WO2008121442A2 - Pa28-gamma regulation in cells - Google Patents

Abstract

Methods and compositions for regulating PA28-gamma are described that are useful in treating cancer. The methods for regulating PA28-gamma involve preventing PA28-gamma from mediating an interaction between MDM2 and p53, for example, by promoting cell death in a cancer cell or by treating cancer in a subject by regulating PA28-gamma. The compositions for regulating PA28-gamma include, for example, antibodies to PA28-gamma, double stranded RNA, and antisense oligonucleotides. Additionally, methods for decreasing expression of PA28-gamma, methods for detecting an agent that blocks PA28-gamma function, and isolated cells that do not express PA28-gamma are also described.

Description

Attorney Docket No. 20674-060WO1

PA28-GAMMA REGULATION IN CELLS

This invention was made with government support from the National Institutes of Health (Grant No. ROl CAl 12029) and the USA Department of Defense (Grant No. W81XWH-04-1-0845). The United States government has certain rights in this invention.

BACKGROUND

In response to cellular stresses, the protein p53 accumulates and is activated, leading to apoptosis, cell cycle arrest, or senescence. These activities of p53 are important for preventing cell transformation, tumor formation, and tumor progression (e.g., loss of p53 functionality results in malignancy). Ubiquitinization-mediated proteasomal degradation is the primary pathway for p53 regulation. The MDM2 oncoprotein is the primary cellular ubiquitin E3 ligase of p53. MDM2 and p53 participate in an auto-regulatory feedback loop, in which p53 transactivates MDM2, which then binds to p53 thereby facilitating p53 degradation. These interactions are important in a variety of cellular conditions and pathologies.

SUMMARY

The present disclosure describes methods and compositions for regulating the interaction of MDM2 and p53 by interrupting PA28γ function. Methods for regulating PA28γ involve preventing PA28γ from mediating an interaction between MDM2 and p53, which results in promoted cell death in a cell or in a subject.

Compositions for regulating PA28γ include, for example, antibodies to PA28γ, double stranded RNA, and antisense oligonucleotides. Additionally, methods for decreasing expression of PA28γ and methods for detecting an agent that blocks PA28γ function are also disclosed. The disclosure features a method for promoting cell death. The method includes contacting a cell with a therapeutically effective amount of an agent that binds PA28γ. By binding PA28γ, the agent reduces an interaction between MDM2 and p53. The agent can be an antibody. The method also includes contacting the cell with a therapeutically effective amount of an agent that inhibits PA28γ formation. Attorney Docket No. 20674-060 WOl

The agent can, for example, inhibit transcription of the PA28γ gene or inhibit translation of RNA encoding PA28γ.

The disclosure also features a method for treating cancer in a subject. The method includes administering to the subject a therapeutically effective amount of an agent that binds PA28γ or an agent that inhibits PA28γ formation.

Also featured are purified antibodies that specifically bind to SEQ ID NO:1, which corresponds to the sequence of amino acids 76-103 of PA28γ. Also featured are vectors and nucleic acids that encode SEQ ID NO:1 or SEQ ID NO:4, which is an oligonucleotide complimentary to an oligonucleotide that encodes SEQ ID NO:1. The disclosure further features double-stranded RNA that inhibits expression of PA28γ. These double-stranded RNA include a first strand that is substantially identical to 19-49 consecutive nucleotides of a nucleic acid encoding PA28γ and a second strand that has a sequence complementary to the first strand.

Additionally, the disclosure features an antisense oligonucleotide (DNA or RNA) that inhibits the endogenous expression of PA28γ in a human cell and methods of using the antisense oligonucleotide. For example, the disclosure features a method for decreasing expression of PA28γ. The method includes introducing the oligonucleotide into the cell.

Further, the disclosure features a method for detecting an agent that reduces PA28γ function. The method involves treating a first cell that expresses PA28γ,

MDM2, and p53 with an agent, and then treating a second cell that expresses MDM2 and p53, but not PA28γ, with the agent. The viability of the first cell and the second cell are then compared, and a reduced viability in the first cell as compared to the second cell indicates that the agent blocks PA28γ function.

BRIEF DESCRIPTION OF FIGURES

Fig. IA shows Western blots indicating the effects of PA28γ and PA28β on p53 expression.

Fig. IB shows Western blots indicating the effects of knocking down PA28γ by transient transfection of double stranded siRNA on p53 levels in A549 and MCF7 cells. Attorney Docket No. 20674-060 WOl

Fig. 1C shows bar graphs of p53 transactivational activity in MCF7 cells that were transfected with either PA28γ or PA28β and a p21 luciferase reporter.

Fig. 2A shows a Western blot (left panel) and a graph (right panel) indicating the p53 protein steady-state in LNCaP cells. Fig. 2B shows a Western blot and a graph indicating the p53 protein steady- state in MCF-7 cells.

Fig. 2C shows a Western blot of MCF-7 cells transfected with PA28γ or empty vector in which the cell lysates were immunoprecipitated by the antibody against proteasome α/β subunits, indicating that PA28γ promotes p53 binding to proteosome.

Fig. 2D shows both direct immunoblotting and immunoprecipitation gels of endogenous p53 in PA28γ overexpressing cells, indicating PA28γ promotes p53 ubiquitination.

Fig. 2E shows direct immunoblotting gels of LNCaP cells that were co- transfected with PA28γ and HA-Ub in the presence or absence of MDM2, followed by inhibition of the proteasome with MG132, indicating PA28γ and MDM2 synergistically induce p53 ubiquitination.

Fig. 2F shows a gel separating immunoprecipitates of LNCaP cells that were co-transfected with PA28γ and HA-Ub in the presence or absence of MDM2, followed by inhibition of the proteasome with MG 132, confirming that PA28γ and MDM2 synergistically induce p53 ubiquitination.

Fig. 3Al shows a Western blot of PC3 cell immunoprecipitates captured by PA28γ antibodies.

Fig. 3A2 shows a Western blot of LNCaP cell immunoprecipitates captured by MDM2 antibodies.

Fig. 3B shows Western blots separating the results of p53 and PA28γ in vitro pull down assays.

Fig. 3Cl shows Western blots separating the GFP immunoprecipitated lysates of COS7 cells that were transfected with MDM2-T7 and/or PA28γ-GFP. Binding was detected by immunoblotting with T7 antibody. Attorney Docket No. 20674-060WO1

Fig. 3C2 shows a Western blot separating the T7 immunoprecipitated lysates of COS7 cells that were transfected with MDM2-T7 and/or PA28γ-GFP. Binding was detected by immunoblotting with GFP antibody.

Fig. 3D shows Western blots separating the lysates of LNCaP cells that were immunoprecipitated the PA28γ antibody then detected by p53, MDM2, or PA28γ antibodies.

Fig. 3E shows Western blots separating the results of MDM2 and PA28γ in vitro pull down assays.

Fig. 3Fl shows a Western blot separating the GFP immunoprecipitated lysates of COS7 cells that were transfected with p53-HA and/or PA28γ-GFP. Binding was detected by immunoblotting with HA antibody.

Fig. 3F2 shows a Western blot separating the HA immunoprecipitated lysates of COS7 cells that were transfected with p53-HA and/or PA28γ-GFP. Binding was detected by immunoblotting with GFP antibody. Fig. 4A shows Western blots showing immunoblotting results for MCF7 cells transfected with low amounts of MDM2 in the presence or absence of PA28γ, indicating that MDM2 and PA28γ synergistically decrease p53 levels in cells.

Fig. 4B shows Western blots showing immunoblotting results for LNCaP cells co-transfected with PA28γ or control vector with an MDM2 antisense loigonucleotide (AS) or a mismatch control oligonucleotide (ASM), suggesting that PA28γ is a co factor of MDM2 -induced p53 degradation.

Fig. 4C shows Western blots showing immunoblotting results for U2OS cells co-transfected with MDM2 antisense loigonucleotide (AS) or a mismatch control oligonucleotide (ASM) with various doses of PA28γ, confirming that PA28γ is a co- factor of MDM2 -induced p53 degradation.

Fig. 4D shows Western blots showing immunoblotting results for A549 cells that were transiently transfected with PA28γ siRNA followed by overexpression of MDM2.

Fig. 4E shows Western blots showing immunoblotting results for stable MCF7 cells (control or PA28γ knockdown) that were transfected with various amounts of pcMV-MDM2. Attorney Docket No. 20674-060WO1

Fig. 4F shows Western blots showing immunoblotting results for stable MCF7 cells (control or PA28γ knockdown) that were transfected with various amounts of MDM2 antisense loigonucleotide (AS) or a mismatch control oligonucleotide (ASM).

Fig. 4G shows Western blots showing immunoblotting results for PC3 cells (control or PA28γ knockdown) that were co-transfected with p53, GFP, and various amounts of MDM2.

Fig. 5A shows Western blots showing immunoblotting results for LNCaP cells that were transfected with various amounts of PA28γ.

Fig. 5B shows Western blots showing immunoblotting results for MCF7 cells that were transfected with PA28γ.

Fig. 6A shows Western blots gels showing immunoblotting results for U2OS cells that were transfected with GFP, GFP-P A28γ, or the GFP-P A28γ mutants P245Y, Gl 5OS, or Nl 5 IY, indicating that PA28γ induces p53 degradation independent of its proteasome activation activities. Fig. 6B shows Western blots gels showing immunoblotting results for assays of GFP immunoprecipitated COS7 cells containing a series of plasmids expressing mutants of PA28γ that were transfected with MDM2-T7; and a summary of the MDM2 binding results.

Fig. 6C shows Western blots showing immunoblotting results for assays of GFP immunoprecipitated COS7 cells containing a series of plasmids expressing mutants of PA28γ that were transfected with p53-HA; and a summary of the MDM2 binding results.

Fig. 6D shows Western blots showing immunoblotting results for U2OS cells that were transfected with GFP, GFP-P A28γ, or GFP-P A28γ-Δ76-103, indicating that the binding ability of PA28γ to both MDM2 and p53 is involved in its ability to induce p53 degradation.

Fig 6E shows Western blots showing the results for U2OS cells in the absence, expression, and overexpression of PA28γ of first immunoprecipitation with p53 antibody then immunoblotting with MDM2 antibody; and Westerns blot showing the results for A549 cells in the absence or presence of siSNA (PA28γ-knockdown) of Attorney Docket No. 20674-060 WOl

first immunoprecipitation with p53 antibody then immunoblotting with MDM2 antibody.

Fig. 6F shows Western blots showing immunoblotting results for a pull down assay in which GST-MDM2 was incubated with in vitro translated p53 in the presence or absence of PA28γ.

Fig. 7 A shows bar graphs indicating the % Survival Rate of A549, MCF-7 and MCF-7 p53 knock down cells that were treated with a control siRNA pool or various levels of a PA28γ siRNA pool.

Fig. 7B shows bar graphs indicating the Apoptotic Index of A549, MCF-7 and MCF-7 p53 knock down cells that were treated with a control siRNA pool or various levels of a PA28γ siRNA pool.

Fig. 7C shows Western blots showing immunoblotting results for stable MCFlOA cells with PA28γ KD, p53 KD, or PA28γ and p53 double KD.

Fig. 7D shows a bar graph indicating the Apoptotic Index for MCFlOA cells with PA28γ KD, p53 KD, or PA28γ and p53 double KD.

Fig. 7E shows pie charts indicating the cell cycle distribution for MCFlOA cells with PA28γ KD, p53 KD, or PA28γ and p53 double KD.

Fig. 7F shows Western blots showing immunoblotting results at different time points after γ-irradiation exposure for MCF7 cells that were transfected with PEF or PEF-PA28γ.

Fig. 7G shows a bar graph indicating the Apoptotic Index for MCF7 cells with transiently overexpressed GFP or GFP-PA28γ before and after exposure to γ- radiation.

Fig. 7H shows Western blots showing immunoblotting results for MCFlOA cells that were overexpressing various amounts of PA28γ or PA28β.

Fig. 71 shows Western blots showing immunoblotting results indicating the basal PA28γ expression levels for LNCaP, U87MG, A549, U2OS, HCTl 16, and MCF7 cells.

Fig. 7J shows Western blots showing immunoblotting results for LNCaP, U87MG, A549, U2OS, HCTl 16, and MCF7 cells treated with various concentrations of MDM2 antisense oligonucleotide (AS) or mismatch oligonucleotide (ASM). Attorney Docket No. 20674-060 WOl

DESCRIPTION

Described herein are methods and compositions for regulating PA28γ. PA28γ (also known as REGγ, PSME3, and Ki antigen) belongs to the PA28 family, which also includes PA28α and PA28β. With the exception of 15-32 amino acid homologue-specifϊc inserts, the PA28 family members exhibit high similarity in their sequences. PA28α and PA28β combine to form a heteroheptamer that has been demonstrated to be involved in cellular immunity. PA28γ forms a homoheptamer that has been demonstrated to bind to and activate the 2OS proteasome so that small peptides (but not intact proteins) can be degraded in an ATP-dependent manner as well as promote nuclear retention of the hepatitis C virus core protein.

PA28γ is a negative regulator of p53 that, without meaning to be bound by theory, is believed to be an essential co-factor that modulates the binding between MDM2-p53 through protein-protein interaction. Without PA28γ, MDM2 does not regulate exogenous and endogenous ρ53 protein levels. In turn, in the absence of MDM2, PA28γ loses the capacity to induce p53 degradation. PA28γ binds to both MDM2 and p53 in vitro and in vivo, and, in the presence of PA28γ, the binding between MDM2 and p53 is enhanced. Without PA28γ, MDM2-p53 binding is inhibited. Additionally, mutant PA28γ without the region spanning amino acids 76- 103, which is essential for the binding of PA28γ to both p53 and MDM2 and includes the major part of the homologue specific "insert region" of PA28 family, does not have the capability to degrade p53. Without meaning to be bound by theory, the accelerated p53 degradation by the p53-MDM2-PA28γ complex may result from the formation of a ternary complex of these three proteins. Alternatively, PA28γ may bind to MDM2 and p53 sequentially, thereby increasing the local relative ratio of MDM2 to p53.

Methods for regulating PA28γ involve preventing PA28γ from mediating an interaction between MDM2 and p53, for example, by promoting cell death in a cancer cell or by treating cancer in a subject by regulating PA28γ. Compositions for regulating PA28γ are also described and include, for example, antibodies to PA28γ, double stranded RNA, and antisense oligonucleotides. Additionally, methods for decreasing expression of PA28γ, methods for detecting an agent that blocks PA28γ Attorney Docket No. 20674-060WO1

function, and isolated cells that do not express PA28γ are also disclosed. Further, isolated cells that express a PA28γ mutant that does not mediate the interaction between MDM2 and p53, isolated nucleic acids, isolated peptides, and PA28γ expression vectors are also disclosed. A nucleic acid sequence for PA28γ is provided at Accession No. BC002684

(available at http://www.ncbi.nlm.nih.gov/). Of the amino acid sequence of PA28γ (Accession No. AAH02684; http://www.ncbi.nhn.nih.gov/), the region spanning amino acids 76-103 (SEQ ID NO: 1) binds to both MDM2 and p53. Examples of useful peptides from the amino acid sequence of PA28γ include peptides with five or more consecutive amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more amino acids) from SEQ ID NO: 1 as well as peptides with the amino acid sequence of SEQ ID NO:1. Additionally, examples of useful peptides from the amino acid sequence of PA28γ include peptides (e.g., as competitive blockers or epitopes for creating antibodies) with sequence homology of 65% or greater (e.g., 65% or greater, 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, or 99% or greater ) with SEQ ID NO:1. An example of the nucleic acid sequence encoding amino acids 76-103 of PA28γ is shown below as SEQ ID NO:2 below.

Agents that bind to PA28γ or compete with PA28γ binding, such as antibodies and other molecules, are useful with the methods described herein. Molecules useful as agent that bind to PA28γ or compete with PA28γ binding include molecules that inhibit PA28γ from binding to MDM2 and/or p53. An agent can prevent PA28γ from binding with MDM2, for example, by binding to the portion of PA28γ that binds to MDM2 thereby preventing MDM2 from binding. Similarly, an agent can prevent PA28γ from binding to p53, for example, by binding to the portion of PA28γ that binds to p53 thereby preventing p53 from binding. Further, such molecules can competitively bind to either MDM2 or p53 and block PA28γ from binding to those molecules. Molecules useful as agents that bind to PA28γ or compete with PA28γ binding could also prevent PA28γ from mediating a binding interaction between MDM2 and p53. Molecules useful as agents can include proteins, peptides, Attorney Docket No. 20674-060WO1

peptidomimetics, peptoids, small inorganic molecules, small non-nucleic acid organic molecules, or other drugs.

Antibodies as described herein include antibodies that are specific to an epitope contained within the amino acid sequence of PA28γ or a portion thereof, as well as antibodies that are specific to an epitope spanning amino acids 76-103 (SEQ ID NO: 1) of PA28γ or a portion thereof. The polypeptides of PA28γ described herein can be used to prepare antibodies specific to PA28γ. Antibody compositions useful with the methods described herein can also include combinations of antibodies specific to PA28γ that are selected to bind a range of PA28γ polypeptides with different amino acid sequences. For example, such a combination may comprise a first and second antibody, wherein the first antibody is specific to SEQ ID NO: 1 or a portion thereof and the second antibody is specific to a portion of PA28γ that does not overlap or overlaps only partially with SEQ ID NO: 1.

The PA28γ specific antibodies described herein include antibodies obtained from both polyclonal and monoclonal preparations, as well as the following: hybrid (chimeric) antibody molecules {see, e.g., Winter et al, Nature (1991) 349, 293-299; and U.S. Patent No. 4,816,567; F(ab')2 and F(ab) fragments; Fv molecules (non- covalent heterodimers, see, e.g., Inbar et al, Proc Natl Acad Sd USA (1972) 69, 2659-2662; and Ehrlich et al., Biochem. (1980) 19, 4091-4096); single-chain Fv molecules (sFv) {see, e.g., Huston et al. , Proc Natl Acad Sci USA (1988) 85, 5897- 5883); dimeric and trimeric antibody fragment constructs; minibodies {see, e.g., Pack et al, Biochem (1992) 31, 1579-1584; Cumber et al, J Immunology (1992) 149B, 120-126); humanized antibody molecules {see, e.g., Riechmann et al, Nature (1988) 332, 323-327; Verhoeyan et al, Science (1988) 239, 1534-1536; and U.K. Patent Publication No. GB 2,276, 169, published 21 September 1994); and, any functional fragments obtained from such molecules, wherein such fragments retain immunological binding properties of the parent antibody molecule. The compositions described herein further include antibodies obtained through non-conventional processes, such as phage display. The antibodies described herein can be polyclonal, monoclonal, recombinant, e.g., chimeric or humanized, fully human, non-human, e.g., murine, or single chain Attorney Docket No. 20674-060 WOl

antibodies. Methods of making such antibodies are known. In some cases, the antibodies have effector function and can fix complement. The antibodies can also be coupled to toxins, reporter groups, or imaging agents.

In some embodiments, the PA28γ specific antibodies described herein are monoclonal antibodies. These monoclonal antibodies include an antibody composition having a homogeneous antibody population. The monoclonal antibodies described herein may be obtained from murine hybridomas, as well as human monoclonal antibodies obtained using human rather than murine hybridomas. See, e.g., Cote, et a Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, 1985, p 77.

Chimeric, humanized, and completely human antibodies expressed by transgenic animals are desirable for applications that include repeated administration, e.g., therapeutic treatment (and some diagnostic applications) of a human subject. Further, all fragments or derivatives thereof (e.g., Fab, Fab', F(ab')₂, scFv, Fv, or Fd fragments) that maintain the ability to specifically bind to and recognize PA28γ are also included. The antibodies described herein can also be used in prophylactic or therapeutic treatment, for example, by delivering a toxin or a therapeutic agent such as an antibiotic.

Agents that prevent the transcription and/or translation of PA28γ such as complementary nucleic acids including antisense oligonucleotides and siRNAs are useful with the methods described herein. An RNA sequence that encodes PA28γ will be readily apparent to those of skill in the art by reviewing the DNA sequence that encodes PA28γ (Accession No. BC002684). An example of an RNA sequence encoding amino acids 76-103 of PA28γ is shown as SEQ ID NO:3 below. RNA interference (RNAi) is a phenomenon in which a small double-stranded nucleic acid can knock down the expression of its corresponding gene. Antisense nucleic acids useful in RNAi are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule. In the cell, they hybridize to that πiRNA, forming a double stranded molecule. The cell does not translate an mRNA in this double-stranded form. Therefore, antisense nucleic acids interfere with the expression of mRNA into protein. Attorney Docket No. 20674-060WO1

A small interfering RNA or short interfering RNA or siRNA is a double- stranded RNA molecule that is complementary to a target nucleic acid sequence, for example, SEQ ID NO: 3. A double-stranded RNA molecule is formed by the complementary pairing between a first RNA portion and a second RNA portion. The length of each portion generally is 30 or fewer nucleotides in length (e.g., 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides), but can be longer, i.e., 49-31 nucleotides (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, or 31). For example, the length of each portion can be between 10 and 49 nucleotides in length. In some siRNA molecules, the first and second portions of the RNA molecule are complementary and when hybridized form a "stem" of a hairpin structure. The first and second portions are joined by a linking sequence, which forms the "loop" in the hairpin structure. The linking sequence can vary in length, e.g., the linking sequence can be 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. While the first and second portions are complementary, complete symmetry is not necessary, as the hairpin structure may contain 3 ' or 5' overhang nucleotides (e.g., a 1, 2, 3, 4, or 5 nucleotide overhang).

Criteria have been established for designing siRNAs. (See, e.g., Elbashire et al, Nature (2001) 411, 494-498; Amarzguioui et al, Biochem. Biophys. Res. Commun. (2004) 316(4), 1050-1058; Reynolds et al., Nat. Biotech. (2004) 22(3), 326- 330). Details on siRNA design can be found in the websites of several commercial vendors such as Ambion, Dharmacon, GenScript, and OligoEngine. The sequence of any potential siRNA candidate generally can be checked for any possible matches to other nucleic acid sequences or polymorphisms of nucleic acid sequence using the BLAST alignment program (see ncbi.nhn.nih.gov on the World Wide Web). Once designed, siRNAs can be generated by any method known in the art, for example, by in vitro transcription, recombinantly, or by synthetic means. siRNAs can be generated in vitro by using a recombinant enzyme, such as T7 RNA polymerase, and DNA oligonucleotide templates, or can be prepared in vivo, for example, in cultured cells. (See, e.g., Elbashire et al, Nature (2001) 411, 494-498; Brummelkamp et al. , Science (2002) 296, 550-553; and Lee et al. , Nat. Biotech. (2002) 20, 500-505).

As an example, an siRNA as described herein can be an RNA that inhibits expression of PA28γ containing a first strand with a sequence substantially identical Attorney Docket No. 20674-060 WOl

to 19-49 consecutive nucleotides of a nucleic acid that encoded PA28γ, and a second strand comprising a sequence substantially complementary to the first. As used herein, the term substantially identical is intended to mean a sequence that is at least 60% (e.g., at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%) identical to another nucleic acid sequence, when compared and aligned with that sequence for maximum correspondence. As used herein the term substantially complementary is intended to mean a sequence that is at least 60% (e.g., at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%) complementary to another nucleic acid sequence, when compared and aligned with that sequence for maximum correspondence. The double-stranded RNA can optionally have a single stranded overhang at either end or both ends. The first strand can be a nucleic acid sequence encoding SEQ ID NO: 1. The double-stranded RNA can further include a pharmaceutically acceptable carrier. The first strand can be connected to the second strand in such a way, e.g., with a connector, that allows the first strand to hybridize to the second strand. Further, a DNA is disclosed that encodes the double-stranded RNA. This DNA can include a promoter functionally linked to single RNA strand containing the first and second strands, such that the first strand can hybridize to the second strand. Further, the DNA can have two anti-parallel promoter functionally linked to the first and second RNA strands.

Additionally, antisense oligonucleotides that inhibit the endogenous expression of PA28γ in a human cell are disclosed. Such antisense oligonucleotides can be, for example, DNA sequences consisting of at least 8 nucleotides complementary to a nucleic acid encoding PA28γ or SEQ ID NO: 1. The antisense oligonucleotide can also be a DNA sequence that is complementary to a nucleic acid sequence encoding PA28γ or SEQ ID NO:2. Additionally, the antisense oligonucleotide can be an RNA sequence consisting of at least 8 nucleotides complementary to a nucleic acid encoding PA28γ or SEQ ID NO: 1. The antisense oligonucleotide can also be a RNA sequence that is complementary to a nucleic acid encoding PA28γ or SEQ ID NO: 3. Further the antisense oligonucleotide can have the Attorney Docket No. 20674-060WO1

nucleic acid sequence of SEQ ID NO:4. Optionally the antisense oligonucleotide is double stranded.

Further, agents that bind to a promoter region that promotes the transcription of PA28γ could also be used to block mRNA formation and thereby prevent PA28γ formation.

The oligonucleotides, peptides and agents described herein and/or pharmaceutically acceptable salts thereof can be provided in a pharmaceutical composition. Depending on the intended mode of administration, the pharmaceutical composition can be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include an effective amount of a oligonucleotide, peptide, or agent as described herein and/or a pharmaceutically acceptable salt thereof in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers, or diluents. By pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected substrate without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

As used herein, the term "carrier" encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia, PA, 2005. Examples of physiologically acceptable carriers include buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as Attorney Docket No. 20674-060WO1

polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN^® (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICS™ (BASF; Florham Park, NJ).

Compositions containing an oligonucleotide, peptide, or agent as described herein and/or a pharmaceutically acceptable salt thereof suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

These pharmaceutical compositions may also contain adjuvants such as preserving, wetting, emulsifying, suspending, and dispensing agents. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

Solid dosage forms for oral administration of an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof are admixed with at least one inert customary excipient (or carrier) such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as Attorney Docket No. 20674-060 WOl

for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example, paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.

Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.

Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others well known in the art. They may contain opacifying agents, and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions which can be used are polymeric substances and waxes. The active compounds can also be in micro- encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

Liquid dosage forms for oral administration of an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3- butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols and fatty acid esters of sorbitan or mixtures of these substances, and the like. Attorney Docket No. 20674-060WO1

Suspensions, in addition to the active compounds, may contain suspending agents, as for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar- agar and tragacanth, or mixtures of these substances, and the like. Compositions of an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof for rectal administrations are preferably suppositories which can be prepared by mixing the compounds of the present invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethyleneglycol or a suppository wax, which are solid at ordinary temperatures but liquid at body temperature and therefore, melt in the rectum or vaginal cavity and release the active component.

Dosage forms for topical administration of an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof include ointments, powders, sprays, and inhalants. The oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof are admixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants as may be required. Ophthalmic formulations, ointments, powders, and solutions are also contemplated as being within the scope of administration methods for an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof.

The term pharmaceutically acceptable salt as used herein refers to those salts of an oligonucleotide, peptide, or agent as described herein that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of patients without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds of the invention. The term "salts" refers to the relatively non-toxic, inorganic and organic acid addition salts of an oligonucleotide, peptide, or agent as described herein. These salts can be prepared in situ during the isolation and/or purification of the oligonucleotide, peptide, or agent as described herein or by separately reacting the oligonucleotide, peptide, or agent as described herein with a suitable organic or inorganic acid and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, Attorney Docket No. 20674-060WO1

bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate mesylate, glucoheptonate, lactobionate, methane sulphonate and laurylsulphonate salts, and the like. These may include cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium and amine cations including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. (See S. M. Barge et al., J. Pharm. Sd. (1977) 66, 1, which is incorporated herein by reference in its entirety, at least, for compositions taught therein.)

Methods are described herein that are useful in treating cancer and other diseases marked by proliferation of cells. The methods can be used to treat a subject with cancer and/or other proliferative diseases. Subjects for treatment include animals, for example, mammalian species such as humans, and domestic animals such as dogs, cats, horses, and the like. Methods for regulating PA28γ involve reducing PA28γ from mediating an interaction between MDM2 and p53. The term "reducing" as used herein refers to halting, decreasing, delaying, or completely eliminating as compared to a control, i.e., a control lacking an agent or the same subject or sample prior to contact with an agent. Cancers and proliferative diseases that can be treated using the methods and compositions described herein include, but are not limited to, abnormally growing cells and tumor cells such as papillomas, warts, and gliomas, breast cancer, colon cancer, hepatomas, leukemias, lung cancer (e.g. small cell and non-small cell), melanoma, myelomas, neuroblastomas, osteosarcomas, ovarian cancer, pancreatic cancer, prostate cancer (androgen-dependent or -independent), cancer of the head and neck, thyroid cancer, uterine cancer, cervical cancer, tumors of the brain such as astrocytomas, activated immune cells (e.g. , activated lymphocytes, lymphoid and myeloid cells), choriocarcinoma, endometrial cancer, esophageal cancer, gastric cancer, intraepithelial neoplasms, renal cancer, liver cancer, biliary tract cancer, oral cancer, rectal cancer, sarcomas, skin cancer, testicular cancer.

A method of promoting cell death, for example, in a cancer cell is described. This method includes contacting a cell with a therapeutically effective amount of an Attorney Docket No. 20674-060 WOl

agent that binds PA28γ. The agent prevents PA28γ from mediating an interaction between MDM2 and p53. The agent can prevent PA28γ from binding to MDM2, p53, or to both MDM2 and p53. The agent can be an antibody and the antibody can bind an epitope of PA28γ. The epitope can be SEQ ID NO: 1 or a portion of SEQ ID NO: 1. In this method, and all the methods described, various combinations of agents can be used, for example, an additional agent such as a chemotherapeutic agent, radiation, or anti-inflammatory agent can also be administered to the cell.

The term therapeutically effective amount as used herein refers to an amount of a particular agent that will reduce the level of PA28γ binding to MDM2, p53, or both MDM2 and p53, as compared to a control. The therapeutically effective amount of a particular agent may be determined by one of ordinary skill in the art. The agents may be administered in a single dose or in the form of individual divided doses, such as from 1 to 4 times per day. The specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors, including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition.

To promote cell death in a cancer cell, the cancer cell can be contacted with a therapeutically effective amount of an agent that inhibits PA28γ formation. The agent can inhibit transcription of the PA28γ gene. The agent can be a nucleic acid that hybridizes under physiological conditions to a nucleic acid encoding PA28γ or functionally linked promoter regions such that transcription of RNA encoding the PA28γ amino acid sequence is blocked. The term physiological conditions refers to conditions that are typical inside a cell (i.e., pH is around 7, the predominant solvent is water, and the temperature is above 0⁰C and below 50⁰C). If the agent is a nucleic acid, the nucleic acid can also hybridize under physiological conditions to a nucleic acid encoding SEQ ID NO: 1 or to an RNA encoding PA28γ. Further, the agent can inhibit the translation of RNA encoding PA28γ . An additional agent such as a chemotherapeutic agent, radiation, or anti-inflammatory agent can also be administered to the cell. Attorney Docket No. 20674-060WO1

A method for treating cancer in a subject is described. In this method a subject is administered a therapeutically effective amount of an agent that binds PA28γ and reduces PA28γ mediation in an interaction between MDM2 and p53. As used herein the terms treating or treatment of cancer or cancerous cells in a subject includes: delay in onset; diminution, eradication, or delay in exacerbation of signs or symptoms after onset; and prevention or delay of relapse or metastasis. The agent can reduce PA28γ binding to MDM2, p53, or to both MDM2 and p53. The agent can be an antibody or any of the agents described herein and such agents can be combined with other agents. The subject to be treated can be administered a therapeutically effective amount of an agent that inhibits PA28γ formation, optionally in combination with other therapeutic agents. The agent can inhibit transcription of the PA28γ gene. The agent can be a nucleic acid that hybridizes under physiological conditions to a nucleic acid encoding PA28γ or functionally linked promoter regions such that transcription of RNA encoding the PA28γ amino acid sequence is blocked or reduced. If the agent is a nucleic acid, the nucleic acid can also hybridize under physiological conditions to a nucleic acid encoding SEQ ID NO: 1 or to an RNA encoding PA28γ. Further, the agent can inhibit the translation of RNA encoding PA28γ .

A method of decreasing expression of PA28γ is described. In this method, an antisense oligonucleotide or siRNA that inhibits the expression of PA28γ is provided. Then the oligonucleotide is introduced into a cell that expresses PA28γ. The antisense oligonucleotide can be a nucleotide sequence consisting of at least 8 nucleotides that are complementary to a nucleic acid encoding PA28γ, a nucleic acid encoding SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or a portion of these sequences. Further the antisense oligonucleotide can have the nucleic acid sequence of SEQ ID NO:4.

Methods for screening potential agents that bind to PA28γ are also disclosed. These methods (also referred to herein as screening assays) can be used to identify molecules that bind to PA28γ, i.e., candidate compounds identified from one or more test compounds {e.g., antibodies, proteins, peptides, peptidomimetics, peptoids, small inorganic molecules, small non-nucleic acid organic molecules, or other drugs). Attorney Docket No. 20674-060WO1

Compounds thus identified can be used to modulate binding between MDM2 and p53 by interacting with PA28γ. Further, the cells used in the method can be cultured to investigate relative apoptosis levels. In these cultured cells, an increased apoptosis level indicates that the agent is blocking PA28γ function. By way of example, one such method for detecting an agent that reduces

PA28γ function involves several steps. One step is treating a first cell that expresses PA28γ, MDM2, and p53 with a candidate compound. A second cell that expresses MDM2 and p53, but not PA28γ, is also treated with the candidate compound. The viability of the fist cell is compared with the viability of the second cell. In this method, a reduction in viability in the first cell as compared to the second cell indicates the candidate compound blocks PA28γ function.

The test compounds used in the methods described herein can be obtained using any of the numerous approaches in combinatorial library methods, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone, which are resistant to enzymatic degradation, but which, nevertheless, remain bioactive; see, e.g., Zuckermann et al, 1994, J. Med. Chem., 37:2678-2685); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one- bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer, or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des., 12: 145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example, in DeWitt et al (1993, Proc. Natl. Acad. Sci. USA, 90:6909; Erb et al. , 1994, Proc. Natl. Acad. Sci. USA, 91 : 11422; Zuckermann et al. , 1994, J. Med. Chem., 37:2678; Cho et al, 1993, Science, 261:1303; Carrell etal, 1994, Angew. Chem. Int. Ed. Engl., 33:2059; Carell et al, 1994, Angew. Chem. Int. Ed. Engl., 33:2061; and in Gallop et al, 1994, J. Med. Chem., 37:1233). Libraries of compounds may be presented in solution {e.g., Houghten, 1992,

Biotechniques, 13:412-421), or on beads (Lam, 1991, Nature, 354:82-84), chips Attorney Docket No. 20674-060 WOl

(Fodor, 1993, Nature, 364:555-556), bacteria (Ladner, U.S. Patent No. 5,223,409), spores (Ladner, U.S. Patent No. 5,223,409), plasmids (Cull et al, 1992, Proc. Natl. Acad. Sci. USA, 89:1865-1869), or on phage (Scott and Smith, 1990, Science, 249:386-390; Devlin, 1990, Science, 249:404-406; Cwtά& et al, 1990, Proc. Natl. Acad. Sci. USA, 87:6378-6382; Felici, 1991, J. MoI. Biol., 222:301-310; and Ladner supra).

Cell-free assays are also possible and involve preparing a reaction mixture of PA28γ and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected.

An interaction between two molecules, for example, can be detected using fluorescence energy transfer (FET) {see, e.g., Lakowicz et al, U.S. Patent No. 5,631,169 and Stavrianopoulos et al, U.S. Patent No. 4,868,103). A fluorophore label on the first 'donor' molecule is selected such that its emitted fluorescent energy will be absorbed by a fluorescent label on a second 'acceptor' molecule, which in turn is able to fluoresce due to the absorbed energy. Alternately, the 'donor' protein molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the 'acceptor' molecule label may be differentiated from that of the 'donor.' Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the 'acceptor' molecule label in the assay should be maximal. An FET binding event can be conveniently measured through standard fluorometric detection means well known in the art {e.g., using a fluorimeter).

As a further example, determining the ability a target molecule to bind to PA28γ can be accomplished using real-time Biomolecular Interaction Analysis (BIA) {e.g., Sjolander et al, 1991, Anal. Chem., 63:2338-2345 and Szabo et al, 1995, Curr. Opin. Struct. Biol., 5:699-705). "Surface plasmon resonance" or "BIA" detects biospecific interactions in real time, without labeling any of the interactants {e.g.,

BIAcore). Changes in the mass at the binding surface (indicative of a binding event) result in alterations of the refractive index of light near the surface (the optical Attorney Docket No. 20674-060WO1

phenomenon of surface plasmon resonance (SPR)), resulting in a detectable signal that can be used as an indication of real-time reactions between biological molecules.

The PA28γ or the test substance can also be anchored onto a solid phase (including, for example, a mobile solid phase support such as beads). The PA28γ/test compound complexes anchored on the solid phase can be detected at the end of the reaction. For example, PA28γ can be anchored onto a solid surface, and the test compound, which is not anchored, can be labeled, either directly or indirectly, with a detectable label as discussed herein.

PA28γ and portions thereof or multiple test substances also can be anchored onto a solid phase using protein microarray technology, which is also known by other names including: protein chip technology and solid-phase protein array technology. Protein microarray technology is well known to those of ordinary skill in the art and is based on, but not limited to, obtaining an array of identified peptides or proteins on a fixed substrate, binding target molecules or biological constituents to the peptides, and evaluating such binding. See, e.g., G. MacBeath & S. L. Schreiber, Science (2000) 289(5485), 1760-1763. Microarray substrates include but are not limited to glass, silica, aluminosilicates, borosilicates, metal oxides such as alumina and nickel oxide, various clays, nitrocellulose, or nylon. The microarray substrates may be coated with a compound to enhance synthesis of a probe (e.g., a peptide) on the substrate. Coupling agents or groups on the substrate can be used to covalently link the first amino acid to the substrate. A variety of coupling agents or groups are known to those of skill in the art. Peptide probes can be synthesized directly on the substrate in a predetermined grid. Alternatively, peptide probes can be spotted on the substrate, and in such cases the substrate may be coated with a compound to enhance binding of the probe to the substrate. In these embodiments, presynthesized probes are applied to the substrate in a precise, predetermined volume and grid pattern, preferably utilizing a computer-controlled robot to apply probe to the substrate in a contact-printing manner or in a non-contact manner such as ink jet or piezo-electric delivery. Probes may be covalently linked to the substrate. In some embodiments, one or more control peptide or protein molecules are attached to the substrate.

Control peptide or protein molecules allow determination of factors such as peptide or Attorney Docket No. 20674-060WO1

protein quality and binding characteristics, reagent quality and effectiveness, hybridization success, and analysis thresholds and success.

In some embodiments it is desirable to immobilize PA28γ to facilitate separation of complexed from uncomplexed forms, as well as to accommodate automation of the assay. Binding of a test compound to PA28γ, or interaction of

PA28γ with a MDM2 or p53 in the presence or absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided that adds a domain that allows one or both of the proteins to be bound to a matrix. For example, glutathione-S-transferase/ PA28γ fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione Sepharose™ beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and either the non-adsorbed target protein, MDM2, or p53, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of PA28γ binding determined using standard techniques.

Other techniques for immobilizing either PA28γ or a binding target on matrices include using conjugation of biotin and streptavidin. Biotinylated PA28γ or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kits from Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).

To conduct the assay, the non-immobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the Attorney Docket No. 20674-060WO1

previously non-immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the immobilized component (the antibody, in turn, can be directly labeled or indirectly labeled with, e.g., a labeled anti-Ig antibody).

Cell-free assays also can be conducted in a liquid phase. In such an assay, the reaction products are separated from unreacted components, by any of a number of standard techniques, including but not limited to: differential centrifugation (for example, Rivas et al, 1993, Trends Biochem. Sci., 18:284-287); chromatography (gel filtration chromatography, ion-exchange chromatography); electrophoresis {see, e.g., Ausubel et al., eds., Current Protocols in Molecular Biology (1999) J. Wiley: New York.); and immunoprecipitation {see, e.g., Ausubel et al, eds., Current Protocols in Molecular Biology, (1999) J. Wiley: New York). Such resins and chromatographic techniques are known to those skilled in the art {see, e.g. , Heegaard, J. MoI. Recognit. (1998) 11, 141-148; Hage et al., J. Chromatogr. B. Biomed. Sci. Appl. (1997) 699, 499-525). Further, fluorescence energy transfer may also be conveniently utilized, as described herein, to detect binding without further purification of the complex from solution. In the methods described herein, the use of multiple agents in various combinations is possible. For example, multiple antibodies can be used or multiple antisense nucleotides or siRNAs can be used. Further, antibodies can be combined with antisense nucleotides and/or siRNAs. The scope of the various combinations, even if not explicitly stated herein, are considered to be described. In these methods, the subject, cancer, or cancerous cells, for example, can be further treated with one or more additional agents. The one or more additional agents and an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof can be administered in any order, including simultaneous administration, as well as temporally spaced order of up to several days apart. The methods may also include more than a single administration of the one or more additional agents and/or an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof. The administration of the one or Attorney Docket No. 20674-060 WOl

more additional agent and an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof may be by the same or different routes and concurrently or sequentially. The types of additional agents that can be administered include, but are not limited to chemotherapeutic agents and radiation. Examples of combinations that can be used include, but are not limited to, an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof and chemotherapy; an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof and radiation; and an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof, chemotherapy, and radiation. Administration could also be to blood or other biological sample, e.g., bone marrow, removed from a subject and then reintroduced into the same or a different subject.

Chemotherapeutic agents useful with an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof include, but are not limited to, Taxotere® (Sanofi-Aventis; Bridgewater, NJ), Gemcitabine, methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5- fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS faraesyl transferase inhibitor, farnesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470,

Hycamtin/Topotecan, PKC412, Valsρodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZDOlOl, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32 /Valrubicin, Metastron/strontium derivative,

Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Placlitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS-182751 /oral platinum, UFT(Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Attorney Docket No. 20674-060 WOl

Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZDl 839, LU 79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin,

Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as melphelan and cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorambucil, Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP 16-213), Floxuridine, Fluorouracil (5-FU),

Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Alfa- 2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o.p¹- DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-

AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate. Radiation treatment useful with an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof includes, but is not limited to, γ-irradiation. γ-irradiation can be administered, for example, from about 0.1 to about 10.0 Gy, from about 0.25 to about 8.0 Gy, from about 0.5 to about 5.0 Gy, or as 3.0 Gy of radiation. As an example, γ-irradiation can be administered at 1.56 Gy/min. γ-irradiation can be administered, for example, over a one or two week period. If administered over a one week period, γ-irradiation can be administered, e.g., either twice or four times. If administered over a two week period, γ-irradiation can be administered, e.g., three times on Days 2, 4, and 9.

An oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof can be administered before, consecutively with, or after γ-irradiation treatment or other treatment. Pre-treatment with an Attorney Docket No. 20674-060 WOl

oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof can occur, for example, from about 2 to about 6 h prior to γ- irradiation. Alternatively, post-treatment with an oligonucleotide, peptide, or agent as described herein and/or pharmaceutically acceptable salts thereof can occur, for example, from about 2 to about 6 h prior to γ-irradiation.

The methods as described herein are useful for the prophylactic or therapeutic treatment of humans or animals. For example, the methods are useful for human (pediatric and adult) and veterinary applications. Treating with a combination of an oligonucleotide, peptide, or agent and/or pharmaceutically acceptable salts thereof and one or more of a chemo therapeutic agents, radiation, or other agents is described.

The preparation of plasmids or viruses including vectors, and the use of nucleic acid sequences to construct vectors expressing antisense oligonucleotides or siRNAs that can interfere with or block the mRNAs of any or all of the DNA sequences described herein is also described. Correspondingly, the preparation of antisense oligonucleotides and siRNAs is included herein.

As used herein, the term isolated in reference, for example, to a nucleic acid molecule is a molecule that is separated from and relatively devoid of other molecules that are usually associated with the isolated molecule in vivo. Thus, an isolated nucleic acid molecule includes, without limitation, a nucleic acid molecule that is free of sequences that naturally flank one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid is derived {e.g., a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease digestion). Such an isolated nucleic acid molecule can be introduced into a vector (e.g. , a cloning vector, or an expression vector) for convenience of manipulation or to generate a fusion nucleic acid molecule or polypeptide. In addition, an isolated nucleic acid molecule can include an engineered nucleic acid molecule such as a recombinant or a synthetic nucleic acid molecule. Thus, the molecule can be relatively pure, including, for example, about 70-100% pure.

Isolated nucleic acid molecules as described herein can be obtained using techniques routine in the art. For example, the isolated nucleic acids described herein can be obtained using any method including, without limitation, recombinant nucleic acid technology, and/or the polymerase chain reaction (PCR). General PCR Attorney Docket No. 20674-060WO1

techniques are described, for example in PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate a nucleic acid molecule. Isolated nucleic acids as described herein also can be chemically synthesized, either as a single nucleic acid molecule or as a series of oligonucleotides. In addition, isolated nucleic acid molecules as described herein also can be obtained by mutagenesis using common molecular cloning techniques (e.g., site-directed mutagenesis). Possible mutations include, without limitation, deletions, insertions, substitutions, and combinations thereof.

Vectors containing the nucleic acid molecules described herein are also useful. For example, an expression vector including a coding sequence encoding eight or more consecutive amino acids of SEQ ID NO:1 or SEQ ID NO:2 is disclosed. Vectors, including expression vectors, are commercially available and/or produced by recombinant DNA technology methods routine in the art. A vector containing a nucleic acid molecule can have elements necessary for expression operably linked to such a nucleic acid, and further can include sequences such as those encoding a selectable marker (e.g., a sequence encoding antibiotic resistance), and/or those that can be used in purification of a polypeptide (e.g. , a His tag). A vector as used herein includes any viral vector, as well as any plasmid, cosmid, phage, or binary vector. Vectors can integrate into the cellular genome or exist extrachromosomally (e.g., an autonomous replicating plasmid with an origin of replication).

Vectors as just described can be placed into host cells. The term host cell refers not only to a particular cell but also to the progeny or potential progeny of that cell. A host cell can be any prokaryotic or eukaryotic cell. For example, host cells can include bacterial cells such as E. coli, insect cells, yeast cells, or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Many methods for introducing nucleic acids into host cells, both in vivo and in vitro, are known in the art and include, but are not limited to, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer.

Isolated cells useful with the methods described herein include cells that do not express PA28γ. As referred to herein, an isolated cell refers to a cell separated Attorney Docket No. 20674-060WO1

from other cells. Isolated cells that do no express PA28γ can alternatively express MDM2, p53, or both MDM2 and p53. Additional isolated cells that are useful with the methods described herein include cells that express a PA28γ mutant. The mutant can include a mutation that reduces PA28γ mediated interaction between MDM2 and p53. Such a mutant may have a mutation at one ore more site in residues 76 to 103 of PA28γ. Mutations include substitutions, insertions, or deletions, such mutations reduce the ability of PA28γ to bind to either MDM2 or p53. Methods for creating such cells are known in the art.

The examples below are intended to further illustrate certain embodiments of the invention, and are not intended to limit the scope of the claims.

Examples Methods Used Cells

LNCaP, MCF7, and PC3 cells were obtained from the American Type Culture Collection (Rockville, MD). U2OS (A.T.C.C. number HTB-96) and MCFlOA (A.T.C.C. number CRL-10317) cells are also available from the American Type Culture Collection. MCF7 cells with stable p53 knockdown are described in M. Li et al, Cancer Res. 65 (2005) 8200-8208. PC3, MCF7, and MCFlOA cells with PA28γ stable knockdown cells were established using pBabe-U6 based RNAi producing vectors as described in M. Li et al, Cancer Res. 65 (2005) 8200-8208 and Z. Zhang et al., J. Biol. Chem. 279 (2004) 16000-16006. The cells were cultured under standard conditions and procedures as described by the American Type Culture Collection. Plasmids and Oligonucleotides Flag tagged pcDNA3-PA28β and PEF-PA28γ vectors were provided by Dr. Y. Matsuura (Osaka University, Japan) and are described in H Miyamoto, et al., J. Virol. 81(2007) 1727-1735. The GFP-Cl-PA28γ, PGEX-2T-PA28γ, pcDNA3-PA28γ and GFP-C l-PA28γ deletions were generated by proof-reading PCR, and mutants GFP- Cl-PA28γ-P245Y, -G150S and -N151Y were produced using the QuikChange® Site- Directed Mutagenesis Kit (Stratagene; La Jolla, CA) and verified by sequencing. pcDNA3-p53-HA (J Zhu, et al, J. Biol. Chem. 275 (2000) 39927-39934.), pcGT-T7- MDM2 (D Chen et al, Oncogene (2007): in Press), p21 luciferase reporter (R Attorney Docket No. 20674-060WO1

Chinery et al, Nature Medicine 3 (1997) 1233-1241), pBabe-U6 (L Shu, et al, Genes Dev. 20 (2006) 2961-2972), and _PBabe-U6-p53 (L Shu, et al, Genes Dev. 20 (2006) 2961-2972) were provided by Dr. X. Chen (UAB) and are described in the cited references. pcMV-MDM2 (J Roth, et al, EMBO J. 17(1998):554-564.) and pcMV- p53 (U Santhanam, et al, Proc Natl Acad Sci USA. 88 (1991) 7605-7609) were provided by Dr. J. Chen (Moffitt Cancer Center) and are described in the cited references. HA-Ub was provided by Dr. Y. Shi (Harvard) and is described in G Sui, et al, Cell 117(2004) 859-872. MDM2 antisense and mismatch oligonucleotides have been described previously (H. Wang et al, Clin. Cancer Res. 7 (2001) 3613- 3624; H. Wang et al, Mol Med. 8 (2002) 185-199; H. Wang et al, Ann. N Y. Acad. Sci. 1002 (2003) 217-235; H. Wang et al, Prostate 54 (2003) 194-205; R. Zhang et al, Curr. Cancer Drug Targets 5 (2005) 43-49). The double-stranded control siRNA pool (non-targeting), PA28γ siRNA pool and the transfection reagent DharmaFECT™ 1 were purchased from Dharmacon, Inc. (Lafayette, CO). Antibodies

Rabbit PA28γ antiserum was purchased from AFFINITI (Exeter, United Kingdom) and rabbit polyclonal antibody was purchased from Invitrogen Corp. (Carlsbad, CA). Human p53 antibodies DO-I and FL393 were purchased from EMD Biosciences, Inc./CALBIOCHEM^® (San Diego, CA) and Santa Cruz Biotechnology (Santa Cruz, CA). Human MDM2 antibodies SMP 14 and H221 were purchased from Santa Cruz Biotechnology. Human p63 4A4, p73 GC 15 and T7 antibodies were purchased from EMD Biosciences, Inc./CALBIOCHEM^®. The proteosome a/b subunit and S7/Rptl antibodies were purchased from AFFINITI, and Flag M2 and GFP-N-Terminal antibodies were purchased from Sigma (St. Louis, MO). The HA.11 monoclonal antibody was purchased from Covance (Princeton, NJ). Radiation Therapy γ-irradiation was administered at 8 Gy by a ⁶⁰Co Picker unit irradiator (1.56 Gy/min) (JL Shepard Co.; Glendale, CA).

Example 1: PA28γ reduces cellular p53 levels and inhibits the transactivational activity of p53

To determine the effects of PA28γ on p53 expression, several human cancer cell lines were transfected with PA28γ or its homologue, PA28β {see Fig. IA). After Attorney Docket No. 20674-060 WOl

24 hours, in cells transfected with PA28γ (but not PA28β) expression of p53 protein was decreased in a concentration-dependent manner. Concomitantly, the expression of p21, a p53 target gene, was decreased. To ascertain whether PA28γ is essential for p53 regulation, stable PA28γ knockdown (KD) MCF7 cells were established using siRNA plasmids. Compared to cells transfected with the control vector (pBabe-U6), the level of p53 protein in PA28γ KD cells was elevated (Fig. IB). Further, PA28γ knockdown by transient transfection of double stranded siRNA also resulted in an increase in the p53 levels in A549 and MCF7 cells {see Fig. IB).

To examine the effects of PA28γ on p53 transactivational activity, MCF7 cells were transfected with either PA28γ or PA28β and a p21 luciferase reporter. p21 reporter activity was decreased in a concentration-dependent manner in PA28γ transfected cells, but PA28β transfection had no substantial effect (Fig. 1C). To confirm that the negative effects of PA28γ on the p21 reporter were the result of p53 inhibition, rather than p53 -independent pathways (Weinberg & Denning, Crit. Rev. Oral Biol. Med. 13 (2002) 453-464), MCF7 cells were co-transfected with PA28γ or PA28β with both the p21 reporter and p53. Co-transfected p53 reversed the negative effects of PA28γ overexpression {see Fig. 1C). These observations indicate that PA28γ can inhibit p53 transactivational activity in cells by decreasing the level of the p53 protein. Example 2; PA28γ induces ρ53 ubiquitination and proteasome-mediated degradation p53 is a short-lived protein regulated by proteasomal degradation. To evaluate the effects of PA28γ on p53 degradation, the p53 protein steady-state in cells was determined. To that end, cells were transfected with PA28γ or its corresponding control vector. As expected, the half-life of endogenous p53 was decreased in the PA28γ-transfected cells {see Figs. 2A and 2B).

To verify that PA28γ induces p53 degradation through the proteasome, MCF7 cells were transfected with PA28γ or empty vector, and the cell lysates were immunoprecipitated by the antibody against proteasome α/β subunits. When PA28γ was overexpressed, there was an increase in p53 bound by the proteasome {see Fig. 2C). Attorney Docket No. 20674-060 WOl

In order to determine whether PA28γ affects p53 ubiquitination (because ubiquitination is important for p53 degradation (M. Li et ai, Nature 416 (2002) 648- 653)), PA28γ was overexpressed in cells, with or without additional transfection of ubiquitin, followed by inhibition of proteasome activity by MG132 (15 μM, 4 h). As shown in Fig. 2D, both direct immunoblotting and immunoprecipitation demonstrated increased ubiquitination of endogenous p53 in PA28γ overexpressing cells.

To determine if PA28γ and MDM2 synergistically induce p53 ubiquitination, LNCaP cells were co-transfected with PA28γ and HA-Ub in the presence or absence of MDM2, followed by inhibition of the proteasome with MG132. Both direct immunoblotting {see Fig. 2E) and immunoprecipitation {see Fig. 2F) showed increases of ubiquitinated p53 in the cells with cotransfected MDM2 and PA28γ. Example 3; PA28Y binds to both MDM2 and p53

Based on the observation in Example 2 that PA28γ amplifies the MDM2- mediated p53 ubiquitination, whether there is binding among PA28γ, MDM2 and p53 was determined. First, the binding between endogenous MDM2 and PA28γ was examined in PC3 {see Fig. 3Al) and LNCaP {see Fig. 3A2) cells. As shown in Figs. 3Al and 3A2, there is direct binding between MDM2 and PA28γ in immunoprecipitates captured by either the PA28γ antibody {see Fig. 3Al) or the MDM2 antibody {see Fig. 3A2). The binding was further confirmed by in vitro assays which showed that MDM2 or PA28γ was pulled down by GST-PA28γ or

GST-MDM2, but not by GST {see Fig. 3B). For confirmation, exogenous T7-tagged MDM2 and GFP-tagged PA28γ were overexpressed in COS7 cells. The binding between MDM2 and PA28γ, using either GFP {see Fig. 3Cl) or T7 {see Fig. 3C2) for immunoprecipitation and the T7 or GFP antibody for immunoblotting, was detected in lysates from co-transfected cells.

Next, the possible binding between PA28γ and p53 was examined. In LNCaP cells, both endogenous MDM2 and p53 were detected in immunoprecipitates with the PA28γ antibody {see Fig. 3D). In addition, in pull-down assays, in vitro translated p53 or PA28γ was pulled down by GST-PA28γ or GST-p53, but not by GST {see Fig. 3E). Exogenous p53-HA and PA28γ-GFP were transiently overexpressed in COS7 cells to confirm the binding. As demonstrated in Figs. 3Fl and 3F2, the HA antibody {see Fig. 3Fl) or GFP antibody {see Fig. 3F2) detected p53-HA or PA28γ-GFP in the Attorney Docket No. 20674-060WO1

immunoprecipitates captured by the GFP antibody (see Fig. 3Fl) or HA antibody (see Fig. 3F2), respectively, of cell lysates from co-transfected cells. Taken together, these observations indicate a direct binding among PA28γ, MDM2 and p53. Example 4; PA28γ is essential for MDM2-mediated p53 degradation To establish that PA28γ is a co-factor for p53 degradation induced by MDM2, low amounts of MDM2 were transfected either alone or co-transfected with low amounts of PA28γ into MCF7 cells (see Fig. 4A). Ectopically expressed low-level MDM2 alone did not decrease endogenous p53. However, when transfected together, low amounts of PA28γ and MDM2 had a potent inhibitory effect on the level of p53 protein (see Fig. 4A). Next LNCaP cells were co-transfected with PA28γ along with an MDM2 antisense oligonucleotide (AS) or a mismatch control oligonucleotide (ASM) (Z. Zhang et al, Proc. Natl. Acad. ScL USA 100 (2003) 11636-11641), and noted that when MDM2 was inhibited by the oligonucleotide, PA28γ lost its capacity to induce p53 degradation (see Fig. 4B). Consistent with this result, PA28γ did not downregulate the p53 level in U2OS cells when MDM2 was inhibited by antisense oligonucleotides (see Fig. 4C).

To confirm that PA28γ is a co-factor for p53 regulation by MDM2, PA28γ was transiently knocked down in A549 cells by double stranded siRNA (see Fig. 4D). The elevated p53 level in PA28γ knockdown cells was not affected by overexpressed MDM2 (see Fig. 4D). In contrast, in control siRNA transfected cells, the p53 level was decreased by MDM2 (see Fig. 4D). To confirm the results, PC3 and MCF7 cell lines with stable PA28γ KD were established. MCF7 cells with stable PA28γ KD or control cells (U6) were transfected with pcMV-MDM2 (see Fig. 4E) or an MDM2 antisense oligonucleotide (AS) (see Fig. 4F). The decrease in endogenous p53 protein levels after MDM2 overexpression (see Fig. 4E) and accumulation of p53 upon MDM2 inhibition (see Fig. 4F) seen in control cells were abrogated in PA28γ KD cells. Further, PC3 cells with either stable PA28γ KD or pBabeUβ control vector were transfected with p53, MDM2, and GFP (to verify the transfection efficiency). Co-transfection with MDM2 decreased the exogenous p53 level in control PC3 cells (U6), but not in PA28γ KD cells (see Fig. 4G). These data show that PA28γ is essential for p53 degradation induced by MDM2. Attorney Docket No. 20674-060 WOl

Example 5: PA28γ specifically acts on p53, but not its homologues p63 and p73

To determine the specificity of the inhibitory effects of PA28γ on p53, whether PA28γ promotes proteasomal degradation of p63 and p73, the two homologues of p53 was examined. LNCaP (Fig. 5A) and MCF7 (Fig. 5B) cells were transfected with various levels of PA28γ. As shown in Figs. 5A and 5B, p53 was decreased, but p63 and p73 protein levels were unaffected by ectopically expressed PA28γ. This further supports the specific role of PA28γ in the MDM2-mediated degradation of p53, particularly considering that p63 and p73 are resistant to MDM2- mediated degradation (U.M. Moll & N. Slade, MoI. Cancer Res. 2 (2004) 371-386). Example 6: PA28γ induces p53 degradation by facilitating the binding between MDM2 and p53, not by activating the proteasome

To determine whether the activation of the proteasome by PA28γ is required for p53 degradation induced by PA28γ, U2OS cells were transiently overexpressed with GFP-PA28γ or GFP, or three mutants of PA28γ: P245Y, G150S and N151Y. The mutations of the highly conserved amino acids, P245, G150 and N151, though they result in loss of proteasome activation (Z. Zhang et al, Proc. Natl. Acad. ScL USA 95 (1998) 2807-2811), did not have any effect on the PA28γ-induced degradation of p53 (see Fig. 6A).

Subsequently, a series of plasmids expressing mutants of PA28γ were generated by proof-reading PCR. As shown in Figs. 6B and 6C, the region spanning amino acids 76-103 is essential for PA28γ binding to both MDM2 (see Fig. 6B) and p53 (see Fig. 6C). The homologue specific "insert region" of the members of the PA28 family spans amino acids 71-103 (J.R. Knowlton et al, Nature 390 (1997) 639- 643). When the mutant of PA28γ without most of this region was transfected into U2OS cells, the mutant did not have the capability to degrade p53 (see Fig. 6D). Although there was no detectable binding between PA28γ-l-l 15 and MDM2 (possibly due to the distortion of the conformation of the truncated protein), PA28γ without amino acids 116-161 was still able to bind MDM2. PA28γ without amino acids 76-103 also lost its binding capacity (see Fig. 6B). Considering that amino acids 66-161 of PA28γ also bind to MDM2 (see Fig. 6B), amino acids 76-103 appear to be essential for PA28γ binding to MDM2. Attorney Docket No. 20674-060WO1

Because PA28γ is a cofactor for MDM2-mediated induction of p53 ubiquitination and degradation and directly binds to both proteins, whether PA28γ affects the binding between MDM2 and p53 was also examined. Cells were transfected to overexpress various levels of PA28γ, and the cell lysates were immunoprecipitated with antibodies for p53. The highest level of PA28γ led to an increase in MDM2 in the p53 immunoprecipitates, although the total p53 and immunoprecipitated p53 levels were decreased by PA28γ (see Fig. 6El), demonstrating that PA28γ influences the binding between p53 and MDM2. To establish that PA28γ is required for the MDM2-p53 interaction, cells were transfected with siRNA to transiently knockdown PA28γ. p53 was upregulated by PA28γ knockdown, while the MDM2 binding to p53 was decreased (see Fig. 6E2). These observations were supported by an in vitro pull-down assay in which GST-MDM2 was incubated with in vitro translated p53 in the presence or absence of in vitro translated PA28γ (see Fig. 6F). The amount of p53 bound to GST-MDM2 captured by GST beads was increased in the presence of PA28γ compared to that in the absence of PA28γ. These data demonstrate that PA28γ induces p53 degradation specifically by promoting the binding between MDM2 and p53, rather than by proteasome activation.

Example 7: PA28γ inhibits p53-mediated apoptosis and cell cycle arrest in the presence or absence of DNA damage

Considering the negative effects of PA28γ on p53 protein levels and transactivational activity, the role of PA28γ in p53-induced apoptosis and cell cycle arrest was assessed. A549 cells were treated with a control siRNA pool or a PA28γ siRNA pool. For the cells treated with the PA28γ siRNA, survival was decreased (Fig. 7A) while apoptosis increased (Fig. 7B). In contrast, the effects of PA28γ (on MCF7 cells) were abrogated by p53 knockdown (Figs. 7A and 7B).

To confirm these results, the normal human breast cell line MCFlOA was selected to establish stable cell lines with PA28γ knockdown (KD), p53 KD, or PA28γ and p53 double-KD. p53, and the product of its target gene, p21, were both elevated in PA28γ KD cells compared to control cells (Fig. 7C). Further, the p21 protein level was decreased in double-KD cells (Fig. 7C). As a result, the proportions of apoptotic (Fig. 7D) and Gl arrested (Fig. 7E) cells in the PA28γ KD cell line were Attorney Docket No. 20674-060 WOl

elevated, and apoptosis and Gl arrest were both inhibited in double-KD cells compared to the level of that in control cells (Fig. 7D and 7E)

In addition, the accumulation of p53 after γ-irradiation was abrogated in the presence of transiently overexpressed PA28γ in MCF7 cells (Fig. 7F). Apoptosis was also inhibited in these cells overexpressing GFP-P A28γ compared to control (GFP only) cells following γ-irradiation (measured eight hours after radiation exposure)(Fig. 7G).

Finally, to examine the hypothesis that PA28γ may act as an oncogene the human normal breast cell line MCFlOA was transiently transfected with various levels of PA28γ or PA28β. In the PA28γ transfected cells, but not the PA28β transfected cells, endogenous p53 decreased in a concentration-dependent manner (Fig. 7H).

The response of p53 to MDM2 inhibition by an antisense oligonucleotide varies in different cancer cell lines. Because PA28γ is necessary for MDM2 -induced p53 degradation, this difference may be due to different levels of endogenous PA28γ in various cancer cells lines. Six cancer cell lines with wild-type p53 were selected to examine the basal level of PA28γ. U2OS cells had the lowest basal expression of PA28γ (Fig. 71). Following MDM2 inhibition, there was no appreciable p53 induction (Fig. 7J). In contrast, p53 protein levels increased following inhibition of MDM2 in other cells, all of which express higher levels of PA28γ (Figs. 71 and 7J). These results indicate that PA28γ is a factor in determining the response of cells to MDM2 inhibition.

Additional embodiments are shown in the claims.

Any patents or publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

The present invention is not limited in scope by the embodiments disclosed in the examples which are intended as illustrations of a few aspects of the invention and any embodiments which are functionally equivalent are within the scope of this invention. Various modifications of the invention in addition to those shown and Attorney Docket No. 20674-060WO1

described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims. Further, while only certain representative combinations of the compositions disclosed herein are specifically discussed in the embodiments above, other combinations of the compositions will become apparent to those skilled in the art and also are intended to fall within the scope of the appended claims.

Attorney Docket No. 20674-060 WOl

Sequences:

SEQ ID NO: 1 (amino acids 76-103 of PA28γ; Homo sapiens (human);

ACCESSION: AAH02684)

HDGLDGPTYKKRRLDECEEAFQGTKV ( SEQ ID NO : 1 )

SEQ ID NO: 2 (nucleic acid sequence encoding amino acids 76-103 of

PA28γ; Homo sapiens (human); ACCESSION: BC002684)

AGTGAAGCTCAAGGTTGATTCTTTCAGGGAGCGGATCACAAGTGAGG CAGAAGACTTGGTGGCAAATTTTTTCCCAAAGAAGTT ( SEQ ID NO : 2 )

SEQ ID NO: 3 (example mKNAfrom nucleic acid sequence encoding amino acids 76-103 of PA28γ; Homo sapiens (human); ACCESSION: BC002684)

AGUGAAGCUCAAGGUUGAUUCUUUCAGGGAGCGGAUCACAAGUGAGG CAGAAGACUUGGUGGCAAAUUUUUUCCCAAAGAAGUU (SEQ ID NO : 3 )

SEQ ID NO:4 (RNA sequence complementary to SEQ ID NO:3)

AACUUCUUUGGGAAAAAAUUUGCCACCAAGUCUUCUGCCUCACUUGU GAUCCGCUCCCUGAAAGAAUCAACCUUGAGCUUCACU (SEQ ID NO: 4)

Claims

Attorney Docket No. 20674-060WO1We claim:

1. A method of promoting cell death comprising contacting a cell with a therapeutically effective amount of an agent that binds PA28γ and reduces an interaction between MDM2 and p53.

2. The method of claim 1 , wherein the agent reduces PA28γ binding to MDM2.

3. The method of claim 1 , wherein the agent reduces PA28γ binding to p53.

4. The method of any of claims 1-3, wherein the agent is an antibody.

5. The method of any of claims 1-3, wherein the agent binds to an epitope of PA28γ and wherein the epitope comprises at least a portion of SEQ ID NO: 1.

6. The method of claim 5, wherein the epitope comprises SEQ ID NO: 1.

7. The method of any of claims 1-3, further comprising administering to the subject an additional agent.

8. The method of claim 7, wherein the additional agent is a chemotherapeutic agent, radiation, or both.

9. A method of promoting cell death comprising contacting the cell with a therapeutically effective amount of an agent that inhibits PA28γ formation.

10. The method of claim 9, wherein the agent inhibits transcription of a nucleic acid encoding PA28γ.

11. The method of claim 10, wherein the agent is a nucleic acid that hybridizes under physiological conditions to a nucleic acid encoding PA28γ or to promoter regions functionally linked to a nucleic acid encoding PA28γ.

12. The method of claim 11, wherein the nucleic acid hybridizes under physiological conditions to a nucleic acid encoding SEQ ID NO: 1. Attorney Docket No. 20674-060 WOl

13. The method of any of claim 9, wherein the agent inhibits the translation of RNA encoding PA28γ.

14. The method of claim 13, wherein the agent is a nucleic acid that hybridizes under physiological conditions to an RNA encoding PA28γ.

15. The method of any of claims 9-14 , further comprising administering to the subject an additional agent.

16. The method of claim 15, wherein the agent is a chemotherapeutic agent, radiation, or both.

17. A method for treating cancer in a subject comprising administering to the subject a therapeutically effective amount of an agent that binds PA28γ and reduces an interaction between MDM2 and p53.

18. The method of claim 17, wherein the agent reduces PA28γ binding to MDM2.

19. The method of claim 17, wherein the agent reduces PA28γ binding to p53.

20. The method of any of claims 17-19, wherein the agent is an antibody.

21. The method of claim 17-19, wherein the agent binds to an epitope of PA28γ comprising at least a portion of SEQ ID NO: 1.

22. The method of claim 21 , wherein the epitope comprises SEQ ID NO: 1.

23. The method of any of claims 17-19, further comprising administering to the subject an additional agent.

24. The method of claim 23, wherein the agent is a chemotherapeutic agent, radiation, or both.

25. A method for treating cancer in a subject comprising administering to the subject a therapeutically effective amount of an agent that inhibits PA28γ formation. Attorney Docket No. 20674-060 WOl

26. The method of claim 25, wherein the agent inhibits transcription of the nucleic acid encoding PA28γ.

27. The method of claim 26, wherein the agent is a nucleic acid that hybridizes under physiological conditions to SEQ ID NO:1 or to promoter regions functionally linked to a nucleic acid encoding PA28γ.

28. The method of claim 27, wherein the nucleic acid hybridizes under physiological conditions to a nucleic acid encoding SEQ ID NO: 1.

29. The method of claim 25, wherein the agent inhibits translation of RNA encoding PA28γ.

30. The method of claim 29, wherein the agent is a nucleic acid that hybridizes under physiological conditions to an RNA encoding PA28γ.

31. The method of any of claims 25-30, further comprising administering to the subject an additional agent.

32. The method of claim 31, wherein the agent is a chemotherapeutic agent, radiation, or both.

33. A purified antibody that specifically binds to SEQ ID NO: 1.

34. A purified antibody as defined in claim 33, wherein the antibody inhibits the binding of PA28γ to MDM2.

35. A purified antibody as defined in claim 33, wherein the antibody inhibits the binding of PA28γ to p53.

36. A purified antibody as defined in any of claims 33-35, wherein the antibody inhibits PA28γ mediation of an interaction between MDM2 and p53.

37. A double-stranded RNA consisting of Attorney Docket No. 20674-060WO1

a first strand comprising a sequence substantially identical to 19-49 consecutive nucleotides of a nucleic acid encoding SEQ ID NO:2; and

a second strand comprising a sequence substantially complementary to the first,

the double-stranded RNA optionally having a single stranded overhang at either end or both ends, wherein the RNA inhibits expression of PA28γ.

38. A double-stranded RNA as defined in claim 37, wherein the first strand comprises a nucleic acid sequence encoding SEQ ID NO:1.

39. A double-stranded RNA as defined in claim 37, further comprising a pharmaceutically acceptable carrier.

40. A double-stranded RNA as defined in claim 37, wherein the first strand and second strand are linked to each other through a linking sequence and the first strand hybridizes to the second strand.

41. A DNA encoding the double-stranded RNA of claims 37-40.

42. The DNA of claim 41 , further comprising a promoter functionally linked to a single RNA strand containing the first strand and the second strand, wherein the first strand can hybridize to the second strand.

43. The DNA of claim 41 , further comprising two anti-parallel promoters functionally linked to the two RNA strands.

44. An antisense oligonucleotide that inhibits the endogenous expression of PA28γ in a cell.

45. An antisense oligonucleotide as defined in claim 44, wherein the antisense oligonucleotide is a nucleotide sequence comprising at least 8 nucleotides complementary to a nucleic acid selected from the group consisting of a nucleic acid encoding PA28γ, a nucleic acid encoding SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. Attorney Docket No. 20674-060WO1

46. An antisense oligonucleotide as defined in claim 44, wherein the antisense oligonucleotide sequence consists of the nucleic acid sequence of SEQ ID NO:4.

47. A method of decreasing expression of PA28γ comprising:

providing an antisense oligonucleotide or siRNA that inhibits the expression ofPA28γ;

introducing the oligonucleotide into a cell that expresses PA28γ.

48. The method of claim 47, wherein the antisense oligonucleotide is a nucleotide sequence comprising at least 8 nucleotides complementary to a nucleic acid selected from the group consisting of a nucleic acid encoding PA28γ, a nucleic acid encoding SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

49. The method of claim 47, wherein the antisense oligonucleotide sequence consists of the nucleic acid sequence of SEQ ID NO:4.

50. A method for detecting an agent that reduces PA28γ function comprising:

treating a first cell expressing PA28γ, MDM2, and p53 with an agent;

treating a second cell expressing MDM2 and p53, but not PA28γ, with the agent; and

comparing viability of the first cell with the second cell,

reduced viability in the first cell as compared to the second cell indicating the agent blocks PA28γ function.

51. An isolated nucleic acid consisting of a nucleic acid encoding SEQ ID NO: 1.

52. An isolated nucleic acid as defined in claim 51 , wherein the nucleic acid is SEQ ID NO: 2.

53. An isolated nucleic acid as defined in claim 51, wherein the nucleic acid is SEQ ID NO: 3. Attorney Docket No. 20674-060WO1

54. An isolated nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:4.

55. An isolated peptide comprising eight or more consecutive amino acids of SEQ ID NO: 1.

56. An isolated peptide as defined in claim 55, wherein the peptide is the peptide of SEQ ID NO: 1.

57. An expression vector comprising a coding sequence encoding eight or more consecutive amino acids of SEQ ID NO:1.

58. An expression vector as defined in claim 57, wherein the coding sequence is SEQ ID NO: 2.