new stereogenic centers); and the protecting group has a minimum of additional functionality to avoid further sites of reaction. As detailed herein, oxygen, sulfur, nitrogen, and carbon protecting groups may be utilized. Hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p- methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1- methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4- methoxytetrahydrothiopyranyl S,S-dioxide, 1 -[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin- 4-yl (CTMP), l,4-dioxan-2-yl, tetrahydrofliranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a- octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1 -ethoxyethyl, 1 -(2-chloroethoxy)ethyl, 1 -methyl- 1 -methoxy ethyl, 1 -methyl- 1 -benzyloxy ethyl, 1 -methyl- 1 -benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, /?-chlorophenyl, /?-methoxyphenyl, 2,4-dinitrophenyl, benzyl, /?-methoxybenzyl, 3,4-dimethoxybenzyl, o- nitrobenzyl, /?-nitrobenzyl, /?-halobenzyl, 2,6-dichlorobenzyl, /?-cyanobenzyl, /?-phenylbenzyl, 2- picolyl, 4-picolyl, 3-methyl-2-picolyl iV-oxido, diphenylmethyl, p,p '-dinitrobenzhydryl, 5- dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, /?-methoxyphenyldiphenylmethyl, di(/?-methoxyphenyl)phenylmethyl, tri(/?-methoxyphenyl)methyl, 4-(4 ' - bromophenacyloxyphenyl)diphenylmethyl, 4,4',4"-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4 ' ,4 " -tris(levulinoyloxyphenyl)methyl, 4,4 ' ,4 " -tris(benzoyloxyphenyl)methyl, 3-(imidazol- 1 - yl)bis(4 ' ,4 ' ' -dimethoxyphenyl)methyl, 1 , 1 -bis(4-methoxyphenyl)- 1 ' -pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, l,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthexylsilyl, t- butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-/?-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate,/?-chlorophenoxyacetate, 3- phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p- phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2- (trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2- (triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl /?-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl /?- methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl /?-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-l-napththyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o- (dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4- (methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4- methylphenoxyacetate, 2,6-dichloro-4-( 1 , 1 ,3 ,3-tetramethylbutyl)phenoxyacetate, 2,4-bis( 1,1- dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2- methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N',N'- tetramethylphosphorodiamidate, alkyl JV-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4- methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, /?-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1- methoxyethylidene ortho ester, 1-ethoxyethylidine ortho ester, 1 ,2-dimethoxyethylidene ortho ester, α-methoxybenzylidene ortho ester, l-(Λ/,Λ/-dimethylamino)ethylidene derivative, a-(N,N'- dimethylamino)benzylidene derivative, 2-oxacyclopentylidene ortho ester, di-t-butylsilylene group (DTBS), l,3-(l,l,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t- butoxydisiloxane-l,3-diylidene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate. Amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7- dibromo)fluoroenylmethyl carbamate, 2,7-di-t-butyl-[9-( 10,10-dioxo- 10,10,10,10- tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2- phenylethyl carbamate (hZ), l-(l-adamantyl)-l-methylethyl carbamate (Adpoc), l,l-dimethyl-2- haloethyl carbamate, l,l-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), l,l-dimethyl-2,2,2- trichloroethyl carbamate (TCBOC), 1 -methyl- l-(4-biphenylyl)ethyl carbamate (Bpoc), l-(3,5-di- £-butylphenyl)-l-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(/V,iV-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1- adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, TV-hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), p- methoxybenzyl carbamate (Moz), /?-nitobenzyl carbamate, /?-bromobenzyl carbamate, p- chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfϊnylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2- methylsulfonylethyl carbamate, 2-(/?-toluenesulfonyl)ethyl carbamate, [2-(l,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), l,l-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acyloxybenzyl carbamate, p- (dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6- chromonylmethyl carbamate (T croc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, JV'-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzyl thiocarbamate, /?-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, /?-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, l,l-dimethyl-3-(/V,iV- dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p '-methoxyphenylazo)benzyl carbamate, 1- methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1 -methyl- 1 -cyclopropylmethyl carbamate, l-methyl-l-(3,5-dimethoxyphenyl)ethyl carbamate, 1 -methyl- l-(p- phenylazophenyl)ethyl carbamate, 1 -methyl- 1-phenylethyl carbamate, 1 -methyl- 1 -(4- pyridyl)ethyl carbamate, phenyl carbamate, /?-(phenylazo)benzyl carbamate, 2,4,6-tri-t- butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, TV- benzoylphenylalanyl derivative, benzamide,/?-phenylbenzamide, o-nitophenylacetamide, o- nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p- hydroxyphenyl)propanamide, 3 -(o-nitrophenyl)propanamide, 2-methyl-2-(o- nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, A- chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N- 1,1,4,4-tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted l,3-dimethyl-l,3,5- triazacyclohexan-2-one, 5-substituted l,3-dibenzyl-l,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(I -isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5- dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4- methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7- dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (F cm), N-2-picolylamino N'- oxide, N-l,l-dimethylthiomethyleneamine, N-benzylideneamine, N-p- methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, NN'-isopropylidenediamine, N-/?- nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2- hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5 ,5 -dimethyl-3 -oxo- 1 - cyclohexenyl)amine, N-borane derivative, N-diphenylborinic acid derivative, N- [phenyl(pentacarbonylchromium- or tungsten)carbonyl] amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o- nitrobenzenesulfenamide (Νps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Νpys), /?-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6- trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3 ,5 ,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β- trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'- dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.. Exemplary protecting groups are detailed herein, however, it will be appreciated that the present invention is not intended to be limited to these protecting groups; rather, a variety of additional equivalent protecting groups can be readily identified using the above criteria and utilized in the method of the present invention. Additionally, a variety of protecting groups are described in Protective Groups in Organic Synthesis, Third Ed. Greene, T.W. and Wuts, P.G., Eds., John Wiley & Sons, New York: 1999, the entire contents of which are hereby incorporated by reference.
[0015] It will be appreciated that the compounds, as described herein, may be substituted with any number of substituents or functional moieties. In general, the term "substituted" whether preceded by the term "optionally" or not, and substituents contained in formulae of this invention, refer to the replacement of hydrogen radicals in a given structure with the radical of a specified substituent. When more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. As used herein, the term "substituted" is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. For purposes of this invention, heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms. Furthermore, this invention is not intended to be limited in any manner by the permissible substituents of organic compounds. Combinations of substituents and variables envisioned by this invention are preferably those that result in the formation of stable compounds useful in the treatment, for example, of synucleinopathies or other neurodegenerative diseases. The term "stable", as used herein, preferably refers to compounds which possess stability sufficient to allow manufacture and which maintain the integrity of the compound for a sufficient period of time to be detected and preferably for a sufficient period of time to be useful for the purposes detailed herein.
[0016] In the compounds and compositions of the invention, the term "alkyl" refers to the radical of saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In preferred embodiments, a straight chain or branched chain alkyl has
12 or fewer carbon atoms in its backbone (e.g., C1-C12 for straight chain, C3-C12 for branched chain), and more preferably 6 or fewer, and even more preferably 4 or fewer. Likewise, preferred cycloalkyls have from 3-10 carbon atoms in their ring structure, and more preferably have 5, 6, or 7 carbons in the ring structure.
[0017] Unless the number of carbons is otherwise specified, "lower alkyl" as used herein means an alkyl group, as defined above, but having from one to ten carbons, more preferably from one to six carbon atoms in its backbone structure, and even more preferably from one to four carbon atoms in its backbone structure. Likewise, "lower alkenyl" and "lower alkynyl" have similar chain lengths. Preferred alkyl groups are lower alkyls. In preferred embodiments, a substituent designated herein as alkyl is a lower alkyl.
[0018] As used herein, the term "halogen" designates -F, -Cl, -Br or -I; the term "sulfhydryl" means -SH; and the term "hydroxyl" means -OH.
[0019] The term "methyl" refers to the monovalent radical -CH3, and the term "methoxyl" refers to the monovalent radical -CH2OH.
[0020] The term "aralkyl" or "arylalkyl", as used herein, refers to an alkyl group substituted with an aryl group (e.g., an aromatic or heteroaromatic group).
[0021] The terms "alkenyl" and "alkynyl" refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.
[0022] The term "aryl" as used herein includes 5-, 6- and 7-membered single-ring aromatic groups that may include from zero to four heteroatoms, for example, benzene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine, and the like. Those aryl groups having heteroatoms in the ring structure may also be referred to as "aryl heterocycles" or "heteroaromatics." The aromatic ring can be substituted at one or more ring positions with such substituents as described above, for example, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, ester, heterocyclyl, aromatic or heteroaromatic moieties, -CF3, -
CN, or the like. The term "aryl" also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings (the rings are "fused rings") wherein at least one of the rings is aromatic, e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls and/or heterocyclyls.
[0023] The terms "ortho", "meta", and "para" apply to 1,2-, 1,3- and 1 ,4-disubstituted benzenes, respectively. For example, the names 1 ,2-dimethylbenzene and ortho-dimethylbenzene are synonymous.
[0024] The terms "heterocyclyl" or "heterocyclic group" or "heteroaryl" refer to 3- to 10- membered ring structures, more preferably 3- to 7-membered rings, whose ring structures include one to four heteroatoms. Heterocycles can also be polycycles. Heterocyclyl groups include, for example, thiophene, benzothiophene, thianthrene, furan, pyran, isobenzofuran, chromene, xanthene, phenoxathiin, pyrrole, imidazole, pyrazole, isothiazole, isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, pyrimidine, phenanthroline, phenazine, phenarsazine, phenothiazine, furazan, phenoxazine, pyrrolidine, oxolane, thiolane, oxazole, piperidine, piperazine, morpholine, lactones, lactams such as azetidinones and pyrrolidinones, sultams, sultones, and the like. The heterocyclic ring can be substituted at one or more positions with such substituents as described above, as for example, halogen, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, ketone, aldehyde, ester, a heterocyclyl, an aromatic or heteroaromatic moiety, -CF3, -CN, or the like.
[0025] As used herein, the definition of each expression, e.g., alkyl, m, n, etc., when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.
[0026] Definitions of other terms used throughout the specification include:
[0027] As used herein and in the appended claims, the singular forms "a", "an", and "the" include the plural reference unless the context clearly indicates otherwise. Thus, for example, a reference to "a cell" includes a plurality of such cells.
[0028] "Animal": As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and/or worms. In certain embodiments, the animal is a vertebrate. In certain embodiments, the non-human animal is a mammal (e.g., an ape, a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or clone. [0029] "Effective amount": In general, the "effective amount" of an active agent or combination of agents refers to an amount sufficient to elicit the desired biological response. As will be appreciated by those of ordinary skill in this art, the effective amount of an inventive combination may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the agents being delivered, the disease being treated, the mode of administration, and the patient. For example, the effective amount of an inventive combination (e.g. , farnesyl transferase inhibitor and α-synuclein aggregation inhibitor) is the amount of each component that when given together results in reducing the α-synuclein aggregation and/or toxicity and/or symptoms and/or disease progression in a subject.
[0030] "Pharmaceutically acceptable": The present invention provides "pharmaceutically acceptable" compositions, which comprise a therapeutically effective amount of one or more of the compounds described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. As described in detail, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream or foam; sublingually; ocularly; transdermally; or nasally, pulmonary and to other mucosal surfaces.
[0031] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0032] "Pharmaceutically acceptable carrier": The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.
[0033] "Pharmaceutically acceptable salt": The term "pharmaceutically acceptable salt" as used herein are meant to comprise the therapeutically active non-toxic acid and non-toxic base addition salt forms that the compounds are able to form. The compounds that have basic properties can be converted into their pharmaceutically acceptable acid addition salts by treating the base form with an appropriate acid. Appropriate acids include, for example, inorganic acids such as hydrohalic acids, e.g. , hydrochloric or hydrobromic acid; sulfuric; nitric; phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic, malonic, succinic (i.e., butanedioic acid), maleic, fumaric, malic, tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cyclamic, salicylic, p- aminosalicylic, pamoic and the like acids. In certain embodiments, the salt is a tartrate salt. The tartrate salt may be either L-tartric acid or D-tartric acid. Both tartric acids are available from Aldrich Chemical Company, Inc. (Milwaukee, Wisconsin). The salts may be anhydrous or hydrous forms.
[0034] The compounds that have acidic properties can be converted into their pharmaceutically acceptable base addition salts by treating the acid form with a suitable organic or inorganic base. Appropriate base salt forms include, for example, the ammonium salts, the alkali and earth alkaline metal salts, e.g., the lithium, sodium, potassium, magnesium, calcium salts and the like, salts with organic bases, e.g., the benzathine, N-methyl-D-glucamine, hydrabamine salts, and salts with amino acids such as, for example, arginine, lysine and the like. [0035] The terms acid or base addition salt also comprise the hydrates and the solvent addition forms that the compounds are able to form. Examples of such forms are, e.g., hydrates, alcoholates, and the like.
[0036] As set out herein, certain embodiments of the present compounds may contain a basic functional group, such as amino or alkylamino, and are, thus, capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable acids. The term "pharmaceutically-acceptable salts" in this respect refers to the relatively non-toxic, inorganic and organic acid addition salts of compounds of the present invention. These salts can be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting a purified compound of the invention in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed during subsequent purification. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like. (See, for example, Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci. 66:1-19; incorporated herein by reference). [0037] The pharmaceutically acceptable salts of the subject compounds include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from nontoxic organic or inorganic acids. For example, such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like. [0038] In other cases, the compounds of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable bases. The term "pharmaceutically-acceptable salts" in these instances refers to the relatively non-toxic, inorganic and organic base addition salts of compounds of the present invention. These salts can likewise be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting the purified compound in its free acid form with a suitable base, such as the hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like. (See, for example, Berge et ah, supra).
[0039] "Small molecule": As used herein, the term "small molecule" is used to refer to molecules, whether naturally-occurring or artificially created {e.g., via chemical synthesis) that have a relatively low molecular weight. Typically, a small molecule is an organic compound {i.e., it contains carbon). The small molecule may contain multiple carbon-carbon bonds, stereocenters, and other functional groups {e.g., amines, hydroxyl, carbonyls, heterocyclic rings, etc.). In some embodiments, small molecules are monomeric and have a molecular weight of less than about 1500 g/mol. In certain embodiments, the molecular weight of the small molecule is less than about 1000 g/mol or less than about 500 g/mol. Preferred small molecules are biologically active in that they produce a biological effect in animals, preferably mammals, more preferably humans. Small molecules include, but are not limited to, radionuclides and imaging agents. In certain embodiments, the small molecule is a drug. Preferably, though not necessarily, the drug is one that has already been deemed safe and effective for use in humans or animals by the appropriate governmental agency or regulatory body. For example, drugs approved for human use are listed by the FDA under 21 C. F. R. §§ 330.5, 331 through 361, and 440 through 460, incorporated herein by reference; drugs for veterinary use are listed by the FDA under 21 CF. R. §§ 500 through 589, incorporated herein by reference. All listed drugs are considered acceptable for use in accordance with the present invention.
[0040] "Synucleinopathic subject": As used herein, the term "synucleinopathic subject" or "subject with a synucleinopathy" refers to a subject that is diagnosed with, affected by, or at risk of developing a synucleinopathy (e.g. , predisposed, for example genetically predisposed, to developing a synucleinopathy, or for whom biomarkers suggest a pre-clinical state) and/or any neurodegenerative disorder characterized by pathological synuclein aggregations. Several neurodegenerative disorders including Parkinson's disease, diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl) are collectively grouped as synucleinopathies. In certain particular embodiments, the synucleinopathy is Parkinson's disease. In certain embodiments, the synucleinopathy is diffuse Lewy body disease (DLBD). In certain embodiments, the synucleinopathy is multiple system atrophy. In certain particular embodiments, the synucleinopathy is a disorder of brain iron concentration (e.g., pantothenate kinase-associated neurodegeneration).
[0041] "Therapeutically effective amount": The phrase "therapeutically effective amount" as used herein means that amount of a compound or composition which is effective for producing some desired therapeutic effect in a subject at a reasonable benefit/risk ratio applicable to any medical treatment. Accordingly, a therapeutically effective amount prevents, minimizes, slows, or reverses disease progression associated with a synucleinopathy or other neurodegenerative disease. Disease progression can be monitored by clinical observations, laboratory, and/or neuroimaging investigations apparent to a person skilled in the art. A therapeutically effective amount can be an amount that is effective in a single dose or an amount that is effective as part of a multi-dose therapy, for example an amount that is administered in two or more doses or an amount that is administered chronically.
[0042] "Treatment": According to the invention, the term "treatment" includes prophylaxis and therapy, and includes managing a subject's symptoms and halting the progression of the disease. Treatment includes preventing, slowing, stopping, or reversing (e.g., curing) the development of a synucleinopathy or other neurodegenerative disease, and/or the onset of certain symptoms associated with a synucleinopathy or other neurodegenerative disease in a subject with, or at risk of developing, a synucleinopathy, a related disorder, or other neurodegnerative disease. For the treatment of a synucleinopathy, the therapy typically includes preventing, slowing, stopping or reversing (e.g. , curing) the accumulation and/or aggregation of α-synuclein in a subject with a synucleinopathy. Therapy also includes decreasing the amount of accumulated α-synuclein in a subject with a synucleinopathy or other neurodegenerative disorder.
Brief Description of the Drawing
[0043] Figure 1 shows that UCH-Ll membrane association is regulated by its farnesylation.
[0044] Figure 2 shows that C220S mutation abolished the inhibitory effect of UCH-Ll WT on α-synuclein degradation.
[0045] Figure 3 shows that farnesyl transferase inhibitor can rescue the α-synuclein toxicity in infected SH-SY5Y cells overexpressing α-synuclein.
[0046] Figure 4 shows that FTI-277 rescued α-synuclein toxicity in SH-SY5Y cells by reducing the amount of α-synuclein accumulation.
[0047] Figure 5 shows the formula of various exemplary farnesyl transferase inhibitors.
[0048] Figure 6 is a graph showing the number of cells positive for α-synuclein immunoreactivity in the cortex (top panel) and hippocampus (bottom panel) of 11 month old α- synuclein transgenic mice after 30 days of treatment with Zarnestra and control. P<0.05,
**P<0.01
[0049] Figure 7 shows the (A) frontal cortex of α-synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel); and (B) hippocampus of α-synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel). Immunofluorescence analysis of brain sections performed with a primary antibody to full-length human α-synuclein, then a seocndary Cy2-conjugated antibody. Magnification: 100 fold.
[0050] Figure 8 shows ubiquitin immunohistochemistry in the cortex and parts of the neuronal layer in the hippocampus of α-synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel). Magnification: 200 fold.
[0051] Figure 9 shows Campbell Switzer staining of the Lewy body-like inclusions in the hippocampus of α-synuclein transgenic mice treated with vehicle (left panel) or Zarnestra (right panel). Magnification: 400 fold. [0052] Figure 10 shows the quantification of α-synuclein by ELISA in the cytoplasmic fraction from the cortex of non-transgenic (ntg) or α-synuclein transgenic (syn tg) mice treated for 30 days.
[0053] Figure 11 shows the quantification of α-synuclein by ELISA in the membrane fraction of the cortex of non-transgenic (ntg) or α-synuclein transgenic (syn tg) mice treated for
30 days.
[0054] Figure 12 shows the quantification of farnesylated UCH-Ll in the membrane fraction from the cortex of non-transgenic (ntg) or α-synuclein transgenic (syn tg) mice treated for 30 days.
[0055] Figure 13 shows the quantification of α-synuclein by ELISA in the cytoplasmic fraction from the cortex of α-synuclein transgenic mice treated for 30 days.
[0056] Figure 14 shows the quantification of α-synuclein by ELISA in the membrane fraction from the cortex of α-synuclein transgenic mice treated for 30 days.
[0057] Figure 15 shows the quantification of UCH-Ll in the membrane fraction from the cortex of α-synuclein transgenic mice treated for 30 days.
[0058] Figure 16 shows the quantification of α-synuclein by ELISA in the cytoplasmic fraction from the cortex of α-synuclein transgenic mice treated for 90 days.
[0059] Figure 17 shows the quantification of α-synuclein by ELISA in the membrane fraction from the hippocampus of α-synuclein transgenic mice treated for 90 days.
[0060] Figure 18 demonstrates the number of cells positive for α-synuclein immunoreactivity in the cortex (top panel) and hippocampus (bottom panel) of 7 month old α- synuclein transgenic mice after 90 days of treatment.
[0061] Figure 19 shows the cortex and hippocampus of 7 month old α-synuclein transgenic mice after 90 days of treatment with vehicle or OSI-754. Immunofluorescence analysis of brain sections performed with a primary antibody to human α-synuclein, then a secondary Cy2- conjugated antibody. Magnification: 20 fold.
[0062] Figure 20 shows the cortex and hippocampus of 7 month old α-synuclein transgenic mice after 90 days of treatment with vehicle or OSI-754. Immunofluorescence analysis of brain sections performed with a primary antibody to NeuN. Magnification: 20 fold.
[0063] Figure 21 shows that nortriptyline binds to α-synuclein and affects the rate of structure formation in the presence of l,l,l,3,3,3-hexafluoro-2-propanol (HFIP). A. Monitoring of Thioflavin T fluorescence. B. Monitoring of α-synuclein fluorescence polarization. Solvent alone (solid line); nortriptyline at 50 μM (open squares), 100 μM (open circles), 200 μM (open triangles), and 400 μM (open diamonds).
[0064] Figure 22 shows that indatraline binds to α-synuclein and affects the rate of structure formation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP). A. Monitoring of
Thioflavin T fluorescence. B. Monitoring of α-synuclein fluorescence polarization. Solvent alone (solid line); indatraline at 50 μM (open squares), 100 μM (open circles), 200 μM (open triangles), and 400 μM (open diamonds).
[0065] Figure 23 shows that fluoxetine and norfluoxetine bind to α-synuclein and affect the rate of structure formation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP).
Monitoring of Thioflavin T fluorescence. A. Fluoxetine. B. Norfluoxetine. Solvent alone
(solid line); compound at 50 μM (open squares), 100 μM (open circles), 200 μM (open triangles), and 400 μM (open diamonds).
[0066] Figure 24 shows that protriptyline and maprotiline bind to α-synuclein and affect the rate of structure formation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP).
Monitoring of Thioflavin T fluorescence. A. Protriptyline. B. Maprotiline. Solvent alone
(solid line); compound at 50 μM (open squares), 100 μM (open circles), 200 μM (open triangles), and 400 μM (open diamonds).
[0067] Figure 25 shows that norclomipramine and nordoxepin bind to α-synuclein and affect the rate of structure formation in the presence of l,l,l,3,3,3-hexafluoro-2-propanol (HFIP).
Monitoring of Thioflavin T fluorescence. A. Norclomipramine. B. Nordoxepin. Solvent alone
(solid line); compound at 50 μM (open squares), 100 μM (open circles), 200 μM (open triangles), and 400 μM (open diamonds).
[0068] Figure 26 shows that sertraline binds to α-synuclein and affects the rate of structure formation in the presence of HFIP. Monitoring of Thioflavin T fluorescence. Solvent alone
(solid line); sertraline at 50 μM (open squares), 100 μM (open circles), 200 μM (open triangles), and 400 μM (open diamonds).
[0069] Figure 27 shows that nortriptyline, indatraline, and fluoxetine delay aggregation of α- synuclein. A. Amount of α-synuclein monomer in solution. B. Monitoring of α-synuclein fluorescence polarization. Solvent alone (black bars), indatraline (gray bars), nortriptyline (white bars), and fluoxetine (hatched bars). [0070] Figure 28 shows that nortriptyline, indatraline, and fluoxetine delay aggregation of α- synuclein in a dose-dependent manner. A. Indatraline. Solvent alone (solid line); indatraline at 1 μM (solid squares), 10 μM (open squares), 50 μM (open cirlces), or 100 μM (open diamonds). B. Nortriptyline. Solvent alone (solid line); nortriptyline at 0.1 μM (open squares), 50 μM (open cirlces), or 200 μM (open diamonds). C. Fluoxetine. Solvent alone (solid line); fluoxetine at 1 μM (open squares), 50 μM (open cirlces), or 200 μM (open diamonds). [0071] Figure 29 shows that nortriptyline and indatraline decrease α-synuclein neurotoxicity in dopaminergic neurons. Midbrain cultures from embryonic mice were infected with a recombinant lentivirus encoding A53T human α-synuclein (A53T) or a control virus (control), then treated for 3 days. The percent Tyrosine-Hydroxylase-positive neurons (TH+ cells) was determined as described. Experiments, including controls, were run separately for nortriptyline (black bars) and indatraline (white bars).
[0072] Figure 30 is a graph showing quantification of α-synuclein by ELISA in the cytoplasmic (black bars) and membrane fraction (white bars) in 4 month old α-synuclein transgenic mice treated for 30 days. A. Cortex. B. Hippocampus. *, p < 0.05; **, p < 0.01. [0073] Figure 31 is a graph showing the number of cells positive for α-synuclein immunoreactivity in 4 month old α-synuclein transgenic mice after 30 days of treatment with 25 mg/kg nortriptyline. A. Cortex. B. Hippocampus.
[0074] Figure 32 includes photomicrographs of the hippocampus of 4 month old α- synuclein transgenic mice after 30 days of treatment with vehicle or nortriptyline. Immunofluorescence analysis of brain sections immunostained for human α-synuclein fgreen) and NeuN (red).
[0075] Figure 33 is a graph showing the number of cells positive for human α-synuclein immunoreactivity in 7 month old α-synuclein transgenic mice after 30 days of treatment with nortriptyline at 0.5 mg/kg, 5 mg/kg, and 25 mg/kg. A. Cortex. B. Hippocampus. * p < 0.05, ** p < 0.01, *** P < 0.001, one-way ANOVA with Newman-Keuls comparison post-hoc test.
Detailed Description of the Invention
[0076] Synucleins are small proteins (123 to 143 amino acids) characterized by repetitive imperfect repeats KTKEGV (SEQ ID NO: XX) distributed throughout most of the amino- terminal half of the polypeptide in the acidic carboxy-terminal region. There are three human synuclein proteins termed α, β, and γ, and they are encoded by separate genes mapped to chromosomes 4221.3-q22, 5q23, and 10q23.2-q23.3, respectively. The most recently cloned synuclein protein synoretin is closely homologous to γ-synuclein and is predominantly expressed within the retina, α-synuclein, also referred to as the non-amyloid component of senile plaques precursor protein (NACP), SYNl or synelfm, is a heat-stable, "natively unfolded" protein of poorly defined function. It is predominantly expressed in the central nervous system (CNS) neurons where it is localized to pre-synaptic terminals. Electron microscopy studies have localized α-synuclein in close proximity to synaptic vesicles at axonal termini, suggesting a role for α-synuclein in neurotransmission or synaptic organization, and biochemical analysis has revealed that a small fraction of α-synuclein may be associated with vesicular membranes but most α-synuclein is cytosolic.
[0077] Genetic and histopathological evidence supports the idea that α-synuclein is the major component of several proteinaceous inclusions characteristic of specific neurodegenerative diseases. Pathological synuclein aggregations in Parkinson's disease are restricted to the α- synuclein isoforms, as β and γ synucleins have not been detected in these inclusions. Lewy bodies, neuronal fibrous cytoplasmic inclusions that are histopathological hallmarks of Parkinson's disease (PD) and diffuse Lewy body disease (DLBD), are strongly labeled with antibodies to α-synuclein. Dystrophic ubiquitin-positive neurites associated with PD pathology, termed Lewy neurites (LN) and CA2/CA3 ubiquitin neurites are also α-synuclein positive. Furthermore, pale bodies, putative precursors of LBs, thread-like structures in the perikarya of slightly swollen neurons and glial silver positive inclusions in the midbrains of patients with LB diseases are also immunoreactive for α-synuclein. α-synuclein is likely the major component of glial cell inclusions (GCIs) and neuronal cytoplasmic inclusions in MSA and some types of brain iron accumulation including PANKl . α-synuclein immunoreactivity is present in some dystrophic neurites in senile plaques in Alzheimer's Disease (AD) and in the cord and cortex in amyotrophic lateral sclerosis (ALS). α-synuclein immunoreactivity is prominent in transgenic and toxin-induced mouse models of PD, AD, ALS, and HD.
[0078] Further evidence supports the notion that α-synuclein is the actual building block of the fibrillary components of LBs, LNs, and GCIs. Immunoelectron microscopic studies have demonstrated that these fibrils are intensely labeled with α-synuclein antibodies in situ. Sarcosyl-insoluble α-synuclein filaments with straight and twisted morphologies can also be observed in extracts of DLBD and MSA brains. Moreover, α-synuclein can assemble in vitro into elongated homopolymers with similar widths as sarcosyl-insoluble fibrils or filaments visualized in situ. Polymerization is associated with a concomitant change in secondary structure from random coil to anti-parallel β-sheet structure consistent with the Thioflavine-S reactivity of these filaments. Furthermore, the PD-association with α-synuclein mutation, A53T, may accelerate this process, as recombinant A53T α-synuclein has a greater propensity to polymerize than wild-type α-synuclein. This mutation also affects the ultrastructure of the polymers; the filaments are slightly wider and are more twisted in appearance, as if assembled from two proto filaments. The A30P mutation may also modestly increase the propensity of α-synuclein to polymerize, but the pathological effects of this mutation also may be related to its reduced binding to vesicles. Interestingly, carboxyl-terminally truncated α-synuclein may be more prone to form filaments than the full-length protein.
[0079] The proteosomal degradation of α-synuclein is a mediated by parkin and neuronal ubiquitin C-terminal hydrolase (UCH-Ll). Parkin is an E3 ligase that ubiquitinylates α- synuclein and thereby tags it for degradation. UCH-Ll acts in normal neuronal tissues to cleave the ubiquitinylated proteins that are products of the proteosomal degradation of the polyubiquitinylated proteins.
[0080] It has been now discovered that UCH-Ll is farnesylated in vivo. UCH-Ll is associated with the membrane, and this membrane association is mediated by farnesylation. Farnesylated UCH-Ll also stabilizes the accumulation of α-synuclein. The invention relates to the prevention or inhibition of UCH-Ll farnesylation which would result in UCH-Ll membrane disassociation and acceleration of the degradation of α-synuclein. Since α-synuclein accumulation is pathogenic in PD, DLBD, and MSA, an increased degradation of α-synuclein and/or inhibition of α-synuclein accumulation ameliorates the toxicity associated with a pathogenic accumulation of α-synuclein.
[0081] The modification of a protein by a farnesyl group can have an important effect on function for a number of proteins. Farnesylated proteins typically undergo further C-terminal modification events that include a proteolytic removal of three C-terminal amino acids and carboxymethylation of C-terminal cystines. These C-terminal modifications facilitate protein- membrane association as well as protein-protein interactions. Farnesylation is catalyzed by a protein farnesyltransferase (FTase), a heterodimeric enzyme that recognizes the CAAX motif present at the C-terminus of the substrate protein. FTase transfers a farnesyl group from farnesyl pyrophosphate and forms a thioether linkage between the farnesyl and the cystine residues in the CAAX motif. A number of inhibitors of FTase have been developed and are known in the art. However, the invention provides novel methods for using certain farnesyl transferase inhibitors to treat subjects having symptoms associated with α-synuclein accumulation. [0082] The term synucleionopathy typically refers to neurological disorders that are characterized by a pathological accumulation and/or aggregation of α-synuclein. This group of disorders includes, but is not limited to, PD, DLBD, MSA, and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl). [0083] Parkinson's disease (PD) is a neurological disorder characterized by bradykinesia, rigidity, tremor, and postural instability. The pathologic hallmark of PD is loss of neurons in the substantia nigra pars compacta (SNpc) and the appearance of Lewy bodies in remaining neurons. It appears that more than about 50% of the cells in the SNpc need to be lost before motor symptoms appear. Associated symptoms often include small handwriting (micrographia), seborrhea, orthostatic hypotension, urinary difficulties, constipation and other gastrointestinal dysfunction, sleep disorders, depression and other neuropsychiatric phenomena, dementia, and smelling disturbances (occurs early). Patients with Parkinsonism have greater mortality, about two times compared to general population without PD. This is attributed to greater frailty or reduced mobility.
[0084] The term synucleinopathic subject encompasses a subject that is affected by, or is at risk of developing a synucleinopathy such as PD, DLBD, MSA, and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration (e.g., PANKl). These subjects can be readily identified by persons of ordinary skill in the art by symptomatic diagnosis, physical examination, neurologic examination, and/or in some instances in conjunction with genetic screening, brain scans, SPEC, PET imaging, etc. [0085] Diagnosis of PD, at present, is mainly clinical and is based on the clinical findings listed above. Parkinsonism, refers to any combination of two of bradykinesia, rigidity, and/or tremor. PD is the most common cause of parkinsonism. Other causes of parkinsonism are side effects of drugs, mainly the major tranquilizers, such as haloperidol, strokes involving the basal ganglia, and other neurodegenerative disorders, such as Diffuse Lewy Body Disease (DLBD), progressive supranuclear palsy (PSP), frontotemporal dementia (FTD), MSA, and Huntington's disease. The pathological hallmark of PD and DLBD is the Lewy body, an intracytoplasmatic inclusion body typically seen in affected neurons of the substantia nigra and to a variable extent, in the cortex in the former disease, and vice versa in the latter, α-synuclein has been identified as the main component of Lewy bodies in sporadic Parkinsonism.
[0086] Although parkinsonism can sometimes be attributed to viruses, stroke, or toxins in a few individuals, for the most part, the cause of Parkinson's disease in any particular case is unknown. Environmental influences which may contribute to PD may include drinking well water, farming and industrial exposure to heavy metals (e.g. , iron, zinc, copper, mercury, magnesium and manganese), alkylated phosphates and other pesticides, and orthonal chlorines. Paraquat (a herbicide) has also been associated with increased prevalence of Parkinsonism including PD. Cigarette smoking is associated with a decreased incidence of PD. The current consensus is that PD may either be caused by an uncommon toxin combined with high genetic susceptibility or a common toxin combined with relatively low genetic susceptibility. [0087] A small percentage of subjects that are at risk of developing PD can be identified for example by genetic analysis. There is good evidence for certain genetic factors being associated with PD. Large pedigrees of autosomal dominantly inherited PDs have been reported. For example, three point mutations in the α-synuclein gene (SNCA gene) have been associated with autosomal dominant PD, as duplication and triplication of the wildtype SNCA gene. [0088] The term "synucleinopathic subject" also encompasses a subject that is affected by, or is at risk of developing diffuse Lewy body disease (DLBD). These subjects can be readily identified by persons of ordinary skill in the art by symptomatic diagnosis, physical examination, or by genetic screening, brain scans, SPECT, PET imaging, etc.
[0089] DLBD is the second most common cause of dementia in older individuals; it effects 7% of the general population older than 65 years and 30% of those aged over 80 years. It is part of a range of clinical presentations that share a pathology based on abnormal aggregation of the synaptic protein α-synuclein. DLBD has many of the clinical and pathological characteristics of the dementia that occur late in the course of Parkinson's disease. A "one year rule" has been proposed to separate DLBD from PD. According to this rule, onset of dementia within 12 months of Parkinsonism qualifies as DLBD, whereas more than 12 months of Parkinsonism before onset of dementia qualifies as Parkinson's Disease with dementia (PDD). The central features of DLBD include progressive cognitive decline of sufficient magnitude to interfere with normal social and occupational function and neuropsychiatry phenomena. Prominent or persistent memory impairment does not necessarily occur in the early stages, but it is evident with progression in most cases. Deficits on tests of attention and of frontal cortical skills and visual spatial ability can be especially prominent.
[0090] Core diagnostic features, two of which are essential for diagnosis of probable and one for possible DLBD are fluctuating cognition with pronounced variations in attention and alertness, recurrent visual hallucinations that are typically well-formed and detailed, and spontaneous features of Parkinsonism. In addition, there can be some supportive features, such as repeated falls, syncope, transient loss of consciousness, neuroleptic sensitivity, systematized delusions, hallucinations and other modalities, REM sleep behavior disorder, and depression. Patients with DLBD do better than those with Alzheimer's Disease in tests of verbal memory, but worse on visual performance tests. This profile can be maintained across the range of severity of the disease, but can be harder to recognize in the later stages owing to global difficulties. DLBD typically presents with recurring episodes of confusion on a background of progressive deterioration. Typical patients with DLBD show a combination of cortical and subcortical neuropsychological impairments with substantial attention deficits and prominent frontal subcortical and visual spatial dysfunction. These help differentiate this disorder from Alzheimer's disease.
[0091] Rapid eye movement (REM), sleep behavior disorder is a parasomnia manifested by vivid and frightening dreams associated with simple or complex motor behavior during REM sleep. This disorder is frequently associated with the synucleinopathies, DLBD, PD, and MSA, but occurs less often in amyloidopathies and tauopathies. The neuropsychological pattern of impairment in REM sleep behavior disorder/dementia is similar to that reported in DLBD and qualitatively different from that reported in Alzheimer's Disease. Neuropathological studies of REM sleep behavior disorder associated with neurodegenerative disorder have shown Lewy body disease or multiple system atrophy. REM sleep wakefulness disassociations (REM sleep behavior disorder, daytime hypersomnolence, hallucinations, cataplexy) characteristic of narcolepsy can explain several features of DLBD, as well as PD. Sleep disorders could contribute to the fluctuations typical of DLBD, and their treatment can improve fluctuations and quality of life. Subjects at risk of developing DLBD can be identified. Repeated falls, syncope, transient loss of consciousness, and depression are common in older people with cognitive impairment and can serve as (a red flag) to a possible diagnosis of DLBD. By contrast, narcoleptic sensitivity in REM sleep behavior disorder can be highly predictive of DLBD. Their detection depends on the clinicians having a high index of suspicion and asking appropriate screening questions.
[0092] Clinical diagnosis of synucleinopathic subjects that are affected by or at risk of developing Lewy body disease can be supported by neuroimaging investigations. Changes associated with DLBD include preservation of hippocampal, and medialtemporal lobe volume on MRI and occipital hypoperfusion on SPECT. Other features, such as generalized atrophy, white matter changes, and rates of progression of whole brain atrophy are not helpful in differential diagnosis. Dopamine transporter loss in the caudate and putamen, a marker of nigrostriatal degeneration, can be detected by dopamenergic SPECT and can prove helpful in clinical differential diagnosis. A sensitivity of 83% and specificity of 100% has been reported for an abnormal scan with an autopsy diagnosis of DLBD.
[0093] Consensus criteria for diagnosing DLBD include ubiquitin immunohistochemistry for Lewy body identification and staging into three categories; brain stem predominant, limbic, or neocortical, depending on the numbers and distribution of Lewy bodies. The recently-developed α-synuclein immunohistochemistry can visualize more Lewy bodies and is also better at indicating previously under recognized neurotic pathology, termed Lewy neurites. [0094] In most patients with DLBD, there are no genetic mutations in the α-synuclein or other Parkinson's disease-associated genes. Pathological up-regulation of normal, wild-type α- synuclein due to increased mRNA expression is a possible mechanism, or Lewy bodies may form because α-synuclein becomes insoluble or more able to aggregate. Another possibility is that α-synuclein is abnormally processed, for example, by a dysfunctional proteasome system and that toxic "proto fibrils" are therefore produced. Sequestering of these toxic fibrils into Lewy bodies could reflect an effort by the neurons to combat biological stress inside the cell, rather than their simply being neurodegenerative debris.
[0095] Target symptoms for the accurate diagnosis of DLBD can include extrapyramidal motor features, cognitive impairment, neuropsychiatric features (including hallucinations, depression, sleep disorder, and associated behavioral disturbances), or autonomic dysfunction. [0096] The term "synucleinopathic subject" also encompasses a subject that is affected by, or is at risk of developing multiple system atrophy (MSA). These subjects can be readily identified by persons of ordinary skill in the art by symptomatic diagnosis, physical examination, and neurological examination sometimes in conjunction with genetic screening, brain scans, SPECT, PET imaging, etc.
[0097] MSA is a neurodegenerative disease marked by a combination of symptoms; affecting movement, cognition, autonomic and other body functions, hence the label "multiple system atrophy". The cause of MSA is unknown. Symptoms of MSA vary in distribution of onset and severity from person to person. Because of this, the nomenclature initially included three distinct terms: Shy-Drager syndrome, striatonigral degeneration (SD), and olivopontocerebellar atrophy (OPCA). These terms have been replaced by the nomenclature MSA-C (MSA with a cerebellar phenotype) and MSA-P (MSA with a parkinsonian phenotype). [0098] In Shy-Drager syndrome, the most prominent symptoms are those involving the autonomic system; blood pressure, urinary function, and other functions not involving conscious control. Striatonigral degeneration causes predominately parkinsonism (slowed movements and rigidity), while OPCA principally affects balance, coordination, and speech. The symptoms for MSA typically include orthostatic hypotension, impotence, urinary difficulties, constipation, and speech and swallowing difficulties.
[0099] The initial diagnosis of MSA is usually made by carefully interviewing the patient and performing a physical examination. Several types of brain imaging, including computer tomography, scans, magnetic resonance imaging (MRI), and positron emission tomography (PET), can be used as corroborative studies. An incomplete and relatively poor response to dopamine replacement therapy, such as SINEMET (levodopa/carbidopa), may be a clue that a presentation of bradykinesia and rigidity (parkinsonism) is not due to PD. A characteristic involvement of multiple brain systems with prominent autonomic dysfunction is a defining feature of MSA and one that at autopsy confirms the diagnosis. The presence of glial cytoplasmic inclusions containing α-synuclein is pathognomic of MSA. In comparison to Parkinson's disease, in addition to the poor response to Sinemet, there are a few other observations that are strongly suggested for MSA, such as postural instability, low blood pressure on standing (orthostatic hypotension) and high blood pressure when lying down (supine hypertension), urinary difficulties, impotence, constipation, speech and swallowing difficulties out of proportion to slowness and rigidity. [00100] The present invention provides a novel system for treating synucleinopathic subjects (e.g., Parkinson's disease) or patients with other neurodegenerative diseases. In certain embodiments, the invention includes methods of treating a subject with a prototypic synucleinopathy, such as Parkinson's Disease (PD), diffuse Lewy body disease (DLBD), multiple system atrophy (MSA), and neuronal brain iron accumulation syndrome with α- synuclein deposition, with a combination of a farnesyl transferase inhibitor and an α-synuclein aggregation inhibitor. In certain other embodiments, the invention includes methods of treating a subject with a neurodegenerative disease such as amyotrophic lateral sclerosis (ALS), Huntington's Disease (HD), or Alzheimer's Disease (AD), with such a combination. Without wishing to be bound by any particular theory or mechanism of action, the methods of the invention are useful in preventing or decreasing the accumulation, aggregation, and/or toxicity of α-synuclein. In certain embodiments, the treatments methods decrease the aggregation of α- synuclein. In certain er embodiments, the treatment methods inhibit the aggregation of α- synuclein. In certain embodiments, the methods are useful in reducing the toxicity of aggregations of α-synuclein. In still other embodiments, the methods are useful in decreasing levels of insoluble α-synuclein and/or increasing clearance of α-synuclein. The invention provides methods for treating a subject with a synucleinopathy or other neurodegenerative disease, including the step of administering to the subject a therapeutically effective amount of a farnesyl transferase inhibitor and an agent that inhibits the aggregaton of α-synuclein. The combination of these agents may lead to an additive or synergistic effect as described herein. In certain embodiments, the subject is a vertebrate. In certain embodiments, the subject is a mammal. In preferred embodiments, the subject is a human. The human may be male or female, and the human may be at any stage of development.
[00101] Farnesyl transferase inhibitors have been shown to be useful in the treatment of synucleinopathies by reducing the levels and deposition of α-synuclein in cells (e.g., neurons). See, e.g., published U.S. applications, US 2006/0106060; US 2005/0272722; US 2005/0288298; and US 2005/0277629; each of which is incorporated herein by reference. Agents such as nortriptyline, indatraline, fluoxetine, norfluoxetine, protriptyline, maprotiline, norclomipramine, nordoxepin, and sertraline that inhibit the aggregation of α-synuclein have been found to be particularly useful in combination with farnesyl transferase inhibitors in the treatment of synucleinopathies to prevent the accumulation, aggregation, and/or associated toxicity of aggregates of α-synuclein.
[00102] Based on these discoveries, the invention provides methods of treating cells (e.g., neural cells) with the inventive combinations both in vitro and in vivo. In certain embodiments, the cells are human neural cells. The cells may be primary cells, or they may be derived from a cell line. The invention also provides pharmaceutical compositions and preparations comprising the inventive combinations. Kits containing the inventive combinations are also provided.
Farnesyl Transferase Inibitor
[00103] Any farnesyl transferase inhibitor known in the art may be combined with an agent that inhibits the aggregation of α-synuclein to form an inventive combination for the treatment of a synucleinopathy. In certain embodiments, the farnesyl transferase inhibitor has been shown to be useful in the treatment of synucleinopathies or other neurodegenerative diseases. Various farnesyl transferase inhibitors that have been found useful in the treatment of synucleinopathies or other neurodegenerative diseases are described in published U.S. patent applications, US 2006/0106060; US 2005/0272722; US 2005/0288298; and US 2005/0277629; each of which is incorporated herein by reference; U.S. patent applications, USSN 11/615,088; USSN 60/764,678; and USSN 60/813,181; each of which is incorporated herein by reference; and published international PCT applications, WO 2005/089504; WO 2005/089515; WO 2005/089496; and WO 2005/089502; each of which is incorporated herein by reference. Any farnesyl transferase inhibitor described in these patent applications may be used in combination with an agent that inhibits the aggregation of α-synuclein in accordance with the present invention.
[00104] In certain embodiments, the inventive combination comprises a farnesyl transferase inhibitor of the formula:
Figure imgf000033_0001
or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, the tartrate salt of the compound is used. This compounds is also known by the names, LNK-754, OSI-754, and CP-609754. [00105] In another embodiment, the inventive combination comprises a farnesyl transferase inhibitor of the formula:
Figure imgf000033_0002
wherein the dashed line indicates that the bond between C-3 and C -4 of the quinolin-2-one ring is a single or double bond;
R1 is selected from H, Ci-Ci0 alkyl, -(CR13R14)qC(O)R12, -(CR13R14)qC(O)OR15, -(CR13R14)qOR12, -(CR13R14)qSO2R15, -(CR13R14),(C3-Ci0 cycloalkyl), -(CR13R14),(C6-Ci0 aryl), and -(CR13R14)t(4-10 membered heterocyclic), wherein t is an integer from 0 to 5 and q is an integer from 1 to 5, said cycloalkyl, aryl and heterocyclic R1 groups are optionally fused to a C6- Cio aryl group, a Cs-Cg saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R1 groups, except H but including any optional fused rings referred to above, are optionally substituted by one to four R6 groups; R2 is halo, cyano, -C(O)OR15, or a group selected from the substituents provided in the definition of R12; each R3, R4, R5, R6, and R7 is independently selected from H, Ci-Ci0 alkyl, C2-Ci0 alkenyl, halo, cyano, nitro, mercapto, trifluoromethyl, trifluoromethoxy, azido, -OR12, -C(O)R12, -C(O)OR12, -NR13C(O)OR15, -OC(O)R12, -NR13SO2R15, -SO2NR12R13, -NR13C(O)R12, -C(O)NR12R13, -NR12R13, -CH=NOR12, -S(O)1R12 wherein j is an integer from O to 2, -(CR13R14KC6-Ci0 aryl), -(CR13R14),(4-10 membered heterocyclic), -(CR13R14),(C3-Ci0 cycloalkyl), and -(CR13R14),C≡CR16, and wherein in the foregoing R3, R4, R5, R6, and R7 groups t is an integer from O to 5; the cycloalkyl, aryl and heterocyclic moieties of the foregoing groups are optionally fused to a C6-Ci0 aryl group, a C5-C8 saturated cyclic group, or a 4-10 membered heterocyclic group; and said alkyl, alkenyl, cycloalkyl, aryl and heterocyclic groups are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, -NR13SO2R15, -SO2NR12R13, -C(O)R12, -C(O)OR12, -OC(O)R12, -NR13C(O)OR15, -NR13C(O)R12, -C(O)NR12R13, -NR12R13, -OR12, Ci-Ci0 alkyl, C2- Ci0 alkenyl, C2-Ci0 alkynyl, -(CR13R14>(C6-Ci0 aryl), and -(CR13R14),(4-10 membered heterocyclic), wherein t is an integer from O to 5;
R8 is H, -OR12, -NR12R13, -NR12C(O)R13, cyano, -C(O)OR13, -SR12, -(CR13R14),(4-10 membered heterocyclic), wherein t is an integer from O to 5, or Ci-C6 alkyl, wherein said heterocyclic and alkyl moieties are optionally substituted by 1 to 3 R6 substituents;
R9 is -(CR13R14)t(imidazolyl) wherein t is an integer from O to 5 and said imidazolyl moiety is optionally substituted by one or two R6 substituents; each R10 and R11 is independently selected from the substituents provided in the definition of R6; each R12 is independently selected from H, Ci-Ci0 alkyl, -(CR13R14),(C3-Ci0 cycloalkyl), -(CR13R14XC6-Ci0 aryl), and -(CR13R14>(4-10 membered heterocyclic), wherein t is an integer from O to 5; said cycloalkyl, aryl and heterocyclic R12 groups are optionally fused to a C6-Ci0 aryl group, a C5-C8 saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R12 substituents, except H, are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, -C(O)R13, -C(O)OR13, -OC(O)R13, -NR13C(O)R14, -C(O)NR13R14, -NR13R14, hydroxy, Ci-C6 alkyl, and Ci-C6 alkoxy; each R , 13 and R , 14 is independently H or Ci-C6 alkyl, and where R 13 and R , 14 are as
-(CR , 13r R> 14Λ )q or (CR , 13r R> 14 )t each is independently defined for each iteration of q or t in excess of 1 ;
R , 15 is selected from the substituents provided in the definition of R 12 except R , 15 is not H;
R , 16 is selected from the list of substituents provided in the definition of R 12 and
-SiR17R18R19;
R , 17 , R , 18 , and R , 19 are each independently selected from the substituents provided in the definition of R12 except R17, R18, and R19 are not H; and provided that at least one of R3, R4, and R5 is -(CR13R14)tC≡CR16 wherein t is an integer from 0 to 5 and R13, R14, and R16 are as defined above; or a derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, a racemate is used in the invention. In other embodiments, an enantiomerically pure compound is used. In other embodiments, an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer). [00106] For certain compounds of formula I, the stereochemistry is defined as follows:
Figure imgf000035_0001
[00107] For other compounds of formula I, the stereochemistry is defined as follows:
Figure imgf000035_0002
[00108] In certain classes of compounds of formula I, the dashed line represents one bond of a double bond between C-3 and C -4 of the quinolin-2-one ring.
[00109] In other classes of compounds of formula I, R1 is H or Ci-C6 alkyl. In certain compounds useful in the invention, R1 is H, methyl, ethyl, ώo-propyl, or n-propyl. In certain particular compounds, R1 is methyl.
[00110] In other classes of compounds of formula I, R2 is H, halo, or Ci-C6 alkyl. In certain compounds, R2 is H.
[00111] In yet other classes of compounds of formula I, one of R3, R4, and R5 is -
(CR13R14)tC≡CR16, wherein t is an integer from 0 to 5, inclusive, and R13, R14, and R16 are as defined above; and the other two of R3, R4, and R5 are H. In other compounds, one of R3, R4, and R5 is -C≡CH. In yet other compounds, one of R3, R4, and R5 is -C≡CH; and the other two of R3, R4, and R5 are H.
[00112] In other classes of the compounds of formula I, R6 is H.
[00113] In other classes of the compounds of formula I, R7 is H.
[00114] In yet other classes of the compounds of formula I, R8 is H, -OR12, or -NR12R13, wherein R12 and R13 are as defined above. R8 is hydroxy or amino. In other compounds, R8 is hydroxy. In yet other componds, R8 is amino.
[00115] In certain classes of the compounds of formula I, R9 is an imidazolyl moiety, optionally substituted with one or two R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is Ci-C6 alkyl, preferably methyl. In certain compounds, R9 is
Figure imgf000036_0001
wherein R is as defined above and t is an integer between 0 and 2, inclusive. R
In other compounds, R9 is
Figure imgf000037_0001
, wherein R0 is as defined above. In other compounds,
Figure imgf000037_0002
[00116] In certain classes of the compounds of formula I, R10 is H, C1-C10 alkyl, halo, cyano, nitro, or amino. In certain compounds, R , 10 is halo, preferably chloro or fluoro. In certain particular compounds, R10 is chloro. In certain compounds, at least one of R10 and R11 is H.
[00117] In certain classes of the compounds of formula I, R 11 is H, C1-C10 alkyl, halo, cyano, nitro, or amino. In certain compounds, R , 11 is halo, preferably chloro or fluoro. In certain particular compounds, R11 is chloro.
[00118] Certain compounds of formula I include those wherein R1 is H, Ci-C6 alkyl, or cyclopropylmethyl; R2 is H; R3 is -C≡CR16; and R8 is -NR12R13, -OR12, or a heterocyclic group selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl, wherein said heterocyclic group is optionally substituted by an R6 group. Other compounds of formula I include those wherein R9 is imidazolyl optionally substituted by Ci-C6 alkyl; R8 is hydroxy, amino, or triazolyl; and R4,
R5, R10 and R11 are each independently selected from H and halo.
[00119] Other compounds of formula I include those wherein R1 is -(CR13R14),(C3-Ci0 cycloalkyl), wherein t is an integer from 0 to 3; R2 is H; R3 is -C≡CR16; and R8 is -NR12R13, -
OR12, or a heterocyclic group selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl, wherein said heterocyclic group is optionally substituted by an R6 group. Yet other compounds of formula I include those wherein R9 is imidazolyl, optionally substituted by Ci-C6 alkyl; R8 is hydroxy, amino, or triazolyl; R4, R5, R10 and R11 are each independently selected from H and halo; and R1 is cyclopropylmethyl.
[00120] Other compounds of formula I include those wherein R3 is ethynyl and the other substituents are as defined above. Other compounds of formula I include those wherein R is -
C≡CR16. For certain compounds, R16 is H. For other compounds, R16 is -SiR17R18R19. For other compounds, R16 is Ci-C6 alkyl.
[00121] Compounds useful in the present invention include compounds of the formula (II):
Figure imgf000038_0001
wherein R1, R5, R6, R8, and R11 are defined as above.
[00122] Compounds useful in the present invention also include compounds of the formula
(III):
Figure imgf000038_0002
wherein R1, R5, R6, R8, and R11 are defined as above.
[00123] Compounds useful in the present invention include compounds of the formula (IV):
Figure imgf000038_0003
wherein R1, R5, R6, R8, and R11 are defined as above.
[00124] Compounds useful in the present invention include compounds of the formula (V):
Figure imgf000039_0001
wherein R1, R5, R6, R8, and R11 are defined as above.
[00125] In other classes of compounds of formula H-V, R1 is H or Ci-C6 alkyl. In certain compounds useful in the invention, R1 is H, methyl, ethyl, ώo-propyl, or n-propyl. In certain particular compounds, R1 is methyl.
[00126] In yet other classes of compounds of formula H-V, R5 is -(CR13R14),C≡CR16, wherein t is an integer from 0 to 5, inclusive, and R13, R14, and R16 are as defined above; and the other two R3 and R4 are H. In yet other compounds, R5 is -C≡CR16. For certain compounds, R5 is C2- C6 alkynyl. In other compounds, R5 is -C≡CH.
[00127] In other classes of the compounds of formula H-V, R6 is H. In other classes of the compounds of formula H-V, R6 is Ci-C6 alkyl. In certain compounds, R6 is methyl. [00128] In yet other classes of the compounds of formula H-V, R8 is H, -OR12, or -NR12R13, wherein R12 and R13 are as defined above. R8 is hydroxy or amino. In other compounds, R8 is hydroxy. In yet other componds, R8 is amino.
[00129] In certain classes of the compounds of formula H-V, R11 is H, C1-C10 alkyl, halo, cyano, nitro, or amino. In certain compounds, R11 is halo, preferably chloro or fluoro. In certain particular compounds, R11 is chloro.
[00130] Compounds useful in the present invention include compounds of the formula (VI):
Figure imgf000039_0002
wherein R1, R5, R6, and R11 are defined as above.
[00131] In other classes of compounds of formula VI, R1 is H or Ci-C6 alkyl. In certain compounds useful in the invention, R1 is H, methyl, ethyl, ώo-propyl, or n-propyl. In certain particular compounds, R1 is methyl.
[00132] In yet other classes of compounds of formula VI, R5 is -(CR13R14),C≡CR16, wherein t is an integer from 0 to 5, inclusive, and R13, R14, and R16 are as defined above; and the other two of R3, R4, and R5 are H. For certain compounds, R5 is C2-C6 alkynyl. In other compounds, R5 is
-C≡CH.
[00133] In certain classes of the compounds of formula VI, R11 is H, Ci-Cio alkyl, halo, cyano, nitro, or amino. In certain compounds, R11 is halo, preferably chloro or fluoro. In certain particular compounds, R11 is chloro.
[00134] Exemplary compounds useful in the present invention include the following:
6-[(4-Chloro-phenyl)-hydroxy-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-ethynyl- phenyl)-l -methyl- 1 H-quinolin-2-one (R enantiomer);
6-[(4-Chloro-phenyl)-hydroxy-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-ethynyl- phenyl)-l -methyl- 1 H-quinolin-2-one (S enantiomer);
6-[Amino-(4-chloro-phenyl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-ethynyl-phenyl)- 1 -methyl- 1 H-quinolin-2-one (R enantiomer);
6-[Amino-(4-chloro-phenyl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-ethynyl-phenyl)- 1 -methyl- 1 H-quinolin-2-one (S enantiomer);
6-[(4-Chloro-phenyl)-hydroxy-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-ethynyl-4- fluoro-phenyl)- 1 -methyl- 1 H-quinolin-2-one;
6-[(4-chloro-phenyl)-hydroxy-(3-methyl-3H-imidazol-4-yl)-methyl]-4-[3-(3-hydroxy-3- methyl-but-l-ynyl)-phenyl]-l -methyl- lH-quinolon-2-one (S enantiomer); and
6-[(4-chloro-phenyl)-hydroxy-(3-methyl-3H-imidazol-4-yl)-methyl]-4-[3-(3-hydroxy-3- methyl-but- 1 -ynyl)-phenyl] - 1 -methyl- 1 H-quinolon-2-one (R enantiomer) . [00135] In another embodiment, the inventive combination comprises a farnesyl transferase inhibitor of the formula (VII):
Figure imgf000041_0001
6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-chloro-phenyl)-l- cyclopropylmethyl- 1 H-quinoline-2-one (VII) or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, the tartrate salt of the compound is administered. In certain particular embodiments, the compound of formula VII useful in accordance with the present invention is (+)-6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]- 4-(3-chloro-phenyl)-l -cyclopropylmethyl- lH-quinoline-2-one(LNK-427). In certain particular embodiments, the compound of formula VII useful in the invention is (-)-6-[amino-(6-chloro- pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-chloro-phenyl)-l-cyclopropylmethyl- 1 H-quinoline-2-one.
[00136] In another embodiment, the inventive combination comprises a farnesyl transferase inhibitor of the formula: (VIII):
Figure imgf000041_0002
wherein the dashed line indicates an optional second bond connecting C-3 and C-4 of the quinolin-2-one ring;
R1 selected from H, Ci-Ci0 alkyl, -(CR13R14^C(O)R12, -(CR13R14^C(O)OR15, — (CR13R14 ^C(O)R12, -(CR13R14^SO2R15, — (CR13R14>(C3-Ci0 cycloalkyl), — (CR13R14),(C6— Cio aryl), and — (CR13R14)^(4 — 10 membered heterocyclic), wherein said cycloalkyl, aryl and heterocyclic R1 groups are optionally fused to a C6-CiO aryl group, a Cs-Cg saturated cyclic group, or a 4 — 10 membered heterocyclic group; and the foregoing R1 groups, except H but including any optional fused rings referred to above, are optionally substituted by 1 to 4 R6 groups;
R2 is halo, cyano, — C(O)OR15, or a group selected from the substituents provided in the definition of R12; each R3, R4, R5, R6, and R7 is independently selected from H, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0 alkynyl, halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — OR12, — C(O)R12, -C(O)OR12, -NR13C(O)OR15, -OC(O)R12, -NR13SO2R15, -SO2NR12R13, — NR13C(O)R12, -C(O)NR12R13, -NR12R13, -CH=NOR12, -S(O)7R12 wherein j is an integer from O to 2, — (CR13R14),(C6-Ci0 aryl), — (CR13R14),(4-10 membered heterocyclic), — (CR13R14XC3-Ci0 cycloalkyl), and — (CR13R14>C≡CR16; and wherein the cycloalkyl, aryl, and heterocyclic moieties of the foregoing groups are optionally fused to a C6-Ci0 aryl group, a C5-C8 saturated cyclic group, or a 4-10 membered heterocyclic group; and said alkyl, alkenyl, cycloalkyl, aryl and heterocyclic groups are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — NR13SO2R15, -SO2NR12R13, -C(O)R12, -C(O)OR12, -OC(O) R12, -NR13C(O)OR15, — NR13C(O)R12, -C(O)NR12R13, -NR12R13, —OR12, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0 alkynyl, — (CR13R14),(C6-d0 aryl), and — (CR13R14),(4-10 membered heterocyclic);
Z is an aromatic 4 — 10 membered heterocyclic group, substituted by 1 to 4 R6 substituents;
R8 is H, —OR12, -OC(O)R12, -NR12R13, -N=CR12R13, -NR12C(O)R13, cyano, — C(O)OR13, -SR12, or -(CR13R14),(4— 10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups;
R9 is — (CR13R14),(imidazolyl) or — (CR13R14),(pyridinyl) wherein said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R6 substituents; each R12 is independently selected from H, Ci-Ci0 alkyl,— (CR13R14),(C3 Ci0 cycloalkyl), -(CR13R14X(C6 Cio aryl), and — (CR13R14),(4-10 membered heterocyclic); said cycloalkyl, aryl and heterocyclic R12 groups are optionally fused to a C6-CiO aryl group, a C5-Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — C(O)R13, — C(O)OR13 -OC(O)R13, -NR13C(O)R14, -C(O)NR13R14, -NR13R14, hydroxy, Ci-C6 alkyl, and CiC6 alkoxy; each t is independently an integer from 0 to 5 and each q is independently an integer from I to 5; each R13 and R14 is independently H or Ci-C6 alkyl, and where R13 and R14 are as — (CR13R14 )q or -(CR13R14),. each is independently defined for each iteration of q or t in excess of i;
R15 is selected from the substituents provided in the definition of R12 except R15 is not H;
R16 is selected from the list of substituents provided in the definition of R12 and — SiR17R18R19; and
R17, R18 and R19 are each independently selected from the substituents provided in the definition of R12 except at least one of R17, R18 and R19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, a racemate is used in the invention. In other embodiments, an enantiomerically pure compound is used. In other embodiments, an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer). [00137] For certain compounds of formula VIII, the stereochemistry is defined as follows:
Figure imgf000043_0001
[00138] For other compounds of formula VIII, the stereochemistry is defined as follows:
Figure imgf000044_0001
[00139] In certain embodiments, compounds of formula VIII are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R6 substituents. In certain particular embodiments, compounds of formula VIII are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R6 substituents. In certain embodiments, Z is a pyridine group substituted with 1 to 4 R6 substituents. In certain particular embodiments, Z is a
pyridine group substituted with one R6 substituent. In certain embodiments, Z is
Figure imgf000044_0002
. In certain particular embodiments, Z is a pyridine group substituted with one R6 substituent, wherein the R6 substituent is halo (e.g., chloro). In certain particular embodiments, Z is
Figure imgf000044_0003
. In other embodiments, compounds of formula VIII are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R6 substituents. Preferably, Z comprises from 1 to 3 heteroatoms selected from 0, S and N. [00140] In certain embodiments, compounds of formula VIII are those wherein R1 is H, C1- Ce alkyl, or cyclopropylmethyl. In certain embodiments, R1 is cyclopropylmethyl.
[00141] In certain embodiments, compounds of formula VIII are those wherein R is - NR12R13, —OR12, or — (CR13R14),(4-10 membered heterocyclic) substituted with from 1 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl. In certain embodiments, said heterocyclic is substituted with one R6 group. In certain embodiments, R8 is hydroxy, amino, or triazolyl. In certain embodiments, R8 is hydroxy. In certain other embodiments, R8 is amino.
[00142] In certain embodiments, compounds of formula VIII are those wherein R8 is H, —
OR12, -OC(O)R12, -NR12R13, -NR12C(O)R13, cyano, -C(O)OR13, -SR12, or — (CR13R14),(4-
10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups.
[00143] In certain embodiments, compounds of formula VIII are those wherein R3, R4, R5, and R6 are independently selected from H, halo, and Ci-C6 alkoxy. In certain embodiments, one of R3, R4, and R5 is halo (e.g., chloro), and the others are hydrogen.
[00144] In certain embodiments, compounds of formula VIII are those wherein R6 and R7 are both hydrogen.
[00145] In certain embodiments, compound of formula VIII are those wherein R9 is an imidazolyl moiety, optionally substituted with one or two R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is Ci-C6 alkyl, preferably methyl. In certain compounds, R9
is
Figure imgf000045_0001
wherein R is as defined above and t is an integer between 0 and 2, inclusive.
In other compounds, R9 is
Figure imgf000045_0002
, wherein R6 is as defined above. In other compounds,
Figure imgf000045_0003
[00146] Compounds useful in the present invention include compounds of the formula:
Figure imgf000046_0001
wherein R1, R2, R3, R4, R5, R6, R7, and R8 are defined as above.
[00147] Compounds useful in the present invention include compounds of the formula:
Figure imgf000046_0002
wherein R2, R3, R4, R5, R6, R7, and R8 are defined as above.
[00148] Compounds useful in the present invention include compounds of the formula:
Figure imgf000046_0003
wherein R1, R2, R5, R6, R7, and R8 are defined as above.
[00149] Compounds useful in the present invention include compounds of the formula:
Figure imgf000047_0001
wherein R1, R5, R6, and R8 are defined as above.
[00150] Compounds useful in the present invention include compounds of the formula:
Figure imgf000047_0002
wherein R1, R5, R6, and R8 are defined as above.
[00151] Exemplary compounds useful in the present invention include:
6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-chloro- phenyl)-l-methyl-lH-quinolin-2-one (R enantiomer);
6-[amino -(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-chloro- phenyl)-l-methyl-lH-quinolin-2-one (S enantiomer);
4-(3-chloro-phenyl)-6-[(6-chloro-pyridin-3-yl)-hydroxy-(3-methyl-3H-imidazol-4-yl)- methyl]- 1 -cyclopropylmethyl- 1 H-quinolin-2-one;
6-[amino -(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol-4-yl)-methyl]-4-(3-chloro- phenyl)- 1 -cyclopropylmethyl- 1 H-quinolin-2-one;
4-(3-chloro-phenyl )-6-[(5-chloro-pyridin-2-yl)-bydroxy-(3-methyl-3H-imidazol-4-yl)- methyl]- 1 -methyl-lH-quinolin-2-one;
6-[amino-(5 -chloro-pyridin-2-yl)-(3-methyl-3H-imid azol- 4-yl)-methyl]-4-(3-chloro- phenyl)- 1 -methyl-lH- quinolin-2-one; 6-[amino-(5-chloro-pyridin-2-yl)-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3-chloro- phenyl)- 1 -cyclopropyhnethyl- 1 H-quinolin-2-one;
6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3,5-dichloro- phenyl)-l -methyl-lH- quinolin-2-one;
6-[amino-(5-chloro-thiophen-2-yl)-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3-chloro- phenyl)-l -methyl-lH- quinolin-2-one;
6-[(5-chloro-thiophen-2-yl)-hydroxy-(3-methyl-3H- imidazol-4-yl)-methyl]-4-(3-ethoxy- phenyl)- 1 -methyl- 1 H-quinolin-2-one; amino-(5-chloro-thiophen-2-yl)-(3-methyl-3H-imidazol-4- yl)-meth yl]-4-(3-ethoxy- phenyl)-l-meth yl-lH-quinolin- 2-one;
6-[(6-chloro-pyridin-3-yl)-hydroxy-(3-methyl-3H- imidazol-4-yl)-methyl]-4-(3-ethoxy- phenyl)- 1 -methyl- 1 H-quinolin-2-one;
6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3-ethoxy- henyl)- 1 -methyl-lH-quinolin- 2-one;
6[benzo[b]thiophen-2-yl-hydroxy-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3-chloro- phenyl)- 1 -methyl-lH- quinolin-2-one;
6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3-chloro- phenyl)-l H-quinolin-2-one;
(-)-6-[amino-(6-chloro-pyridin-3-yl)-(3-methyl-3H- imidazol-4-yl)-methyl]-4-(3-chloro- phenyl)- 1 - cyclopropylmethyl- 1 H-quinolin-2-one;
6-[amino-(6-me thyl-pyridin-3-yl)-(3-methyl-3H-imidazol- 4-yl)-methyl]-4-(3-chloro- phenyl)-l -methyl-lH- quinolin-2-one;
6-[ amin o-(p yridin-3-yl)-(3-methyl-3 H-imid a zol-4-yl)- methyl]-4-(3-chloro-phenyl)- 1 -cyclopropylmethyl- 1 H-quinolin-2-one;
(+)-4-(3-chloro-phenyl)-6-[(6-chloro-pyridin-3-yl)- hydroxy-(3-methyl-3H-imidazol-4- yl)-methyl]-l- cyclopropylmethyl- 1 H-quinolin-2-one; and pharmaceutically acceptable derivatives, analogs, stereoisomers, isomers, solvates, salts, or other forms of the foregoing compounds.
[00152] In another embodiment, the inventive combination comprises a farnesyl transferase inhibitor of the formula (IX):
Figure imgf000049_0001
wherein the dashed line indicates an optional second bond connecting C-3 and C-4 of the quinoline ring;
R2 is halo, cyano, — C(O)OR15, or a group selected from the substituents provided in the definition of R12; each R3, R4, R5, R6, and R7 is independently selected from H, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0alkynyl, halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — OR12, — C(O)R12, -C(O)OR12, -NR13C(O)OR15 -OC(O)R12, -NR13SO2R15 -SO2NR12R13, — NR13C(O)R12, -C(O)NR12R13, — NR12R13- CH=NOR12 -S(O) R12 wherein j is an integer from O to 2, - (CR13R14),(C6-d0 aryl), - (CR13R14),(4-10 membered heterocyclic), -(CR13R14), -(C3-Ci0 cycloalkyl), and - (CR13R14)£≡CR16; and wherein the cycloalkyl, aryl, and heterocyclic moieties of the foregoing groups are optionally fused to a C6 — Ci0 aryl group, a C5- Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and said alkyl, alkenyl, cycloalkyl, aryl and heterocyclic groups are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — NR13SO2R15, -SO2NR12R13, -C(O)R12, -C(O)OR12, -OC(O)R12, -NR13C(O)OR15, — NR13C(O)R12, -C(O)NR12R13, -NR12R13, —OR12, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0 alkynyl, -(CR13R14XC6-Ci0 aryl), and -(CR13R14),(4-10 membered heterocyclic);
Z is an aromatic 4-10 membered heterocyclic group, substituted by 1 to 4 R6 substituents;
R8 is H, -OR12, -OC(O)R12, -NR12R13, -NR12C(O)R13, cyano, -C(O)OR13, -SR12, or - (CR13R14)^(4-10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups;
R9 is-(CR13R14),(imidazolyl) or -(CR13R14),(pyridinyl), wherein said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R6 substituents; each R12 is independently selected from H, Ci-Ci0 alkyl, -(CR13R14),(C3-Ci0 cycloalkyl), -(CR13R14)XC6-Cio aryl), and -(CR13R14),(4-10 membered heterocyclic); said cycloalkyl, aryl, and heterocyclic R12 groups are optionally fused to a C6-CiO aryl group, a Cs-Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, -C(O)R13, - C(O)OR13, -OC(O)R13, -NR13C(O)R14, -C(O)NR13R14, -NR13R14, hydroxy, Ci-C6 alkyl, and Ci- C6 alkoxy; each t is independently an integer from O to 5; each R13 and R14 is independently H or Ci-C6 alkyl, and where R13 and R14 are as -
(CR . 13r R> 14λ )t each is independently defined for each iteration oft in excess of 1 ;
R15 is selected from the substituents provided in the definition of R12 except R15 is not H;
R . 16 is selected from the list of substituents provided in the definition of R 12 and - o SiτR> 17r R> 18r R> 19 ; and J,
R17, R38 and R19 are each independently selected from the substituents provided in the definition of R12 except at least one of R17, R18 and R19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, a racemate is used in the invention. In other embodiments, an enantiomerically pure compound is used. In other embodiments, an enantiomerically enriched mixture is used {e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer). [00153] For certain compounds of formula IX, the stereochemistry is defined as follows:
Figure imgf000050_0001
[00154] For other compounds of formula IX, the stereochemistry is defined as follows:
Figure imgf000051_0001
[00155] In certain embodiments, compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R6 substituents. In certain particular embodiments, compounds of formula IX are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R6 substituents. In certain embodiments, Z is a pyridine group substituted with 1 to 4 R6 substituents. In certain particular embodiments, Z is a
pyridine group substituted with one R6 substituent. In certain embodiments, Z is
Figure imgf000051_0002
ΛΛ; . In certain particular embodiments, Z is a pyridine group substituted with one R6 substituent, wherein the R6 substituent is halo (e.g., chloro). In certain particular embodiments, Z is
Figure imgf000051_0003
. In other embodiments, compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R6 substituents. Preferably, Z comprises from 1 to 3 heteroatoms selected from O, S, and N. [00156] In certain embodiments, compounds of formula IX are those wherein R8 is — NR12R13, —OR12, or — (CR13R14),(4-10 membered heterocyclic) substituted with from 1 to 4 R6 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl. In certain embodiments, said heterocyclic is substituted with one R6 group. In certain embodiments, R8 is hydroxy, amino, or triazolyl. In certain embodiments, R8 is hydroxy. In certain other embodiments, R8 is amino. [00157] In certain embodiments, compounds of formula IX are those wherein R8 is H, —
OR12, -OC(O)R12, -NR12R13, -NR12C(O)R13, cyano, -C(O)OR13, -SR12, or — (CR13R14),(4-
10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups.
[00158] In certain embodiments, compounds of formula IX are those wherein R3, R4, R5, and
R6 are independently selected from H, halo, and Ci-C6 alkoxy. In certain embodiments, one of
R3, R4, and R5 is halo (e.g., chloro), and the others are hydrogen.
[00159] In certain embodiments, compounds of formula IX are those wherein R6 and R7 are both hydrogen.
[00160] In certain embodiments, compound of formula IX are those wherein R9 is an imidazolyl moiety, optionally substituted with one or two R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is Ci-C6 alkyl, preferably methyl. In certain compounds, R9
IS
Figure imgf000052_0001
, wherein R6 is as defined above and t is an integer between 0 and 2, inclusive.
In other compounds, R9 is
Figure imgf000052_0002
<~ , wherein R6 is as defined above. In other compounds,
Figure imgf000052_0003
[00161] Compounds useful in the present invention include compounds of the formula:
Figure imgf000052_0004
wherein R > 2 , r R> 3 , T R-) 4 , τ R-> 5 , τ R-> 6 , τ R-> 7 , and R are defined as above. [00162] Compounds useful in the present invention include compounds of the formula:
Figure imgf000053_0001
wherein R2, R3, R4, R5, R6, R7, and R8 are defined as above.
[00163] Compounds useful in the present invention include compounds of the formula:
Figure imgf000053_0002
wherein R2, R5, R6, R7, and R8 are defined as above.
[00164] Compounds useful in the present invention include compounds of the formula:
Figure imgf000053_0003
wherein R > 53, r R> 60, and Rδ are defined as above.
[00165] Compounds useful in the present invention include compounds of the formula: wherein R5, R6, and R8 are defined as above.
[00166] In another embodiment, the inventive combination comprises a farnesyl transferase inhibitor of the formula (X):
Figure imgf000054_0002
wherein the dashed line indicates an optional second bond connecting C-3 and C-4 of the quinoline ring;
R2 is halo, cyano, — C(O)OR15, or a group selected from the substituents provided in the definition of R12; each R3, R4, R5, R6, and R7 is independently selected from H, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0 alkynyl, halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — OR12, — C(O)R12, -C(O)OR12, -NR13C(O)OR15, -OC(O)R12, -NR13SO2R15, -SO2NR12R13, — NR13C(O)R12, -C(O)NR12R13, -NR12R13, -CH=NOR12, -S(O)7R12 wherein j is an integer from O to 2, (CR13 R14XC6-Ci0 aryl), -(CR13R14>(4-10 membered heterocyclic),
(CR13R14XC3-Ci0 cycloalkyl), and — (CR13R14)£≡CR16; and wherein the cycloalkyl, aryl and heterocyclic moieties of the foregoing groups are optionally fused to a C6-CiO aryl group, a Ci-Cg saturated cyclic group, or a 4-10 membered heterocyclic group; and said alkyl, alkenyl, cycloalkyl, aryl and heterocyclic groups are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — NR13SO2R15, -SO2NR12R13, -C(O)R12, -C(O)OR12, -OC(O)R12, -NR13C(O)OR15, — NR13C(O)R12, -C(O)NR12R13, -NR12R13, —OR12, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0 alkynyl, — (CR13R14),(C6-Ci0 aryl), and — (CR13R14),(4-10 membered heterocyclic);
Z is an aromatic 4-10 membered heterocyclic group, substituted by 1 to 4 R6 substituents;
R8 is H, —OR12, -OC(O)R12, — NR12R13,- NR12C(O)R13, cyano, -C(O)OR13, -SR12, or — (CR13R14)X4-10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups;
R9 is — (CR13R14>(imidazolyl) or — (CR13R14>(pyridinyl) wherein said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R6 substituents; each R12 is independently selected from H, Ci-Ci0 alkyl, — (CR13R14)XC3-Ciθ cycloalkyl), — (CR13R14XC6- Ci0 aryl), and — (CR13R14>(4-10 membered heterocyclic); said cycloalkyl, aryl, and heterocyclic R12 groups are optionally fused to a C6-Ci0 aryl group, a Cs-Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — C(O)R13, -C(O)OR13, -OC(O)R13, -NR13C(O)R14, -C(O)NR13R14, -NR13R14, hydroxy, Ci-C6 alkyl, and Ci-C6 alkoxy; each t is independently an integer from O to 5; each R13 and R14 is independently H or Ci-C6 alkyl, and where R13 and R14 are as — (CR13R14),. each is independently defined for each iteration oft in excess of 1; R15 is selected from the substituents provided in the definition of R12 except R15 is not H;
R16 is selected from the list of substituents provided in the definition of R12 and — SiR R R ; and,
R17, R18 and R19 are each independently selected from the substituents provided in the definition of R12 except at least one of R17, R18 and R19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, a racemate is used in the invention. In other embodiments, an enantiomerically pure compound is used. In other embodiments, an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer). [00167] For certain compounds of formula X, the stereochemistry is defined as follows:
Figure imgf000056_0001
[00168] For other compounds of formula X, the stereochemistry is defined as follows:
Figure imgf000056_0002
[00169] In certain embodiments, compounds of formula X are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R6 substituents. In certain particular embodiments, compounds of formula X are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R6 substituents. In certain embodiments, Z is a pyridine group substituted with 1 to 4 R6 substituents. In certain particular embodiments, Z is a pyridine group
substituted with one R substituent. In certain embodiments, Z is
Figure imgf000056_0003
*ΛΛ/ . In certain particular embodiments, Z is a pyridine group substituted with one R6 substituent, wherein the R6 substituent is halo (e.g., chloro). In certain particular embodiments, Z is
Figure imgf000057_0001
ΛΛ/ . In other embodiments, compounds of formula X are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R6 substituents.
Preferably, Z comprises from 1 to 3 heteroatoms selected from 0, S and N.
[00170] In certain embodiments, compounds of formula X are those wherein R8 is — NR12R13,
— OR12, or — (CR13R14),(4-10 membered heterocyclic) substituted with from 1 to 4 R6 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl. In certain embodiments, said heterocyclic is substituted with one R6 group. In certain embodiments, R8 is hydroxy, amino, or triazolyl. In certain embodiments, R8 is hydroxy.
In certain other embodiments, R8 is amino.
[00171] In certain embodiments, compounds of formula X are those wherein R8 is H, — OR12,
-OC(O)R12, -NR12R13, -NR12C(O)R13, cyano, -C(O)OR13, -SR12, or — (CR13R14>(4-10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups.
[00172] In certain embodiments, compounds of formula X are those wherein R3, R4, R5, and
R6 are independently selected from H, halo, and Ci-C6 alkoxy. In certain embodiments, one of
R3, R4, and R5 is halo (e.g., chloro), and the others are hydrogen.
[00173] In certain embodiments, compounds of formula X are those wherein R6 and R7 are both hydrogen.
[00174] In certain embodiments, compound of formula X are those wherein R9 is an imidazolyl moiety, optionally substituted with one or two R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is Ci-C6 alkyl, preferably methyl. In certain compounds, R9
is
Figure imgf000057_0002
, wherein R6 is as defined above and t is an integer between 0 and 2, inclusive.
Figure imgf000058_0001
In other compounds, R9 is ^- , wherein R6 is as defined above. In other compounds,
Figure imgf000058_0002
[00175] Compounds useful in the present invention include compounds of the formula:
Figure imgf000058_0003
wherein R > 2 , r R> 3 , τ R-> 4 , τ R-> 5 , T R-) 6 , τ R-> 7 , and R are defined as above. [00176] Compounds useful in the present invention include compounds of the formula:
Figure imgf000058_0004
wherein R2, R3, R4, R5, R6, R7, and R8 are defined as above.
[00177] Compounds useful in the present invention include compounds of the formula:
Figure imgf000059_0001
wherein R2, R5, R6, R7, and R8 are defined as above.
[00178] Compounds useful in the present invention include compounds of the formula:
Figure imgf000059_0002
wherein R > 5 , r R> 6 , and R are defined as above. [00179] Compounds useful in the present invention include compounds of the formula:
Figure imgf000059_0003
wherein R > 5 , r R> 6 , and R are defined as above.
[00180] In another embodiment, the inventive combination comprises a farnesyl transferase inhibitor of the formula (XI):
Figure imgf000060_0001
wherein the dashed line indicates an optional second bond connecting C-3 and C-4 of the quinoline ring;
R is Ci-C6 alkyl;
R2 is halo, cyano, — C(O)OR15, or a group selected from the substituents provided in the definition of R 12 each R3, R4, R5, R6, and R7 is independently selected from H, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-Ci0alkynyl, halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, — OR12, — C(O)R12, -C(O)OR12, -NR13C(O)OR15, -OC(O)R12, -NR13SO2R15, -SO2NR12R13, — NR13C(O)R12, -C(O)NR12R13, -NR12R13, — CH==N0R12, -S(O)7R12 wherein j is an integer from O to 2, — (CR13R14XC6-Ci0 aiyl), — (CR13R14),(4-10 membered heterocyclic), — (CR13R14XC3-Ci0 cycloalkyl), and— (CR13R14)£≡CR16; and wherein the cycloalkyl, aryl, and heterocyclic moieties of the foregoing groups are optionally fused to a C6-Ci0 aryl group, a C5- Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and said alkyl, alkenyl, cycloalkyl, aryl, and heterocyclic groups are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethox azido, — NR13SO2R15, -SO2NR12R13, -C(O)R12, -C(O)OR12, -OC(O)R12, -NR13C(O)OR15, —
NR » 113J/C(0)R , 1l2z, — C(0)NR » 1l2zrR> 113J, -NR12R13, —OR12, Ci-Ci0 alkyl, C2-Ci0 alkenyl, C2-C -4i0 alkynyl, — (CR13R14XC6-Ci0 aryl), and — (C13R14),(4-10 membered heterocyclic);
Z is an aromatic 4-10 membered heterocyclic group, substituted by 1 to 4 R6 substituents;
R8 is H, —OR12, -OC(O)R12, -NR12R13, -R12C(O) R13, cyano, -(O)OR13, — R12, or — (CR12R14χ4-10 membered heterocyclic), wherein said heterocyclic R8 groups are subsituted by 1 to 4 R6 groups;
Figure imgf000061_0001
said imidazolyl or pyridinyl moiety is substituted by 1 or 2 R6 substituents; each R12 is independently selected from H, Cl-C10 alkyl, — (CR13R14),(C3-Ci0 cycloalkyl), — (CR13R14),(C6-Cio aryl), and — (CR13R14>(4-10 membered heterocyclic); said cycloalkyl, aryl, and heterocyclic R12 groups are optionally fused to a C6-CiO aryl group, a C5-Cs saturated cyclic group, or a 4-10 membered heterocyclic group; and the foregoing R12 substituents, except H but including any optional fused rings, are optionally substituted by 1 to 3 substituents independently selected from halo, cyano, nitro, trifluoromethyl, trifluoromethoxy, azido, -C(O)R13, -C(O)OR13, -OC(O)R13, -NR13C(O)R14, -C(O)NR13R14, -NR13R14, hydroxy, Ci-C6 alkyl, and Ci-C6 alkoxy; each t is independently an integer from O to 5; each R13 and R14 is independently H or Ci-C6 alkyl, and where R13 and R14 are as — (CR13R14),. each is independently defined for each iteration oft in excess of 1;
R15 is selected from the substituents provided in the definition of R12 except R15 is not H;
R16 is selected from the list of substituents provided in the definition of R12 and — SiR17R18R19; and,
R17, R18 and R19 are each independently selected from the substituents provided in the definition of R12 except at least one of R17, R18 and R19 is not H; or a pharmaceutically acceptable derviative, analog, stereoisomer, isomer, solvate, salt, or other form thereof. In certain embodiments, a racemate is used in the invention. In other embodiments, an enantiomerically pure compound is used. In other embodiments, an enantiomerically enriched mixture is used (e.g., 70%, 75%, 80%, 90%, 95%, 98%, 99% of one enantiomer).
[00181] For certain compounds of formula XI, the stereochemistry is defined as follows:
Figure imgf000061_0002
[00182] For other compounds of formula XI, the stereochemistry is defined as follows:
Figure imgf000062_0001
[00183] In certain embodiments, compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group substituted with from 1 to 4 R6 substituents. In certain particular embodiments, compounds of formula IX are those wherein Z is a pyridine or thiophene group substituted with from 1 to 4 R6 substituents. In certain embodiments, Z is a pyridine group substituted with 1 to 4 R6 substituents. In certain particular embodiments, Z is a
pyridine group substituted with one R6 substituent. In certain embodiments, Z is
Figure imgf000062_0002
*ΛΛ/ . In certain particular embodiments, Z is a pyridine group substituted with one R6 substituent, wherein the R6 substituent is halo (e.g., chloro). In certain particular embodiments, Z is
Figure imgf000062_0003
. In other embodiments, compounds of formula IX are those wherein Z is a 5 or 6 membered aromatic heterocyclic group fused to a benzene group, substituted with from 1 to 4 R6 substituents. Preferably, Z comprises from 1 to 3 heteroatoms selected from 0, S and N. [00184] In certain embodiments, compounds of formula IX are those wherein R8 is — NR12R13, —OR12, or — (CR13R14),(4-10 membered heterocyclic) substituted with from 1 to 4 R6 groups, wherein said 4-10 membered heterocyclic is selected from triazolyl, imidazolyl, pyrazolyl, and piperidinyl. In certain embodiments, said heterocyclic is substituted with one R6 group. In certain embodiments, R8 is hydroxy, amino, or triazolyl. In certain embodiments, R8 is hydroxy. In certain other embodiments, R8 is amino.
[00185] In certain embodiments, compounds of formula IX are those wherein R8 is H, —
OR12, -OC(O)R12, -NR12R13, -NR12C(O)R13, cyano, -C(O)OR13, -SR12, or — (CR13R14),(4-
10 membered heterocyclic), wherein said heterocyclic R8 groups are substituted by 1 to 4 R6 groups.
[00186] In certain embodiments, compounds of formula IX are those wherein R3, R4, R5, and
R6 are independently selected from H, halo, and Ci-C6 alkoxy. In certain embodiments, one of
R3, R4, and R5 is halo (e.g., chloro), and the others are hydrogen.
[00187] In certain embodiments, compounds of formula IX are those wherein R6 and R7 are both hydrogen.
[00188] In certain embodiments, compound of formula IX are those wherein R9 is an imidazolyl moiety, optionally substituted with one or two R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is defined as above. In certain compounds, R9 is an imidazolyl moiety substituted with one R6 substituents, wherein R6 is Ci-C6 alkyl, preferably methyl. In certain compounds, R9
is
Figure imgf000063_0001
wherein R is as defined above and t is an integer between 0 and 2, inclusive.
In other compounds, R9 is
Figure imgf000063_0002
, wherein R6 is as defined above. In other compounds,
Figure imgf000063_0003
[00189] Compounds useful in the present invention include compounds of the formula:
Figure imgf000064_0001
wherein R2, R3, R4, R5, R6, R7, and R8 are defined as above.
[00190] Compounds useful in the present invention include compounds of the formula:
Figure imgf000064_0002
wherein R2, R3, R4, R5, R6, R7, and R8 are defined as above.
[00191] Compounds useful in the present invention include compounds of the formula:
Figure imgf000064_0003
wherein R2, R5, R6, R7, and R8 are defined as above.
[00192] Compounds useful in the present invention include compounds of the formula:
Figure imgf000064_0004
wherein R5, R6, and R8 are defined as above.
[00193] Compounds useful in the present invention include compounds of the formula:
Figure imgf000065_0001
wherein R > 5 , r R> 6 , and R are defined as above.
[00194] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000065_0002
This compound is also known by the name Zarnestra or Rl 15777.
[00195] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000066_0001
or a stereoisomeric form, or a pharmaceutically acceptable acid or base addition salt form thereof, wherein: one of a, b, c and d represents N or N+O , and the remaining a, b, c, and d groups represent carbon, wherein each carbon has an R1 or R2 group bound to said carbon; or each of a, b, c, and d is carbon, wherein each carbon has an R1 or R2 group bound to said carbon; the dotted line ( — ) represents optional bonds;
X represents N or CH when the optional bond to Cl 1 is absent, and represents C when the optional bond to Cl 1 is present; when the optional bond is present between carbon atom 5 and carbon atom 6 then there is only one A substituent bound to C-5 and there is only one B substituent bound to C-6 and A or B is other than H; when the optional bond is not present between carbon atom 5 and carbon atom 6 then there are two A substituents bound to C-5, wherein each A substituent is independently selected, and two B substituents bound to C-6, wherein each B substituent is independently selected, and wherein at least one of the two A substituents or one of the two B substituents are H, and wherein at least one of the two A substituents or one of the two B substituents is other than H;
A and B are independently selected from the group consisting of: (1) H; (2) — R ; (3) — R9— C(O)-R9; (4) — R9— CO2- R9a; (5) — (CH2)PR26; (6) — C(O)N(R9)2, wherein each R9 is the same or different; (7) -C(O)NHR9; (8) -C(O)NH-CH2-C(O)-NH2; (9) -C(O)NHR26; (10) — (CH2)PC(R9)— O— R9a; (11) — (CH2)P(R9)2, wherein each R9 is the same or different; (12) — (CH2)PC(O)R9; (13) — (CH2)PC(O)R27,; (14) — (CH2)PC(O)N(R9)2, wherein each R9 is the same or different; (15) — (CH2)PC(O)NH(R9); (16) — (CH2)PC(O)N(R26)2, wherein each R26 is the same or different; (17) — (CH2)PN(R9)— R9a; (18) — (CH2)PN(R26)2, wherein R26 is the same or different; (19) — (CH2)PNHC(O)R5; (20) — (CH2)PNHC(O)2R50; (21) — (CH2)pN(C(O)R27a)2 wherein each R27ais the same or different; (22) — (CH2)PNR51C(O)R27; (23) — (CH2)PNR51C(O)R27 wherein R51 is not H, and R51 and R27 taken together with the atoms to which they are bound form a 5 or 6 membered heterocycloalkyl ring consisting; (24) — (CH2)PNR51C(O)NR27; (25) — (CH2)PNR51C(O)NR27 wherein R51 is not H, and R51 and R27 taken together with the atoms to which they are bound form a 5 or 6 membered heterocycloalkyl ring; (26) — (CH2)pNR51C(O)N(R27a)2, wherein each R27ais the same or different; (27) — (CH2)PNHSO2N(R51)2, wherein each R51 is the same or different; (28) — (CH2)PNHCO2R50; (29) — (CH2)PNC(O)NHR51; (30) — (CH2)PCO2R51; (31) -NHR9; (32)
Figure imgf000067_0001
R 30 and . r R, 31 are the same or different, and each p is
independently selected; (33)
Figure imgf000067_0002
wherein R 30, R31, R32 and R33 are the same or different; (34)-alkenyl-CO2R9a; (35)- alkenyl-C(O)R9a; (36)-alkenyl-CO2R51; (37)- alkenyl-C(O)— R27a; (38) (CH2)p-alkenyl-CO2— R51; (37) — (CH2)PC=NOR51; and (39) — (CH2)p-phthalimid; p is O, 1, 2, 3 or 4; each R1 and R2 is independently selected from the group consisting of: (1) H; (2) Halo; (3) -CF3, (4) —OR10; (5) —COR10; (6) -SR10; (7) -S(O)1R15 wherein t is 0, 1 or 2; (8) — N(R10)2; (9) -NO2; (10) -OC(O)R10; (11) -CO2R10; (12) -OCO2R15; (13) -CN; (14) — NR10COOR15; (15) -SR15C(O)OR15; (16) — SR15N(R13)2 provided that R15 in — SR15N(R3)2 is not — CH2 and wherein each R is independently selected from the group consisting of: H and — C(O)OR15; (17) benzotriazol-1-yloxy; (18) tetrazol-5-ylthio; (19) substituted tetrazol-5-ylthio; (20) alkynyl; (21) alkenyl; and (22) alkyl, said alkyl or alkenyl group optionally being substituted with halogen, —OR10 or -CO2R10;
R3 and R4 are the same or different and each independently represent H, and any of the substituents of R1 and R2;
R5, R6, R7 and R7aeach independently represent: H, -CF3, —COR10, alkyl or aryl, said alkyl or aryl optionally being substituted with -S(O)1R15, -NR10COOR15, -C(O)R10; or — CO2R10, or R5 is combined with R6 to represent =0 or =S;
R8 is selected from the group consisting of:
Figure imgf000068_0001
CT O (2.0), R1 1 (3.0),
Figure imgf000068_0002
R9 is selected from the group consisting of: (1) unsubstituted heteroaryl; (2) substituted heteroaryl; (3) arylalkoxy; (4) substituted arylalkoxy; (5) heterocycloalkyl; (6) substituted heterocycloalkyl; (7) heterocycloalkylalkyl; (8) substituted heterocycloalkylalkyl; (9) unsubstituted heteroarylalkyl; (10) substituted heteroarylalkyl; (11) unsubstituted heteroarylalkenyl; (12) substituted heteroarylalkenyl; (13) unsubstituted heteroarylalkynyl and (14) substituted heteroarylalkynyl; wherein said substituted R9 groups are substituted with one or more substituents selected from the group consisting of: (1) —OH; (2) -CO2R14; (3) -CH2OR14; (4) halogen; (5) alkyl; (6) amino; (7) trityl; (8) heterocycloalkyl; (9) cycloalkyl; (10) arylalkyl; (11) heteroaryl; (12)
heteroarylalkyl and
Figure imgf000068_0003
wherein R14 is independently selected from the group consisting of: H; alkyl; aryl, arylalkyl, heteroaryl and heteroarylalkyl; R9a is selected from the group consisting of: alky and arylalkyl;
R10 is selected from the group consisting of: H; alkyl; aryl and arylalkyl;
R11 is selected from the group consisting of: (1) alkyl; (2) substituted alkyl; (3) unsubstituted aryl; (4) substituted aryl; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl; (7) unsubstituted heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) fluoro; and (3) alkyl; and wherein said substituted aryl and substituted heteroaryl R11 groups are substituted with one or more substituents independently selected from the group consisting of: (1) — OH; (2) halogen; and (3) alkyl;
Rl lais selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) unsubstituted aryl; (6) substituted aryl; (7) unsubstituted cycloalkyl; (8) substituted cycloalkyl; (9) unsubstituted heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl Rl la groups are substituted with one or more substituents independently selected from the group consisting of: (1) — OH; (2) — CN; (3) — CF3; (4) fluoro; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; and wherein said substituted aryl and substituted heteroaryl R1 la groups have one or more substituents independently selected from the group consisting of: (1) — OH; (2) — CN; (3) -CF3; (4) halogen; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl; and (11) heteroalkenyl;
R12 is selected from the group consisting of: H, alkyl, piperidine Ring V, cycloalkyl, and - alkyl-(piperidine Ring V);
R15 is selected from the group consisting of: alkyl and aryl;
R21, R22 and R46 are independently selected from the group consisting of: (1) — H; (2) alkyl; (3) unsubstituted aryl; (4) substituted aryl substituted with one or more substituents independently selected from the group consisting of: alkyl, halogen, CF3 and OH; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl substituted with one or more substituents independently selected from the group consisting of: alkyl, halogen, CF3 and OH; (7) heteroaryl of the formula,
Figure imgf000070_0001
and (8) heterocycloalkyl of the formula:
Figure imgf000070_0002
R44 is selected from the group consisting of: (a) — H, (b) alkyl; (c) alkylcarbonyl; (d) alkyloxy carbonyl; (e) haloalkyl; and (f) -C(O)NH(R51);
R26 is selected from the group consisting of: (1) H; (2) alkyl; (3) alkoxyl; (4) -CH2- CN; (5) R9; (6) -CH2CO2H; (7) — C(O)alkyl; and (8) CH2C02alkyl;
R27 is selected from the group consisting of: (1) — H; (2) — OH; (3) alkyl; and (4) alkoxy;
R27ais selected from the group consisting of: (1) alkyl; and (2) alkoxy;
R30, R31, R32 and R33 are independently selected from the group consisting of: (1) — H; (2) —OH; (3) =0; (4) alkyl; (5) aryl (e.g. phenyl); (6) arylalkyl (e.g. benzyl); (7) — 0R9a; (8) — NH2; (9) — NHR9a; and (10) — N(R9a)2 wherein each R9ais independently selected;
R50 is selected from the group consisting of: (1) alkyl; (2) unsubstituted heteroaryl; (3) substituted heteroary; and (4) amino; wherein said substituents on said substituted R50 groups are independently selected from the group consisting of: alkyl, halogen, and — OH;
R51 is selected from the group consisting of: H, and alkyl; provided that a ring carbon atom adjacent to a ring heteroatom in a substituted heterocycloalkyl moiety is not substituted with a heteroatom or a halo atom; and provided that a ring carbon atom, that is not adjacent to a ring heteroatom, in a substituted heterocycloalkyl moiety, is not substituted with more than one heteroatom; and provided that a ring carbon atom, that is not adjacent to a ring heteroatom, in a substituted heterocycloalkyl moiety, is not substituted with a heteroatom and a halo atom; and provided that a ring carbon in a substituted cycloalkyl moiety is not substituted with more than one heteroatom; and provided that a carbon atom in a substituted alkyl moiety is not substituted with more than one heteroatom; and provided that the same carbon atom in a substituted alkyl moiety is not substituted with both heteroatoms and halo atoms.
[00196] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000071_0001
wherein X=CH or N; B is H when the optional bond is present between C-5 and C-6, and when the optional bond between C-5 and C-6 is absent then each B is H.
[00197] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000071_0002
wherein X=CH or N; A is H when the optional bond is present between C-5 and C-6, and when the optional bond between C-5 and C-6 is absent then each A is H.
[00198] In certain embodiments, R1 to R4 each may be independently selected from H or halo. R5 to R7 may be H. In one embodiment, a may be N and the remaining b, c and d substituents may be carbon. In another embodiment, a, b, c, and d may be carbon. The optional bond between C-5 and C-6 may be present. Alternatively, the optional bond between C-5 and C-6 may be absent. R8 may be group 2.0, or 4.0. One of A and B may be H and the other may be R9. R9 may be selected from the group consisting of: (1) heterocycloalkylalkyl of the formula — (CH2)n-heterocycloalkyl; (2) substituted heterocycloalkylalkyl of the formula — (CH2)n- substituted heterocycloalkyl; (3) unsubstituted heteroarylalkyl of the formula — (CH2)n- heteroaryl; and (4) substituted heteroarylalkyl of the formula — (CH2)n- substituted heteroaryl; wherein n is 1, 2, or 3 and the substituents for said substituted R9 groups are each independently selected from the group consisting of: (1) —OH; (2) -CO2R14; (3) -CH2OR14, (3) halo, (4) alkyl; (5) amino; (6) trityl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroaryl and (10) heteroarylalkyl. wherein R14 is independently selected from the group consisting of: H and alkyl. In another embodiment, R9 may be selected from the group consisting of: (1) — (CH2)n- imidazolyl; (2) — (CH2)n-substituted imidazolyl; (3) — (CH2)n-morpholinyl; (4) — (CH2)n- substituted morpholinyl, (5) — (CH2)n-piperazinyl, and (6) — (CH2)n-substituted piperazinyl, wherein n is 1, 2, or 3. R11 may be selected from the group consisting of: alkyl, cycloalkyl and substituted cycloalkyl wherein the substituents are selected from the group consisting of: halo,
alkyl and amino; and R , 11aamay be selected from: alkyl, unsubstituted aryl,
Figure imgf000072_0001
Figure imgf000072_0002
and substituted aryl, cycloalkyl or substituted cycloalkyl, wherein the substituents on said substituted groups are selected from the group consisting of: halo, — CN or CF3; (3) R2, R2, and R22 are H; and (4) R46 is selected from the group consisting of: unsubstituted aryl, 2247 substituted aryl wherein the substituents are selected from the group consisting of: alkyl, alkylcarbonyl and haloalkyl, and wherein R44 is selected from the group consisting of: H or — C(O)NH2. In another embodiment, R8 may be selected from the group consisting of: (1) group 2.0 wherein R11 is selected from the group consisting of: t-butyl and cyclohexyl; (2) group 3.0 wherein R11 is selected from the group consisting of: methyl and t- butyl; (3) group 4.0 wherein, R12 is H, and Rllais selected from the group consisting of: t-butyl, cyanophenyl, chlorophenyl, fluorophenyl and cyclohexyl; (4) group 5.0 wherein R21 and R22 are
H, and R46 is selected from the group consisting of:
Figure imgf000073_0001
wherein R44 is -C(O)NH2. R8 may be group 4.0.
[00199] In one embodiment, the optional bond between C5 and C6 may be present and A is H and B is R9.
[00200] In one embodiment, (1) R1 to R4 each may be independently selected from the group consisting of: H and halo; (2) R5, R6, R7, and R7a are H; (3) a is N and the remaining b, c and d substituents are carbon; (4) the optional bond between C5 and C6 is present; (5) A is H; (6) B is R9; (7) R8 is group 2.0 or 4.0; (8) R11 is selected from the group consisting of: alkyl, cycloalkyl and substituted cycloalkyl wherein the substituents are selected from the group consisting of: halo, alkyl and amino; (9) Rllais selected from the group consisting of: alkyl, unsubstituted aryl, substituted aryl, cycloalkyl or substituted cycloalkyl, wherein the substituents on said substituted groups are are selected from the group consisting of: halo, — CN and CF3; (10) R12 is H; (11) R9 is selected from the group consisting of: (a) — (CH2)n-heterocycloalkyl; (b) — (CH2)n-substituted heterocycloalkyl; (c) — (CH2)n-heteroaryl, and (d) — (CH2)n-substituted heteroaryl; wherein n is 1, 2, or 3 and the substituents for said substituted R9 groups are each independently selected from the group consisting of: (1) —OH; (2) -CO2R14; (3) -CH2OR14, (4) halo, (5) alkyl; (6) amino; (7) trityl; (8) heterocycloalkyl; (9) arylalkyl; (10) heteroaryl and (11) heteroarylalkyl; wherein R 14 is independently selected from the group consisting of: H and alkyl; and (12) X is N or CH. [00201] In another embodiment, (1) R1 to R4 each may be independently selected from H, Br or Cl; (2) R9 is selected from the group consisting of: (a) — (CH2)n-imidazolyl; (b) — (CH2)n- substituted imidazolyl; (c) — (CH2)n-morpholinyl; (d) — (CH2)n-substituted morpholinyl, (e) — (CH2)n-piperazinyl, or (f) — (CH2)n-substituted piperazinyl, wherein n is 1, 2, or 3; (3) R11 is selected from the group consisting of: t-butyl and cyclohexyl; (4) R12 is H; and (5) Rl lais selected from the group consisting of: t-butyl, cyanophenyl, chlorophenyl, fluorophenyl and cyclohexy.
[00202] In yet another embodiment, (1) R1 and R2 are H; (2) R3 is H; (3) R4 is Cl; (5) R8 is 4.0 wherein Rl lais cyanophenyl; and R12 is H; and (6) R9 is selected from the group consisting of: — CH2-imidazolyl, and — CH2-imidazolyl wherein said imidazolyl moiety is substituted with a methyl group. [00203] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000074_0001
wherein X may be N.
[00204] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000075_0001
wherein:
(A) one of a, b, c and d represents N or N+O , and the remaining a, b, c, and d groups represent CR1 wherein each R1 group on each carbon is the same or different; or
(B) each a, b, c, and d group represents CR1 wherein each R1 group on each carbon is the same or different;
(C) the dotted lines ( — ) represent optional bonds;
(D) X represents N or CH when the optional bond to C 11 is absent, and represents C when the optional bond to Cl 1 is present;
(E) R1 is selected from the group consisting of: (1) H; (2) halo; (3) -CF3; (4) —OR10; (5) COR10; (6) -SR10; (7) -S(O)1R15; (8) — N(R10)2; (9) -NO2; (10) -OC(O)R10; (11) CO2R10; (12) -OCO2R10; (13) -CN; (14) -NR10COOR15; (15) -SR15C(O)OR15; (16) — SR15N(R13)2 wherein each R13 is independently selected from the group consisting of: H and — C(O)OR15, and provided that R15 in — SR15N(R13)2 is not — CH2; (17) benzotriazol-1-yloxy; (18) tetrazol-5- ylthio; (19) substituted tetrazol-5-ylthio; (20) alkynyl; (21) alkenyl; (22) alkyl; (23) alkyl substituted with one or more substitutents independently selected from the group consisting of: halogen, — OR10 and — CO2R10; (24) alkenyl substituted with one or more substitutents independently selected from the group consisting of: halogen, — OR10 and — CO2R10;
(F) Each R is independently selected from the group consisting of: (1) halo; (2) — CF3; (3) —OR10; (4) COR10; (5) -SR10; (6) -S(O)1R15; (7) — N(R10)2; (8) -NO2; (9) -OC(O)R10; (10) CO2R10; (11) -OCO2R10; (12) -CN; (13) -NR10COOR15; (14) -SR15C(O)OR15; (15) — SR15N(R13)2 wherein each R13 is independently selected from the group consisting of: H and — C(O)OR15, and provided that R15 in — SR15N(R13)2 is not -CH2; (16) benzotriazol-1-yloxy; (17) tetrazol-5-ylthio; (18) substituted tetrazol-5-ylthio; (19) alkynyl; (20) alkenyl; (21) alkyl; (22) alkyl substituted with one or more substitutents independently selected from the group consisting of: halogen, — OR10 and — CO2R10; and (23) alkenyl substituted with one or more substitutents independently selected from the group consisting of: halogen, — OR10 and — CO2R10;
(G) m is O, 1 or 2;
(H) t is O, 1 or 2
(I) R5, R6, R7 and R7a are each independently selected from the group consisting of: (1) H; (2) — CF3; (3) — COR10; (4) alkyl; (5) unsubstituted aryl; (6) alkyl substituted with one or more groups selected from the group consisting of: —OR10, -SR10, -S(O)1R15, -NR10COOR15, — N(R10)2, -NO2, -C(O)R10; — OCOR10, -OCO2R15, CO2R10, and OPO3R10; and (7) aryl substituted with one or more groups selected from the group consisting of: — OR10, — SR10, — S(O)1R15, -NR10COOR15, — N(R10)2'-NO2, -C(O)R10; — OCOR10, -OCO2R15, -CO2R10, and OPO3R10; or
(J) R5 together with R6 represents =0 or =S;
(K) R8 is selected from the group consisting
(4.0),
Figure imgf000076_0001
(L) R , 10 is selected from the group consisting of: H; alkyl; aryl and arylalkyl;
(M) R , 11 is selected from: (1) alkyl; (2) substituted alkyl; (3) unsubstituted aryl; (4) substituted aryl; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl; (7) unsubstituted heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) fluoro; and (3) alkyl; and wherein said substituted aryl and substituted heteroaryl R11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) halogen; and (3) alkyl;
(N) Rl lais selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) unsubstituted aryl; (6) substituted aryl; (7) unsubstituted cycloalkyl; (8) substituted cycloalkyl; (9) unsubstituted heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R1 la groups are substituted with one or more substituents selected from the group consisting of: (1) —OH; (2) -CN; (3) -CF3; (4) fluoro; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; and wherein said substituted aryl and substituted heteroaryl R1 la groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) — CN; (3) -CF3; (4) halogen; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; (O) R12 is selected from the group consisting of: H, alkyl, piperidine Ring V, cycloalkyl, and -alkyl-(piperidine Ring V);
(P) R15 is selected from the group consisting of: alkyl and aryl;
(Q) R21, R22 and R46 are independently selected from the group consisting of: (1) H; (2) alkyl; (3) unsubstituted aryl; (4) substituted aryl substituted with one or more substituents selected from the group consisting of: alkyl, halogen, CF3 or OH; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl substituted with one or more substituents selected from the group
consisting of: alkyl, halogen, CF3 or OH; (7) heteroaryl of the formula,
Figure imgf000077_0001
Figure imgf000078_0002
(8) piperidine Ring V:
Figure imgf000078_0001
wherein R44 is selected from the group consisting of: (a) H, (b) alkyl; (c) alkylcarbonyl; (d) alkyloxy carbonyl; (e) haloalkyl and (f) — C(O)NH(R51);
(R) R51 is selected from the group consisting of: — H and alkyl (e.g., methyl, ethyl, propyl, butyl and t-butyl);
(S) B is the group:
Figure imgf000078_0003
(T) in said B group: (1) p of the — (CH2)P — moiety is 0; (2) p of the
moiety is 1 to 3; (3) when p is one for the moiety
Figure imgf000078_0004
then R 30 is selected from the group consisting of: — OH and — NH2, and R31 is alkyl; (4) when p is 2 or 3 for the
Figure imgf000079_0001
then: (1) for one -CR30R31- moiety, R30 is selected from the group consisting of: — OH and — NH2, and R31 is alkyl; and (2) for the remaining — CR30R31 — moieties R30 and R31 are hydrogen; and (5) R9 is unsubstituted heteroaryl or substituted heteroaryl, provided that when said heteroaryl group contains nitrogen in the ring, then said heteroaryl group is not bound by a ring nitrogen to the adjacent — CR30R31 — moiety when R30 is —OH or -NH2.
[00205] In one embodiment, (4) a is N; (5) b, c and d are CR1 groups wherein all of said R1 substituents are H, or one R1 substituent is halo and the remaining two R1 substituents are hydrogen; (6) m is 1, and R3Ais halo, or m is 2 and each R3Ais the same or different halo (e.g., Br or Cl); and (7) R5, R6, R7, and R7a are H. [00206] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000079_0002
wherein: (A) B is the group:
(B) in said B group
Figure imgf000080_0001
: (1) p of the — (CH2)P — moiety is 0; (2) p of the
moiety is 1 to 3; (3) when p is one for the moiety
Figure imgf000080_0002
then R 30 is selected from the group consisting of: — OH and — NH2, and R31 is alkyl; (d) when p is 2 or 3 for the
moiety
Figure imgf000080_0003
then: (1) for one -CR30R31- moiety, R30 is selected from the group consisting of: — OH and — NH2, and R31 is alkyl; and (2) for the remaining — CR30R31 — moieties R30 and R31 are hydrogen; and (e) R9 is unsubstituted heteroaryl or substituted heteroaryl, provided that when said heteroaryl group contains nitrogen in the ring, then said heteroaryl group is not bound by a ring nitrogen to the adjacent — CR30R31 — moiety when R30 is —OH or -NH2;
(C) a is N;
(D) b, c and d are CR1 groups wherein all of said R1 substituents are H, or one R1 substituent is halo and the remaining two R1 substituents are hydrogen;
(E) m is 1 , and R3A is halo, or m is 2 and each R3A is the same or different halo; (F) X is N or CH;
(G) R5, R6, R7, and R7a are H;
(H) R8 is selected from the group consisting of:
Figure imgf000081_0001
(I) R11 is selected from: (1) alkyl; (2) substituted alkyl; (3) unsubstituted aryl; (4) substituted aryl; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl; (7) unsubstituted heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) fluoro; and (3) alkyl; and wherein said substituted aryl and substituted heteroaryl R11 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) halogen; and (3) alkyl;
(J) Rllais selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) unsubstituted aryl; (6) substituted aryl; (7) unsubstituted cycloalkyl; (8) substituted cycloalkyl; (9) unsubstituted heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted alkyl, substituted cycloalkyl, and substituted heterocycloalkyl R1 la groups are substituted with one or more substituents selected from the group consisting of: (1) —OH; (2) -CN; (3) -CF3; (4) fluoro; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; and wherein said substituted aryl and substituted heteroaryl R1 la groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) — CN; (3) -CF3; (4) halogen; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl; (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; (K) R12 is selected from the group consisting of: H, alkyl, piperidine Ring V, cycloalkyl, and -alkyl-(piperidine Ring V);
(L) R21, R22 and R46 are independently selected from the group consisting of: (1) H; (2) alkyl; (3) unsubstituted aryl; (4) substituted aryl substituted with one or more substituents selected from the group consisting of: alkyl, halogen, CF3 or OH; (5) unsubstituted cycloalkyl; (6) substituted cycloalkyl substituted with one or more substituents selected from the group
consisting of: alkyl, halogen, CF3 or OH; (7) heteroaryl of the formula,
Figure imgf000082_0001
Figure imgf000082_0003
(8) piperidine Ring V:
Figure imgf000082_0002
wherein R44 is selected from the group consisting of: (a) H, (b) alkyl; (c) alkylcarbonyl; (d) alkyloxy carbonyl; (e) haloalkyl and (f) — C(O)NH(R51); and
(M) R51 is selected from the group consisting of: H and alkyl (e.g., methyl, ethyl, propyl, butyl and t-butyl). [00207] In certain embodiments, (A) in the B group: (1) p of the
Figure imgf000082_0004
moiety is 0; (2) p of the moiety is 1 to 2; (3) when p is
one for the
Figure imgf000082_0005
then R 30 is selected from the group consisting of: — OH and — NH2, and R , 31 is Ci-C2 alkyl; (4) when p is 2 or 3 for the moiety
Figure imgf000083_0001
then:
(1) for one — CR30R31 — moiety, R30 is selected from the group consisting of: — OH and
NH2, and R31 is Ci-C2 alkyl; and (2) for the remaining -CR30R31- moieties R30 and R31 are hydrogen; and (5) R9 is imidazolyl or substituted imidazolyl, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR30R31 — moiety when R30 is — OH or — NH2;
(B) R8 is 2.0;
(C) R11 is alkyl;
(D) X is N;
(E) b, c and d are CR1 groups wherein all of said R1 substituents are H;
(F) m is 1 , and R3A is halo; and
(G) X is N.
[00208] In certain embodiments, in the B group: (1) p of the — (CH2)P — moiety is 0; (2) p of
the
Figure imgf000083_0002
moiety is 1; (3) R30 is selected from the group consisting of: — OH and
— NH2, and R31 is Ci-C2 alkyl; and (4) R9 is substituted imidazolyl wherein said the substituent is an alkyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent -CR30R31- moiety. [00209] In certain embodiments, (A) in said B group: (1) p of the — (CH2)P — moiety is 0; (2)
p of the
Figure imgf000083_0003
moiety is 1 ; (3) R , 30 is — OH, and R 31 . is methyl; and (4) R is substituted imidazolyl wherein the substituent is a methyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR30R31 — moiety; and (B) R3Ais Cl; and (C) Rπ is alkyl.
R9 may be
Figure imgf000084_0001
R , 11 may be t-butyl.
[00210] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000084_0002
wherein all substituents may be as defined above.
[00211] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000085_0001
wherein all substituents may be as defined above.
[00212] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000085_0002
wherein all substituents may be as defined above. [00213] In certain embodiments, (A) in the B group: (1) p of the — (CH2)P — moiety is 0; (2)
p of the
Figure imgf000086_0001
moiety is 1 ; (3) R30 is —OH, and R3 J is methyl; and (4) R9 is substituted imidazolyl wherein the substituent is a methyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR30R31 — moiety; and (B) R3Ais Cl; and (C) Rπ is alkyl.
R9 may be
Figure imgf000086_0002
R . 11 may be t-butyl. [00214] In certain embodiments, (A) in the B group: (l) p ofthe (CH2)p— moiety is 0; (2)
p of the
Figure imgf000086_0003
moiety is 1 ; (3) R30 is — OH, and R31 is methyl; and (4) R9 is substituted imidazolyl wherein the substituent is a methyl group, provided that said imidazolyl group is not bound by a ring nitrogen to the adjacent — CR30R31 — moiety; and (B) R3Ais Cl; and (C) Rπ is alkyl. R9 may be
Figure imgf000086_0004
R11 may be t-butyl. [00215] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000087_0001
or a stereoisomeric form, or a pharmaceutically acceptable acid or base addition salt form thereof, wherein: one of a, b, c and d represents N or N+O", and the remaining a, b, c, and d groups represent carbon, wherein each carbon has an R1 or R2 group bound to said carbon; or each of a, b, c, and d is carbon, wherein each carbon has an R1 or R2 group bound to said carbon; the dotted lines ( — ) represent optional bonds;
X represents N or CH when the optional bond is absent, and represents C when the optional bond is present; when the optional bond is present between carbon atom 5 and carbon atom 6 then there is only one A substituent bound to carbon atom 5 and there is only one B substituent bound to carbon atom 6 and A or B is other than H; when the optional bond is not present between carbon atom 5 and carbon atom 6, then there are two A substituents bound to carbon atom 5 and two B substituents bound to carbon atom 6, wherein each A and B substituent is independently selected from the group consisting of:
(1) — H; (2) — R9; (3) — R9— C(O)-R9; (4) — R9— CO2- R9a; (5) — (CH2)pR26; (6) — C(O)N(R9)2, wherein each R9 is the same or different; (7) -C(O)NHR9; (8) -C(O)NH-CH2- C(O)-NH2; (9) -C(O)NHR26; (10) — (CH2)pC(R9)— O— R9a; (11) — (CH2)p(R9)2, wherein each R9 is the same or different; (12) — (CH2)pC(O)R9; (13) — (CH2)pC(O)R27a; (14) — (CH2)pC(O)N(R9)2, wherein each R9 is the same or different; (15) — (CH2)pC(O)NH(R9); (16) — (CH2)pC(O)N(R26)2, wherein each R26 is the same or different; (17) — (CH2)pN(R9)— R9a; (18) — (CH2)pN(R26)2, wherein R26 is the same or different; (19) — (CH2)pNHC(O)R50; (20) — (CH2)pNHC(O)2R50; (21) — (CH2)pN(C(O)R27a)2 wherein each R27ais the same or different; (22) — (CH2)pNR51C(O)R27, or R51 and R27 taken together with the atoms to which they are bound form a heterocycloalkyl ring consisting of, 5 or 6 members, provided that when R51 and R27 form a ring, R51 is not H; (23) — (CH2)pNR51C(O)NR27, or R51 and R27 taken together with the atoms to which they are bound form a heterocycloalkyl ring consisting or 5 or 6 members, provided that when R51 and R27 form a ring, R51 is not H; (24) — (CH2)pNR51C(O)N(R27^2, wherein each R27ais the same or different; (25) — (CH2)pNHSO2N(R51)2, wherein each R51 is the same or different; (26) — (CH2)pNHCO2R50; (27) — (CH2)pNC(O)NHR51; (28) — (CH2)pCO2R51; (29) —
NHR9; (30) 30
Figure imgf000088_0001
and R , 31 are the same or different; (31)
Figure imgf000088_0002
wherein R30, R31, R32 and R33 are the same or different; (32) - alkenyl-CO2R9a; (33) -alkenyl-C(O)R9a; (34) -alkenyl-CO2R51; (35) -alkenyl-C(O)— R27a; (36)
(CH2)p-alkenyl-CO2— R , 51 ;. (37) — (CH2)pC=NOR , 5M1 and (38) — (CH2)p-Phthalimid; p is O, 1, 2, 3 or 4; each R1 and R2 is independently selected from H, Halogen, -CF3, —OR10, COR10, — SR10, -S(O),15 wherein t is 0, 1 or 2, — N(R10)2, -NO2, -OC(O)R10, CO2R10, -OCO2R15, -CN, -NR10COOR15, -SR15C(O)OR15 — SR15N(R13)2 provided that R15 in — SR15N(R13)2 is not — CH2, and wherein each R13 is independently selected from H or — C(O)OR15, benzotriazol-1- yloxy, tetrazol-5-ylthio, or substituted tetrazol-5-ylthio, alkynyl, alkenyl or alkyl, said alkyl or alkenyl group optionally being substituted with halogen, — OR10 or — CO2R10; R3 and R4 are the same or different and each independently represent H, or any of the substituents of R1 and R2;
R , R , R7 and R , 7a each independently represent H, -CF3, — COR 10 , alkyl or aryl, said alkyl or aryl optionally being substituted with —OR , 10, — SR 10 , — S(O)1R , 15 , — NR , 110X/- OOR , 15 , — N(R . 1i0υ\)2,
-NO2, -C(O)R , 10, — OCOR . 10 , -OCO2R . 105, — CO2R . 110 , OPO3R . 10 , or RD is combined with R0 to represent =0 or =S;
R8 is selected from the group consisting of:
Figure imgf000089_0001
R9 is selected from the group consisting of: (1) heteroaryl; (2) substituted heteroaryl; (3) arylalkoxy; (4) substituted arylalkoxy; (5) heterocycloalkyl; (6) substituted heterocycloalkyl; (7) heterocycloalkylalkyl; (8) substituted heterocycloalkylalkyl; (9) heteroarylalkyl; (10) substituted heteroarylalkyl; (11) heteroarylalkenyl; (12) substituted heteroarylalkenyl; (13) heteroarylalkynyl; (14) substituted heteroarylalkynyl; (15) arylalkyl; (16) substituted arylalkyl; (17) alkenyl, and (18) substituted alkenyl; wherein said substituted R9 groups are substituted with one or more substituents selected from the group consisting of: (1) — OH; (2) -CO2R14; (3) -CH2OR14, (4) halogen; (5) alkyl; (6) amino; (7) trityl; (8) heterocycloalkyl; (9) cycloalkyl; (10) arylalkyl; (11) heteroaryl; (12) heteroarylalkyl and (13)
Figure imgf000089_0002
wherein
R14 is independently selected from the group consisting of: H; alkyl; aryl, arylalkyl, heteroaryl and heteroarylalkyl;
R9a is selected from the group consisting of: alky and arylalkyl; R10 is selected from the group consisting of: H; alkyl; aryl and arylalkyl; R11 is selected from the group consisting of: (1) alkyl; (2) substituted alkyl; (3) aryl; (4) substituted aryl; (5) cycloalkyl; (6) substituted cycloalkyl; (7) heteroaryl; (8) substituted heteroaryl; (9) heterocycloalkyl; and (10) substituted heterocycloalkyl; wherein said substituted R11 groups have 1, 2 or 3 substituents selected from the group consisting of: (1) — OH; (2) halogen and (3) alkyl;
Rl lais selected from the group consisting of: (1) H; (2) OH; (3) alkyl; (4) substituted alkyl; (5) aryl; (6) substituted aryl; (7) cycloalkyl; (8) substituted cycloalkyl; (9) heteroaryl; (10) substituted heteroaryl; (11) heterocycloalkyl; and (12) substituted heterocycloalkyl; wherein said substituted R1 la groups have one or more substituents selected from the group consisting of: (1) —OH; (2) -CN; (3) -CF3; (4) halogen; (5) alkyl; (6) cycloalkyl; (7) heterocycloalkyl, (8) arylalkyl; (9) heteroarylalkyl; (10) alkenyl and (11) heteroalkenyl; R12 is selected from the group consisting of: H, and alkyl; R15 is selected from the group consisting of: alkyl and aryl;
R21, R22 and R46 are independently selected from the group consisting of: (1) — H; (2) alkyl; (3) aryl; (4) substituted aryl, optionally substituted with one or more substituents selected from the group consisting of: alkyl, halogen, CF3 and OH; (5) cycloalkyl; (6) substituted cycloalkyl; optionally substituted with one or more substituents selected from the group consisting of: alkyl,
halogen, CF3 and OH; (7) heteroaryl of the formula,
Figure imgf000090_0001
heterocycloalkyl of the formula:
Figure imgf000090_0002
wherein R44 is selected from the group consisting of: (1) — H; (2) alkyl; (3) alkylcarbonyl; (4) alkyloxy carbonyl; (5) haloalkyl and (6) -C(O)NH(R51); when R21, R22 or R46 is the heterocycloalkyl of the formula above, Ring V is
Figure imgf000091_0001
R26 is selected from the group consisting of: (1) — H; (2) alkyl; (3) alkoxyl; (4) -CH2- CN;
(5) R9; (6) -CH2CO2H; (7) — C(O)alkyl and (8) CH2C02alkyl;
R27 is selected from the group consisting of: (1) — H; (2) —OH; (3) alkyl and (4) alkoxy; R27ais selected from the group consisting of: (1) alkyl and (2) alkoxy;
R30 through R33 are independently selected from the group consisting of: (1) — H; (2) — OH; (3)
=0; (4) alkyl; (5) aryl and (6) arylalkyl; R50 is selected from the group consisting of: (1) alkyl; (2) heteroaryl; (3) substituted heteroaryl and (4) amino; wherein said substituents on said substituted R50 groups are independently selected from the group consisting of: alkyl; halogen; and — OH;
R5Oais selected from the group consisting of: (1) heteroaryl; (2) substituted heteroaryl and (3) amino; R51 is selected from the group consisting of: — H, and alkyl.
[00216] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000092_0001
or a stereoisomeric form, or a pharmaceutically acceptable acid or base addition salt form thereof, wherein:
A represents N or N-oxide;
X represents N, CH or C, such that when X is N or CH, there is a single bond to carbon atom 11 as represented by the solid line; or when X is C, there is a double bond to carbon atom 11 , as represented by the solid and dotted lines;
XI and X2 are independently selected from bromo or chloro, and X3 and X4 are independently selected from hydrogen, bromo or chloro provided that at least one of X3 and X4 is hydrogen;
Y1 and Y2 are independently selected from hydrogen or alkyl; Z is =0 or =S; R5, R6, R7 and R8 each independently represents hydrogen, -CF3, -COR10, alkyl or aryl, and further wherein R5 may be combined with R6 to represent =0 or =S and/or R7 may be combined with R8 to represent =0 or =S;
R10, R19 and R20 independently represent hydrogen, alkyl, alkoxy, aryl, aralkyl, heteroaryl, heteroarylalkyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl and heterocycloalkylalkyl, with the proviso that R19 and R20 are not both hydrogen; v is zero, 1, 2 or 3; and w is zero or 1.
[00217] In certain embodiments, there may be a single bond at carbon atom 11, X is CH, Z is =0 and R5, R6, R7 and R8 are hydrogen. In one embodiment, X1 is bromo, X2 is chloro, X3 is bromo and X4 is hydrogen. In one embodiment, Z is =0; v is 1, w is 1, and Y1 and Y2 are hydrogen. In one embodiment, R19 and R20 are independently selected from hydrogen, aryl and heterocycloalkyl wit h the proviso that R19 and R20 are not both hydrogen. In one embodiment, the aryl group is substituted with alkoxy; and the heterocycloalkyl group is substituted with — COOR10 wherein R10 is hydrogen or alkyl. In one embodiment, there is a single bond at carbon atom 11, X is CH, Z is =0, R5, R6, R7 and R8 are hydrogen, X1 is bromo, X2 is chloro, X3 is bromo and X4 is hydrogen, v is 1, w is 1, and Y1 and Y2 are hydrogen, R19 and R20 are independently selected from hydrogen, aryl and heterocycloalkyl; wherein the aryl group is substituted with alkoxy; and the heterocycloalkyl group is substituted with — COOR10 wherein R10 is hydrogen or alkyl, with the proviso that R19 and R20 are not both hydrogen. In one embodiment, there is a single bond at carbon atom 11, X is CH, Z is =0 and R5, R6, R7 and R8 are hydrogen. In one embodiment, X1 is bromo, X2 is chloro, X3 is bromo and X4 is hydrogen. In one embodiment, Z is =0; v is 1, w is 1, and Y1 and Y2 are hydrogen. In one embodiment, R19 and R20 are independently selected from hydrogen, alkyl, aryl and heterocycloalkyl with the proviso that R19 and R20 are not both hydrogen. In one embodiment, the alkyl group is substituted with —OR10, alkoxy, -OCOR10, -CONR10R12 or — COOR10, wherein R10 and R12 are independently selected from hydrogen, alkyl or alkoxy; the aryl group is substituted with alkoxy; and the heterocycloalkyl group is substituted with — COOR10 wherein R10 is hydrogen or alkyl. In one embodiment, there is a single bond at carbon atom 11, X is CH, Z is =0, R5, R6, R7 and R8 are hydrogen, X1 is bromo, X2 is chloro, X3 is bromo and X4 is hydrogen, v is 1 , w is 1 , and Y1 and Y2 are hydrogen, R19 and R20 are independently selected from hydrogen, alkyl, aryl and heterocycloalkyl, wherein the alkyl group is substituted with — OR10, alkoxy, — OCOR10, —
CONR10R12 or — COOR10, wherein R10 and R12 are independently selected from hydrogen, alkyl or alkoxy; the aryl group is substituted with alkoxy; the heterocycloalkyl group is substituted with — COOR10 wherein R10 is hydrogen or alkyl, with the proviso that R19 and R20 are not both hydrogen.
[00218] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000094_0001
or a stereoisomeric form, or a pharmaceutically acceptable acid or base addition salt form thereof, wherein:
R and R2 are independently selected from halo;
R1 and R3 are independently selected from the group consisting of H and halo, provided that at least one of R1 and R3 is H;
W is N, CH or C, when the double bond is present at the C-I l position;
R4 is
Figure imgf000094_0002
or R 5D ; . r R> 5D is
Figure imgf000095_0001
R6 and R7 are independently selected from the group consisting of H, alkyl, substituted alkyl, acyl, aryl, aralkyl, heterocycloalkyl and heteroaryl;
X is =0 or =S;
Z1 and Z2 are independently =0 or =S; n and n3 are independently 0, 1 or 2; and ni and n2 are independently 0 or 1.
[00219] In one embodiment, X is =0 and R6 and R7 are each hydrogen. In one embodiment, n is 1 and n3 is 0 or 1. In one embodiment, R is bromo and R2 is chloro or bromo. In one embodiment, R is bromo, R2 is chloro or bromo, R1 is H, and R3 is chloro or bromo. In one embodiment, R is bromo, R2 is chloro or bromo, R3 is H, and R1 is chloro or bromo. In one embodiment, the compound may any one of the following:
Figure imgf000096_0001
[00220] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000097_0001
or a stereoisomeric form, or a pharmaceutically acceptable acid or base addition salt form thereof, wherein: a represents N and the remaining b, c and d groups represent CR1 or CR2;
R1 is selected from H or halo;
R2 is selected from NO2, Br, Cl or I;
R3 is Cl;
R4 is H or halo;
R5, R6, R7 and R8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H2 ;
R20 and R21 are independently selected from H or alkyl;
R46 is selected from: pyridyl, pyridyl N-oxide or piperidine Ring V:
Figure imgf000097_0002
wherein R50 represents alkyl, alkylcarbonyl, alkyloxycarbonyl, haloalkyl, or —
C(O)NH(R10) wherein R10 is H or alkyl; and
Z represents O.
[00221] In one embodiment, R1 is H. In one embodiment, R2 is selected from Br, Cl or I. In one embodiment, R2 is Br at the C-3 position. In one embodiment, R2 is Br at the C-3 position and R is at the C-8 position. In one embodiment, both R and R are hydrogen, or both R and R21 are alkyl. In one embodiment, both R20 and R21 are hydrogen. In one embodiment, R46 is 3-pyridyl, 4-pyridyl, 3-pyridyl N-oxide, 4-pyridyl N-oxide, 4-N-methyl piperidinyl, 3 -N- methylpiperidinyl, 4-N-acetylpiperidinyl or 3-N-acetylpiperidinyl. In one embodiment, R46 is 3- pyridyl, 4-pyridyl, 3-pyridyl N-oxide, or 4-pyridyl N-oxide. In one embodiment, R46 is 4-pyridyl or 4-pyridyl N-oxide. In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000098_0001
wherein:
R1 is selected from H or halo;
R2 is selected from -CH3, Br, or I;
R3 is Cl;
R4 is H or halo;
R5, R6, R7 and R8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H2;
R20 and R21 are H;
R46 is selected from: pyridyl, pyridyl N-oxide, triazolyl, 1-N-methylpiperazinyl,
Figure imgf000099_0001
t is 0, 1 or 2, or piperidine Ring V: wherein R50 represents alkyl, alkylcarbonyl, alkoxycarbonyl, haloalkyl, or — C(O)NH(R10) wherein R10 is H or alkyl; and Z represents O.
[00222] In one embodiment, R1 is H. In one embodiment, R2 is selected from Br. In one embodiment, R2 is Br and R3 is at the C-8 position. In one embodiment, R46 is selected from 3- pyridyl, 4-pyridyl, 3 -pyridyl N-oxide, 4-pyridyl N-oxide, 4-N-methyl piperidinyl, 3 -N- methylpiperidinyl, 4-N-acetylpiperidinyl or 3-N-acetylpiperidinyl. In one embodiment, R46 is selected from: 3-pyridyl, 4-pyridyl, 3-pyridyl N-oxide, or 4-pyridyl N-oxide. In one embodiment, R46 is selected from 4-pyridyl or 4-pyridyl N-oxide.
[00223] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000100_0001
wherein:
R1 is selected from H or halo;
R2 is Cl;
R3 is Cl;
R4 is H or halo;
R5, R6, R7 and R8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H2;
R20 and R21 are H;
R46 is selected from: 4-pyridyl N-oxide, 4-pyridyl or piperidine Ring V: wherein R50 represents alkyl, alkylcarbonyl, alkyloxycarbonyl, haloalkyl, or —
C(O)NH(R10) wherein R10 is H or alkyl; and
Z represents O.
[00224] In one embodiment, R1 is H. In one embodiment, R3 is at the C-8 position. In one embodiment, R46 is 4-pyridyl N-oxide, 4-N-methyl piperidinyl, or 3-N-methylpiperidinyl. [00225] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000101_0001
wherein: a represents N and the remaining b, c and d groups represent CR1 or CR2;
R1 and R2 are independently selected from H, halo, -CF3, lower alkyl or benzotriazol-1- yloxy;
R3 and R4 are independently selected from H or halo;
R5, R6, R7 and R8 are H; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H2;
R , 25 represents pyridyl, pyridyl N-oxide, N-methyl-piperidinyl or phenyl;
R > 48 represents H or alkyl; and
Z represents O.
[00226] In certain embodiments, R1 is Cl or H; and R2 is H, Cl or Br. In one embodiment, R3 is Cl. In one embodiment, R25 represents phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyridyl N- oxide, 3-pyridyl N-oxide, or 4-pyridyl N-oxide. In one embodiment, R48 represents H or methyl. In one embodiment, R25 represents phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyridyl N-oxide, 3- pyridyl N-oxide, or 4-pyridyl N-oxide; and R48 represents H or methyl. In one embodiment, R1 is Cl or H; R2 is Br, Cl, or I; R3 and R4 independently represent H or halo; R25 represents phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyridyl N-oxide, 3-pyridyl N-oxide, or 4-pyridyl N-oxide; and R48 represents H or methyl. In one embodiment, R3 is Cl at the C-8 position and R4 is H. [00227] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000102_0001
Figure imgf000103_0001
wherein:
R1 is selected from H or halo;
R3 is Cl;
R4 is H or halo; the dotted line between carbon atoms 5 and 6 represents an optional double bond, such that when a double bond is present, A and B independently represent H, and when no double bond is present between carbon atoms 5 and 6, A and B each independently represent H2; and
R65 represents H or —OR66 wherein R66 represents alkyl.
[00228] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000104_0001
Figure imgf000104_0002
[00229] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000105_0001
Figure imgf000105_0002
(+)-enantiomer, or
Figure imgf000106_0001
[00230] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000106_0002
[00231] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula
Figure imgf000107_0001
(+)-enantiomer.
[00232] In certain embodiments, the farnesyl transferase inhibitor used in accordance with the present invention is of the formula:
Figure imgf000107_0002
This compound is also known by the name SCH66336 or Sarasar.
[00233] The therapeutically effective amount of the farnesyl transferase inhibitor included in the combination therapy will vary depending on the patient, the disease being treated, extent of disease, the route of administration, other medications being administered to the patient, desired outcome, etc. In certain embodiments, the farnesyl transferase inhibitor is administered in the range of approximately 0.0001 mg/kg body weight to approximately 10 mg/kg body weight. In certain embodiments, the farnesyl transferase inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 1 mg/kg body weight. In certain embodiments, the farnesyl transferase inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 0.1 mg/kg body weight. In certain embodiments, the farnesyl transferase inhibitor is administered in the range of approximately 0.01 mg/kg body weight to approximately 0.1 mg/kg body weight. As will be appreciated by one of skill in the art, depending on the form of the farnesyl transferase inhibitor being administered the dosing may vary. The dosages given herein are dose equivalents with respect to the active ingredient. In certain embodiments, the farnesyl transferase inhibitor is administered parenterally. In certain embodiments, the farnesyl transferase inhibitor is administered intravenously. In certain embodiments, the farnesyl transferase inhibitor is administered orally. In certain embodiments, the farnesyl transferase inhibitor is administered from once a week to 2-3 times per day. In certain particular embodiments, the farnesyl transferase inhibitor is administered once per day. In certain embodiments, the farnesyl transferase inhibitor and synuclein aggregation inhibitor are administered together. In other embodiments, they are administered separately. In certain embodiments, the combination is administered long term to prevent the development of the synucleinopathy or other neurodegenerative diseases.
Inhibitors of a-synuclein aggregation
[00234] Any agent that has been discovered to prevent the aggregation of α-synuclein may be used in combination with a farnesyl transferase inhibitor to treat synucleinopathies or other neurodegenerative diseases. Agents may be screened for their ability to prevent the aggregation of α-synuclein using techniques known in the art. Several assays for identifying compounds that prevent the aggregation of α-synuclein are described in the Examples section below. In certain embodiments, the assays involves testing for the aggregation of α-synuclein in hexafluoroisopropanol. In other embodiments, the assay invovles testing for the aggregation of α-synuclein in an aqueous solution. In certain embodiments, the agent is a small molecule. In certain embodiments, the agent is an organic compound. In certain embodiments, the agent is a drug approved for use in humans by the U.S. Food and Drug Administration (FDA) or under consideration by the FDA. [00235] In certain embodiments, the agent is an anti-depressant. In certain embodiments, the agent used in combination with a farnesyl transferase inhibitor is a tricyclic antidepressant. In certain embodiments, the agent is selected from the group consisting of nortriptyline, maprotiline, protriptyline, nordoxepin, and norclomipramine. In certain particular embodiments, the agent is nortriptyline. In certain embodiments, the agent is a monoamine reuptake inhibitor. The reuptake inhibitor may block the re -uptake of neurotransmitters such as norepinephrine, dopamine, serotonin, or combinations thereof. The reuptake inhibitor may be selective for a particular neurotransmitter, or it may be non-selective and block the reuptake of multiple neurotransmitters. In certain embodiments, the agent is selective serotonin reuptake inhibitor (SSRI). In certain embodiments, the agent is sertraline. In certain other embodiments, the agent is indatraline. In certain embodiments, the agent is fluoxetine. In certain embodiments, the agent is norfluoxetine.
[00236] In certain emboidments, any agent known to prevent the aggregation of α-synuclein may be used in the treatment of Parkinson's Disease. In certain embodiments, nortriptyline, maprotiline, protriptyline, nordoxepin, and norclomipramine is used in the treatment of Parkinson's Disease with or without another therapy. In certain embodiments, sertraline, indatraline, fluoxetine, or norfluoxetine is used in the treatment of Parkinson's Disease with or without another therapy.
[00237] Certain particular inventive combinations useful in accordance with the present invention include: LNK-754 and nortriptyline, LNK-754 and maprotiline, LNK-754 and protriptyline, LNK-754 and norclomipramine, LNK-754 and sertraline, LNK-754 and indatraline, LNK-754 and nordoxepin, LNK-754 and fluoxetine, LNK-754 and norfluoxetine, LNK-427 and nortriptyline, LNK-427 and maprotiline, LNK-427 and protriptyline, LNK-427 and norclomipramine, LNK-427 and sertraline, LNK-427 and indatraline, LNK-427 and nordoxepin, LNK-427 and fluoxetine, LNK-427 and norfluoxetine, Sarasar and nortriptyline, Sarasar and maprotiline, Sarasar and protriptyline, Sarasar and norclomipramine, Sarasar and sertraline, Sarasar and indatraline, Sarasar and nordoxepin, Sarasar and fluoxetine, Sarasar and norfluoxetine,Zarnestra and nortriptyline, Zarnestra and maprotiline, Zarnestra and protriptyline, Zarnestra and norclomipramine, Zarnestra and sertraline, Zarnestra and indatraline, Zarnestra and nordoxepin, Zarnestra and fluoxetine, and Zarnestra and norfluoxetine. [00238] The therapeutically effective amount of the α-synuclein aggregation inhibitor included in the therapy will vary depending on the patient, the disease being treated, extent of disease, the route of administration, other medications being administered to the patient, desired outcome, etc. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 0.0001 mg/kg body weight to approximately 25 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 1 mg/kg body weight to approximately 25 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 10 mg/kg body weight to approximately 20 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 1 mg/kg body weight to approximately 10 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 1 mg/kg body weight to approximately 5 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 1 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 0.001 mg/kg body weight to approximately 0.1 mg/kg body weight. In certain embodiments, the α-synuclein aggregation inhibitor is administered in the range of approximately 0.01 mg/kg body weight to approximately 0.1 mg/kg body weight. In certain embodiments, approximately 1 mg to approximately 2000 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1000 mg to approximately 2000 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 1000 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 500 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 100 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 50 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 1 mg to approximately 10 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 10 mg to approximately 100 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 25 mg to approximately 100 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 10 mg to approximately 50 mg of the α-synuclein aggregation inhibitor is administered each day. In certain embodiments, approximately 25 mg to approximately 75 mg of the α-synuclein aggregation inhibitor is administered each day. As will be appreciated by one of skill in the art, depending on the form of the α-synuclein aggregation inhibitor being administered the dosing may vary. The dosages given herein are dose equivalents with respect to the active ingredient. In certain embodiments, the α-synuclein aggregation inhibitor is administered parenterally. In certain embodiments, the α-synuclein aggregation inhibitor is administered intravenously. In certain embodiments, the α-synuclein aggregation inhibitor is administered orally. In certain embodiments, the α-synuclein aggregation inhibitor is administered from once a week to four times per day. In certain particular embodiments, the α-synuclein aggregation inhibitor is administered once per day. In certain emboidments, the α-synuclein aggregation inhibitor is administered twice per day. In certain emboidments, the α-synuclein aggregation inhibitor is administered 3-4 times per day. In certain embodiments, the farnesyl transferase inhibitor and α- synuclein aggregation inhibitor are administered together (e.g., at the same time). In other embodiments, they are administered separately. In certain embodiments, the combination is administered long term to prevent the development of the synucleinopathy or other neurodegenerative diseases. The inventive combination therapy may be administered continuously or intermittently. For example, the combination or one of the components of the combination may be administered for a certain period of time (e.g., weeks, months) and the discontinued for a certain period of time (e.g., weeks, months). In certain embodiments, the combination or a component is administered for 1 to 3 months followed by a year with none of the combination or component. In certain embodiments, the combination or component is administered every other month, every other quarter, every other six months, or every other year.
Uses
[00239] The inventive combination therapy may be used in vitro or in vivo. The combination is useful in treating diseases associated with the accumulation and/or aggregation of α-synuclein. The inventive combination is particularly useful in treating or preventing synucleinopathies including Parkinson's disease, diffuse Lewy body disease, multiple system atrophy disorder, and disorders of brain iron concentration including pantothenate kinase-associated neurodegeneration. However, other diseases which are associated with abnormal aggregations of α-synuclein may also be treated with the inventive combination. For example, the inventive combination may be used to treating the following diseases: amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and Alzheimer's disease (AD).
[00240] In certain embodiments, the disease being treated using the inventive combination therapy is Parkinson's disease. In certain embodiments, the disease being treated using the inventive combination therapy is diffuse Lewy body disease. In certain embodiments, the disease being treated using the inventive combination therapy is multiple system atrophy disorder. In certain embodiments, the disease being treated using the inventive combination therapy is pantothenate kinase-associated neurodegeneration. In certain embodiments, the disease being treated using the inventive combination therapy is amyotrophic lateral sclerosis (ALS). In certain embodiments, the disease being treated using the inventive combination therapy is Huntington's disease. In certain embodiments, the disease being treated using the inventive combination therapy is Alzheimer's disease. In certain embodiments, the disease being treated using the inventive combination therapy is Parkinson's disease. In certain embodiments, the disease being treated using the inventive combination therapy is frontotemporal dementia. In certain embodiments, the disease being treated using the inventive combination is prion disease (e.g., Creutzfeldt Jakob Disease). In certain embodiments, the disease being treated using the inventive combination is Niemann-Pick Type Cl disease. In certain embodiments, the disease being treated using the inventive combination is Gaucher's disease. In certain embodiments, the disease being treated using the inventive combination is progressive supranuclear palsy. [00241] The inventive combination of agents may also be used with one or more other pharmaceutical agents. For example, the combination may be used with pharmaceutical agents currently used to treat synucleinopathies or other neurodegenerative diseases, or symptoms arising as side-effects of the disease or of the aforementioned medications. [00242] For example, methods of the invention can be used in combination with medications for treating PD. Levodopa mainly in the form of combination products containing carbodopa and levodopa (Sinemet and Sinemet CR) is the mainstay of treatment and is the most effective agent for the treatment of PD. Levodopa is a dopamine precursor, a substance that is converted into dopamine by an enzyme in the brain. Carbodopa is a peripheral decarboxylase inhibitor that prevents side effects and lower the overall dosage requirement. The starting dose of Sinemet is a 25/100 or 50/200 tablet prior to each meal. Dyskinesias may result from overdose and also are commonly seen after prolonged (e.g., years) use. Direct acting dopamine agonists may have less of this side effect. About 15% of patients do not respond to levodopa. Stalevo (carbodopa, levodopa, and entacapone) is a new combination formulation for patients who experience signs and symptoms of "wearing-off." The formulation combines carbodopa and levodopa (the most widely used agents to treat PD) with entacapone, a catechol-O-methyltransferase inhibitor. While carbodopa reduces the side effects of levodopa, entacapone extends the time levodopa is active in the brain, up to about 10% longer.
[00243] Amantadine (SYMMETREL®) is a mild agent thought to work by multiple mechansims including blocking the re-uptake of dopamine into presynaptic neurons. It also activates the release of dopamine from storage sites and has a glutamate receptor blocking activity. It is used as early monotherapy, and the dosing is typically 200 to 300 mg daily. Amantadine may be particularly helpful in patients with predominant tremor. Side effects may occasionally include ankle swelling and red blotches. It may also be useful in later stage disease to decrease the intensity of drug-induced dyskinesia.
[00244] Anticholinergics (trihexyphenidyl, benztropine mesylate, procyclidine, artane, cogentin) do not act directly on the dopaminergic system. Direct-acting dopamine agonists include bromocriptidine (Parlodel), pergolide (Permax), ropinirol (Requip), and pramipexole (Mirapex). These agents cost substantially more than levodopa (Sinemet), and additional benefits are controversial. Depending on which dopamine receptor is being stimulated, Dl and D2 agonist can exert anti-Parkinson effects by stimulating the Dl and D2 receptors, such as Ergolide. Mirapex and Requip are the newer agents. Both are somewhat selective for the dopamine D2 receptor. Direct dopamine agonists, in general, are slightly more likely to produce adverse neuropsychiatric side effects such as confusion than levodopa. Unlike levodopa, direct dopamine agonists do not undergo conversion to dopamine and thus do not produce potentially toxic free radical as they are metabolized. It is also possible that the early use of a direct dopamine agonist decreases the propensity to develop the late complications, associated with direct stimulation of the dopamine receptor by dopamine itself, such as the "on-off ' effect and dyskinesia.
Ill [00245] Monoaminoxidase-B inhibitors (MAO) such as selegiline (Diprenyl, or Eldepryl), taken in a low dose, may reduce the progression of Parkinsonism. These compounds can be used as an adjunctive medication. A study has documented that selegiline delays the need for levodopa by roughly three months, although interpretation of this data is confounded by the mild symptomatic benefit of the drug. Nonetheless, theorectical and in vitro support for a neuroprotective effect for some members of the selectiv MAOB class of inhibitors remains {e.g., rasagiline).
[00246] Catechol-O-methyltransferase inhibitors (COMT) can also be used in combination treatments of the invention. Catechol-O-methyltransferase is an enzyme that degrades levodopa, and inhibitors can be used to reduce the rate of degradation. Entacapone is a peripherally acting COMT inhibitor, which can be used in certain methods and compositions of the invention. Tasmar or Tolcapone, approved by the FDA in 1997, can also be used in certain methods and compositions of the invention. Psychiatric adverse effects that are induced or exacerbated by PD medication include psychosis, confusion, agitation, hallucinations, and delusions. These can be treated by decreasing dopaminergic medications, reducing or discontinuing anticholinergics, amantadine, catechol O-methyltransferase inhibitors (COMTIs), or monoamine oxidase inhibitors (MAOIs), or by adding low doses of atypical antipsychotics such as clozapine or quetiapine.
[00247] The inventive combination therapy can also be used in conjunction with surgical therapies for the treatment of PD. Surgical treatment is presently recommended predominantly for those who have failed medical management of PD. Unilateral thalamotomy can be used to reduce tremor. It is occasionally considered for patients with unilateral tremor not responding to medication. Bilateral procedures are typically not advised. Unilateral deep brain stimulation of the thalamus for tremor may also be a benefit for tremor. Unilateral pallidotomy is an effective technique for reducing contralateral drug-induced dyskinesias. Gamma knife surgery- thalamotomy or pallidotomy-can be performed as a radiological alternative to conventional surgery. The currently preferred neurosurgical intervention is, however, bilateral subthalamic nucleus stimulation. Neurotransplantation strategies remain experimental. In addition to surgery and medication, physical therapy in Parkinsonism maintains muscle tone, flexibility, and improves posture and gait. [00248] In other aspects, the inventive combination therapy can be used in conjuction with one or more other medications for treating DLBD. For example, the lowest acceptable doses of levodopa can be used to treat DLBD. D2-receptor antagonists, particularly traditional neuroleptic agents, can provoke severe sensitivity reactions in DLBD subjects with an increase in mortality of two to three times. Cholinsterase inhibitors dicussed herein may also be used in conjunction with the inventive treatment of DLBD. Glutamate antagonists such as memantine may also be used
[00249] In treating MSA, the inventive combinations can be used in conjunction with one or more alternative medications for treating the symptoms of MSA. Typically, the drugs that can be used to treat various symptoms of MSA become less effective as the disease progresses. Levodopa and dopamine agonists used to treat PD are sometimes partially effective for the slowness and rigidity of MSA. Orthostatic hypertension can be improved with cortisone, midodrine, fludrocortisone, or other drugs that raise blood pressure. Male impotence may be treated with penile implants or drugs. Incontinence may be treated with medication or catheterization. Constipation may improve with increased dietary fiber or laxatives. [00250] The combination of farnesyl transferase inhibitor and α-synuclein aggregation inhibitor may also be used in vitro to treat cells. The treatment of cells with the inventive combination may be useful in studying the mechanism of action of the agents. The method may also be used to test the efficacy of a particular combination of agents. The cells used in the in vitro assay may be any type of cell. In certain embodiments, the cells are mammalian cells. In certain particular embodiments, the cells are human cells. In certain embodiments, the cells are neural cells. The cells typically express α-synuclein and may show the formation of α-synuclein aggregation. In certain embodiments, the cells may be genetically engineered to express α- synuclein.
Pharmaceutical Composition
[00251] The present invention also provides pharmaceutical compositions, preparation, and kits comprising a farnesyl transferase inhibitor and an agent that inhibits the aggregation of α- synuclein, and optionally a pharmaceutically acceptable carrier or excipient. The compositions, preparation, and kits typically include amounts of each agent appropriate for the administration to a subject. In certain embodiments, the two agents are not mixed togeteher in the same composition. For example, the two agents may not be part of the same solution or tablet. Typically, the two agents are kept in different compositions and are administered separately. A kit may contain the inventive pharmaceutical composition as well as instructions for prescribing the combination. In certain embodiments, the agents act synergistically and therefore the amount of one or both agents is lower than the amount administered when only one agent is used. In certain embodiments, the agents act additively and the amount of one or both agents is optionally lower than the amount administered when only one agent is used. In certain embodiments, the amount of both agents is lower. The dosing of each of the farnesyl transferase inhibitor and the α-synuclein aggregation inhibitor is described in more detail above.
[00252] Any pharmaceutical acceptable carrier or excipient may be part of the inventive pharmaceutical compositions. Wetting agents, emulsifϊers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants may be present in the inventive compositions.
[00253] Examples of pharmaceutically-acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like. [00254] Formulations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, and the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, this amount will range from about 1% to about 99% of active ingredient, preferably from about 5% to about 70%, most preferably from about 10% to about 30%. [00255] In certain embodiments, a formulation of the present invention comprises an excipient selected from the group consisting of cyclodextrins, liposomes, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters, polyacrylates, polyphosphazenes, and polyanhydrides; and a compound of the present invention. In certain embodiments, an aforementioned formulation renders orally bioavailable a compound of the present invention. [00256] Methods of preparing these formulations or compositions include the step of bringing into association a compound of the present invention with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound of the present invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product. [00257] Formulations of the invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound of the present invention as an active ingredient. A compound of the present invention may also be administered as a bolus, electuary or paste.
[00258] In solid dosage forms of the invention for oral administration (e.g., capsules, tablets, pills, dragees, powders, granules, and the like), the active ingredient is mixed with one or more pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; humectants, such as glycerol; disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; solution retarding agents, such as paraffin; absorption accelerators, such as quaternary ammonium compounds; wetting agents, such as, for example, cetyl alcohol, glycerol monostearate, and non-ionic surfactants; absorbents, such as kaolin and bentonite clay; lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and coloring agents. In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
[00259] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made in a suitable machine in which a mixture of the powdered compound is moistened with an inert liquid diluent.
[00260] The tablets, and other solid dosage forms of the pharmaceutical compositions of the present invention, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be formulated for rapid release, e.g., freeze-dried. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients. [00261] Liquid dosage forms for oral administration of the compounds of the invention include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifϊers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
[00262] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
[00263] Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
[00264] Formulations of the pharmaceutical compositions of the invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds of the invention with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
[00265] Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
[00266] Dosage forms for the topical or transdermal administration of a compound of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
[00267] The ointments, pastes, creams and gels may contain, in addition to an active compound of this invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
[00268] Powders and sprays can contain, in addition to a compound of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
[00269] Transdermal patches have the added advantage of providing controlled delivery of a compound of the present invention to the body. Dissolving or dispersing the compound in the proper medium can make such dosage forms. Absorption enhancers can also be used to increase the flux of the compound across the skin. Either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel can control the rate of such flux. [00270] Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this invention.
[00271] Pharmaceutical compositions of this invention suitable for parenteral administration comprise one or more compounds of the invention in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
[00272] Examples of suitable aqueous and nonaqueous carriers, which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. [00273] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms upon the subject compounds may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin. [00274] In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution, which in turn, may depend upon crystal size and crystalline form.
[00275] Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.
[00276] Injectable depot forms are made by forming microencapsule matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissue.
[00277] In certain embodiments, a compound or pharmaceutical preparation is administered orally. In other embodiments, the compound or pharmaceutical preparation is administered intravenously. Alternative routs of administration include sublingual, intramuscular, and transdermal administrations.
[00278] When the compounds of the present invention are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1% to 99.5% (more preferably, 0.5% to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.
[00279] The preparations of the present invention may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, etc. administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral administrations are preferred.
[00280] The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
[00281] The phrases "systemic administration," "administered systemically," "peripheral administration," and "administered peripherally" as used herein mean the administration of a compound, drug, combination, pharmaceutical composition, or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
[00282] These compounds or compositions may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.
[00283] Regardless of the route of administration selected, the compounds of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art.
[00284] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
[00285] The selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
[00286] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required to achieve the desired therapeutic effect and then gradually increasing the dosage until the desired effect is achieved. [00287] In some embodiments, a compound or pharmaceutical composition of the invention is provided to a synucleinopathic subject chronically. Chronic treatments include any form of repeated administration for an extended period of time, such as repeated administrations for one or more months, between a month and a year, one or more years, or longer. In many embodiments, a chronic treatment involves administering a compound or pharmaceutical composition of the invention repeatedly over the life of the synucleinopathic subject. Preferred chronic treatments involve regular administrations, for example one or more times a day, one or more times a week, or one or more times a month. In general, a suitable dose such as a daily dose of a compound of the invention will be that amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. Generally doses of the compounds of this invention for a patient, when used for the indicated effects, will range from about 0.0001 to about 100 mg per kg of body weight per day. Preferably the daily dosage will range from 0.001 to 50 mg of compound per kg of body weight, and even more preferably from 0.01 to 10 mg of compound per kg of body weight. However, lower or higher doses can be used. In some embodiments, the dose administered to a subject may be modified as the physiology of the subject changes due to age, disease progression, weight, or other factors.
[00288] If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.
[00289] While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition) as described above.
[00290] The compounds according to the invention may be formulated for administration in any convenient way for use in human or veterinary medicine, by analogy with other pharmaceuticals.
[00291] According to the invention, compounds for treating neurological conditions or diseases can be formulated or administered using methods that help the compounds cross the blood-brain barrier (BBB). The vertebrate brain and CNS has a unique capillary system unlike that in any other organ in the body. The unique capillary system has morphologic characteristics which make up the blood-brain barrier (BBB). The blood-brain barrier acts as a system- wide cellular membrane that separates the brain interstitial space from the blood.
[00292] The unique morphologic characteristics of the brain capillaries that make up the BBB are: (a) epithelial-like high resistance tight junctions which literally cement all endothelia of brain capillaries together, and (b) scanty pinocytosis or transendothelial channels, which are abundant in endothelia of peripheral organs. Due to the unique characteristics of the blood-brain barrier, hydrophilic drugs and peptides that readily gain access to other tissues in the body are barred from entry into the brain or their rates of entry and/or accumulation in the brain are very low.
[00293] In one aspect of the invention, farnesyl transferase inhibitor compounds that cross the
BBB are particularly useful for treating synucleinopathies. In one embodiment, it is expected that farnesyl transferase inhibitors that are non-charged (e.g., not positively charged) and/or non- lipophilic may cross the BBB with higher efficiency than charged (e.g., positively charged) and/or lipophilic compounds. Therefore it will be appreciated by a person of ordinary skill in the art that some of the compounds of the invention might readily cross the BBB. Alternatively, the compounds of the invention can be modified, for example, by the addition of various substitutuents that would make them less hydrophilic and allow them to more readily cross the
BBB.
[00294] Various strategies have been developed for introducing those drugs into the brain which otherwise would not cross the blood-brain barrier. Widely used strategies involve invasive procedures where the drug is delivered directly into the brain. One such procedure is the implantation of a catheter into the ventricular system to bypass the blood-brain barrier and deliver the drug directly to the brain. These procedures have been used in the treatment of brain diseases which have a predilection for the meninges, e.g., leukemic involvement of the brain
(U.S. Patent 4,902,505, incorporated herein in its entirety by reference).
[00295] Although invasive procedures for the direct delivery of drugs to the brain ventricles have experienced some success, they are limited in that they may only distribute the drug to superficial areas of the brain tissues, and not to the structures deep within the brain. Further, the invasive procedures are potentially harmful to the patient.
[00296] Other approaches to circumventing the blood-brain barrier utilize pharmacologic- based procedures involving drug latentiation or the conversion of hydrophilic drugs into lipid- soluble drugs. The majority of the latentiation approaches involve blocking the hydroxyl, carboxyl and primary amine groups on the drug to make it more lipid-soluble and therefore more easily able to cross the blood-brain barrier.
[00297] Another approach to increasing the permeability of the BBB to drugs involves the intra-arterial infusion of hypertonic substances which transiently open the blood-brain barrier to allow passage of hydrophilic drugs. However, hypertonic substances are potentially toxic and may damage the blood-brain barrier.
[00298] Peptide compositions of the invention may be administered using chimeric peptides wherein the hydrophilic peptide drug is conjugated to a transportable peptide, capable of crossing the blood-brain barrier by transcytosis at a much higher rate than the hydrophilic peptides alone. Suitable transportable peptides include, but are not limited to, histone, insulin, transferrin, insulin-like growth factor I (IGF-I), insulin-like growth factor II (IGF-II), basic albumin and prolactin.
[00299] Antibodies are another method for delivery of compositions of the invention. For example, an antibody that is reactive with a transferrin receptor present on a brain capillary endothelial cell, can be conjugated to a neuropharmaceutical agent to produce an antibody- neuropharmaceutical agent conjugate (U.S. Patent 5,004,697, incorporated herein in its entirety by reference). The method is conducted under conditions whereby the antibody binds to the transferrin receptor on the brain capillary endothelial cell and the neuropharmaceutical agent is transferred across the blood brain barrier in a pharmaceutically active form. The uptake or transport of antibodies into the brain can also be greatly increased by cationizing the antibodies to form cationized antibodies having an isoelectric point of between about 8.0 to 11.0 (U.S. Patent 5,527,527, incorporated herein in its entirety by reference).
[00300] A ligand-neuropharmaceutical agent fusion protein is another method useful for delivery of compositions to a subject (U.S. Patent 5,977,307, incorporated herein in its entirety by reference). The ligand is reactive with a brain capillary endothelial cell receptor. The method is conducted under conditions whereby the ligand binds to the receptor on a brain capillary endothelial cell and the neuropharmaceutical agent is transferred across the blood brain barrier in a pharmaceutically active form. In some embodiments, a ligand-neuropharmaceutical agent fusion protein, which has both ligand binding and neuropharmaceutical characteristics, can be produced as a contiguous protein by using genetic engineering techniques. Gene constructs can be prepared comprising DNA encoding the ligand fused to DNA encoding the protein, polypeptide or peptide to be delivered across the blood brain barrier. The ligand coding sequence and the agent coding sequence are inserted in the expression vectors in a suitable manner for proper expression of the desired fusion protein. The gene fusion is expressed as a contiguous protein molecule containing both a ligand portion and a neuropharmaceutical agent portion.
[00301] The permeability of the blood brain barrier can be increased by administering a blood brain barrier agonist, for example bradykinin (U.S. Patent 5,112,596, incorporated herein in its entirety by reference), or polypeptides called receptor mediated permeabilizers (RMP) (U.S. Patent 5,268,164, incorporated herein in its entirety by reference). Exogenous molecules can be administered to the host's bloodstream parenterally by subcutaneous, intravenous or intramuscular injection or by absorption through a bodily tissue, such as the digestive tract, the respiratory system or the skin. The form in which the molecule is administered (e.g., capsule, tablet, solution, emulsion) depends, at least in part, on the route by which it is administered. The administration of the exogenous molecule to the host's bloodstream and the intravenous injection of the agonist of blood-brain barrier permeability can occur simultaneously or sequentially in time. For example, a therapeutic drug can be administered orally in tablet form while the intravenous administration of an agonist of blood-brain barrier permeability is given later (e.g., between 30 minutes later and several hours later). This allows time for the drug to be absorbed in the gastrointestinal tract and taken up by the bloodstream before the agonist is given to increase the permeability of the blood-brain barrier to the drug. On the other hand, an agonist of blood-brain barrier permeability (e.g., bradykinin) can be administered before or at the same time as an intravenous injection of a drug. Thus, the term "co-administration" is used herein to mean that the agonist of blood-brain barrier and the exogenous molecule will be administered at times that will achieve significant concentrations in the blood for producing the simultaneous effects of increasing the permeability of the blood-brain barrier and allowing the maximum passage of the exogenous molecule from the blood to the cells of the central nervous system. [00302] In other embodiments, compounds of the invention can be formulated as a prodrug with a fatty acid carrier (and optionally with another neuroactive drug). The prodrug is stable in the environment of both the stomach and the bloodstream and may be delivered by ingestion. The prodrug passes readily through the blood brain barrier. The prodrug preferably has a brain penetration index of at least two times the brain penetration index of the drug alone. Once in the central nervous system, the prodrug, which preferably is inactive, is hydrolyzed into the fatty acid carrier and the farnesyl transferase inhibitor (and optionally another drug). The carrier preferably is a normal component of the central nervous system and is inactive and harmless. The compound and/or drug, once released from the fatty acid carrier, is active. Preferably, the fatty acid carrier is a partially-saturated straight chain molecule having between about 16 and 26 carbon atoms, and more preferably 20 and 24 carbon atoms. Examples of fatty acid carriers are provided in U.S. Patents. 4,939,174; 4,933,324; 5,994,932; 6,107,499; 6,258,836; and 6,407,137, the disclosures of which are incorporated herein by reference in their entirety. [00303] The administration of the agents of the present invention may be for either prophylactic or therapeutic purposes. When provided prophylactically, the agent is provided in advance of disease symptoms. The prophylactic administration of the agent serves to prevent or reduce the rate of onset of symptoms of a synucleinopathy. When provided therapeutically, the agent is provided at (or shortly after) the onset of the appearance of symptoms of actual disease. In some embodiments, the therapeutic administration of the agent serves to reduce the severity and duration of the disease.
[00304] The function and advantage of these and other embodiments of the present invention will be more fully understood from the examples described below. The following examples are intended to illustrate the benefits of the present invention, but do not exemplify the full scope of the invention.
EXAMPLES Experimental Procedures
[00305] Tissue culture: AU cell lines were obtained by ATCC. SH-SY5Y and Cos-7 were grown in 10% FBS DMEM (Sigma). Cells were split the day before experiments including transfection, metabolic labeling and drug treatment.
[00306] Proteins and antibodies: UCH-Ll variants were purified according to the published procedure. Synuclein antibody (SYN-I) was purchased from Signal Transduction Lab. Actin antibody and FLAG antibody (M2) were from Sigma. UCH-Ll antibody (anti-PGP 9.5) was from Chemicon. [00307] Chemicals: FTI-277 and lactacystin was purchased from Calbiochem. Crosslinking reagent DE was from Pierce. DMEM and MEM were purchased from Gibco. All the other material was purchased from Sigma.
[00308] Plasmids: C220S cDNA was generated by PCR site-specific mutagenesis. For the PCR, the 5' primer is uchforw SEQ ID NO: 1
(CTAAAGCTTATGCAGCTCAAGCCGATGGAG), and 3' primer is uchc220s SEQ ID NO:2 (CTAAGA CTCGAGTTAGGCTGCCTTGCTGAGAGC). Wt UCH-Ll served as the template. The PCR fragment was inserted into pcDNA vector. For S18YC220S mutant, S18Y UCH-Ll served as the template in PCR. For the FLAG tagged UCH-Ll, the 5' primer is FLAGuchforw SEQ ID NO: 3
(CTAAAGCTTATGGACTACAAGGATGACGACGACAAAGATGCAGCTCAAGC CGATGGAG), and the 3' primer is uchrev SEQ ID NO: 4
(ATCCTCGAGTTAGGCTGCCTTGACGAGAGC). Wt UCH-Ll or C220S served as the template. PCR fragment was purified and inserted into pcDNA vector. For the FLAG tagged UCH-L3, the 5' primer is L3HindIII SEQ ID NO: 5 (CTAAAGCTT ATGGACTAC AAGGATGACGACGACAAAGATGGAGGGTCAACGCTGGCTG), the 3 'primer is L3XhoISAA SEQ ID NO: 6 (ATCCTCGAGCTATGCTGCAGAAAGAGCAATCGCA). For the UCH-L3 CKAA variant, the 5' primer is L3 HindIII and the 3' primer is L3XhoICKAA SEQ ID NO: 7 (ATCCTCGAGCTATGCTGCCTTAGAAAGAGCAATCGCATTAAATC). α-synuclein degradation assay: Lipofectamine 2000 was used to transfect COS-7 cells according to the Invitrogen protocol. Transfected cells were cultured at 37 0C for 48 hours before being treated with 35 μM lactacystin or DMSO. After 24 hours of incubation, the cells were lysed with Tris buffer (50 mM Tris, 2% SDS, 0.1% NP-40), and subjected to SDS-PAGE, followed by quantitative Western blotting.
[00309] Salt and detergent treatment of SV fraction: SV fraction was prepared as describe elsewhere. SV was incubated with various salts at designed concentration for 30 minutes on ice, or 1% Triton X-100 or control without salts and detergent. Treated SV was pelleted at 100,000g for 30 minutes. Supernatants and pellets were subjected to SDS-PAGE and Western blotting. [00310] Membrane fractionation: Cells were harvested by scraping and washed with PBS. Cell pellet was suspended in lysis buffer (50 mM Tris-HCl, 1 mM EDTA) supplemented with protease inhibitor cocktail (Sigma) and homogenized by passing through 26G needles 10 times. Suspension was clarified by spinning at 60Og for 5 minutes. Clarified suspension was ultracentrifuged at 100,00Og for 2 hours and separated into membrane and cytosol. Membrane fraction was washed with washing buffer (50 mM Tris-HCl, 1 mM EDTA 1 M NaCl), and pelleted each time with bench-top centrifuge.
[00311] 2D electrophoresis: For the isolation of total cellular protein, cultured SH-S Y5 Y cells maintained as described above were rinsed with ice-cold PBS. Cells were lysed in ImI dSDS buffer (5OmM Tris-HCl, pH 8.0 0.1% SDS) supplemented with protease inhibitor cocktail. Lysates were boiled for 3 min, and were treated with Dnase and Rnase as described. Lysates were precipitated with ice-cold acetone for at least 2 hours, and pellets were resuspended in 2D sample buffer (8M urea, 0.5% CHAPS, 0.2% DTT, 0.5% IPG buffer, 0.002% bromophenol blue). 2D electrophoresis was carried out according to manufacture's protocol (Amersham Life Science). 7cm pH 4-7 strips were used. For SH-SY5Y membrane fraction, culture SH-SY5Y cells were rinsed with cold PBS and harvested with lysis buffer (5OmM Tris-HCl, pH 8.0, ImM ZnAc2, 25OmM sucrose). Lysate was passed through 25G needles for several times and spun at lOOOg for 5 min. Supernatant was centrifuged at 200,00Og for 2 hours. Pellet was extensively washed with lysis buffer and extracted with cold acetone. Pellet was resuspended in 2D sample buffer.
[00312] Viral Infection: Viral infection and MTT assay in SH-SY5Y cells: The viruses were amplified and purified according to the published procedure. SH-SY5Y cells were grown on 100mm petri-dishes and induced with 10OnM retinoic acid for 3-5 days before the virus infection with M.I. O at 75. Viruses were diluted with DPBS to desired M.I.O.. After four hours of incubation, 10ml growth medium was added. On the second day, cells were splitted into 96-well plates and treated with compounds for next 48 hours. The growth medium in each well was replaced with growth medium with 5ug/ml MTT. Medium was removed after three hours incubation, and 200ul isopropyl (0.04N HCl) was added into each well. The signal was read at 570nm.
[00313] Viable cell counting: At stated time poins, SH-SY5Y cells were trypsinized with lOOul trypsin-EDTA for 1 minute and neutralized with 400ul growth medium. Cell suspension was made up by mixing 0.2 ml of cells in growth medium, 0.3 ml of HBSS and 0.5 ml of 0.4% Trypan Blue solution. Viable cell numbers were counted by standard cell counting chamber. [00314] Western Blotting: Following transfer of SDS gels onto NC membrane, all membranes were blocked with 5% non-fat milk in TBST (5OmM Tris-HCl pH7.4, 15OmM NaCl, 0.1% Tween 20), and incubated with primary antibody overnight with 1% BSA in TBST, washed three times with TBST, and incubated with horseradish peroxidase-conjugated secondary antibody for 1 hour (Promega). Bound antibodies were detected using enhanced chemiluminascence (NEM).
Example 1: UCH-Ll is farnesylated in vivo and in cell culture
[00315] The UCH-Ll sequence contains the sequence CXXX, a consensus farnesylation site, at its C-terminus. This sequence is not present in UCH-L3. The possibility that this sequence was modified in vivo was investigated. First, the chemical nature of the previously reported association of UCH-Ll and synaptic vesicles from rat brain was probed. [00316] The results are shown in Figure 1, panel A: Effects of various amount of salt and non-ionic detergent on the dissociations of synapsin I, synaphysin and UCH-Ll from SV was analyzed by treating aliquots of SV fraction with either KCl, NaCl, MgCl2, or 1% Triton X-100. Membrane fraction and soluble fraction was separated by centrifugation and each fraction was subjected to SDS-PAGE followed by Western blots, a (synapsin I), c (synaphysin) and e (UCH- Ll) are from pellet, and b (synapsin I), d (synaphysin) and f (UCH-Ll) are supernatant fractions. Unlike synapsin (Figure 1, panel A, rows a and b), which is not an integral membrane protein, and like synaptophysin (rows c and d), UCH-Ll (rows e and f) could not be separated from the vesicular fraction by increasing salt concentration. Only treatment with detergent was sufficient to solubilize UCH-Ll, consistent with its farnesylation.
[00317] Analysis of various fractions from SH-SY5Y neuroblastoma cells (similar results from rat brain, not shown) by two-dimensional SDS-PAGE gel electrophoresis showed two major and two minor species in the total homogenate and one species in the membrane- associated fraction (Figure 1, panel B: More than two forms of UCH-Ll were present in SH- SY5Y cell (gel a) detected using 2D electrophoretic analysis followed by Western blotting. Only one of them (open arrow) is associated with membrane (gel b). Treatment of SH-S Y5 Y cells with FTI-277 (gel d) results in a significant decrease in the amount of membrane bound UCH-Ll (open arrow) without affecting the amount of cytosolic UCH-Ll (close arrow) when compared to cells treated with DMSO (gel c). This species was presumably the fully processed species: farnesylated, truncated and C-terminally methylated. [00318] Consistent with this premise, treatment of the cells with the farnesyl transferase inhibitor FTI -277 decreased the amount of the membrane-associated species. In addition, a UCH-Ll -containing species was immunoprecipitated from whole cell lysate by an anti-farnesyl antibody (Calbiochem). Finally, treatment of the cells with 14C-mevalonic acid or with 3H- farnesol resulted in incorporation of radiolabel into UCH-Ll {Figure 1, panel C). UCH-Ll was modified with [14C] mevalonate (gel a) and [3H] farnesol (gel b) in vivo. (b). Transfection of the C220S mutant into COS-7 cells prevented radioincorporation and eliminated the membrane- associated species (not shown). Figure 1, panel D, shows that WT UCH-Ll but not the C220S variant was detected in the membrane fraction of COS-7 cells transfected with either of the UCH-Ll variants).
Example 2: Removal of the farnesyltation site has no effect on the in vitro enzymatic activity or aggregation properties of UCH-Ll
[00319] The C220S mutant as expressed in E. coli and purified using a published method. As expected from examination of structural models of UCH-Ll, the point mutation had no effect on the in vitro hydrolase (Figure 2, panel A) or ligase (panel B) activities. (A) Michaelis-Menten plot of various amount Ub-AMC titrated against either UCH-Ll WT (close circle) or C220S (open circle) showed comparable hydrolytic activities. (B) The mutation does not affect UCH- Ll in vitro ligase activity. In addition, the C220S mutation did not eliminate the propensity of S18 to oligomerize. This finding cleared the way to examine the effects of C220S in cell culture.
Example 3: Farnesylation and membrane association of UCH-Ll is required to promote accumulation of α-synuclein in COS-7 cells
[00320] The C220S mutation eliminated the ability of S 18 to promote α-synuclein accumulation in COS-7 cells but had no effect on the S18Y polymorph (Figure 2, panel C): the relative amount of 16kDa α-synuclein was quantified and normalized against the amount of actin in transfected COS-7 cells with the presence of UCH-Ll variants. 100% accumulation of α- synuclein was achieved in cells treated with the proteasome inhibitor lactacystin). This finding suggested that farnesylation and membrane attachment of UCH-Ll are both required. In order to isolate the latter possibility, a mutant form of UCH-L3 was constructed in which the UCH-Ll farnesylation sequence was added to the UCH-L3 C-terminus. This protein did not cause accumulation of α-synuclein (panel D): The relative amount of α-synuclein in COS-7 cells transfected with UCH-Ll and UCH-L3 variants was compared), although it was farnesylated and incorporated into the membrane. Thus, membrane attachment of an active hydrolase was insufficient to cause accumulation of α-synuclein.
Example 4: Inhibition of farnesylation rescues cell death caused by α-synuclein overexpression in SH-SY5Y cells
[00321] Since α-synuclein neurotoxicity is dose-dependent, it follows that accumulation of α-synuclein, caused by UCH-Ll farnesylation, should promote its toxicity. We demonstrated this to be true in mammalian neuroblastoma SH-SY5Y cells. This dopaminergic cell line has been used to demonstrate the rescue of α-synuclein toxicity by parkin, an effect that has also been demonstrated in primary dopaminergic cultures. These cells express high endogenous levels of UCH-Ll. The α-synuclein gene was overexpressed (as compared to endogenous levels) via infection with an adenoviral vector and toxicity was demonstrated by the Trypan blue {Figure 3) and MTT assays (Figure 4). Figure 3 shows SH-SY5Y cells infected by α - synuclein-expressing adenovirus treated with DMSO (A), FTI-277 (B), LDN57414 (C), FTI-277 and LDN57414 (D) . (E) Viable cell numbers were quantified by counting the cells treated with either DMSO (lower dark circles), FTI-277 (upper dark circles), LDN57414 (light triangles) or LDN57414 and FTI-277 (dark triangles) that did not stain with trypan blue. The unit of y-axis is 105 /ml. (F) Cell viability was assessed by the amount of metabolic activity using MTT assay. Figure 4 shows: (A) the viability of SH-S Y5 Y cells infected by α- synuclein-expressing adenovirus after treatment of DMSO (closed triangles) or FTI-277 (open triangles), and of cells infected with lacZ-expressing adenovirus after treatment of DMSO (closed circles) or FTI-277 (open circles), and of cells infected with empty adenovirus after treatment of DMSO (closed squares) or FTI-277 (open squares) were assessed using MTT assay. The effect of FTI-277 on the α-synuclein accumulation in the SH-SY5 Y infected with α-synuclein-expressing adenovirus were analyzed by Western blotting (B) and the amount of α-synuclein (C) was quantified using NIH Image program and normalized against the amount of actin.
[00322] The commercially-available small molecule farnesyl transferase inhibitor FTI-277, which had previously been shown to reduce the amount of membrane-associated, farnesylated species (Figure 1, panel B, row d), resulted in a significantly decreased loss of cells (compare Figure 3, panel B to panel A). This neuroprotective effect was eliminated by co-adminstration of the small-molecule UCH-Ll inhibitor (not shown), suggesting that the FTI effect was primarily due to its effect on UCH-Ll . Treatment with FTI -277 reduced the total amount of UCH-Ll in SH-S Y5 Y cells and increased its rate of turnover (pulse-chase experiment not shown), in addition to reducing the amount of membrane-associated protein. This treatment also reduced the amount of α-synuclein in these cells (Figure 4, panels B and C). [00323] The following publications describe useful farnesyl transferase inhibitor compounds, their structural and functional analogs and compositions and related synthetic methods: US 6,258,824, US 6,388,092, US 6,710,209, US 6,479,513, US 6,740,757, US 6,734,308, US 6,645,982, US 6,579,887, US 6,545,020, US 6,458,800, US 6,451,812, US 6,420,387, US 6,294,552, US 6,187,786, US 6,177,432, US 6,169,096, US 6,150,377, US 6,037,350, US 5,968,952, US 6,777,438, US 6,486,202; US 5,850,918; US 5,238,922, WO01/46137, US 2003/0083348, WO 2002050058, WO 2002085364, WO 2002064142, WO 2002043733, WO 2001064252, US 2002019530, US 2002120145, US 2003212008, WO 2001064246, US 2003022918, WO 2001064226, US 2003027808, US 2003114487, US 2004192727, WO 2001064218, US 2003125326, WO 2001064217, US 2003078281, WO 2001064199, US 2003181473, WO 2001064198, US 2003050323, WO 2001064197, US 2003125268, WO 2001064196, US 2003060480, WO 2001064195, US 2003186925, WO 2001064194, US 2003100553, WO 2001062234, US 2003060450, WO 2001056552, US 2003027839, WO 2000001411, US 6545020, WO 2000001386, US 6451812, WO 9855124, US 6365600, US 2002091138, WO 9721701, US 6169096, US 6420387, WO 2002024687, US 2003199547, WO 2002024686, US 2003207887, WO 2002024683, WO 2002072574, US 6358961, WO 2003080058, WO 2003/021355, WO 2001/53289, WO 2000/47574, and WO 2000/12499; each of which is incorporated herein by reference. The disclosures of these and all patents, published patent applications, and scientific publications are incorporated herein by reference in their entirety.
Example 5: Treatment with Zarnestra Decreases α-Synuclein Levels in the Brain
[00324] Farnesyl transferase inhibitors Zarnestra and OSI-754 were administered to mice of the α-synuclein transgenic line described in Masliah et al. (Masliah et al. "Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders" Science 287(5456): 1265-69, 2000; incorporated herein by reference). Animals from this line have α-synuclein neuronal inclusions in the cortex, hippocampus, and the olfactory bulb (Masliah et al. "Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders" Science 287(5456): 1265-69, 2000; incorporated herein by reference). Transgenic mice were orally administered either FTI in 20% cyclodextrin solution or the same volume of vehicle alone twice a day for 30 or 90 days. In some cases, non- transgenic mice also received vehicle twice a day for 30 to 90 days. At the end of treatment, mice were sacrificed, and the brains removed and hemisected. One hemisphere of each was fixed in 4% paraformaldehyde/PBS (pH 7.4), cryoperserved, then sectioned for histology. The other hemisphere was subdivided into four brain regions, including the cortex and hippocampus, that were homogenized and processed into cytoplasmic and membrane fractions.
Figure imgf000134_0001
[00325] Transgenic animals treated with 35 mg/kg Zarnestra twice a day for 30 days exhibited fewer inclusions than transgenic animals administered vehicle alone. Formation of α -synuclein inclusions in the cortex and hippocampus was probed by immunostaining with an antibody for human α-synuclein. Cells positive for human α-synuclein were quantified. In both regions, transgenic mice that received Zarnestra had significantly fewer α -synuclein-positive cells per mm2 than those treated with vehicle (Figure 6). Representative images are shown in Figure 7. These regions were also analyzed for ubiquitin-immunoreactive inclusions and by the Campbell Switzer method of silver staining. Ubiquitin is known to be a constituent of Lewy Bodies and in the α-synculein inclusions found in the transgenic mouse line used in the study (Masliah et al. "Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders" Science 287(5456): 1265-69, 2000; incorporated herein by reference). Transgenic mice that received Zarnestra had fewer ubiquitin-immuoreactive inclusions than those treated with vehicle alone {Figure 8). Campbell-Switzer staining is a general marker of Lewy Body type inclusions (Uchihara et al. "Silver stainings distinguish Lewy bodies and glial cytoplasmic inclusions: comparison between Gallyas-Braak and Campbell- Switzer methods" Acta Neuropathol. (Berl.) 110(3):255-60, 2005; incorporated herein by reference). Transgenic mice treated with Zarnestra had fewer inclusions than those that received vehicle alone {Figure 9).
[00326] Treatment with 35 mg/kg Zarnestra twice a day for 30 days decreased levels of α- synuclein protein in the cortex and the amount of farnesylated UCH-Ll in the cortex of transgenic mice. Total α -synuclein levels were analyzed by a sandwich ELISA assay similar to one previously described (El-Agnaf et al. "Detection of oligomeric forms of alpha-synuclein protein in human plasma as a potential biomarker for Parkinson's disease" FASEB J. 20(3) :419- 25, 2006; incorporated herein by reference). In the cortex of vehicle treated animals, α - synuclein protein levels in the α -synuclein transgenic line are greater than in non-transgenic mice in both cytoplasmic {Figure 10) and membrane fractions {Figure 11). Transgenic mice that received Zarnestra had lower α -synuclein protein levels than vehicle-treated transgenic mice and nearly the same as that detected in the non-transgenic group in both the cytoplasmic {Figure 10) and membrane fractions {Figure 11), which represent soluble and insoluble α -synuclein, respectively. Farnesylated UCH-Ll in the cortex is contained in the membrane fraction. The amount of UCH-Ll was determined by quantitative Western Blot. Vehicle-treated α-synuclein transgenic mice had significantly more farnesylated UCH-Ll than non-transgenic mice. Treatment with Zarnestra decreased the amount of farnesylated UCH-Ll in transgenic mice to levels similar to non-transgenic mice that received vehicle alone {Figure 12). [00327] Treatment with 45 mg/kg OSI-754 twice a day for 30 days decreased levels of α- synuclein protein and decreased the amount of farnesylated UCH-Ll in the cortex of transgenic mice. Total α-synuclein levels were analyzed by a sandwich ELISA assay. Transgenic mice that received OSI-754 at this dose had lower α-synuclein protein levels than vehicle-treated transgenic mice in both cytoplasmic {Figure 13) and membrane fractions {Figure 14). The amount of farnesylated UCH-Ll was determined by quantitative Western Blot, then normalized to actin. Treatment with OSI-754 decreased the amount of farnesylated UCH-Ll in transgenic mice {Figure 15).
[00328] Treatment with either 45 mg/kg OSI-754 twice a day or with 9 mg/kg OSI-754 twcie a day for 90 days decreased levels of α-synuclein protein in the cortex and hippocampus. Total α-synuclein levels were analyzed by a sandwich ELISA assay. Transgenic mice that received OSI-754 had lower α-synuclein protein levels than vehicle-treated transgenic mice in both cytoplasmic {Figure 16) and membrane fractions {Figure 17).
Transgenic α-synuclein mice treated with either 45 mg/kg OSI-754 twice a day or with 9 mg/kg OSI-754 twice a day for 90 days exhibited fewer inclusions than transgenic animals administered vehicle alone. Formation of α -synuclein inclusions in the cortex and hippocampus was probed by immunostaining with an antibody for human α -synuclein. Cells positive for human α -synuclein were quantified. In both regions, transgenic mice that received OSI-754 at either dose had fewer α-synuclein-positive cells per mm2 than those treated with vehicle {Figure 18). Representative images from the cortex and hippocampus are shown in Figure 19. OSI-754 treatment did not affect neuronal morphology or density in either region as shown by staining for Neuronal Specific Nuclear Protein (NeuN). Representative images from the cortex and hippocampus are shown in Figure 20.
Example 6: Inhibition of α-synuclein Aggregation
[00329] Nortriptyline, indatraline, fluoxetine, norfluoxetine, norclomipramine, nordoxepin, maprotiline, and sertraline were found to bind to α-synuclein and affect the rate of protein aggregation in the presence of 1,1, 1,3,3, 3-hexafluoro-2-propanol (HFIP). HFIP induces rapid structure formation and aggregation of α -synuclein (Munishkina et al. (2003). "Conformational behavior and aggregation of alphα-synuclein in organic solvents: modeling the effects of membranes" Biochemistry 42(9): 2720-30; Maiti et al. (2004) "Raman spectroscopic characterization of secondary structure in natively unfolded proteins: α-synuclein" J Am Chem Soc 126(8): 2399-408). Compounds were incubated with purified recombinant human α- synuclein (20 μM) in a buffer containing HFIP (25 mM Tris, pH 8.0, 3.1% HFIP) at room temperature. Structure formation was monitored by Thioflavin T flourescence and fluorescence polarization. Thioflavin T fluorescence can be used to measures aggregation of amyloidogenic proteins, including α-synuclein (exctiation, 440 nm; emission, 495 nm) (Naiki et al. (1989) "Fluorometric determination of amyloid fibrils in vitro using the fluorescent dye, thioflavin Tl" AnalBiochem 177(2): 244-9; Conway et al. (2000). "Fibrils formed in vitro from alphα- synuclein and two mutant forms linked to Parkinson's disease are typical amyloid" Biochemistry 39(10): 2552-63). Average molecular size was monitored by fluorescence polarization using human α-synuclein covalently conjugated to Alexa Fluor 594 (exctiation, 546 nm; emission, 620 nm). Assays were performed in a 384-well plate and readings taken directly from each well over time. Nortriptyline (Figure 21) and indatraline (Figure 22) cause a dose-dependent increase in the rate of structure formation of α-synuclein in the presence of HFIP as determined by Thioflavin T fluorescence and fluorescence polarization. Dose-dependent effects on α-synuclein aggregation were also observed by Thioflavin T fluorescence measurements for fluoxetine, norfluoxetine (Figure 23), protriptyline, maprotiline (Figure 24), norclomipramine, nordoxepin (Figure 25) and sertraline (Figure 26).
[00330] Nortriptyline, indatraline, and fluoxetine delay the onset of α-synuclein aggregation in a buffer system relevant to physiological conditions. The rate of the α-synuclein aggregation was determined by monitoring the amount of α-synuclein monomer in solution and by fluorescence polarization. Recombinant α-synuclein (70 μM, 20 mM Bis-tris propane, 100 mM LiCl, pH 7.4, 700 μl total volume) was incubated at 37°C with gentle agitation. Samples (40 μl) were separated on a 2 ml Shodex KW-G gel filtration column (20 mM Bis-tris propane, 100 mM LiCl, pH 7.4, 0.5 ml/min). Absorbance at 280 nm was recorded and the monomer peak height was quantified. At the same time points, aliquots (5 μl) were diluted ten-fold and fluorescence polarization measured in a 384-well plate. At a single concentration (100 μM), nortriptyline, indatraline, and fluoxetine delayed loss of α-synuclein monomer from solution (Figure 27A) and also the formation of larger structures (Figure 27B). This effect was dose-dependent (Figure 28). [00331] Nortriptyline and indatraline decrease α-synuclein neurotoxicity toward dopaminergic neurons. Midbrain cultures will be prepared from El 7 rat ventral mesencephalon as described in a published protocol (Xu et al. (2002) "Dopamine-dependent neurotoxicity of alphα-synuclein: a mechanism for selective neurodegeneration in Parkinson disease" Nat Med 8(6): 600-6). Cultured cells were infected with a recombinant lentivirus encoding human A53T α-synuclein (A53T) or a control virus (none). Cells were treated with various concentrations of nortriptyline (black bars) or indatraline (white bars) for 3 days. Cells were then fixed and immunostained for Microtubule-associated protein 2, which stains all neurons, and Tyrosine Hydroxylase, a marker for dopaminergic neurons. Toxicity of A53T α-synuclein toward dopaminergic neurons was determined by calculating the percentage neurons positive for tyrosine hydroxylase (TH+ cells). Both nortriptyline and indatraline diminished toxicity of A53T α-synuclein toward dopaminergic neurons in a dose-dependent manner (Figure 9). [00332] Nortriptyline was administered to mice of the α-synuclein transgenic line described in Masliah et al. ((2000) "Dopaminergic loss and inclusion body formation in alphα-synuclein mice: implications for neurodegenerative disorders" Science 287(5456): 1265-9). Animals from this line have α-synuclein neuronal inclusions in the cortex, hippocampus, and the olfactory bulb. Transgenic mice were administered Notriptyline in saline (0.9%) or the same volume of vehicle alone once a day intraperitoneally for 30 days. At the end of treatment, mice were sacrificed and the brains removed and hemisected. One hemisphere of each was fixed in 4% paraformaldehyde/PBS (pH 7.4), cryoperserved, then sectioned for histology. From the other hemisphere, the cortex and hippocampus were dissected, homogenized, and processed into cytoplasmic and membrane fractions.
[00333] Treatment with 25 mg/kg nortriptyline once a day for 30 days decreased levels of α- synuclein protein in the cortex and hippocampus. Total α-synuclein levels were analyzed by a sandwich ELISA assay similar to one previously described (El-Agnaf et al. (2006) "Detection of oligomeric forms of α-synuclein protein in human plasma as a potential biomarker for Parkinson's disease" Faseb J 20(3) :419-25). Transgenic mice that received nortripytline had lower α-synuclein protein levels than vehicle-treated transgenic mice in the cytoplasmic and membrane fractions in both the hippocampus and cortex (Figure 30).
[00334] Transgenic animals treated with nortriptyline (25 mg/kg, 5 mg/kg, and 0.5 mg/kg) once a day (ip administration) for 30 days exhibited fewer human α-synuclein immunoreactive cells than transgenic animals administered vehicle alone. Formation of α-synuclein inclusions in the cortex and hippocampus was probed by immunostaining with an antibody for human α- synuclein. Cells positive for human α-synuclein were quantified. In both regions, transgenic mice that received nortriptyline had significantly fewer α-synuclein-positive cells per mm2 than those treated with vehicle after 30 days of treatment (Figures 31 and 33). Representative images from the hippocampus of 4 month old α-synuclein transgenic mice treated with 25 mg/kg nortriptyline are shown in Figure 32. [00335] Having now described some illustrative embodiments of the invention, it should be apparent to those skilled in the art that the foregoing is merely illustrative and not limiting, having been presented by way of example only. Numerous modifications and other illustrative embodiments are within the scope of one of ordinary skill in the art and are contemplated as falling within the scope of the invention. In particular, although many of the examples presented herein involve specific combinations of method acts or system elements, it should be understood that those acts and those elements may be combined in other ways to accomplish the same objectives. Acts, elements and features discussed only in connection with one embodiment are not intended to be excluded from a similar role in other embodiments. Further, for the one or more means-plus-function limitations recited in the following claims, the means are not intended to be limited to the means disclosed herein for performing the recited function, but are intended to cover in scope any means, known now or later developed, for performing the recited function. Use of ordinal terms such as "first", "second", "third", etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements. Similarly, use of a), b), etc., or i), ii), etc. does not by itself connote any priority, precedence, or order of steps in the claims. Similarly, the use of these terms in the specification does not by itself connote any required priority, precedence, or order.
[00336] The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.

Claims

ClaimsWhat is claimed is:
1. A method of treating a synucleinopathic subject, the method comprising administering to a synucleinopathic subject:
(a) a therapeutically effective amount of a farnesyl transferase inhibitor or a pharmaceutically acceptable form thereof; and
(b) a therapeutically effective amount of an agent that inhibits the aggregation of α- synuclein or a pharmaceutically acceptable form thereof.
2. The method of claim 1, wherein the synucleinopathic subject has a synucleinopathy selected from the group consisting of Parkinson's disease, diffuse Lewy body disease, multiple system atrophy disorder, and pantothenate kinase-associated neurodegeneration.
3. The method of claim 1, wherein the synucleinopathic subject has Parkinson's disease.
4. The method of claim 1, wherein the synucleinopathic subject has a disease associated with abnormal synuclein accumulation or metabolism selected from the group consisting of amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and Alzheimer's disease (AD).
5. The method of claim 1, 2, 3, or 4, wherein the subject is a human.
6. The method of claim 1, 2, 3, or 4, wherein the therapeutically effective amount of the farnesyl transferase inhibitor or a pharmaceutically acceptable form thereof comprises about 10 ng/kg of body weight to about 1000 mg/kg of body weight at a frequency of administration from once a day to once a month.
7. The method of claim 1, 2, 3, or 4, wherein the therapeutically effective amount of the agent that inhibits the aggregation of alpha-synuclein or a pharmaceutically acceptable form thereof comprises about 10 ng/kg of body weight to about 1000 mg/kg of body weight at a frequency of administration from once a day to once a month.
8. The method of claim 1, wherein the farnesyl transferase inhibitor is LNK-754 (OSI-754).
9. The method of claim 1 , wherein the farnesyl transferase inhibitor is of formula:
Figure imgf000141_0001
10. The method of claim 1, wherein the farnesyl transferase inhibitor is LNK-427 (OSI-427).
11. The method of claim 1 , wherein the farnesyl transferase inhibitor is of formula:
Figure imgf000141_0002
12. The method of claim 1 , wherein the farnesyl transferase inhibitor is Zarnestra.
13. The method of claim 1 , wherein the farnesyl transferase inhibitor is Sarasar.
14. The method of claim 1 , wherein the agent that inhibits the aggregation of α-synuclein is selected from the group consisting of nortriptyline, maprotiline, protriptyline, norclomipramine, sertraline, fluoxetine, norfluoxetine, nordoxepin, and indatraline.
15. The method of claim 1, wherein the farnesyl transferase inhibitor is LNK-754, and the agent that inhibits the aggregation of α-synuclein is nortriptyline.
16. The method of claim 1, wherein the farnesyl transferase inhibitor is LNK-427, and the agent that inhibits the aggregation of α-synuclein is nortriptyline.
17. The method of claim 1 , wherein the farnesyl transferase inhibitor is Zarnestra, and the agent that inhibits the aggregation of α-synuclein is nortriptyline.
18. The method of claim 1 , wherein the farnesyl transferase inhibitor is Sarasar, and the agent that inhibits the aggregation of α-synuclein is nortriptyline.
19. The method of claim 1 further comprising administering to the subject an amount of one or more non- farnesyl transferase inhibitor compounds effective to treat a neurological disorder.
20. The method of claim 19, wherein each non- farnesyl transferase inhibitor compound is selected from the group consisting of dopamine agonist, DOPA decarboxylase inhibitor, dopamine precursor, monoamine oxidase blocker, cathechol O-methyl transferase inhibitor, anticholinergic, and NMDA antagonist.
21. The method of claim 19, wherein each non- farnesyl trasferase inhibitor compound is selected from the group consisting of Memantine, Aricept, and other acetylcholinesterase inhibitors.
22. An article of manufacture comprising packaging material; a farnesyl transferase inhibitor or a pharmaceutically acceptable form thereof; and an agent that inhibits the aggregation of α- synuclein or a pharmaceutically acceptable form thereof; wherein the article of manufacture further comprises a label or package insert indicating that the farnesyl transferase inhibitor and the agent that inhibits the aggregation of α-synuclein can be administered to a subject for treating a synucleinopathy.
23. The article of manufacture of claim 22, wherein the synucleinopathy is selected from the group consisting of: Parkinson's disease, diffuse Lewy body disease, multiple system atrophy disorder, and pantothenate kinase-associated neurodegeneration.
24. The article of manufacture of claim 22, wherein the synucleinopathy is Parkinson's disease.
25. The article of manufacture of claim 22, wherein the synucleinopathic subject has a disease associated with abnormal synuclein accumulation or metabolism selected from the group consisting of amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and Alzheimer's disease (AD).
26. The article of manufacture of claim 22, further comprising one or more non-farnesyl transferase inhibitor compounds effective to treat a neurological disorder.
27. The article of manufacture of claim 26, wherein each non-farnesyl transferase inhibitor compound is selected from the group consisting of dopamine agonist, DOPA decarboxylase inhibitor, dopamine precursor, monoamine oxidase blocker, cathechol O-methyl transferase inhibitor, anticholinergic, and NMDA antagonist.
28. The article of manufacture of claim 26, wherein each non-farnesyl trasferase inhibitor compound is selected from the group consisting of Memantine, Aricept, and other acetylcholinesterase inhibitors.
29. A pharmaceutical composition for treating a synucleinopathy or other neurodegenerative disease comprising a therapeutically effective amount of a farnesyl transferase inhibitor and a therapeutically effective amount of an agent that inhibits the aggregation of α-synuclein.
30. The pharmaceutical composition of claim 29, wherein the synucleinopathy is selected from the group consisting of: Parkinson's disease, diffuse Lewy body disease, multiple system atrophy disorder, and pantothenate kinase-associated neurodegeneration.
31. The pharmaceutical composition of claim 29, wherein the synucleinopathy is Parkinson's disease.
32. The pharmaceutical composition of claim 29, wherein the farnesyl transferase inhibitor and agent that inhibits α-synuclein aggregation are packaged separately.
33. The pharmaceutical composition of claim 29, wherein the amount of each of the farnesyl transferase inhibitor and the agent that inhibits α-synuclein aggregation is less than the amount of the agent used alone.
34. A kit comprising a pharmaceutical composition of claim 29, 30, 31, 32, or 33.
35. The kit of claim 34, wherein the kit comprises multiple dosage units of the pharmaceutical composition.
36. The kit of claim 34 further comprising prescribing information.
PCT/US2008/062437 2007-05-03 2008-05-02 Treatment of synucleinopathies WO2008137692A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US91582807P 2007-05-03 2007-05-03
US60/915,828 2007-05-03

Publications (1)

Publication Number Publication Date
WO2008137692A1 true WO2008137692A1 (en) 2008-11-13

Family

ID=39943951

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/062437 WO2008137692A1 (en) 2007-05-03 2008-05-02 Treatment of synucleinopathies

Country Status (1)

Country Link
WO (1) WO2008137692A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010056985A3 (en) * 2008-11-13 2010-10-21 Link Medicine Corporation Treatment of proteinopathies using a farnesyl transferase inhibitor
WO2012038565A2 (en) * 2010-09-21 2012-03-29 Universidad De Sevilla PROTEINS OF THE CRY FAMILY AS MARKERS FOR DETERMINING THE RISK OF DEVELOPING AN α-SYNUCLEINOPATHY OR DETERMINING SAID DISEASE
US8232402B2 (en) 2008-03-12 2012-07-31 Link Medicine Corporation Quinolinone farnesyl transferase inhibitors for the treatment of synucleinopathies and other indications
WO2012170657A1 (en) * 2011-06-07 2012-12-13 Georgetown University Targeting gsk-3beta for the treatment of parkinson's disease
US8343996B2 (en) 2008-11-13 2013-01-01 Astrazeneca Ab Azaquinolinone derivatives and uses thereof
EP3620163A1 (en) * 2014-05-01 2020-03-11 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
CN111803473A (en) * 2019-04-10 2020-10-23 云南帕精生物科技有限公司 Application of nortriptyline in treating Parkinson's disease
US10828283B2 (en) 2014-05-01 2020-11-10 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
US10835496B2 (en) 2015-04-21 2020-11-17 Eiger Biopharmaceuticals, Inc. Pharmaceutical compositions comprising lonafarnib and ritonavir
EP3609578A4 (en) * 2017-04-13 2021-03-10 Chase Therapeutics Corporation Pharmaceutical combination and its use for treating synucleinopathies
US11311519B2 (en) 2014-05-01 2022-04-26 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
WO2023183285A1 (en) * 2022-03-22 2023-09-28 The General Hospital Corporation Methods of diagnosing and treating neurodegenerative diseases

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050272722A1 (en) * 2004-03-18 2005-12-08 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies
US20050277629A1 (en) * 2004-03-18 2005-12-15 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies (Lansbury)
US20050288298A1 (en) * 2004-03-18 2005-12-29 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies
US20060106060A1 (en) * 2004-03-18 2006-05-18 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies (Lansbury)
US20060105394A1 (en) * 2004-11-08 2006-05-18 Nunzio Pomara Methods and compositions for treatment and prevention of major depressive disorder
US20070213366A1 (en) * 2005-12-23 2007-09-13 Justman Craig J Treatment of Synucleinopathies
US20070293539A1 (en) * 2004-03-18 2007-12-20 Lansbury Peter T Methods for the treatment of synucleinopathies

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050272722A1 (en) * 2004-03-18 2005-12-08 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies
US20050277629A1 (en) * 2004-03-18 2005-12-15 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies (Lansbury)
US20050288298A1 (en) * 2004-03-18 2005-12-29 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies
US20060106060A1 (en) * 2004-03-18 2006-05-18 The Brigham And Women's Hospital, Inc. Methods for the treatment of synucleinopathies (Lansbury)
US20070293539A1 (en) * 2004-03-18 2007-12-20 Lansbury Peter T Methods for the treatment of synucleinopathies
US20060105394A1 (en) * 2004-11-08 2006-05-18 Nunzio Pomara Methods and compositions for treatment and prevention of major depressive disorder
US20070213366A1 (en) * 2005-12-23 2007-09-13 Justman Craig J Treatment of Synucleinopathies

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8232402B2 (en) 2008-03-12 2012-07-31 Link Medicine Corporation Quinolinone farnesyl transferase inhibitors for the treatment of synucleinopathies and other indications
US8343996B2 (en) 2008-11-13 2013-01-01 Astrazeneca Ab Azaquinolinone derivatives and uses thereof
WO2010057028A3 (en) * 2008-11-13 2010-12-02 Link Medicine Corporation Treatment of proteinopathies using a farnesyl transferase inhibitor
WO2010056985A3 (en) * 2008-11-13 2010-10-21 Link Medicine Corporation Treatment of proteinopathies using a farnesyl transferase inhibitor
JP2012508765A (en) * 2008-11-13 2012-04-12 リンク・メディスン・コーポレーション Treatment of proteinosis using farnesyltransferase inhibitors
WO2012038565A3 (en) * 2010-09-21 2013-02-21 Universidad De Sevilla PROTEINS OF THE CRY FAMILY AS MARKERS FOR DETERMINING THE RISK OF DEVELOPING AN α-SYNUCLEINOPATHY OR DETERMINING SAID DISEASE
ES2390990A1 (en) * 2010-09-21 2012-11-20 Universidad De Sevilla PROTEINS OF THE CRY FAMILY AS MARKERS FOR DETERMINING THE RISK OF DEVELOPING AN a-SYNUCLEINOPATHY OR DETERMINING SAID DISEASE
WO2012038565A2 (en) * 2010-09-21 2012-03-29 Universidad De Sevilla PROTEINS OF THE CRY FAMILY AS MARKERS FOR DETERMINING THE RISK OF DEVELOPING AN α-SYNUCLEINOPATHY OR DETERMINING SAID DISEASE
WO2012170657A1 (en) * 2011-06-07 2012-12-13 Georgetown University Targeting gsk-3beta for the treatment of parkinson's disease
US11311519B2 (en) 2014-05-01 2022-04-26 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
EP3620163A1 (en) * 2014-05-01 2020-03-11 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
US11793793B2 (en) 2014-05-01 2023-10-24 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
US10828283B2 (en) 2014-05-01 2020-11-10 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
US10835496B2 (en) 2015-04-21 2020-11-17 Eiger Biopharmaceuticals, Inc. Pharmaceutical compositions comprising lonafarnib and ritonavir
US11517532B2 (en) 2015-04-21 2022-12-06 Eiger Biopharmaceuticals, Inc. Methods of treating hepatitis delta virus infection
EP3609578A4 (en) * 2017-04-13 2021-03-10 Chase Therapeutics Corporation Pharmaceutical combination and its use for treating synucleinopathies
US11318122B2 (en) 2017-04-13 2022-05-03 Chase Therapeutics Corporation Pharmaceutical combination and its use for treating synucleinopathties
CN111803473A (en) * 2019-04-10 2020-10-23 云南帕精生物科技有限公司 Application of nortriptyline in treating Parkinson's disease
WO2023183285A1 (en) * 2022-03-22 2023-09-28 The General Hospital Corporation Methods of diagnosing and treating neurodegenerative diseases

Similar Documents

Publication Publication Date Title
WO2008137692A1 (en) Treatment of synucleinopathies
US20100292292A1 (en) Treatment of Neurodegenerative Diseases Using Indatraline Analogs
US10653676B2 (en) Small molecule inhibitors of USP1 deubiquitinating enzyme activity
WO2008122038A1 (en) Regulating autophagy
Silva‐Adaya et al. Excitotoxic damage, disrupted energy metabolism, and oxidative stress in the rat brain: antioxidant and neuroprotective effects of l‐carnitine
US20200255447A1 (en) Thienopyrimidines and uses thereof
US20110294794A1 (en) Treatment of proteinopathies using a farnesyl transferase inhibitor
US8252829B2 (en) Aminopyrrolidinone derivatives and uses thereof
JP5857043B2 (en) PRPK-TPRKB modulator and use thereof
ES2668556T3 (en) Pyrazzolone derivatives useful in the treatment of amyotrophic lateral sclerosis
WO2009018088A2 (en) Imaging of alpha-synuclein
KR20110033304A (en) Activation of histone deacetylase 1 (hdac1) protects against dna damage and increases neuronal survival
US8232402B2 (en) Quinolinone farnesyl transferase inhibitors for the treatment of synucleinopathies and other indications
JP2009521470A (en) Treatment of synuclein disorder
JP2007529555A (en) How to treat synucleinopathy
JP2016520532A (en) Benzimidazole derivatives and uses thereof
Kaushal et al. CM156, a high affinity sigma ligand, attenuates the stimulant and neurotoxic effects of methamphetamine in mice
JP2014510065A (en) Novel small molecules as therapeutic agents
EP2427438B1 (en) Pyrimidine-2,4,6-triones for use in the treatment of amyotrophic lateral sclerosis
US9162968B2 (en) Cyclohexane-1,3-diones for use in the treatment of amyotrophic lateral sclerosis
JP2009503072A (en) Adjuvant chemotherapy for anaplastic glioma
Shim et al. Discovery of a NADPH oxidase inhibitor,(E)-3-cyclohexyl-5-(4-((2-hydroxyethyl)(methyl) amino) benzylidene)-1-methyl-2-thioxoimidazolidin-4-oneone, as a novel therapeutic for Parkinson's disease
KR20080051246A (en) Pharmaceutical composition for prevention of treatment of neurodegenerative disease and inhibition of nadph oxidase
WO2014036595A1 (en) Compounds and methods for treating diseases or conditions associated with the central nervous system and/or neurite outgrowth
Cagasova 1, 3-Disubstituted-tetrahydro-β-carbolines: A New Method for Stereochemical Assignment and Synthesis of Potential Antimalarial Agents

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08769269

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08769269

Country of ref document: EP

Kind code of ref document: A1