WO2008092134A2

WO2008092134A2 - Tumor-specific antigens, cytotoxic t lymphocytes responsive thereto, and methods of using the same

Info

Publication number: WO2008092134A2
Application number: PCT/US2008/052132
Authority: WO
Inventors: James P. Allison; Peter A. Savage
Original assignee: Memorial Sloan-Kettering Cancer Center
Priority date: 2007-01-26
Filing date: 2008-01-25
Publication date: 2008-07-31
Also published as: WO2008092134A3

Abstract

The present invention provides tumor-specific class I MHC presented peptides and methods of using the same, as well as cytotoxic T lymphocytes (CTLs) responsive to tumor-specific class I MHC presented peptides and methods of using the same.

Description

PATENT ATTORNEY DOCKET NO. 188944/PCT

TUMOR-SPECIFIC ANTIGENS, CYTOTOXIC T LYMPHOCYTES RESPONSIVE THERETO, AND

METHODS OF USING THE SAME

[001] CROSS-REFERENCE TO RELATED APPLICATIONS

[002] This application claims priority to U.S. provisional patent application serial number 60/886,897 filed January 26, 2007, incorporated herein by reference in its entirety, and U.S. provisional patent application serial number 61/015,172 filed December 19, 2007, incorporated herein by reference in its entirety.

[003] FIELD

[004] The invention relates to tumor-specific class I MHC presented peptides and methods of using the same, as well as cytotoxic T lymphocytes (CTLs) responsive to tumor-specific class I MHC presented peptides and methods of using the same.

[005] BACKGROUND

[006] Cytotoxic lymphocyte (CTL) response has been shown to be an important host defense against malignant cells, Rock et al. J. Immunol., (1993), 150:1244. Adoptive transfer of tumor stimulated CTLs has been associated with some tumor regressions, Rosenberg et al., N. Eng. J. Med., (1988), 319:1676. An alternative approach to augmenting the T-cell response to tumors involves the use of tumor vaccines, and is referred to as specific active immunotherapy. There is a need to provide specific tumor antigens for the purpose of enhancing the immune response to tumor cells.

[007] Epitopes for CD8⁺ CTLs are short peptides that bind to a cleft on the surface of the class I MHC molecule, Udaka et al., Cell, (1992), 69:989; VanBleek et al., Nature, (1990), 348:213; FaIk et al., J. Exp. Med., (1991), 174:425. These peptides, generated from proteolysis of proteins in the cytosol, are transported to the endoplasmic reticulum where they become associated with newly synthesized class I MHC molecules. They are then transported to the cell surface, Elliott et al., Nature, (1990), 3348:195. Because of the complexity of the peptide mixture associated with class I MHC molecules, Hunt et al., Science, (1992), 255:1261 , the definition of individual peptides that comprise specific CTL epitopes has proved extremely difficult. Notably, peptides derived from nuclear proteins are not typically presented by class I MHC molecules because these proteins do not enter the class I presentation pathway. Accordingly, CTLs are believed to be generally ignorant of nuclear antigens.

[008] SUMMARY OF INVENTION [009] In one aspect, the invention provides immunogens which are capable of promoting a tumor- specific cytotoxic T lymphocyte ("CTL") response. The immunogens comprise histone H4 antigens described herein.

[0010] In one aspect, the invention provides histone H4 antigens, sometimes referred to herein as H4 antigens, which are polypeptides having an amino acid sequence substantially corresponding to that of a fragment or peptide of histone H4 protein to which an H4-responsive CTL responds. Histone H4 antigens of the invention are useful as immunogens for stimulating a tumor-specific CTL response.

[0011] In one aspect, the invention provides H4 antigen-nucleic acids, which encode histone H4 antigens described herein.

[0012] In one aspect, the invention provides vectors comprising H4 antigen-nucleic acids described herein. In one embodiment, the vector is a viral vector.

[0013] In one aspect, the invention provides host cells comprising vectors, which vectors comprise H4 antigen-nucleic acids described herein.

[0014] In one aspect, the invention provides host cells comprising H4 antigen-nucleic acids described herein.

[0015] In one embodiment, a host cell of the invention is an antigen presenting cell (APC). In a preferred embodiment, a host cell is a dendritic cell.

[0016] In one aspect, the invention provides anti-tumor vaccines capable of stimulating a cellular response against a tumor characterized by histone H4 presentation with class I MHC. The anti-tumor vaccines of the invention comprise a histone H4 antigen, or an H4 antigen-nucleic acid. Vaccines of the invention include but are not limited to cells comprising a histone H4 antigen or an H4 antigen- nucleic acid, and cell preparations comprising a histone H4 antigen. In an especially preferred embodiment, an anti-tumor vaccine comprises an APC that comprises H4 antigen presented with class I MHC. In a preferred embodiment, an anti-tumor vaccine comprises an immunogen described herein.

[0017] In one embodiment, an anti-tumor vaccine further comprises an immunomodulatory agent, or a nucleic acid encoding the same. In one embodiment, the immunomodulatory agent is an agonist of a positive costimulatory molecule, e.g., an Ig-fusion protein capable of effecting costimulation of a CTL. In another embodiment, the costimulatory agent is an antagonist of a negative costimulatory molecule, e.g., an antibody capable of reducing inhibition of CTL costimulation. In a preferred embodiment, the immunomodulatory agent is an anti-CTLA4 antibody.

[0018] In one embodiment, an anti-tumor vaccine comprises an adjuvant.

[0019] In one aspect, the invention provides an isolated H4-responsive CTL.

[0020] In one aspect, the invention provides a CTL hybridoma responsive to histone H4 antigen.

[0021] In one aspect, the invention provides methods for detecting the presence of a tumor-specific CTL in a patient sample. In one embodiment, the methods comprise detecting the presence of an H4- responsive CTL in a sample from the patient. In another embodiment, the methods comprise detecting a TCR transcript specific for histone H4.

[0022] In one aspect, the invention provides methods for detecting the presence of a cell in a patient, which cell presents histone H4 peptide with class I MHC. In a preferred embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In another embodiment, the methods comprise detecting an increased level of H4 antigen and/or non-nuclear H4 antigen in a sample from the patient. In another embodiment, the methods comprise detecting a TCR transcript specific for histone H4.

[0023] In one aspect, the invention provides methods for detecting the presence of a tumor cell in a patient. In a preferred embodiment, the methods comprise detecting the presence of an H4- responsive CTL in a sample from the patient. In a preferred embodiment, the tumor cell is a prostate tumor cell. In another embodiment, the methods comprise detecting an increased level of H4 antigen and/or non-nuclear H4 antigen in a sample from the patient. In another embodiment, the methods comprise detecting a TCR transcript specific for histone H4.

[0024] In one aspect, the invention provides methods for diagnosing a patient as having cancer. In a preferred embodiment, the methods comprise detecting the presence of an H4-rεsponsive CTL in a sample from the patient. In a preferred embodiment, the cancer is prostate cancer. In another embodiment, the methods comprise detecting an increased level of H4 antigen and/or non-nuclear H4 antigen in a sample from the patient. In another embodiment, the methods comprise detecting a TCR transcript specific for histone H4.

[0025] In one aspect, the invention provides methods for detecting a tumor in a patient. In a preferred embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In a preferred embodiment, the tumor is a prostate tumor. In another embodiment, the methods comprise detecting an increased level of H4 antigen and/or non-nuclear H4 antigen in a sample from the patient. In another embodiment, the methods comprise detecting a TCR transcript specific for histone H4.

[0026] In one aspect, the invention provides methods for detecting autoimmune disease. In a preferred embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In another embodiment, the methods comprise detecting an increased level of H4 antigen and/or non-nuclear H4 antigen in a sample from the patient. In another embodiment, the methods comprise detecting a TCR transcript specific for histone H4.

[0027] In methods that comprise detecting the presence of an H4-responsive CTL in a sample from a patient, in a preferred embodiment, the sample comprises peripheral blood cells. In another preferred embodiment, the sample comprises tumor tissue infiltrating cells. In another embodiment, the sample comprises cells obtained from a lymph node. Samples may include, but are not limited to, biopsies and resections.

[0028] In methods that comprise detecting the presence of an H4-responsive CTL in a sample from a patient, in a preferred embodiment, the methods comprise contacting the sample, or cells obtained therefrom, with an H4 antigen and a matched class 1 MHC, preferably a class I MHC matched APC. In one embodiment, a class I MHC matched cell is engineered for such use.

[0029] In methods that comprise detecting an increased level of H4 antigen in a sample from the patient, in a preferred embodiment, the sample is a tumor sample. Samples may include, but are not limited to, biopsies and resections.

[0030] In one aspect, the invention provides immunotherapeutic methods of treating a patient having a tumor. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunostimulatory agent. In another embodiment, the methods comprise adoptive transfer of H4-responsive CTLs.

[0031] In one aspect, the invention provides methods for inhibiting tumor growth. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent. In another embodiment, the methods comprise adoptive transfer of H4-responsive CTL.

[0032] In one aspect, the invention provides methods for inducing tumor cell death. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent. In another embodiment, the methods comprise adoptive transfer of H4-responsive CTL.

[0033] In one aspect, the invention provides methods for stimulating an anti-tumor CTL response. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent.

[0034] In one aspect, the invention provides methods for stimulating a tumor specific CTL. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent.

[0035] In one aspect, the invention provides methods for inhibiting the growth of a cell, which cell presents histone H4 peptide with class I MHC. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent. In another embodiment, the methods comprise adoptive transfer of H4-responsive CTL.

[0036] In one aspect, the invention provides methods for inducing the death of a cell, which cell presents histone H4 antigen with class I MHC. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent. In another embodiment, the methods comprise adoptive transfer of H4-responsive CTL.

[0037] In one aspect, the invention provides methods for stimulating an endogenous H4-responsive CTL in a patient. In one embodiment, the methods involve vaccinating a patient with an anti-tumor vaccine described herein. In one embodiment, the methods comprise administering an immunomodulatory agent. [0038] In one aspect, the invention provides transgenic mice expressing a TCR reactive to histone H4 peptide presented with class I MHC. Such mice are useful for the study of histone H4-specific immune responses and the further development of histone H4-based immunotherapies in mouse models of cancer.

[0039] In one aspect, the invention provides methods for preparing a medicament useful for the treatment of cancer, which medicament comprises an anti-tumor vaccine described herein.

[0040] In one aspect, the invention provides kits useful for the diagnosis of cancer. In one embodiment, the kits may be used to detect the presence of an H4-responsive CTL in a sample from a patient. In one embodiment, the kits may be used to detect the presence of H4 antigen. In one embodiment, the kits may be used to detect the presence of TCR transcript specific for H4 peptide.

[0041] In one aspect, the invention provides tetramers comprising H4 antigens and MHC molecules, and methods of using the same. In one embodiment, tetramers are used in methods to detect the presence of H4-responsive T cells.

[0042] BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1. CD8α⁺ T cells bearing Vβ8⁺ TCRs with a conserved CDR3 length are reproducibly overrepresented in the prostate of TRAMP mice. TCR Vβ8 CDR3 size spectratyping analysis of prostate tissue from nine representative B6 control mice, ten 21 -wk TRAMP^+/+ mice, and ten 27-wk TRAMP^+/+ mice. Prostate RNA was reverse transcribed and subjected to PCR amplifcation using a fluorescent Cβ-specific primer and a primer specific for the Vβ8 family. Amplification products were then resolved on a 4% polyacrylamide gel and analyzed on an automated fluorescence sequencer. The "reference" spectra (bottom row) are derived from female control spleen samples. The arrow and blackened peaks denote overrepresentation of a conserved 245-base spectral band in the majority of TRAMP samples.

[0044] Figure 2. Quantification of peak areas for prominent Vβ8⁺ 245-base CDR3 spectral bands. For the TCR Vβ8 CDR3 size spectratyping analysis of TRAMP prostate tissue (see representative spectra in Figure 1), the ratio of the peak area of the overrepresented 245-base CDR3 spectral band divided by the sum of the peak areas of the entire CDR3 spectrum is plotted. Data from individual B6 males, TRAMP^+/+ males, and TRAMP^+/+ females of the indicated ages are plotted. Horizontal bars denote mean values. The differences of 21-week and 27-week TRAMP males relative to B6 males are statistically significant (P < 0.05).

[0045] Figure 3. Preferential use of Vβ8.3 by conserved TCRβ chains in TRAMP prostate. Summary of Vβ subfamily usage for overrepresented Vβ8⁺ TCR transcripts. ³²P-labelled Vβ8⁺ PCR amplification products were resolved by PAGE, and the 245-base peaks were purified, cloned, and sequenced by standard methods. In all, 70 subclones pooled from seven 27-wk male TRAMP prostate samples and 30 subclones pooled from three 27-wk female TRAMP spleen samples were analyzed. The percentage of sequences utilizing the indicated Vβ8 subfamily member are presented for TRAMP and control sequence sets. [0046] Figure 4. Determination of the "Vβ8.3-SGT" clonotype: sequence analysis of Vβ8⁺ 245-base CDR3 spectral bands. Summary of sequencing results for overrepresented Vβ8⁺ TCR transcripts. ³²P-labelled Vβ8⁺ PCR amplification products were resolved by PAGE, and the 245-base fragments were purified, cloned. For each purified band, multiple subclones were sequenced by standard methods. In all, 70 clones pooled from seven 27-wk male TRAMP prostate samples and 30 clones pooled from three 27-wk female TRAMP spleen samples were analyzed. For each CDR3 residue, the percentage of sequences having the indicated predicted amino acid are presented for TRAMP and control sequence sets. For simplicity, since CDR3 residues 5-10 are encoded entirely by the JD gene segment, the percentage of sequences utilizing the indicated Jβ are shown.

[0047] Figure 5. Prevalence of "Vβ8.3-SGT" clonotype in conserved Vβ8⁺ 245-base sequence sets. The prevalence of CDR3 sequences containing the clonotypic "Vβ8.3-SGT" sequence is shown for sequence sets from seven 27-wk male TRAMP prostate samples and three control 27-wk female TRAMP spleen samples.

[0048] Figure 6. CDR3 size spectratyping analysis of TRAMP prostate using Vβ8 primers of increasing specificity. TCR CDR3 size spectratyping analysis of prostate tissue from ten 27-wk TRAMP^+/+ mice using Vβ primers of increasing specificity for the Vβ8.3-SGT clonotype. From left to right, CDR3 spectra for the same ten samples are depicted for Vβ8, Vβ8.3, and Vβ8.3-SGT-specific primers. The cDNA samples analyzed are the same as the samples depicted in Figure 1 (right column). Prostate RNA was reverse transcribed and subjected to PCR amplifcation using a fluorescent Cβ-specific primer and a primer specific for the indicated Vβ. Amplification products were then resolved on a 4% polyacrylamide gel and analyzed on an automated fluorescence sequencer. The "reference" spectra (bottom row) are derived from female control spleen samples. Blackened peaks denote overrepresentation of the conserved spectral band. NP indicates no PCR product.

[0049] Figure 7. Vβ8.3-SGT clonotypic T cells are CD8⁺. CDR3 size spectratyping analysis of CD4⁺ and CD8α⁺ cells isolated from TRAMP prostate tissue using Vβ primers specific for Vβ8.3 (left panel) and the Vβ8.3-SGT clonotype (right panel). CD4⁺ and CD8⁺ T cells from nine 27-week-old TRAMP males were obtained by mechanical disruption of prostate tissue, collagenase treatment, enrichment over Percoll and Histopaque 1119 gradients, and isolation via fluorescence-activated cell sorting (FACS). For each sample, 500-10,000 cells were sorted directly into lysis mix, reverse transcribed, and analyzed as described in Figure 1. The arrow denotes a 222-base pair fragment that is overrepresented in the majority of CD8⁺ TRAMP samples. Blackened peaks denote the PCR fragments that are overrepresented in TRAMP samples.

[0050] Figure 8. Identification of a clonotypic TCRα chain: TCRα spectratyping of sorted CD8^"Vβ8.3⁺ cells from TRAMP prostate. TCRα CDR3 size spectratyping analysis of CD8⁺Vβ8.3⁺ T cells isolated from two groups of 27-wk TRAMP mice. For groups 1 and 2 (five mice per group), CD8^"Vβ8.3^" and CD8⁺Vβ8.3⁺ cells from prostate (PR) or spleen (SP) were FACS-sorted directly into lysis mix, reverse transcribed, and subjected to CDR3 size spectratyping using primer sets specific for Vβ8.3 and Vαs 1-20, as described in Figure 1. Results for Vα2, Vα18, and Vβ8.3 are shown. Blackened peaks denote conserved spectral bands.

[0051] Figure 9. Identification of a clonotypic TCRα chain: sequence analysis of 246-base Vα2 spectral band. Predicted CDR3 amino acid sequences of predominant Vα2 TCR transcripts observed in CD8⁺Vβ8.3⁺ samples shown in Figure 8. ³²P-labelled Vα2 PCR amplification products were resolved by PAGE, and the predominant peaks were purified and cloned. For each purified peak, several subclones were then sequenced by standard methods. Predicted CDR3 sequences and Ja usage are shown for TRAMP prostate group 1 , TRAMP prostate group 2, and Bδ spleen control. The conserved Vα2 CDR3 sequence "Vα2-SGTGGYKV" is shown in pink.

[0052] Figure 10. Identification of a clonotypic TCRα chain: sequence analysis of 27δ-base Vα18 spectral band. Predicted CDR3 amino acid sequences of predominant Vα18 TCR transcripts observed in CDS⁺V^S.3⁺ samples shown in Figure 8. ³²P-labelled Vα18 PCR amplification products were resolved by PAGE, and the predominant peaks were purified and cloned. For each purified peak, several subclones were then sequenced by standard methods. Predicted CDR3 sequences and Ja usage are shown for TRAMP prostate group 1 , TRAMP prostate group 2, and B6 spleen control. The conserved Vα18 CDR3 sequence "Vα18-DXGTGGYKV" (where X indicates variability at a given position) is shown in pink.

[0053] Figure 11. TCRα CDR3 length restriction of Vα2⁺ T cells in the prostate of TRAMP⁺'^" Vβ8.3- SGT transgenic mice. CDR3 spectratyping analysis of prostate infiltrates of TRAMP mice crossed to Vβ8.3-SGT single-chain TCR transgenic mice (see Figure 12 for generation of transgenic mice). cDNA from the prostate of tumor-bearing TRAMP⁺'^" Vβ8.3-SGT transgenic mice and littermate control TRAMP⁺'^" mice (12 mice total) was subjected to CDR3 size spectratyping using Vα2 and Vβ8.3- specific primers. The Vβ8.3-SGT transgenic genotype of each mouse is indicated in the right column. Blackened peaks denote the expected overrepresentation of transcripts of conserved CDR3 length.

[0054] Figure 12. Generation of Vβ8.3-SGT and αβTCR transgenic mice expressing TCR chains from the clonotypic Vα2⁺Vβ8.3⁺ TCR. Flow cytometric analysis of splenic T cells from B6 and transgenic mice expressing TCR chains of the clonotypic Va2^8.3⁺ heterodimer. TCR transgenic mice were generated by standard methods using the TCR cassette vectors of Kouskoff et al. (Journal of Immunological Methods 180:273, 1995). The rearranged clonotypic Vα2-SGT TCRα (Figure 9) and Vβ8.3-SGT TCRβ (Figure 4) chains were cloned into vectors pTαcass and pTβcass, respectively. Purified, linearized constructs were either injected singly (to generate Vβ8.3-SGT single-chain transgenics) or co-injected (to produce αβTCR transgenics). Mice were either generated on a pure B6 background or crossed to the B6 background for at least 12 generations. Mice shown are B6 controls, a Vβ8.3-SGT transgenic line, an αβTCR transgenic line exhibiting variegated expression of the αβTCR, (αβTCRtg (v)) and a Rag1^"'^" αβTCR transgenic line (αβTCRtg Rag1^"'^"). Representative histograms or dot plots of the indicated cell surface markers are shown. 1st Row: the percentage of Vα2⁺ cells within the TCRβ⁺ population is indicated. 2nd Row: the percentage of Vβ8.3⁺ cells within the TCRβ⁺ population is indicated. 3rd Row: the percentage of T ceils expressing CD4 or CD8 is indicated. 4th Row: the percentage of CD8α⁺ cells falling within the CD44^hl9h CD122⁺ gate is indicated.

[0055] Figure 13. Clonotypic Vα2⁺Vβ8.3⁺ T cells recognize a widespread, non-mutated self antigen. Stimulation of the clonotypic Vα2⁺Vβ8.3⁺ T cell hybridoma 6B1-6 with tissue extracts. The indicated tissues from 23- to 30-week-old TRAMP^+/+ males (M), B6 males, or B6 females (F) were isolated, minced, subjected to collagenase digestion, and boiled in 10% acetic acid. The resulting extract was then passed through a 3 kD cutoff membrane and resolved by reversed-phase HPLC. Fractions were collected in 96-well plates, dried, and cultured overnight with K^b-expressing L cells and the LacZ- inducible (IL-2 promoter) clonotypic Vα2⁺Vβ8.3⁺ hybridoma 6B1-6. T cell stimulation was assayed by measuring LacZ production. LacZ cleaves the chromogenic substrate CPRG, releasing a product that is detected by measuring absorbance at 595 nm. For the indicated extracts, plots of T cell stimulation (absorbance at 595-655 nm) vs. HPLC fraction number are shown. (A) The stimulatory activity can be isolated from prostate, spleen, and liver of male TRAMP^+/+ males. T cell recognition is blocked by co-incubation with anti-K^b antibodies. (B) The stimulatory activity can be isolated from the spleen and liver of male and female B6 mice. (C) The stimulatory activity can be isolated from many organs. In this experiment, the mass of starting material was normalized to 150 mg tissue from each organ.

[0056] Figure 14. The stimulatory activity is preferentially localized in the nucleus. Stimulation of the clonotypic Vα2⁺Vβ8.3⁺ hybridoma 6B1-6 with subcellular fractions. Extracts from B16 melanoma cells were fractionated according to the methods of Wysocka et al. (Molecular and Cellular Biology 21 :3820, 2001). Briefly, cells were lysed in detergent, nuclei were spun out by low-speed centrifugation, and the "soluble cytosolic" supernatant was removed. The nuclear pellet was then subjected to hypotonic lysis, and the resulting suspension was subjected to high-speed centrifugation. The supernatant ("soluble nuclear") and pellet ("chromatin-enriched") fractions were then separated. The three aforementioned fractions were then boiled in 10% acetic acid, passed through a 3 kD cutoff membrane and resolved by reversed-phase HPLC. HPLC fractions were assayed as described in Figure 13. For the indicated subcellular fractions, plots of T cell stimulation (absorbance at 595-655 nm) vs. HPLC fraction number are shown. Results from two independent experiments are shown (left and right columns).

[0057] Figure 15. Clonotypic Vα2⁺Vβ8.3⁺ T cells recognize histone H4. A histone mixture or individual purified histones (from calf thymus, Roche) were boiled in 10% acetic acid, passed through a 3 kD cutoff membrane, resolved by reversed-phase HPLC, and assayed for stimulation of the clonotypic Va2^8.3⁺ T cell hybridoma as described in Figure 13. For the indicated histones, plots of T cell stimulation (absorbance at 595-655 nm) vs. HPLC fraction number are shown.

[0058] Figure 16. Identification of the histone H4-derived stimulatory peptide using 2D-HPLC and tandem mass spectrometry. (A) 2D-HPLC purfication of the stimulatory peptide. Purified full-length histone H4 (from calf thymus, Roche) was boiled in 10% acetic acid, passed through a 3 kD cutoff membrane, resolved on a C18 reversed-phase HPLC column, and assayed for stimulation of the clonotypic Vα2⁺Vβ8.3⁺ T cell hybridoma (top panel). The stimulatory fraction 52 was then resolved on a C8 reversed-phase HPLC column, and assayed as before (bottom panel). The stimulatory fraction 51 was then subjected to sequence analysis by tandem mass spectrometry Plots of T cell stimulation (absorbance at 595-655 nm) vs. HPLC fraction number are shown. (B) C8 fraction 51 from part (A) was subjected to sequence analysis by tandem mass spectrometry. A single peptide of mass 1886 Da and sequence WΥALKRQGRTLYGFGG was detected. The sequence is identical to residues 86- 102 of histone H4 (which is identical in calf and mouse).

[0059] Figure 17. Stimulation of histone H4-reactive T cells with C-terminal histone H4-derived peptides presented by CDHc⁺ DCs. Representative data for stimulation of the clonotypic T cell hybridoma (A) or clonotypic αβTCR transgenic T cells (B) with histone H4 C-terminal peptides pulsed on CDHc⁺ DCs. To isolate CDHc⁺ DCs, B16 melanoma cells producing Flt3L were injected subcutaneously in the backs of male B6 mice. 10-14 days later, mice were euthanized, spleens were harvested, and CDHc⁺ DCs were isolated by magnetic sorting using CD11c MACS beads (Miltenyi). DCs were cultured overnight in LPS and GM-CSF. The following day, DCs were washed and cultured with peptide and responder T cells. The peptides used were histone H4 17-mer (86-102), 9-mer (86- 94), 8-mer (86-93), 7-mer (86-92), 6-mer (86-91), and the negative control SIINFEKL. (A) Clonotypic hybridoma cells were stimulated for 18 hours. Plots of hybridoma stimulation (absorbance at 595-655 nm) vs. peptide concentration are shown. (B) Clonotypic αβTCR transgenic T cells were stimulated for 48 hours. Plots of IFN-γ production vs. peptide concentration are shown.

[0060] Figure 18. The minimal core epitope for stimulation of histone H4-reactive T cells is the heptamer histone H4 (86-92). Summary of stimulation experiments to determine the minimal core epitope recognized by histone H4-reactive T cells. Smaller peptides derived from the stimulatory peptide histone H4 (86-102) WYALKRQGRTLYGFGG fitting K^b-binding criteria were synthesized (Sigma-Genosys) and tested for their capacity to stimulate histone H4-reactive T cells when cultured with antigen presenting cells. T cells used were either clonotypic T cell hybridoma cells or clonotypic αβTCR transgenic T cells. APCs used were either K^b-expressing L cells or primary CDHc⁺ dendritic cells. The sequences of stimulatory peptides are shown in red, while the sequences of non- stimulatory peptides are shown in white. For primary stimulation data, see Figure 17.

[0061] Figure 19. High concentrations of histone H4 peptide stabilize K^b expression on RMA-S cells. Stabilization of K^b expression on the surface of TAP-deficient RMA-S cells was performed as described by Hogquist et al. (European Journal of Immunology, 23:3028, 1993). Briefly, RMA-S cells were cultured overnight at 31⁰C in round-bottom 96-well plates. The following day, peptides were added at varying concentrations. Cells were then cultured for 30 minutes at 31⁰C, followed by four hours at 37°C. Cells were then transferred to ice and stained for flow cytometric analysis of K^b expression. The peptides used were histone H4 17-mer (86-102), 9-mer (86-94), 8-mer (86-93), 7- mer (86-92), 6-mer (86-91), and the positive control SIlNFEKL. For each peptide, the fold change in median K^b expression is plotted over a range of peptide concentrations. [0062] Figure 20. Division of histone H4-reactive transgenic T cells in the prostate-draining lymph nodes of TRAMP^+/+ mice. T cells from CD45.1⁺ histone H4-reactive αβTCR transgenic mice were purified by magnetic sorting using a MACS CD8 T cell isolation kit (Miltenyi), labeled with 5 μM CFSE, and adoptively transferred into 27-week-old tumor-bearing TRAMP^+/+ or 27-week-old B6 mice. 5 days post-transfer, mice were euthanized, and cells from spleen (SP), prostate-draining periaortic lymph nodes (pLN), and non-draining brachial lymph nodes (bl_N) were analyzed by flow cytometry. (A) Representative flow cytometric analysis of CFSE dilution of adoptively transferred histone H4-reactive T cells. Plots of side scatter (SSc) vs. CFSE are shown for CD8α⁺CD45.1⁺-gated cells. The percentage of cells with diluted CFSE is indicated. (B) Summary of CFSE dilution data for eight TRAMP^+/+ and eight B6 recipients. For each mouse, the percentage of histone H4-reactive donor cells having diluted CFSE is plotted for the indicated lymphoid organs. Mean values are denoted by horizontal bars.

[0063] Figure 21. Histone H4-reactive transgenic T cells adoptively transferred into RIP-Tag2 mice do not undergo division. T cells from CD45.1⁺ histone H4-reactive αβTCR transgenic mice were purified by magnetic sorting using a MACS CD8 T cell isolation kit (Miltenyi), labeled with 5 μM CFSE, and adoptively transferred into 13-week-old male RIP-Tag2 mice (Hanahan reference) and age- matched B6 male mice. 5 days post-transfer, mice were euthanized, and cells from spleen (SP), pancreatic lymph nodes (pLN), and non-draining brachial lymph nodes (bLN) were analyzed by flow cytometry. CFSE dilution data are summarized for RIP-Tag2 and B6 recipients. For each mouse, the percentage of histone H4-reactive donor cells having diluted CFSE is plotted for the indicated lymphoid organs. Mean values are denoted by horizontal bars.

[0064] Figure 22. Normal levels of antinuclear antibodies in TRAMP^+/+ mice. Serum from Fas- deficient B6MRL-Fas^lpr mice, TRAMP^+/+ mice, and B6 mice of the indicated ages was isolated and analyzed for the presence of antinuclear antibodies (ANA) by sandwich ELISA (Alpha Diagnostic). The levels of ANA are read out in a colorimetric assay, which is quantified by the absorbance at 450 nm. Bar graphs denote mean values +/- standard deviation. (-) and (+) represent negative and positive ELISA controls, respectively.

[0065] Figure 23. Slight reduction in prostate and genitourinary tract mass in TRAMP mice having a high precursor frequency of histone-H4-reactive T cells. TRAMP^+/+ mice were crossed to a transgenic line that exhibits variegated expression of the clonotypic histone H4-reactive αβTCR (αβTCRtg (v) mice). These mice express the full αβTCR in approximately 10% of mature T cells, and thus have a high precursor frequency of histone H4-reactive cells. The resulting male offspring, either TRAMP⁺'^" or TRAMP⁺'^" αβTCRtg (v), were sacrificed between 26-28 weeks of age, and the mass of the genitourinary tract (GU) and prostate (PR) was determined following dissection. For each mouse, the log of the tissue mass (mg) is plotted for both GU and PR. Median values are indicated by horizontal blue bars. Statistical analysis was performed using the Wilcoxon rank sum test. P values are indicated in red. [0066] Figure 24. Histone H4-reactive HRC transgenic T cells adoptively transferred into castrated B6 mice do not recognize histone H4 antigen and do not divide. When cells divide, CFSE staining intensity decreases approximately two-fold for each division. Castration induces prostate involution characterized by cell death. 9-week-old B6 males were either castrated (6 mice) or received a sham operation (6 mice). 7 days later, purified CD45.1⁺ HRC T cells were labeled with 5 μM CFSE and adoptively transferred into these mice. Five days after T cell transfer, donor CD45.1⁺ HRC T cells from spleen (SP), tumor-draining periaortic lymph nodes (pLN), and non-draining brachial lymph nodes (bl_N) were analyzed by flow cytometry. For each mouse, plots of side scatter (SSc) vs. CFSE are shown for the pLN. The percentage of CFSE-diluted cells is indicated.

[0067] Figure 25. Elevated frequencies of histone H4-reactive T cells in the blood of tumor-bearing TRAMP mice. Blood from 10 tumor-free B6 mice (> 27 weeks of age) and 14 tumor-bearing TRAMP^+/+ mice (> 27 weeks of age) was analyzed by flow cytometry. Blood cells were isolated, subjected to red cell lysis, and stained with antibodies specific for CD8 and the activation marker CD44, as well as H4/K^b tetramer-PE and an irrelevant OVA-K^b tetramer PE-Cy5. The frequency of antigen-experienced H4/K^b tetramer⁺ CD44^hιgh T cells is plotted as a percentage of CD8 T cells. Horizontal bars indicate mean values.

[0068] DETAILED DESCRIPTION

[0069] By "histone H4-responsive CTL" or "H4-responsive CTL" is meant a CD8⁺ T cell that is responsive to a peptide consisting of an amino acid sequence corresponding to that of a segment of histone H4, which is presented with class I MHC. CTL responsiveness may include sustained calcium flux, cell division, production of cytokines such as IFN-γ and TNF-α, upregulation of activation markers such as CD44 and CD69, and specific cytolytic killing of antigen-expressing target cells. CTL responsiveness may also be determined using an artificial reporter that accurately indicates CTL responsiveness.

[0070] By "TCR transcript specific for histone H4" is meant a transcript that encodes a TCR that is capable of binding to histone H4 antigen presented with class I MHC.

[0071] H4 Antigens

[0072] By "histone H4 antigen" and "H4 antigen" is meant a polypeptide having an amino acid sequence substantially corresponding to the amino acid sequence of a fragment or peptide of histone H4 protein that is capable of stimulating an H4-responsive CTL. Preferred H4 antigens are peptides, preferably 7-20 amino acids in length, more preferably 7-11 amino acids in length which are derived from histone H4 protein, preferably human histone H4 protein, which may be presented, directly or following processing, with class I MHC molecules, and when so presented are capable of stimulating an H4-responsive CTL. Especially preferred are peptides corresponding to an amino acid sequence toward the carboxy end of the histone H4 protein, including the 17-mer peptide sequence WYALKRQGRTLYGFGG (amino acids 86-102 of histone H4) and the internal sequence WYALKR. Peptides having amino acid sequences substantially corresponding to such preferred peptide sequences may differ at one or more residues that are not essential for TCR recognition of the preferred peptide as presented by the class I MHC, or for peptide binding to MHC. Such substantially corresponding peptides are also capable of stimulating an H4-responsive CTL. Peptides having amino acid sequences differing from wild-type peptide at residues that do not affect TCR recognition but improve the stability of binding to MHC may improve the immunogenicity of the histone H4 peptide, and may be referred to herein as "optimized peptides". Using existing knowledge about which of these residues may be more likely to affect binding either to the MHC or to the TCR, a rational approach to the design of substantially corresponding peptides may be employed. Resulting peptides that are functional are contemplated as H4 antigens, (see E. L. Huczko et al. J. Immunol. 151 -2572, 1993; J. Ruppert et al. Cell 754: 929, 1993; Madden Dr et al. Cell 75:693-708, 1994.)

[0073] Substantially corresponding peptides may be identified by a variety of techniques. It is known in the art that one may synthesize all possible single substitution mutants of a known peptide. While the effects of different substitutions are not always additive, it is reasonable to expect that two favorable or neutral single substitutions at different residue positions in the epitope can safely be combined in most cases.

[0074] Substantially corresponding peptides include optimized peptides, which comprise a sequence that differs from wϋdtype and exhibit an altered activity, as compared to peptides comprising wildtype sequence. For example, the peptide WYAFKR, in which the leucine lying in the dominant K^b-binding anchor position is mutated to a phenylalanine, exhibits increased affinity for K^b and is recognized by clonotypic T cells in vitro. Further, WYAFKR/K^b tetramers stain HRC T cells efficiently. It is understood that optimized peptides may vary in sequence for a number of purposes, which include providing for increased affinity of peptides for different MHC molecules.

[0075] One may also synthesize a family of related single or multiple substitution mutants, present the mixture to a class I MHC matched APCs, preferably of a cell line, and expose the same to H4- responsive CTLs. Methods for the preparation of degenerate peptides are described in Rutter, U.S. Pat. No. 5,010,175, Haughten, et al., Proc. Nat. Acad. Sci. (USA), 82:5131-35 (1985), Geysen, et al., Proc. Nat. Acad. Sci. (USA), 81 :3998-4002 (1984); WO861/06487; WO86/00991.

[0076] The person of ordinary skill in the art, in determining which residues to vary, may also make comparisons of the sequences of the naturally processed MHC associated peptides, and may obtain 3D structures of the MHC: peptide: TCR complexes, in order to identify residues involved in MHC or TCR binding. Such residues may either be left alone, or judiciously mutated in an attempt to enhance MHC or TCR binding.

[0077] It is also possible to predict substantially corresponding peptides by taking into account studies of sequence variations in families of naturally occurring homologous proteins. Certain amino acid substitutions are more often tolerated than others, and these are often correlatable with similarities in size, charge, etc. between the original amino acid and its replacement. Insertions or deletions of amino acids may also be made.

[0078] Conservative substitutions are herein defined as exchanges within one of the following five groups: I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, GIy II. Polar, negatively charged residues: and their amides Asp, Asn, GIu, GIn III. Polar, positively charged residues: His, Arg, Lys IV. Large, aliphatic, nonpolar residues: Met, Leu, lie, VaI, Cys V. Large, aromatic residues: Phe, Tyr, Trp.

[0079] Within the foregoing groups, the following substitutions are considered "highly conservative": Asp/Glu His/Arg/Lys Phe/Tyr/Trp Met/Leu/I le/Val,

[0080] Semi-conservative substitutions are defined to be exchanges between two of groups (I)-(V) above which are limited to supergroup (A), comprising (I), (II) and (111) above, or to supergroup (B), comprising (IV) and (V) above.

[0081] Substitutions are not limited to the genetically encoded, or even the naturally occurring amino acids. When the peptide is prepared by peptide synthesis, the desired amino acid may be used directly. Alternatively, a genetically encoded amino acid may be modified by reacting it with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues. The following examples of chemical derivatives are provided by way of illustration and not by way of limitation.

[0082] Aromatic amino acids may be replaced with D- or L-naphylalanine, D- or L-Phenylglycine, D- or L-2-thieneylalanine, D- or L-1-, 2-, 3- or 4-pyreneylalanine, D- or L-3-thieneylalanine, D- or L-(2- pyridinyl)-alanine, D- or L-(3-pyridinyl)-alanine, D- or L-(2-pyrazinyl)-alanine, D- or L-(4-isopropyl)- phenylglycine, D-(trifluoromethyl)-phenylglycine, D-(trifluoromethyl)-phenylalanine, D-p- fluorophenylalanine, D- or L-p-biphenylphenylalanine, D- or L-p-methoxybiphenylphenylalanine, D- or L-2-indole-(alkyl)alanines, and D- or L-alkylainines where alkyl may be substituted or unsubstituted methyl, ethyl, propyl, hexyl, butyl, pentyl, iso-propyl, iso-butyl, sec-isotyl, iso-pentyl, non-acidic amino acids, of C1-C20.

[0083] Acidic amino acids can be substituted with non-carboxylate amino acids while maintaining a negative charge, and derivatives or analogs thereof, such as the non-limiting examples of (phosphono)-alanine, glycine, leucine, isoleucine, threonine, or serine; or sulfated (e.g., -SO₃ H) threonine, serine, tyrosine.

[0084] Other substitutions may include unnatural hyroxylated amino acids made by combining "alkyl" (as defined and exemplified herein) with any natural amino acid. Basic amino acids may be substituted with alkyl groups at any position of the naturally occurring amino acids lysine, arginine, ornithine, citrulline, or (guanidino)-acetic acid, or other (guanidino)alkyl-acetic acids, where "alkyl" is define as above. Nitrile derivatives (e.g., containing the CN-moiety in place of COOH) may also be substituted for asparagine or glutamine, and methionine sulfoxide may be substituted for methionine. Methods of preparation of such peptide derivatives are well known to one skilled in the art.

[0085] In addition, any amide linkage can be replaced by a ketomethylene moiety, e.g. (-C=O)-CH₂ --) for (-(C=O)-NH-). Such derivatives are expected to have the property of increased stability to degradation by enzymes, and therefore possess advantages for the formulation of compounds which may have increased in vivo half lives, as administered by oral, intravenous, intramuscular, intraperitoneal, topical, rectal, intraocular, or other routes. [0086] In addition, any amino acid can be replaced by the same amino acid but of the opposite chirality. Thus, any amino acid naturally occurring in the L-configuration (which may also be referred to as the R or S configuration, depending upon the structure of the chemical entity) may be replaced with an amino acid of the same chemical structural type, but of the opposite chirality, generally referred to as the D-amino acid but which can additionally be referred to as the R- or the S-, depending upon its composition and chemical configuration. Such derivatives have the property of greatly increased stability to degradation by enzymes, and therefore are advantageous in the formulation of compounds which may have longer in vivo half lives, when administered by oral, intravenous, intramuscular, intraperitoneal, topical, rectal, intraocular, or other routes.

[0087] Additional amino acid modifications of amino acids may include the following: Cysteinyl residues may be reacted with alpha-haloacetates (and corresponding amines), such as 2-chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives. Cysteinyl residues may also be derivatized by reaction with compounds such as bromotrifluoroacetone, alpha- bromo-beta-(5-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1 ,3-diazole.

[0088] Histidyl residues may be derivatized by reaction with compounds such as diethylprocarbonate e.g., at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain, and para- bromophenacyl bromide may also be used; e.g., where the reaction is preferably performed in 0.1 M sodium cacodylate at pH 6.0.

[0089] Lysinyl and amino terminal residues may be reacted with compounds such as succinic or other carboxylic acid anhydrides. Derivatization with these agents is expected to have the effect of reversing the charge of the lysinyl residues. Other suitable reagents for derivatizing alpha-amino- containing residues include compounds such as imidoesters/e.g., as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4 pentanedione; and transaminase-catalyzed reaction with glyoxylate.

[0090] Arginyl residues may be modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1 ,2-cyclohexanedione, and ninhydrin according to known method steps. Derivatization of arginine residues requires that the reaction be performed in alkaline conditions because of the high pKa of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.

[0091] The specific modification of tyrosyl residues per se is well-known, such as for introducing spectral labels into tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. N-acetylimidizol and tetranitromethane may be used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively.

[0092] Carboxyl side groups (aspartyl or glutamyl) may be selectively modified by reaction with carbodiimides (R'-N-C-N-R') such as 1-cyclohexyl-3-(2-morpholinyl-(4-ethy!) carbodiimide or 1-ethyl-3- (4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl and glutamyl residues may be converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.

[0093] Glutaminyl and asparaginyl residues may be readily deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues may be deamidated under mildly acidic conditions. Either form of these residues fails within the scope of the present invention.

[0094] Derivatization with bifunctional agents is useful for cross-linking the peptide to a water- insoluble support matrix or to other macromolecular carriers, according to known method steps. Commonly used cross-linking agents include, e.g., 1 , 1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'- dithiobis(succinimidylpropionate), and bifunctional maleimides such as bis-N-maleimido-1 ,8-octane. Derivatizing agents such as methy!-3-[(p-azidophenyl)dithio]propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light. Alternatively, reactive water-insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described in U.S. Pat. Nos. 3,969,287; 3,691 ,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 (which are herein incorporated entirely by reference), may be employed for protein immobilization.

[0095] Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains (Creighton, T. E., Proteins: Structure and Molecule Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine, methylation of main chain amide residues (or substitution with N-methyl amino acids) and, in some instances, amidation of the C-terminal carboxyl groups, according to known method steps. Glycosylation is also possible.

[0096] Derivatized moieties may improve the solubility, absorption, biological half life, and the like, or eliminate or attenuate any possible undesirable side effect of the molecule. Moieties capable of mediating such effects are disclosed, for example, in Remington's Pharmaceutical Sciences, 16th ed., Mack Publishing Co., Easton, Pa. (1980).

[0097] lmmunogen

[0098] An immunogen of the present invention comprises or consists of an H4-antigen. The immunogen may comprise one or more H4 antigens, which may be the same or different. If it comprises a plurality of such antigens, they may be linked, covalently or non-covalently, and such linkage may be direct or through a spacer of some kind. The immunogen may take any form that is capable of eliciting a CTL response against a cell presenting an H4 peptide with class I MHC. By way of example and not of limitation, the immunogen may be a fusion of a plurality of H4 antigens which is sufficiently large to be immunogenic, a conjugate of one or more H4 antigens to a soluble immunogenic macromolecular carrier, such as serum albumin, keyhole limpet hemocyanin, dextran, a recombinant virus engineered to display the H4 antigen on its surface, or a conjugate of a plurality of H4 antigens to a branched lysine core structure, a so-called "multiple antigenic peptide" (see Posnett,.et al., J. Biol. Chem., 263:1719-25, 1988). The immunogenic conjugate may also comprise moieties intended to enhance the immune response, such as a cytokine.

[0099] Mode of Production

[00100] H4 antigen and peptide portions of the immunogens of the present invention may be produced by any conventional technique, including (a) nonbiological synthesis by sequential coupling of component amino acids, (b) production by recombinant DNA techniques in a suitable host cell, and (c) chemical or enzymatic modification of a sequence made by (a) or (b) above.

[00101] Gene Expression. The peptides disclosed herein may be produced, recombinantly, in a suitable host, such as bacteria from the genera Bacillus, Escherichia, Salmonella, Erwinia, and yeasts from the genera Hansenula, Kluyveromyces, Pichia, Rhinosporidium, Saccharomyces, and Schizosaccharomyces, or cultured mammalian cells such as COS-1. The more preferred hosts are microorganisms of the species Pichia pastoris, Bacillus subtilis, Bacillus brevis, Saccharomyces cerevisiae, Escherichia coli and Yarrowia lipolytica. Any promoter, regulatable or constitutive, which is functional in the host may be used to control gene expression.

[00102] Standard reference works setting forth the general principles of recombinant DNA technology include Watson, J. D., et al., Molecular Biology of the Gene, Volumes I and II, The Benjamin/Cummings Publishing Company, Inc., publisher, Menlo Park, Calif. (1987); Darnell, J. E., et al., Molecular Cell Biology, Scientific American Books, Inc., Io publisher, New York, N. Y. (1986); Lewin, B. M., Genes II, John Wiley & Sons, publishers, New York, N. Y. (1985); Old, R. W., et al., Principles of Gene Manipulation: An Introduction to Genetic Engineering, 2d edition, University of California Press, publisher, Berkeley, Calif. (1981 ); Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. (1989); and Ausubel, et al., Current Protocols in Molecular Biology, Wiley Interscience, N. Y., (1987, 1992). These references are herein entirely incorporated by reference.

[00103] Chemical Peptide Synthesis. Chemical peptide synthesis is a rapidly evolving area in the art, and methods of solid phase peptide synthesis are well-described in the following references, hereby entirely incorporated by reference: (Merrifield, B., J. Amer. Chem. Soc. 85:2149-2154 (1963); Merrifield, B., Science 232:341-347 (1986); Wade, J. D., et al., Biopolymers 25:S21-S37 (1986); Fields, G. B., Int. J. Polypeptide Prot. Res. 35:161 (1990); MilliGen Report Nos. 2 and 2a, Millipore Corporation, Bedford, Mass., 1987) Ausubel, et al, supra, and Sambrook, et al, supra.

[00104] In general, as is known in the art, such methods involve blocking or protecting reactive functional groups, such as free amino, carboxyl and thio groups. After polypeptide bond formation, the protective groups are removed (or de-protected). Thus, the addition of each amino acid residue requires several reaction steps for protecting and deprotecting. Current methods utilize solid phase synthesis, wherein the C-terminal amino acid is covalently linked to an insoluble resin particle large enough to be separated from the fluid phase by filtration. Thus, reactants are removed by washing the resin particles with appropriate solvents using an automated programmed machine. The completed polypeptide chain is cleaved from the resin by a reaction which does not affect polypeptide bonds. [00105] In the more classical method, known as the "tBoc method," the amino group of the amino acid being added to the resin-bound C-terminal amino acid is blocked with tert-butyloxycarbonyl chloride (tBoc). This protected-amino acid is reacted with the bound amino acid in the presence of the condensing agent dicyclohexylcarbodiimide, allowing its carboxyl group to form a polypeptide bond the free amino group of the bound amino acid. The amino-blocking group is then removed by acidification with trifluoroacetic acid (TFA); it subsequently decomposes into gaseous carbon dioxide and isobutylene. These steps are repeated cyclically for each additional amino acid residue. A more vigorous treatment with hydrogen fluoride (HF) or trifluoromethanesulfonyl derivatives is common at the end of the synthesis to cleave the benzyl-derived side chain protecting groups and the polypeptide-resin bond.

[00106] More recently, the preferred "Fmoc" technique has been introduced as an alternative synthetic approach, offering milder reaction conditions, simpler activation procedures and compatibility with continuous flow techniques. This method was used, e.g., to prepare the peptide sequences disclosed in the present application. Here, the .varies. -amino group is protected by the base labile 9-fluorenylmethoxycarbonyl (Fmoc) group. The benzyl side chain protecting groups are replaced by the more acid labile t-butyl derivatives. Repetitive acid treatments are replaced by deprotection with mild base solutions, e.g., 20% piperidine in dimethylformamide (DMF), and the final HF cleavage treatment is eliminated. A TFA solution is used instead to cleave side chain protecting groups and the peptide resin linkage simultaneously.

[00107] At least three different peptide-resin linkage agents can be used: substituted benzyl alcohol derivatives that can be cleaved with 95% TFA to produce a peptide acid, methanolic ammonia to produce a peptide amide, or 1% TFA to produce a protected peptide which can then be used in fragment condensation procedures, as described by Atherton, E., et al., J. Chem. Soc. Perkin Trans. 1 :538-546 (1981) and Sheppard, R. C, et a!., Int. J. Polypeptide Prot. Res. 20:451-454 (1982). Furthermore, highly reactive Fmoc amino acids are available as pentafluorophenyl esters or dihydro- oxobenzotriazine esters derivatives, saving the step of activation used in the tBoc method.

[00108] H4 Antigen-Nucleic Acids

[00109] Another aspect of the invention is a nucleic acid sequence encoding an H4 antigen. Such nucleic acids are "H4 antigen-nucleic acids". Preferred are H4 antigen-nucleic acids encoding preferred H4 antigens described herein. H4 antigen-nucleic acids include RNA, DNA, and derivatives thereof.

[00110] By nucleic acid is meant at least two nucleotides covalently linked together. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage, et al., Tetrahedron, 49(10):1925 (1993) and references therein; Letsinger, J. Org. Chem., 35:3800 (1970); Sprinzl, et al., Eur. J. Biochem., 81:579 (1977); Letsinger, et al,, Nucl. Acids Res., 14:3487 (1986); Sawai, et al., Chem. Lett, 805 (1984), Letsinger, et al., J. Am. Chem. Soc, 110:4470 (1988); and Pauwels, et al., Chemica Scripta, 26:141 (1986)), phosphorothioate (Mag, et al., Nucleic Acids Res., 19:1437 (1991); and U.S. Patent No. 5,644,048), phosphorodithioate (Briu, et al., J. Am. Chem. Soc, 111 :2321 (1989)), O-methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc, 114:1895 (1992); Meier, et al., Chem. Int. Ed. Engl., 31 : 1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson, et al., Nature, 380:207 (1996), all of which are incorporated by reference)). Other analog nucleic acids include those with positive backbones (Denpcy, et al., Proc. Natl. Acad. Sci. USA, 92:6097 (1995)); non-ionic backbones (U.S. Patent Nos. 5,386,023; 5,637,684; 5,602,240; 5,216, 141; and 4,469,863; Kiedrowshi, et al., Angew. Chem. Intl. Ed. English, 30:423 (1991); Letsinger, et al., J. Am. Chem. Soc, 110:4470 (1988); Letsinger, et al., Nucleoside & Nucleotide, 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook; Mesmaeker, et al., Bioorganic & Medicinal Chem. Lett, 4:395 (1994); Jeffs, et al., J. Biomolecular NMR, 34:17 (1994); Tetrahedron Lett, 37:743 (1996)) and non-ribose backbones, including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars, as well as "locked nucleic acids", are also included within the definition of nucleic acids (see Jenkins, et al., Chem. Soc. Rev., (1995) pp. 169- 176). Several nucleic acid analogs are described in Rawls, C & E News, June 2, 1997, page 35. All of these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to increase the stability and half-life of such molecules in physiological environments. In addition, mixtures of naturally occurring nucleic acids and analogs can be made. Alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. The nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc.

[00111] Due to degeneracy in the genetic code, varying nucleic acid sequences can encode identical H4 antigens.

[00112] Conventional methods for nucleic acid cloning techniques are described in Sambrook et al, (eds) (1989) in "Molecular Cloning. A Laboratory Manual" Cold Spring Harbor Press, Plainview, N. Y. and Ausubel et al (eds) in "Current Protocols in Molecular Biology" (1987), John Wiley and Sons, New York, N.Y.

[00113] The present invention also encompasses vectors comprising H4 antigen-nucleic acid sequence. Optionally the vector may also comprise a nucleic acid sequence encoding at least one immunostimulatory molecule. The vector may also contain a gene encoding marker for use in detecting localization in cells and tissues. [00114] Eukaryotic expression vectors include but are not limited to retroviral vectors, vaccinia virus vectors, adenovirus vectors, herpes virus vectors, fowlpox virus vectors, baculovirus vectors, human papillomavirus vectors, equine encephalitis vectors, influenza virus vectors and the like.

[00115] The present invention encompasses novel recombinant virus expressing H4 antigen or portion thereof. The recombinant virus may also express at least one immunostimulatory molecule. The recombinant virus is capable of eliciting or upregulating a cell-mediated immune response in a mammal for the purpose of preventing or treating cancer in the mammal, particularly humans.

[00116] Methods for constructing and expressing exogenous gene products from recombinant vaccinia virus vectors are disclosed by Perkus et al Science 229:981 984, 1985, Kaufman et al Int. J. Cancer 48:900 907, 1991 , Moss Science 252:1662, 1991 , Smith and Moss BioTechniques Nov./Deα, p. 306 312, 1984, and U.S. Pat. No. 4,738,846. Sutter and Moss (Proc. Nat¹] Acad. Sci. U.S.A. 89:10847 10851 , 1992) and Sutter et al (Virology 1994) disclose the construction and use as a vector, the non-replicating recombinant Ankara virus (MVA, modified vaccinia Ankara) which may be used as a viral vector in the present invention. Baxby and Paoletti (Vaccine 10:8 9, 1992) disclose the construction and use as a vector, a non-replicating poxvirus, including canarypox virus, fowlpox virus and other avian species for use as a viral vector in the present invention.

[00117] A host cell may be infected with the recombinant virus to express H4 antigen or portion thereof alone or in combination with at least one immunostimulatory molecule. The host cell may also be infected with a recombinant virus expressing an MHC class I molecule.

[00118] Eukaryotic host cell lines include, but are not limited to COS cells, CHO cells, HeIa cells, NIH/3T3 cells, insect cells, antigen presenting cells such as dendritic cells and the like. Optionally the host cell may also express a stimulatory molecule. In the case where the host cells express H4 antigen in combination with at least one MHC molecule, it is preferable that a eukaryotic expression system be used to allow for proper glycosylation. The expression of both the H4 antigen and the immunostimulatory molecule by the host cell provides the necessary MHC restricted H4 peptide to H4-responsive T cells and the appropriate signal to the T cell to aid in antigen recognition and proliferation or clonal expansion of H4-responsive T cells. The overall result is upregulation of the immune response. The upregulation of the immune response is manifest by an increase in cancer antigen specific CTLs which are able to kill or inhibit the growth of cancer or precancer cells presenting H4 peptide with class I MHC.

[00119] Autologous ex vivo-expanded dendritic cells isolated from a patient are preferred. If a cell line is used, then the host cell would have to be transduced with an appropriate MHC allele from the patient.

[00120] The DNA may be inserted into the host cell by transfection, transduction, liposomes and the like by methods known in the art. (Sambrook et al, 1989, in: "Molecular Cloning A Laboratory Manual", Cold Spring Harbor press, Plainview, N. Y.). For liposomes, cationic lipids are preferred, for example, polycationic lipid, dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium (DMRIE) complexed with the neutral phospholipid dioleoyl phosphatidyl-ethanolamine (DOPE) as disclosed by Nabel, E. G. et al, 1992, Hum. Gene. Ther. 3:367 275; Nabel, G. J. et al, 1992, Hum. Gene Ther. 3:649 656; Stewart, M. J. et al 1992 Hum. Gene Ther. 3:399 410; Nabel, G. J. et al 1993 Proc. Natl. Acad. Sci. USA 90:11307 11311 ; and Harrison, G. S. et al 1995 Bio Techniques 19:816 823.

[00121] A recombinant viral vector may be introduced into a mammal either prior to any evidence of cancer or to inhibit growth or to mediate regression of the disease in a mammal afflicted with a cancer having cells presenting H4 antigen with class I MHC. Examples of methods for administering the viral vector into mammals include, but are not limited to, exposure of cells to the recombinant virus ex vivo, or injection of the recombinant virus by way of intravenous, subcutaneous, intradermal, intramuscular routes.

[00122] Immunotherapy

[00123] Approaches to cancer immunotherapy can be divided into active and passive categories. Active immunotherapy involves the direct immunization of cancer patients with cancer antigens in an attempt to boost immune responses against the tumor. Passive immunotherapy refers to the administration of immune reagents, in the present case immune cells with antitumor reactivity, with the goal of directly mediating antitumor responses. The present invention contemplates both approaches.

[00124] Recent techniques utilizing "naked" DNA injected directly into muscle or into the skin have been shown to raise both cellular and humoral immune reactions to encoded antigens (Cooney, E. L., A. C. Collier, P D. Greenberg, R. W. Coombs, J. Zarling, D. E. Arditti, M. C. Hoffman, S. L. Hu and L. Correy, 1991 , Lancet 337:567; Wolff, J. A., R. W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and P. L. Feigner, 1990, Science 247:1465; Davis, H. L., R. G. Whalen, and B. A. Demeniex, 1993, Hum. Gene Ther. 4:151 ; Yang, N. S., J. Burkholder, B. Roberts, B. Martinelli, and D. McCabe, 1990, Proc. Natl. Acad. Sci. USA 87:9568; Williams, R. S., S. A. Johnston, M. Riedy, M. J. DeVit, S. G. McElligott, and J. C. Sanford, 1991 , Proc. Natl. Acad. Sci. USA 88:2726; Fynan, E. R., Webster, D. H. Fuller, J. R. Haynes, J. C. Santoro, and H. L. Robinson, 1995, Proc. Natl. Acad. Sci. USA 90:11478; Eisenbraum, M. D., D. H. Fuller, and J. R. Haynes, 1993, DNA and Cell Bio. 12:791 ; Fuller, D. H. and J. R. Haynes, 1994, AIDS Res. Hum. Retrovir. 10(11): 1433; Acsadi, G., G. Dickson, D. R. Love, A. Jani, F. S. Walsh, A. Gurusinghe, J. A. Wolff, and K. E. Davies, 1991 , Nature 352:815). Techniques using nonviable DNA vectors have the advantage of ease of preparation and safety of administration. The nucleic acid sequence of the present invention is useful as an immunogen and as a DNA vaccine against cancer. The present H4 antigen-nucleic acids may be administered using a gene gun in amounts to elicit a cellular response against a cancer cell. Nanogram quantities are useful for such purposes.

[00125] Any of the wide variety of vaccination methods known in the art may be used in the methods herein. Anti-tumor vaccines of the invention are capable of promoting CTL activity against a tumor characterized by histone H4 presentation with class I MHC. For example, whole cells from tumor samples, cell lysates and enriched fractions comprising H4 peptide may be used as the basis for a vaccine aimed at promoting such anti-tumor CTL responses. These may be used in combination with adjuvants, which facilitate stimulation of the immune system by acting on T cells directly or through APCs. Adjuvants include immunomodulatory substances having a positive immunomodulatory effect, as described herein. Partially purified histone H4 protein, as well as H4 peptides may also be used as the bases of anti-tumor vaccines herein. These too may be used in combination with adjuvants. Means of increasing peptide immunogenicity that are known in the art may be used. Recombinant viruses (e.g., adenovirus, lentivectors), virus-like particles, liposomes, antigen-pulsed APCs, DNA encoding for histone H4, and other compositions may also be used as the bases of anti-tumor vaccines herein. In a preferred embodiment, an anti-tumor vaccine of the invention comprises an APC loaded with histone H4 peptide. Further, see Berinstein, Enhancing cancer vaccines with immune-modulators, Vaccine, 2007 Sep 27;25 Suppl 2:B72-88; Palucka et al., Taming cancer by inducing immunity via dendritic cells, Immunol Rev. 2007 Dec;220: 129-50.

[00126] Passive immunotherapy with genetically modified immune cells (commonly referred to as adoptive immunotherapy) capable of recognizing human tumor antigens is effective in mediating the regression of cancer in selected patients. In vitro techniques have been developed in which human lymphocytes are sensitized in vitro to tumor antigen peptides presented on antigen presenting cells. By repetitive in vitro stimulation cells can be derived with a great capacity to recognize human tumor antigens. The adoptive transfer of these cells may be more effective in mediating tumor regression in vivo than are conventionally grown cells. See also Rosenberg et al, NEM 319: 1676-1680, 1988; Rosenberg SA et al. Science 233: 1318-1321.

[00127] In another method of treatment, autologous cytotoxic lymphocytes or tumor infiltrating lymphocytes may be obtained from a patient with cancer. The lymphocytes are grown in culture and H4-responsive CTLs expanded by culturing in the presence of H4 antigen presented with MHC class I, alone or in combination with at least one immunomodulatory agent, preferably additionally with cytokines. The H4-responsive CTLs are then infused back into the patient in an amount effective to reduce or eliminate the tumors in the patient.

[00128] Patients could be pre-stimulated with an anti-tumor peptide vaccine prior lymphocyte harvest if the existing response was inadequate. Lymphocytes stimulated with peptide in vitro could then be expanded to 10¹⁰ or 10¹¹ cells, then re-infused into the patients in a manner analogous to that used for LAK cell therapy. It is expected that the adoptively transferred CTLs would survive best with IL-2 infusion at low to intermediate doses, and that putative inhibitors of Tc suppression (eg: cyclophosphamide) may be employed also, prior to the infusions of CTLs.

[00129] Regarding vaccination approaches, see also Osada et al., lnt Rev Immunol. 2006 Sep- Dec;25(5-6):377-413; Aloysius et al., Vaccination therapy in malignant disease, Surgeon, 2006 Oct;4(5):309-20; Palena et al., Cancer vaccines: preclinical studies and novel strategies, Adv Cancer Res. 2006;95:115-45.

[00130] Enhancing vaccine effect

[00131] There is evidence in the literature to suggest that the activity of vaccines that produce a low or even a moderate anti-tumor activity when administered alone can be enhanced by various immunomodulatory agents. In one embodiment, the invention provides methods of treating cancer that comprise administration of such an immunomodulatory agent, or adjuvant, which produces a positive immunomodulatory effect in combination with an immunogen described herein. In a preferred embodiment, an anti-tumor vaccine of the invention comprises an immunogen of the invention and an immunomodulatory agent. These immunomodulatory agents can act by enhancing the T cell stimulatory activity of antigen presenting cells. Examples of such immunomodulators are OX-40 ligand, GITR, 41 BB, GM-CSF, TLR agonists, and CD40 ligand. Cytokines can also be administered along with H4 antigens to create the right milieu for T cell restimulation. Regarding T cell culture and restimulation for human samples, see, for example, Jackson et al. Journal of Immunological Methods 291 :51 (2004). The activity of anti-tumor vaccines may be hampered by inhibitory signals such as CTLA4 signaling. It can also be hampered by cells that regulate the activation of other cells. These inhibitory factors can be controlled by administering anti-CTLA4 antibodies or by elimination of regulatory T cells. See, for example, Quezada et al. Journal of Clinical Investigation 116:1935 (2006).

[00132] Administration of GM-CSF increased the immune response against an anti-melanoma, antigen-specific peptide vaccine (Cancer. 2003 Jan 1 ;97 (1):186-200.) RhGM-CSF was shown to enhance the effect of active immunotherapy in melanoma patients (J lmmunother (1997). 1999 Mar;22(2): 166-74.) TLR agonists, by providing a necessary second signal for T cell stimulation, can enhance the effects of anti-tumor vaccines that produce their effect by activating T cells. For example, CpG 7909 ( a TLR9 agonist) is an efficient vaccine adjuvant that promotes strong antigen-specific CD8+ T cell responses in melanoma patients who received a mixture of a melanoma antigen and the TLR9 agonist (J Clin Invest. 2005 Mar;115(3):739-46.) The fusion of CD40L to mE7 gene enhanced the specific immune responses and anti-tumor effects against HPV16 E7-expressing murine tumors (Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 2007 Oct;29(5):584-91.)

[00133] Rosenberg et al. have shown that IL 2 enhanced the anti-tumor activity of the peptide vaccine gp100 209 2M when administered to melanoma patients (Nat Med. 1998 Mar;4(3):321-7.) IL 12 enhanced the effect of peptide pulsed PBMCs as part of an anti-melanoma vaccine in a study conducted by Gajewski et al. (Clin Cancer Res. 2001 Mar;7(3 Suppl):895s-901s.) Interferon - alpha has been shown to enhance the effect of the cell lysate vaccine Melacine in patients with metastatic melanoma (J Clin Oncol 1994;12:402-1 1.)

[00134] Anti-CTLA4 combined with the GVAX melanoma vaccine brought about the complete prevention of tumor outgrowth (J Exp Med. 1999 Aug 2;190(3):355-66.) This was associated with the increase in infiltrating CD4 and CD8 lymphocytes. Renal Cancer patients who received a dose of DAB389-IL-2 treatment to eliminate Tregs showed a higher frequency of anti-tumor CD8 T cells after injection with a DC vaccine. This shows that elimination of regulatory cells can enhance the effect of an anti-tumor vaccine (J Clin Invest 2005; 115:3623-33.)

[00135] Combination Therapies

[0013S] Immunotherapies described herein can be combined with surgical resection and/or radiation and /or traditional chemotherapy.

[00137] Diagnostic Applications [00138] The present invention provides a number of methods for diagnosing cancer that stem from the finding that CD8⁺ T cells that are reactive to histone H4 peptide and express highly conserved TCRs are associated with cancer. The overrepresentation of TCR transcripts specific for the histone H4 peptide were found consistently in TRAMP+/+ mice of 21 weeks of age, relatively early for this model of cancer, supporting that a diagnostic looking for histone H4-specific CTLs is effective at detecting cancer, and particularly early to mid-stage cancer.

[00139] It has been reported that CTLs specific for tumor cells are found in the blood of patients with a variety of cancer types. For example, elevated frequencies of T cells specific for melanoma- associated antigens are often found in the peripheral blood of melanoma patients. Moreover, in certain cancers in which the tumor antigens targeted by the CTLs are wild-type proteins, the antigens appear to elicit an immune response only in the presence of cancer. Cancer/testis (CT) antigens are present in the testes of healthy males, and there is no apparent immune response to them. However, when an animal or patient develops cancer, CTLs are found specific for these proteins (Simpson et al. Nature Reviews: Cancer, 5:615 (2005); Jager et al, J Exp Med, 187: 265 (1998); Romero et al, Advances in Immunology, 92: 187(2006)). The implications of this are that a diagnostic test looking for CTLs specific for such antigens will be negative for patients without cancer. This assertion is supported by data herein showing a lack of recognition of histone H4 antigen by adoptively transferred T cells in mice that have been castrated, which establishes that a non-cancer driven necrosis does not appear to lead to the activation of the H4 specific T cells. This finding further suggests that the increased frequency of these cells in prostatic adenocarcinoma is a specific phenomenon and not just in response to necrosis. This leads to the conclusion that the detection of these cells may be of use in 'specific diagnosis of such carcinomas.

[00140] In addition, peptides derived from nuclear proteins such as histone H4 are not typically presented by class I MHC molecules because these proteins do not enter the class I presentation pathway. Accordingly, CTLs are believed to be generally ignorant of nuclear antigens.

[00141] In one embodiment, the diagnostic methods provided herein comprise detecting the presence of an H4-responsive CTL in a sample from a patient. In another embodiment, the methods comprise detecting overexpression of TCR transcripts specific for an H4 peptide in a sample from a patient. In another embodiment, the methods comprise detecting an increased level of H4 antigen in a sample from a patient.

[00142] In one embodiment, reactivity of sample-derived T cells to H4 peptide is detected. T cells may be isolated from patient peripheral blood, lymph nodes, tissue samples such as derived from biopsy and resection, or other source. Reactivity assays may be performed on primary T cells or other appropriate derivatives. For example, T cells may be fused to generate hybridomas. Assays for measuring T cell responsiveness are known in the art, and include proliferation assays and cytokine release assays.

[00143] An H4-responsive CTL may be detected in a number of ways, including but not limited to the following preferred embodiments. In one embodiment, an H4-responsive CTL is detected by direct staining using an appropriate fluorescent H4-peptide/MHC tetramer. In another embodiment, an H4- responsive CTL is detected using the "TRAP" assay ("T-cell recognition of APCs by protein transfer") (see, for example, Beadling et al. Nature Medicine 12:1208 (2006)). In another embodiment, detection of histone H4-reactive T cells in blood samples is performed using methods outlined by Yuan et al. (Cytotherapy 8:498, 2006). Each of these methods is further described and exemplified below. Assays and indices for detecting reactive T cells are known, and include but are not limited to the use of IFN-γ ELISPOT and IFN-γ intracellular cytokine staining.

[00144] T cells may be recombinantly engineered so as to comprise reporter constructs indicative of responsiveness, such as IL-2 promoter fused to reporter gene.

[00145] In a preferred embodiment, MHC/H4 peptide tetramers are used to directly detect histone H4- specific CTLs.

[00146] Other various methods are known in the art for determining whether a T cell clone will respond to a particular antigenic peptide. Typically the peptide is added to a suspension of the T cells for a period of from one to three days. The response of the T cells may be measured by proliferation, e.g., uptake of labeled thymidine, or by release of cytokines, e.g., IL-2. Various assays are available for detecting the presence of released cytokines.

[00147] Various negative and positive controls may be included in assays, for example unrelated peptides, medium alone, and antigen presenting cells expressing different HLA alleles, particularly from different species, may serve as negative controls.

[00148] Proliferation assays measure the level of T cell proliferation in response to a specific antigen, and are widely used in the art. In an exemplary assay, recipient lymph node, blood or other tissue derived cells are obtained. A suspension of cells is prepared and washed, then cultured in the presence of the test antigen (H4 peptide). Antigen-induced proliferation is assessed, for example, by the monitoring the synthesis of DNA by the cultures using standard means, such as labeled thymidine incorporation.

[00149] T cell cytotoxic assays can be used to detect cytotoxic T cells having specificity for H4 histone antigen. In one embodiment, cytotoxic T cells are tested for their ability to kill target cells bearing MHC class I molecules associated with peptides derived from H4 histone. Target cells presenting H4 peptide may be labeled and added to a suspension of T cells from a patient sample. The cytotoxicity may be measured by quantitating the release of label from lysed cells. Controls for spontaneous and total release may be included in the assay.

[00150] Enzyme linked immunosorbent assay (ELISA) and ELISA spot assays may also be used to determine the cytokine profile of reactive T cells. The capture antibodies may be any antibody specific for a cytokine of interest, where, for example, supernatants from T cell proliferation assays are conveniently used as a source of antigen. After blocking and washing, labeled detector antibodies may be added, and the concentrations of protein present determined as a function of the label that is bound. [00151] The ELISA spot technique allows the measurement of different factors secreted by activated T cells. This technique is extremely sensitive and specific. ELISA spot assays may be performed for cytokines of interest, e.g., IFN-γ. In one embodiment, plates are set up with capture antibodies, as in a conventional ELISA. Lymphocytes may be placed in each well with or without antigen and cultured overnight. After washing, labeled detection antibodies are added. The plate-bound secondary antibodies are then visualized. The number of spots is counted, e.g. using a computerized image analysis system that is designed to detect ELISA spots using predetermined criteria based on size, shape and colorimetric density.

[00152] TCR transcripts specific for an H4 peptide may be detected in a number of ways, including but not limited to the following preferred embodiments. In one embodiment, a nucleic acid preparation derived from a sample from a patient is assayed for TCR transcripts specific for an H4 peptide using RT-PCR. In another embodiment, such a nucleic acid preparation is subjected to hybridization analysis with a probe capable of detecting a TCR transcript specific for an H4 peptide. In one embodiment, an array comprising such a probe may be used.

[00153] An increased level of H4 antigen in a sample from a patient may be detected in a number of ways, including but not limited to immunodetection using antibodies specific for histone H4.

[00154] Enhanced detection of H4-specific CD8⁺ T cells in blood

[00155] The difference in the frequencies of H4-specific CD8⁺ T cells in the untreated peripheral blood of tumor bearing mice as opposed to the frequency of such cells in the controls shows that diagnosis of tumors is possible by using a sample of peripheral blood. By culturing the T cells present in the two samples and restimulating them using H4 pulsed APCs (Jackson et al. Journal of Immunological Methods 291 :51 (2004), it is possible to magnify small differences in T cell frequencies and achieve a higher sensitivity for diagnosis. See Figure 25.

[00156] Response to treatment

[00157] In one aspect, the invention provides methods for evaluating a patient's response to cancer treatment. In one embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In one embodiment, the methods comprise detecting the presence of H4 antigen. In one embodiment, the methods comprise detecting the presence of TCR transcript specific for histone H4. In one embodiment, the methods further comprise measuring a second indicator of response to treatment, such as PSA level in prostate cancer (see, for example, Math Biosci. 21004 Aug; 190(2): 113-26). A decrease in H4-responsive CTLs, a decrease in H4 antigen, and/or a decrease in TCR transcript specific for histone H4 evidences a positive response to cancer treatment.

[00158] Staging and determination of prognosis

[00159] The detection of the presence of H4-responsive CTLs, H4 antigen, and/or TCR transcript specific for histone H4 can be correlated with the stage of cancer. This can be done, for example, by comparison to known staging markers. For example, in prostate cancer, these indices can be compared to information gained by ultrasound, findings of the digital rectal examination, and results of a biopsy.

[00160] Stage of detection relates to prognosis. For example, for prostate cancer, mortality is reduced coincident with clinical introduction of measuring PSA level and detection at an early stage, long-term disease-free survival is linked to stage of detection, and randomized trials demonstrate a survival advantage for early surgical intervention.

[00161] In one aspect, the invention provides methods of determining cancer prognosis. In one embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In one embodiment, the methods comprise detecting the presence of H4 antigen. In one embodiment, the methods comprise detecting the presence of TCR transcript specific for histone H4. In one embodiment, the methods comprise detecting the presence of APCs presenting fragments of histone H4 with class I MHC.

[00162] Autoimmune disorder

[00163] In one aspect, the invention provides methods for diagnosing an autoimmune disorder, characterized by the presence of CTLs reactive against histone H4 autoantigen. In one embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In one embodiment, the methods comprise detecting the presence of H4 antigen. In one embodiment, the methods comprise detecting the presence of TCR transcript specific for histone H4.

[00164] In one aspect, the invention provides methods for evaluating a patient's response to treatment of an autoimmune disorder characterized by the presence of CTLs reactive against histone H4 autoantigen. In one embodiment, the methods comprise detecting the presence of an H4-responsive CTL in a sample from the patient. In one embodiment, the methods comprise detecting the presence of H4 antigen. In one embodiment, the methods comprise detecting the presence of TCR transcript specific for histone H4. A decrease in H4-responsive CTLs, a decrease in H4 antigen, and/or a decrease in TCR transcript specific for histone H4 evidences a positive response to treatment of the autoimmune disease.

[00165] Kits

[00166] In one aspect, the invention provides kits useful for practicing a diagnostic method disclosed herein. Kits may include informative pamphlets, for example, pamphlets informing one how to use reagents to practice a diagnostic method disclosed herein. In one embodiment, the kits may be used to detect the presence of an H4-responsive CTL in a sample from a patient. In one embodiment, the kits may be used to detect the presence of H4 antigen in a sample from a patient. In one embodiment, the kits may be used to detect the presence of TCR transcript specific for H4 peptide in a sample from a patient.

[00167] Pharmaceutical Methods and Preparations

[00168] The preferred animal subject of the present invention is a primate mammal. By the term "mammal" is meant an individual belonging to the class Mammalia, which includes humans. The invention is particularly useful in the treatment of human subjects, although it is intended for veterinary uses as well.

[00169] The form of administration may be systemic or topical. For example, administration of such a composition may be by various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, transdermal, or buccal routes. Alternatively, or concurrently, administration may be by the oral route. Parenteral administration can be by bolus injection or by gradual perfusion over time.

[0017O]A typical regimen comprises administration of an effective amount of the immunogen, administered over a period ranging from a single dose, to dosing over a period of hours, days, weeks, months, or years.

[00171] It is understood that the suitable dosage of a immunogen of the present invention will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. However, the most preferred dosage can be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation. This will typically involve adjustment of a standard dose, e.g., reduction of the dose if the patient has a low body weight.

[00172] Prior to use in humans, a drug will first be evaluated for safety and efficacy in laboratory animals. In human clinical studies, one would begin with a dose expected to be safe in humans, based on the preclinical data for the drug in question, and on customary doses for analogous drugs (if any). If this dose is effective, the dosage may be decreased, to determine the minimum effective dose, if desired. If this dose is ineffective, it will be cautiously increased, with the patients monitored for signs of side effects. See, e.g., Berkow, et al., eds., The Merck Manual, 15th edition, Merck and Co., Rahway, NJ., 1987; Goodman, et al., eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford, N. Y., (1990); Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics, 3rd edition, ADIS Press, LTD., Williams and Wilkins, Baltimore, Md. (1987), Ebadi, Pharmacology, Little, Brown and Co., Boston, (1985), which references and references cited therein, are entirely incorporated herein by reference.

[00173] The total dose required for each treatment may be administered by multiple doses or in a single dose. The immunogen may be administered alone or in conjunction with other therapeutics directed to the disease or directed to other symptoms thereof.

[00174] The appropriate dosage form will depend on the disease, the immunogen, and the mode of administration; possibilities include tablets, capsules, lozenges, dental pastes, suppositories, inhalants, solutions, ointments and parenteral depots. See, e.g., Berker, supra, Goodman, supra, Avery, supra and Ebadi, supra, which are entirely incorporated herein by reference, including all references cited therein. However, it is expected that each vaccine preparation will include 1-100 ug of the H4 antigen.

[00175] In addition to at least one immunogen as described herein, a pharmaceutical composition may contain suitable pharmaceutically acceptable carriers, such as excipients, carriers and/or auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. See, e.g., Berker, supra, Goodman, supra, Avery, supra and Ebadi, supra, which are entirely incorporated herein by reference.

[00176] The composition may also include an adjuvant, such as DETOX (Ribi lmrnunochemica!s)(muramyl dipeptide and cell wall fragments from Mycobacterium phlei). If desired, the adjuvant may be conjugated to the epitope and not simply a part of a mixture. See Deres, et al, Nature, 342:561-4 (1989).

[00177] The composition may also include an immunomodulator, especially cytokines such as IL-1 , IL-2, IL-4, IL-6, IL-7, IL-12, Interferon-alpha, Interferon-gamma, Granulocyte Macrophage Colony Stimulating Factor (GMCSF), Tumor Necrosis Factor (TNF)-alpha, and TNF-beta. Additionally, antagonists of negative costimulatory molecules may be used, e.g., anti-CTLA-4 antibody or anti PD-1 / anti-PD-L1 antibody.

[00178] A pharmaceutical composition according to the present invention may further comprise at least one cancer chemotherapeutic compound, such as one selected from the group consisting of an anti-metabolite, a bleomycin peptide antibiotic, a podophyllin alkaloid, a Vinca alkaloid, an alkylating agent, an antibiotic, cisplatin, or a nitrosourea. A pharmaceutical composition according to the present invention may further or additionally comprise at least one viral chemotherapeutic compound selected from gamma globulin, amantadine, guanidine, hydroxybenzimidazole, interferon-α, interferon-β, interferon-γ, thiosemicarbarzones, methisazone, rifampin, ribvirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, or ganciclovir. See, e.g., Katzung, supra, and the references cited therein on pages 798-800 and 680-681 , respectively, which references are herein entirely incorporated by reference.

[00179] As an alternative to a pharmaceutical composition comprising the immunogen of the present invention, per se, the pharmaceutical composition may instead comprise a vector comprising an expressible gene encoding such an immunogen. The pharmaceutical composition and method would then be chosen so that the vector was delivered to suitable cells of the subject, so that the gene would be expressed and the immunogen produced in such a manner as to elicit an immune response. A preferred vector would be a Vaccinia virus, such as a construct containing a minigene encoding an H4 antigen. A preferred route for immunization would be scarification. A preferred immunization protocol would be 10⁶ to 10⁸ pfu/dose in the initial injection, followed up with boosters at 1 ,3 and 12 months.

[00180] Recombinant vaccinia virus constructs have been used for immunization against hepatitis B (Moss, et al., Nature, 311 , 67, 1984), herpes simplex virus (Wacchsman, et al., Biosci. Rep. 8, 323; 334, 1988), parainfluenza type 3 (Spriggs, et al., J. Virol., 62, 1293, 1988), and Lassa fever virus (Fisher-Hoch, et al., Proc. Natl. Acad. Sci. USA, 86, 317, 1989). Vaccinia virus constructs comprising gene for cancer-associated antigens have also been prepared (Lathe, et al., Nature, 326, 878, 1987; Bernards, et al., Proc. Natl. Acad. Sci. USA, 84, 6854, 1987; Estin, et al., Proc. Natl. Acad. Sci. USA, 85, 1052, 1988). [00181] After immunization the efficacy of a vaccine comprising immunogen can be assessed by production of immune cells that recognize H4 antigen, as assessed by specific lytic activity, specific cytokine production, tumor regression or combination of these.

[00182] In one aspect, the invention provides transgenic mice bearing expressing a TCR reactive to histone H4 peptide presented with class I MHC. Such mice are useful for the study of histone H4- reactive responses and the further development of histone H4-based immunotherapies in mouse models of cancer. The general method of producing transgenic animals is described in Krimpenfort et al U.S. Pat. No. 5,175,384, Leder et al U.S. Pat. No. 5, 175,383, Wagner et al U.S. Pat. No. 5,175,385, Evans et al U.S. Pat. No. 4,870,009 and Berns U.S. Pat. No. 5,174,986. The resulting transgenic animals are useful in studies of the development of cancer. The animal model is useful in screening vaccines and chemotherapeutic drugs for cancer treatment. The transgenic animal is also useful in studies of the development of cancer.

[00183] Tetrarmers

[00184] MHC/peptide tetramers ("H4 tetramers") find a number of uses. For example, they can be used to detect and quantitate histone H4-responsive T cells based on the specificity of their antigen receptors.

[00185] In one embodiment, K^b tetramers were produced bearing the analog peptide WYAFKR, in which the leucine lying in the dominant K^b-binding anchor position is mutated to a phenylalanine. The WYAFKR peptide exhibited increased affinity for K^b and was recognized by clonotypic T cells in vitro and VYAFKR/Kb tetramers ("H4/Kb tetramers") stained HRC T cells efficiently (Science. 2008 Jan 11 ;319(5860):215-20.)

[00186] All citations are expressly incorporated herein in their entirety by reference. [00187] EXPERIMENTAL [00188] Example 1

[00189] Male transgenic adenocarcinoma of mouse prostate (TRAMP) mice express SV40 T antigen under the control of a prostate-specific promoter, resulting in the development of spontaneous adenocarcinoma in the prostate by 14-20 weeks of age. In a screen for endogenous tumor-reactive T cell responses in the TRAMP model, we identified a novel infiltrating CD8αβ⁺ T cell population expressing a conserved αβ T cell antigen receptor (αβTCR) that is consistently overrepresented in TRAMP prostate tumors. Upon adoptive transfer, T cells from transgenic mice expressing the conserved αβTCR undergo division in the prostate-draining lymph nodes of tumor-bearing TRAMP mice, but not in age-matched wild-type mice. In efforts to characterize the antigen driving this response, we found that T cells expressing the conserved αβTCR could be stimulated in vitro using HPLC-purified extracts from a variety of organs from both TRAMP and wild-type mice, indicating that the stimulatory antigen is a widespread, non-mutated self antigen. Thus, although the antigen is broadly expressed in both tumor-bearing and wild-type mice, T cell recognition of the antigen is specifically observed in mice with prostate cancer. TRAMP mice crossed to a transgenic line expressing the conserved αβTCR in 10% of mature T cells exhibited reduced prostate and genitourinary tract size relative to age-matched TRAMP mice, indicating that a high precursor frequency of antigen-specific T cells results in decreased tumor burden. Using two-dimensional HPLC purification and tandem mass spectrometry, the stimulatory activity present in extracts was identified as a 17-mer peptide identical to the histone H4 carboxy terminus, corresponding to residues 86-102 (WYALKRQGRTLYGFGG). The minimal core epitope for stimulation of clonotypic T cells was found to be the heptamer WYALKR, corresponding to histone H4 86-92. Transfection and antibody blocking studies revealed that the histone H4 peptides are restricted to the class I MHC molecule K^b. In sum, here we outline the discovery of the first naturally arising tumor antigen in an autochthonous mouse model of cancer.

[00190] In a screen to identify naturally arising T cell responses in the TRAMP prostate cancer model, we used TCR CDR3 size spectratyping to screen for reproducible T cell clonal expansions utilizing conserved TCRs in the prostate infiltrate of tumor-bearing TRAMP mice. TCRβ CDR3 size spectratyping was performed on cDNA from the prostates of tumor-bearing 21-week-old TRAMP, 27- week-old TRAMP, and age-matched B6 control male mice using a Cβ-specific primer paired separately with primers specific for twenty Vβ families. Spectratyping of the Vβ8 family revealed the consistent overrepresentation of Vβ8⁺ TCR transcripts of a conserved CDR3 length in the prostates of tumor-bearing TRAMP mice, but not in control B6 mice (Figure 1). The overrepresentation of this particular Vβ8⁺ transcript is quantified in Figure 2, in which the ratio of the peak area of the overrepresented CDR3 band divided by the sum of the peak areas of the entire CDR3 spectrum are plotted for each mouse analyzed. The prominent Vβ8⁺ transcripts from several TRAMP mice and B6 controls was purified and cloned. For each purified band, multiple subclones were sequenced. Sequence analysis revealed that the conserved transcript encoded a CDR3 of ten amino acids in length, with a strong preference for the Vβ8.3 variable region (Figure 3), and a preference for the amino acid sequence serine-glycine-threonine in the first three positions of the CDR3 (Figure 4). This conserved clonotypic sequence, termed "Vβ8.3-SGT", was prevalent in samples from six of the seven TRAMP samples sequenced, but was not observed in transcripts from control mice (Figure 5). The predominance of TCR transcripts of the Vβ8.3-SGT clonotype in TRAMP prostate infiltrates was further illustrated through the use of CDR3 spectratyping primers of varying specificity (Vβ8, Vβ8.3, and a clonotype-specific Vβ8.3-SGT primer), which revealed increasing predominance of transcripts of the expected CDR3 length with increasing primer specificity (Figure 6). The finding that T cells expressing highly conserved TCRβ chains consistently infiltrate TRAMP prostate tumors suggests that a T cell response reactive to the same antigen arises spontaneously in the majority of tumor- bearing TRAMP mice.

[00191] To determine whether T cells expressing the conserved Vβ8.3-SGT TCR are of the CD4⁺ or CD8⁺ lineage, prostate-infiltrating CD4⁺ and CD8⁺ T cells were isolated from 27-week-old TRAMP mice by fluorescence activated cell sorting and subjected to CDR3 size spectratyping analysis using Vβ8.3 and Vβ8.3-SGT-specific primers (Figure 7). The analysis revealed that T cells expressing the conserved TCRβ chain fall within the CD8⁺ T cell subset, suggesting that these cells are MHC class I- restricted.

[00192] In order to identify TCRα chains that preferentially pair with the conserved Vβ8.3-SGT TCRβ chain to form a functional αβTCR heterodimer, we prepared cDNA from CD8⁺Vβ8.3⁺ T cells and control subsets from the pooled prostates and pooled spleens of two groups of tumor-bearing TRAMP mice, and subjected these samples to TCRα CDR3 size spectratyping. CDR3 size spectratyping using the Vβ8.3-specific primer revealed the expected predominance in CDR3 length, indicating that the clonotypic Vβ8.3-SGT T cell response was taking place in these groups of mice (Figure 8). The TCRα spectratyping analysis revealed a strong restriction in CDR3 length for CD8⁺Vβ8.3⁺ T cells in the prostates of both groups for the Vα2⁺ and Vα18⁺ subsets, a predominance that was not observed in CDδVβδ.3^" subsets or in spleen controls (Figure 8). DNA sequence analysis of clones derived from these predominant bands revealed striking sequence conservation (Figures 9 and 10). For example, in the Vα2 family, the identical predicted CDR3 sequence of eight amino acids in length (SGTGGYKV) utilizing the Jα12 gene segment was observed in the majority of sequenced clones isolated from the two independent groups of TRAMP mice (Figure 9). This conserved clonotypic TCRα sequence was termed "Vα2-SGT". Likewise, in the Vα18 samples, the identical predicted CDR3 of nine amino acids (DXGTGGYKV, where X signifies variability) and using the Jα12 segment was observed in all clones sequenced from the two groups (Figure 10). Thus, these findings suggest that conserved TCRα chains utilizing either Vα2 or Vα18 variable regions can preferentially pair with the clonotypic Vβ8.3-SGT chain to form a functional αβTCR heterodimer.

[00193] Further evidence that the conserved Vα2⁺ transcript having a CDR3 of eight amino acids in length can pair with the clonotypic Vβ8.3-SGT chain comes from CDR3 spectratyping analysis of prostate infiltrates of TRAMP mice crossed to Vβ8.3-SGT single-chain TCR transgenic mice (see below and Figure 12 for generation of transgenic mice). In these mice, the clonotypic Vβ8.3-SGT chain is expressed on 100% of αβ T cells, and therefore all TCRα chains detected in mature T cells are capable of pairing with the Vβ8.3-SGT chain. When prostate samples from TRAMP⁺'^" Vβ8.3-SGT transgenic mice were analyzed using Vα2-specific spectratyping primers, a predominant CDR3 peak of the expected eight amino-acid CDR3 length was observed in all samples analyzed (Figure 11).

[00194] In order to re-construct the conserved Vα2-SGT / Vβ8.3-SGT TCR that is overrepresented in TRAMP prostates in vivo, we generated αβTCR transgenic mice. TCR transgenic mice were generated by standard methods using the TCR cassette vectors of Kouskoff et al. (Journal of Immunological Methods 180:273, 1995). The rearranged clonotypic Vα2-SGT and Vβ8.3-SGT chains were cloned into vectors pTαcass and pTβcass, respectively. Purified, linearized constructs were co- injected into blastocysts, which were then implanted into pseudopregnant females. Mice were either generated on a pure B6 background or crossed to the B6 background for at least 12 generations. Two lines of αβTCR transgenic mice were propagated, one line exhibiting full expression of the αβTCR (αβTCRtg), and another that exhibited variegated expression (αβTCRtg (v)), in which only -10% of mature αβ T cells express both the Vα2⁺ and Vβ8.3⁺ transgenic TCR chains. In αβTCRtg transgenic mice crossed to a Rag1 -deficient background, over 99% of T cells in the spleen and lymph nodes are CD8⁺CD4^" (Figure 12), consistent with spectratyping results indicating that clonotypic T cells are CD8⁺. In parallel with αβTCRtg generation, single-chain TCR transgenic mice expressing the clonotypic Vβ8.3-SGT chain only were generated by single injection of the Vβ8.3-SGT / pTβcass construct (Figure 12).

[00195] To facilitate the study of the clonotypic T cell response, an immortalized T cell hybridoma expressing the conserved Vα2⁺Vβ8.3⁺ TCR and a LacZ reporter gene driven by the IL-2 promoter was generated. T cells from αβTCRtg mice were activated in vitro using plate-bound anti-CD3 and anti- CD28 antibody and fused with the LacZ-inducible cell line BWZ.36 (Sanderson and Shastri, International Immunology 6:369, 1994), which stably expresses LacZ under the control of the IL-2 promoter as well as CD8α. The resulting hybrid subclone 6B1-6 was selected based on its stable expression of CD8α, Vα2, and Vβ8.3, and its ability to produce high levels of β-galactosidase upon stimulation with plate-bound antibody (data not shown). The Vα2⁺ and Vβ8.3⁺ TCR chains from this hybridoma were cloned and sequenced to confirm identity to the clonotypic Vα2-SGT and Vβ8.3-SGT chains (data not shown).

[00196] In order to characterize the expression pattern of the antigen recognized by T cells expressing the conserved Vα2⁺Vβ8.3⁺ TCR, crude extracts from tissues were assayed for their ability to stimulate the clonotypic hybridoma 6B1-6 when cultured with MHC-expressing L cells. Tissues from 23- to 30-week-old TRAMP^+/+ males, B6 males, or B6 females were isolated, minced, subjected to collagenase digestion, and boiled in 10% acetic acid. The resulting extract was then passed through a 3 kD cutoff membrane and resolved by reversed-phase HPLC. Fractions were collected in 96-well plates, dried, and cultured overnight with K^b or D^b-expressing L cells and the 6B1-6 hybridoma. When crude extracts from the prostate of 27-week-old TRAMP males were assayed, a single peak of activity was observed (Figure 13A). This activity was only observed when the L cells used as APCs expressed the K^b class I MHC molecule, and was blocked by culture with the anti-K^b monoclonal antibody Y-3 (Figure 13A), indicating that the stimulatory activity is restricted by K^b. In addition to the prostate, the stimulatory activity could be detected in crude extracts from TRAMP lung, spleen, thymus, and bone marrow when 150 mg of tissue was used as starting material (Figure 13C), and in liver when larger amounts of tissue were used (data not shown), indicating that the antigen is broadly expressed. Furthermore, the stimulatory activity could be isolated from the spleen and liver of both male and female B6 control mice (Figure 13B), indicating that the presence of the antigen is gender-independent and is independent of the presence of the prostate or prostate cancer.

[00197] The stimulatory activity could also be detected in crude extracts from several murine tumor cell lines, including the B16 melanoma, EL4 thymoma, and TRAMP-C2 prostate cancer cell lines (data not shown). Despite the presence of the antigen in the crude extracts of all cell lines examined, none of the cell lines was able to directly stimulate the 6B1-6 hybridoma (data not shown). The stimulatory activity could also be isolated from the spleens of TAP-deficient and MHC-disparate mice (data not shown), indicating that the presence of the antigen is both TAP-independent and MHC- independent.

[00198] To further explore the nature of the stimulatory antigen, subcellular fractions of extracts from the B16 melanoma cell line were isolated and assayed for the ability to stimulate the 6B1-6 hybridoma. B16 extracts were fractionated according to the methods of Wysocka et al. (Molecular and Cellular Biology 21 :3820, 2001). Briefly, cells were lysed in detergent, nuclei were spun out by low-speed centrifugation, and the "soluble cytosolic" supernatant was removed. The nuclear pellet was then subjected to hypotonic lysis, and the resulting suspension was subjected to high-speed centrifugation. The supernatant ("soluble nuclear") and pellet ("chromatin-enriched") fractions were then separated. The three aforementioned fractions were then boiled in 10% acetic acid, passed through a 3 kD cutoff membrane and resolved by reversed-phase HPLC. When the resulting HPLC fractions were assayed, stimulation of the clonotypic 6B1-6 hybridoma was only observed for the soluble nuclear and insoluble nuclear fractions (Figure 14). Therefore, then antigen recognized by clonotypic Vα2⁺Vβ8.3⁺ T cells is preferentially localized in the nucleus.

[00199] Taken together, the extract data indicate that the stimulatory antigen recognized by clonotypic T cells infiltrating TRAMP prostate tumors is a ubiquitous, non-mutated, nuclear antigen.

[00200] With the knowledge that the stimulatory antigen is a ubiquitous nuclear antigen, we assayed the highly conserved histone proteins for their ability to stimulate the 6B1-6 hybridoma. A histone mixture or individual purified histones from calf thymus were boiled in 10% acetic acid, passed through a 3 kD cutoff membrane, resolved by reversed-phase HPLC, and assayed for stimulation of the 6B1-6 hybridoma upon culture with K^b-expressing L cells. Preparations from the histone mixture and from purified histone H4 stimulated the 6B1-6 hybridoma (Figure 15), indicating that T cells expressing the conserved Vα2⁺Vβ8.3⁺ TCR recognize a peptide derived from histone H4. To identify the antigenic peptide, the stimulatory activity was subjected to two rounds of HPLC purification consisting of resolution on a C18 reversed-phase column followed by resolution on a C8 column (Figure 16A). The resulting stimulatory fraction was subjected to sequence analysis using tandem mass spectrometry. A single 17-mer peptide of mass 1886 Da and sequence WYALKRQGRTLYGFGG, (identical to the C-terminus of calf histone H4, residues 86-102), was detected in the stimulatory fraction (Figure 16B). Importantly, the protein sequence of calf histone H4 is identical to that of mouse. To confirm the identity of the stimulatory peptide and to define the minimal core epitope required for T cell recognition, the C-terminal histone H4₈₆-io₂ 17-mer and smaller peptides derived from this peptide were synthesized and tested for the ability to stimulate T cells expressing the conserved TCR (Figures 17 and 18). Upon incubation with CDHc⁺ dendritic cells, histone H4₈₆.₁₀₂ stimulated activation of 6B1-6 hybridoma cells (Figure 17A) and IFN-γ production by αβTCRtg T cells expressing the conserved Vα2⁺Vβ8.3⁺ TCR (Figure 17B). Truncations of the histone H4₈₆-io₂ peptide from the C-terminal end also stimulated clonotypic T cells, with peptides H4₈₆-₉₂, H4₈₆_₉₃, and H4₈₆.₉₄ all exhibiting stimulatory properties. Interestingly, the most potent peptide was the heptamer histone H4₈₆.₉₂, an unusual finding considering the fact that K^b primarily presents octameric and nonameric peptides. [00201] To assess the relative ability of C-terminal histone H4 peptides to bind the K^b molecule, the ability of peptides to stabilize K^b expression on TAP-deficient RMA-S cells was evaluated. Histone H4₈₆.₉₂, H4₈₆_₉₃, H4₈₆-₉₄ and H4₈₆-io₂ all stabilized K^b expression (Figure 19), but only to a small extent (5-10% of maximal stabilization based on the positive control peptide SIINFEKL) and only at the highest concentrations tested (10 μM and 100 DM). Among the histone H4 peptides tested, the heptameric histone H4₈₆_₉₂ displayed the highest affinity for K^b, consistent with its highest potency for stimulation of clonotypic T cells (Figure 17).

[00202] To analyze T cell recognition of C-terminal histone H4 peptides in TRAMP mice in vivo, the division of histone H4-reactive transgenic T cells (previously referred to as αβTCRtg T cells) was assessed following adoptive transfer into tumor-bearing TRAMP mice. Congenically marked transgenic T cells were CFSE-labeled, adoptively transferred into 27-week-old TRAMP and age- matched B6 control mice, and analyzed five days post-transfer for CFSE dilution. Histone H4-reactive donor T cells that had undergone CFSE dilution were observed in the prostate-draining lymph nodes of TRAMP mice, but not in age-matched B6 controls (Figure 20). Cells that had diluted CFSE were not observed in TRAMP spleen and non-draining lymph nodes (Figure 20), indicating that T cell antigen recognition is limited to the lymph nodes draining the tumor site. Thus, T cell recognition of histone H4 antigen in vivo is specifically observed in the prostate-draining lymph nodes of tumor- bearing TRAMP mice.

[00203] To assess whether presentation of C-terminal histone H4-derived peptides is a general property of transgenic tumor models in which tumorigenesis is driven by SV40 T antigen, transgenic histone H4-reactive T cells were adoptively transferred into 13-week-old RIP-Tag2 mice. These mice express SV40 T antigen under the rat insulin promoter, and develop pancreatic carcinomas (Hanahan, D., Nature 315:115, 1985). In all experiments, CFSE dilution of histone H4-reactive T cells was not observed in the spleen, tumor-draining lymph nodes, or non-draining lymph nodes of RIP- Tag2 mice (Figure 21 ), suggesting that histone H4 presentation does not occur in RIP-Tag2 mice. These results indicate that presentation of histone H4 for recognition by T cells is not a general property of T antigen-driven transgenic tumor models.

[00204] CD8⁺ MHC class l-restricted T cell responses to histones have not been reported previously in models of cancer or autoimmunity. However, antibody and CD4⁺ T cell responses to histones and other nuclear antigens have been described in numerous autoimmune disorders in both humans and murine models. To determine whether antibody reactivity to histones and other nuclear antigens is a general property of the immune response in TRAMP mice with prostate cancer, we analyzed blood serum for the presence of antinuclear antibodies (ANA). Whereas lupus-prone Fas-deficient B6.MRL mice exhibited elevated levels of ANA, tumor-bearing TRAMP mice exhibited normal ANA levels comparable to those of B6 controls (Figure 22). Therefore, the CD8⁺ MHC class l-restricted T cell response to histone H4 in the TRAMP model is not simply a hallmark of a global cellular and humoral response to nuclear antigens.

[00205] To assess the contribution of histone H4-reactive T cells to tumor immunity or tolerance, TRAMP^+/+ mice were crossed to the transgenic line that exhibits variegated expression of the clonotypic histone H4-reactive αβTCR (αβTCRtg (v) mice). These mice express the full αβTCR in approximately 10% of mature T cells, and thus have a high precursor frequency of histone H4- reactive cells, yet exhibit diversity in the remaining 90% of the repertoire. The resulting male offspring, either TRAMP⁺'^' or TRAMP⁺'^" αβTCRtg (v), were sacrificed between 26-28 weeks of age, and the mass of the genitourinary tract and prostate was determined following dissection. Statistical analysis revealed a slight, but statistically significant reduction in prostate and genitourinary tract mass in TRAMP⁺'^" αβTCRtg (v) relative to TRAMP⁺'^" controls, suggesting that, on average a high precursor frequency of histone H4-specific T cells results in decreased tumor burden in TRAMP mice.

[00206] Example 2: Immunotherapy of mouse prostate cancer by immunization with histone H4 peptide in conjunction with TLR3 agonist and anti-CD40 antibody

[00207] To evaluate the ability of histone H4-reactive CD8⁺ T cells to mediate anti-tumor cytolytic responses in TRAMP mice, an immunization strategy using a combination of histone H4 peptide, the TLR3 agonist Poly I:C, and agonistic anti-CD40 antibody is employed (Ahonen et al., Journal of Experimental Medicine, 199:775, 2004). Mice are immunized by intraperitoneal injection of a mixture containing histone H4₈₆_₉₂ peptide (100 μg), Poly I:C (50 μg), and anti-CD40 antibody clone FGK45 (100 μg). TRAMP male mice are immunized at 2 months, 3 months, and 4 months of age. As controls, age-matched TRAMP treated with Poly I:C and anti-CD40 alone (no peptide) are included in the study. At 6 months of age, mice are sacrificed, and the histone H4-reactive cytolytic T cell response in lymphoid organs and prostate infiltrate are analyzed by standard methods. In addition, prostate tumors are evaluated by gross dissection and histological analysis.

[00208] Example 3: Immunotherapy of mouse prostate cancer by adoptive transfer of histone H4- reactive T cells

[00209] To evaluate the efficacy of adoptive cell therapy using histone H4-reactive T cells in the TRAMP prostate cancer model, adoptive transfer of in vitro-expanded histone H4-reactive T cells into irradiated TRAMP recipients is performed using methods similar to those used by Gattinoni et al. (Journal of Clinical Investigation 115:1616, 2005). To isolate dendritic cells (DCs) for use in T cell expansion, B16 melanoma cells producing Flt3L are injected subcutaneously in the backs of male B6 mice. 10-14 days later, mice are euthanized, spleens are harvested, and CDHc⁺ DCs are isolated by magnetic sorting using CD11c MACS beads (Miltenyi). DCs are cultured at 1 x 10⁵ cells per well overnight in LPS (1 ng/mL) and GM-CSF (20 ng/mL). The following day, DCs are washed and cultured with 1 x 10⁵ cells per well histone H4-reactive αβTCRtg Rag1^"'^" T cells with culture medium containing 10 μM histone H4₈₆.₉₂ peptide and recombinant mouse IL-15 (50 ng/mL). Following three days of stimulation, T cells are harvested and washed. 5-month-old recipient TRAMP mice are irradiated with 500 cGy, and 2 x 10⁶ in vitro-activated histone H4-reactive T cells are adoptively transferred by tail vein injection. As controls, age-matched TRAMP males that are irradiated but do not receive donor cells are included in the study. At two weeks post-treatment, mice are sacrificed, and the histone H4-reactive cytolytic T cell response in lymphoid organs and prostate infiltrate are analyzed by standard methods. In addition, prostate tumors are evaluated by gross dissection and histological analysis.

[00210] Example 4: Direct detection and enumeration of histone H4-reactive CD8⁺ T cells in tumor- bearing TRAMP mice

[00211] In order to directly evaluate the frequency, phenotype, and localization of histone H4-reactive T cells in TRAMP mice, two methods are employed. The first method involves direct staining using fluorescent peptide/MHC tetramers, and the second involves the use of the "TRAP" assay ("T-cell recognition of APCs by protein transfer"). Prostate tissue is dissected, mechanically disrupted between frosted microscope slides, and subjected to treatment with collagenase type 2 (1 mg/rmL) for one hour at 37°C. Resulting suspensions are filtered, and lymphocytes are enriched via gradient density centrifugation on a continuous Percoll gradient, followed by centrifugation over Histopaque- 1119 (Sigma). Spleen and lymph nodes are dissected and mechanically disrupted through 70 μm cell strainers.

[00212] (A). Direct staining of histone H4-reactive T cells using PE-labeled H-2K^b / histone H4₈₆_₉₂ tetramers

[00213] PE-labeled peptide/MHC tetramers are prepared by refolding recombinant H-2K^b heavy chain and β2microglobulin in the presence of histone H4₈₆_₉₂ peptide using standard methods (Altman et al., MHC-peptide Tetramers to Visualize Antigen-Specific T Cells, Current Protocols in Immunology). Prostate, spleen, and lymph node samples are stained with tetramers at various concentrations in the presence of anti-CDδαdc er antibody clone CT-CD8a (Caltag) and antibodies to other cell surface phenotypic markers for one hour on ice, washed three times, fixed with 1% paraformaldehyde, and analyzed by flow cytometry.

[00214] Use of tetramers comprising optimized peptide.

[00215] In these experiments, to improve on affinity of wild-type histone H4(86-92) WYALKR binding to K^b and production of stable tetramers, K^b tetramers were produced bearing the analog peptide WYAFKR, in which the leucine lying in the dominant K^b- binding anchor position is mutated to a phenylalanine. The WYAFKR peptide exhibited increased affinity for K^b and was recognized by clonotypic T cells in vitro and WYAFKR/K^b tetramers ("H4/K^b tetramers") stained HRC T cells efficiently (Science. 2008 Jan 11 ;319(5860):215-20.)

[00216] (B). Detection of histone H4-reactive T cells via TRAP assay

[00217] TRAP assay is performed as outlined by Beadling and Slifka (Nature Medicine 12:1208, 2006). CDHc⁺ DCs are surface biotinylated by incubation with EZ-Link-Sulfo-NHS-LC-biotin (1 mg/mL, Pierce) for 20 minutes on ice. DCs are then washed and fluorescently labeled by incubation with Pacific Blue-conjugated streptavidin (1 μg/mL). Next, DCs are pulsed with 10 μM histone H4₈₆.₉₂ peptide for one hour and washed. Prostate, spleen, and lymph node samples are then cultured with labeled DCs for 6 hours, harvested, and stained with antibodies to appropriate cell surface markers. Histone H4-reactive T cells are identified by flow cytometry based on their acquisition of Pacific Blue- labeled proteins from the APC membrane during antigen recognition.

[00218] Example 5: Detection of human cancer by monitoring for the presence of histone H4-reactive T cell responses in peripheral blood

[00219] Detection of histone H4-reactive T cells in blood samples is performed using methods outlined by Yuan et al. {Cytotherapy 8:498, 2006). For antigen presenting cells, a panel of subclones of the human chronic myelogenous leukemia cell line K562 engineered to individually express common HLA alleles is first established (Britten et al., Journal of Immunological Methods 259:95, 2002). Prior to immune monitoring, the patient HLA type is determined by standard methods. K562 subclones expressing the appropriate HLA alleles are irradiated with 30 Gy, and cultured at 1 x 10⁵ cells per well with 2 x 10⁶ patient peripheral blood mononuclear cells per well in culture medium containing a panel of overlapping histone H4-derived peptides (1 μM each peptide), 10% autologous serum, recombinant human IL-2 (10 IU/mL), and recombinant human IL-15 (10 ng/mL). After ten days of culture, cells are harvested and assayed for the presence of histone H4-reactive T cells by IFN-γ ELISPOT and IFN-γ intracellular cytokine staining using standard methods.

[00220] Figure 25. Elevated frequencies of histone H4-reactive T cells in the blood of tumor-bearing TRAMP mice. Blood from 10 tumor-free B6 mice (> 27 weeks of age) and 14 tumor-bearing TRAMP^+/+ mice (> 27 weeks of age) was analyzed by flow cytometry. Blood cells were isolated, subjected to red cell lysis, and stained with antibodies specific for CD8 and the activation marker CD44, as well as H4/K^b tetramer-PE and an irrelevant OVA-K^b tetramer PE-Cy5. The frequency of antigen-experienced H4/K^b tetramer⁺ CD44^hl9h T cells is plotted as a percentage of CD8 T cells. Horizontal bars indicate mean values. The difference in the frequencies of H4 specific CD8 T cells in the peripheral blood of tumor bearing mice as opposed to the frequency of such cells in the controls shows that diagnosis of tumors is possible by using a sample of peripheral blood. Further, this experiment was conducted using untreated blood samples. By culturing the T cells present in the two samples and restimulating them using H4 pulsed APCs (Jackson et al. Journal of Immunological Methods 291 :51 (2004), it would be possible to magnify small differences in T cell frequencies and achieve a higher sensitivity for diagnosis.

[00221] Example 6: Immunotherapy of human cancer by immunization with histone H4 peptide-loaded dendritic cells

[00222] Histone H4 peptide-loaded dendritic cell (DC) vaccines are prepared using methods similar to those described by Banchereau et al. (Cancer Research 61 :6451 , 2001). To harvest DC progenitors, patients receive granulocyte-colony stimulating factor (10 μg/kg/day) subcutaneously for five days to mobilize stem cell progenitors, then undergo leukapheresis on two consecutive days to isolate CD34⁺ hematopoietic progenitors. The CEPRATE SC stem cell concentration system (CellPro Inc.) is then used to enrich for CD34⁺ progenitors. CD34⁺ enriched samples are cultured for 8 days in the presence of recombinant human cytokines GM-CSF (50 ng/mL), Flt3L (100 ng/mL), and TNF (10 ng/mL) to promote dendritic cell maturation. On the final day of culture, a panel of overlapping peptides derived from histone H4 (1 μM each peptide) is added to the culture. Cells are then washed four times with saline and administered to the patients via three separate subcutaneous injections in separate sites (both thighs and the upper arm). Each patient receives a total of four vaccinations administered every 14 days. To monitor vaccine efficacy, peripheral blood cells are analyzed pre- treatment and 14 days after each vaccination for the presence of histone H4-reactive T cells via IFN-γ ELISPOT assay.

[00223] Example 7: Immunotherapy of human cancer by adoptive transfer of histone H4-reactive T cells

[00224] Adoptive transfer of ex vivo-expanded histone H4-reactive T cells into human cancer patients is performed using methods based on those of Yee et al. (Journal of Immunology 162:2227, 1999) and Rosenberg et al. [Journal of Immunotherapy 26:385, 2003). For each patient, autologous dendritic cells are derived by culturing adherent peripheral blood mononuclear cells (PBMCs) in medium containing recombinant human GM-CSF and recombinant human IL-4 for 5-7 days. Dendritic cells are harvested, irradiated with 30 Gy and cultured in 48-well plates at 2.5 x 10⁴ cells per well with 5 x 10⁵ fresh PBMCs per well in culture medium containing a panel of overlapping histone H4-derived peptides (1 μM each peptide), 10% autologous serum, and recombinant human IL- 15 (50 πg/mL). After 7 days, cultures are assayed for histone H4-reactivity by IFN-γ ELISPOT and IFN-γ intracellular cytokine staining using standard methods. To obtain sufficient numbers of antigen-specific cells, two additional rounds of T cell restimulation are performed prior to patient treatment. Patients are subjected to nonmyeloablative lymphodepletion by 2 days of cyclophosphamide treatment followed by 5 days of fludarabine treatment. Ex vivo expanded histone H4-reactive T cells are harvested, washed, and infused intravenously at a dose of 1 x 10¹⁰ cells. IL-2 is administered at a dose of 720,000 IU/kg by bolus intravenous infusion.

[00225] Example 8: Figure 24. Histone H4-reactive HRC transgenic T cells adoptively transferred into castrated B6 mice do not recognize histone H4 antigen and do not divide. When cells divide, CFSE staining intensity decreases approximately two-fold for each division. Castration induces prostate involution characterized by cell death. 9-week-old B6 males were either castrated (6 mice) or received a sham operation (6 mice). 7 days later, purified CD45.1⁺ HRC T cells were labeled with 5 μM CFSE and adoptively transferred into these mice. Five days after T cell transfer, donor CD45.1 ⁺ HRC T cells from spleen (SP), tumor-draining periaortic lymph nodes (pLN), and non-draining brachial lymph nodes (bLN) were analyzed by flow cytometry. For each mouse, plots of side scatter (SSc) vs. CFSE are shown for the pLN. The percentage of CFSE-diluted cells is indicated. These data show that necrosis is not responsible for the H4-specific CTLs.

[00226] Materials and Methods [00227] Mice

[00228] TRAM P^+/+ mice (S1), a generous gift from N, Greenberg, were maintained in the homozygous state on the B6 background by interbreeding. C57BL/6J (B6) mice, CD45.1⁺ B6. SJ L-Ptprc^a Pepc^bIBoyJ mice, and Rag1 -deficient B6.129S7-Rag7^tmfMom/J mice were purchased from The Jackson Laboratory. RIP-Tag2 mice on the B6 background (S2) were a gift from V Gocheva and J. Joyce.

[00229] TCR transgenic mice were generated by standard methods using the TCR cassette vectors of Kouskoff et ai. (S3). The TCR cassette vectors pTαcass and pTβcass were a gift from D. Mathis and C. Benoist. The rearranged clonotypic Vα2-SGTGGYKV TCRα and Vβ8.3-SGTGGSAETL TCRβ chains were cloned into pTαcass and pTβcass, respectively. For each of the TCRα and TCRβ constructs, the appropriate V region (using Bδ spleen cDNA as template, primers 1 and 2) and the rearranged CDR3 region (using DNA clones derived from conserved spectratyping products as template, primers 3 and 4) were PCR amplified. The V and CDR3 regions were then fused together via splicing by overlap extension using primers 1 and 4. The fused TCRα or TCRβ chains were then cloned into pBSII (Stratagene) using Xmal/Sacll or Xhol/Sacll, respectively, and subcloned into pTαcass or pTβcass using STBL4 cells (Invitrogen). The resulting TCRα and TCRβ constructs were excised from the vector using Sail and Kpnl, respectively. Primers used are as follows:

[00230] Vβ8.3: Vβ8.3 primeri δ'-CCGCTCGAGCGGATGGGCTCCAGGCTCTTTC-S'; Vβ8.3 primer2 δ'-GGACATCTCCTATTTGAAGGT-S'; Vβ8.3 primer3 δ'-GAGGCTGATCCATTACTCATATG-S'; Vβ8.3 primer4 5'-TCCCCGCGGGGACCCAACTTACCGAGAACAGTCAGTCTGGTT-S';

[00231] Vα2: Vα2-primer1 δ'-TCCCCCCGGGGGGAATGGACAAGATCCTGACAGC-S'; Vα2-primer2 δ'-CTGAGTCTCCAGGCTGAGAG-S'; Vα2-primer3 δ'-CTCTCAGCCTGGAGACTCAG-S'; Vα2-primer4 5'-TCCCCGCGGGGAGCTCACTTACCAGGGCTTACCAGCAATCG-S';

[00232] Excised linear constructs were purified and either injected singly (to generate TCRβ single- chain transgenics) or co-injected (to produce TCRαβ transgenics) into blastocysts. Transgenic founders were produced and screened by standard methods. Transgenic mice were either generated on a pure B6 background or generated in (CBA x B6)F2 mice and crossed to the Bδ background for at least 12 generations. TCR transgenic lines that were generated and maintained were a TCRβ single- chain transgenic (HRB, histone H4-reactive TCR transgenic, beta-chain), a TCRαβ transgenic line exhibiting variegated expression of the conserved TCRαβ (HRV, histone H4-reactive TCR transgenic, variegated expression), a TCRαβ transgenic exhibiting complete expression of the TCRαβ (HRC, histone H4-reactive TCR transgenic, complete expression), and the HRC transgenic crossed to the Rag 1 -deficient background. Genotyping of transgenic mice was performed by PCR amplification of earpunch DNA using forward primer δ'-CCAGTATCTCGAGCGGATGG-S', and reverse primer 5'- TGCACTACCCCCAGTCCCAC-3', which specifically amplifies the Vβ8.3⁺ TCRβ transgene.

[00233] All mice were maintained in microisolator cages, and treated in accordance with NIH and American Association of Laboratory Animal Care regulations. All mice were bred and maintained in accordance with the animal care and use regulations of the University of California, Berkeley and Memorial Sloan-Kettering Cancer Center.

[00234] TCR CDR3 size spectratyping and sequence analysis [00235] Tissue was homogenized in TRI reagent (Sigma) by polytron homogenization, and RNA was isolated by standard methods. RNA was reverse transcribed using oligo dT primer (Invitrogen) and Superscript Il reverse transcriptase (Invitrogen). cDNA was subjected to PCR amplification with Platinum Taq (Invitrogen) using a 6-FAM-labeled constant region-specific primer (Genset) paired in separate reactions with primers specific for V-region families (see Table S1 ). 40 cycles of PCR amplification were performed with annealing at 55°C. Amplification products were resolved on a 4% polyacrylamide gel and analyzed on an automated fluorescence sequencer (Applied Biosystems 377). A Genescan 400HD Rox-labeled DNA ladder (Applied Biosystems) was used as an internal calibration control to determine fragment length CDR3 size spectra were analyzed using Genescan software (Applied Biosystems). For DNA sequencing of select CDR3 fragments, PCR amplification was repeated with a constant region-specific primer lacking 6-FAM and with ³²P-α-dATP in the reaction mixture. ³²P-!abeled PCR products were resolved by PAGE, and the gel was transferred to Whatman paper and dried. CDR3 fragments were detected by autoradiography, purified, cloned into the pCR4-TOPO vector (Invitrogen), and sequenced by standard methods.

[00236] Flow cytometry, antibodies, and peptide/MHC tetramer staining

[00237] All antibodies used were purchased from eBioscience, BD Biosciences, and Caltag. Typically, cells were stained for 20 minutes on ice in wash buffer (phosphate-buffered saline with 2% FCS and 0.1 % NaN₃), or where appropriate, using procedures recommended by the manufacturer, followed by three washes. Peptide/MHC tetramers were produced by I. Leiner in the MSKCC Tetramer Core Facility. For peptide/MHC tetramer staining, cells were stained with -15 nM WYAFKR/K^b tetramer-PE and -1.5 nM irrelevant SIINFEKL/K^b tetramer-PE-Cy5 in the presence of anti-CD8C-Pacific Blue (clone 53-6.7) for 2 hours on ice in complete RPMI-1640 with 10% FCS. Stained cells were washed three times, resuspended in wash buffer containing 1 μg/mL propidium iodide (Pl), and analyzed by flow cytometry. Flow cytometry was performed on a Cyan ADP (Dako), using FlowJo data analysis software (Tree Star). For analysis, cells that were Pl⁺ or SIINFEKL/K⁵ tetramer⁺ were eliminated by gating.

[00238] Generation of the clonotypic LacZ-inducible T cell hybridoma 6B1-6

[00239] A LacZ-inducible T cell hybridoma expressing the clonotypic Vα2-SGTGGYKV / Vβ8.3- SGTGGSAETL TCR was generated using the methods of Shastri and colleagues (S4). Splenocytes from histone H4-reactive HRC transgenic mice were activated in vitro in a flask pre-coated with anti- CD3 antibody 500A2 (10 μg/mL) and anti-CD28 antibody 37N (5 μg/mL). Two days post-stimulation, viable T cells were purified over Lympholyte M (Cedarlane) and fused using polyethylene glycol 1500 (Roche) using standard methods with the LacZ-inducible cell line BVVZ.36 CD8α (S5), a gift from N. Shastri, which expresses LacZ under the control of the NFAT enhancer element of the IL-2 promoter. The resulting HAT-resistant hybrids were then screened 15 days post-fusion for CD8α, Vα2, and Vβ8.3 expression. Hybrid subclone 6B1-6 was selected based on its stable expression of CD8α, Vα2, and Vβ8.3, and its ability to produce high levels of c-galactosidase upon stimulation with plate- bound anti-CD3 antibody. The Vα2⁺ and Vβ8.3⁺ TCR chains from this hybridoma were cloned and sequenced to confirm identity to the cionotypic Vα2-SGTGGYKV and Vβ8.3-SGTGGSAETL chains.

[00240] Isolation of T cells from mouse prostate

[00241] Prostate tissue was dissected, mechanically disrupted between frosted microscope slides or by mincing using surgical razor blades, and subjected to treatment with 1 mg/mL collagenase type 2 (Worthington) for one hour at 37⁰C in complete RMPI media. Resulting suspensions were filtered through 70 Cm cell strainers (BD Biosciences), and lymphocytes were enriched via gradient density centrifugation on a continuous Percoll gradient (GE Healthcare), followed by centrifugation over Histopaque-1119 (Sigma).

[00242] Stimulation of the cionotypic hybridoma 6B1-6 with cellular extracts

[00243] Crude cellular acid extracts were isolated and assayed for stimulation of the cionotypic hybridoma 6B1-6 using an approach based on the methods of Serwold et al. (S6). To obtain single cell suspensions, mouse organs were dissected, gently minced using surgical razor blades, and subjected to two successive rounds of treatment with 1 mg/mL collagenase type 2, each one hour at 37⁰C. Resulting suspensions were filtered through 70 μm cell strainers and washed. Single cell suspensions or subcellular extracts were boiled in 10% acetic acid for 10 minutes and passed through a Microcon YM-3 3 kD cutoff filter (Millipore). Extracts were then resolved by reversed-phase HPLC using an Agilent 1100 series HPLC fitted with either a Protein and Peptide C18 column (Grace Vydac) or a Zorbax Eclipse XDB-C8 column (Agilent) using an acetonitrile gradient in 0.1% TFA. Fractions were collected in flat-bottom 96-well plates and dried by SpeedVac (Thermo-Electron). 5 x 10⁴ L cells expressing K^b and B7.2 or D^b and B7.2 (both gifts from N. Shastri) and 5 x 10⁴ 6B1-6 hybridoma cells were then added to each well, and the plates were cultured for 18 hours at 37⁰C. The cultures were washed once with PBS, and 100 μL of CPRG solution (150 μM CPRG (Roche), 1 mM MgCI₂, 0.125% NP-40 in PBS) was added to each well. Plates were incubated for four hours at 37°C, and the absorbance at 595 nm and 655 nm was measured. When the 6B1-6 hybridoma is activated, it produces β-galactosidase, which cleaves CPRG and releases phenol red, which is quantified by measuring absorbance at 595 nm. Absorbance at 655 nm is used as a reference wavelength.

[00244] Biochemical fractionation of subcellular extracts

[00245] Extracts from B16 melanoma cells were fractionated according to the methods of Wysocka et al. (S7). Briefly, B16 melanoma cells were resuspended in buffer A (10 mM HEPES pH 7.9, 1O mM KCI, 1.5 mM MgCI₂, 0.34 M sucrose, 10% glycerol, 1 mM dithiothreitol, and Complete protease inhibitor cocktail (Roche)). Triton X- 100 was added to 0.1 % final concentration, the cells were incubated on ice for 8 min, and nuclei were collected by centrifugation (5 min, 130Og, 4°C). The "soluble cytosolic" supernatant was removed and clarified by high-speed centrifugation (5 min, 2000Og, 4°C). The nuclear pellet was washed once in buffer A and lysed for 30 min in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM dithiothreitol, and Complete protease inhibitor cocktail), and the insoluble "chromatin-enriched" fraction and "soluble nuclear" fractions were separated by centrifugation (5 min, 170Og, 4°C). Acetic acid was added to each subcellular fraction to 10% final concentration, and the samples were boiled for 10 minutes.

[00246] Identification of the histone H4-derived peptide antigen

[00247] Full-length histone H4 (from calf thymus, Roche) was boiled in 10% acetic acid, passed through a Microcon YM-3 3 kD cutoff filter, resolved via HPLC on a Protein and Peptide C18 column (Grace Vydac), and assayed for stimulation of the clonotypic hybridoma 6B1 -6. The stimulatory fraction was then resolved via HPLC on a Zorbax Eclipse XDB-C8 column (Agilent), and assayed as before. The stimulatory fraction was then subjected to sequence analysis by Nano-LC-ESI-ion trap mass spectrometry. Peptides were analyzed by LC-MS/MS on an LTQ (Thermo Electron) operating in positive ion mode. Chromatography was by nanoflow HPLC using the 1100 Series HPLC (Agilent) at flow rates of 300 nL/min. Separation was achieved by a gradient of increasing acetonitrile in water (2-34%) for 80 minutes using 0.1% formic acid as the ion-pairing agent on a capillary 75-μm ID column self-packed with Jupiter Proteo C12 (Phenomenex) chromatographic support. The LC eluent was directed to a nano-ionspray source. Automatic gain control (AGC) was set at 3x10⁴ ions for MS, and 2x 10⁴ ions for MS" and CID collision energies were set at 35%. Peak lists for database searching were created using Bioworks software and searched with the sequest algorithm (Thermo Electron). The allowed mass tolerance between expected and observed masses for LTQ data was + 0.5 daltons for MS and MS/MS. Searches were performed against both the nonredundant National Center for Biotechnology Information database (NCBInr., 3/12/2006) and Swiss-Prot (3/12/2006) on rodent sub-databases. Peptides with an Xcorr score of greater than 2.5 were considered potentially correct and manually checked to assess assignment of major ions in MS/MS.

[00248] Stimulation of clonotypic T cells with histone H4-derived peptides

[00249] Antigen presenting cells were incubated with histone H4-reactive T cells in the presence of varying concentrations of peptide. APCs were either L cells expressing K^b and B7.2 (5 x 10⁴ / well), L cells expressing D^b and B7.2 (5 x 10⁴ / well) or CD11 C⁺ primary dendritic cells (DCs) (1 x 10⁵ / well). To isolate CDHc⁺ DCs, B16 melanoma cells producing Flt3L were injected subcutaneously in the backs of male B6 mice. 10-14 days later, mice were euthanized, spleens were harvested, and CDHc⁺ DCs were isolated by magnetic sorting using CD11c MACS beads (Miltenyi). DCs were cultured overnight in 1 ng/mL LPS (ultra pure S. Minnesota, Invivogen) and 20 ng/mL GM-CSF (R&D Systems). The following day, DCs were washed and cultured with peptide and responder T cells. Responder T cells were either the clonotypic hybridoma 6B1-6 (5 x 10⁴ / well) or MACS-purified histone H4-reactive HRC T cells (1 x 10⁵ / well). Clonotypic hybridoma cells were stimulated for 18 hours, at which time cultures were assayed for β-galactosidase activity. HRC T cells were stimulated for 48 hours, at which time supernatants were taken for analysis of IFN-γ production by sandwich ELISA (antibodies from BD Biosciences). Synthetic peptides were purchased from Sigma-Genosys, and included histone H4 17-mer H4(86-102), 9-mer H4(86-94), 8-mer H4(86-93), 7-mer H4(86-92), 6- mer H4(86-91), and the control SIINFEKL.

[00250] RMA-S K^b stabilization assay [00251] Assays of stabilization of K^b expression on the surface of TAP-deficient RMA-S cells by addition of exogenous peptides were performed as described by Hogquist et al. (S8). Briefly, 5 x 10⁴ RMA-S cells were cultured overnight at 31⁰C in round-bottom 96-well plates. The following day, peptides were added at varying concentrations. Cells were then cultured for 30 minutes at 31⁰C, followed by four hours at 37°C. Cells were quick-chilled on ice, stained with anti-K^b-PE antibody, fixed with 1 % paraformaldehyde, and analyzed by flow cytometry. The peptides used were histone H4 17- mer H4(86-102), 9-mer H4(86-94), 8-mer H4(86-93), 7-mer H4(86-92), 6-mer 1-14(86-91), and the control SIINFEKL.

[00252] Adoptive transfer of CFSE-labeled T cells

[00253] Spleen and lymph node cells from HRC transgenic mice crossed to the CD45.1⁺ B6.SJL- Ptprc^a Pepc^b/BoyJ strain (either Rag1^+/+ or Rag1^"Λ) were labeled with 5 μM CFSE (Invitrogen) in serum-free RPMI for 2 minutes at 37°C. CD8⁺ cells were then purified using a MACS CD8 T cell isolation kit (Miltenyi) and adoptively transferred into recipient mice by tail vein injection, typically 1 x 10^s or 5 x 10⁵ cells in 200 μL volume. At various times post-transfer, recipient mice were euthanized, and cells from lymphoid organs and/or prostate were isolated and analyzed by flow cytometry. Donor HRC T ceils were identified based on CD45.1⁺ and CDSa⁺ markers.

[00254] In vivo cytotoxicity assay

[00255] B6 splenocytes were split into two samples and labeled with either 0.5 μM or 5 μM CFSE in serum-free RPMI for 2 minutes at 37°C. Samples were then washed and cultured with 10 μM peptide in complete RPMI with 10% FCS for 1 hour at 37⁰C. Cells that were stained with 0.5 μM CFSE were incubated with the histone H4(86-92) analog WYAFKR peptide, while cells stained with 5 μM CFSE were incubated with SIINFEKL peptide. Cells were washed, mixed together at a 1 :1 ratio, and injected into recipient mice by tail vein injection, 5 x 10⁶ cells in 250 μL volume. 14 hours later, mice were euthanized, and the spleens and periaortic lymph nodes were harvested. In each sample, the recovery of CFSE-intermediate (0.5 μM) and CFSE-high (5 μM) target cells was quantified. Percent WYAFKR-specific target lysis in TRAMP^+/+ mice relative to B6 mice was calculated using the formula 1 - (r_Bβ / TTRAMP) x 100, where r = (% SIINFEKL-labeled targets / % WYAFKR-labeled targets). As a positive control for the assay, SIINFEKL-specific cytolytic activity was assessed following injection of target cells into Bδ mice that had been vaccinated 7 days earlier by intraperitoneal injection of 100 Dg SIINFEKL peptide, 50 μg double-stranded PoIy(I)-PoIy(C) (Amersham), and 100 μg anti-CD40 antibody clone FGK45 (BioExpress), as described by Ahonen et al. (S9).

[00256] Analysis of antinuclear antibodies

[00257] Blood was isolated by tail bleed, and samples were incubated for 30 minutes at 37°C to coagulate blood cells. Samples were then centrifuged, and the resulting supernatant was assayed using an ANA sandwich ELISA kit (Alpha Diagnostic).

[00258] Statistical analysis [00259] Analysis was performed using Prism software (GraphPad). Where data sets were normally distributed, t-tests were performed. In other cases, the non-parametric Wilcoxon rank sum test was used.

[0026O] To determine whether histone H4-reactive T cell responses take place in a different autochthonous cancer model driven by SV40 Tag, we analyzed RIP-Tag2 mice, which develop pancreatic cancer due to expression of Tag driven by the rat insulin promoter (S2). Upon analysis, we observed no proliferation of adoptively transferred HRC T cells in the pancreatic lymph nodes and spleen of tumor-bearing RIP-Tag2 mice (fig. S9). These findings suggest that MHC class I presentation of histone H4 for recognition by T cells is not a general property of transgenic tumor models driven by expression of SV40 Tag. In addition, serum levels of antinuclear antibodies in tumor-bearing TRAMP^+/+ mice were comparable to those in age-matched B6 mice (fig. S10), implying that the CD8⁺ T cell response to histone H4 in the TRAMP model is likely not part of a broader autoimmune response to nuclear antigens.

[00261] Table !

PCR primer sequences for TCRb CDR3 size spectratyping analysis. Primer sequences are listed for 25 Vb-famiiy specific primers and a Cb-specific primer. For spectratyping, a Cb-specific primer labeled with 6-FAM on its 5' terminus was used. Nucleotides listed in brackets indicate degeneracy, while X denotes complete degeneracy. primer Va family Vα fai

Arden et al. IMG mVa1.P1 1 7 GACTCCCAGCCCAGTGACTC mVa2.P2 2 14 GAGAAAAAGCTCTCCTTGCAC mVa2.P3 2 14 CTCTCAGCCTGGAGACTCAG mVa3.P1 3 9 ATGGCTTTGAGGCTGAGTTC mVa4,P1 4 6 (C/G)TCCTTCCACTTGCAGAAAG mVa5.P1 5 3 CGAAGGACAAGGATTCACTG mVa6.P1 6 21 CAGGGTCCAGAATATGTGAC mVa7,P1 7 15 GCCGCTATTCTGTAGTCTTC mVa8.P1 8 12 GCCACTCTCCATAAGAGCAG mVa9.P1 10 13 GCTTTGTCCCAGAAGGATTG mVa10.P1 10 13 CGCAGCTCTTTGCACATTTC mVa11.P1 11 4 TCTAAGGAG(A/C)GCTACAGCAC mVa12.P1 12 2 ACCAGGGACCACAGTTTATC mVa13.P1 9 17 CCGTTGTTAAAGGCACCAAG mVa14.P1 14 11 ACAGGCAAAGGTCTTGTGTC mVa15.P1 18 8 AAGACTCAGAGCCACCCTTG mVa15.P2 18 8 CAGCTCCTTGTCCATCACTG mVa16.P1 17 16 GTTCCATCGGACTCATCATC mVa17.P1 19 1 TGAAGGACAGTGGGCATTTC mVa18.P1 13 5 GCTCATCATTGACATTCGTTC mVa19.P1 6 21 TCACGCTCCTAATAGACATTC mVa20.P1 19 1 CACACTCCTGATATCCGTAC mVa21.P1 15 10 AACGATTCTCCCTGCACATC

mCa.P2 CCATGGTTTTCGGCACATTG

Table 2.

PCR primer sequences for TCRa CDR3 size spectratyping analysis. Primer sequences are listed for 21 Va-family specific primers and a Ca-specific primer. For spectratyping, a Ca-specific primer labeled with 6-FAM on its 5' terminus was used. Nucleotides listed in brackets indicate degeneracy. The column "Va family Arden et al." lists the Va family name according to the nomenclature of Arden et al. (Immunogenetics 42:501 , 1995). The column "Va family IMGT" lists the Va family name according to the nomenclature of the IMGT website (http://imgt.cines.fr/textes/lMGTrepertoire/Proteins/).

primer sequence

mVb1.P1 AATGCCCAGACAGCTCCAAGC mVb2.P1 GACAAAGAGGTCAAATCTCTTC mVb3.P1 CCTTGCAGCCTAGAAATTCAG mVb4.P1 CAAAGTGCTAAGAAGCCTCTAG mVb5.P1 ACAGTTTGATGACTATCACTCTG mVb6.P1 TTTTCTCTCACTGTGACATCTG mVb7.P1 TACAGGGTCTCACGGAAGAAG mVb8.P1 GAGGCTGATCCATTA(T/C)TCATATG mVbδ.3.P1 GGTGCTGGCAACCTTCAAATAG mVbδ.3-SGT.P1 CTTCTGTGCCAGCAGTGGXAC mVb9.P1 TCTCTCTACATTGGCTCTGCAG mVb10.P1 ACTCATTGTAAACGAAACAGTTC mVb11 ,P1 ACTCTGAAGATCCAGAGCACG mVb12.P1 ATGGAAGATGGTGGGGCTTTC mVb13.P1 ATAGATAATTCACAGTTGCCCTC mVb14.P1 CCTCCAGCAACTCTTCTACTC mVb15.P1 TGAACTGATAGCACTTTCTACTG mVb16.P1 AGTCATGGAGAAGTCTAAAC mVb17.P1 TCCTGGAAATCCTATCCTCTG mVb18.P1 GAGCTTGATGCTCATGGCAAC mVb19.P1 CGGGAGAAGAACTCAAATTTTTG mVb20.P1 TCAGCTGTGTGCCCCTCCAG mVb21.P1 TATTCAACAAATAGGTTCAGAAG mVb22.P1 AACATCAAGAAGCTCATGACAG mVb23.P1 AAGAGAAAGATGTGAAATTTGTG mVb24.P1 GCTCCTTCTCCATGTTGAAGAG mVb25.P1 ATGCAGGGCAGGGGTTGAAG

mCb.P1 CTTGGGTGGAGTCACATTTCTC

[00262] Sl N. M. Greenberg et al., Proc Natl Acad Sci U S A 92, 3439 (Apr 11 , 1995). [00263] S2. D. Hanahan, Nature 315, 115 (May 9-15, 1985).

[00264] S3. V. Kouskoff, K. Signorelli, C. Benoist, D. Mathis, J Immunol Methods 180, 273 (Mar

27, 1995).

[00265] S4. S. Malarkannan, L. M. Mendoza, N. Shastri, Methods MoI Biol 156, 265 (2001). [00266] S5. S. Sanderson, N. Shastri, lnt Immunol 6, 369 (Mar, 1994). [00267] S6. T. Serwold, N. Shastri, J Immunol 162, 4712 (Apr 15, 1999). [00268] S7. J. Wysocka, P. T. Reilly, W. Herr, MoI Cell Biol 21 , 3820 (Jun, 2001 ).

[00269] S8. K. A. Hogquist, A. G. Grandea, 3rd, M. J. Bevan, Eur J Immunol 23, 3028 (Nov,

1993).

[00270] S9. C. L. Ahonen et al., J Exp Med 199, 775 (Mar 15, 2004).

Claims

WE CLAIM:

1. An anti-tumor vaccine useful for the treatment of cancer, said vaccine comprising an immunogen, said immunogen comprising a histone H4 antigen.

2. The anti-tumor vaccine according to claim 1 , wherein said histone H4 antigen comprises the sequence WYALKRQGRTLYGFGG.

3. The anti-tumor vaccine according to claim 1 , wherein said histone H4 antigen comprises the sequence WYALKR.

4. The anti-tumor vaccine according to claim 1 , wherein said histone H4 antigen comprises an optimized histone H4 peptide.

5. The anti-tumor vaccine according to claim 1 , wherein said immunogen comprises an APC.

6. The anti-tumor vaccine according to claim 1 , further comprising an immunomodulatory agent.

7. A method for diagnosing a patient as having cancer, comprising detecting the presence of an H4- responsive CTL in a sample from the patient.

8. A method for diagnosing a patient as having cancer, comprising detecting the presence of TCR transcript specific for H4 antigen.

9. A method for diagnosing a patient as having cancer, comprising detecting the presence of non- nuclear H4 antigen in a sample from the patient.

10. The method according to any one of claims 7-9, wherein the cancer is prostate cancer.

11. The method according to any claim 7 or 8, wherein the sample is selected from peripheral blood, lymph node, and tissue biopsy.

12. A method for determining cancer prognosis, comprising detecting the presence of an H4- responsive CTL in a sample from the patient.

13. A method for determining cancer prognosis, comprising detecting the presence of non-nuclear H4 antigen in a sample from the patient.

14. A method for determining cancer prognosis, comprising detecting the presence of TCR transcript specific for H4 antigen in a sample from the patient.

15. A method for detecting a response to cancer treatment, comprising detecting a decrease in the presence of H4-responsive CTLs in a sample from the patient receiving treatment.

16. A method for detecting a response to cancer treatment, comprising detecting a decrease in the presence of non-nuclear H4 antigen in a sample from the patient receiving treatment.

17. A method for detecting a response to cancer treatment, comprising detecting a decrease in the presence of TCR transcript specific for H4 antigen in a sample from the patient receiving treatment.

18. A method for treating a patient having cancer characterized by the presence of cells presenting H4 peptide with class I MHC, comprising administering to the patient an anti-tumor vaccine according to claim 1.

19. An isolated cytotoxic T lymphocyte (CTL) responsive to H4 peptide.

20. A method for treating a patient having cancer characterized by the presence of cells presenting H4 peptide with class I MHC, comprising administering the CTL according to claim 19 to said patient.

21. An H4 tetramer comprising MHC and H4 peptide sequences, which is capable of binding to the isolated CTL of claim 19.