WO2007140383A2

WO2007140383A2 - Spirocyclic sulfonamides and related compounds

Info

Publication number: WO2007140383A2
Application number: PCT/US2007/069918
Authority: WO
Inventors: Kevin J. Hodgetts; David C. Ihle; Guiying Li; Ping Ge; Bertrand L. Chenard; David J. Wustrow
Original assignee: Neurogen Corporation
Priority date: 2006-05-30
Filing date: 2007-05-30
Publication date: 2007-12-06
Also published as: WO2007140383A3

Abstract

Spirocyclic sulfonamides and related compounds of Formula 1 are provided : (Formula (I)): in which the variables are as described herein. Such compounds may be used to modulate bradykinin receptor activity in vivo or in vitro, and are particularly useful in the treatment of conditions responsive to Bi modulation in humans, domesticated companion animals and livestock animals, including inflammation and pain. Pharmaceutical compositions and methods for using them to treat such disorders are provided, as are methods for using such ligands for receptor localization studies and various in vitro assays.

Description

SPIROCYCLIC SULFONAMIDES AND RELATED COMPOUNDS

FIELD OF THE INVENTION

This invention relates generally to spirocyclic sulfonamides and related compounds, and to the use of such compounds to treat conditions responsive to bradykinin receptor- 1 (B]) modulation. The invention further relates to the use of such compounds as reagents for the identification of other agents that bind to B], and as probes for the detection and localization of Bj.

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application 60/803,419, filed May 30, 2006, which is hereby incorporated by reference in its entirety.

DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NO: I Bj PCR primer number 1

SEQ ID NO:2 B₁ PCR primer number 2

SEQ ID NO : 3 B₁ PCR primer number 3 SEQ JD NO:4 B₁ PCR primer number 4

BACKGROUND OF THE INVENTION

Millions of people throughout the world are incapacitated by pain. Existing treatments For pain are, unfortunately, not completely effective, and typically have undesirable side effects. Non- steroidal anti-inflammatory drugs are only moderately effective against pain, and have serious renal and gastrointestinal side effects at high doses. Opiates, such as morphine, are potent analgesics, but their usefulness is limited because of adverse side effects, such as physical addictiveness and withdrawal properties, as well as respiratory depression, mood changes, and decreased intestinal motility with concomitant constipation, nausea, vomiting, and alterations in the endocrine and autonomic nervous systems. There is thus a need for effective agents for the treatment of pain.

Bradykinin (BK) is a nonapeptide that functions in cardiovascular homeostasis, contraction and relaxation of smooth muscles, inflammation and pain. The effects of BK are mediated by specific G protein-coupled BK receptors, of which there are at least two distinct subtypes termed Bj and B₂. The B₂ receptor is expressed constitutively in a variety of tissues. In contrast, the B₃ receptor is inducibly expressed in response to pathophysiological conditions such as inflammation, pain, trauma, bacterial infection, burns and shock. Accordingly. B| is a particularly attractive drug target for these and other conditions, and agents that act at this receptor may be targeted specifically to injured tissues, with minimal effects in normal tissues. In addition, compounds that bind to B] and/or modulate the activity of B, also find use as research tools.

I Tliere is thus a need in the art for small molecule modulators of Bj activity. The present invention fulfills this need and provides further related advantages.

SUMMARY OF THE INVENTION

The present invention provides spirocyclic sulfonamides and related compounds that satisfy Formula I:

Formula I

or are a pharmaceutically acceptable salt, solvate (e.g., hydrate) or ester of such a compound.

Within Formula I:

=^^ represents a single or double bond;

Ar is phenyl or a 5- or 6-membered heteroaryl, each of which is optionally substituted, and each of which is preferably unsubstituted or substituted on one or more ring carbon atoms (e.g., substituted on from 0 to 4 ring carbon atoms) with a substituent independently chosen at each occurrence from R_a; A is N, CH or C; B is N or CH; D is N(R₄₃), CH(R₄₁,), O, SO or SO₂;

Y is a group of the formula (CH₂VZ-(CH₂)_P that is optionally substituted and is preferably substituted with from O to 4 substituents independently chosen from amino, hydroxy, oxo, cyano, C_rC₆alkyl, C₂-C₆aϊkenyl, C₂-QaIkVTVyI, CpCβhaloalkyl and substituents of the same carbon atom or adjacent carbon atoms that are taken together to form C₃-C₆cycloalkyl; wherein Z is absent, O, S or NRg, wherein R^ is hydrogen or Ci-Qalkyl; and r and p are independently chosen integers ranging from O to 6; each n is independently I₅ 2 or 3; each R_a is independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyi and -COOH; (ii) Ci-C₆alkyl, C₃-C₆alkenyl, C₂-C₆alkynyl, C,-C₆haloalkyl, C₂-C₆alkyl ether, (C₃-

\_^]-

Cgalkoxycarbonyl, Ci-C₆alkylsulfonylCo-C₄alkyl, mono- or di-(Ci-C₆alkyi)amiτioCo-C₄alkyl, mono- or di-(CrC₆alkyl)aminosulfonyICo-C₄alkyI, and (4- to 8-membered heterocycloalkyl)Co-C₄alkyi; each of which is optionally substituted and each of which is preferably substituted with from O to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; and (iii) groups that are taken together with an R_a attached to an adjacent ring carbon atom to form a fused 5- to 10-membered carbocycle or heterocycle that is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, πitro, oxo, Ci-Qalkyl, Ci-C₆haloalkyl, C;-Qalkoxy, Q- C₆haloalkoxy, and mono- or di-(Ci-C₆alkyl)aminoCo-C₄alkyl;

R₂ and R₃ are:

(i) independently chosen from (a) hydrogen; and (b) Cj-Cgalkyl, Ci-Cgalkenyl, Ca-QaJkynyl, C_r Qhafoalkyl and (C₃~CgcycloaIkyl)Co-C₄alkyl, each of which is optionally substituted and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, amino and C|-C₄alkyl; or

(ii) taken together to form a 4- to ] O-membered carbocycle or heterocycle that includes A as a ring member and is optionally substituted; preferably the carbocycle or heterocycle so formed is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino and C]-C₈alkyi; R₄Js:

(i) hydrogen; or

(ii) Ci-Cgalkyl, C₂-C_ftalkenyl, C₂-Cβalkynyl, Q-Cnhaloalkyl, mono- or di-(Cj-Qalkyl)aminoCo-

C₄alkyl, (C₃-Cscarbocycle)C₀-C₄alkyl or (4- to 8-membered heterocycle)C₀-C₄alkyl, each of which is optionally substituted and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino, cyano, aminocarbonyl, aminosulfonyl, -COOH, C]-C₄alkyl and C_rC₄aikoxy; R₄₁, is:

(i) hydrogen, halogen, cyano, hydroxy, aminocarbonyl, aminosulfony! or -COOH; or (ii) CpQalkyl, C₂-C₆aikenyl, C₂-C₆alkynyL CrC₆haloalkyl, Ci-C₆alkoxy, mono- or di-(Ci- CgalkyOaminoCo-Giaikyl, (C₃-C₈carbocyc]e)C₀-C₄alkyl or (4- to 8-membered heterocyc Ie)Co-

C₄alkyl, each of which is optionally substituted and each of which is preferably substituted with from O to 4 substituents independently chosen from oxo, hydroxy, haiogen, amino, aminocarbonyl, aminosulfonyl, -COOH and Ci-C₄alkyl; and Each R₅ represents from O to 4 substituents independently chosen from oxo and C_rC₄aikyl. Within certain aspects, spirocycϋc sulfonamides and related compounds of Formula I, and other Formulas provided herein, are B| modulators and exhibit a K₁ of no greater than 5 micromolar, 2 micromolar, 1 micromolar, 500 nanomolar, 100 nanomolar. 50 nanomolar or 10 nanomolar in a Bi binding assay and/or have an EC₅₀ or IC₃₀ value of no greater than 5 micromolar, 2 micromolar, 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar in an assay for determination of B₁ agonist or antagonist activity. In certain embodiments, B; modulators provided herein are B₁ antagonists; preferably such antagonists exhibit no detectable Bi agonist activity.

Within certain aspects, spirocyclic sulfonamides and related compounds of Formula I are labeled with a detectable marker (e.g., radiolabeled or fluorescein conjugated). The present invention further provides, within other aspects, pharmaceutical compositions comprising at least spirocyclic sulfonamide or related compound of Formula I in combination with a physiologically acceptable carrier or excipient.

The present invention further provides, within other aspects, pharmaceutical compositions comprising at least one compound as described herein in combination with a physiologically acceptable carrier or excipient.

Methods are further provided for inhibiting agonist-induced Bi activity. Within certain such aspects, the inhibition takes place in vitro. Such methods comprise contacting a Bj receptor with at least one Bi antagonist as described herein, under conditions and in an amount or concentration sufficient to detectably inhibit agonist-induced B) activity. Within other such aspects, the B] receptor is in a patient. Such methods comprise contacting cells expressing a Bi receptor in a patient with at least one B] antagonist as described herein in an amount or concentration that would be sufficient to detectably inhibit agonist-induced B, activity in cells expressing a cloned B, receptor in vitro.

The present invention further provides methods for treating a condition responsive to B] receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of at least one spirocyclic sulfonamide or related compound of Formula I.

Within other aspects, methods are provided for treating pain in a patient, comprising administering to a patient suffering from (or at risk for) pain a therapeutically effective amount of at least one spirocyciic sulfonamide or related compound of Formula I. Pain conditions that may be treated include, but are not limited to, inflammatory pain, acute pain, dental pain, back pain, surgical pain, headache, neuropathic pain, and pain associated with osteoarthritis or trauma.

Within further aspects, the present invention provides methods for determining the presence or absence Of B₁ in a sample, comprising: (a) contacting a sample with a spirocyclic sulfonamide or related compound of Formula I under conditions that permit binding of the compound to B|j and (b) detecting a signal indicative of a level of the compound bound to B]. In yet another aspect, the invention provides methods of preparing the compounds disclosed herein, including the intermediates.

These and other aspects of the present invention will become apparent upon reference to the following detailed description. DETAILED DESCRIPTION

As noted above, the present invention provides spirocyciic sulfonamides and related compounds. Such compounds may be used in vitro or in vivo in a variety of contexts, as described herein. TERMiNOLOGY

Compounds are generally described herein using standard nomenclature. For compounds having asymmetric centers, it should be understood that (unless otherwise specified) all of the optical isomers and mixtures thereof are encompassed. In addition, compounds with carbon-carbon double bonds may occur in Z- and E- forms, with all isomeric forms of the compounds being included in the present invention unless otherwise specified. If a compound exists in various tautomeric forms, a recited compound is not limited to any one specific tautomer, but rather is intended to encompass all tautomeric forms. Certain compounds are described herein using a general formula that includes variables (e.g., Y, R], n). Unless otherwise specified, each variable within such a formula is defined independently of any other variable, and any variable that occurs more than one time in a formula is defined independently at each occurrence.

The term "spirocyciic sulfonamides and related compounds" encompasses all compounds that satisfy Formula I. This term further includes pharmaceutically acceptable salts, solvates and esters of such compounds, as well as the various ciystal forms and polymorphs.

A "pharmaceutically acceptable salt" of a compound recited herein is an acid or base salt that is suitable for use in contact with the tissues of human beings or animals without excessive toxicity or carcinogenicity, and preferably without irritation, allergic response, or other problem or complication. Such salts include mineral and organic acid salts of basic residues such as amines, as weli as alkali or organic salts of acidic residues such as carboxylic acids. Specific pharmaceutically acceptable anions for use in salt formation include, but are not limited to, acetate, 2-acetoxybenzoate, ascorbate, beπzoate, bicarbonate, bitartrate, bromide, calcium edetate, carbonate, chloride, citrate, dihydrochloride, diphosphate, edetate, estolate (ethylsuccinate), formate, fumarate. gluceptate, gluconate, glutamate, glycolate, glycol IyI arsani late, hexylresorcinate. hydrabamine, hydrobromide, hydrochloride, hydroiodide, hydroxymaieate, hydroxynaphthoate, iodide, isethionate, lactate, lactobionate, malate, maleate, mandelate, methylbromide, methylnitrate, methylsulfate, mucate, napsylate. nitrate, pamoate, pantothenate, phenylacetate, phosphate, polygalacturonate, propionate, salicylate, stearate. subacetate, succinate, sulfamate, sulfanllate, sulfate, sulfonates including besylate (benzenesulfonate), camsylate (camphorsulfonate), edisylate (ethane- 1,2-disulfonate), esylate (ethanesulfonate) 2-hydroxyethylsulfonate, mesylate (methanesulfonate), triflate (trifluoromethanesulfonate) and tosylate (p-toluenesulfonate), tannate, tartrate, teoclate and triethiodide. Similarly, pharmaceutically acceptable cations for use in salt fonnation include, but are not limited to ammonium, benzathine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine, procaine, and metals such as aluminum, calcium, lithium, magnesium, potassium, sodium and zinc. Those of ordinary skill in the art will recognize further pharmaceutically acceptable salts for the compounds provided herein. In general, a pharmaceutically acceptable acid or base salt can be synthesized from a parent compound that contains a basic or acidic moiety by any conventional chemical method. Briefly, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, the use of nonaqueous media, such as ether, ethyl acetate, ethanol, methanol, isopropanol or acetonitrile, is preferred.

It will be apparent that each compound provided herein may, but need not, be formulated as a solvate (e.g., a hydrate) or non-covalent complex. Also provided herein are prodrugs of the compounds provided herein. A "prodrug" is a compound that may not fully satisfy the structural requirements of the compounds provided herein, but is modified in vivo, following administration to a patient, to produce a compound provided herein. For example, a prodrug may be an acylated derivative of a compound as provided herein. Prodrugs include compounds wherein hydroxy, amine or suifhydryl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxy, amino, or suifhydryl group, respectively. Examples of prodrugs include, but are not limited to, acetate, formate, phosphate and benzoate derivatives of alcohol and amine functional groups within the compounds provided herein. Prodrugs of the compounds provided herein may be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved in vivo to yield the parent compounds.

As used herein, the term "alkyl" refers to a straight or branched chain saturated aliphatic hydrocarbon. Alkyl groups include groups having from 1 to 8 carbon atoms (Ci-Cgalkyl), from 1 to 6 carbon atoms (C,-C₆alky!) and from 1 to 4 carbon atoms (Cj -C_halky!), such as methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, pentyl 2-pentyi, isopentyl, neopentyl, hexyϊ, 2-hexyI, 3-hexyl or 3-methylpentyl. "Co-C₄alkyl" refers to a single covalent bond (Co) or an alkylene group having 1. 2, 3 or 4 carbon atoms; "Co-Cβalkyl" refers to a single covalent bond or a C_rC₆aikylene group; "Qr C₂alkyl" refers to a single covalent bond or a methylene or ethylene group.

"Alkylene" refers to a divalent alkyl group, as defined above. C_rC₄alkylene is an alkylene group having 1, 2, 3 or 4 carbon atoms, "Alkenyl" refers to straight or branched chain aikene groups, which comprise at least one unsaturated carbon-carbon double bond. Alkεnyl groups include C₂-C₆aikenyl groups, which have from 2 to 6 carbon atoms, such as ethenyl, ally! or isopropenyl. "Alkynyl" refers to straight or branched chain alkyne groups, which have one or more unsaturated carbon-carbon bonds, at least one of which is a triple bond. Alkynyl groups include C₂-C₆aikynyl groups, which have from 2 to 6 carbon atoms.

A "cycloalkyl" is a saturated or partially saturated cyclic group in which all ring members are carbon, such as cyclopropyl, cycSobutyl, cyclopentyl, cyclohexyl and partially saturated variants thereof. Certain cycloalkyl groups are Cj-Cgcycloalkyl, in which the ring contains from 3 to 8 ring members, all of which are carbon. A "(C₃-Cgcycloaikyl)Co-C₄alkyl" is a C-rCgcycloaiky] group linked via a single covalent bond or a CpCialkylene group.

By "alkoxy," as used herein, is meant an alkyl group attached via an oxygen bridge. Alkoxy groups include CpCβalkoxy and CrC₄alkoxy groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively, Methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, ,vec-butoxy, lert-butoxy. n- pentoxy, 2-pentoxy, 3-pentoxy, isopentoxy, neopentoxy, hexoxy, 2-hexoxy, 3-hexoxy, and 3- methylpentoxy are representative alkoxy groups.

Similarly, "alkylthio" refers to an alkyl group as attached via a sulfur bridge (i.e., -S-alkyl). Alkylthio groups include Ci-C₆a1kylthio and C₃-Cjaikylthio groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively.

The term "oxo," as used herein refers to an oxygen substituent of a carbon atom that results in the formation of a carbonyl group (C=O). An oxo group that is a substituent of a nonaromatic carbon atom results in a conversion Of -CH₂- to -C(=O)— . An oxo group that is a substituent of an aromatic carbon atom results in a conversion of -CH- to — C(=O)- and may result in a loss of aromaticity.

"Alkylsulfinyl" refers to groups of the formula -(SO)-a]kyi, in which the sulfur atom is the point of attachment. Alkylsulfinyl groups include CpCealkyisulfmyl and CpC₄alkyisuifinyl groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively.

"AlkyJsulfonyl" refers to groups of the formula -(SO₂)-alkyl, in which the sulfur atom is the point of attachment. Alkylsulfonyl groups include CpC₆alkylsulfonyl and CpGjalkylsulfonyl groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively.

The term "alkanoyl" refers to an acyl group (e.g., -(C=O)-alkyl), where attachment is through the carbon of the keto group. Alkanoyl groups include Cj-Cgalkanoyl, Cj-Csalkanoyl and C_%-

C₄alkanoyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively. "Cialkanoyl" refers to -(C=O)H, which (along with C₂-C₃alkanoyl) is encompassed by the term "CpCgalkanoyl."

Ethanoyl is C₂alkanoyl.

Similarly, "alkyl ether" refers to a linear or branched ether substituent. Alkyl ether groups include C₂-Csalkyl ether, C₂-C₆alkyl ether and C^^alkyl ether groups, which have 2 to 8, 6 or 4 carbon atoms, respectively. A C₂ alkyl ether is -CH₂-O-CH₃. The term "alkoxycarbonyl" refers to an alkoxy group linked via a carbonyl (i.e., a group having the general structure -C(=O)-O-a!kyi). Alkoxycarbonyl groups include CpC₈, CpCg and Cp C₄alkoxycarbonyl groups, which have from 1 to 8, 6 or 4 carbon atoms, respectively, in the alkyl portion of the group. "Cj alkoxycarbonyl" refers to -Cf=O)-O-CH₃.

"Alkylamino" refers to a secondary or tertiary amine that has the general structure -NH-alkyi or — N(alkyl) (alkyl), wherein each alkyl is selected independently from alkyl, cycloalkyl and

(cycloafkyl)alkyl groups. Such groups include, for example, mono- and di-(CpC_salkyl)amino groups. in which each C]-C₃alkyl may be the same or different, as well as mono- and di-Cd-Cealky^amino groups and mono- and di-(Cj-C₄alkyl)amino groups.

"Alkylaminoalkyl" refers to an alkylamino group linked via an alkylene group {i.e., a group having the general structure -alkylene~NH-alky! or -~aIkylene-N(alkyI)(aikyl)) in which each alkyi is selected independently from alkyi. cycloalkyl and (eye loalkyl) alky 1 groups. Alkylaminoalkyl groups include, for example, mono- and di-(C]-C₈aIky])amiπoC]-Q,aikyi, mono- and di-(C_r C₆alky])aminoCj-C₆alky] and mono- and di-(C]-C(,alkyi)aminoCj-C.)alkyl. "Mono- or di-(C_r C(iaikyl)aminoC₀-C₄alkyI" refers to a mono- or di-(Ci-C₆alkyl)amino group linked via a single covalent bond or a C_rC₄aIkylene group. The following are representative alkylaminoalkyl groups:

It will be apparent that the definition of "alkyi" as used in the terms "alkylamino" and "alkylaminoalkyl" differs from the definition of "alkyi" used for all other alkyi-containing groups, in the inclusion of cycloalkyl and (cycloalkyl)alkyl groups (e.g., (C₃-C₇cycloalkyl)Co-C₆alkyl).

The term "aminocarbonyl" refers to an amide group {i.e.,

"Mono- or di-(C_r Cήalkyl)aminocarbonylC₀-C₄alkyl" refers to an aminocarbonyl group in which one or both hydrogens are replaced with an independently selected C_rC₆afkyl group, and which is linked via a single covalent bond or a CrQalkylene group.

The term "aminosulfonyl" refers to a sulfonamide group (i.e., -SO₂NH₂). "Mono- or di-{C_r C₆alkyl)aminosulfonyIC₀-C₄alkyr' refers to an aminosulfonyl group in which one or both hydrogens are replaced with an independently selected C]-C₆alkyl group, and which is linked via a single covalent bond or a Cj-C₄alkylene group.

The term "halogen" refers to fluorine, chlorine, bromine or iodine.

A "haloalkyl" is an alkyi group that is substituted with 1 or more independently chosen halogens (e.g., "Cj-Cghaloalkyi" groups have from 1 to 8 carbon atoms; "Cj-Cghaloalkyl¹¹ groups have from 1 to 6 carbon atoms). Examples of haloalkyl groups include, but are not limited to, mono-, di- or tiϊ-fluoromethyl; mono-, di- or tri-chloromethyl; mono-, di-, tri-, tetra- or penta-fluoroethyl; mono-, di-, tri-. tetra- or penta-chloroethyi; and 1,2.2,2-tetrafluoro-l-trifluoromethyl-ethyi. Typical haloalkyl groups are trifluoromethyl and difluoromethyl.

A dash ("-") that is not between two letters or numbers is used to indicate a point of attachment for a substituent. For example, -C(=O)NH₂ is attached through the carbon atom.

A "carbocycle" has from 1 to 3 fused, pendant or spiro rings, each of which has only carbon ring members and each of which may, but need not, be bridged by an alkylene moiety. Typically, a carbocycle that has a single ring contains from 3 to 8 ring members (i.e., C₃-C₃carbocycles); rings having from 4 or 5 to 7 ring members (i.e., C^-Cvcarbocycles or C₅-C₇carbocycles) are recited in certain embodiments. Carbocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members. Carbocycles may be optionally substituted with a variety of substiluenls, as indicated. Unless otherwise specified, a carbocycle may be a cycloalkyl group (i.e., each ring is saturated or partially saturated as described above) or an aryl group (i.e., at least one ring within the group is aromatic). Representative aromatic carbocycles are phenyl, naphthyl, tetrahydronaphthyl and biphenyl. In certain embodiments preferred carbocycles have a single ring, such as phenyl and C3- Cgcycioalky] groups.

Certain carbocycles recited herein are (C₃-C₈carbocycle)C₀-C₄alkyl groups (i.e., groups in which a 3- to 8-membered carbocyclic group (which may be cycloalkyl or aryl) is linked via a single covalent bond or a CrQalkylene group). Phenyl groups linked via a single covaient bond or Q- C₂alkylene group are designated phenyl C₀-C₂alkyl (e.g., benzyl, I-phenyl-ethyl, 1 -phenyl-propyl and 2-phenyl-ethyl). When substituted, it will be apparent that such groups may be substituted on the ring portion and/or on the alkylene portion of the group.

A "heterocycle" (also referred to herein as a "heterocyclic group") has from 1 to 3 fused, pendant or spiro rings, at least one of which is a heterocyclic ring (i.e., one or more ring atoms is a heteroatom independently chosen from oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon). Typically, a heterocyclic ring comprises I , 2, 3 or 4 heteroatoms; within certain embodiments each heterocyclic ring has 1 or 2 heteroatoms per ring. Each heterocyclic ring generally contains from 3 to 8 ring members (rings having from 4 or 5 to 7 ring members are recited in certain embodiments) and heterocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members. Certain heterocycles comprise a sulfur atom as a ring member; in certain embodiments, the sulfur atom is oxidized to SO or SO₂. Heterocycles may be optionally substituted with a variety of substituents, as indicated. Certain heterocycles are 4- to 10-membered and comprise one or two rings; in certain embodiments, such heterocycles are monocyclic (e.g., A- to 8-membered. 5- to 8-membered, 4- to 7-membered, or 5- or 6-membered). Certain heterocycles are heteroaryl groups (i.e., at least one heterocyclic ring within the group is aromatic), such as a 5- to 10-membered heteroaiyl (which may be monocyclic or bicyclic) or a 6- membered heteroaryl (e.g., pyridyl or pyrimidyl). Other heterocycles are heterocycloalkyl groups (i.e., do not comprise an aromatic heterocyclic ring). Certain heterocycles may be linked by a single covalent bond or via an alkylene group, as indicated, for example, by the terms "(4- to 8-membered heterocycloa!kyI)C₀-Cjalkyl."

A "substituent," as used herein, refers to a molecular moiety that is covalently bonded to an atom within a molecule of interest. For example, a "ring substituent" may be a moiety such as a halogen, alkyl group, haloalkyl group or other group discussed herein that is covalently bonded to an atom (such as a carbon or nitrogen atom) that is a ring member. The term "substitution" refers to replacing a hydrogen atom in a molecular structure with a substituent as described above, such that the valence on the designated atom is not exceeded, and such that a chemically stable compound (i.e., a compound that can be isolated, characterized, and tested for biological activity) results from the substitution.

Groups that are "optionally substituted" are unsubstituled or are substituted by other than hydrogen at one or more available positions, typically 1 , 2, 3, 4 or 5 positions, by one or more suitable groups (which may be the same or different). Optional substitution is also indicated by the phrase "substituted with from 0 to X substituents," where X is the maximum number of possible substituents. Certain optionally substituted groups are substituted with from 0 to 2, 3 or 4 independently selected substituents (i.e., are unsubstituted or substituted with up to the recited maximum number of substituents). "B]," as used herein, refers to the human B_} bradykinin receptor reported by Menke et al.

(1994) J. Biol Chem. 259:21583-21586, as well as allelic variants thereof and homologues thereof found in other species (e.g., GenBank Accession Number AAXI4712 (Macaca fascicularis)).

The term "B] agonist" refers to a compound that binds Bi and induces signal transduction mediated by B₁. B, agonists include, for example, bradykinin and kallidin (lysyl-bradykinin), as well as peptide portions or variants of bradykinin or kallidin that bind Bi and retain activity. Representative B] agonists include, but are not limited to, desArg⁹bradykinin and desArg'°kallidin.

A "Bi antagonist" is a compound that detectably inhibits signal transduction mediated by Bj. Such inhibition may be determined using the representative calcium mobilization assay provided in Example 7. Preferred B, antagonists have an IC₅₀ of 5 μM or less in this assay, more preferably 2 μM or less, and still more preferably 1 μM or less, 500 nM or less. 100 nM or less or 10 nM or less. In certain embodiments, the Bj antagonist is specific for Bi (i.e., the IC₅₀ value in a similar assay performed using the B₂ receptor is greater than 2 μM and/or the IC_5O ratio (B₂/B₁) is at least 10, preferably 100, and more preferably at least 1000). Bi antagonists preferably have minimal agonist activity (i.e., induce an increase in the basal activity Of B₁ that is less than 5% of the increase that would be induced by one EC₅₀ of the peptide agonist desArg^iOkallidin, and more preferably have no detectable agonist activity within the assay described in Example 7). Bj antagonists for use as described herein are generally non-toxic. B] antagonists include neutral antagonists and inverse agonists.

A "neutral antagonist" of B₁ is a compound that inhibits the activity of B_s agonist (e.g., desArg^!Okallidin) at B₁, but does not significantly change the basal activity of the receptor (i e., within a calcium mobilization assay as described in Example 7 performed in the absence of agonist, B, activity is reduced by no more than 10%, more preferably by no more than 5%, and even more preferably by no more than 2%; most preferably, there is no detectable reduction in activity). Neutral antagonists may. but need not, also inhibit the binding of agonist to Bj. An "inverse agonist" of Bj is a compound that reduces the activity of Bi below its basal activity level in the absence of activating concentrations of agonist. Inverse agonists may also inhibit the activity of agonist at Bj, and/or may inhibit binding of Bt agonist to Bi. The reduction in basal activity of B; produced by an inverse agonist may be determined from a calcium mobilization assay, such as the assay of Example 7.

A "therapeutically effective amount" (or dose) is an amount that, upon administration to a patient, results in a discernible patient benefit (e.g., provides detectable relief from a condition being treated). Such relief may be detected using any appropriate criteria. A therapeutically effective amount or dose generally results in a concentration of compound in a body fluid (such as blood, plasma, serum, CSF, synovial fluid, lymph, cellular interstitial fluid, tears or urine) that is sufficient to result in detectable alteration in B^mediated signal transduction (using an assay provided herein). The discernible patient benefit may be apparent after administration of a single dose, or may become apparent following repeated admin istrati on of the therapeutically effective dose according to a predetermined regimen, depending upon the indication for which the compound is administered. For the treatment of pain, a discernible patient benefit is generally apparent after administration of a single therapeutically effective dose, although further benefit may become apparent following repeated administrations. A "patient" is any individual treated with a spirocyclic sulfonamide or related compound as provided herein. Patients include humans, as well as other animals such as companion animals (e.g., dogs and cats) and livestock. Patients may be experiencing one or more symptoms of a condition responsive to B₁ modulation or may be free of such symptom(s) (i.e., treatment may be prophylactic in a patient considered to be at risk for the development of such symptoms). SPIROCYCLIC SULFONAMIDES AND RELATED COMPOUNDS

As noted above, the present invention provides spirocyclic sulfonamides and related compounds of Formula 1 that may be used in a variety of contexts, including in the treatment of conditions responsive to B] modulation, as described herein.

Foπnula I

Such compounds may also be used within in vitro assays (e.g., assays for Bi activity), as probes for detection and localization of B] and within assays to identify other B₁ antagonists.

Ar, within Formula I and other Formulas provided herein, generally represents an optionally substituted phenyl or 5- or 6-menibered heteroaryl. As noted above, such optional substituents may be taken together to form an optionally substituted fused ring (e.g., Ar groups include optionally substituted naphthyl, quinolinyl, and the like). Within certain spirocyclic sulfonamides and related compounds provided herein, Ar is phenyl, naphthyl, or a pyridyl or pyrimidinyl, each of which is substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, Ci-C₆alkyl, C,-C₆haloalkyl, CVCsalkoxy, and mono- or di-{Ci-C₆alkyl)aminoCo-C₄aIkyl. Within other spirocyclic sulfonamides and related compounds, Ar is phenyl that is substituted with from 0 to 4 subslituents independently chosen from R_a. Within further embodiments of the Formulas provided herein, Ar is phenyl that is substituted with 1, 2 or 3 substituents independently chosen from haϊogen, hydroxy, cyano, amino, nitro,

Ci-Qhaloaϊkyl, Ci-Cgaikoxy. Ci-Qhaloalkoxy, and mono- or di-(Ci-C₆alkyl)aininoCo-C₄alkyl.

The variable "R_a" generally represents optional substituents of Ar. Within certain compounds, each substituent represented by R_a is independently chosen from halogen, hydroxy, Q- C₆alkyl, C_rC₆alkoxy, Cs-Cghaloalkyl and Ci-Cghaloalkoxy. Within further compounds, Ar is:

, in which Rj₃, R_ib and R,_c each represent hydrogen or one substituent independently chosen from R_a. Within certain embodiments, R;_a is halogen, hydroxy, Cj-Cgalkyl, Ci-Qalkoxy, C₁- Qhaloalkyl or CpQhaloalkoxy and R|_b and R_]c are each hydrogen, halogen or methyl.

The variable "A," as noted above is N, CH or C. It will be apparent that if A is N or CH, then the bond designated == represents a single bond. Within certain such compounds, R₂ and R₃ are taken together to form an optionally substituted saturated or partially saturated ring. If A is C, then the bond designated ^^ represents a double bond. Within certain compounds in which A is C, R₂ and R₃ are taken together to fonn an optionally substituted aromatic ring.

Within certain spirocyclic sulfonamides and related compounds provided herein, R₂ and R₃ are independently chosen from hydrogen and Ci-Cealkyi. Other spirocyclic sulfonamides and related compounds provided herein satisfy Formula II:

Formula II

wherein:

X is CH₂, NR₇, O, S, SO or SO₂; m and q are independently 0, 1 or 2, such that the sum of m and q is 1, 2 or 3; R_<j represents from 0 to 4 substituents independently chosen from oxo, hydroxy and Cj-Qaikyl; and R₇ is hydrogen or C| -C_halky!. Certain such compounds further satisfy Formula Ha or Formula lib:

Formula Ha Formula lib

Re, within certain compounds of Formulas II, Ua and Hb, represents from 0 to 4 substituents independently chosen from Ci-C₂alkyl. Certain R₆ groups represent gem-dimethyl (e.g., the group designated:

Within certain embodiments of Formula I, and other formulas provided herein, m is 0 and q is 0 or 1. In such embodiments, the group designated:

Within other embodiments, the sum of m and q is 2 or 3. In such embodiments, the group designated:

. Such groups include, for

example,

_?

The variable "Y," as noted above is a group of the formula (CH₂)_r-Z-(CH₂)_p. H will be apparent that if Z is absent and r and p are both zero, then Y is absent and the compound satisfies Formula III: Formula III

Within other compounds provided herein. Y is -CH₂-O-CH₂- -0-CH₂-CH₂-, -CH₂-CH₂-O- CH₂- -CH₂-NH-CH₂- -CH₂=CH₂-, or -(CH₂)_W, wherein w is 0. 1 , 2, 3, or 4. In certain such compounds, w is 1, 2 or 3 (i.e., Y is -CH₂-, -CH₂-CH₂-, Or -CH₂-CH₂-CH₂-).

Within certain spirocyciic sulfonamides and related compounds provided herein, the group designated:

, each of which is optionally substituted with oxo or Ci-C^alkyl (e.g., methyl). In certain such compounds, B is nitrogen; in other such compounds B is CH. In certain compounds, D is O, N(R₄₃) or CH(R_4I,); wherein R₄₃ is hydrogen, C_rC_όalkyi, C_rC₆cyanoalkyI, Q-Qalkanoyl, (C₃-C₇cycioalky])Co-C₂aikyl, phenylC₀-C₂alkyϊ or (5- to 7-membered heterocycle)C₀-C₂aikyl; and R_4V, is hydrogen, haiogen, C₁- C₆alkyi, C]-C₆aikoxycarbonyl, mono- or di-(Ci-C₄aikyl)aminoC₀-C₂alkyl, mono- or Oi-(C, - C₄alkyl)aminocarbonylCo-C₂alkyl₅ (C₃-CvCycioa[kyi)Co-C₂alkyl or phenylC₀-C₂alkyl.

Representative spirocyciic sulfonamides and related compounds of Formula 1 further satisfy one or more of Formulas IV-XV:

Formula VI Formula VII

Formula VIlI Formula IX

Formula X Formula XI

Foπnula XII Formula XIII

Formula XIV Formula XV wherein:

Ri represents from 0 to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarboπyl. aminosulfonyl and -COOH: and

(ii) C|-C₆alkyl, C₂-C₆alkenyl. C₂-C₆alkynyl, C_rC₆haloalkyl, C₂-C₆alkyl ether, (C₃-

C_gcycloa]kyl)Co-C₄alkyl, C_rC₆aIkoxy, C]-C₆alkylthio, Cϊ-C₆alkylsulfinyl, C,-

C₆alkoxycarbonyl, Ci-C₆alkyisulfonylCo-C₄alkyl, mono- or di-(Ci-C(jalkyl)aminoCo-C₄aikyl. mono- or di-(Ci-C₆aIkyl)aminosulfoπylCo-C₄alkyl, and (4- to 8-membered heterocy c loalky I)C₀-Q alkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; X is CH₂, NH, O, S, SO or SO₂; w is 0, 1, 2, 3 or 4; in certain embodiments, w is 1 , 2 or 3; R₂ and R₃, where indicated, are independently chosen from hydrogen and C,-C₆alkyl:

R₆ and R₈ represent from 0 to 4 substituents independently chosen from oxo, hydroxy and C_rC₈aikyl; or two substituents represented by R₈ are taken together to form a fused 5- or 6-membered carbocycle or heterocycle; in certain embodiments, R₆ represents from 0 to 4 substituents independently chosen from oxo, hydroxy and C]-C₃alkyl; and the remaining variables are as described above.

Other representative spirocyclic sulfonamides and related compounds of Formula I further satisfy one or more of Formulas XVl-XXI:

Formula XVI Formula XVII

Formula XVlII Formula XIX

Formula XX Formula XXI wherein:

R] represents from 0 to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; and (ii) CrQalkyl, C₂-C₆alkenyl, C₂-C₆alkyπyl. C_rC₆haloalkyl, C₂-C₆alkyl ether. (C₃-

C₈cycloalkyl)C₀-C₄alkyi, C₅-C₆aikoxy, C|-C₆alkylthio, C,-C₆alkylsulfmyi. C,-

Qalkoxycarbonyl, CrQalkylsulfonylCo^alkyl, mono- or di-(C_rC₆alkyl)aminoCo-C₄alkyJ, mono- or di-(Ci-C₆alkyI)aminosulfonylC₀-C₄alkyl, and (4- to 8-membered h eterocyc loalky I)Co-C₄ alky 1; each of which is substituted with from 0 to 4 sυbstituents independently chosen from oxo, halogen, hydroxy, cyano and amino; X is O or S;

Each s is independently 0 or I ;

R₂ and R₃ are independently chosen from hydrogen and C_rC₆alkyl; R₄₁ is CrQalky] or (C,-C₇cycloaIkyl)C₀-C₂aIkyI; and

R₆ represents from 0 to 2 substituents independently chosen from Cj-Cgalkyl.

Representative spirocyclic sulfonamides and related compounds provided herein include, but are not limited to, those specifically described in the Examples below. It will be apparent that the specific compounds recited herein are representative only, and are not intended to limit the scope of the present invention. Further, as noted above, all compounds of the present invention may be present as a free acid or base or as a pharmaceutically acceptable salt, hydrate or ester.

As noted above, within certain aspects, compounds provided herein are Bi modulators, In addition, certain compounds provided herein are specific for B;. B| modulator activity may be confirmed using a calcium mobilization assay, such as the assay described in Example 7, herein. If desired, binding activity of the compounds provided herein to Bi may be confirmed using the representative assay described in Example 6, herein, or using an assay described by Fox et al. (2005) Br. J. Pharmacol. J 44:889-99. Preferred Bj modulators exhibit a K₁ within such an assay of 5 micromolar or less, more preferably 2 micromolar or less, 1 micromolar or less, 500 nanomolar or less, 100 nanomolar or less or 10 nanomolar or less. In vivo activity of Bi modulators provided herein may be confirmed using any of a variety of animal models including, but not limited to, those described in the following documents (each of which is hereby incorporated by reference for its disclosure of the recited animal model): Wood et al. (2003) J. Med. Chem. 4(5: 1803-06 - carrageenan-induced mechanical pressure hyperalgesia; Conley et al. (2005) Eur. J. Pharmacol. 527:44-51 - thermal antinociception and carrageenan-induced mechanical pressure hypersensitivity;

Gougat et al. (2004) J. Pharmacol. Exper. Therap. 309:661-669 - UV irradiation-induced thermal hyperalgesia and chronic constriction of the sciatic nerve-induced neuropathy and in ischemia- induced injury; Fox et ai. (2005) Br. J. Pharmacol. 144:889-99 - complete Freund's adjuvant- induced mechanical pressure hypersensitivity; Gabra et al. (2005) J. Neuropathol. Exp Neurol 64:782-89 - diabetes-induced peripheral neuropathic pain; Pesquero et al. (2000) Proc. Natl. Acad. ScL USA 57:8140-45 - carrageenan- induced pleurisy

(inflammation around the lung); Lawson et al. (2005) Eur. J. Pharmacol. 574:69-78 - diabetes-induced vascular disease; Hirata et a (2003) Eur. J. Pharmacol. 474:255-60 - ACE inhibitor-induced cough; Mazzuferi et al. (2005) Neuroscience . 735:979-86 - neuronal hyperexcitability in epilepsy.

If desired, compounds provided herein may be evaluated for certain pharmacological properties including, but not limited to, oral bioavailability (preferred compounds are orally bioavaiiable to an extent allowing for therapeutically effective doses of less than 140 mg/kg, preferably less than 50 mg/kg, more preferably less than 30 mg/kg, even more preferably less than 10 mg/kg, still more preferably less than 1 mg/kg and most preferably less than 0.1 mg/kg), toxicity (a preferred compound is nontoxic when a therapeutically effective amount is administered to a subject), side effects (a preferred compound produces side effects comparable to placebo when a therapeutically effective amount of the compound is administered to a subject), serum protein binding and in vitro and in vivo half-life (a preferred compound exhibits an in vivo half-life allowing for

Q.I.D. dosing, preferably T.I. D. dosing, more preferably B. I. D. dosing, and most preferably once-a- day dosing). In addition, differential penetration of the blood brain barrier may be desirable. Routine assays that are well known in the art may be used to assess these properties, and identify superior compounds for a particular use. For example, assays used to predict bioavailability include transport across human intestinal cell monolayers, including Caco-2 cell monolayers. Penetration of the blood brain barrier of a compound in humans may be predicted from the brain levels of the compound in laboratory animals given the compound {e.g., intravenously). Serum protein binding may be predicted from albumin binding assays. Compound half-life is inversely proportional to the frequency of dosage of a compound. In vitro half-lives of compounds may be predicted from assays of microsomal half-life as described herein.

As noted above, preferred compounds provided herein are nontoxic. In general, the term

"nontoxic" as used herein shall be understood in a relative sense and is intended to refer to any substance that has been approved by the United States Food and Drug Administration ("FDA") for administration to mammals (preferably humans) or, in keeping with established criteria, is susceptible to approval by the FDA. for administration to mammals (preferably humans). In addition, a highly preferred nontoxic compound generally satisfies one or more of the following criteria: (1) does not substantially inhibit cellular ATP production; (2) does not significantly prolong heart QT intervals; (3) does not cause substantial liver enlargement or (4) does not cause substantial release of liver enzymes.

As used herein, a compound that does not substantially inhibit cellular ATP production is a compound that satisfies the criteria set forth in Example 8, herein. In other words, cells treated as described in Example 8 with 100 μM of such a compound exhibit ATP levels that are at least 50% of the ATP levels detected in untreated cells. In more highly preferred embodiments, such cells exhibit ATP levels that are at least 80% of the ATP levels detected in untreated cells.

A compound that does not significantly prolong heart QT intervals is a compound that does not result in a statistically significant prolongation of heart QT intervals (as determined by electrocardiography) in guinea pigs, minipigs or dogs upon administration of a dose that yields a serum concentration equal to the EC₅₀ or IC₅₀ for the compound. In certain preferred embodiments, a dose of 0.01, 0.05, 0.1 , 0.5. 1, 5, 10, 40 or 50 mg/kg administered parenterally or orally does not result in a statistically significant prolongation of heart QT intervals. By "statistically significant" is meant results varying from control at the p<0.1 level or more preferably at the p<0.05 level of significance as measured using a standard parametric assay of statistical significance such as a student's T test.

A compound does not cause substantial liver enlargement if daily treatment of laboratory rodents (e.g., mice or rats) for 5-10 days with a dose that yields a serum concentration equal to the

EC₅₀ or IC₅₀ for the compound results in an increase in liver to body weight ratio that is no more than 100% over matched controls. In more highly preferred embodiments, such doses do not cause liver enlargement of more than 75% or 50% over matched controls. If non-rodent mammals (e.g., dogs) are used, such doses should not result in an increase of liver to body weight ratio of more than 50%, preferably not more than 25%, and more preferably not more than 10% over matched untreated controls. Preferred doses within such assays include 0.01, 0.05. 0.1, 0.5, 1, 5, 10, 40 or 50 mg/kg administered parenterally or orally.

Similarly, a compound does not promote substantial release of liver enzymes if administration of twice the minimum dose that yields a serum concentration equal to the EC₅₀ or IC₅₀ for the compound does not elevate serum levels of ALT, LDH or AST in laboratory rodents by more than 100% over matched mock-treated controls. In more highly preferred embodiments, such doses do not elevate such serum levels by more than 75% or 50% over matched controls. Alternatively, a compound does not promote substantial release of liver enzymes if, in an in vitro hepatocyte assay, concentrations (in culture media or other such solutions that are contacted and incubated with hepatocytes in vitro) that are equal to the EC₅₀ or IC₅₀ for the compound do not cause detectable release of any of such liver enzymes into culture medium above baseline levels seen in media from matched mock-treated control cells. In more highly preferred embodiments, there is no detectable release of any of such liver enzymes into culture medium above baseline levels when such compound concentrations are five-fold, and preferably ten-fold the EC₅₀ or IC₅₀ for the compound.

In other embodiments, certain preferred compounds do not inhibit or induce microsomal cytochrome P450 enzyme activities, such as CYP I A2 activity, CYP2A6 activity, CYP2C9 activity, CYP2C19 activity, CYP2D6 activity, CYP2E1 activity or CYP3A4 activity at a concentration equal to the EC_JO or IC₅₀ for the compound. Certain preferred compounds are not clastogenic (e.g., as determined using a mouse erythrocyte precursor ceil micronucJeus assay, an Ames micronucleus assay, a spiral micronucleus assay or the like) at a concentration equal the EC₅₀ or IC₅₀ for the compound. In other embodiments, certain preferred compounds do not induce sister chromatid exchange (e.g., in Chinese hamster ovary cells) at such concentrations.

For detection purposes, as discussed in more detail below, compounds provided herein may be isotopically-labeled or radiolabeled. For example, such compounds may have one or more atoms replaced by an atom of the same element having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be present in the compounds provided herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as ²H, ³H, ¹¹C₅ ¹³C, ^!4C, '⁵N, ⁱ⁸O, ¹⁷O, ³¹P, ³²P, ³⁵S, ¹⁸F and ³⁶Cl. In addition, substitution with heavy isotopes such as deuterium (i.e., ²H) can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances. PREPARATION OF B_J MODULATORS

Compounds provided herein may generally be prepared using standard synthetic methods. In general, starting materials are commercially available from suppliers such as Sigma-Aldrich Corp. (St. Louis, MO), or may be synthesized from commercially available precursors using established protocols. By way of example, a synthetic route similar to that shown in any of the following Schemes may be used, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon appreciated by those skilled in the art. Certain spirocyclic intermediates for use in the synthetic methods described herein are prepared as described in US provisional application Serial Number 60/746,680, at pages 24-26, which is hereby incorporated by reference for its teaching of the synthesis of such intermediates. It will be apparent that the reagents and synthetic transformations in the following Schemes and in the art can be readily modified to produce additional compounds of Formula T. Each variable in the following Schemes refers to any group consistent with the description of the compounds provided herein.

When a protecting group is required, an optional deprotection step may be employed. Suitable protecting groups and methodology for protection and deprotection, such as those described in Protecting Groups in Organic Synthesis by T. Greene, are well known. Compounds and intermediates requiring protection/deprotection will be readily apparent.

Certain definitions used in the following Schemes and in the Examples include: AIBN 2,2'-Azobis(2-methy[propionitrile)

BOC t-butoxycarbonyl BOP benzotriazol-l-yl-oxy-tris(dimethylamino)phosphonium hexafiuorophosphate

DIBAL diisobutylaluminium hydride DMA N.iV-dimethylacelamide

DMAP N,N-dimethy]-4-aminopyridine

DCM dichloromethane

DMF dimethyl formamide

DMSO dimethyl sulfoxide

Eq. equivalent(s)

Et ethyl

EtOH ethanol

EtOAc ethyl acetate h hoυr(s)

¹H NMR proton nuclear magnetic resonance

IPr isopropyl

LAH lithium aluminum hydride

LC-MS liquid chromatography/mass spectrometry

LDA lithium diisopropyl amide mCPBA m-chloroperoxybenzoic acid

Me methyl

MeOH methanol

MHz megahertz

M+l mass + 1 rain minute(s)

MS mass spectrometry n-BuLi n-butyl lithium

NMO Ν-methylmorpholine Ν-oxide δ chemical shift it room temperature

R_τ retention time (mass spectroscopy)

Ph phenyl

SCX strong cation exchange

TBAF tetrabutyl ammonium fluoride

TBS terf-butyldimethylsilyl tBuOK potassium /erf-butoxide

TEA triethylamine

TFA trifluoroacetic acid

THF tetrahydrofuran

TPAP tetra-n-propylammonium perruthenate Scheme 1

Scheme 2

R₁ R_{5 R};

Scheme 4

/Pr₂NEt₁CH₂CI₂ -78⁰C

Scheme 5

ScI- ieme 6

Ar Ar O=S=O O=S=O Cl NaOH

R₃ 0 TEA EtOH

R₃ 0

Scheme 7

In certain embodiments, a compound provided herein may contain one or more asymmetric carbon atoms, so that the compound can exist in different stereoisomer forms. Such forms can be, for example, racemates or optically active forms. As noted above, all stereoisomers are encompassed by the present invention. Nonetheless, it may be desirable to obtain single enantiomers (i.e., optically active forms). Standard methods for preparing single enantiomers include asymmetric synthesis and resolution of the racemates. Resolution of the racemates can be accomplished, for example, by conventional methods such as crystallization in the presence of a resolving agent, or chromatography using, for example a chiral HPLC column.

Compounds may be radiolabeled by carrying out their synthesis using precursors comprising at least one atom that is a radioisotope. Each radioisotope is preferably carbon (e.g., ^!4C), hydrogen

(e.g., Η), sulfur (e.g., ^J S) or iodine (e.g., I). Tritium labeled compounds may also be prepared catalytically via platinum-catalyzed exchange in tritiated acetic acid, acid-catalyzed exchange in tritiated trifluoroacetic acid, or heterogeneous-catalyzed exchange with tritium gas using the compound as substrate. In addition, certain precursors may be subjected to tritium-halogen exchange with tritium gas, tritium gas reduction of unsaturated bonds, or reduction using sodium borotritide, as appropriate. Preparation of radiolabeled compounds may be conveniently performed by a radioisotope supplier specializing in custom synthesis of radiolabeled probe compounds. PHARMACEUTICAL COMPOSITIONS

The present invention also provides pharmaceutical compositions comprising one or more spirocyclic sulfonamides or related compounds provided herein, together with at least one physiologically acceptable carrier or excipient. Pharmaceutical compositions may comprise, for example, one or more of water, buffers {e.g., neutral buffered saline or phosphate buffered saline), ethanol, mineral oil, vegetable oil, dimethylsulfoxide, carbohydrates (e.g., glucose, mannose, sucrose, starch, mannitol or dextrans), proteins, adjuvants, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione and/or preservatives. In addition, other active ingredients may (but need not) be included in the pharmaceutical compositions provided herein.

Pharmaceutical compositions may be formulated for any appropriate manner of administration, including, for example, topical, oral, nasal, rectal or parenteral administration. The term parenteral as used herein includes subcutaneous, intradermal, intravascular (e.g., intravenous), intramuscular, spinal, intracranial, intrathecal and intraperitoneal injection, as well as any similar injection or infusion technique. In certain embodiments, compositions suitable for oral use are preferred. Such compositions include, for example, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Within yet other embodiments, phaπnaceutical compositions may be formulated as a lyophiiizate.

Compositions intended for oral use may further comprise one or more components such as sweetening agents, flavoring agents, coloring agents and/or preserving agents in order to provide appealing and palatable preparations. Tablets contain the active ingredient in admixture with physiologically acceptable excipients that are suitable for the manufacture of tablets. Such excipients include, for example, inert diluents (e.g., calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate), granulating and disintegrating agents (e.g., corn starch or aigiπic acid), binding agents (e.g., starch, gelatin or acacia) and lubricating agents (e.g., magnesium stearate, stearic acid or talc). Tablets may be formed using standard techniques, including dry granulation, direct compression and wet granulation. The tablets may be uncoated or they may be coated by known techniques.

Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g., calcium carbonate, calcium phosphate or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil).

Aqueous suspensions contain the active material(s) in admixture with suitable excipients, such as suspending agents (e.g., sodium carboxymethylcellulose, methylcellulose, hydropropylmethylcelliilose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia); and dispersing or wetting agents (e.g., naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with fatty acids such as polyoxyethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as hepladecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as poiyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyethylene sorbitan monooleate). Aqueous suspensions may also comprise one or more preservatives, such as ethyl or n-propyl p- hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and/or one or more sweetening agents, such as sucrose or saccharin.

Oily suspensions may be formulated by suspending the active ingredient(s) in a vegetable oil (e.g., arachis oil, olive oil, sesame oil or coconut oil) or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and/or flavoring agents may be added to provide palatable oral preparations. Such suspensions may be preserved by the addition of an anti-oxidant such as ascorbic acid.

Dispersibie powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, such as sweetening, flavoring and coloring agents, may also be present.

Pharmaceutical compositions may also be formulated as oil-in-water emulsions. The oily phase may be a vegetable oil (e.g., olive oil or arachis oil), a mineral oil (e.g., liquid paraffin) or a mixture thereof. Suitable emulsifying agents include naturaily-occurring gums (e.g., gum acacia or gum tragacanth), naturally-occurring phosphatides (e.g., soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol), anhydrides (e.g., sorbitan monoleate) and condensation products of partial esters derived from fatty acids and hexitol with ethylene oxide (e.g., poiyoxyethylene sorbitan monoleate). An emulsion may also comprise one or more sweetening and/or flavoring agents.

Syrups and elixirs may be formulated with sweetening agents, such as glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also comprise one or more demulcents, preservatives, flavoring agents and/or coloring agents. Formulations for topical administration typically comprise a topical vehicle combined with active agent(s), with or without additional optional components. Suitable topical vehicles and additional components are well known in the art, and it will be apparent that the choice of a vehicle will depend on the particular physical form and mode of delivery. Topical vehicles include water; organic solvents such as alcohols (e.g., ethanol or isopropyl alcohol) or glycerin; glycols (e.g., butylene, isoprene or propylene glycol); aliphatic alcohols (e.g., lanolin); mixtures of water and organic solvents and mixtures of organic solvents such as alcohol and glycerin; lipid-based materials such as fatty acids, acylglycerols (including oils, such as mineral oil, and fats of natural or synthetic origin), phosphoglycerides, sphingolipids and waxes; protein-based materials such as collagen and gelatin: silicone-based materials (both non-volatile and volatile); and hydrocarbon-based materials such as microsponges and polymer matrices. A composition may further include one or more components adapted to improve the stability or effectiveness of the applied formulation, such as stabilizing agents, suspending agents, emulsifying agents, viscosity adjusters, gelling agents, preservatives, antioxidants, skin penetration enhancers, moisturizers and sustained release materials. Examples of such components are described in Martindale— The Extra Pharmacopoeia (Pharmaceutical Press, London 1993) and Remington; The Science and Practice of Pharmacy, 21 ^st ed., Lippincott Williams & Wilkins, Philadelphia, PA (2005). Formulations may comprise microcapsules, such as hydroxymethylcellulose or gelatin-microcapsuies, liposomes, albumin microspheres, microemulsions, nanoparticles or nanocapsuies.

A topical formulation may be prepared in any of a variety of physical forms including, for example, solids, pastes, creams, foams, lotions, gels, powders, aqueous liquids and emulsions. The physical appearance and viscosity of such pharmaceutically acceptable forms can be governed by the presence and amount of emulsifier(s) and viscosity adjusters) present in the formulation. Solids are generally firm and non-pourable and commonly are formulated as bars or sticks, or in particulate form; solids can be opaque or transparent, and optionally can contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Creams and lotions are often similar to one another, differing mainly in their viscosity; both lotions and creams may be opaque, translucent or clear and often contain emulsifiers, solvents, and viscosity adjusting agents, as well as moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Gels can be prepared with a range of viscosities, from thick or high viscosity to thin or low viscosity. These formulations, like those of lotions and creams, may also contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Liquids are thinner than creams, lotions, or gels and often do not contain emulsifiers. Liquid topical products often contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Suitable emulsifiers for use in topical formulations include, but are not limited to, ionic emuisifϊers, ceteary! alcohol, non-ionic emulsifiers like polyoxyethyiene oleyl ether, PEG-40 stearate, ceteareth-12, ceteareth-20, ceteareth-30, ceteareth alcohol, PEG-100 stearate and glyceryl stearate. Suitable viscosity adjusting agents include, but are not limited to, protective colloids or non-ionic gums such as hydroxyethylceilulose, xanthan gum, magnesium aluminum silicate, silica. microcrystalline wax, beeswax, paraffin, and cetyl palmitate. A gel composition may be formed by the addition of a gelling agent such as chitosan, methyl cellulose, ethyl cellulose, polyvinyl alcohol, polyquaterniums, hydroxyethylceilulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, carbomer or ammoniated glycyrrhizinate. Suitable surfactants include, but are not limited to, non ionic, amphoteric, ionic and anionic surfactants. For example, one or more of dimethicone copolyol, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, laυranτide DEA, cocamide

DEA, and cocamide MEA, oleyl betaine, cocamidopropy! phosphatidyl PG-dimonium chloride, and ammonium laureth sulfate may be used within topical formulations. Suitable preservatives include. but are not limited to, antimicrobials such as methylparaben, propylparaben, sorbic acid, benzoic acid, and formaldehyde, as well as physical stabilizers and antioxidants such as vitamin E, sodium ascorbate/as corbie acid and propyl gallate. Suitable moisturizers include, but are not limited to, lactic acid and other hydroxy acids and their salts, glycerin, propylene glycol, and butylene glycol. Suitable emollients include lanolin alcohol, lanolin, lanolin derivatives, cholesterol, petrolatum, isostearyl neopentanoate and mineral oils. Suitable fragrances and colors include, but are not limited to, FD&C

Red No. 40 and FD&C Yellow No. 5, Other suitable additional ingredients that may be included a topical formulation include, but are not limited to, abrasives, absorbents, anti-caking agents, anti- foaming agents, anti-static agents, astringents (e.g., witch hazel, alcohol and herbal extracts such as chamomile extract), binders/excipieπts, buffering agents, chelating agents, film forming agents, conditioning agents, propellants. opacifying agents, pH adjusters and protectants.

Art example of a suitable topical vehicle for formulation of a gel is: hydroxypropylcellulose

(2.1%); 70/30 isopropyl alcohol/water (90.9%); propylene glycol (5.1%); and Polysorbate 80 (1.9%).

An example of a suitable topical vehicle for formulation as a foam is: cetyl alcohol (1.1%); stearyl alcohol (0.5%: Quaternium 52 (1.0%); propylene glycol (2.0%); Elhanol 95 PGF3 (63 .05%): deionized water (30.05%); P75 hydrocarbon propellant (4.30%). AH percents are by weight.

Typical modes of delivery for topical compositions include application using the fingers; application using a physical applicator such as a cloth, tissue, swab, stick or brush; spraying (including mist, aerosol or foam spraying); dropper application; sprinkling; soaking; and rinsing. A pharmaceutical composition may be prepared as a sterile injectible aqueous or oleaginous suspension. The compound(s) provided herein, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Such a composition may be formulated according to the known art using suitable dispersing, wetting and/or suspending agents such as those mentioned above. Among lhe acceptable vehicles and solvents that may be employed are water, 1 ,3-butanediol, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectible compositions, and adjuvants such as local anesthetics, preservatives and/or buffering agents can be dissolved in the vehicle. Pharmaceutical compositions may also be formulated as suppositories (e.g., for recta! administration). Such compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Suitable excipients include, for example, cocoa butter and polyethylene glycols.

Compositions for inhalation typically can be provided in the form of a solution, suspension or emulsion that can be administered as a dry powder or in the form of an aerosol using a conventional propellant (e.g., dichlorodifluoromethane or trichlorofluoromethane).

Pharmaceutical compositions may be formulated for release at a pre-determined rate. Instantaneous release may be achieved, for example, via sublingual administration (i.e., administration by mouth in such a way that the active ingredient(s) are rapidly absorbed via the blood vessels under the tongue rather than via the digestive tract). Controlled release formulations (i.e., formulations such as a capsule, tablet or coated tablet that slows and/or delays release of active ingredient(s) following administration) may be administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at a target site. In general, a controlled release formulation comprises a matrix and/or coating that delays disintegration and absorption in the gastrointestinal tract (or implantation site) and thereby provides a delayed action or a sustained action over a longer period. One type of controlled-release formulation is a sustained-release formulation, in which at least one active ingredient is continuously released over a period of time at a constant rate. Preferably, the therapeutic agent is released at such a rate that blood (e.g., plasma) concentrations are maintained within the therapeutic range, but below toxic levels, over a period of time that is at least 4 hours, preferably at least 8 hours, and more preferably at least 12 hours. Such formulations may generally be prepared using well known technology and administered by. for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Carriers for use within such formulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of modulator release. The amount of modulator contained within a sustained release formulation depends upon, for example, the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.

Controlled release may be achieved by combining the active ingredient(s) with a matrix material that itself alters release rate and/or through the use of a controlled-release coating. The release rate can be varied using methods well known in the art, including (a) varying the thickness or composition of coating, (b) altering the amount or manner of addition of plasticizer in a coating, (c) including additional ingredients, such as release-modifying agents, (d) altering the composition, particle size or particle shape of the matrix, and (e) providing one or more passageways through the coating. The amount of modulator contained within a sustained release formulation depends upon, for example, the method of administration (e.g., the site of implantation), the rate and expected duration of release and the nature of the condition to be treated or prevented. The matrix material, which itself may or may not serve a controlled-release function, is generally any material that supports the active ingredient(s). For example, a time delay material such as glyceryl monosterate or glyceryl distearate may be employed. Active ingredient(s) may be combined with matrix material prior to formation of the dosage form (e.g., a tablet). Alternatively, or in addition, active ingredient(s) may be coated on the surface of a particle, granule, sphere, microsphere, bead or pellet that comprises the matrix material. Such coating may be achieved by conventional means, such as by dissolving the active ingredient(s) in water or other suitable solvent and spraying. Optionally, additional ingredients are added prior to coating (e.g., to assist binding of the active ingredient(s) to the matrix material or to color the solution). The matrix may then be coated with a barrier agent prior to application of controlled-release coating. Multiple coated matrix units may, if desired, be encapsulated to generate the final dosage form.

In certain embodiments, a controlled release is achieved through the use of a controlled release coating {i.e., a coating that permits release of active ingredient(s) at a controlled rate in aqueous medium). The controlled release coating should be a strong, continuous film that is smooth, capable of supporting pigments and other additives, non-toxic, inert and tack-free. Coatings that regulate release of the modulator include pH-independent coatings, pH-dependent coatings (which may be used to release modulator in the stomach) and enteric coatings (which allow the formulation to pass intact through the stomach and into the small intestine, where the coating dissolves and the contents are absorbed by the body). It will be apparent that multiple coatings may be employed (e.g., to allow release of a portion of the dose in the stomach and a portion further along the gastrointestinal tract). For example, a portion of active ingredient(s) may be coated over an enteric coating, and thereby released in the stomach, while the remainder of active ingredient(s) in the matrix core is protected by the enteric coating and released further down the GI tract. pH dependent coatings include, for example, shellac, cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropylmethylcellulose phthalate, methacrylic acid ester copolymers and zein.

In certain embodiments, the coating is a hydrophobic material, preferably used in an amount effective to slow the hydration of the gelling agent following administration. Suitable hydrophobic materials include alkyl celluloses (e.g., ethylcellulose or carboxymethylceilulose), cellulose ethers. cellulose esters, acrylic polymers (e.g., poly(acrylic acid), poly(methacrylic acid), acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxy ethyl methacrylates, cyanoethyl methacrylate, methacrylic acid alkamide copolymer, poly(methyl methacrylate), po Iy aery 1 amide, ammonio methacryiate copolymers, aminoalkyl methacryiate copolymer. poly(methacryiic acid anhydride) and glycidyl methacrylate copolymers) and mixtures of the foregoing. Representative aqueous dispersions of ethylcellulose include, for example,

AQUACOAT® (FMC Corp., Philadelphia. PA) and SURELEASE® (Colorcon, Inc., West Point,

PA), both of which can be applied to the substrate according to the manufacturer's instructions.

Representative acrylic polymers include, for example, the various EUDRAGIT® (Rohm America, Piscataway, NJ) polymers, which may be used singly or in combination depending on the desired release profile, according to the manufacturer's instructions. The physical properties of coatings that comprise an aqueous dispersion of a hydrophobic material may be improved by the addition or one or more plasticizers. Suitable piasticizers for aikyl celluloses include, for example, dibutyl sebacate, diethyl phthalate, triethyl citrate, tributyl citrate and triacetin. Suitable plasticizers for acrylic polymers include, for example, citric acid esters such as triethyl citrate and tributyl citrate, dibutyl phthalate, polyethylene glycols, propylene glycol, diethyl phthalate, castor oil and triacetin.

Controlled-release coatings are generally applied using conventional techniques, such as by spraying in the form of an aqueous dispersion. If desired, the coating may comprise pores or channels or to facilitate release of active ingredient. Pores and channels may be generated by well known methods, including the addition of organic or inorganic material that is dissolved, extracted or leached from the coating in the environment of use. Certain such pore-forming materials include hydrophilic polymers, such as hydroxyalkylcelluloses (e.g., hydroxypropylmethylcellulose), cellulose ethers, synthetic water-soluble polymers (e.g., polyvinylpyrrolidone, cross-linked polyvinylpyrrolidone and polyethylene oxide), water-soluble polydextrose, saccharides and polysaccharides and alkali metal salts. Alternatively, or in addition, a controlled release coating may include one or more orifices, which may be formed my methods such as those described in US Patent Nos. 3,845,770; 4,034,758; 4,077,407; 4,088,864; 4,783,337 and 5,071,607. Controlled-release may also be achieved through the use of transdermal patches, using conventional technology (see, e.g., US Patent No. 4,668,232).

Further examples of controlled release formulations, and components thereof, may be found, for example, in US Patent Nos. 4,572,833; 4,587,117; 4,606,909; 4,610,870; 4,684,516; 4.777,049;

4,994,276; 4,996,058; 5,128,143; 5,202,128; 5,376,384; 5,384,133; 5,445,829; 5,510,1 19; 5,618,560;

5,643,604; 5,891,474; 5,958,456; 6,039,980; 6,143,353; 6,126,969; 6,156,342; 6,197,347; 6,387,394;

6,399,096; 6,437,000; 6,447,796; 6,475,493; 6,491,950; 6,524,615; 6,838,094; 6,905,709; 6,923,984;

6,923,988; and 6,91 1 ,217; each of which is hereby incorporated by reference for its teaching of the preparation of controlled release dosage forms.

In addition to or together with the above modes of administration, a compound provided herein may be conveniently added to food or drinking water (e.g. , for administration to non-human animals including companion animals (such as dogs and cats) and livestock). Animal feed and drinking water compositions may be formulated so that the animal takes in an appropriate quantity of the composition along with its diet. It may also be convenient to present the composition as a premix for addition to feed or drinking water.

Spirocyclic sulfonamides and related compounds provided herein are generally administered in a therapeutically effective amount. Preferred systemic doses are no higher than 50 mg per kilogram of body weight per day (e.g., ranging from about 0.001 mg to about 50 mg per kilogram of body weight per day), with oral doses generally being about 5-20 fold higher than intravenous doses (e.g., ranging from 0.01 to 40 mg per kilogram of body weight per day). The amount of active ingredient that may be combined with the carrier materials to produce a single dosage unit will vary depending, for example, upon the patient being treated and the particular mode of administration. Dosage units will generally contain from about 10 μg to about 500 nig of an active ingredient. Optimal dosages may be established using routine testing, and procedures that are well known in the art.

Pharmaceutical compositions provided herein may, but need not, further comprise one or more additional pharmaceutical agents, such as an anti-inflammatory agent or analgesic.

Anti-inflammatory agents include, for example, non-steroidal anti-inflammatory drugs (ISFSAIDs), non-specific and cyclooxygenase-2 (COX-2) specific cyclooxgenase enzyme inhibitors, gold compounds, corticosteroids, methotrexate, leflunomide, cyclosporine A, IM gold, minocycline, azathioprine, tumor necrosis factor (TNF) receptor antagonists, soluble TNF alpha receptor (etanercept), anti-TNF alpha antibodies (e.g., infliximab and adalimumab), anti-C5 antibodies, interleukin-1 (IL-I ) receptor antagonists (e.g., anakinra or IL-I trap), IL-18 binding protein, CTLA4- Tg (e.g., abatacept), anti-human IL-6 receptor monoclonal antibody (e.g., tocilizumab), LFA-3-Ig fusion proteins (e.g., alefacept), LFA-I antagonists, anti-VLA4 monoantibody (e.g., natalizumab), anti-CDl la monoclonal antibody, anti-CD20 monoclonal antibody (e.g., rituximab), anti-IL-12 monoclonal antibody, anti-IL-15 monoclonal antibody, CDP 484, CDP 870, chemokine receptor antagonists, selective iNOS inhibitors, p38 kinase inhibitors, integrin antagonists, angiogenesis inhibitors, and TMI-I dual inhibitors. Further anti-inflammatory agents include meloxicam, rofecoxib, celecoxib, etoricoxib, parecoxib, valdecoxib and tilicoxib.

NSAIDs include, but are not limited to, ibuprofen, flurbiprofen, naproxen or naproxen sodium, diclofenac, combinations of diclofenac sodium and misoprostol, sulindac, oxaprozin, diflunisal, piroxicam, indomethacin, etodolac, fenoprofen calcium, ketoprofen, sodium nabumetone, sulfasalazine, tolmetin sodium, and hydroxychloroquine. One class of NSAIDs consists of compounds that inhibit cyclooxygenase (COX) enzymes; such compounds include celecoxib and rofecoxib. NSAIDs further include salicylates such as acetylsalicylic acid or aspirin, sodium salicylate, choline and magnesium salicylates, and salsalate, as well as corticosteroids such as cortisone, dexamethasone, methylprednisolone, prednisolone, prednisolone sodium phosphate, and prednisone.

Certain analgesics for use in combination with Bj modulators provided herein are also anti- inflammatory agents, and are listed above. Other such medications are analgesic agents, including narcotic agents which typically act at one or more opioid receptor subtypes (e.g., μ, K and/or δ), preferably as agonists or partial agonists. Such agents include opiates, opiate derivatives and opioids, as well as pharmaceutically acceptable salts and hydrates thereof. Specific examples of narcotic analgesics include, within preferred embodiments, alfentanil, alphaprodine, anileridine, hezitramide, bυprenorphine, butorphanoi, codeine, diacetyldihydromorphine, diacetylmorphine. dihydrocodeine, diphenoxylate, ethyimorphine, fentanyl, heroin, hydrocodone, hydromorphone, isomethadone, levomethorphan, levorphane, levorphanol, meperidine, metazocine, methadone, methorphan, metopon, morphine, nalbuphine, opium extracts, opium fluid extracts, powdered opium, granulated opium, raw opium, tincture of opium, oxycodone, oxymorphone, paregoric, pentazocine, pethidine, phenazocine, piminodine, propoxyphene, racemethorphan, racemorphan, sulfentanyl, thebaine and pharmaceutically acceptable salts and hydrates of the foregoing agents.

Other examples of narcotic analgesic agents include acetorphine, acetyldihydrocodeine, acetyl methadol, allylprodine, alphracetylmethadoi, alphameprodine, alphamethadol, benzethidine, benzyl morphine, betacetylmethadol, betameprodine, betamethadoi, betaprodine, clonitazene, codeine methylbromide, codeine-N-oxide, cyprenorphine, desomorphine, dextromoramide, diampromide, diethylthiambutene, dihydromorphine, dimenoxadol, dimepheptanoϊ. dimethylthiamubutene, dioxaphetyl butyrate, dipipanone, drotebanol, ethanol, ethylmethylthiambutene, etonitazene, etoφhine, etoxeridine, furethidine, hydromorphinol, hydroxypethidine, ketobemidone, levomoramide, levophenacylmorphan, methyldesorphine, methyldihydrornorphine, morpheridine, morphine, methylpromide, morphine methylsulfonate, morphine-N-oxide, myrophin, naloxone, naltyhexone, nicocodeine, nicomoφhine, noracymethadol, norlevorphanol. normethadone, normorphine. norpipanone, pentazocaine, phenadoxone, phenampromide, phenomorphaπ, phenoperidine, piritramide, pholcodine, proheplazoine, properidine, propiran, racemoramide, thebacon, trimeperidine and the pharmaceutically acceptable salts and hydrates thereof.

Further specific representative analgesic agents include, for example acetaminophen

(paracetamol); aspirin and other NSAIDs described above; NR2B antagonists; capsaicin receptor antagonists; anti-migraine agents; anticonvulsants such as oxcarbazepine and carbamazepine; antidepressants (such as TCAs. SSRIs, SNRIs, substance P antagonists, etc.); spinal blocks; pentazocine/naloxone; meperidine; levorphanol; buprenorphine; hydromorphone; fentanyl; sufentanyl; oxycodone; oxycodone/acetaminophen, nalbuphine and oxymorphone. Still further analgesic agents include CB2 -receptor agonists, such as AM 1241, capsaicin receptor antagonists and compounds that bind to the α2δ subunit of voltage-gated calcium channels, such as gabapentin and pregabalin.

Representative anti-migraine agents for use in combination with a B] modulator provided herein include CGRP antagonists, capsaicin receptor antagonists, ergotamines and 5-HT] agonists, such as sumatripan, naratriptan, zolmatriptan and rizatriptan.

Pharmaceutical compositions may be packaged for treating conditions responsive to B₁ modulation (e.g., treatment of pain, inflammation or other disorder(s) recited herein). Packaged pharmaceutical preparations generally comprise a container holding a therapeutically effective amount of a pharmaceutical composition as described above and instructions (e.g., labeling) indicating that the composition is to be used for treating a condition responsive to Bj modulation in a patient (e.g., pain or other disorder as indicated herein). In certain embodiments, a packaged pharmaceutical preparation comprises one or more spirocyclic sulfonamides or related compounds provided herein and one or more additional agents in the same package, either in separate containers within the package or in the same container (i.e., as a mixture). Preferred mixtures are formulated for oral administration {e.g., as pills, capsules, tablets or the like). In certain embodiments, the package comprises a label bearing indicia indicating that the components are to be taken together for the treatment of pain.

METHODS OF USE Within certain aspects, the present invention provides methods for treating a condition responsive to Bi modulation in a patient. The patient may be afflicted with such a condition, or may be free of symptoms but considered at risk for developing such a condition. A condition is "responsive to Bi modulation" if the condition or symptom(s) thereof are alleviated, attenuated, delayed or otherwise improved by modulation of Bj activity. In general, such methods comprise administering to the patient a therapeutically effective amount of at least one compound as provided herein.

Conditions responsive to Bj modulation include, for example pain; inflammation including neuroinflammation (such as atherosclerosis), inflammation associated with airway diseases {e.g., asthma, including allergic asthma, exercise-induced bronchocoπstriction, occupational asthma, and other non-allergic asthmas), and inflammatory skin disorders {e.g., psoriasis and eczema)); respiratory disorders including bronchoconstriction, asthma, chronic obstructive pulmonary disease {e.g., emphysema), chronic cough (including ACE-inhibitor cough), adult respiratory distress syndrome, bronchitis, pneumonia, allergic rhinitis and vasomotor rhinitis; vascular edema (including diabetes- related vascular disease); and epilepsy. Other conditions responsive to Bj modulation include diabetes {e.g., type O or non insulin dependent, as well as diabetic vasculopathy, diabetic neuropathy, diabetic retinopathy, post capillary resistance and symptoms associated with insulitis), seizure disorders {e.g., epilepsy), multiple sclerosis, liver disease, cardiovascular disorders {e.g., atherosclerosis, congestive heart failure and myocardial infarction), neurodegenerative diseases {e.g., Alzheimer's disease and Parkinson's disease) rheumatoid arthritis, infection, cancer, cranial trauma, rhinitis, septic shock, endotoxic and pancreatic shock, anaphylaxis, inflammatory bowel disease, irritable bowel syndrome, pancreatitis, cystitis, uveitis, vascular permeability, gingivitis, osteoporosis, benign prostatic hyperplasia, hyperactive bladder, cerebral edema, vasodilation, hypotension associated with sepsis, edema resulting from trauma associated with burns, sprains or fracture, cerebral edema, angiodema, Crohn's disease and ulcerative colitis. Bi modulators may also be used as smooth muscle relaxants for treating spasms of the gastrointestinal tract of uterus. In certain embodiments, the condition responsive to Bi modulation is pain or inflammation.

Pain that may be treated using the B, modulators provided herein includes, for example, acute, chronic, inflammatory, and neuropathic pain. Specific pain indications that may be treated as described herein include, but are not limited to, bone and joint pain {e.g., pain associated with osteoarthritis or rheumatoid arthritis; various neuropathic pain syndromes (such as post-herpetic neuralgia, trigeminal neuralgia, reflex sympathetic dystrophy, diabetic neuropathy, Guillian Barre syndrome, fibromyalgia, oral neuropathic pain, phantom limb pain, post-mastectomy pain, peripheral neuropathy, traumatic neuropathy, painful polyneuropathy, myofascial pain syndromes, MS-re!ated neuropathy, HIV or AIDS-related neuropathy, and chemotherapy-induced and other iatrogenic neuropathies); visceral pain, (such as that associated with gastroesophageal reflux disease (GERD), irritable bowel syndrome, inflammatory bowel disease, pancreatitis, renal colic, interstitial cystitis, intestinal gas, gynecological disorders (e.g., menstrual pain, dysmenorrhoea, pain associated with cystitis, labor pain, chronic pelvic pain, vulvodynia, chronic prostitis, and endometriosis), heart pain and abdominal pain, and urological disorders); dental pain (e.g., toothache, denture pain, nerve root pain, pain resulting from periodontal disease, and pain due to dental surgery including operative and post-operative pain); stump pain; meralgia paresthetica; burning-mouth syndrome; pain associated with nerve and root damage, including as pain associated with peripheral nerve disorders (e.g., nerve entrapment and brachial plexus avulsions, amputation, peripheral neuropathies including bilateral peripheral neuropathy, tic douloureux, atypical facial pain, nerve root damage, and arachnoiditis), causalgia, neuritis (including, for example, sciatic neuritis, peripheral neuritis, polyneuritis, optic neuritis, postfebrile neuritis, migrating neuritis, segmental neuritis and Gombault's neuritis), neuronitis, neuralgias (e.g., those mentioned above, cervicobrachial neuralgia, cranial neuralgia, geniculate neuralgia, glossopharyngiai neuralgia, migranous neuralgia, idiopathic neuralgia, intercostals neuralgia, mammary neuralgia, mandibular joint neuralgia, Morton's neuralgia, nasociliary neuralgia, occipital neuralgia, red neuralgia, Sluder's neuralgia, splenopalatiπe neuralgia, supraorbital neuralgia and vidian neuralgia); surgery-related pain; musculoskeletal pain; central nervous system pain (e.g., pain due to brain stem damage, sciatica, and ankylosing spondylitis); and spinal pain, including spinal cord injury-related pain.

Headache, including headaches involving peripheral nerve activity may also be treated as described herein. Such headache pain includes, for example, sinus, cluster (i.e., migranous neuralgia) and tension headaches, migraine, temporomandibular pain and maxillary sinus pain. For example, migraine headaches may be prevented by administration of a compound provided herein as soon as a pre-migrainous aura is experienced by the patient.

Further pain conditions that can be treated as described herein include Charcot's pains, ear pain, muscle pain, eye pain, orofacial pain (e.g., odontalgia), repetitive motion pain, carpel tunnel syndrome, acute and chronic back pain (e.g., lower back pain), gout, scar pain, hemorrhoidal pain, dyspeptic pains, angina, nerve root pain, "non-painful" neuropathies, complex regional pain syndrome, nomotopic pain and heterotopic pain - including pain associated with carcinoma, often referred to as cancer-associated pain (e.g., in patients with bone cancer), pain (and inflammation) associated with venom exposure (e.g., due to snake bite, spider bite, or insect sting) and trauma- associated pain (e.g., post-surgical pain, episiotomy pain, pain from cuts, musculoskeletal pain, bruises and broken bones, and burn pain, especially primary hyperalgesia associated therewith), Additional pain conditions that may be treated as described herein include pain associated with autoimmune diseases or immunodeficiency disorders, hot flashes, bums, sunburn, and pain that results from exposure to heat, cold or external chemical stimuli.

In certain embodiments, pain treated with Bi modulators provided herein is inflammatory pain, acute pain, dental pain, back pain, surgical pain, headache, neuropathic pain or pain from osteoarthritis or trauma.

It will be apparent that compounds provided herein may be administered alone or in combination with one or more additional agents that are suitable for treating the disorder of interest. Within such combination therapy, the compound(s) and additional agent(s) may be present in the same pharmaceutical composition, or may be administered separately in either order. Representative anti-inflammatory agents and analgesics for use in combination therapy include those indicated above. Within other aspects, Bj modulators provided herein may be used within combination therapy for the treatment of conditions involving pain and/or inflammatory components. Such conditions include, for example, autoimmune disorders and pathologic autoimmune responses known to have an inflammatory component including, but not limited to, arthritis (especially rheumatoid arthritis), psoriasis, Crohn's disease, lupus erythematosus, irritable bowel syndrome, tissue graft rejection, and hyperacute rejection of transplanted organs. Other such conditions include trauma (e.g., injury to the head or spinal cord), cardio- and cerebro-vascular disease and certain infectious diseases. Within such combination therapy, a B₁ modulator is administered to a patient along with an additional analgesic and/or anti-inflammatory agent. The B, modulator and additional analgesic and/or anti-inflammatory agent may be present in the same pharmaceutical composition, or may be administered separately in either order.

Administration to the patient can be by way of any means discussed above, including oral, topical, nasal or transdermal administration, or intravenous, intramuscular, subcutaneous, intrathecal, epidural, intracerebro ventricular or like injection. Oral administration is preferred in certain embodiments (e.g., formulated as pills, capsules, tablets or the like).

Treatment regimens may vary depending on the compound used and the particular condition to be treated. In general, a dosage regimen of 4 times daily or less is preferred, with 1 or 2 times daily particularly preferred. It will be understood, however, that the specific dose and treatment regimen for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex and diet of the patient, the time of administration, the route of administration, the rate of excretion, any drug combination and the severity of the particular disease undergoing therapy. Dosages are generally as described above; in general, the use of the minimum dose sufficient to provide effective therapy is preferred. Patients may generally be monitored for therapeutic effectiveness using medical or veterinary criteria suitable for the condition being treated or prevented. Suitable dosages for Bj modulators (either alone or within such combination therapy) are generally as described above. Dosages and methods of administration of any additional agent(s) (e.g., anti-inflammatory and/or analgesic agents) can be found, for example, in the manufacturer's instructions or in the Physician's Desk Reference. In certain embodiments, combination administration results in a reduction of the dosage of the additional agent required to produce a therapeutic effect (i.e., a decrease in the minimum therapeutically effective amount). Thus, preferably, the dosage of additional agent in a combination or combination treatment method of the invention is less than the maximum dose advised by the manufacturer for administration of the agent without combination with a compound of Formula L More preferably this dose is less than ³A, even more preferably less than ¹A, and highly preferably less than '/_* of the maximum dose, while most preferably the dose is less than 10% of the maximum dose advised by the manufacturer for administration of the agent(s) when administered without combination administration as described herein. It will be apparent that the dose of compound as provided herein needed to achieve the desired effect may similarly be affected by the dose and potency of the additional agent. Within separate aspects, the present invention provides a variety of non-pharmaceutical in vitro and in vivo uses for the compounds provided herein. For example, such compounds may be labeled and used as probes for the detection and localization of Bi (in samples such as ceil preparations or tissue sections, preparations or fractions thereof). In addition, compounds provided herein that comprise a suitable reactive group (such as an aryl carbonyl, nitro or azide group) may be used in photoaffmity labeling studies of receptor binding sites. In addition, compounds provided herein may be used as positive controls in assays for receptor activity, as standards for determining the ability of a candidate agent to bind to _Bh or as radiotracers for positron emission tomography (PET) imaging or for single photon emission computerized tomography (SPECT). Such methods can be used to characterize B, receptors in living subjects. For example, a compound may be labeled using any of a variety of well known techniques {e.g., radiolabeled with a radionuclide such as tritium, as described herein), and incubated with a sample for a suitable incubation time (e.g., determined by first assaying a time course of binding). Following incubation, unbound compound is removed (e.g., by washing), and bound compound detected using any method suitable for the label employed (e.g., autoradiography or scintillation counting for radiolabeled compounds; spectroscopic methods may be used to detect luminescent groups and fluorescent groups). As a control, a matched sample containing labeled compound and a greater (e.g., 10-fold greater) amount of unlabeled compound may be processed in the same manner. A greater amount of detectable label remaining in the test sample than in the control indicates the presence of Bi in the sample. Detection assays, including receptor autoradiography (receptor mapping) of B₁ in cultured cells or tissue samples may be performed as described by Kuhar in sections 8.1.1 to 8.1.9 of Current Protocols in Pharmacology (1998) John Wiley & Sons, New York. The Following Examples are offered by way of illustration and not by way of limitation. Unless otherwise specified all reagents and solvent are of standard commercial grade and are used without further purification. Using routine modifications, the starting materials may be varied and additional steps employed to produce other compounds provided herein.

EXAMPLES

Mass spectroscopy data in the following Examples is Electrospray MS, obtained in positive ion mode using a Micromass Ti me-of-F light LCT (Micromass, Beverly MA), equipped with a Waters 600 pump (Waters Corp.; Milford, MA), Waters 996 photodiode array detector, and a Gilson 215 autosampler (Gilson, Inc.; Middleton, WI). MassLynx (Advanced Chemistry Development, ϊnc; Toronto, Canada) version 4.0 software with OpenLyπx Global Server™. Open Lynx™ and AutoLynx™ processing is used for data collection and analysis.

Unless otherwise indicated, MS conditions are as follows: capillary voltage = 3.5 kV; cone voltage = 30 V, desolvation and source temperature = 35O⁰C and 12O⁰C, respectively; mass range =

181-750 with a scan time of 0.22 seconds and an interscan delay of 0.05 min. Sample volume of 1 microliter is injected onto a 50x4.6mm Chromoiith SpeedROD RP-I 8e column (Merck KGaA,

Darmstadt, Germany), and eluted using a 2-phase linear gradient at a flow rate of 6 ml/min. Sample is detected using total absorbance count over the 220-340 nm UV range. The elution conditions are:

Mobile Phase A - 95% water, 5% MeOH with 0.05% TFA; Mobile Phase B - 5% water, 95% MeOH with 0.025% TFA. The following gradient is used: 0-0.5 min 10-100%B, hold at 100%B to 1.2 min, return to 10%B at 1.21 min. Inject to inject cycle is 2.15 min.

For MS data marked with a "§", MS conditions are as follows: capillary voltage - 3.5 kV; cone voltage ^~ 30 V, desolvation and source temperature = 25O⁰C and 100⁰C, respectively; mass range = 100-800 with a scan time of 0.5 seconds and an interscan delay of 0.1 seconds. Sample volume of 1 to 10 microliter is injected onto a 50x4.6mm Chromoiith SpeedROD column (Merck KGaA, Darmstadt, Germany), and eluted using a 2-phase linear gradient at a flow rate of 6 ml/min. Sample is detected using total absorbance count over the 220-254 nm UV range. The elution conditions are: Mobile Phase A - 95% water, 5% MeOH with 0.05% formic acid; Mobile Phase B - 5% water, 95% MeOH with 0.025% formic acid. The following gradient is used:

Timefmin) %B 0 5

0.01 5

1.0 100 2 100

2.1 5 Compounds 1-8 exhibit an IC₅₀ at Bi (determined as described in Example 7) that is 5 micromolar or less. EXAMPLE 1. SYNTHBSlS OF REPRESENTATIVE SPIROCYCLIC SULFONAMIDES AND RELATED COMPOUNDS

A. 4-METlIOXY-N,2,6-TRIMETHYL-N-{2-[2-(9-METIlYL-3,9-DIΛZASPIRθ[5.5]UNDEC-3-YL)-2- OXOETHOXY] ETHYL} BENZENE S ULFONAM IDE (COMPOUND 1 )

Step ] . N-(2-HydroxyethyI)-4-methoxy-N,2,6-trimethylbenzenesulfoπamide

4-Methoxy-2,6-dimethylbenzenesulfonyl chloride (12 g, 51 mmol) is added to a solution of 2- (methylamino)ethanol (4.6 mL, 61 mmoi), diisopropyl ethyl amine (22 mL, 130 mmol), and CH₂Cl₂ (130 mL) under N₂. The reaction vessel is sealed and left to stir for 21 h. The solution is washed with 1 :1 sat. aq. NH₄C!: H₂O (2 X 200 mL) and brine (200 mL). The aqueous layers are extracted with CH₂Cl₂ (200 mL). The combined organic layers are dried over Na₂SO₄, filtered, and concentrated to afford the title compound as a pale yellow oil. LC-MS m/∑ (M + Na^~): 296.06 (§).

Step 2. {2-[(4-Methoxy-2,6-dimethylbenzenesuIfonyI)methylamino]ethoxy}acetic acid ter/-butyl ester

Sodium hydride, 60% dispersion in mineral oil, (3.7 g, 90 mmol) is added to a solution of (2- hydroxyethyl)-4-methoxy-2,6,N-trimethylbenzenesulfonamide (14.5 g) and DMF (300 mL) at 0 ⁰C under N₂. After 15 min, t-butyl bromoacetate (1 1 .5 mL, 78 mmol) is added and the cold bath is removed. After 16 h, the reaction mixture is poured into 50% sat. aqueous NH₄Cl (400 mL). The solution is extracted with EtOAc (2 X 250 mL). The combined organic layers are washed with 50% sat. aqueous NH₄Cl (400 mL), dried over Na₃SO₄, filtered, and concentrated. Purification by flash column chromatography (5: 1 hexanes:EtOAc, 250 g SiO₂) affords the title compound as a pale yellow oil. LC-MS m/z (M + Na^{^}): 410.02 (§).

Step 3. {2-[(4-Methoxy-2,6-dimethylbenzenesulfonyl)methylamino]ethoxy}acetic acid {2-[(4-Methoxy-2,6-dimethylbenzenesuIfonyl)methy!amino]ethoxy} acetic acid /er/-butyl ester (18.9 g, 48.8 mmol) is treated with 4 M HCl in dioxane (60 mL) at rt overnight. The volatϋes are removed under reduced pressure to afford a tan solid. ¹H NMR (400 MHz, CDCl₃) δ: 6.65 (s, 2H). 4.13 (s, 2H), 3.82 (s, 3H). 3.72 (t, 2H). 3.53 (t, 2H), 2.70 (s, 3H), 2.60 (s, 6H). LC-MS m/z (M + Na^"): 354.07 (§).

Step 4. 4-Methoxy-N,2,6-trimethy]-N-{2-[2-(9-methyl-3.9-diazaspiro[5.5]undec-3-yl)-2- oxoethoxy]ethyi}benzenesulfonamide (Compound 3 ) A 1.0 M solution of TEA in toluene (0.15 mL) is added Io a solution of {2-[(4-methoxy-2,6- dimethy lbenzenesulfonyl)methy lam ino]ethoxy} acetic acid (24 mg, 72 μmol), 3-methyl-3,9-diaza- spiro[5.5]undecane (10 mg, 60 μmol), and dimethylacetamide (0.3 mL) under N₂. A 0.2 M solution of 2-chloro-l,3-dimethyIimidazolidinium chloride in acetonitrile (0.6 mL) is added. The reaction vessel is sealed and the mixture is warmed to 50 ⁰C for 2.5 h. After cooling to ambient temperature, 1 M aqueous NaOH (1 .5 mL) is added and then the volatiles are removed under reduced pressure. The aqueous residue is extracted with EtOAc (2 X 1.5 mL). The organics are loaded onto two 0.5 g SCX columns. Each column is washed with MeOH (3 X 3 mL) and then eluded with 5:5:2 EtOAc : MeOH : TEA (4.5 mL). Concentration of the organics under reduced pressure afforded the title compound as a pale yellow film. ^!H-NMR (400 MHz. CDCl₃) δ: 6.62 (s, 2H), 4.10 (s, 2H), 3.81 (s, 3H), 3.67 (t, 2H), 3.52 (dd, 2H), 3.37 (t, 2H), 3.34 (dd, 2H), 2.78 (s, 3H), 2.60 (s, 6H), 2.35-2.44 (m, 4H), 2.29 (s, 3H), 1.42-1.60 (m, 8H). LC-MS m/z (M + H'): 482.22; R_τ - 1.09 min.

B. N-{2-[2-(2-CYCLOBUTYL-2,8-D!AZASPIRO[4.5]DEC-8-YL)-2-OXOETHOXY]ETHYL}-4-MBTHOXY- N,2,6-TRIMETHYLBENZENESULFONAMIDE (COMPOUND 2)

The title compound is prepared as a yellow oil essentially as described in Example IA, above.

¹H-NMR (400 MHz, CDCl₃) & 6.62 (s, 2H), 4.10 (s, 2H), 3.81 (s, 3H), 3.67 (t, 2H), 3.42-3.60 (m, 2H), 3.37 (t. 2H), 3.28-3.36 (m, 2H), 3.04-3.14 (m. I H), 2.79 (s, 3H), 2.60 (s, 6H). 2.28-2.62 (m, 4H), 1.84-2.05 (m, 6H). 1 .54-1.77 (m, 6H). LC-MS m/z (M + H'): 508.33: R₁- = 1.07 min. C. N-{2-[2-(8-CYCLOBUTYL-2,8-DIAZASPIRO[4.5]DEC-2-YL)-2-OXOETHOXY]ETHYL}-4-METHOXY- N,2,6-TRIMETHYLBENZENESULFONAMIDE (COMPOUND 3)

The title compound is prepared as a pale yellow film is essentially as described in Example I A, above. ¹H-NMR (400 MHz, CDCl₃) S: 6.62 (s, 2H), 4.03 (s, 2H), 3.81 (s, 3H), 3.73 (t, 2H), 3.1 7- 3.54 (m, 5H), 2.80 (s₉ 3H), 2.61 (s, 6H), 1.62-2.78 (m, 15H). LC-MS m/z (M + H⁺): 508.21 ; R_τ = 1 .1 1 min.

D. 3-[( {(3R)-4-[(4-METHOXY-2,6-DIMETHYLPHENYL)SULFONYL]-6,6-DIMETHYLMORPHOLIN-3-

YL} METΠOXY)ACETYL]-9-METHYL-3,9-DIAZΛSPIRO[5.5]UNDECΛNE (COMPOUND 4)

Step 1. (3S)-Methyl 4-benzyi-6-(iodomethyl)-6-methylfnorphoIine-3-carboxylate

(S)-Methyi 2-(benzylamino)-3-hydroxypropanoate (27.4 g. 131 mmol) is combined with 3- bromo-2-methylpropene (25 mL, 248 mmol), K₃CO₃ (45 g, 327 mmol), and KI (4.3 g, 26 mmol) in 300 mL acetonitrile. The reaction mixture is stirred at rt for 3 days. Todine (66 g, 262 mmol) is added and the reaction mixture is stirred an additional 2 h at rt. The reaction mixture is diluted with 300 mL ether and transferred to a separately funnel. The solution is washed twice successively with 200 mL IN NajSOa. once with 200 mL saturated NaHCOj, and once with 200 mL brine. The organic phase is dried over MgSO₄, filtered and concentrated in vacuo. The product is purified by flash chromatography, eluting with 9/1 hexanes/EtOAc to afford (3S)-methyl 4-benzyl-6-(iodomethyl)-6- methylmorphoiine-3-carboxylate as a 5/1 mixture of diastereomers.

Step 2. (S)-Methyl 6,6-dimethylmorpholine-3-carboxylate

This mixture of diastereomers obtained in step 1 is combined with tributyltin hydride (73 mL, 272 mmol) in 400 mL refluxing toluene. AIBN (1 g, 6 nimol) dissolved in 40 mL toluene is added dropwise. After 2 h reflux, the reaction mixture is cooled to it. Saturated aqueous KF solution (800 mL) is added and the resulting heterogeneous mixture is filtered through Celite and the solid washed with EtOAc. The combined solutions are transferred to a separatory funnel and washed twice with 200 mL saturated KF, and then once with 2O mL brine. The organic phase is dried over MgSO₄. filtered and concentrated in vacuo. The product is purified by flash chromatography eluting with 95/5 hexanes/EtOAc followed by EtOAc to afford (S)-methyl 4-benzyl-6,6-dimethylmorpholine-3- carboxylate as a clear oii. This oil is dissolved in a mixture of 200 mL MeOH and 20 mL acetic acid. Palladium hydroxide (5 g, 20 wt. % on carbon) is added and the reaction mixture hydrogenated on a Paar apparatus at 50 psi for 10 h. An additional 5 g of palladium hydroxide is added and the hydrogenation is continued at 50 psi for another 25 h. The reaction mixture is filtered through Celite and concentrated in vacuo to afford the title compound. I H NMR (400 MHz, d-6-DMSO) d: 3.71- 3.74 (m, IH), 3.61-3.65 (m, IH), 3.61 (s, 3H), 3.36 (m, IH), 2.65 (d, IH), 2.46 (d, I H), LI 1 (s, 3H), 1.09 (s, 3H).

Step 3. (S)-Methyl 4-(4-methoxy-2,6-dimethylphenyIsulfoπyI)-6,6-dimethyJmoipholine-3- carboxylate

(S)-Methyl 6,6-dimethyimorphoiine-3-carboxylate (2.3 g, 13 mmol) is dissolved in 50 mL pyridine. 2.6-DimethyI-4-methoxyphenylsulfonyi chloride (3.1 g. 13 mmol) and DMAP (15 mg) are added. The reaction mixture is stirred at 50 ⁰C for 5 h. The reaction mixture is cooled to rt. diluted with 100 mL EtOAc, and transferred to a separatory funnel. The reaction mixture is washed three times with 50 mL water and once with 50 mL brine. The organic phase is dried over MgSO₄. filtered, then concentrated in vacuo. The product is purified by flash chromatography eluting with 8/2 hexanes/EtOAc followed by 1 /1 hexanes/EtOAc to afford (S)-methyl 4-(4-methoxy-2,6- dimethylphenylsulfonyi)-6,6-dimethylmorpholine-3-carboxylate.

Step 4. (R)-2-((4-(4-Methoxy-2,6-dimethylphenylsulfonyl)-6,6-dimethylmoφholin-3- yl)methoxy)acetic acid

(S)-Methyl 4-(4-methoxy-2,6-dimethylphenylsulfonyl)-6,6-dimethylmorpholine-3- carboxylate is dissolved in 8 mL of dry THF at 0 ⁰C. DlBAL (8 mL of a IM solution in THF) is added and the reaction mixture stirred 30 min at 0 ⁰C. An additional 1 mL DlBAL solution is added and stirring is continued for 30 min. The reaction mixture is quenched by addition of solid Na₂SO₄- IOH₂O. The reaction mixture is filtered through Ceiite and concentrated in vacuo to afford (R)-(4-(4-methoxy-2,6-dimethyIphenylsuIfonyl)-6,6-dimethylmorpholin-3-yl)methanol. This compound, without further purification, is dissolved in 30 mL DMA at rt. Potassium iodide (20 mg) and sodium hydride (140 mg of a 60% oil dispersion) are added, followed by bromo ?er/-butyl acetate (0.48 mL, 3.2 mmoi). The reaction mixture is stirred for 2 days, and then diluted with 50 mL EtOAc, transferred to a separatory funnel, and washed once with 20 mL water and once with 20 mL brine. The organic phase is dried over MgSO^, filtered and concentrated in vacuo. The product is purified by flash chromatography eluting with 9/1 hexanes/EtOAc to afford (R)-ter;- butyl 2-((4-(4~methoxy- 2,6-dimerhylphenylsuIfonyl)-6,6-dimethylmorpholin-3-y!)methoxy)acetate. This compound is dissolved in 3 mL of 4 M HCl in dioxane, and stirred at 50⁰C for 3 h. The reaction mixture is cooled to rt and concentrated in vacuo. The product is purified by flash chromatography, eluting with 1/1 hexanes/EtOAc to afford the title compound. LC-MS m/z (M+Na): 424.73 (§). Step 5. 3-[({(3R)-4-[(4-Methoxy-2,6-dimethylρhenyl)su]fonyl]-6,6-dimethylmorpholin-3- yl}methoxy)acetyl]-9-methyi-3,9-diazaspiro[5.5]undecane (Compound 4)

A 1 .0 M solution of TEA in toluene (0.15 mL) is added to a solution of {(R)-2~((4-(4- methoxy-2,6-dimethylphenylsulfonyI)-6,6-dimethylmorpholin-3-yl)methoxy)acetic acid (28 mg, 70 μmoi), 3-methyl-3,9-diaza-spiro[5.5]undecane (10 mg, 60 μmoi), and dimethylacetamide (0.3 mL) under N₂. A 0.2 M solution of 2-chioro-l,3-dimethylimidazolidinium chloride in acetonitrile (0.6 mL) is added. The reaction vessel is sealed and the mixture is warmed to 50 ⁰C for 2.5 h. After cooiing to ambient temperature, 1 M aqueous NaOH (1.5 mL) is added and then the volatiles are removed under reduced pressure. The aqueous residue is extracted with EtOAc (2 X 1.5 mL). The organics are loaded onto two 0.5 g SCX columns. Each column is washed with MeOH (3 X 3 mL) and then eluded with 5:5:2 EtOAc : MeOH : TEA (4.5 mL). Concentration of the organics under reduced pressure afforded the title compound as a pale yellow film. ¹H-NMR (400 MHz, CDCi:,) δ: 6.62 (s, 2H), 4.04 (s, 2H), 3.95 (dd, IH), 3.81 (s, 3H), 3.76-3.88 (m, 2H), 3.68-3.74 (m, I H), 3.47- 3.59 (m, 3H), 3.29-3.36 (m, 2H). 2.94-3.04 (m. 2H), 2.60 (s, I H), 2.36-2.46 (m, 4H), 2.30 (s, 3H), 1.54-1 .63 (m, 4H), 1 .41 -1.48 (m, 4H), 1.51 (s, 3H), 1.1 1 (s, 3H). LC-MS m/z (M + H⁺): 552.24: R_τ = 1.14 min. E. 2-CYCLOBUTYL-8-[({(3R)-4-[(4-METHOXY-2.6-DIMETHYLPHENYL)SULFONYL]-6,6-

DlMETHYLMORPHOLIN-3-YL}METHOXY)ACETYL]-2,8-DIAZASPfRO[4.5]DECANE (COMPOUND 5)

The title compound is prepared as a dark yellow oil essentially as described in Example ID, above. ¹H-NMR (400 MHz, CDCl₃) & 6.62 (s, 2H), 4.03 (s, 2H), 3.93 (dd, IH), 3.81 (s, 3H), 3.76-

3.87 (ra, 2H), 3.67-3.74 (m, IH), 3.42-3.58 (m, 3H). 3.28-3.34 (m, 2H), 2.86-3.05 (m, 3H), 2.60 (s,

6H), 2.28-2.62 (m, 4H), ! .61 -2.05 (m, 12H), 1.15 (s, 3H), 1.21 (s, 3H). LC-MS m/z (M + H⁺):

578.39; R_τ = 1 .1 1.

F. 8~CYCLOBUTYL-2-[({(3R)-4-[(4-METHOXY-2,6-DIMETHYLPHENYL)SULFONYL]-6,6- DIMETHYLM0RPH0LIN-3-YL}METH0XY)ACETYL]-2,8-DIΛZASPlR0[4.5]DECΛNE (COMPOUND 6)

The title compound is prepare as a° pale yellow film essentially as described in Example ID, above. ¹H-NMR (400 MHz, CDCl₃) δ: 6.62 (s, 2H), 3.81 (s, 3H), 3.80-3.98 (m, 4H), 3.70-3.76 (m, IH), 3.58-3.63 (m, I H), 3.47-3.53 (m, IH), 3.37-3.44 (m, IH), 3.27-3.35 (m, 2H), 3.14- 3.19 (m, IH), 2.94-3.07 (m, 2H), 2.63-2.77 (m, IH), 2.60 (s, 6H), 1.53-2.58 (m, 17H). 1.50 (s, 3H), 1.1 1 (s, 3H). LC-MS m/z (M + H^'): 578.23; R₇ = 1.16 min.

EXAMPLE 2. SYNTHESIS OF REPRESENTATiVE SUBSTITUTED AZOSPIRO INTERMEDIATES

A. 9-BENZYL-2,4-DIOXO-3 ,9-DIAZASPIRO[S₅S]UNDECANE- US-DICARBONITRILE

A solution of ethyl cyanoacetate (0.2 moϊ) and l-benzyl-4-piperidone (0.1 mol) is added to 80 ml of 7 N NH₃ in MeOH with stirring at 0 ⁰C. The solution is stored in the refrigerator for 2 days, and the precipitate is filtered, washed with cold MeOH, and dried. The salt is treated with 200 ml of hot Λvater, and the boiling suspension is acidified with 2N HCl (150 ml). The resulting solution is cooled to rt to give a yellow precipitate, which is filtered to afford the title compound. LC-MS (M+l ) 323.05 ( § ) ^■

B. 9-BENZYL-3,9-DIAZASPIRO[5.5]UNDECANE-2,4-DIONE

A mixture of 9-benzyl-2,4-dioxo-3,9-diazaspira[5,5]undecane-l,5-dicarbonitriie (60 mmol) in

65% H₂SO₄ (39 ml) is refluxed for 2 hours. The solution is cooled to 0⁰C, and neutralized with IO N

NaOH to pH about 8. The solution is extracted with DCM (3 x 25 mL). The combined organic layers are dried (MgSO₄) and solvent removed in vacuo to give the title compound. ¹H NMR (CDCl₃) δ

8.01 (IH, s), 7.22-7.34 (5H, m), 3.52 (2H, s), 2.52 (4H, s), 2.41-2.51 (4H, m). 1.59 (4H, t).

C. 3-BENZYL-3,9-DIA2ASPIR0[5.5]UNDECΛNE

To a solution of 9-berιzy!-3,9-diazasρiro[5.5]undecane-2,4-dione (24.6 mmo!) in ether (30 ml), IM LAH (74 mL) is added. The resulting mixture is heated under reflex for 8 hours. The mixture is cooled to rt, and water (20 ml) is added slowly. After stirring for 1 hr, the mixture is filtered. The filtrate is dried over Na₂SO₄, filtered and the solvent is removed to give the title compound. ¹H NMR (CDCl₃) δ 7.23-7.31 (5H, m), 3.49 (2H, s), 2.77 (4H, t), 2.38 (4H, t), 1.69 (I H, s), 1.52 (4H, t), 1.41 (4H, t).

D. 3-BENZYL-9-CYCLOBUTYL-3_;9-DIAZASPIRO[5.5JUNDECANE

3-Benzyl-3,9-diazaspiro[5.5]undecane (6.14 mmol) is dissolved in 2.5% acetic acid in DCM (24 mL) at 0 ⁰C and treated dropwise with cyclobutanone (9.21 mmol). The mixture is stirred for 30 min and then sodium triacetoxyborohydride (9.21 mmol) is added in portions. The reaction mixture is stirred at rt overnight, basified with saturated sodium carbonate solution and extracted with DCM. The combined extracts are washed with water, and then brine, dried over anhydrous Na₃SO₄ and concentrated in vacuo to afford the title compound. E. 3-CYCLOBUTYL-S^-DIAZASPIRO[S-S]UNDECANE

3-Benzyl-9-cyclobutyl-3,9-diazaspiro[5.5]undecane (6 mmol) is dissolved in EtOH (20 nil). Palladium hydroxide (0.5 g, 20% on carbon powder, moisture ca. 60%) is added and the mixture is stirred at rt under hydrogen (50 psi) overnight. The reaction mixture is filtered through ceiite and the filtrate is concentrated in vacuo to afford the title compound.

F. 3-BENZYL-9-METHYL-3,9-DIAZA-SPIRO[5. S]UNDECANE

Sodium cyanoborohydride (1.3 g, 20 mmol) is added to a solution of 3-benzyi-3,9-diaza- spiro[5.5]undecane (980 mg, 4.01 mmol) and acetonitriie (20 mL) cooled to 0 ⁰C. 37% Aqueous formaldehyde (9.5 mL) is added in one portion. After 5 min, glacial acetic acid (2.1 mL) is added in three portions over 1 h. After 20 h, the mixture is made basic with 1 M aqueous NaOH and then extracted with CH₂CI₂ (4 X 50 mL). The combined organic layers are dried over

filtered, and concentrated. Purification by flash column chromatography (2% NH₄OH in 4: 3 CH₂C^MeOH, 75 g SiO₂) affords the title compound as a pale yellow oil. LC-MS m/∑ (M + H⁺): 259.29 (§).

G. 3-ME'i HYL-3 ,9-DIAZA-SPΓRO[5.5]UNDECANE

3-Benzyl-9-methyi-3,9-diaza-spiro[5.5]undecane is dissolved in a mixture of 20 mL EtOH and 2 mL acetic acid. Palladium hydroxide (1 g, 20 wt. % on carbon) is added and the reaction mixture hydrogenated on a Paar apparatus at 50 ⁰C and 50 psi for 22 h. The reaction mixture is filtered through Ceiite and concentrated in vacuo to afford the title compound as a thick, light yellow oil. ¹H-NMR (400 MHz, CDCl₃) ά 2.79 (t, 4H). 2.34 (t, 4H), 2.26 (s, 3H), 1 .89 (s, IH), 1.54 (t, 4H), 1.42 (t. 4H). LC-MS m/z (M + IT): 169.20 (§).

H. 8-BENZYL-2-CYCLOBUTYL-2,8-DIAZASPIRO[4, S]DECANE

A solution of 8-benzyl-2.8-diazasρiro[4.5]decane (Biorganic and Medicinal Chemistry Letters (1998) 5: 1851-56) (10 mmol) is dissolved in 2.5% acetic acid in DCM (40 mL) at 0 dropwise with cyclobutanoπe (15 mmol). The mixture is stirred for 30 min and then sodium triacetoxyborohydride (15 mmol) is added in portions. The reaction mixture is stirred at it overnight, basifϊed with saturated sodium carbonate solution and extracted with DCM. The combined extracts are washed with water, and then brine, dried over anhydrous Na₂SO₄ and concentrated in vacuo to afford the title compound.

J. 2-CYCLOBUTYL-2,8-DIAZASPIRO[4,5]DECANE

8-Benzyl-2-cyclobutyl-2,8-diazaspiro[4.5]decane (7 mmol) is dissolved in a mixture of 30 niL EtOH and 3 mL acetic acid. Palladium hydroxide (1 g, 20 wt. % on carbon) is added and the reaction mixture hydrogenated on a Paar apparatus at 50 ⁰C and 50 psi for 22 h. The reaction mixture is filtered through Celite and concentrated in vacuo to afford the title compound. ¹H-NMR (400 MHz, CDCl₃) & 1.53-1.70 (m, 6H), 1.92-1.97 (m, 4H)₅ 2.31-2.49 (m, 8H), 2.51 -2.80 (m, 2H), 2.82-2.90 (m, IH).

J. 8-BENZYL-2,8-DIAZA-SPIRO[4.5]DECANE-2 -CARBOXYLIC ACID TERT-BUTYL ESTER

To a solution of 8-benzyl-2,8-diazaspiro[4.5]decane (Biorganic and Medicinal Chemistry Letters (1998) 5:1851-56) (2.3g, 10 mmol) and TEA (2.02g, 20 mmol) in DMF (50 ml) is added di- tert-butyl dicarbonate (2.4g, 1 1 mmol). The solution is stirred at rt overnight and evaporated to dryness. The residue is dissolved in DCM (50 mL) and washed with 2M potassium carbonate solution. The aqueous layer is extracted with DCM (4 x 50 mL), and the organics are combined, washed with brine, dried and evaporated to give the title compound.

K. 2.8-DlAZA-SPIRO[4.5]DECANE-2-CARBOXYLIC ACID TERT-BUTYL CSTER

8-Benzyl-2,8-diaza-spiro[4.5]decane-2-carboxylic acid tert-buty\ ester (5 rπmoi) is dissolved in a mixture of 20 mL EtOH and 2 mL acetic acid. Palladium hydroxide (1 g, 20 wt. % on carbon) is added and the reaction mixture hydrogenated on a Paar apparatus at 50 ⁰C and 50 psi for 22 h. The reaction mixture is filtered through Celite and concentrated in vacuo to afford the title compound. L. 8-CYCLOBUTYL-2,8-DIAZA-SPIRθ[4.5]DECANE-2-CARBOXYLIC ACID TERT-BOTYL ESTER

2,8-Diaza-spiro[4.5]decane-2-carboxylic acid fer/-butyi ester (5 mmol) is dissolved in 2.5% acetic acid in DCM (20 niL) at 0 ⁰C and treated dropwise with cyclobutanone (7 mmoi). The mixture is stirred for 30 min and then sodium triacetoxyborohydride (7 mmoi) is added in portions. The reaction mixture is stirred at it overnight, basified with saturated sodium carbonate solution and extracted with DCM. The combined extracts are washed with water, and then brine, dried over anhydrous Na₂SC^ and concentrated in vacuo to afford the title compound.

M. S-CYCLOBUTYL^δ-DIAZA-SPIROl/LSlDECANE

To a solution of 8-cycIobutyl~2,8-diaza-sρiro[4.5]decane-2-carboxyiic acid fer/-butyl ester (5 mmol) in DCM (20 ml) is added dropwise trifiuoracetic acid (50 mmol). The solution is stirred at rt for 6 hr and evaporated to dryness. The residue is dissolved in DCM (25 ml) and washed with 2M potassium carbonate solution. The aqueous layer is extracted with DCM (4 x 25 ml) and the combined organics are washed with brine, dried and evaporated to give the title compound, ¹H-NMR (400 MHz, CDCl₃) δ: 1.54-1.61 (m, 4H), 1.63-1.70 (m, 2H), 1.83-1.88 (m, 2H), 1 .97-2.03 (m, 2H), 2.10-2.29 (brm, 4H), 2.63-2.67 (m. IH), 2.71 (s, 2H), 2.98 (t, 2H), 3.19-3.21 (m, 3H).

EXAMPLE 3. SYNTHESIS OF REPRESENTATIVE SPIROCYCLIC SULFONAMIDES AND RELATED COMPOUNDS

A. 2-CYCLOBUTYL-8-({3 -[(4-METHOXY-2, 6-DIMETHYLPHENYL)SULFONYL]BUTOXY} ACETΎL)-2,8-

DIAZASPIRO[4.5]DECANE (COMPOUND 7)

Step 1. 4-Methoxy-2,6-dimethylbenzenethioI (I)

4-Methoxy-2,6-dimethylbenzenesu!fonyl chloride (6 g, 25.6 mmol) is added dropwise to a suspension of LAH (2.43 g, 64.1 mmol) in THF (200 raL) at O ⁰C under N₂. The mixture is stirred at rt for 2h, and then refluxed for 3 h. The reaction mixture is cooled to O ⁰C, quenched with Na₂SC^ 1 OH₂O, and then stirred at rt for 1 h. The suspension is filtered through celite, and the filter cake is washed with THF. The filtrate and wash are combined, and concentrated under reduced pressure to afford the title compound as a yellow oil. LC-MS m/z (M + If ): 169.1 1 (§).

Step 2. /-'^-Buryl{3-[(4-methoxy-2,6-dimethylphenyl)thio]propoxy}dimethylsilane (II)

To a suspension of NaH (1.09 g, 27.2 mmoL 60% in mineral oil) in DMF (20 mL) at 0 ⁰C under N₂ is added a solution of 4-methoxy-2,6-dimethylbenzenethiol in DMF (20 mL) dropwise. After stirring for 20 min, (3-bromopiOpoxy)(/er/-butyl)dimethyisilane (5.05 mL, 21.7 mmol) is added. The reaction is warmed to rt. After stirring for 16 h, the reaction is quenched with 50% saturated brine, and extracted with EtOAc (2x). The combined organic extracts are washed with water and brine, dried over Na₂SO₄. and concentrated under reduced pressure. Purification by silica gel chromatography (hexane/EtOAc: 95/5) gives the title compound as a yellow oil. LC-MS m/z (M + H): 341.17 (§). Step 3. fer/-Butyl{3-[(4-methoxy-2,6-dimethylphenyi)sulfonyl]propoxy}dimethylsilane (III)

To a solution of the oil generated in step 2 in CH₂Cl₂ (100 mL) at 0 ⁰C is added mCPBA

(77%, 8.40 g, 37.4 mmol) portion-wise. The reaction is wanned to rt. After stirring at rt for 16 h. the reaction mixture is diluted with CH₂Cl₂, washed with 50% sat. NaHCO^ and brine, dried over Na₂SO₄. and concentrated under reduced pressure. Purification by silica gel chromatography (hexane/EtOAc:

4/1) gives the title compound as a colorless oil. LC-MS m/z (M + H⁴): 373.14 (§).

Step 4. 3-[(4-Melhoxy-2,6-dimethylρhenyl)suifonyl]butan-l-ol (IV)

To a solution of ;er^butyl{3-[(4-methoxy-2,6-dimethylphenyl)sulfonyl]propoxy} dimethylsiianc (2.2 g, 5.91 mmol) in THF (30 mL) at -78 ⁰C under N₂ is added n-BuLi (1.6 M in hexane, 4.25 mL, 6.80 mmol) dropwise. After stirring at -78 ⁰C for I h, iodomethane (0.37 mL, 5.91 mmol) is added. The mixture is stirred at -78 ⁰C for 30 min, then allowed to warm to rt, and stirred at rt overnight. The reaction mixture is quenched with 50% sat. NH₄Cl. and extracted with EtOAc. Organic layers are combined, washed with brine, dried over Na₂SO₄, and concentrated under reduced pressure to afford a yellow oil that contains a mixture of the title compound and starting material. About 2/3 of the oil is dissolved in THF (6 mL), and treated with TBAF (IM solution in THF, 5.3 mL) at rt overnight. The reaction is diluted with EtOAc, washed with 50% brine and brine, dried over Na₂SO₄ and concentrated under reduced pressure. The residue is purified by reverse-phase HPLC to afford 3-[(4-methoxy-2,6-dimethylρheny]) sulfonyl]propan-l-ol (colorless oil) and the title compound as a colorless oil. LC-MS m/z (M + H^*): 273.13 (§). Step 5. /er/-Butyl{3-[(4-methoxy-2,6-dimethylphenyl)sulfonyl]butoxy}acetate (V)

To a solution of 3-[(4-methoxy-2₅6-dimethylphenyl)sulfonyl]butan-I- ol (380 mg, 1.40 mmol) in DMF (5 mL) at 0 ⁰C is added NaH (60% in mineral oil, 83.8 mg, 2.10 mmol). After stirring at 0 ⁰C for 20 min, /-butyl bromoacetate (246.3 μL, 1.67 mmol) is added. The reaction is allowed to warm to rt. After stirring at rt for 16 h. the reaction is quenched with 50% sat. NH₄Cl, and extracted with EtOAc. Combined organic layers are washed with water and brine, dried over Na₂SO₄, and concentrated under reduced pressure. Purification by silica gel chromatography affords the title compound as a colorless oil. LC-MS m/z (M + Na^τ): 409.13 (§).

Step 6. {3-[(4-Methoxy-2,6-dimethylphenyl)suifonyl]butoxy} acetic acid (VI)

/<?r/-Butyl{3-[(4-methoxy-2,6-dimethylphenyl)sulfonyi]butoxy}acetate (349 mg, 0.90 mmol) is treated with TFA (1 mL) at rt for 10 min. TFA is then removed under reduced pressure at rt. Purification by flash chromatography (hexane/EtOAc: 1/3) affords the title compound as a white solid. LC-MS m/z (M + H⁺): 331.11 (§). Step 7. 2-Cyclobutyl-8-({3-[(4-melhoxy-2,6-dimethylphenyl)suifonyI3butoxy}acety]>2₃8- ciiazaspiro[4.5]decane (VII; Compound 7)

A 1.0 M solution of TEA in toluene (0.12 niL) is added to a solution of the acid VI (20 mg, 60 μmol), 2-cyclobutyl-2,8-diazaspiro[4.5]decane (! 0.5 mg, 60 μmol), and dimethylacetamide (0.3 niL) under N₂. A 0.2 M solution of 2-chIoro-l,3-dimethylimidazolidinium chloride in acetoniirile (0.5 mL) is added. The reaction vessel is sealed and the mixture is warmed to 50 ⁰C for 2.5 h. After cooling to ambient temperature, 1 M aqueous NaOH (1.5 mL) is added and then the volatiles are removed under reduced pressure. The aqueous residue is extracted with EtOAc (2 X 1.5 mL). The organics are loaded onto two 0.5 g SCX columns. Each column is washed with EtOAc (3 X 3 mL) and then eluded with 10:5:2 EtOAc : MeOH : TEA (4.5 mL). Solvent removal under reduced pressure affords the title compound as a yellow oil. ¹H-NMR (400 MHz, CDCl₃) δ. 6.64 (s, 2H), 4.02-4.14 (m, 2H), 3.82 (s, 3H), 3.20-3.64 (m, 8H), 2.84 (m, IH), 2.66 (s, 6H), 2.25-2.60 (m, 5H). 1.90-2.30 (m, 4H), 1.65-1.82 (m, 6H), 1.30 (d, 3H). LC-MS m/z (M + H⁺): 507.28; R_T = 0.91 min.

B. 3-CYCLOBUTYL-9-( {3 -[(4-METHOXY^₅O-DIMETHYLPHENYL)SULFONYL]PROPOXY) ACETYL) -3,9-DIAZASPJRO[5. S]UNDECANE (COMPOUND 8)

The title compound is made essentially as described in Example 3 A, above. ¹H-NMR (400 MHz, CDCl₃) δ: 6.64 (s, 2H), 4.09 (s, 2H), 3.82 (s, 3H), 3.60(t, 2H), 3.52 (t, 2H), 3.34 (t, 2H), 3.20- 3.24 (m, 2H), 2.66 (s, 6H), 2.20-2.60 (m, 4H), 2.04-2.30 (m, 4H), 1.60-1.80 (m, 7H), 1.44-1.47 (m, 4H). LC-MS m/z (M + H> 507.20; R₁ = 1.10 min.

EXAMPLE 4. ADDITIONAL REPRESENTATIVE COMPOUNDS

Using routine modifications, the starting materials may be varied and additional steps employed to produce other compounds provided herein. Compounds listed in Tables I and II are prepared using such methods. All compounds in Table I exhibit an IC₅Q at Bi (determined as described in Example 7) that is 5 micromoiar or less. The molecular weight (determined as described above, and presented as M+I ) is shown in the column headed "MS" in Table I, with retention time (R_T) given in minutes. Table 1

Representative Spirocyclic Sulfonamides and Related Compounds

Compound Name ET MS

0.92 522.29

1.14 558.23

1.10 468.22 ide

1.05 510.26

0.88 496.28

Compound Name R_τ MS

0.91 510.29

1.10 510.3

1.10 518.1

2-chloro-N- {2-[2-(2-cycIobutyl- 2,8-diazaspiro[4.5]dec-8-yl)-2- oxoelhoxy] ethyl } -4,6- 1.1 544.2 dimethoxy-N- methylbenzenesulfonamtde

4-methoxy-N ,2, 6-trimethy 1-N -

{2-[2-(2-melhyl-2,8- diazaspiro[4.5]dec-8-yl)-2- 1.1 468.2 oxoethoxy]ethyl}benzenesιιlfon amide

3-cyclobuty!-9-[({4-[(2,4- dichlorophenyl)suIfonyI]-6,6- dimethylmorpholin-3- 1.2 602.1 yl}methoxy)acetyl]-3,9- diazaspiro[5.5]undecane

Compound Name ET MS

3-[(2-{[(4-methoxy-2,ό- dimethylphenyl)sulfonyl](methy

I)amino}ethoxy)acetyl]-N,N- dimethyI-3- 1.2 538.3 azaspiro[5.5]undecane-9- carboxamide

0.9 524.3

Table Il Additional Representative Spirocyclic Sulfonamides and Related Compounds

EXAMPLE 5. PREPARATION OF B_rTRANSFECTED CELLS

This Example illustrates the preparation of B₁ -transfected cells for use in Bi binding and modulation assays (Examples 6 and 7).

Cynomolgus macaque lung total RNA is isolated as described by Chomzynski et al. (1987) Anal. Biochem, 162: 156-159. A cDNA encoding B₁ is cloned from the total RNA by reverse transcriptase-polymerase chain reaction (RT-PCR) with the following oligonucleotides:

Primer 1 : GGCGCTAGCCACCATGGCATCCTGGCCCCCTC (SEQ ID NO:1) Primer 2: AGCCGTCCCAGATCTGAAC (SEQ ID NO:2) Primer 3: GATCTGGGACGGCTTGGATG (SEQ ID NO:3) Primer 4: CGGAGCTCTTAATTCCGCCAGAAAAGTTGGA (SEQ ID NO:4)

Primer pairs 1 & 2 and 3 & 4 are used to generate overlapping cDNA fragments corresponding to the entire protein coding sequence of cynomolgus macaque B| cDNA are isolated and linked to fonn the full-length coding sequence (GenBank Accession Number AY788905). The construct is cloned into pcDNA 3.1 (invitrogen, Carlsbad, CA) and transfected into Chinese hamster ovary (CHO) cells using Lipofectamine (Invitrogen), resulting in cynomolgus macaque Bj-expressing CHO cells. Alternatively, the construct is cloned into pBAKPAK9 (Clontech, Mountain View, CA) and transfected into Sf9 cells to generate clonal bacuiovirus stocks. Clonal cell lines stably expressing the cynomolgus macaque B_; receptor are selected in G418. A single clonal line that exhibits high levels of receptor expression is chosen for use in binding and calcium mobilization assays (Examples 6 and 7). Clonal bacuiovirus stocks are used to infect Sf9 cells such that the infected cells express high levels of recombinant B] receptors. These cells are used in radioligand binding assays (Example 6).

EXAMPLE 6. B₁ RECEPTOR BINDING ASSAYS

This Example illustrates a representative B] receptor binding assay that may be used to determine the binding affinity of compounds for B|.

A. [3 H]-DESARG^!0KALLIDIN BINDING TO INTACT IMR-90 CELLS OR CHO CELLS STABLY EXPRESSING

RAl B]

IMR-90 cells, which εndogenously express human Bi, are seeded into 24 well plates at

65,000 cells per well, cultured overnight, and then treated for 3 h with 0.2 ng/mL interleukin-1 beta to induce B₁ expression (Menke, et al. (1994) J. Biol. Chem. 269:21583-86). CHO cells stably expressing rat B₁ are seeded into 24 well plates at 200,000 cells per well and cultured overnight. The cells are then washed 3 times with phosphate buffered saline (PBS). One hundred fifty microliters of binding buffer (50 mM Tris 7.4. O. J 4 mg/mL, bacitracin, and 1 mg/mL BSA) is added to each well.

Various concentrations of test compound are added to each well from DMSO solutions such the final DMSO concentration is 1% by volume: some wells receive DMSO only, and some wells receive

DMSO plus 10 μM desArg'^ϋKallidin to define non-specific binding. All wells then receive 0.3 nM (final concentration) [3H]-desArg¹⁰Kallidin. The plates are allowed to sit for 2 h at room temperature. Cells are then washed three times, and lysed with 400 μ! Ultima Gold scintillation fluid (PerkinElmer; Boston. MA; 20 min incubation). The fluid is then transferred to counting vials counted in a Packard liquid scintillation counter (PerkinElmer). The number of counts present in the scintillation fluid is plotted as a function of antagonist compound concentration and fitted to a logistical equation using SigmaPlot (Systat Software, Point Richmond, CA) to determine each compound's IC₅₀ and Kj (e.g., as described by Szailasi, et al. (1993) J. Pharmacol. Exp. Ther. 2(5)5:678-83).

B. [3 H]-DESARD¹⁰I¹CALLIDIN BINDIMG TO MEMBRANE HOMOGENATES OF SF9 CELLS EXPRESSING CYNOMOLGUS MACAQUE B] Sf9 cells infected with a baculovirus carrying the coding sequence for cynomolgus macaque

Bi are harvested by centrifugation and frozen at -80 ⁰C. Pellets are subsequently resuspended on ice in THs buffered saline (TBS; 50 mM Tris (pH 7.4), 120 mM NaCi), and cells are homogenized using a polytron for 30 seconds. The crude membrane fraction is collected by centrifugation at 20,000 rpm.

Membranes are washed two times with TBS and collected by centrifugation each time. Protein content of the membranes is determined after the last wash and the concentration is adjusted to 0.7 μg/uL with binding buffer (50 mM Tris 7.4, 0.14 mg/niL bacitracin, and 1.0 mg/mL BSA). To perform the binding assay, 150 microliters of membrane fraction is added to each well of a 96-well plate along with 50 μl [Η]-desArgⁱ⁰Kallidin (0.3 nM final) and test compound in DMSO (final

DMSO concentration = 1%). Some wells receive DMSO only, and some wells receive DMSO plus 10 μM desArg¹⁰Kallidin to define non-specific binding. The 96 well plates are allowed to sit for 2 h at room temperature. Membrane proteins are then harvested by filtration onto GF/C filtermats

(PerkinElmer) pre-soaked for 1 hr in 0.5 % polyethyienimine. After filtration, filters are dried and then counted in a Beta plate counter. The number of counts present in the scintillation fluid is plotted as a function of antagonist compound concentration and fitted to a logistical equation using SigmaPlot (Systat Software, Point Richmond, CA) to determine each compound's IC₅₀ and K, {e.g., as described by Szailasi, et al. (1993) J. Pharmacol. Exp. Ther. 266:678-83).

EXAMPLE 7. CALCIUM MOBILIZATION ASSAY

This Example illustrates representative calcium mobilization assays for use in evaluating test compounds for agonist and antagonist activity. Cynomolgus macaque B_rexpressing CHO cells (Example 5) are plated in a 96 well plate.

The cells are cultured for 1 day, after which culture media is emptied from the plate and replaced with 50 μl of KRH (Krebs-Ringer HEPES buffer: 25 mM HEPES, 5 mM KCl, 0.96 mM NaH₂PO4, 1 mM MgSOj_f, 2 mM CaCI₂, 5 mM glucose, 1 mM probenecid, pH 7.4) supplemented with the calcium- sensitive fluorescent dye Fluo4-AM (5 μg/ml; Teflabs, Austin, TX). The cells are then incubated at 37 ⁰C in an environment containing 5% CO₂. After the 1 hour incubation, the dye solution is removed from the plate, the plate is washed once with KRH, and 100 μL KRH is added.

DETERMINATION OF B₁ AGONIST EC₅₀

100 μL KRH + 2% DMSO is added to each well of cells, such that the final volume in each well is 200 microliters and the final DMSO concentration is 1%. Various concentrations of the B] agonist desArg^l0Kai]idin are added. Addition of desArg¹⁰KaIHdJn elicits a fluorescent response as consequence of increased intracellular calcium. This response is measured with a FLIPR instrument

(Moiecuϊar Devices, Sunnyvale, CA) and determined to be desArg'°Kallidin concentration dependent.

A plot of maximum fluorescent response as a function of desArg'°Kalligin is generated and an EC₅₀ (concentration required to elicit a 50% of maximal response) for the response is determined using the equation: y=a*(l/(l+(b/x)^c))

In this equation, y is the maximum fluorescence signal, x is the concentration of the Bi agonist, a is the E_max, b corresponds to the EC₅₀ value and c is the Hill coefficient. By replacing the desArg'°Kallidin with a test compound, this assay is also used to assess B| agonist activity of the test compound.

DETERMINATION OF ANTAGONIST ACTIVITY

Various concentrations of test compounds are added to the cell plate prepared as described above in 100 μL KRH + 2% DMSO, such that the final volume in each well is 200 microliters and the final DMSO concentration is 1%. The EC₅₀ concentration of desArg^I0Kallidin is then added to each weli of plates containing test compound to determine the extent to which each test compound inhibits an agonist-induced B; response. The maximum fluorescent response is plotted as a function of test compound concentration in order to determine the IC₅₀ (concentration required to inhibit 50% of the effect of agonist) for each compound at Bi. Antagonists of Bi decrease this response by at least about 20%, preferably by at least about 50%, and most preferably by at least 80%, as compared to matched control (i.e . cells treated with desArg¹⁰Kallidin at the EC₅₀ concentration in the absence of test compound), at a concentration of 10 micromolar or less, preferably 1 micromolar or less.

Alternatively, the data is analyzed as follows. First, the average maximum relative fluorescent unit (RFU) response from negative control wells (no agonist) is subtracted from the maximum response detected for each of the other experimental wells. Second, average maximum RFU response is calculated for the positive control wells (agonist wells). Then, percent inhibition for each compound tested is calculated using the equation:

_TΛ τ i -1 -, - i _™ , _™ r Peak Signal in Test Wells 1

Percent Inhibition = 100 - 100 x ,r— ; — : — ^ — r . -, , „-

L Peak signal in Agontst Wells J

The % inhibition data is plotted as a function of test compound concentration and test compound IC_;o is determined using a linear regression in which x is ln(concentration of test compound) and y is ln(percent inhibition^ 100 - percent inhibition). Data with a percent inhibition that is greater than 90% or less than 15% are rejected and are not used in the regression. The IC₅₀ is e (-mlercept^Ji]ope)

EXAMPLE 8. MDCK CYTOTOXICITY ASSAY This Example illustrates the evaluation of compound toxicity using a Madin Darby canine kidney (MDCK) cell cytotoxicity assay.

1 μL of test compound is added to each well of a clear bottom 96-well plate (Packard, Meriden, CT) to give final concentration of compound in the assay of 10 μM, 100 μM or 200 μM. Solvent without test compound is added to control wells. MDCK cells, ATCC no. CCL-34 (American Type Culture Collection, Manassas, VA), are maintained in sterile conditions following the instructions in the ATCC production information sheet. Confluent MDCK cells are trypsinized, harvested, and diluted to a concentration of 0.1 x 10⁶ cells/mL with warm (37°C) medium (VITACELL Minimum Essential Medium Eagle, ATCC catalog # 30- 2003). 100 μL of diluted cells is added to each well, except for five standard curve control wells that contain 100 μL of warm medium without cells. The plate is then incubated at 37°C under 95% O₂, 5% COT for 2 hours with constant shaking. After incubation, 50 μL of mammalian cell lysis solution (from the Packard {Meriden, CT) ATP-LITE-M Luminescent ATP detection kit) is added per well, the wells are covered with PACKARD TOPSEAL stickers, and plates are shaken at approximately 700 rpm on a suitable shaker for 2 min. Compounds causing toxicity will decrease ATP production, relative to untreated cells. The

ATP-LITE-M Luminescent ATP detection kit is generally used according to the manufacturer's instructions to measure ATP production in treated and untreated MDCK cells. PACKARD ATP LITE-M reagents are allowed to equilibrate to room temperature. Once equilibrated, the lyophiiized substrate solution is reconstituted in 5.5 mL of substrate buffer solution (from kit). Lyophiiized ATP standard solution is reconstituted in deionized water to give a 10 mM stock. For the five control wells, 10 μL of serially diluted PACKARD standard is added to each of the standard curve control wells to yield a final concentration in each subsequent well of 200 11M, 100 nM, 50 11M, 25 nM, and 12.5 nM. PACKARD substrate solution (50 μL) is added to all wells, which are then covered, and the plates are shaken at approximately 700 rpm on a suitable shaker for 2 min. A white PACKARD sticker is attached to the bottom of each plate and samples are dark adapted by wrapping plates in foil and placing in the dark for 10 min. Luminescence is then measured at 22°C using a luminescence counter (e.g., PACKARD TOPCOUNT Microplate Scintillation and Luminescence Counter or TECAN SPECTRAFLUOR PLUS), and ATP levels calculated from the standard curve. ATP levels in cells treated with test compoιmd(s) are compared to the levels determined for untreated cells. Cells treated with 10 μM of a preferred test compound exhibit ATP levels that are at least 80%, preferably at least 90%, of the untreated ceils. When a 100 μM concentration of the test compound is used, cells treated with preferred test compounds exhibit ATP levels that are at least 50%, preferably at least 80%, of the ATP levels detected in untreated cells.

Claims

What is claimed is:

3. A compound of the formula:

or a pharmaceutically acceptable salt or hydrate thereof, wherein: == represents a single or double bond; Ar is phenyl or a 5- or 6-membered heteroaryl, each of which is optionally substituted on one or more ring carbon atoms with a substituent independently chosen at each occurrence from R_a; A is N, CH or C; B is N or CH;

D is N(R₁₈), CH(R,_b), O, SO or SO₂;

Y is a group of the formula (CH₂X-Z-(CH₂)_P that is substituted with from 0 to 4 substituents independently chosen from amino, hydroxy, oxo, cyano, Cj-C₆alkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, Cj-C₆haloalkyl and substituents of the same carbon atom or adjacent carbon atoms that are taken together to form Cs-Cgcycloalkyl; wherein

Z is absent, O, S or NR₆, wherein R₆ is hydrogen or C]-Qalkyl; and r and p are independently chosen integers ranging from O to 6; each n is independently 1 , 2 or 3; each R_a is independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfoπyl and -COOH; (ii) Cj-Qalkyl, C₂-C₆alkenyl, C₂-Qaikynyl, Cj-Qhaloalkyl, C₂-Qalkyi ether, (C₃-C₃cycloalkyl)C₀- C₄alkyi, C|-C₆alkoxy, C]-C₆alkylthio, CpCsalkylsulfinyl, CrQalkoxycarbonyl, C_r QalkylsulfoπylCo-Cjaikyl, mono- or di-(C]-C₆alkyi)aminoCo-Qalkyi, mono- or di-(Ci- QalkyI)aminosulfonylCo-C₄a!kyl, and (4- to 8-membered heteiOcycioalkyl)Co-C₄alkyl; each of which is substituted with from O to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; and

(iii) groups that are taken together with an R₃ attached to an adjacent ring carbon atom to form a fused 5- to 10-membered carbocycle or heterocycle that is substituted with from O to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, oxo, C_r Qalkyl, Ci-Cβhaloalkyl, Ci-C₆alkoxy, Ci-C₆haloalkoxy, and mono- or di-(C]-C₆alkyl)aminoCo- C₄alkyl; R₂ and R₃ are:

(i) independently chosen from: (a) hydrogen; and

(b) C,-C₆alkyL Q-QalkenyL C_rQaIkynyl, Q-Qhaloalkyl, and (Q-QcycloalkyOQ-Qalkyl, each of which is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, amino and Q-Qalkyi; or

(Ii) taken together to form a 4- to 10-membered carbocycie or heterocycle that includes A as a ring member and is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino and Q-Qalkyl; R₄₃ is:

(i) hydrogen; or

(ii) Q-Qalkyl, Q-Qalkenyl, Q-Qalkynyi, Q-Qhaloalkyl, mono- or di-(Q-Qalkyl)aminoQ- C₄alkyl, (Q-Qcarbocycle)Q-C₄alkyI or (4- to 8-membered heterocyc Ie)Q-QaUCyL each of which is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino, cyano, aminocarbonyl, aminosulfonyl, -COOH, Cj-C₄alkyl and Ci-C₄alkoxy; R₄b is:

(i) hydrogen, halogen, cyano. hydroxy, aminocarbonyl, aminosulfonyl or -COOH: or (ii) Q-Qaiky!, C₂-QaI kenyl, Q-Qalkynyl, Q-Qhaloalkyl, C_rC₆alkoxy, mono- or CU-(C₁- QalkyOaminoQ-Qalkyl, (C₃-Qcarbocycle)C₀-QaikyI or (4- to 8-membered heterocyc Ie)C₀- Qalkyl, each of which is optionally substituted and each of which is preferably substituted with from O to 4 substituents independently chosen from oxo, hydroxy, halogen, amino, aminocarbonyl, aminosulfonyi, -COOH and Q-Qa!kyl; and Each R₅ represents from O to 4 substituents independently chosen from oxo and C|-C₄alkyl.

2. A compound or salt or hydrate thereof according to claim 1 , wherein Ar is phenyl, naphthyl, pyridyl or pyrimidinyl, each of which is substituted with from O to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, CrC₆alkyl, C|-C₆haloalkyi, Q- Qalkoxy, and mono- or di-(C]-Qalkyi)aminoC₀-C₄aikyl.

3. A compound or salt or hydrate thereof according to claim 1, wherein Ar is phenyl that is substituted with from 0 to 4 substituents independently chosen from R_a.

4. A compound or salt or hydrate thereof according to claim 3, wherein Ar is phenyl that is substituted with I, 2 or 3 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro. CrQaikyl, Cj-Qhaloalkyl, Cj-C₆alkoxy, C_rC₆haloalkoxy, and mono- or di-(C|- C₆alky!)aminoCo-C₄aikyL

5. A compound or salt or hydrate thereof according to any one of claims 1-4, wherein each substituent represented by R_a is independently chosen from halogen, hydroxy, Ci-Cealkyl, Q- C₆alkoxy, C_rC₆haIoaIkyl and Cj-C₆haloalkoxy.

6. A compound or salt or hydrate thereof according to claim 5, wherein Ar is:

wherein:

Ri_a is halogen, hydroxy, CrC^alkyl, Q-Cealkoxy, Q-Cβhaloalkyl or C_rC₆haloalkoxy: and

Ri_b and R,_c are each independently hydrogen, halogen or methyl.

7. A compound or salt or hydrate thereof according to any one of claims I -6, wherein A is N.

8. A compound or salt or hydrate thereof according to any one of claims I -6, wherein A is CH.

9. A compound or salt or hydrate thereof according to any one of claims 1-6, wherein: A is C;

=== represents a double bond; and

R₂ and R₃ are taken together to form an optionally substituted aromatic ring.

30. A compound or salt or hydrate thereof according to any one of claims 1 -8, wherein R₂ and R₃ are independently chosen from hydrogen and C_rC₆aikyl.

11. A compound or salt or hydrate thereof according to claim 7, wherein the compound satisfies the formula:

wherein:

X is CHo, NR₇, O, S, SO or SO₂; m and q are independently 0, 1 or 2, such that the sum of m and q is 1, 2 or 3;

R₆ represents from 0 to 4 substituents independently chosen from oxo, hydroxy and Cj-C₈alkyl; and

R₇ is hydrogen or CrQaikyl.

12. A compound or salt or hydrate thereof according to claim 1 1, wherein the compound satisfies the formula:

13. A compound or salt or hydrate thereof according to claim 1 1 or claim 12, wherein R₆ represents from 0 to 4 substituents independently chosen from Q-^alkyl.

14. A compound or salt or hydrate thereof according to claim 13, wherein R₆ represents gem-dimethyl.

15. A compound or salt or hydrate thereof according to any one of claims 1-14, wherein Y is -CH₂-O-CH₂- -CH₂-NH-CH₂- -CH₃- -CH₂-CH₂- -CH₂=CH₂- Or -CH₂-CH₂-CH₂-.

16. A compound or salt or hydrate thereof according to any one of claims 1 -15, wherein the group designated:

17. A compound or salt or hydrate thereof according to any one of claims 1 -16, wherein B is nitrogen.

18. A compound or salt or hydrate thereof according to any one of claims 1-17, wherein D is O.

19. A compound or salt or hydrate thereof according to any one of claims 1-17, wherein: D is N(R₄₃); and

R_fø is hydrogen, C_rC₆alkyl, C_rC₆cyanoalkyl, Ci-C₆alkanoyl. (CrC₇cycloalkyl)Co-C₂aIkyI, phenylCo- C₂alkyl or (5- to 7-membered heterocycle)Co-C₂alkyl.

20. A compound or salt or hydrate thereof according to any one of claims 1 -17, wherein: D is CH(R_4I,); and R₄₁, is hydrogen, halogen, Cj-Cgalkyl, Ci-Cβalkoxycarbonyl, mono- or di-(C[-C₄alkyi)aminoCo-C₂alkyl, mono- or di-(Ci-C₄alkyl)amtnocarbonylCo-C₂alkyl, (C₃-C₇cycloaIkyl)C₀-C₂alkyI or phenyiC₀-

C₂alkyl.

21 . A compound or salt or hydrate thereof according to claim 1, wherein the compound satisfies the formula:

wherein:

Ri represents from 0 to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosuifonyl and -COOH; and (ii) Ci-Qalkyi, C₂-C₆alkenyl, C₂-C₆alkynyl, C_rC₆haIoalkyl₃ C,-C₆alkyl ether, (C₃-C₃cycloalkyl)C₀- Cjalkyl, Cj-Cealkoxy, CpQalkylthio, Ci-C₆a!kyisulfinyl₃ Cj-C₆aikoxycarbonyl, C_r CβalkylsulfonylCo-Cjalkyl, mono- or

mono- or di-(Cp C₆aIkyl)aminosulfony!Co-C₄alkyt, and (4- to 8-membered heterocycloalkyl)C₀-C/jalkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino;

X is CH₂, NH, O, S, SO or SO₂; w is 0, 1, 2, 3 or 4; and

R₆ represents from 0 to 4 substituents independently chosen from oxo, hydroxy and C_rC_salkyl.

22. A compound or sait or hydrate thereof according to claim K wherein the compound satisfies the formula:

wherein:

Ri represents from 0 to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano. amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; and (ii) Ci-QaJky], C₂-C₆alkenyl₃ C₂-C₆alkynyl, d-Qhaloaikyl, C₂-C₆alkyl ether, (C,-C₈cycloalky!)C₀- Qalkyl, d-C^alkoxy, Cj-Cgalkylthio, Ci-C₆alkylsulfinyl, Ci-C₆alkoxycarbonyl, C₁- C₆alkylsulfonylCo-C₄alkyl, mono- or di-(C|-Qalkyl)aminoCo-C₄alkyl. mono- or di-(C_r C₆alkyl)aminosulfonylC₀-C₄alkyi, and (4- to 8-membered heterocycloalkyl)C₀-C4alkyi; each of which is substituted with from O to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; w is 0, 1, 2, 3 or 4; and

R₂ and R₃ are independently chosen from hydrogen and CpCealkyl.

23. A compound or salt or hydrate thereof according to claim 1, wherein the compound satisfies the formula:

wherein:

R; represents from O to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyf, aminosulfonyl and -COOH; and (ii) C_rC₆a!kyi, C_rC₆alkeny], C₂-C₆alkynyl, d-Qhaloalkyi, C₂-C₆alkyl ether, (C₃ -Qcycloalky J)C₀- C₄alkyi, C_rC₆alkoxy, C_rC₆aikyIthio, Cj-Qaikylsulfinyl, CpQalkoxycarbonyL C,- CήaikylsuϊfonylCo-Ciaikyl, mono- or di-fCi-CealkyOaminoCo-C^alkyl, mono- or di-(C,- C₆aikyl)aminosulfonylCo-C₄aIkyl, and (4- to 8-membered heterocycloalkyl)Co-C₄aikyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; w is 0, 1 , 2, 3 or 4;

X is CH₂, CH, NH, N, O, S, SO or SO₂; and

Rg represents from 0 to 4 substituents independently chosen from oxo, hydroxy and Ci-Cgalkyl: or two substituents represented by R₈ are taken together to form a fused 5- or 6-membered carbocycle or heterocycle.

24. A compound or salt or hydrate thereof according to claim 1, wherein the compound satisfies the formula:

R₁ represents from O to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; and (ii) C_rC₆alkyJ, C₂-C₆alkenyl, C₂-C₆alkynyl, C_rC₆haloalkyl, C₂-C₆alkyl ether, (C₃-C₃cycloalkyi)C₀- C₄alkyl, Cj-C₆a!koxy. C_rC₆aIkylthio, C]-C₆alkylsulfinyl, C]-C₆alkoxycarbonyl, C_r CήalkylsuifonylC₀-C₄alkyl, mono- or di-(Cj-C₆alkyI)arninoCo-C₄alkyl, mono- or di-(Cj- C₆alkyl)aininosulfony]C₀-C^a[ky1, and (4- to 8-membered heteiOcyc!oalkyl)C₀-C₄alkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; w is 0, 1, 2, 3 or 4; and

R₂ and R₃ are independently chosen from hydrogen and C_rC₆alkyl.

25. A compound or salt or hydrate thereof according to any one of claims 20-24, wherein w is 1, 2 or 3.

26. A compound or salt or hydrate thereof according to claim I, wherein the compound satisfies the formula:

wherein:

Ri represents from 0 to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; and (ii) C,-C₆alkyl₅ C₂-C_ήalkenyl, C₂-C₆alkynyl, C,-C₆haioaikyl, C₂-C₆aikyl ether, (C₃-Cgcycloalky!)C₀- C₄alkyl, Ci-C₆alkoxy, C_rC₆alkylthio, Ci-Cealkylsulfinyl, Ci-Qalkoxycarbonyl, C_r CealkylsulfonylCo-C^aikyi, mono- or di-(C|-C₆alkyl)aminoCo-C₄alky!, mono- or di-(Cr C₆alkyl)aminosulfonyiCo-C₄aikyl, and (4- to 8-membered heterocycloalkyl)Co-C₄alkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino;

X is O or S;

Each s is independently 0 or 1 ;

R₂ and R₃ are independently chosen from hydrogen and CpCealkyl;

R₄₃ is CrQalky! or (C₃-C₇cycloaIkyl)C₀-C₂aIkyl; and

R₆ represents from 0 to 2 substituents independently chosen from Cj-Cgalkyi.

27. A compound or salt or hydrate thereof according to claim 1, wherein the compound satisfies the formula:

wherein:

R] represents from 0 to 4 substituents independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; and (ii) Ci-Qalkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, C]-C₆haioalkyl, C₂-C₆a]kyl ether, (Ci-C₃cycloalkyl)Co- C₄alkyl, C_rC₆alkoxy, C_rC₆alkylthio, C_rC₆alkyIsulfinyI, C_rC₆alkoxycarbony], C₁- C₆alkylsulfonylCo-C₄alkyl, mono- or di-(C]-Cήalkyl)aminoCo-C₄alkyl, mono- or di-(C_r Qalkyl)aminosulfonyiCo-C₄alkyi, and (4- to 8-membered heterocycioaIkyl)Co-C₄alkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; X is O or S; s is 0 or 1 ;

R₂ and Rj are independently chosen from hydrogen and Ci-C^alkyl; R.j_a is Q-Qalkyl, C_f-C_&cyanoaϊkyl,

(C₃-C₇cycloaIkyl)C₀-C₂aIkyl, phenylC₀-C;alkyl or

(5- to 7-membered heterocycle)Co-C₂alkyI; and R₀ represents from 0 to 2 substituents independently chosen from CpCgaJkyi.

28. A compound or sait or hydrate thereof according to claim 1 , wherein the compound is:

3-cyclobutyl-9-[({(3R)-4-[(4-methoxy-2,6-dimethyiphenyl)sulfonyl]-6.6-dimethylmorpholin-3- yl}methoxy)acetyl]-3,9-diazaspiro[5.5]undecane;

N-{2-[2-(9-cyclobutyl-3.9-diazaspiro[5.5]undec-3-y])-2-oxoethoxy]ethyl}-4-methoxy-N,2,6- trimethy 1 benzenesu lfonamide ;

2-cyclobutyI-8-[({(3R)-4-[(4-methoxy-2,6-dimethylpheny[)suifonyl]-6,6-dimethylmoφholin-3- yl}methoxy)acetyl]-2,8-diazaspiro[4.5]decane; N-{2-[2-(2-cyclobutyl-2,8-diazaspiiO[4.5]dec-8-y])-2-oxoethoxy]etliyl}-4-methoxy-N,2₃6- trimethylbenzenesulfbnamide;

3-[({(3R)-4-[(4-methoxy-2,6-dimethylphenyl)sulfonyl]-6,6-dimethylmoφholin-3-yl}methoxy)acetyl]- 9-methyI-3,9-diazaspiro[5.5]υndecane;

4-methoxy-N,2,6-trimethyl-N-{2-[2-(9-methy!-3,9-diazaspiro[5.5]undec-3-y[)-2- oxoethoxy]ethyl}benzenesulfonamide;

N-{2-[2-(8-cyclobutyl-2,8-diazaspiro[4.5]dec-2-yl)-2-oxoethoxy]ethyl}-4-methoxy-N,2,6- tri methy lbenzenesulfonamide:

8-cyclobu-yl-2-[({(3R)-4-[(4-methoxy-2,6-dimethylphenyl)sulfonyl]-6,6-dimethyimoφholin-3- yl}methoxy)acetyi]-2,8-diazaspiro[4.5]decane;

N-{2-[2-(9-benzry1-3_s9-diazaspiro[5.5]undec-3-yl)-2-oxoelhoxy]ethyl}-4-methoxy-N,2_J6- trimelhylbenzenesulfonamide;

N-{2-[2-(3,9-dia2aspiro[5.5]undec-3-yl)-2-oxoethoxy]ethyl}-4-metlioxy-N,2,6- trimethylbenzenesuifonamide;

N-{2-[2-(9-acety]-3,9-diazaspiro[5.5]undec-3-yl)-2-oxoethoxy]ethyI}-4-methoxy-N,2,6- trimethylbenzenesulfonamide;

N-{2-[2-(9-ethyl-3,9-diazaspiro[5.5]undec-3-yl)-2-oxoethoxy]ethyl}-4-methoxy-N,2,6- trimethylbenzenesulfonamide;

4-methoxy-N,2,6-trimethyI-N-{2-[2-oxo-2-(9-propyI-3,9-diazaspiro[5.5]undec-3- yl)ethoxy]ethyl}benzenesulfonamide;

3-cyclobutyl-9-({3-[(4-methoxy-2,6-dimethylphenyl)sulfonyi]propoxy}acetyl)-3,9- diazasρiro[5.5]undecane;

2-cyclobutyl-8-({3-[(4-methoxy-2,6-dimethyIphenyl)suJfoπyl]butoxy}acetyI)-2,8- diazaspiro[4.5]decane;

N-{2-[2-(9-isopropyl-3,9-diazaspiro[5.5]undec-3-yl)-2-oxoethoxy]ethyi}-4-methoxy-N,2,6- trimethylbenzenesulfonamide;

4-ch!oro-2,6-dimethoxy-N-methyI-N-{2-[2-(9-methyl-3,9-diazaspiro[5.5]undec-3-yl)-2- oxoethoxy]ethyl}benzenesulfonamide;

2-chloro-N-{2-[2-(2-cyclobutyl-2,8-diazasρiro[4,5]dec-8-yl)-2-oxoethoxy]ethyl}-4,6-dimethoxy-N- methy lbenzenesulfonamide;

4-methoxy-N,2,6-lrimethyl-N-{2-[2-(2-methyl-2,8-diazaspiro[4.5]dec-8-yl)-2- oxoethoxy]ethy]}benzenesuifonamide;

3-cyclobutyl-9-[({4-[(2,4-dichlorophenyl)sulfonyl]-6,6-dimethylmoφholin-3-yl}methoxy)acetyl]-3,9- diazaspiro[5.5]undecane;

4-methoxy-N,2,6-trimethyI-N-{2-[2-(3-oxa-9-azaspiro[5.5]undec-9-yi)-2- oxoethoxy]elhyl}benzenesulfonamide;

9-[({(3R)-4-[(4-methoxy-2,6-dimethylphenyl)suIfonyl]-6,6-dimetliylmoφholin-3-yl}methoxy)acetyI]- 3 -oxa-9-azaspiro[5.5 ] undecaπe;

3-[({4-[(2,3-dichlorophenyl)suIfonyl]-6,6-dimethylmoφhoIin-3-yl}methoxy)acetyl]-9-methyl-3₅9- diazaspiro[5.5]undecane;

N-(2-{2-[9-(cyanomethyl)-3,9-diazaspiro[5.5]undec-3-yl]-2-oxoethoxy}ethyl)-4-methoxy-N,2.6- trimethyibenzenesulfonamide;

3-(4,5-dihydro-lH-imidazol-2-ylmethyl)-9-[({(3R)-4-[(4-methoxy-2,6-dimethylphenyI)sulfonyl]-6.6- dimethyimoφholin-3-yl}methoxy)acetyl]-3,9-diazaspiro[5.5]undecane; ethyl 3-[(2-{[(4-methoxy-2,6-dimethylρhenyl)sulfonyl](methyI)amino}ethoxy)acetyl]-3- azaspiro[5.5]undecane-9-carboxylate; 3-[(2-{[(4-methoxy-2,6-dimethyiphenyl)sulfonyl](methyl)araino}etlioxy)acetyl]-N_JN-dimethyl-3- azaspiro[5.5]undecane-9-carboxamide; or

N-[2-(2-{9-[(dimethylamino)methyl]-3-azaspiiO[5.5]undec-3-yl}-2-oxoethoxy)ethyl]-4-methoxy- N,2,6-trimethylbenzenesulfonamide.

29. A compound or salt or hydrate thereof according to any one of claims 1-28, wherein the compound exhibits no detectable agonist activity an in vitro assay of B] agonism.

30. A compound or salt or hydrate thereof according to any one of claims 1-28, wherein the compound is capable of exhibiting an IC₅₀ value of 1 micromolar or less in an in vitro assay of Bi antagonism.

31 . A pharmaceutical composition, comprising at least one compound or salt or hydrate thereof according to any one of claims 1-30, in combination with a physiologically acceptable carrier or excipient.

32. A pharmaceutical composition according to claim 31, wherein the composition is formulated as an injectible fluid, an aerosol, a cream, a gel, a pill, a capsule, a syrup or a transdermal patch.

33. A method for inhibiting induction of agonist-induced Bi activity in vitro, the method comprising contacting B| receptor with at least one compound or salt or hydrate thereof according to any one of claims 1-30, under conditions and in an amount sufficient to detectably inhibit agonist- induced Bi activity.

34. A method for inhibiting induction of agonist-induced B] activity in a patient, comprising contacting cells expressing B ₁ receptor with at least one compound or salt or hydrate thereof according to any one of claims 1-30, in an amount sufficient to detectably inhibit agonist-induced Bj activity in cells expressing a cloned Bj receptor in vitro, and thereby inhibiting agonist-induced B| activity in the patient.

35. A method according to claim 34, wherein the patient is a human.

36. A method for treating a condition responsive to B, receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of at least one compound or salt or hydrate thereof according to any one of claims 1-30, and thereby alleviating the condition in the patient.

37. A method according to claim 36, wherein the condition is inflammation or pain.

38. A method according to claim 36, wherein the condition is cough, asthma, vascular edema, or epilepsy.

39. A method for treating pain in a patient comprising administering to a patient suffering from pain a therapeutically effective amount of at least one compound or salt or hydrate thereof according to any one of claims 1-30, and thereby alleviating pain in the patient.

40. A method according to claim 39, wherein the patient is suffering from inflammatory pain, acute pain, dental pain, back pain, surgical pain, headache, neuropathic pain or pain from osteoarthritis or trauma.

41. A method according to claim 39, wherein the patient is a human.

42. A compound or salt or hydrate thereof according to claim 1, wherein the compound is radiolabeled.

43. A method for determining the presence or absence of B] receptor in a sample, comprising the steps of:

(a) contacting a sample with A compound or salt or hydrate thereof according to any one of claims 1-30. under conditions that permit binding of the compound to B] receptor; and

(b) detecting a signal indicative of a level of the compound bound to Bi receptor, and therefrom determining the presence or absence of Bi receptor in the sample.

44. A method according to claim 43, wherein the compound is radiolabeled, and wherein the step of detection comprises the steps of:

(i) separating unbound compound from bound compound; and

(ii) detecting the presence or absence of bound radiolabel in the sample.

45. A packaged pharmaceutical preparation, comprising:

(a) a pharmaceutical composition according to claim 31 in a container; and

(b) instructions for using the composition to treat pain.

46. The use of a compound or salt or hydrate thereof according to any one of claims 1-30 for the manufacture of a medicament for the treatment of a condition responsive to Bi receptor modulation.

47. A use according to claim 46, wherein the condition is an inflammatory condition or pain.