WO2006126574A1 - Method for induction of es cell differentiation - Google Patents

Abstract

Disclosed is a novel method for inducing the ES cell differentiation which can induce the differentiation of a large number of ES cells into an endodermal system. A method for inducing the differentiation of an ES cell into an endodermal cell comprising the step of culturing a mammalian ES cell in the presence of a supporting cell.

Description

 ES cell differentiation induction method

 Technical field

 [0001] The present invention relates to a method for inducing differentiation of ES cells. More specifically, the present invention relates to a method for inducing ES cells into endoderm using a cell line derived from mesoderm as a support cell.

 Background art

 [0002] Due to its pluripotency, ES cells are a useful model system for studying gene function in the nascent stage, and have the potential to become a transplantable cell source for medical use. In order to use ES cells for cell replacement therapy in diseases such as diabetes, differentiation needs to be controlled, which remains a major challenge. Although understanding of the differentiation of ES cells into neural tissue, hematopoietic tissue and heart tissue has advanced considerably (Yamashita, J., Itoh, H., Hirashima, M., et al. (200 0). Flkl- positive cells derived from embryonic stem cells serve as vascular progenit ors.Nature 408, 92-6; and Ying, QL, Stavridis, M., Griffiths, D., Li, M., and Smith, A. (2003). Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol 21, 183-6) There is little knowledge about the differentiation of ES cells into endoderm tissues.

[0003] In 2001, insulin-containing splenocytes, such as ES cells, were formed in vitro by adding specific factors after culturing under conditions where the nestin-positive neuron population was enriched. ^s reported (Lumelsky, N., Blondel, 0. , Laeng, P., Velasco, I., Ravin, R., and Mc Kay, R. (2001). Differentiation of embryonic stem cells to insulin-secreting structure s similar to pancreatic islets. Science 292, 1389—94). However, this insulin-positive cell does not express Pdxl, a marker of 8 cells in the functional knee of both the spleen and duodenum endoderm. The cells did not express insulin I transcripts, but expressed trace amounts of insulin II transcripts. Also, these cells were not stained with anti-C-peptide antibody, a byproduct of de novo synthesis of insulin, which is positive for staining for insulin (Rajag opal, J., Anderson, WJ, Kume, S. , Martinez, OI, and Melton, DA (2003). Insu lin staining of ES cell progeny from insulin uptake. Science 299, 363). These findings indicate that insulin staining is due to insulin uptake from the medium, and the cells themselves do not synthesize insulin, producing nestin-positive cell strength insulin / 3 cells. Was questionable. However, other researchers have reported that insulin-secreting cells are produced from ES cells using similar conditions that are selective for nestin-positive cells, and this problem has not yet been clarified (Blyszczuk, P., Czyz, J., Kania, G., et al. (2003). Expression of Pax4 in embryonic stem cells promotes differentiati on of nestin— positive progenitor and insulin-producing cells. Proc Natl Acad ¾ci USA 100, 998— 1003; Hori, Y "Rulifson, I. C, Tsai, B. C, Heit, JJ, Cahoy, J. D" an d Kim, SK (2002). Growtn inhibitors promote differentiation of insulin-producing ti ssue from embryonic stem Proc Natl Acad Sci USA 99, 16105-10; and Morit oh, Y., Yamato, E., Yasui, Y., Miyazaki, S., and Miyazaki, J. (2003). Analysis of ins ulin— producing cells during in vitro differentiation from feeder-free embryonic stem cells. Diabetes 52, 1163-8). It has recently been reported that when glucose is added to the medium, it produces a cell population that releases nestin-positive progenitor force S insulin, but notably no C-peptide release is detected (Hansson, M ., Tonning, A., Frandsen, U., et al. (2004). Artifactual insulin release from differentiated embryonic stem cells. Diabetes 53, 2603-9) ₀ This suggests that there is not. Thus, the challenge of manipulating ES cells to produce endocrine spleen | 8 cells remains unresolved.

In mouse embryos, Pdxl expression is the first divergence signal and is detected in the dorsal endoderm of the intestinal tract in day 8.5 embryos. In day 9.5 embryos, Pdxl expression is found in dorsal and ventral spleen buds and duodenal endoderm. In adults, Pdxl expression is maintained in the duodenal epithelium and the islet β cells that secrete insulin and plays an important role in the transcriptional regulation of the insulin gene (Offield, MF, Jetton, TL, Labosky, PA, et al. (199 6). PDX 丄 is required for pancreatic outgrowth and differentiation of the rostral duod enum. Development 122, 983-95). Targeted mutagenesis of Pdxl in mice has shown that Pdxl is required for splenectomy and rostral duodenum development (Ahlgren, U., Jons son, J., and Edlund, H. (1996). The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in I PF1 / PDX1— deficient mice. De velopment 122, 1409-16). Therefore, Pdxl is an essential molecule for the development of the spleen and is useful as an early marker for splenic progenitor cells and other endoderm-derived tissues such as the stomach, duodenum, and bile ducts.

 [0005] The present inventors have previously reported a protocol for efficiently generating Pdxl-positive cells using an ES cell line having a lacZ reporter gene at the Pdxl locus. Co-culture of ES cells with embryonic spleen primordia or splenic mesenchyme showed that the number of cells induced to differentiate into Pdxl-expressing cells was markedly increased. We screened for growth factors that promote the differentiation of ES cells into spleen and found that TGF 2 is a factor that partially mimics the splenic primordium activity. -Peale, F.V "Jr., Sugden, L., and Bothwell, M. (1998). Ch aracterization of CMIX, a chicken homeobox gene related to the Xenopus gene mix. 1. Mech Dev 75, 167—70; and Stein, S., Roeser, T., and Kessel, M. (1998). CMIX, a paired-type homeobox gene expressed before and during formation of The avian prim mitive streak. Mech Dev 75, 163-5) This specifically promoted the differentiation of ES cells into the endoderm system. Application of embryonic spleen primordia or splenic mesenchyme to induce ES cell differentiation is difficult.

 Disclosure of the invention

 Problems to be solved by the invention

[0006] As described above, it has been reported that cells that are stained with an insulin antibody increase using a method of changing the culture conditions of ES cells. However, the cells detected by this method are not cells that have been created through the process of normally producing insulin-producing β cells in vivo. Moreover, it has been pointed out that this is an apparent phenomenon by the cells adsorbing insulin in the medium (Rajagopal, J. et al, Science 299, 363, 2003). In order to solve this, a culture method that induces the expression of an early marker of spleen development is effective. An object of the present invention is to provide a novel ES cell sorting method that enables differentiation of even a large amount of ES cells into the endoderm system. Means for solving the problem

 [0007] Any type of cell promotes the growth of endoderm cells, leading to the separation of specific cells on the anteroposterior axis, and these cells are of splenic primordia or splenic mesenchymal force We speculated that it would replace the signal. Therefore, the present inventors screened established cell lines in order to discover such induction sources, and the cell line derived from mesoderm strongly induces differentiation of ES cells into endoderm! They found sputum activity and promoted spleen or liver development. The present invention has been completed based on these findings.

That is, according to the present invention, there is provided a method for inducing differentiation from ES cells to endoderm cells, comprising culturing ES cells derived from a mammal in the presence of supporting cells.

 Preferably, the feeder cells are cells derived from mesoderm.

 Preferably, the feeder cells are M15 cells, MEF cells or ST2 cells.

[0009] Preferably, differentiation is induced from ES cells into any of undifferentiated endoderm progenitor cells, immature cells of endoderm-derived organs, or mature cells of endoderm-derived organs.

 Preferably, the endoderm-derived organ is the spleen, liver, lung, pharynx, or small intestine. Preferably, when culturing ES cells in the presence of feeder cells, actin bin, basic fibroblast growth growth factor (bFGF), and Z or noggin are added and cultured.

 Preferably, when culturing ES cells in the presence of feeder cells, nicotinamide is further added and cultured.

 Preferably, mammalian ES cells are mouse, monkey or human ES cells.

[0010] According to another aspect of the present invention, there is provided an endoderm cell obtained by the above-described method of the present invention and induced to differentiate from an ES cell.

[0011] According to still another aspect of the present invention, a step of inducing differentiation from an ES cell into an endoderm cell by the above-described method of the present invention, and the endoderm cell induced to differentiate by fluorescence labeling. A method for obtaining endoderm cells induced to differentiate from ES cells, comprising a step of separation by flow cytometry (FACS) is provided.

[0012] According to still another aspect of the present invention, endoderm cells differentiated from ES cells obtained by the method of the present invention described above are coated on a plate coated with 2-methacryloyloxetyl phosphorylcholine. Endodermal system derived from ES cells, including culturing A method for maintenance culture of cells is provided.

 Preferably, in the maintenance culture method described above, the culture is performed in the presence of knockout serum replacement (KSR).

 [0013] According to still another aspect of the present invention, the presence of a test substance is induced when differentiation is induced from ES cells to endoderm cells by culturing mammalian-derived ES cells in the presence of supporting cells. When ES cells are cultured under the condition that ES cells are cultured in the absence of the test substance, the degree of differentiation induction into endoderm cells and when the ES cells are cultured in the presence of the test substance A method is provided for screening for a substance that promotes or inhibits differentiation induction from ES cells to endoderm cells, comprising comparing the degree of differentiation induction into system cells.

 [0014] Preferably, the test substance is a growth factor or a low molecular weight compound.

 Preferably, the degree of differentiation induction into endoderm cells is measured using the expression level of the marker expressed in the endoderm as an index.

 Preferably, mammalian ES cells are mouse, monkey or human ES cells. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, embodiments of the present invention will be described in more detail.

 The present invention relates to a method for inducing differentiation from ES cells into endoderm cells, and in particular, a method characterized by culturing mammalian-derived ES cells in the presence of supporting cells.

 [0016] In the separation induction method of the present invention, ES cells can be induced to differentiate into endoderm-derived digestive organ cells such as knees using feeder cells. Inducing differentiation of endoderm cells using feeder cells has been achieved for the first time by the present invention which has not been reported so far. In the examples of the present invention, the expression of the gene marker gene (Pdxl) of spleen stem cells was visualized with a fluorescent protein to enable rapid and sensitive detection. In the present invention, ES cells are easily induced to differentiate by co-culture with supporting cells. Therefore, addition of a specific growth and proliferation factor further promotes differentiation induction. Therefore, the method of the present invention can also be used as a screening for unknown differentiation-inducing factors.

[0017] The ES cells used in the present invention may be ES cells derived from mammals. It is not particularly limited, and for example, mouse, monkey or human-derived ES cells can be used. As the ES cell, for example, a cell having a reporter gene introduced in the vicinity of the Pdxl gene can be used in order to facilitate confirmation of the extent of the ES cell. For example, as used in the examples below, ES cell SK7 with 129 / Sv-derived ES cell line Rl, J1 or GFP reporter transgene under the control of the Pdxl promoter incorporating the lacZ gene at the P dxl locus Stocks can be used. Alternatively, an ES cell PH3 strain having an mRFPl reporter transgene under the control of the Hnf3 | 8 endoderm-specific enzyme fragment and a GFP reporter transgene under the control of the Pdxl promoter can also be used.

[0018] Mammal-derived ES cells can be cultured by a conventional method. For example, in the presence of mitomycin C-treated mouse embryonic fibroblasts (MEF) as feeder cells, LIF ( Differentiation medium supplemented with ESGRO 1000 units / ml, manufactured by Chemicon (10% urine fetal serum (FBS), O.lmM 2-mercaptoethanol, 100 M non-essential amino acids, Dulbecco's supplement supplemented with 2 mM L-glutamine Eagle medium (DMEM, Sigma)).

 In the present invention, ES cells are cultured in the presence of supporting cells, that is, ES cells are co-cultured with supporting cells. The feeder cells used in the present invention are not particularly limited as long as ES cells can be induced to differentiate into endoderm cells, but preferably cells derived from mesoderm can be used as feeder cells. . Specific examples of cells derived from mesoderm that can induce differentiation of ES cells into endoderm cells include M15 cells, MEF cells, and ST2 cells.

 [0020] M15 cells (mouse, mesonephros) are registered in the cell bank as registration number ECACC 95102517.

 (And AMR Center for Applied Microbiology & Research (E and A, C, Salisbury, Wiltshire)). M15 cells are described in the literature (Larsson, SH, Charlieu, JP, Miyagawa, K., et al. (1995). Subnuclear localization of WTl in splicing or transcription factor dom ains is regulated by alternative splicing. Cell 81, 391—401). Description [Accordingly, obtain nj "會. Bank information about M15 is described below.

 [0021] Version 4.200201

15 (mouse, mesonepnros ECACC 95102517

Morphology: Epithelial

 Mouse mesonephric epithelium, polyoma virus large T transformed

 Depositor: Prof V van Heyningen, MRC Human Genetics Unit, Western General Hospital, Edinburgh, UK (Originator)

 No restrictions. Patent: None Specified By Depositor

 Properties: Products: WTl (expressed gene) Applications: Gene expression and prot ein studies connected to kidney development and Wilms' tumourigenesis.

Available in the following LABORATORY:

 CAMR Center for Applied Microbiology & Research (ECACC, Salisbury, Wiltshire) DMEM + 2mM ulutamine + 10% Fetal Bovine Serum (FBS). Split confluent cultures 1: 5 to 1:10 ie seeding at 5x1,000 to 1x10,000 cells / cm2 using 0.25% trypsin or try psin / EDTA; 5% C02; 37C [cell growth impaired at lower industries]. Karyotype: Hyp erdiploid

Hazard: CZ- II

 The W \ 1 -expressing mesonephric cell line M15 (alias Mesol5) was established from mouse mesonephros transgenically expressing the large T protein of polyoma virus under the control of the early viral enhancer.As a tumour suppresser gene with a ke y role in urogenital development , WTl is implicated as predisposition gene in the pathogenesis of Wilms' tumour (WT).

Further information

Research council deposit: Yes

Price— code: C

Bibliographic references:

Cell 1995; 81: 391

By Beatrice ...

TITLE: M15

DATE: 2005/04/24 00:32 URL: http: //www.biotech.ist.unige.it/cldb/cl3312.html

 European Collection of Cell Cultures,

 Health Protection Agency, Porton Down, Salisbury, Wiltshire, UK

 June Poulton

 European Collection of Cell Cultures

 Health Protection Agency,

 Porton down

 SP40JG Salisbury, Wiltshire UK

 Phone: + 44-1980-612512

 Fax: + 44-1980-611315

 E-mail: ecacc@hpa.org.uk

 URL: http://www.ecacc.org.uk/

[0022] MEF (from ICR mouse) is registered with ATCC as catalog number ATCC # SCRC-1046. In addition, MEF cells can be obtained from the literature (Nagy A, et al. Manipulating The Mouse Embryo: A Laboratory Manual. Third Edition Cold Spring Harbor Press; 2003).

 [0023] ST2 cells are registered as RCB0224 in the RIKEN Tsukuba Research Institute Bioresource Center. In addition, ST2 cells can be used in the literature (Ogawa, M., Nishikawa, S., Ikuta, K., Yamamura, F., Naito, M., Takahashi, K. and Nishikawa, S. EMBO J 1988; 7: 1337. -1343).

 [0024] These feeder cells can be cultured according to a conventional method using a normal medium for animal cells supplemented with serum or the like (eg, RPMI medium or DMEM medium).

[0025] The method of culturing mammalian-derived ES cells in the presence of feeder cells is not particularly limited. For example, ES cells can be cultured using feeder cells as feeder cells. For example, undifferentiated ES cells are dissociated with trypsin and suspended in an untreated culture dish in the presence of LIF in a differentiation medium to form embryoid bodies. Embryoid bodies that have been differentiated for 2 days are treated with trypsin, and seeded in a sorting medium on a plate that has been previously engrafted (pre-coated) with feeder cells (support cells). The endoderm system can be cultured by culturing for several days. Differentiation can be induced into cells.

 [0026] In the separation induction method of the present invention, when culturing ES cells in the presence of supporting cells, another substance (eg, a growth factor or a low molecular weight compound) is added and cultured. You can also. For example, differentiation induction from ES cells to endoderm cells can be further promoted by culturing with actinbin, bFGF and / or noggin. In addition, when lactinbin, bFGF, and / or noggin is added, differentiation induction from ES cells to endoderm cells can be promoted by further culturing with nicotinamide.

[0027] According to the ES cell differentiation induction method using the feeder cells according to the present invention, from ES cells, undifferentiated endoderm progenitor cells, immature cells of endoderm-derived organs, or maturation of endoderm-derived organs Differentiation can be induced into any of the cells. Examples of endoderm-derived organs include, but are not limited to, the spleen, liver, lung, pharynx, or small intestine. The separation from ES cells to endoderm cells can be confirmed by determining the expression level of the marker specific to the endoderm.

 [0028] Furthermore, according to the present invention, when ES cells derived from mammals are cultured in the presence of supporting cells to induce differentiation from ES cells to endoderm cells, in the presence of a test substance. When ES cells are cultured in the presence of ES, and the ES cells are cultured in the absence of the test substance, they become endoderm cells, and the degree of differentiation is induced and the ES cells are cultured in the presence of the test substance. And a method of screening for a substance that promotes or inhibits differentiation induction from ES cells to endoderm cells, comprising comparing differentiation induction to the degree of differentiation induction. As a test substance, a growth factor or a low molecular weight compound can be used. At this time, the degree of differentiation induction into endoderm cells can be measured using the expression level of the marker expressed in the endoderm as an index.

 The ability to explain the present invention more specifically by the following examples The present invention is not limited by the examples.

 Example

[0029] (A) Experimental method

(1) ES cell line The 129 / Sv-derived ES cell line Rl incorporating the lacZ gene at the Pdxl locus was provided by Dr. Christopher Wri ght (Panderbilt University). The Pdxl / LacZ ES cell line is a differentiation medium (10% Ushii) supplemented with LIF (ESGR 0 1000 units / ml, Chemicon) in the presence of mitomycin C-treated mouse embryonic fibroblasts (MEF) as feeder cells. Fetal serum (FBS), 0.1 mM 2-mercaptoethanol, 100 μΜ non-essential amino acids, Dulbecco's modified Eagle medium (DMEM, Sigma) supplemented with 2 mM L-glutamine).

 [0030] The ES cell SK7 strain having an EGFP reporter transgene under the control of the Pdxl promoter was isolated from a transgenic mouse homozygous for the Pdxl / EGFP gene. ES cell line SK 7 is supplemented with (1000 units / ½1), 15% Knock-out Serum Replacement (KSR ゝ Invitrogen), 1% FBS, 100 M non-essential amino acids, 2 mM L-glutamine, ImM sodium pyruvate Maintain on MEF in Glasgow Minimum Essential Medium (GMEM, Sigma).

 [0031] The ES cell PH3 strain, which has an mRFPl reporter transgene under the control of the Ηηβ endoderm-specific enhancer fragment and an EGFP reporter transgene under the control of the Pdxl promoter, is a transgenic mouse heterozygous with the Hnf3 β / mRFPl gene. And blastocyst power obtained by crossing the Pdxl / EGF P gene with a homozygous transgenic mouse. The ES cell PH3 line is maintained in the same manner as the ES cell SK7 line except that it is maintained without MEF.

 [0032] Force-quizal ES cell CMK6 strain was purchased from Asahi Techno Glass Co., Ltd. Force-quizal ES cell line is 20% KnockOut Serum Replacement (KSR, Gibco BRL), O.lmM 2-mercaptoethanol, 100 in the presence of mitomycin C-treated mouse embryonic fibroblasts (MEF) as feeder cells. It was maintained in Dulbecco's modified Eagle's medium supplemented with μΜ non-essential amino acids, 2 mM L-glutamine, and ImM sodium pyruvate and a F-12 nutrient mixture (1: 1 mixed medium (D MEM / F12, Sigma)).

[0033] Human ES cell strain KhES-1 was provided by the Institute of Regenerative Medicine, Kyoto University. Human ES cell line is 20% KnockOut Serum Replacement (KSR, Gibco BRL), O.lmM 2-mercaptoethanol, 100 M non-essential in the presence of mitomycin C-treated mouse embryonic fibroblasts (MEF) as one feeder cell Maintained in Dulbecco's modified Dal medium supplemented with the amino acid, 2 mM L-glutamine, and a one-to-one mixed medium of F-12 nutrient mixture (DMEM / F12, Sigma)) It was.

 [0034] (2) ES cell sorting

For differentiation studies, Pdxl / LacZ ES cells passaged once on gelatin-coated plates were used. Undissolved Pdxl / LacZ ES cells were dissociated with trypsin and treated in an untreated culture dish (Batteria grade, Iwaki Glass) at a concentration of 3.0 x 10 ⁵ cells / 90 mm plate in the absence of LIF. Suspension culture was performed to form embryoid bodies. Embryoid bodies that had been differentiated for 2 days were treated with trypsin, and 5000 per seed in a differentiation medium was seeded on a 24-well plate pre-coated with a feeder cell. The control well was precoated with gelatin alone. ES cells seeded on control gelatin-coated wells or feeder-coated wells were allowed to stand for 12 days in differentiation medium, then the cells were fixed and analyzed for X-Gal staining.

 [0035] ES cell line SK7 passaged on MEF was directly passaged on a gelatin-coated plate and then used directly for differentiation studies without forming embryoid bodies. In a 24 well plate pre-coated with a feeder cell, 500 ES cells per strain were seeded in differentiation medium and cultured for 3 to 4 days. On day 3 or 4, FBS was replaced with KSR at the indicated times and growth factors were added. The medium was replaced only once on the 6th day with KSR replacement medium supplemented with growth factors. The exact date on which growth factors were added, or the exact date on which the differentiation medium was replaced with KSR-substituted differentiation medium, is as shown in each figure. Fluorescence photographs of ES cells were taken every 24 hours under a stereomicroscope (Leica MZFLIII).

 [0036] Monkey ES cell differentiation culture method

 Day 0 of culture: Seed 20,000 monkey ES cells per well in a 24-well plate in a differentiation medium. Culture medium is changed on days 1, 3, 5, 7, and 9. The differentiation medium is the same as the differentiation medium for mouse ES cells.

 [0037] Human ES cell differentiation culture method

 The culture conditions for human ES cells are as follows. On day 0 of culture, human ES cells were seeded on a 24-well plate at a concentration of 20,000 cells / well, and the medium was changed on days 1, 3, 5, 7, 9, and 11 of culture. The medium used was KSR-substituted differentiation medium (10% KSR / DMEM (high glucose)).

 [0038] (3) Feeder cell line

Embryonic kidney-derived cell line M15 cells from Dr. T. Noce of Mitsubishi Chemical Life Science Institute Provided. ST2 cells are stromal cells that are known to have the ability to promote differentiation into ES cells and blood cells. MEFs were isolated from embryonic day 12.5-14.5 day embryos. ST2 cells were cultured in RPMI medium supplemented with 5% FBS and O.lmM 2-mercaptoethanol, and the other cells were cultured in DMEM medium supplemented with 10% FBS. Feeder cells other than ST2 cells were treated with 200 g / ml mitomycin C for 2.5 hours before use. M15 cells were seeded on gelatin-coated 24 well plates at a concentration of 2 × 10 ⁵ per well. MEF cells were used at IX 10 ⁵ per well. ST2 cells were used without mitomycin C treatment, and seeded at 5 x 10 ⁴ cells / well on 24 well plates 3-4 days before seeding with ES cells.

[0039] (4) Growth factor

 Recombinant human fluorstatin 300 (GT, # 2669) was purchased from GT. Recombinant human activin A (GT, # 2338) was used at 10 ng / ml. Recombinant mouse noggin ZFc chimera (R & D, # 719-NG) was used at 100 ng / ml. Recombinant human bone morphogenetic protein (BMP) 2 (Osteogenetics GmbH, Wurzburg, Germany) was used at 5 ng / m or 25 ng / ml. Nicotinamide was purchased from Sigma.

 [0040] (5) X-gal staining for detection of j8-galactosidase activity

 ES cell cultures were fixed in 4% paraformaldehyde in PBS for 20 minutes at room temperature, rinsed several times with PBS, and stained for j8-galactosidase activity. For X-gal staining, the cells were washed with 20 mM K Fe (CN), 20 mM K Fe (CN) in PBS in the presence of lmg / ml X-gal.

 3 6 4 6 2

37 in buffer containing 2 mM MgCl, 0.02% Nonidet-P40, 0.01% Deoxycholate

 2

Incubate overnight at ° C. The number of LacZ positive cells in each well was counted under a microscope. After X-gal staining, DNA was extracted from the cells and quantified. The total number of cells in each well was also measured for DNA standardization, and the percentage of X-gal positive cells in each well was calculated. The total number of cells allowed to stand for 12 days was 3 × 10 ⁵ to 1 × 10 ⁶ .

[0041] (6) Quantification of GFP positive cells

Fluorescence photographs of ES cells were taken every 24 hours under a stereo microscope (Leica MZFLIII), and the fluorescence intensity was quantified with Lumin a Vision software (Mitani Corporation, Japan). Immunofluorescence photographs were taken with an Olympus 1X70 using a CCD camera (DP50). [0042] (7) Analysis by reverse transcription polymerase chain reaction (RT-PCR)

 RNA was extracted from ES cells using TRIZOL reagent (G¾co BRL) followed by DNase (Sigma). For reverse transcription (RT) reaction, 3 μg of RNA was reverse transcribed using M-MLV reverse transcriptase (Toyobo) and oligo dT primer (Gibco BRL). 1 μl of 5-fold diluted cDNA (corresponding to 1/100 of the reverse transcript) was used for PCR analysis.

 [0043] For each primer combination, the number of cycles and the amount of cDNA required for RT-PCR in the linear range were determined empirically. Table 1 shows the primer sequences and the number of cycles used for each primer pair. One-fifth of the RT-PCR product was loaded on 5% non-denaturing polyacrylamide gel electrophoresis (PAGE), and prayed with Fluorolmager (Molecular Dynamics) using the DNA-sensitive dye SYBRGreenl (Molecular Probes).

[0044] [Table 1]

Table 1: PCR primers used to detect mouse gene expression

 Removable fe Nafo Prime Primer Reinous Primer, Nike

 Afp TCGTATTCCAACAGGAGG AGGCTTTTGCTTCACCAG 25

 Amylase CAGGCAATCCTGCAGGAACAA CACTTGCGGATAACTGTGCCA 30 β Act in GTGATGGTGGGMTGGGTCA TTTGATGTCACGCACGATTTCC 18

 Ckl9 GTCCTACAGATTGACAATGC CACGCTCTGGATCTGTGACAG 22

 Glucagon ATTCACAGGGCACATTCACC GGTCTCTGAAGTAGTTGACC 29

 Glut2 ACAGAGCTACAATGCAACGTGG CAACCAGAATGCCAATGACGAT 27

 Iapp GATTCCCTATTTGGATCCCC CTCTCTGTGGCACTGAACCA 27

 Insl CAGCCCTTAGTGACCAGCTA ATGCTGGTGCAGCACTGATC 30

 Ins2 TCCGCAACAATCAAAAACCAT GCTGGGTAGTGGTGGGTCTA 29

 Isll GACTGAGAGGGTCTCCAGCTC AGCAAGAACGACTTCGTGATG 26

 Kir6. 2 GGCTCCTAGTGACCTGCACCA CCACAGCCACACTGCGCTTGCG 26

 Met GATCGTTCAACCGGATCAGAA GGAAGAGCCCGGATAATAACAA 25

 NeuroD GGAGTAGGGATGCACCGGGAA CTTGGCCAAGAACTACATCTGG 25

 Ngn3 CTGCGCATAGCGGACCACAGCTTC GCTGAGTTCCAAGCTCCGAT 26

 Nkx2.2 AACCGTGCCACGCGCTCAAA AGGGCCTAAGGCCTCCAGTCT 25

 Nkx6.1 TACTTGGCAGGACCAGAGAG CGCTGGATTTGTGCTTTTTC 25

 Pax4 CAG GAGCCAAATGGCG TGAGCAATGGGTTGATGGCA 27

 Pax6 CAGTCACAGCGGAGTGAATC CGCTTCAGCTGMGTCGCAT 26

 Pax9 CAAGGTGGAGGAGTGGAGCAG GAGGGGGATAGGTTTCTTCTCTG 26

 Pdxl CCAAAACCGTCGCATGAAGTG CTCTCGTGCCCTCAAGAATTTTC 28

 PP AGGATGGCCGTCGCATACTG CTGAAGGACCTCACGTCGAG 30

 Sst CCGTCAGTTTCTGCAGAAGT CAGGGTCMGTTGAGCATCG 26

 Sftpc CATCGTTGTGTATGACTACCAGAG GAATCGGACTCGGMCCAGTATC 34

PCR conditions:

 Iapp, Ins2 and PP:

 30 seconds at 96 ° C (denaturation), 2 seconds at 60 ° C (annealing), and 45 seconds at 72 ° C (extension) (Hot start) Amylase, Insl and Kir6.2

30 seconds at 96 ° C (denaturation) and 30 seconds at 70 ° C (annealing and elongation) (Hot start) Other: 30 seconds at 96 ° C (denaturation), 2 seconds at 60 ° C (annealing), and 45 seconds at 72 ° C (extension)

[0046] (8) Immunohistochemical examination (experimental method in FIGS. 5 and 16)

 When performing a whole mount immunohistochemistry, mesoderm cells or ES cells were placed on a Nunc Thermanox Colerslips 24-well type (Nunc, # 174950). The cells were fixed in 4% paraformaldehyde for 20 minutes at room temperature and washed thoroughly with phosphate buffered saline (PBS-T) containing 0.1% tween. Infiltrate with PBS containing 1% TritonX-100 at room temperature for 10 minutes, incubate with blocking solution (x5 Blocking One, Nacalai Tesque) for 1 hour, then add the primary antibody in the blocking solution to the sample, 4 ° Incubate overnight at C. The sample was thoroughly washed with PBS-T and mounted with PermaFluor Aqueous Mounting Medium (IMMUNON). Confocal images were acquired using a Leica Spectral Confocal Scanning System, TCS-SP2 (Leica).

 [0047] The antibodies used for detection were rabbit anti-AFP (Biomeda, # A02), goat anti-albumin (Sigma, # A1151), mouse anti-Cdx2 (BioGenex, # MU392-UC), mouse anti-CK19 (DAKO, # M0888), Goat Anti-HNF3 β (Santa Cruz, # sc-9187), Usagi Anti-Pdxl (Chemicon, # AB5754), and Usagi Anti-T (Santa Cruz, # sc-20109), Usagi Anti-Nkx2.1 (Santa Cruz, # sc-13040) and Usagi anti-GFP (MBL, # 598). Secondary antibodies used were Allexa 568-conjugated goat anti-rabbit and mouse antibody (Molecular Probes, # A11036 and # A11019), Allexa 488-conjugated goat anti-rabbit and mouse antibody (Molecular Probes, # A11070), C y3 conjugated donkey anti-goat antibody (Jackson Lab, # 705-166-147).

 [0048] (9) Flow cytometry with fluorescent labeling (FACS) (Experimental method in Fig. 12)

M15 cells were seeded at 2 × 10 ⁵ cells per well and cultured before use. 5,000 SK7 ES cells were seeded on the mesodermal cell layer in the differentiation medium and allowed to differentiate for 8 days. On the 8th day of differentiation, SK7 ES cells were dissociated using Cell dissociation buffer (GIBCO BRL) at 37 ° C for 20 minutes. Cells were stained with a combination of monoclonal antibodies (mAb). The antibodies used in this experiment were ECCN2 (Piotin-conjugated anti-E-cadherin monoclonal antibody ECCD2 (provided by Prof. Akiyoshi Nagahama, Prof. Taro Ogawa, Kumamoto University; unlabeled antibody can be purchased from Takara Bio Inc.)), PE-conjugated anti-Cxcr4 Monoclonal antibody 2B11 (Becton, Dickinson and Company). For surface staining, together with a mixture of labeled monoclonal antibodies Incubated in Stained cells were filtered through a 40 m mesh, resuspended in HBSS-1% BSA containing propidium iodide and analyzed by FAC S Canto (Becton, Dickinson and Company). Data were recorded using CellQuest Prosoftware (Becton, Dickinson and Company) and analyzed using the Flowjo program (Tree Star).

 [0049] (10) Flow cytometry with fluorescent labeling (FACS) (Experimental method of Fig. 13)

M15 cells treated with mitomycin were cultured at ⁶ × 10 ⁶ cells per 90 mm plate before use. 3 × 10 ⁵ ES cells, strain SK7, were seeded on the M15 cell layer in differentiation medium and allowed to incubate for 9 days. On day 9 of differentiation, ES cell line SK7 was trypsinized with 0.25% trypsin-EDTA for 10 minutes, filtered through a 40 μm mesh, and at a concentration of 1 × 10 ⁶ to 2 × 10 ⁶ cells / ml, The sample was resuspended in HBSS-1% BSA containing iodine iodide and analyzed with FACS Vantage SE. Undifferentiated ES cell line SK7 was used as a negative control. Differentiated ES cells were divided into 5 fractions according to the intensity of green fluorescence, and RNA extraction and RT-PCR analysis were performed.

 [0050] (11) Method for maintaining culture of ES cell-derived differentiated cells

 Differentiated ES (dES) cells were cultured for 8 days in a medium supplemented with both activin and bFGF under M15 and supplemented with 10% FBS. After culturing ES cells for 8 days, dES is trypsinized with 0.05% trypsin / EDTA and coated with 2-methacryloyloxyethyl PhosphorylCholine (MPC). Pdxl positive cells can be maintained and cultured by seeding again on dishes &plates; Nalgenunc, # 145389).

 [0051] (12) Transplantation under mouse kidney capsule

(In the above section, the Pdxl-positive cells on day 1 of maintenance culture were modified and used for transplantation experiments (Fig. 14). Under normal anesthesia, dES (approximately 3 X 10 ⁶ cells) were implanted. after 1 week of implantation, the mice were sacrificed transplanted ES cells, kidneys removed, by immunohistochemistry cryosections were fixed I spoon in 4% paraformaldehyde aldehyde. graft (10 m) Analyzed.

 [0052] (13) Differentiation of ES cells (Experimental method in Fig. 17)

For sorting under serum-free conditions, SK7 ES cells were seeded at 5,000 cells per well in a 24-well plate pre-coated with mesoderm cells in sorting medium for 8 days. Cultured. The medium was changed every 2 days. ES cells or Pdxl / EGFP cells differentiated into embryonic endoderm (E-cadherin + / CXCR4 + cells) were compared. ES cells were prepared in 10% FBS (FBS) or with or without 20 ng / ml of activin, 10 g / ml insulin (Sigma), 5.5 μg / ml transferrin (Sigma), 6.7 pg Differentiation was performed in serum-free basal medium (DMEM, Gibco BRL) (ITS) supplemented with / ml selenium (Sigma) and 0.25% albumin (Al bmax, GIBCO).

[0053] (B) Results

 (1) Production of factors that promote differentiation of ES cells into Pdxl-expressing intestinal endoderm cells by mesoderm cells

 Using the co-culture system, screening of primary cultured cells and established cell lines was conducted for the activity of promoting endoderm differentiation of ES cells. Since an ES cell line with a lacZ reporter gene inserted at the Pdxl locus was used, expression of the Pdxl gene could be visualized by in situ X-Gal staining. As a result, the mid-renal cell line M15 (Larsson, SH, Charlieu, JP, Miyagawa, K., et al. (1995) .Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing.Cell 81, 391- 401), mouse embryonic fibroblasts (MEF) (Nagy A, et al. (2003) Manipulating The Mouse Embryo: A Laboratory Manual, Third Edition Cold Spring Harbor Press), and ST2 cells (Ogawa, M., Nishika wa, S., Ikuta, K., Yamamura, F., Naito, M., Takahashi, K. and Nishikawa, S. (1988) EMBO J, 7: 1337-1343) When the strain was used as a feeder cell and co-cultured with ES cells, it was found that differentiation of ES cells into Pdxl / β-gal expressing cells was promoted. The M15 cell line significantly enhanced the differentiation of ES cells into Pdxl / 18-gal expressing endoderm cells. When cultured on the M15 cell layer, 0.1% of the separated ES cells became Pdxl / -gal expressing cells (FIG. 1). This is similar to the proportion of Pdxl / β-gal expressing cells induced by co-culture with embryonic spleen primordia. MEF moderately promoted differentiation of ES cells into Pdxl / β-gal expressing endoderm cells. Since ES cells cultured on M15 cells produced the most Pdxl / β-gal expressing cells with good reproducibility, the M15 cell line was used in subsequent experiments.

[0054] Monitor the time-dependent changes of Pdxl / β-gal expressing cells on M15 feeder cell layer did. Figure 2 shows that the number of Pdxl / β-gal expressing cells peaked on day 12 and then decreased. When differentiated ES cells were trypsinized on day 7 and passaged on a freshly prepared M15 cell layer, Pdxl / β-gal positive cells reappeared on day 15 (equivalent to day 8 after passage). Appeared. The reappearance of Pdxl / 18-gal positive cells requires only a short time, indicating that when ES cells are cultured on a single cell layer of M15 feeders, undifferentiated cells or certain endoderm progenitors in the culture It shows that cells are present. When passage was performed up to 10 times, reappearance of Pd xl / β-gal positive cells was also observed.

 [0055] (2) Monitoring of endoderm differentiation in living ES cells using Pdxl / GFP expression In order to track pdxl expression in living ES cells using fluorescent dyes, Pdxl / GFP is included P # 48.9 strain transgenic mice (Gu, G., Wells, JM, Dom bkowski, D., Preffer, F., Aronow, B., and Melton, DA (2004). Global expression A development of ES cell lines was established. The P # 48.9 strain of transgenic mice has been shown to reproduce Pdxl expression through embryogenesis. Initially, eight ES cell lines were established, all of which showed similar Pdxl / GFP expression patterns during in vitro differentiation. Among them, the ES cell line named SK7 proliferated well and was used for the subsequent experiments. Pdxl / GFP-expressing ES cells (SK7) were differentiated on mitomycin-treated M15 cells and the time-dependent changes in Pdxl / GFP expression were monitored.

[0056] A schematic representation of the differentiation procedure is shown in Figure 3A. The ES cell line SK7 was seeded at a density of 500 Zwell on a 24-well plate containing differentiation medium containing 10% FBS. The culture conditions were compared between a control differentiation medium and a medium in which FBS in the differentiation medium after 4th day was replaced with Knocked-out Serum Replacement (KSR-substituted differentiation medium). In low-density culture, when ES cells were cultured in KSR-substituted differentiation medium, it became clear that the number of Pdxl / EGFP positive cells after day 4 increased (Fig. 3A). Fig. 3C shows the morphological changes in the colonies of ES cells in the cell. Many of the colonies remain in a raised shape until the 5th day, and cell migration from the center of the colonies is observed around day 6 (Fig. 3C). As cells migrate, Pdxl / EG FP expression becomes detectable on day 6 and reaches the maximum value on day 8 and decreases thereafter (Fig. 3B). In Pdxl / EGFP positive colonies, the cells also move the central force of the colony, Thereafter, Pdxl / EGFP positive cells were present at the periphery of the colony, and a round large flat colony was formed. Pdxl / EGFP negative colonies showed the characteristics of raised and dense colonies. These results indicate that it is necessary to acquire movement performance for spleen separation.

[0057] (3) Detection of expression of splenic endocrine markers and other endoderm-derived tissue markers in ES cells separated on one cell layer of M15 feeder by RT-PCR analysis

 To clarify the characteristics of the ES cell SK7 strain on the M15 feeder cell, the expression of the splenic endocrine marker was analyzed. Pdxl expression was detected on day 4 and peaked on day 8 (Figure 4). Other endocrine progenitor markers such as Nkx2.2, Nkx6.1, Pax4, Pax6, Isll, NeuroD, Ngn3 were also detected. Expression of Pax4 and Isll is also detected in control ES cells differentiated with gelatin-coated wells, but the expression of other markers is specifically induced by ES cells separated on the Ml 5 feeder cell layer. Is done. Insulin 2 expression in ES cells separated on the M15 feeder cell layer was detected on day 8. Other endocrine molecular and exocrine markers, such as glucagon, spleen polypeptide (Pp), and somatostatin (Sst), are also specific for ES cells separated on M15 feeder cells. Is detected. Maturation 'cell markers such as Iapp, Darcokinase, Kir6.2 are detected

[0058] In addition, immature liver markers (albumin, α-fetoprotein, Met), lung markers (Sft pc (Immunostaining in Fig. 5 also shows Nkx2.1 expression! /)), Oral cavity Marker (Pax9) is detected. That is, by the induction method using M15, the endoderm organ is induced in the liver, lungs and oral cavity in addition to the spleen. Furthermore, since the small intestine is also induced (Fig. 5), it is shown that it has a wide organ-inducing ability. Therefore, the differentiation induction method of the present invention is useful for inducing differentiation of endoderm organs including spleen, liver, lung, small intestine and oral cavity (Pax9, RT-PCR).

 [0059] The above results confirm that M15 support cells specifically promote the differentiation of ES cells into endoderm-derived organs such as spleen and liver. This activity was named Mesodermal Derived Inducing Activity (mesoderm-derived 匕 inducing activity; MDIA).

[0060] Furthermore, the effect of MDIA (mesoderm-derived differentiation induction activity) on other ES cells (Rl and Jl ES cells) was examined. Pdxl, or endocrine marker (insulin, spleen polypeptide, and Somatostatin expression was elevated in MDIA-treated R1 and Jl ES cells! /, (Right figure in Fig. 4). Therefore, it was shown that MDIA can be applied to various types of ES cells.

 [0061] (4) Detection of expression of endoderm-related markers in SK7 cell-derived differentiation cells

 Fig. 5 shows the results of detecting the expression of endoderm-related markers in SK7 cell-derived differential cells by immunohistochemistry. As shown in Figure 5, HNF3 β, a common marker of endoderm cells, various endoderm organ-related genes: albumin of liver marker gene, Nkx2.1 of lung marker gene, and Cdx2 gene of marker of small intestine (red) ) Was recognized. In addition, Hnf3 β-expressing cells overlap with Pdxl / EGFP positive cells. Cells expressing endoderm organ-related genes other than spleen such as lung and liver are different from the Pdxl / EGFP positive cells (green). there were.

 [0062] (5) Endoderm progenitor cells induced by MDIA treatment

The results of RT-PCR analysis showed that other endoderm-derived tissues (such as liver) were also induced by MDIA treatment of ES cells. This shows that MDIA treatment specifically induces differentiation from ES cells to endoderm. Using endoderm-specific enhancer fragment of 内 ηβ gene to monitor endoderm precursor differentiation (Nishizaki, Y., Shima zu, K., Kondoh, Η ·, Sasaki, Η. (2001) Identification of essential sequence motifs in t he node / notochord enhancer of Foxa2 (HnlBbeta) gene that are conserved across ve rtebrate species.Mech Dev 102, 57-66), expression of monomeric red fluorescent protein I reporter gene (mRFPl) A transgenic mouse into which the Hnf3β / mRFPl gene designed to regulate the expression was introduced. Hnf3 β / mRFPl transgenic mice reproduced the expression pattern of Hnf3 β as previously reported (Nishizaki et al., 2001). Ηηβ j8 / mRFPl Transgenic Mouse is Pdxl / EGFP Transgenic Mouse Strain P # 48.9 (Gu, G., Wells, JM, Dombkowski, D "Preffer, F" Aronow, B "and Melton, DA (2004 ) .Global e xpression analysis of gene regulatory pathways during endocrine pancreatic development.Development 131, 165-79) Crossed with Ηηβ j8 / mRFPl and Pdxl / EGFP transgenes. The ES cell line, designated PH3, was used in subsequent experiments ES cells The PH3 line was separated on M15 cells treated with mitomycin and depends on the time of expression of Pdx 1 / EGFP and Hnf3 β / mRFPl. Figure 6 shows the monitored dynamics. The expression of Ηηββ / mRFPl was observed on day 7 of differentiation, indicating that one day preceded the expression of Pdxl / EGFP. The population of ES cells that express Ηηββ is larger than the population that expresses Pdxl. A population of ES cells that express time-dependent expression and Hnf3 β and Pdxl reproduces normal embryonic development. From these results, it was shown that the endoderm precursor is induced by MDIA treatment of ES cells.

 [0063] (6) Part of mesoderm-derived differentiation-inducing activity (MDIA) is an effect of activin

 Screening the expression of several growth factors such as activin β 匕, activin β Β, and fluorstatin in the feeder cell line used in the experiment to clarify the molecular mechanism of mesoderm-derived ス タ チ ン inducible activity (MDIA) did. Activin 13 Α and activin 13 B are expressed at high levels in M15 cells and at moderate levels in MEF cells. Fluorostatin is not expressed in M15 cells, but is expressed at high levels in MEF cells and ST2 cells (FIG. 7A). The effect of activin A supplementation in ES cell cultures was analyzed. Addition of lOng / ml activin A significantly promoted Pdxl / EGFP expression on M15 cells (Figure 7B, Student's t-test, * p <0.01). When fluorstatin was added at 25 ng / ml, Pdxl / EGFP positive cells were reduced, and when added at 250 ng / ml, it was further significantly reduced. MDIA promotion by external addition of activin A (10 ng / ml) is inhibited by 250 ng / ml fluorstatin. These results indicate that MDIA-mediated molecules are useful for studying the induction signals required for ES cell differentiation into the knee. The above results indicate that activin is one of the molecules that mediate MDIA. Since MDIA is not completely inhibited by fluorstatin, the M15 cells involved in MDIA that contain ES cells into endoderm cells may contain other molecules. By studying secreted or membrane-bound molecules expressed in M15 cells or other feeder cells that exhibit MDIA, we are interested in elucidating the molecular mechanism of ES cell differentiation into the endoderm system. Information can be obtained.

 [0064] (7) MDIA promotes the differentiation of ES cells into the endoderm system and can be used to screen for inducers or culture conditions that promote this differentiation.

Whether MDIA can be used to screen for induced molecules that further promote the differentiation of ES cells into the endoderm system when added to ES cells cultured on M15 cell layers. It was examined. As shown in FIG. 3A, ES cells cultured in KSR-substituted medium showed higher production of Pdxl / EGFP-expressing cells, so the possibility of the presence of an inhibitor in serum was estimated. Noggin, an inhibitor of BMP, was added at various times to test its effect on MDIA. Results showed that lOOng / ml noggin supplemented on days 5-8 enhanced MDIA. As shown in Fig. 8, the enhancement effect of Noggin can be observed by using KSR-substituted medium instead of medium. However, the effect of adding noggin was not limited to the later stage of the minute. MDIA was enhanced by adding lOOng / ml noggin on days 0-4. Additional experiments in which noggin was added in a shorter period of time show that noggin addition on days 3-4 is similar to that on days 0-4 (Figure 8). Next, we investigated whether BMP in serum acts to inhibit ES cell differentiation into the endoderm. Figure 9 shows that Pdxl / EGFP-expressing cells of the same level as when cultured in KSR-substituted medium without addition of noggin were produced by the addition of noggin to the medium on day 3-4. Show. The number of Pdxl / EGFP-expressing cells in ES cells differentiated in KSR-substituted medium was decreased by the addition of BMP2, but this was offset by the addition of noggin (Fig. 9). However, it was revealed that the expression of Pdxl / EGFP was low in ES cell sorting in the serum-free state on days 0 to 4 due to poor cell growth. Therefore, in subsequent experiments, noggin was added on the 3rd to 4th days to promote differentiation of ES cells into the endoderm system, and after the 4th day of differentiation, the KSR replacement solution was used instead of the differentiation medium. Use media.

 [0065] Further, the effect of adding nicotinamide (NA) together with noggin or activin A was examined. FIG. 10 shows that the addition of noggin and activin or noggin and nicotinamide did not show any additive effect. However, the addition of noggin, activin, and nicotinamide promoted Pdxl / EGFP expression. The inset shows time-series data when noggin, activin, nicotinamide V, or any of them is added.

 [0066] Because BMP2 and nicotinamide are expressed in both M15 cells and other cell lines! /,!, These results indicate that MDIA is useful for screening growth factors or compounds that promote endoderm differentiation. Indicates that is available.

 [0067] (8) Promotion of differentiation induction into spleen by addition of growth growth factor

Addition of activin, bFGF, or activin + bFGF into differentiation medium containing 10% FBS Showed that the number of cells expressing Pdxl / EGFP increased. FIG. 11A shows the Pdx 1 / EGFP image on day 8. It was added so as to be activin 20 ng / ml and bFGF 5 ng / ml. In FIG. 11A, the morphology of Pdxl / EGFP positive colonies was changed by arranging activin and FGF. The cell mass that was in the center of the positive colony disappeared, resulting in an increase in the number of cells expressing Pdxl / EGFP. Moreover, the synergistic effect was shown by making both act on ES cell simultaneously. The uppermost figure of d8 / M15 shows that the Pdxl / EGFP positive colony when spreading with M15 is spread, the cell mass appears to be small in the center, and the Pdxl / EGFP positive cell is colony. Located on the edge of the (arrow). In Pdxl-negative colonies, a large round colony is observed in the center (arrow head). + Activin (20) contains 20 ng / ml of activin from day 0 to day 8 of differentiation. Many Pdxl / EGFP positive spleen stem cells appeared, showed a wide colony morphology, and Pdxl / EGFP negative colonies decreased. The small mass of cells that was visible in the center of the Pdxl / EGFP positive colony has disappeared. + bFGF (5) is supplemented with 5 ng / m1 of bFGF up to day 8 and day 8. The migration of cells in the center is promoted, and the colony morphology is expanded. As a result, Pdxl / EGFP positive cells are accumulated by the marginal part of the colony. In addition, + activin (20) + bFGF (5) retains activin and bFGF up to the 8th day of differentiation on the 0th day of differentiation. The two further synergized and more Pdxl / EGFP positive knee stem cells appeared.

 [0068] FIG. 11B shows the results of staining of the separated cells obtained under the conditions in which both activin and bFGF in FIG. 11A are stored with an antibody against C peptide. Since the C peptide occurs as a byproduct during insulin biosynthesis, positive cells are shown to actually biosynthesize insulin. Pdxl / EGFP positive cells are green. In the cell line, C peptide alone positive (red) was also observed, but many cells were both C peptide / Pdxl positive (yellow). Enlarged pictures are shown in A and B.

[0069] Furthermore, differentiation was evaluated using FACS. In FIG. 12A, the endoderm (definitive endoderm) is a positive cell for both E-cadherin and Cxcr4. Splenic progenitor cells should be both E-cadherin and Pdxl / EGFP positive cells. On M15, endoderm accounts for 8% of all cells on day 8. Under the conditions where activin and bFGF were added, the percentage of endoderm increased, accounting for 47% of all cells. In addition, splenic progenitor cells are 22% of the endoderm on M15. Under GF-added conditions, the proportion of knee progenitor cells in the endoderm increased to 67%.

[0070] FIG. 12B shows ES cells and M15 cells using side scattered light (SSC) that reflects the complexity of the internal structure of the cell and forward scattered light (FSC) that reflects the size of the cell. The FACS development image of the differentiated ES cell is shown. Using the SSC and FSC indices, M15 cells can be removed by separating the part enclosed by the polygon in the figure. FIG. 12B shows the force under the conditions where activin and bFGF were added. It can be seen that this M15-free fraction contains Pdxl / EGFP positive cells.

 [0071] (9) Isolation and expression analysis of ES cell-derived Pdxl / EGFP positive cells by FACS

 In order to investigate the molecular characteristics of ES cell-derived Pdxl / EGFP-expressing cells, the differentiated ES cell population was analyzed by FACS. FIGS. 13A and 13B show that the population of Pdxl / EGPF positive cells is shifted to the GFP positive side in ES cells sorted on M15 cells compared to undifferentiated ES cells. Differentiated ES cells were divided into 5 fractions according to the expression level of GFP, and for each fraction, the expression of molecular markers in spleen cells was analyzed by RT-PCR. RT-PCR analysis shows high Pdxl expression in the no.4 fraction with a strong GFP positive signal (Figure 13C). This fraction represents approximately 1% of all differentiated ES cells (Figure 13B). In this fraction with a strong GFP-positive signal, expression of NeuroD, insulin, PP, and Sst was also observed, indicating that the cells in this fraction are of the spleen lineage.

 [0072] (10) Differentiation ES cell maintenance culture

 Differentiated ES cells can be maintained and cultured by the method shown in FIG. In other words, Pdxl positive cells could be maintained and cultured by re-seeding the differentiated ES cells in a low cell binding dish coated with MPC under both M15 and both activin and bFGF. (Figure 14).

 [0073] (11) Maintenance of Pdxl / EGFP and insulin expression in ES cells transplanted under the kidney capsule of mice

 The separated ES cells were transplanted under the kidney capsule. Transplanted mice were sacrificed one week later and frozen sections of the grafts were analyzed by immunohistochemistry. FIG. 15 shows that Pdxl / EGFP expression is maintained and insulin expression is also seen. These results indicate that Pdxl / EGFP positive cells proliferate and can be separated into insulin producing cells when transplanted into mice.

[0074] (12) Differentiation induction using monkey ES cells FIG. 16 shows a stained image of cells induced to differentiate on M15 using monkey ES cells in the same manner as mouse ES cells. The culture conditions of monkey ES cells (purchased from Asahi Techno Glass Co., Ltd.) are as follows. On day 0 of culture, monkey ES cells were seeded on a 24-well plate at a concentration of 20,000 cells / well, and the medium was changed on days 1, 3, 5, 7, and 9 of culture. The medium used was a broth medium (10% FBS / D MEM (high glucose). A and B in FIG. 16 are stained images on days 4 and 8 after differentiation induction. The results of staining with the marker HNF3 j8 and the mesoderm marker T (Brachyury) show strong expression of HNF3 β on both day 4 and day 8. C, D, E in Fig. 16 On day 10, the spleen progenitor cell marker Pdxl, the small intestine marker Cdx2, the liver marker albumin, and the bile duct marker CK19 are expressed, so endoderm cells (spleen, liver, Differentiation into the bile duct and small intestine was shown.

[0075] (13) Differentiation induction using human ES cells

 FIG. 17 shows a stained image of cells induced to differentiate on M15 using human ES cells in the same manner as mouse ES cells. The culture conditions for human ES cells are as follows. On day 0 of culture, human ES cells were seeded on a 24-well plate at a concentration of 20,000 cells / well, and the medium was changed on days 1, 3, 5, 7, 9, and 11 of culture. The medium used was a differentiation medium (10% KSR / DMEM (high glucose). In Figs. 17A and 17B, on day 12, endoderm cell marker HNF3 β, small intestine marker Cdx2, liver marker. Albumin, α-fetoprotein, and biliary CK19 were expressed, indicating that they were divided into endoderm cells (liver, bile duct, small intestine).

 [0076] (14) Induction of splenic progenitor cells using serum-free medium on M15 feeder cells

 FIG. 18 shows the results of evaluation of differentiation potential using SK7 cells on M15 feeder cells. The definitive endoderm is a positive cell for both E-cadherin and Cxcr4. Serum factors may be required for endoderm maintenance and separation into Pdxl / EGFP positive cells. In serum-free medium alone, differentiation into endoderm and splenic progenitor cells was low on M15 cells, but when activin was added, the ability to differentiate into endoderm and splenic progenitor cells increased (Fig. 18). In particular, only 2% of the cells were distributed to splenic progenitor cells, and a high efficiency was achieved.

 Industrial applicability

[0077] According to the method of the present invention, ES cell power can be efficiently separated from endoderm cells such as spleen stem cells. Can be guided. Further, by using the culture method of the present invention, it is possible to measure the separation-inducing effect of an unknown substance on the spleen with high sensitivity, and therefore, it can be applied as a screening method for a separation-inducing substance. According to the present invention, differentiated ES cell-derived spleen stem cells or hepatic stem cells can be purified and maintained and cultured in vitro. In addition, the method of the present invention can be applied to multiple types of ES cell lines. The method of the present invention can also be applied to cells of endodermal origin that have the same development.

Brief Description of Drawings

[FIG. 1] FIG. 1 shows screening of spleen-inducing ability in various cell lines. A: A schematic diagram of the differentiation induction method. After seeding ES cells in which LacZ gene was knocked into the Pdxl promoter at a density of 5000 cells / well (24 wells) on cultured cells, the cells were cultured in the presence of serum and stained with X-gal on the 12th day. The effect of inducing splenic differentiation was evaluated. Since floating embryoid bodies (EBs) are seeded on cultured cells on the second day after the formation, they were evaluated by X-gal staining on the 14th day of culture. B: X-gal stained image. Each photograph shows the cell name used as a feeder cell. C: The vertical axis represents the proportion of Pdxl / β-gal positive cells when each cell line is used as a feeder cell. Inductive effects were observed for M15, MEF, and ST2. Student's t-test was significantly different from ES cells differentiated on control experiment gels: **, p <0.01.

[FIG. 2] FIG. 2 shows evaluation of Pdxl / β-gal positive cells from ES cells over time using M15. A: Using M15, which showed the highest spleen induction effect by screening, differentiation induction experiments from ES cells were performed and evaluated over time by X-gal staining. The photo shows the number of days after the start of differentiation induction. The number of days in parentheses is the number of days after passage. B: Time course of appearance of Pdxl / β-gal positive cells by passage on M15 feeder cells. The horizontal axis represents the number of days after the start of differentiation induction, and the vertical axis represents the number of Pdxl / 18-gal positive cells. In differentiation induction using M15, Pdxl / β-gal positive cells initially peak at day 12, but then decrease. When passaged onto M15 feeder cells, Pdxl / β-gal positive cells peaked again 7-8 days after passage. The first passage is indicated by a black circle, and the second passage is indicated by a black square.

FIG. 3 shows evaluation of differentiation into Pdxl / EGFP positive cells in real time using ES cells (SK7 cells) in which GFP is introduced under the Pdxl promoter. A: A schematic diagram of the differentiation induction method is shown. In differentiation induction method using SK7, seeding on M15 without forming EB . In both figures, after seeding at 500 cells / well (24 wells), the cells were cultured in 10% serum medium until the fourth day of culture, and cultured in 10% KSR medium from the fourth day of culture. The appearance of Pdxl / EGFP positive cells over 6 to 8 days after differentiation induction was evaluated. At high density (5000 cells / well), differentiation occurs only in 10% serum medium, but at low density (500 cells / well), differentiation efficiency is poor. When replaced with 10% KSR medium, Pdxl / EGFP-positive cells can Appears. It reaches its peak on the 8th day. Evaluation of differentiation into Pdxl / EGFP positive cells was carried out by summing fluorescence intensities for fluorescent photographs using Luminavision software. B: Pdxl / EGFP-positive colonies when differentiated using M15 show an expanded morphology, and Pdxl / EGFP-positive cells are located at the edge of the colonies. Pdxl / EGFP negative colonies show round colony morphology. The differentiation image of the 7th day after differentiation induction is shown. C: Image of time-lapse culture using SK7 cells and appearance of Pdxl / EGFP positive spleen stem cells. A round colony appears until day 5 after induction, but on the 6th day after differentiation, cell migration occurs rapidly, indicating a spread of colonies. Pdxl / EGFP positive cells are located at the edge of the colony. On day 9 after differentiation induction, the number of Pdxl / EGFP positive cells decreases.

 FIG. 4 shows the results of RT-PCR analysis. Expression of various spleen progenitor cell-related genes, spleen endocrine cell marker genes, exocrine cell marker genes, diffractive β-cell marker genes, and liver marker genes was observed. Although the SK7ES cell line was established from ICR mice, the same M15 support cells promoted the differentiation induction in other Rl and Jl ES cell lines. In cells induced on M15 feeder cells, expression of pdxl gene or endocrine marker genes such as insulin, spleen peptide, and somatostatin was detected on day 8.

 [FIG. 5] FIG. 5 shows the results of detecting the expression of an endoderm-related marker in SK7 cell-derived differentiation cells by immunohistochemistry. Expression of HNF3 β, albumin, Nkx2.1, and Cdx2 was observed.

FIG. 6 shows that endoderm progenitor cells are induced from ES cells. In order to further investigate the dynamics of endoderm progenitor cells separated from ES cells, the endoderm-specific expression control enhancer region of the mouse Hnf3 β gene was used. Pdxl / G so that the expression of Hnf3 β gene can be visualized with the mRFPl (monomeric Red Fluorescent Protein 1) reporter protein. ES cell lines were established from FP, Hnf3 β / mRFPl double transgenic mice. In the established Pdxl / EGFP-Hnf3 β / mRFPl ES cell line, Pdxl / EGFP expression began on day 1, whereas Hnf3 | 8 / mRFPl expression began on day 7 (1 Hnf3 β / mRFPl expression was induced in a wider range of cells than Pdxl / EGFP expressing cells. Analysis of transgenic mice shows that the Hnf3 | 8 gene is expressed along the anteroposterior axis in the intestinal epithelium at the time when the endoderm region is determined to be in the early stage of development (around 8.5 days of embryonic development). In comparison, it was confirmed that it was expressed in a wider range as early as one day, suggesting that this HNF3 β-positive cell corresponds to an endoderm progenitor cell in the stage before being subjected to region selection. Therefore, differentiation induction on M15 feeder cells is considered to reflect the normal development process.

 [Fig. 7] Fig. 7 shows that part of the mechanism of M15 induction by M15 is mediated by activin. Α: A comprehensive analysis of gene expression was performed on the cultured cells used for screening to elucidate the mechanism of spleen 匕 induction by Μ15 using Aifymetrix's Gene Chip, and the expression of genes showing bioactive effects was examined. As a result, it was clarified that the inhibitor folistatin of activin, which is involved in spleen induction in normal development, is extremely low at M15. In addition, activin is expressed to some extent in M15 cells, MEF, and ST2 cells. B: Induction of spleen was promoted by activin, and differentiation induction was inhibited by fluoristin. Activin and fluorstatin were added on the third day after induction of differentiation. The medium was cultured in a medium containing FBS until the third day, and the medium replaced with KSR was used until the third to the eighth day. The appearance of Pdxl / E GFP positive spleen stem cells on the 8th day was evaluated. In order to evaluate the influence of floristatin, addition of fluorstatin at the time of induction of spermatozoon inhibited splenic differentiation induction in a concentration-dependent manner. (Cont is significant compared to Student's t-test, * p <0.05, n = 3). However, the effect of inducing splenic differentiation by M15 could not be inhibited 100%. In addition, the effect of spleen differentiation inducing effect was observed with activin (lOng / ml), which was inhibited by the addition of an excessive amount of folistatin (compared to the group with 10 ng / ml of activin). Significant in test, * * p <0. 01, n = 3).

FIG. 8 shows the results of examining the effect on differentiation induction by adding noggin to the medium. In the early stage of induction, a medium containing FBS is used. Factors were considered. Noggin was added for various periods to evaluate Pdxl / EGFP positive cells appearing in real time. Induction of spleen differentiation was promoted by adding noggin at the early stage of differentiation induction. The number of days that promoted by adding noggin could be identified on days 2-4, or on days 3-4 as the minimum.

 FIG. 9 shows that the promotion of splenic differentiation induction by noggin is due to inhibition of BMP2 contained in serum. Differentiation induction On day 3-4, noggin was added at 100 ng / ml, or BMP2 at a predetermined concentration. Where indicated, FBS in the medium on days 3-4 is replaced with KSR. On day 6, Pdxl / EGFP positive cells were evaluated. In the FBS-containing fraction broth medium, there was a significant difference due to noggin-added calories compared to the non-added group (Student's t-test, ** p <0.01). When KSR was replaced, spleen 匕 induction was enhanced (compared to Noggin (-). Student's t-test, * p 0.05). This enhancement was inhibited by the addition of BMP2 (compared with KSR-substituted medium noggin (-) and BMP addition group (* p 〈0.05, * * p 〈0.01). Inhibition by BMP2 (* *, P 〈0.01).

 FIG. 10 shows that noggin and nicotinamide, or activin and nicotinamide synergistically induce splenic differentiation. Nicotinamide alone did not promote induction of splenic differentiation, but synergistically induced induction of spleen by using in combination with noggin or activin. The combined use of noggin, activin, and nicotinamide shifted the appearance of Pdxl / EGFP positive cells to an early stage and peaked on the 6th day after induction of differentiation. Compare with KSR-replacement medium control group by each day Student's t-test, * * p 〈0.01)

[FIG. 11] FIG. 11 shows the promotion of spleen induction by the addition of activin and bFGF. Figure 11A shows that the number of Pdxl / EGFP-expressing cells greatly increases with the addition of activin, bFGF, or both activin and bFGF into differentiation medium containing 10% FBS. Shown in the image. FIG. 11B shows the result of staining the cells of the cells obtained under the condition where both activin and bFGF in FIG. 11A are supported with an antibody against C peptide.

[FIG. 12] FIG. 12 shows that FACS can quantitatively evaluate the promotion of spleen induction in the spleen by the addition of activin and bFGF, and shows that the degree is very large. We also show that MACS support cells can be selectively removed using FACS using FACS. Figure 12A shows that the endoderm (definitive endoderm) is a positive cell for both E-cadherin and Cxcr4. It shows. Figure 12B shows an M15 cell from a population of ES cells separated using side-scattered light (SSC) that reflects the complexity of the cell's internal structure and forward-scattered light (FSC) that reflects the size of the cell. 2 shows FACS development images of differentiated ES cells before and after selective removal of vesicles.

[FIG. 13] FIG. 13 shows the purification of ES cell-derived spleen stem cells using a cell sorter and analysis of the molecular markers expressed. SK7 ES cells were induced to differentiate in FBS-containing medium in 300,000 cells / 90 mm dish on M15 cells, and FACS was performed on the 9th day. The cell population of the fraction of GFP-positive cells was increased by induction. Fractions 1-4 were collected. Fraction 4 is strongly GFP positive, and cells expressing Pdxl gene are concentrated in this fraction. In addition, it expresses NeuroD, Somat ostatin, and insulin!

 FIG. 14 shows a maintenance culture method of differentiation-induced Pdxl positive splenic progenitor cells. Pdxl-expressing cells can be maintained and cultured by re-seeding the differentiated ES cells in a low cell binding dish coated with MPC under M15 with both activin and bFGF.

FIG. 15 shows transplantation of differentiation-induced ES cells under the adult mouse kidney capsule. Fig. 14 shows how ES cell-derived Pdxl positive knee progenitor cells are transplanted under the adult kidney capsule. FIGS. 15A and 15B show fluorescent micrographs, in which Pdxl / EGFP positive cells are retained. FIG. 15C shows the presence of insulin, Pdxl / EGFP double positive cells by immunohistochemical analysis of the graft.

[FIG. 16] FIG. 16 shows the results of induction of differentiation into endoderm progenitor cells and hepatic knee cells using force quizal ES cells. In Fig. A, on the fourth day of differentiation induction, many endoderm progenitor cells and mesoderm progenitor cells are induced to differentiate. Images of HNF3 β (red: endoderm marker), Τ (green: mesoderm marker) and DAPI nuclear staining of cells on differentiation day 4 (A) and day 8 (B). In Fig. IV, many endoderm cells remain on the 8th day of differentiation induction. Mesodermal progenitor cells can no longer be detected. In Fig. C, Pdxl-positive cells (red) of splenic progenitor cells and Cdx2-positive cells (green) of small intestinal progenitor cells were detected on day 10 of differentiation induction. Both are different cell populations. In Fig. D, albumin-positive cells (red) and α-fetoprotein-positive cells (green) were detected on the 10th day after induction of hepatitis. Many cells were expressed independently, but co-expressed cells were also observed. In Figure IV, CK19-positive cells (red) and a-protein-positive cells (green) were detected on the 10th day of differentiation induction. That Cells expressing each one were observed.

 FIG. 17 shows the results of induction of differentiation into endoderm organs using human ES cells. In Fig. A, on the 12th day of induction of differentiation, Hnf3 β positive cells (red) of endoderm cells and Cd x2 positive cells (green) of small intestinal progenitor cells were detected. Although many cells co-expressed, Cdx2-only positive cells were also observed. In Fig. B, on day 12 of differentiation induction, albumin positive cells (red) and α-fetoprotein positive cells (green) were detected as liver progenitor cells. In Fig. C, CK19-positive cells (green) and oc-protein-positive cells (red) of bile duct cells were detected on the 12th day of differentiation induction.

[18] FIG. 18 shows the results of the induction of knee progenitor cells by induction of serum using serum-free medium on M15 feeder cells.

Claims

The scope of the claims

 [I] A method for inducing differentiation of ES cells into endoderm cells, comprising culturing ES cells derived from mammals in the presence of feeder cells.

 [2] The method according to claim 1, wherein the feeder cells are cells derived from mesoderm.

 [3] The method according to claim 1 or 2, wherein the feeder cells are M15 cells, MEF cells or ST2 cells.

[4] The method according to any one of claims 1 to 3, wherein the ES cell is induced to differentiate into an undifferentiated endoderm progenitor cell, an immature cell of an endoderm-derived organ, or an mature cell of an endoderm-derived organ. The method described in.

 [5] The method according to claim 4, wherein the endoderm-derived organ is spleen, liver, lung, pharynx, or small intestine.

[6] The culture according to any one of claims 1 to 5, wherein when culturing ES cells in the presence of supporting cells, actinbin, basic fibroblast growth growth factor (bFGF), and Z or noggin are added and cultured. The method described.

 [7] The method according to claim 6, wherein when culturing ES cells in the presence of feeder cells, nicotinamide is further added and cultured.

8. The method according to any one of claims 1 to 7, wherein the mammal-derived ES cells are mouse, monkey or human-derived ES cells.

[9] An endoderm cell obtained by differentiation from ES cells, obtained by the method according to any one of claims 1 to 8.

 [10] A step of inducing differentiation from an ES cell into an endoderm cell by the method according to any one of claims 1 to 8, and the differentiation-induced endoderm cell by flow cytometry (FACS) using a fluorescent label. A method for obtaining endoderm cells induced to differentiate from ES cells, comprising a step of separating.

 [II] including culturing endoderm cells obtained by differentiation from ES cells obtained by the method according to any one of claims 1 to 8 on a plate coated with 2-methacryloyloxetyl phosphorylcholine A method for maintaining and culturing endoderm cells induced to differentiate from ES cells.

[12] The method according to claim 11, wherein the culture is performed in the presence of a knockout serum replacement KKSR). Law.

 [13] When inducing differentiation from ES cells to endoderm cells by culturing mammalian-derived ES cells in the presence of supporting cells, the ES cells are cultured in the presence of the test substance. Comparison of the degree of differentiation induction into endoderm cells when ES cells are cultured in the absence of ES and the degree of differentiation induction into endoderm cells when ES cells are cultured in the presence of the test substance Screening a substance that promotes or inhibits differentiation induction from ES cells to endoderm cells.

 14. The screening method according to claim 13, wherein the test substance is a growth factor or a low molecular compound.

 15. The screening method according to claim 13 or 14, wherein the degree of differentiation induction into endoderm cells is measured using the expression level of a marker expressed in the endoderm as an index.

 [16] The screening method according to any one of [13] to [15], wherein the mammal-derived ES cells are mouse, monkey or human-derived ES cells.