WO2008131970A2

WO2008131970A2 - Detection and treatment of disorders with time dependent behaviour like bipolar disorder

Info

Publication number: WO2008131970A2
Application number: PCT/EP2008/003526
Authority: WO
Inventors: Martin Begemann; Moritz Rossner; Klaus-Armin Nave; Hannelore Ehrenreich
Original assignee: MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date: 2007-04-30
Filing date: 2008-04-30
Publication date: 2008-11-06
Also published as: WO2008131970A3

Abstract

The present invention refers to a method for determining genes, whose expression level is related to a disorder or disease, and in particular to a method for detecting the presence or absence of a bipolar disorder and/or detecting the mood phase of a bipolar disorder in a patient. It further refers to a method for treating a bipolar disorder and the manufacture of a medicament for such a treatment.

Description

Detection and Treatment of disorders with time dependent behaviour like Bipolar Disorder

The present invention refers to a method for deter- mining genes, whose expression level is related to a disorder or disease, and in particular to a method for detecting the presence or absence of a bipolar disorder and/or detecting the mood phase of a bipolar disorder in a patient . It further refers to a method for treating a bipolar disorder and the manufacture of a medicament for such a treatment .

Molecular mechanisms underlying bipolar disorders (bipolar affective disorders) like Bipolar I Disor- der, Bipolar II Disorder, Cyclothymia or other Bipolar Disorders Not Otherwise Specified, in particular the molecular mechanisms underlying rapid cycling syndrome are unknown. The term "Bipolar Disorder" and all other terms used in this paragraph should be un- derstood as it is common in the field, e.g. according to the definitions given in "American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision, Washington, DC, American Psychiatric Association, 2000" .

Rapid cycling syndrome is a rare bipolar affective disorder characterized by at least four phases per year and rapid shifts between cycles (Dunner DL, Fieve RR. Clinical Factors in Lithium-Carbonate Pro- phylaxis Failure. Archives of General Psychiatry.

1974;30 (2) :229-233) . Previous work showed that several physiological parameters also change in a phase- specific fashion (Jenner FA, Lee CR, Paschalis C, Hill SE, Burkinshaw L, Jennings G. Electrolyte me- tabolism in patients with periodic affective disorders during treatment with rubidium. Psychopharmacol- ogy (Berl) . 1983 ; 81 (4) : 301-309 ; Crammer JL. Drinking, thirst and water intoxication. Br J Psychiatry. JuI 1991; 159 : 83-89; Crammer JL. Disturbance of water and sodium in a manic-depressive illness. Br J Psychiatry. Sep 1986 ,-149:337-345; Nikitopoulou G, Crammer JL. Change in diurnal temperature rhythm in manic- depressive illness. Br Med J. May 29 1976; 1 (6021): 1311-1314) , revealing rapid cycling as a "whole body disorder" . Despite extensive research on this disease the molecular mechanisms underlying rapid cycling are unknown .

It is thus the aim of the present invention to pro- vide a method for detecting a bipolar disorder or detecting the mood phase of a bipolar disorder. Further, it is the aim of the present invention to provide a method for treating such bipolar disorders as well as the provision of a medicament to be used for treating such bipolar disorders. In a more general manner, it is the aim of the present invention to provide a method to detect or determine genes, whose expression level is related to a disorder or disease with time dependent behaviour, in particular with phase-dependent, e.g. periodic, behaviour.

This problem is solved by the detection methods according to claim 1 or claim 15, the therapeutic method according to claim 11 or 13, and the use of an agent for manufacturing a medicament for bipolar dis- orders according to claim 10 or 12. Further improvements are provided in the respective dependent claims .

The method of determining genes, whose expression level is related to a disease or disorder with time dependent behaviour is based on the observation that by correlating the time dependent behaviour of the disease or disorder with the time dependence of the expression level of one or a plurality of genes in a preferably single patient can reveal genes relevant for the disease or disorder, which upon a statistical analysis of a multitude of patients might have gone undetected.

The present invention with respect to bipolar disorder using the inventive method is based on the fact that several genes have been identified that show phase-specific expression in patients with a bipolar disorder. In particular the relative change in ex- pression level between different mood phases (episodes) can be used not only to detect the presence or absence of such bipolar disorder in the patient, but also to identify the mood phase of the patient. Further, by interacting with the expression or process- ing pathway of these genes or interacting with the function of the corresponding gene products (pro- teins) or their receptors, treatment of bipolar disorders becomes feasible. In particular high expression of the genes coding for the following proteins prostaglandin D synthetase (PTGDS) , prostaglandin D2 11-ketoreductase (AKR1C3), granzyme A (GZMA), gran- zyme B (GZMB) , killer cell immunoglobulin- like receptor CD158k (KIR3DL2) , killer cell lectin-like receptor subfamily D 1/CD94 (KLRDl) and spondin 2 (SPON2) were correlated with the depressed phase of a bipolar disorder. High expression of genes coding for proteins hemoglobin A (HBA) , hemoglobin B (HBB) , cal- granulin C (S100A12) , neuregulin 1 (NRGl) is seen during the manic phase of the bipolar disorder.

By detecting high expression levels in a patient of one of these proteins, it becomes possible to detect the presence of a bipolar disorder and as well determine the mood phase of the patient .

This may be done with at least one of the above mentioned genes, or by analyzing an arbitrary combination of at least two of the genes as mentioned above or even by analyzing all of the genes as mentioned above .

As samples for detection of expression levels any sample containing or consisting of body fluid or body tissue of the patient or any sample prepared from such body fluid or body tissue can be used. Prefera- bly the body fluid is peripheral blood.

With the present inventive method bipolar disorders can be detected and treated including Bipolar I Disorder, Bipolar II Disorder, Cyclothymia and Bipolar Disorder Not Otherwise Specified. Potential agents for treatment of bipolar disorders can well be iden- tified. For example S100A12 response can be blocked with several agents (Shishibori T, Oyama Y, Matsushita 0, et al. Three distinct anti-allergic drugs, amlexanox, cromolyn and tranilast, bind to S100A12 and S100A13 of the SlOO protein family. Biochem J.

Mar 15 1999;338 ( Pt 3):583-589; Yang Z, Yan WX, Cai H, et al . S100A12 provokes mast cell activation: a potential amplification pathway in asthma and innate immunity. J Allergy Clin Immunol. Jan 2007; 119(1): 106-114), and the crystal structure of AKR1C3 predicts an interaction with non-steroidal antiinflammatory drugs (NSAID) at the active site (Lover- ing AL, Ride JP, Bunce CM, Desmond JC, Cummings SM, White SA. Crystal Structures of Prostaglandin D2 11- Ketoreductase (AKR1C3) in Complex with the Nonsteroidal Anti-Inflammatory Drugs Flufenamic Acid and In- domethacin. Cancer Res. March 1, 2004 2004; 64(5): 1802-1810) . Compounds inhibiting the action of prostanoids are being developed (Hammad H, Kool M, Soullie T, et al . Activation of the D prostanoid 1 receptor suppresses asthma by modulation of lung dendritic cell function and induction of regulatory T cells. J. Exp. Med. February 19, 2007 2007; 204(2): 357-367; Sturino CF, O'Neill G, Lachance N, et al . Discovery of a potent and selective prostaglandin D2 receptor antagonist, [ (3R) -4- (4-chloro-benzyl) -7- fluoro-5- (methylsulfonyl) -1,2,3, 4-tetrahydrocy clopenta [b] indol-3-yl] -acetic acid (MK-0524). J Med Chem. Feb 22 2007 ; 50 (4) : 794-806) . Understanding the host factors, such as PPAR, the ligand for many prostanoids, and NF-kappaB that are activated in lymphocytes might help understanding the biochemical pathways that are activated in a phase specific manner. Delineating signal transduction pathways through which NRGl or its cognate receptors, such as erbB2 (Slamon DJ, Leyland-Jones B, Shak S, et al . Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med. Mar 15 2001 ; 344 (11) : 783-792 ; Michailov GV, Sereda MW, Brinkmann BG, et al . Axonal neuregu- lin-1 regulates myelin sheath thickness. Science. Apr 30 2004 ;304 (5671) : 700-703) act in the nervous system on one hand, or the KIR genes (Lanier LL. Natural killer cells: roundup. Immunological Reviews. 2006; 214(1) :5 (8); Lanier LL. NK CELL RECEPTORS. Annual Re- view of Immunology. 1998 ; 16 (1) : 359-393 ) act in the immune system on the other hand, might open up avenues for new therapeutic options. Finally, siRNA (Hossbach M, Gruber J, Osborn M, Weber K, Tuschl T. Gene silencing with siRNA duplexes composed of tar- get-mRNA-complementary and partially palindromic or partially complementary single-stranded siRNAs. RNA Biol. Apr 2006 ; 3 (2) : 82-89 ; Tuschl T, Zamore PD, Leh- mann R, Bartel DP, Sharp PA. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev. Dec 15 1999;13 (24) =3191-3197) might reveal new targets identified in using the described strategy.

In the following as an example one individual with an extreme form of the affective disease and clear-cut accompanying physical symptoms was analyzed. In this approach, genetic heterogeneity, easily veiling slight gene expression shifts, does not play any role. The patient described here has suffered from a classical rapid cycling syndrome and kept a careful diary over 16 years.

Figure 1 shows the clinical features of the depressed and the manic phase in said patient ;

Figure 2 shows the time series of rapid cycling (a) , microchip strategy for identification of regulated genes (b) , qRT-PCR results for two regulated genes, GZMA and HBA, as denoted;

Figure 3 shows the phase-specific gene expression confirmed by qRT-PCR for selected genes. Each bar represents the mean + SD of 5-6 determinations of respective cDNA from PBMC during specific phases. The chart for hemoglobin contains an insert with hemoglobin (protein) concentrations in whole blood; and

Figure 4 shows the clinical course of psychopa- thology ratings before and during treatment of said patient with the cyclooxy- genase inhibitor celecoxib.

Materials and Methods

Peripheral blood mononuclear cells (PBMC) were collected in the middle of depressed or manic phases from the patient at fasting conditions at 8.00 am using standard procedures outside the hay fever season. Ficoll hypaque isolation procedure. RNA was prepared using Trizol and Qiagen RNAeasy columns (Qiagen, HiI- den, Germany) . The RNA samples were used to synthesize cDNAs (SuperScriptIII, Invitrogen, Karlsruhe, Germany) .

DNA Microarray analysis

Transcriptome analysis was performed using the Ge- neChip Human Genome U133 Plus 2.0 (Affymetrix, Santa Clara, CA) (Shi LM, Reid LH, Jones WD, et al . The Micro Array Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements, Nature Biotechnology. Sep 2006; 24(9): 1151-1161) . All of the cDNAs used for microarrays were one-round amplified. GeneChip data were analyzed using the software packages GCOS version 1.2 (Affy- metrix) MAS version 5 (Affymetrix) , R (http://www.r- project.org), Bioconductor

(http://www.bioconductor.org). Genes differentially regulated were analyzed and subsequently independ- ently validated using quantitative real-time PCR.

DNA-Microarray analysis and quantitative real-time (QRT) -PCR: Quantitative real-time PCR reaction of reverse-transcribed RNA was preformed with SYBR Green detection on Applied Biosystems 7500 Fast System. CT- values (cycle threshold values) were standardized to the CT values of GAPDH as denoted in the Figures . Quantitative RT-PCR was carried out with the prices in the following table.

Table 1

Oligonucleotides used for qRT-PCR amplification of differentially expressed genes

Gene Orientation Primer Sequence 5' -> 3'

PTGDS Fwd CGGCTCCTACAGCTACCG

Rev CAGCGCGTACTGGTCGTA

AKR1C3 Fwd CATTGGGGTGTCAAACTTCA

Rev CCGGTTGAAATACGGATGAC

NRGl Fwd CACAGCCCATCACTCCACTA

Rev AAGGATGCTTTCAGTGTGTCC

SP0N2 Fwd AGGACACGGTGACCGAGATA

Rev GCGGGTAGTAGAAGGAGTTGG

HBAl Fwd GACCCGGTCAACTTCAAGC

Rev AGAAGCCAGGAACTTGTCCA HBB Fwd GCACGTGGATCCTGAGAACT

Rev ATGGGCCAGCACACAGAC

GZMA Fwd CCTGTGATTGGAATGAATATGGT

Rev AGGGCTTCCAGAATCTCCAT

GZMB Fwd TAAGGGGGAAACAACAGCAG

Rev CATGTCCCCCGATGATCT

KLRDl Fwd GTGGGAGAATGGCTCTGC

Rev TTTGTATTAAAAGTTTCAAATGATGGA

GAPDH Fwd CTGACTTCAACAGCGACACC

Rev TGCTGTAGCCAAATTCGTTGT

Statistical Analyses

All numerical results are presented as mean±SD in the text and mean+SEM in the figures. Statistical analyses (Hollander M. and Wolfe D. A. (1999) : Nonparamet- ric Statistical Methods, 2^nd edition,- Stuart A., Ord J. K., Arnold S. (1999): Kendall's advanced theory of statistics, 6^th ed. , Vol. 2A: Classical inference and the linear model, London: Hodder Arnold) and Fast Fourier Transformations (Duhamel P., Vetterli M. (1990): Fast Fourier transforms: a tutorial review and state of the art. Signal Processing 19: 259-299) were performed as published using MATLAB R2007a (MAT- LAB, The MathWorks , 2007) . Nonparametric independent Mann-Whitney-U-test (two-tailed) and Student's t-test (two-tailed) were calculated using SPSS 16.0 for Windows (SPSS 2007) .

Case

The patient, a woman born in 1945, had no prior medical illness and no evidence of psychiatric or neurological illnesses in her family history. In 1990, the patient became ill with rapid cycling syndrome and kept a diary over her illness that was used to recon- struct 103 cycles over a 17-year period. The clinical features of the depressed and the manic phase are summarized in Fig. 1. The time series suggests complex rhythms in the periodicity with mean cycle lengths of 56±13 days, switching within hours between manic (27+13 days) and depressed (29+14 days) phases without normal intervals (Fig. 2a) .

In addition to typical affective symptoms, the pa- tient has physical and cognitive signs recurring in a phase-specific manner: The patient eats and drinks excessively during the manic phase, leading to overhydration and alternating weight changes (up to 5 kg) between phases, resulting in significant shifts of hematocrit and hemoglobin concentration. Only in the manic phase, the patient regularly develops edema in her lower extremities and becomes susceptible to seasonal allergies (hay fever) .

Detailed neuropsychological testing revealed shifts also in cognitive performance (Fig. 1) : Semantic fluency is moderately reduced in the depressed but normal in the manic phase. Working memory and flexibility, both indicating executive functions, are se- verely affected in the manic and slightly in the depressed phase. Some domains such as long-term memory appeared to be normal in both phases, or were only slightly impaired such as short-term memory and psychomotor speed. Fine motor function showed moderate impairment for dotting in the depressive phase, whereas tapping (MacQuarrie Tapping Test) was impaired equally in both phases. The premorbid IQ was normal .

The psychopathology, appearance, physical signs and neuropsychological test results in each of the phases are summarized in Fig. 1. The phases shift without a normal interval. In the first two to three days of the manic phase, the patient is completely sleepless and always busy; in the following days of the manic phase the patient sleeps three to four hours per day. Three days after the onset of the manic phase, the patient develops edema in both lower extremities that recovers immediately after the onset of the depressed phase. The two to three days before the end of the manic phase the patient notes a "normalization of sleep' with non-interrupted sleep of regular duration. Witnesses report a change of her voice in the last two to three days of the manic phase: The voice becomes raspy and less melodious. Also, at the end of the depressed phase, witnesses report that her voice becomes more cheerful and richer in tonal inflections . Thus changes in the tone of her voice during a phase heralds the coming switch to the other phase . The patient is not aware of changes in her voice dur- ing the manic or the depressed phase. She reports also physical complaints and signs, such as increased requirement of anti-histamines during the manic phase due to an increased risk to develop allergies (hay fever) . Allergic response was rarely observed during the depressed phases.

Lymphocyte subpopulations were studied by fluorescence activated cell sorting (FACS) at six different time points, i.e. in three different manic and three different depressed phases. The results showed alterations in CD4 T helper cells and CD8 T suppres- sor/cytotoxic cells with a shift to helper cells in the manic phases, and a shift to suppressor cells in the depressed phases within the T cell population. The percentage of natural killer cells and B cells showed no phase-specific alteration in this series. The cyclic pattern of her affective disorder had a poor response to pharmacologic treatment over the past 16 years, such as lithium, venlafaxin, chlor- prothixen, citalopram, paroxetin, carbamazepine , valproic acid, trimipramine, lamotrigine, olanzapine or flupenthixol (fluanxol), and no response to psychotherapy and hypnosis therapy. Neuroleptic (antipsychotic) medication, such as flupenthixol, somewhat reduced the severity of the manic and depressive phase but not the cyclic behaviour of the disorder. During the time of all analyses presented here, the patient was on continuous lamotrigine medication, always the same daily dosage (400 mg) , resulting in

Ug comparable blood serum levels of 4.1 to 8.9 -^²- upon ml repeated controls. No other medication was allowed during the time of testing or before and during a treatment approach using the cyclooxygenase inhibitor celecoxib (Celebrex^R, Pfizer, 2x200mg daily per os) .

Results

A three-tiered approach was employed to identify and analyze genes that were regulated in a phase specific fashion (Fig. 2b) . In the first step, eight blood samples were collected (always at 8:00 A.M. under overnight fasting conditions) at two different consecutive depressed and manic phases on two consecutive days each. All sample collection was done well outside the hay fever season. In a second step a screen (microarray hybridisation) identified genes that showed at least two-fold differences in expression in the manic compared to the depressed phase and vice versa. After this screening by microchip, an in- silico selection step (bioinformatics analysis) was employed to identify and exclude genes that differed between the two consecutive days within a particular phase (arbitrary daily variation) . In the following in-silico selection step, genes were identified and excluded that were differentially expressed in the two depressed or in the two manic phases (arbitrary monthly variation) . In a third step, the expression pattern of the remaining depressed and manic phase genes was subsequently compared and the differentially expressed genes confirmed by quantitative RT- PCR.

Several genes were identified that showed high expression in the depressed phase and low expression in the manic phase, and vice versa. The blood sampling was extended beyond the initial screening period, and regulated genes were again validated more then one year later. Two genes that show exemplary differential expression patterns are shown in Figure 2C: GZMA with high expression in depressed and low in manic phases, and HBA with high expression in manic and low in depressed phases.

In Figure 3, the genes were grouped in biological categories and show their mean expression pattern over five to six time points during either depression or mania. Hemoglobin genes A and B (HBB and HBA) were higher in the manic phase, compared to the depressed phase (Figure 3a) . This contrasts the hemoglobin (protein) concentration in whole blood (insert) that showed the opposite regulation. The genes involved in prostaglandin metabolism, PTGDS (prostaglandin D synthetase) and AKR1C3 (prostaglandin D2 11-Ketoreduc- tase) , showed higher expression in the depressed phase. Further two neurodevelopmental genes were identified that revealed opposing gene expression:

NRGl (neuregulin-1) was expressed higher in the manic phase. SPON2 (spondin-2) , known to regulate the immune response and to act during the development of the nervous system, was higher in the depressed phase. Several further genes, involved in the regula- tion of the immune system, were shown to be phase- specifically expressed (Figure 3B) . To these genes belong the granzymes GZMA (granzym A) and GZMB (gran- zym B) and the KLR genes KIR3DL2 and KLRDl (killer cell lectin-like receptor subfamily D, member 1/CD94), all of these showed higher expression in the depressed phase as compared to the manic phase. The SlOOa.12 (calgranulin C) showed high expression in manic phases. Hemoglobin genes A and B (HBB and HBA) were higher in manic phases, compared to depressed phases. This contrasts the haemoglobin (protein) concentration in whole blood (insert) that showed the opposite regulation (Figure 5d) .

Further the expression of a number of further genes was explored that were suggested to be expressed in a phase-specific pattern according to the screening by oligo-microchip and ±n-silico selection. Subsequent qRT-PCR, however, could not confirm a robust phase- specific gene expression. To these genes belong ORF52, ECGF, TNFSF13b, STATl, NFKB, KCNQl, MAPB2K3, MAPB3K5, FKBP5, NFKBIZ, NCAMl, SRGAP2 (slit-robo), BCL6, S100A12 and CSPG2 (versican) (data not shown) . On the other hand, qRT-PCR was performed on genes that were interesting but not found by our microchip screening to be phase-specifically regulated, e.g. GZMB which tended to be regulated like GZMA (Figure 3b) , or PER2 which was not found to be phase- dependently expressed (data not shown) . Also, globin- regulating genes like FOGl, GATA, BRGl, EPOR and HIFlalpha, were found unaltered during phases (data not shown) . Treatment approach using the cyclooxygenase inhibitor celecoxib

Based on the prostaglandin-associated cyclic gene expression, involving PTGDS (prostaglandin D synthetase) and AKR1C3 (prostaglandin D2 11-ketoreduc- tase) , we made a treatment approach applying the cyclooxygenase inhibitor celecoxib (2x200mg daily per os) . The approach was announced to the local ethical committee .

Treatment with celecoxib was stared with lOOmg and increased by lOOmg daily to reach the final dose of 400mg (2x200mg daily) at day 4. This dose has then been continued for 4.5 months. The medication was well tolerated. Figure 4 illustrates the clinical course before and during celecoxib treatment, including psychopathology ratings of depressed and manic phases. Determination of mean rating scores before and after onset of celecoxib yielded significant improvement of depressed as well as of manic symptoms.

Fig. 4 shows the clinical course of psychopathology ratings before and during treatment with the cyclooxygenase inhibitor clecoxib. The course of the Hamilton Rating Scale for Depression (HAMD) scores, the Young Mania Rating Scale (YMRS) scores, and the Positive and Negative Syndrome Scale (PANSS) scores, presented in line graphs, show a pronounced cycling pattern. Day 0 denotes the start of celecoxib intake. The magnitude of cyclic changes gradually decreases during treatment . The bar graphs give the mean scores±SEM of n=6 depressed and n=6 manic phases (2 before and 4 after onset of treatment each) . HAMD score in depressed and YMRS score in manic phases de- crease significantly upon treatment. Mean values are compared using independent Student's t-test (two- tailed) . M designates the manic phase and D designates the depressed phase.

Discussion

In a first molecular analysis approach to alternating gene expression in bipolar disorder of tissue samples during rapid cycling, PBMC (mononuclear peripheral blood cells) of a woman with a classical 16-year history of the disorder was used, and a phase-specific gene expression profile was obtained on an identical genetic background. The strategy was set up to mini- mize the risk of identifying false positive genes, due to daily or monthly disorder-unrelated variations in gene expression. The gene expression differences among phases are small, but significant, and would most likely not have been recognized upon using more than one affected individual, i.e. different genetic backgrounds. In principle, this strategy can be employed as a screening strategy for any condition with a phase dependent disorder/disease like disorders/ diseases with temporal periodic behaviour, such as sleep or seasonal phenomena disorders.

The patient's impairments comprise psychopathological symptoms, physical signs and symptoms, including the immune system, and a variety of cognitive domains evident upon neuropsychological testing. Accordingly, phase-specific gene expression involved different biological systems, such as blood, metabolism, nervous and immune system, confirming rapid cycling as a whole body disorder. Two genes were identified that are implied in prostaglandin synthesis, PTGDS and AKR1C3. PTGDS mediates synthesis of PGD₂ from PGH₂ from PGH₂ (the cyclooxy- genase-mediated product of arachidonic acid) , and AKR1C3 mediates synthesis of PGF_2α from PGD₂. PGF_2α is a PPARY antagonist, in contrast to two other PGD₂ metabolites that are spontaneously converted from PGJ₂: D12-PGJ₂ and 15deoxy-D12, 14-PGJ₂ that are PPARy agonists. Prostaglandin synthesis plays a pivotal role in metabolic homeostasis, sleep regulation, adipo- genesis, allergic response and inflammation (Hammad H, Kool M, Soullie T, et al . Activation of the D prostanoid 1 receptor suppresses asthma by modulation of lung dendritic cell function and induction of regulatory T cells. J. Exp. Med. February 19, 2007 2007;204 (2) :357-367; Quinkler M, Bujalska IJ, Tomlinson JW, Smith DM, Stewart PM. Depot-specific prostaglandin synthesis in human adipose tissue: A novel possible mechanism of adipogenesis . Gene. 2006;380 (2) :137-143; Ward C, Dransfield I, Murray J, Farrow SN, Haslett C, Rossi AG. Prostaglandin D2 and Its Metabolites Induce Caspase-Dependent Granulocyte Apoptosis That Is Mediated Via Inhibition of I {kappa}B{alpha} Degradation Using a Peroxisome Pro- liferator-Activated Receptor- {gamma} -Independent Mechanism. J Immunol. June 15, 2002

2002;168 (12) :6232-6243; Pinzar E, Kanaoka Y, Inui T, Eguchi N, Urade Y, Hayaishi O. Prostaglandin D synthase gene is involved in the regulation of non-rapid eye movement sleep. PNAS. April 25, 2000

2000 ; 97 (9) :4903-4907; Hayaishi O. Functional Genomics of Sleep and Circadian Rhythm: Invited Review: Molecular genetic studies on sleep-wake regulation, with special emphasis on the prostaglandin D2 system. J Appl Physiol. February 1, 2002 2002 ; 92 (2) : 863-868 ; Matsuoka T, Hirata M, Tanaka H, et al . Prostaglandin D2 as a mediator of allergic asthma. Science. Mar 17 2000;287 (5460) :2013-2017) . NRGl is a neuronal growth factor regulating differentiation, synaptogenesis and myelination in the nervous system (Nave K-A, Salzer JL. Axonal regulation of myelination by neuregulin 1. Current Opinion in Neurobiology. 2006 ; 16 (5) : 492-500) . It is also known as the proto-oncogene HRG (heregulin) involved in breast carcinogenesis (Li L, Cleary S, Mandarano MA, Long W, Birchmeier C, Jones FE. The breast proto-oncogene, HRGalpha regulates epithelial proliferation and lobuloalveolar development in the mouse mammary gland. Oncogene. JuI 25 2002;21 (32) :4900-4907) . SPON2 (spondin, mindin) was originally characterized in zebrafish as a component in the outgrowth of hippocampal neurons (Feinstein Y, Borrell V, Garcia C, et al . F-spondin and mindin: two structurally and functionally related genes expressed in the hippocampus that promote outgrowth of embryonic hippocampal neurons. Development. Aug 1999; 126 (16) : 3637-3648) . It is also abundantly expressed in lymphoid tissue, functions as a pattern- recognition molecule for microbial pathogens in the innate immune response (McDonald C, Nunez G. Mindin the fort. Nat Immunol. Jan 2004 ; 5 (1) : 16-18 ; He YW, Li H, Zhang J, et al . The extracellular matrix protein mindin is a pattern-recognition molecule for microbial pathogens. Nat Immunol. Jan 2004 ; 5 (1) : 88-97) , and is involved in inflammation (Jia W, Li H, He YW. The extracellular matrix protein mindin serves as an integrin ligand and is critical for inflammatory cell recruitment. Blood. Dec 1 2005 ; 106 (12 ): 3854-3859) .

Elevated expression of granzymes A and B (GZMA and GZMB) in the depressed phase was shown. Granzymes are serine proteinases that are expressed mostly in lymphocytes with cytotoxic activities (Buzza MS, Bird PI. Extracellular granzymes: current perspectives. Biol Chera. JuI 2006 ; 387 (7) : 827-837 ; Buzza MS, Hosking P, Bird PI. The granzytne B inhibitor, PI-9, is differentially expressed during placental development and up-regulated in hydatidiform moles. Placenta. Jan 2006;27 (1) : 62-69) . Granzyme B is also a mediator in allergic inflammation (Tschopp CM, Spiegl N, Didi- chenko S, et al . Granzyme B, a novel mediator of allergic inflammation: its induction and release in blood basophils and human asthma. Blood. October 1, 2006 2006;108 (7) =2290-2299) . Several natural killer (NK) cell receptors were identified to be elevated in the depressed phase compared to the manic phase. NK cells are bone marrow-derived lymphocytes that are instrumental in the innate immune response (Lanier

LL. Natural killer cells: roundup. Immunological Reviews. 2006;214 (1) :5-8; Lanier LL. NK CELL RECEPTORS. Annual Review of Immunology. 1998 ; 16 (1) : 359-393) . Several NK receptors recognize HLA molecules, act in- hibitory and thus potentially inhibit the immune response. To this group of receptors belong the C-type lectin superfamily receptors (NK-complex) and the Ig- superfamily receptors of killer cell-inhibitory cell receptor (KIR). KIR3DL2 (CD158K) , a member of the Ig- superfamily inhibiting NK cells, and KLRDl (CD94) , a member of the C-type lectin-family, are both diminished in the manic phase. As KLRDl (CD94) is required for NK cell tolerance to self (Long EO. Immunology Signal sequences stop killer cells. Nature. 1998;391 (6669) :740-743) via recognition of HLA-E

(Braud VM, Allan DSJ, O'Callaghan CA, et al . HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature. 1998 ; 391 (6669) : 795-799) , its reduced expression in the manic phase might accelerate in- flammation and allergic response as reported by the patient in the manic phase. In addition, the S100A12, also known as calgranulin C, shows increased expression in the manic phase. S100A12 is a calcium binding protein that acts proinflammatory, is a potent monocyte chemoattractant and provokes mast cell activa- tion (Hasegawa T, Kosaki A, Kimura T, et al . The regulation of EN-RAGE (S100A12) gene expression in human THP-I macrophages. Atherosclerosis. Dec 2003;171(2) :211-218; Shishibori T, Oyama Y, Matsushita 0, et al . Three distinct anti-allergic drugs, amlexanox, cromolyn and tranilast, bind to S100A12 and S100A13 of the SlOO protein family. Biochem J. Mar 15 1999;338 ( Pt 3):583-589; Hofmann MA, Drury S, Fu C, et al . RAGE mediates a novel proinflammatory axis: a central cell surface receptor for SlOO/calgranulin polypeptides. Cell. Jun 25 1999_/97 (7) :889-901) .

Thus several factors that have been shown to regulate innate immunity and play crucial roles in inflamma- tion and allergy, such as SPON2 , GZMA, GZMB, S100A12 and the NK cell receptors, KIR3DL2 and KLRDl, show phase-specific gene expression. Of note is the fact that all samples have been obtained outside the allergy season and in the complete absence of allergic symptoms.

Globin genes were highly expressed in the manic phase. In contrast, the blood hemoglobin level was decreased in the manic compared to the depressed phase. The pattern of globin gene expression prompted exploration of the expression of genes known to regulate erythropoiesis and globin gene expression (Maha- jan MC, Weissman SM. Multi-protein complexes at the {beta} -globin locus. Brief Funct Genomic Proteomic . March 1, 2006 2006; 5(1): 62-65), even though they did not show phase-specific gene expression on the microchip. Quantitative RT-PCR of FOGl, GATA, BRGl, EPOR and HIFlalpha, however, yielded no differential gene expression.

Some of the gene products give clues to potential treatment targets. Among these, the gene products involved in prostaglandin metabolism are particularly promising. It is attractive to speculate that prostaglandins are mediators of a phylogenetically old behavioural program, regulating hibernation that is pathologically re-activated in humans upon unknown stressors, thereby creating rapid cycling. The positive result of the treatment approach with celecoxib in our patient, leading to attenuation of both de- pressed and manic rating scores, supports a mediator role of prostaglandins regarding symptoms of rapid cycling. It demonstrates that compositions containing or comprising substances interacting with or affecting the function of prostaglandin-associated gene ex- pression, in particular expression of PT GDS and/or AKR1C3 , are effective in treating bipolar disorders. Such substances include cyclooxygenase inhibitors, in particular celecoxib.

Claims

1. A method of detecting the presence or absence of a bipolar disorder and/or the mood phase of a bipolar disorder in a patient, characterized in that in a sample of or from body fluid or body tissue the expression level of at least one gene is de- tected and the detected expression level is correlated with the presence or absence of the bipolar disorder and/or with the phase of the bipolar disorder.

2. The method according to the preceding claim, characterized in that in a sample of body fluid or body tissue the expression level of at least one of the genes coding for prostaglandin D synthetase (PTGDS) , prostaglandin D2 11-ketoreductase (AKR1C3) , granzyme A (GZMA) , granzyme B (GZMB) , killer cell immunoglobulin-like receptor CD158k (KIR3DL2) , killer cell lectin-like receptor subfamily D 1/CD94 (KLRDl) , spondin 2 (SPON2) , hemoglobin A (HBA) , hemoglobin B (HBB) , calgranulin C (S100A12) and neuregulin 1 (NRGl) is detected and the detected expression level is correlated with the presence or absence of the bipolar disorder.

3. The method according to one of the preceding claims, characterized in that a high expression level of at least one of the genes coding for prostaglandin D synthetase (PTGDS) , prostaglandin D2 11-ketoreductase (AKR1C3) , granzyme A (GZMA) , granzyme B (GZMB) , killer cell immu- noglobulin-like receptor CD158k (KIR3DL2) , kil- ler cell lectin-like receptor subfamily D 1/CD94 (KLRDl) and spondin 2 (SPON2) indicates the presence of a bipolar disorder or the depressed phase of the bipolar disorder.

4. The method according to one of the preceding claims, characterized in that a high expression level of at least one of the genes coding for hemoglobin A (HBA) , hemoglobin B (HBB) , cal- granulin C (S100A12) , neuregulin 1 (NRGl) indi- cates the presence of the bipolar disorder or the manic phase of the bipolar disorder.

5. The method according to one of the preceding claims, characterized in that a higher expression level in a first phase of the bipolar dis- order compared to the expression level in a second phase of the bipolar disorder of at least one of the genes coding for prostaglandin D synthetase (PTGDS) , prostaglandin D2 11- ketoreductase (AKR1C3) , granzyme A (GZMA) , gran- zyme B (GZMB) , killer cell immunoglobulin- like receptor CD158k (KIR3DL2) , killer cell lectin- like receptor subfamily D 1/CD94 (KLRDl) and spondin 2 (SPON2) indicates the first phase to be a depressed phase and/or the second phase to be a manic phase.

6. The method according to one of the preceding claims, characterized in that a higher expression level in a first phase of the bipolar disorder compared to the expression level in a sec- ond phase of the bipolar disorder of at least one of the genes coding for hemoglobin A (HBA) , hemoglobin B (HBB) , calgranulin C (S100A12) and neuregulin 1 (NRGl) indicates the first phase to be a manic phase and/or the second phase to be a depressed phase.

7. The method according to one of the preceding claims, characterized in that the body fluid is peripheral blood, urine, ascites, sputum, lymph and/or bone marrow.

8. The method according to one of the preceding claims, characterized in that from a sample comprising or consisting of peripheral blood mononuclear cells (PBMC) are enriched or isolated and then analyzed for gene expression levels.

9. The method according to one of the preceding claims, characterized in that the body tissue comprises or consists of biopsy material .

10. Use of an agent interacting with or affecting the expression of at least one of the genes coding for prostaglandin D synthetase (PTGDS) , prostaglandin D2 11-ketoreductase (AKR1C3) , granzyme A (GZMA) , granzyme B (GZMB) , killer cell immunoglobulin-like receptor CD158k (KIR3DL2) , killer cell lectin-like receptor subfamily D 1/CD94 (KLRDl) , spondin 2 (SPON2) , hemoglobin A (HBA) , hemoglobin B (HBB) , calgranu- lin C (S100A12) and neuregulin 1 (NRGl) for the manufacture of a medicament for bipolar disor- der.

11. A method for treating a bipolar disorder in a patient, characterized in that an agent is administered to the patient, the agent interacting with or affecting the expression of at least one of the genes coding for prostaglandin D synthetase (PTGDS) , prostaglandin D2 11- ketoreductase (AKR1C3) , granzyme A (GZMA) , granzyme B (GZMB) , killer cell immunoglobulin- like receptor CD158k (KIR3DL2) , killer cell lectin- like receptor subfamily D 1/CD94 (KLRDl) , spondin 2 (SPON2) , hemoglobin A (HBA) , hemoglobin B (HBB) , calgranulin C (S100A12) and • neuregulin 1 (NRGl) .

12. Use of an agent interacting with or affecting the function of at least one of the proteins prostaglandin D synthetase (PTGDS) , prostaglandin D2 11-ketoreductase (AKR1C3), granzyme A (GZMA) , granzyme B (GZMB) , killer cell immu- noglobulin-like receptor CD158k (KIR3DL2) , killer cell lectin-like receptor subfamily D 1/CD94 (KLRDl), spondin 2 (SPON2), hemoglobin A (HBA), hemoglobin B (HBB) , calgranulin C (S100A12) and neuregulin 1 (NRGl) or their respective receptors for the manufacture of a medicament for bipolar disorder.

13. A method for treating a bipolar disorder in a patient, characterized in that an agent is ad- ministered to the patient, the agent interacting with or affecting the function of at least one of the proteins prostaglandin D synthetase (PTGDS) , prostaglandin D2 11-ketoreductase (AKR1C3) , granzyme A (GZMA) , granzyme B (GZMB) , killer cell immunoglobulin-like receptor CD158k

(KIR3DL2), killer cell lectin-like receptor subfamily D 1/CD94 (KLRDl) , spondin 2 (SPON2) , hemoglobin A (HBA) , hemoglobin B (HBB) , calgranulin C (S100A12) and neuregulin 1 (NRGl) or their respective receptors.

14. The method or use according to one of the preceding claims, characterized in that the bipolar disorder is a bipolar affective disorder, e.g. Bipolar I Disorder, Bipolar II Disorder, Cyclo- thymia or Bipolar Disorder Not Otherwise Specified, in particular rapid cycling syndrome.

15. A method of determining genes, whose expression level is related to a time-dependent disorder or disease, characterized in that in a patient, presence, absence or phase of said disorder or disease is determined in a time- dependent manner, in a sample of or from body fluid or body tissue of said patient, the expression level of at least one gene is detected in parallel with said determination of presence, absence or phase of said disorder or disease and the detected ex- pression level of said at least one gene is correlated with the presence, absence or phase of said disorder or disease in order to determine at least one gene, whose expression level is related to said disorder or disease.

16. Method according to claim 15, characterized in that the expression level of a single gene or a plurality of genes is determined and correlated in a single patient.

17. Method according to one of claims 15 and 16, characterized in that the disorder or disease has a phase-dependent, in particular periodic behaviour.

18. Method according to one of claims 15 to 17, used for determining genes, whose expression level is related to bipolar disorder, sleep disorders or seasonal phenomena disorders .