WO2006115575A1 - Regulatory regions from papaveraceae - Google Patents

Regulatory regions from papaveraceae Download PDF

Info

Publication number
WO2006115575A1
WO2006115575A1 PCT/US2006/006354 US2006006354W WO2006115575A1 WO 2006115575 A1 WO2006115575 A1 WO 2006115575A1 US 2006006354 W US2006006354 W US 2006006354W WO 2006115575 A1 WO2006115575 A1 WO 2006115575A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
plant
heterologous nucleic
seq
construct
Prior art date
Application number
PCT/US2006/006354
Other languages
French (fr)
Inventor
Nestor Apuya
Yuping Lu
Original Assignee
Ceres Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ceres Inc. filed Critical Ceres Inc.
Publication of WO2006115575A1 publication Critical patent/WO2006115575A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Nutrition Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Regulatory regions suitable for regulating expression of a heterologous nucleic acid are described, as well as nucleic acid constructs that include these regulatory regions. Also disclosed are transgenic plants, e.g., Papaveraceae plants, that contain such constructs.

Description

Regulatory Regions From Payaveraceae
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U. S. C. § 119 to U.S.
Provisional Application No. 60/673,307, filed April 20, 2005, which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
The present invention relates to compositions and methods involving regulatory regions from Papaveraceae species.
INCORPORATION-BY-REFERENCE & TEXT
The material on the accompanying diskette is hereby incorporated by reference into this application. The accompanying diskette contain one file, 60340963.txt, which was created on February 21, 2006. The file named 60340963.txt is 43 KB. The file can be accessed using Microsoft Word on a computer that uses Windows OS.
BACKGROUND An essential element for genetic engineering of plants is the ability to express genes using various regulatory regions. The expression pattern of a transgene, conferred by a regulatory region is critical for the timing, location, and conditions under which a transgene is expressed, as well as the intensity with which the transgene is expressed in a transgenic plant. There is continuing need for suitable regulatory regions that can facilitate transcription of sequences that are operably linked to the regulatory region.
SUMMARY
In one aspect, the invention features an isolated nucleic acid comprising a regulatory region having the nucleotide sequence of SEQ E) NOs: 1, 2, 3, 4, 5, or 6. Bi some embodiments, the regulatory region has a nucleotide sequence complementary to SEQ ID NOs: 1, 2, 3, 4, 5, or 6. In some embodiments, the regulatory region is at least 300 nucleotides in length and has 70% or greater sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, or 6, e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, or 6. A nucleic acid construct can comprise such a regulatory region, operably linked to a heterologous nucleic acid. The heterologous nucleic acid can encode a polypeptide. A transgenic plant can comprise at least one such nucleic acid construct, e.g., first and second nucleic acid constructs, each construct having a regulatory region operably linked to a heterologous nucleic acid. In some cases, the regulatory region of the first nucleic acid construct is different from the regulatory region of the second nucleic acid construct. The plant can be a dicotyledonous plant or a monocotyledonous plant. In some embodiments, the heterologous nucleic acid is a coding sequence for a regulatory protein involved in alkaloid biosynthesis. In some embodiments, the heterologous nucleic acid is a coding sequence for an enzyme involved in alkaloid biosynthesis, e.g., salutaridinol 7-O-acetyltransferase, salutaridine synthase, salutaridine reductase, morphine 6-dehydrogenase; or codeinone reductase. In some embodiments, the heterologous nucleic acid is transcribed into an interfering RNA against a gene coding for a protein involved in alkaloid biosynthesis or an interfering RNA against a gene coding for a methylation status polypeptide.
In another aspect, the invention features a method for making a plant. The method comprises introducing into a plant at least one nucleic acid construct comprising a regulatory region having the nucleotide sequence of SEQ ID NOs: 1, 2, 3, 4, 5, or 6; a nucleotide sequence complementary to SEQ ID NOs: 1, 2, 3, 4, 5, or 6; or a sequence at least 300 nucleotides in length and having 70% or greater sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, or 6. The construct can comprise a heterologous nucleic acid operably linked to the regulatory region. In some embodiments, the heterologous nucleic acid encodes a regulatory protein involved in alkaloid biosynthesis. In some embodiments, the heterologous nucleic acid encodes an enzyme involved in alkaloid biosynthesis, e.g., salutaridinol 7-O-acetyltransferase, salutaridine synthase, salutaridine reductase, morphine 6-dehydrogenase; or codeinone reductase. In some embodiments, the heterologous nucleic acid is transcribed into an interfering RNA against a protein involved in alkaloid biosynthesis. The plant made by the method can be a monocotyledonous plant or a dicotyledonous plant such as a Papaveraceae plant.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
BRIEFDESCRIPTION OFTHE DRAWINGS Figure 1 is the nucleic acid sequence of a Eschscholzia californica N- methylcoclaurine 3 '-hydroxylase (EcNMCBB) regulatory region.
Figure 2 is the nucleic acid sequence of a Papaver somniferum (R5S)- reticuline 7-0-methyltransferase (PsROMT) regulatory region.
Figure 3 is the nucleic acid sequence of a Papaver somniferum S- adenosyl-L-methionine:3 '-hydroxy N-methylcoclaurine 4'-0-methyltransferase 2 (PsHMC0MT2) regulatory region.
Figure 4 is the nucleic acid sequence of a Papaver somniferum salutaridinol 7-0-acetyltransferase (PsSAT) regulatory region.
Figure 5 is the nucleic acid sequence of a Papaver somniferum PsCRX regulatory region.
Figure 6 is the nucleic acid sequence of a Papaver somniferum PsCR3 regulatory region. DETAILED DESCRIPTION
The present invention relates to the discovery of novel regulatory regions of alkaloid biosynthesis genes. These regions are useful for directing the transcription of sequences of interest in eukaryotic organisms.
Regulatory Regions
The present invention features isolated nucleic acids that comprise a regulatory region. A regulatory region described herein is a nucleic acid that regulates transcription of a heterologous nucleic acid, when the regulatory region is operably linked 5' to the heterologous nucleic acid. The terms "nucleic acid" and "polynucleotide" are used interchangeably herein, and refer to RNA or DNA, including cDNA, synthetic DNA or genomic DNA. A nucleic acid can be single- or double-stranded and, if single-stranded, can be either a coding or non- coding strand. An "isolated nucleic acid" lacks one or both of the nucleic acid sequences that flank the nucleic acid as it occurs in nature in the genome. Thus, an isolated nucleic acid includes, without limitation, a DNA molecule that exists as a separate molecule (e.g., a chemically synthesized nucleic acid, or a cDNA or genomic DNA fragment produced by PCR or by restriction endonuclease treatment) without flanking sequences. An isolated nucleic acid also refers to a DNA molecule that is incorporated into a vector, an autonomously replicating plasmid, a virus, or into the genomic DNA of a prokaryote or eukaryote. A nucleic acid existing among hundreds to millions of other nucleic acids within, for example, cDNA libraries, genomic libraries, or gel slices containing a genomic DNA restriction digest, is not an isolated nucleic acid. The nucleic acid molecules depicted in Figures 1-6 are examples of regulatory regions disclosed herein. However, a regulatory region can have a nucleotide sequence that deviates from those shown in Figures 1, 2, 3, 4, 5, or 6, while retaining the ability to regulate expression of an operably linked nucleic acid. For example, a regulatory region having 70% or greater (e.g., 80% or greater, 81% or greater, 82% or greater, 83% or greater, 84% or greater, 85% or greater, 86% or greater, 87% or greater, 88% or greater, 89% or greater, 90% or greater, 91% or greater, 92% or greater, 93% or greater, 94% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, or 99% or greater) sequence identity to any one of the nucleotide sequences depicted in SEQ ID NOs: 1-6 can affect expression of an operably linked nucleic acid.
The term "percent sequence identity" refers to the degree of identity between any given query sequence, e.g., SEQ ID NO:1, and a subject sequence. A subject sequence typically has a length that is more than 80 percent, e.g., more than 82, 85, 87, 89, 90, 93, 95, 97, 99, 100, 105, 110, 115, or 120 percent, of the length of the query sequence. A percent identity for any subject nucleic acid relative to a query nucleic acid can be determined as follows. A query nucleic acid sequence is aligned to one or more subject nucleic acid sequences using the computer program ClustalW (version 1.83, default parameters), which allows alignments of nucleic acid sequences to be carried out across their entire length (global alignment). Chenna et al, Nucleic Acids Res., 31(13):3497-500 (2003).
ClustalW calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pairwise alignment of nucleic acid sequences, the following parameters are used: word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5. For multiple alignment of nucleic acid sequences, the following parameters are used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes. For fast pairwise alignment of protein sequences, the following parameters are used: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; gap penalty: 3. For multiple alignment of protein sequences, the following parameters are used: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: G, P, S, N, D, Q, E, R, K; residue- specific gap penalties: on. The ClustalW output is a sequence alignment that reflects the relationship between sequences. ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher site <http://searchlauncher.bcm.tmc.edu/multi-align/multi-align.html> and at the European Bioinformatics Institute site <http://www.ebi.ac.uk/clustalw>.
To determine a percent identity between a query sequence and a subject sequence, ClustalW divides the number of identities in the best alignment by the number of residues compared (gap positions are excluded), and multiplies the result by 100. The output is the percent identity of the subject sequence with respect to the query sequence. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2. It is also noted that the length value will always be an integer.
A regulatory region featured herein can be made by cloning 5' flanking sequences from a genomic alkaloid biosynthesis gene, as described in more detail below. Alternatively, a regulatory region can be made by chemical synthesis and/or polymerase chain reaction (PCR) technology. PCR refers to a procedure or technique in which target nucleic acids are amplified. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers are typically 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length. PCR is described, for example in PCR Primer: A Laboratory Manual, Ed. by Dieffenbach, C. and Dveksler, G., Cold Spring Harbor Laboratory Press, 1995. Nucleic acids also can be amplified by ligase chain reaction, strand displacement amplification, self-sustained sequence replication or nucleic acid sequence-based amplification. See, for example, Lewis, Genetic Engineering News, 12(9): 1 (1992); Guatelli et al, Proc. Natl. Acad. Sd. USA, 87:1874-1878 (1990); and Weiss, Science, 254:1292 (1991). A fragment of a regulatory region described herein can be made by similar techniques. For example, fragments of a regulatory region can be made that contain nucleotides 1 to 250 of SEQ ID NO:1 or nucleotides 1 to 500 of SEQ ID NO: 1. In another example, fragments of a regulatory region can include nucleotides 1 to 500 of SEQ ID NO:5 or nucleotides 100 to 700 of SEQ ID NO:5. Fragments of a regulatory region can be at least 100 nucleotides in length, e.g., about 200, 250, 300, or 350 nucleotides in length. The ability of fragments to affect expression of an operably linked nucleic acid can be assayed using methods known to one having ordinary skill in the art. In particular, a regulatory region fragment can be operably linked to a reporter nucleic acid and used to transiently or stably transform a cell, e.g., a plant cell. Suitable reporter nucleic acids include β-glucuronidase (GUS), green fluorescent protein (GFP) and luciferase (LUC). Expression of the gene product encoded by the reporter nucleic acid can be monitored in such transformed cells using standard techniques.
A regulatory region described herein or a fragment thereof can also be used as a hybridization probe or a PCR primer. Fragments of the regulatory regions disclosed herein can hybridize under high stringency conditions to the nucleotide sequences of SEQ ID NO: 1 , 2, 3, 4, 5, or 6, or fragments thereof.
Hybridization typically involves Southern analysis (Southern blotting). See, for example, sections 9.37-9.52 of Sambrook et al., 1989, "Molecular Cloning, A Laboratory Manual", second edition, Cold Spring Harbor Press, Plainview; NY. High stringency conditions involve the use of low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (0.1X SSC), 0.1% sodium dodecyl sulfate (SDS) at 650C. Alternatively, denaturing agents such as formamide can be employed during hybridization, e.g., 50% formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 niM NaCl, 75 mM sodium citrate at 420C. Another example is the use of 50% formamide, 5X SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5X Denhardt's solution, sonicated salmon sperm DNA (50 μg/mL), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 420C in 0.2X SSC and 0.1% SDS. A single stranded nucleic acid can also be made that is complementary to one strand of a regulatory region or fragment thereof.
Nucleic acid constructs
A nucleic acid construct includes a regulatory region as disclosed herein. A construct can also include a heterologous nucleic acid operably linked to the regulatory region, in which case the construct can be introduced into an organism and used to direct expression of the operably linked nucleic acid. As used herein, "heterologous nucleic acid" refers to a nucleic acid other than the naturally occurring coding sequence to which the regulatory region was operably linked in a plant. The heterologous nucleic acid can be operably linked to the regulatory region in sense or antisense orientation. "Operably linked" refers to covalent linkage of two nucleic acids such that transcription and, if the heterologous nucleic acid is a coding sequence in sense orientation, translation can occur.
In some embodiments, a heterologous nucleic acid is transcribed and translated into a polypeptide. Suitable polypeptides include, without limitation, polypeptides that affect growth, hormone production, photosynthetic efficiency, nutritional value, and oil or protein composition. Polypeptides also can provide, without limitation, resistance to environmental stresses such as drought and cold, pathogens, insects, or herbicides. For example, Bacillus thuringiensis toxin genes can be expressed in plants to provide insect resistance. See, for example, U.S. Patent No. 5,380,831. Suitable polypeptides also include screenable and selectable markers such as green fluorescent protein, luciferase, β-glucuronidase, or neomycin phosphotransferase II. In some embodiments a heterologous nucleic acid encodes a polypeptide that confers nutrient transporter function, enhanced nutrient utilization, or female sterility.
In some cases, a heterologous nucleic acid is transcribed and translated into a polypeptide associated with alkaloid biosynthesis, such as an enzyme involved in biosynthesis of alkaloid compounds or a regulatory protein such as a transcription factor involved in biosynthesis of alkaloid compounds. Examples of enzymes involved in tetrahydrobenzylisoquinoline alkaloid biosynthesis include those coding for tyrosine decarboxylase (YDC or TYD; EC 4.1.1.25), norcoclaurine synthase (EC 4.2.1.78), coclaurine N-methyltransferase (EC
2.1.1.140), (R, S)-norcoclaurine 6-O-methyl transferase (NOMT; EC 2.1.1.128), S-adenosyl-L-methionine:3 '-hydroxy-N-methylcoclaurine 4'-O- methyltransferase 1 (HMCOMTl; EC 2.1.1.116); S-adenosyl-L-methionine:3'- hydroxy-N-methylcoclaurine 4'-O-methyltransferase 2 (HMC0MT2; EC 2.1.1.116); monophenol monooxygenase (EC 1.14.18.1), N-methylcoclaurine 3'- hydroxylase (NMCH; EC 1.14.13.71), (R,S)-reticuline 7-O-methyltransferase (ROMT); berbamunine synthase (EC 1.14.21.3), columbamine O- methyltransferase (EC 2.1.1.118), berberine bridge enzyme (BBE; EC 1.21.3.3), reticuline oxidase (EC 1.21.3.4), dehydro reticulinium ion reductase (EC 1.5.1.27), (R5S)- 1 -benzyl- 1 ,2,3 ,4-tetrahydroisoquinoline N-methyltransferase (EC 2.1.1.115), (S)-scoulerine oxidase (EC 1.14.21.2), (S)-cheilanthifoline oxidase (EC 1.14.21.1), (S)-tetrahydroprotoberberine N-methyltransferase (EC 2.1.1.122), (S)-canadine synthase (EC 1.14.21.5), tetrahydroberberine oxidase (EC 1.3.3.8), columbamine oxidase (EC 1.21.3.2), and other enzymes, such as protopine-6-monooxygenase, related to the biosynthesis of tetrahydrobenzylisoquinoline alkaloids.
In some cases, a heterologous nucleic acid encodes an enzyme involved in benzophenanthridine alkaloid biosynthesis, e.g., those encoding dihydrobenzophenanthridine oxidase (EC 1.5.3.12), dihydrosanguinarine 10- hydroxylase (EC 1.14.13.56), lO-hydroxy-dihydrosanguinarine 10-O- methyltransferase (EC 2.1.1.119), dihydrochelirubine 12-hydroxylase (EC 1.14.13.57), 12-hydroxy-dihydrochelirabine 12-O-methyltransferase (EC 2.1.1.120), and other enzymes, including dihydrobenzophenanthridine oxidase and dihydrosanguinarine 10-monooxygenase.
In some cases, a heterologous nucleic acid encodes an enzyme involved in morphinan alkaloid biosynthesis, e.g., salutaridinol 7-O-acetyltransferase (SAT; EC 2.3.1.150), salutaridine synthase (EC 1.14.21.4), salutaridine reductase (EC 1.1.1.248), morphine 6-dehydrogenase (EC 1.1.1.218); and codeinone reductase (CR; EC 1.1.1.247).
In some embodiments, a heterologous nucleic acid encodes an enzyme involved in purine alkaloid biosynthesis such as xanthosine methyltransferase, 7- N -methylxanthine methyltransferase (theobromine synthase), or 3,7- dimethylxanthine methyltransferase (caffeine synthase). In some embodiments, a heterologous nucleic acid encodes an enzyme involved in biosynthesis of indole alkaloids compounds such as tryptophane decarboxylase, strictosidine synthase, strictosidine glycosidase, dehydrogeissosshizine oxidoreductase, polyneuridine aldehyde esterase, sarpagine bridge enzyme, vinorine reductase, vinorine synthase, vinorine hydroxylase, 17-O-acetylajmalan acetylesterase, or norajamaline N-methyl transferase. In other embodiments, a heterologous nucleic acid encodes an enzyme involved in biosynthesis of vinblastine, vincristine and compounds derived from them, such as tabersonine 16- hydroxylase, 16-hydroxytabersonine 16-O-methyl transferase, desacetoxyvindoline 4-hydroxylase, or desacetylvindoline O-acetyltransferase. In some embodiments, a heterologous nucleic acid encodes an enzyme involved in biosynthesis of pyridine, tropane, and/or pyrrolizidine alkaloids such as arginine decarboxylase, spermidine synthase, ornithine decarboxylase, putrescine N-methyl transferase, tropinone reductase, hyoscyamine 6-beta- hydroxylase, diamine oxidase, and tropinone dehydrogenase.
A nucleic acid construct may include a heterologous nucleic acid that is transcribed into RNA. Such an RNA can be useful for inhibiting expression of an endogenous gene. Suitable constructs from which such an RNA can be transcribed include antisense constructs. Antisense nucleic acid constructs can include a regulatory region of the invention operably linked, in antisense orientation, to a nucleic acid molecule that is heterologous to the regulatory element. Thus, for example, a transcription product can be similar or identical to the sense coding sequence of an endogenous polypeptide, but transcribed into a mRNA that is unpolyadenylated, lacks a 5' cap structure, or contains an unsplicable intron. Constructs containing operably linked nucleic acid molecules in sense orientation can be used to inhibit the expression of a gene. Methods of co-suppression using a full-length cDNA sequence as well as a partial cDNA sequence are known in the art. See, e.g., U.S. Patent No. 5,231,020.
Alternatively, a heterologous nucleic acid can be transcribed into a ribozyme. See, U.S. Patent 6,423,885. Heterologous nucleic acid molecules can encode ribozymes designed to cleave particular mRNA transcripts, thus preventing expression of a polypeptide. Hammerhead ribozymes are useful for destroying particular mRNAs, although various ribozymes that cleave mRNA at site-specific recognition sequences can be used. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target RNA contain a 5'-UG-3 ' nucleotide sequence. The construction and production of hammerhead ribozymes is known in the art. See, for example, U.S. Patent No. 5,254,678. Hammerhead ribozyme sequences can be embedded in a stable RNA such as a transfer RNA (tRNA) to increase cleavage efficiency in vivo. Perriman, R. et al, Proc. Natl. Acad. Sd. USA, 92(13):6175-6179 (1995); de Feyter, R. and Gaudron, J., Methods in Molecular Biology, Vol. 74, Chapter 43, "Expressing Ribozymes in Plants," Edited by Turner, P.C, Humana Press Inc., Totowa, NJ. RNA endoribonucleases such as the one that occurs naturally in Tetrahymena thermophila, and which have been described extensively by Cech and collaborators can be useful. See, for example, U.S. Patent No. 4,987,071. A nucleic acid construct also may include a heterologous nucleic acid that is transcribed into an interfering RNA. See, e.g., U.S. Patent 6,753,139; U.S. Patent Publication 20040053876; and U.S. Patent Publication 20030175783. RNA interference is a cellular mechanism to regulate the expression of genes and the replication of viruses, involving 21-23 nucleotide small interfering RNAs, and 19-21 bp duplexes with 2 nucleotide 3' overhangs. Methods for designing and preparing siRNAs to target a target niRNA are known to those of skill in the art; see, e.g., WO 99/32619 and WO 01/75164. siRNAs with 30-50% GC content typically are more active than those with a higher G/C content. Stretches of greater than 4 T' s or A' s in the target sequence typically are avoided when selecting an interfering RNA sequence. It may be useful to compare the potential target sites to the appropriate genome database and eliminate from consideration any target sequences with more than 16-17 contiguous base pairs of identity to other coding sequences that are not of interest.
Such an RNA can be one that anneals to another RNA to form an interfering RNA. Such an RNA can also be one that can anneal to itself, e.g., a double stranded RNA having a stem-loop structure. One strand of the stem portion of a double stranded RNA can comprise a sequence that is similar or identical to the sense coding sequence of an endogenous polypeptide, and that is from about 10 nucleotides to about 2,500 nucleotides in length. In some embodiments, the stem portion is similar or identical to UTR sequences 5' of the coding sequence. In some embodiments, the stem portion is similar or identical to UTR sequences 3' of the coding sequence. The length of the sequence that is similar or identical to the sense coding sequence, the 5' UTR, or the 3' UTR can be from 10 nucleotides to 50 nucleotides, from 10 nucleotides to 500 nucleotides, from 15 nucleotides to 300 nucleotides, from 20 nucleotides to 100 nucleotides, or from 25 nucleotides to 100 nucleotides. In some embodiments the length of the sequence that is similar or identical to the sense coding sequence, the 5' UTR, or the 3' UTR can be from 25 nucleotides to 500 nucleotides, from 25 nucleotides to 300 nucleotides, from 25 nucleotides to 1,000 nucleotides, from 100 nucleotides to 2,000 nucleotides, from 300 nucleotides to 2,500 nucleotides, from 200 nucleotides to 500 nucleotides, from 1,000 nucleotides to 2,500 nucleotides, or from 200 nucleotides to 1,000 nucleotides. The other strand of the stem portion of a double stranded RNA can comprise an antisense sequence of an endogenous polypeptide, and can have a length that is shorter, the same as, or longer than the length of the corresponding sense sequence. The loop portion of a double stranded RNA can be from 10 nucleotides to 2,500 nucleotides in length, e.g., from 15 nucleotides to 100 nucleotides, from 20 nucleotides to 300 nucleotides, from 25 nucleotides to 400 nucleotides in length, or from 30 to 2,000 nucleotides. The loop portion of the RNA can include an intron. See, e.g., WO 98/53083; WO 99/32619; WO 98/36083; WO 99/53050; and US patent publications 20040214330 and 20030180945. See also, U.S. Patents 5,034,323; 6,452,067; 6,777,588; 6,573,099; and 6,326,527.
A suitable interfering RNA also can be constructed as described in Brummell, et al, Plant J. 33 :793-800 (2003).
If desired, a nucleic acid construct further can include a 3' untranslated region (3 ' UTR), which can increase stability of a transcribed sequence by providing for the addition of multiple adenylate ribonucleotides at the 3' end of the transcribed mRNA sequence. A 3' UTR can be, without limitation, the nopaline synthase (NOS) 3 ' UTR or the 3 ' UTR of an alkaloid biosynthesis gene, which in a naturally-occurring genome is located 3' of an alkaloid biosynthesis coding region. A nucleic acid construct also can contain inducible elements, intron sequences, enhancer sequences, insulator sequences, or targeting sequences other than those present in a regulatory region described herein. Such other elements may affect expression, or allow a transcript or polypeptide to be targeted to a particular organelle {e.g., a plastid). For example, the 5'-UTR of the small subunit of ribulose bisphosphate carboxylase can be included for enhanced expression, hi another example, a nucleic acid encoding a transit peptide from the small subunit of ribulose bisphospliate carboxylase or other plastid targeted proteins can be used to target the encoded product to the plastid. See, for example, U.S. Patent No. 5,925,806; and Tingey et al, J. Biol. Chem., 1988, 263(20):9651-9657. Regulatory regions and other nucleic acids can be incorporated into a nucleic acid construct using methods known in the art.
A nucleic acid construct may contain more than one regulatory region, each regulatory region operably linked to a heterologous nucleic acid. For example, a nucleic acid construct may contain two regulatory regions, each operably linked to a different heterologous nucleic acid. The two regulatory regions in such a construct can be the same, or can be a different one of the regulatory regions described herein.
Transgenic Plants and Cells
Transgenic plants and cells can be obtained by introducing at least one nucleic acid construct described herein. Suitable plants for transformation include dicots such as cotton, safflower, alfalfa, soybean, rapeseed (high erucic acid and canola), guayule, or sunflower. Also suitable are monocots such as corn, wheat, rye, barley, oat, rice, millet, amaranth or sorghum. Also suitable are vegetable crops or root crops such as broccoli, peas, sweet corn, popcorn, tomato, beans (including kidney beans, lima beans, dry beans, green beans) and the like. Also suitable are fruit crops such as peach, pear, apple, cherry, orange, lemon, grapefruit, plum, mango and palm. Other suitable species include Lycopersicum esculentum, Nicotiana spp. {e.g., Nicotiana tabacum), Capsicum spp. (including C. annuum), Parthenium argentatum Gray, Mentha spicata, M. pulegium, M. piperita, Thymus vulgaris L., Origanum vulgare, Rosmarinus officinalis, Melissa officinalis, Lavandula augustifolia or Salvia officinalis. Other suitable species include Hevea benthamiana, Hevea guianensus, Hevea brasiliensis, Manihot glaziovii, Manihot dichotoma, Castilla elastica, Ficus elastica, Funtimia elastica, Landolphia kirkii, Landolphia gentilli, Landolphia heudelotii, Landolphia owariensis, Crytostegia grandiflora, Crytostegia madagascariansis, Taraxacum megalorhizon, Palaquim gutta, Manϊϊkara bidentata, and Manϊlkara zapata. Thus, the regulatory regions described herein can be utilized with dicotyledonous plants belonging to the orders Magniolales, Middles, Laurales, Piperales, Aristochiales, Nymphaeales, Ranunculales, Papeverales, Sarraceniaceae, Trochodendrales, Hamamelidales, Eucomiales, Leitneriales, Myricales, Fagales, Casuarinales, Caryophyllales, Batales, Polygonales,
Plumbaginales, Dilleniales, Theales, Malvales, Urticales, Lecythidales, Violates, Salicales, Capparales, Ericales, Diapensales, Ebenales, Primulales, Rosales, Fabales, Podostemales, Haloragales, Myrtales, Cornales, Proteales, Santales, Rafflesiales, Celastrales, Euphorbiales, Rhamnales, Sapindales, Jnglandales, Geraniales, Polygalales, Umbellales, Gentianales, Polemoniales, Lamiales, Plantaginales, Scrophulariales, Campanulales, Rubiales, Dipsacales, and Asterales. Regulatory regions described herein can also be utilized with monocotyledonous plants belonging to the orders Alismatales, Hydrocharitales, Najadales, Triuridales, Commelinales, Eriocaulales, Restionales, Poales, Juncales, Cyperales, Typhales, Bromeliales, Zingiber ales, Arecales,
Cyclanthales, Pandanales, Arales, Lilliales, and Orchidales, or with plants belonging to Gymnospermae, e.g., Pinales, Ginkgoales, Cycadales and Gnetales. Thus, the invention has use over a broad range of plant species, including species from the genera Allium, Alseodaphne, Anacardium, Arachis, Asparagus, Atropa, Avena, Beilschmiedia, Brassica, Citrus, Citrullus, Capsicum, Catharanthus, Carthamus, Cocculus, Cocos, Coffea, Croton, Cucumis, Cucurbita, Daucus, Duguetia, Elaeis, Eschscholzia, Ficus, Fragaria, Glaucium, Glycine, Gossypium, Helianthus, Heterocallis, Hevea, Hordeum, Hyoscyamus, Lactuca, Landolphia, Linum, Litsea, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana, Medicago, Musa, Nicotiana, Olea, Oryza, Panicum,
Pannesetum, Papaver, Parthenium, Persea, Phaseolus, Pinus, Pistachia, Pisum, Pyrus, Prunus, Raphanus, Rhizocarya, Ricinus, Secale, Senecio, Sinomenium, Sinapis, Solanum, Sorghum, Stephania, Theobroma, Trigonella, Triticum, Vicia, Vinca, Vitis, Vigna and Zea. A particularly suitable group of species with which to practice the invention include alkaloid producing plants, e.g., plants from the Papaveraceae, Berberidaceae, Lauraceae, Menispermaceae, Euphorbiaceae, Legummosae, Boraginaceae, Apocynaceae, Asclepiadaceae, Liliaceae, Gnetaceae, Erythroxylaceae, Convolvulaceae, Ranunculaeceae, Rubiaceae, Solanaceae, and Rutaceae families. The Papaveraceae family, for example, contains about 250 species found mainly in the northern temperate regions of the world and includes plants such as California poppy and Opium poppy. Useful genera within the Papaveraceae family include the Papaver {e.g., Papaver bracteatum, Papaver orientale, Papaver setigerum, and Papaver somniferum), Sanguinaria, Dendromecon, Glaucium, Meconopsis, Chelidonium, Eschscholzioideae {e.g., Eschscholzia, Eschscholzia californica), and Argemone {e.g., Argemone hispida, Argemone mexicana, and Argemone munitά) genera. Other alkaloid producing species with which to practice this invention include Croton salutaris, Croton balsamifera, Sinomenium acutum, Stephania cepharantha, Stephania zippeliana, Litsea sebiferea, Alseodaphne perakensis, Cocculus laurifolius, Duguetia obovata, Rhizocarya racemifera, and Beilschmiedia oreophila.
Seeds produced by a transgenic plant can be grown and selfed (or outcrossed and selfed) to obtain plants homozygous for the construct. Seeds can be analyzed to identify those homozygotes having the desired expression of the construct. Transgenic plants can be entered into a breeding program, e.g., to increase seed, to introgress the novel construct into other lines or species, or for further selection of other desirable traits. Alternatively, transgenic plants can be obtained by vegetative propagation of a transformed plant cell, for those species amenable to such techniques.
As used herein, a transgenic plant also refers to progeny of an initial transgenic plant. Progeny includes descendants of a particular plant or plant line, e.g., seeds developed on an instant plant. Progeny of an instant plant also includes seeds formed on F1, F2, F3, and subsequent generation plants, or seeds formed on BC1, BC2, BC3, and subsequent generation plants.
Transgenic techniques for introducing nucleic acid into plants include, without limitation, Agrobacterium-mediated transformation, electroporation, and particle gun transformation. Illustrative examples of transformation techniques are described in PCT Application No. 99/04117 (particle bombardment of Brαssicα) and U.S. Patent 5,188,958 {Agrobαcterium). See also, Nature Biotechnology 22(12):1559-1566 (2004); Fund Plant Biol. 30:1045-1058 (2000); and Park et al, J. Exp. Botany 51(347):1005-1016 (2003). Transformation methods utilizing the Ti and Ri plasmids of Agrobacterium spp. typically use binary type vectors. If cell or tissue cultures are used as the recipient tissue for transformation, plants can be regenerated from transformed cultures by techniques known to those skilled in the art. Transgenic plants can be useful for a variety of purposes, since a regulatory region disclosed herein can be used to express any of a number of desired heterologous nucleic acids. Plant cell cultures also can be utilized in the same manner. For example, the amount of an enzyme or a regulatory protein involved in biosynthesis of alkaloid compounds can be modulated using the methods and compositions described herein, leading to a modulation in the amount of one or more alkaloid compounds in the transgenic plant relative to a control plant that lacks the recombinant nucleic acid construct. Alkaloid compounds that can be modulated include tetrahydrobenzylisoquinoline alkaloids, morphinan alkaloids, benzophenanthridine alkaloids, monoterpenoid indole alkaloids, bisbenzylisoquinoline alkaloids, pyridine alkaloids, purine alkaloids, tropane alkaloids, quinoline alkaloids, terpenoid alkaloids, betaine alkaloids, steroid alkaloids, acridone alkaloids, and phenethylamine alkaloids.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1 - Isolation of Papaveraceae regulatory regions To clone the regulatory regions PsHMCOMT2 (SEQ ID NO: 3) and PsCKK (SEQ ID NO: 5), a genomic library was constructed from opium poppy genomic DNA that was partially digested with restriction enzyme Sau3A. A thermal asymmetric interlaced (TAIL)-PCR reaction was performed following the protocol published by Liu et al. (1995) Plant J, 8:457-63, with some modifications. A mixture of an arbitrary set of forward primers, designated AD2 (5'-NGTCGASWGANAWGAA-S', with S = G or C, W = A or T, and N = A, G, C, or T; SEQ ID NO: 19), was used in combination with a reverse primer specific to the reported cDNA sequence of interest. The reverse primers were designed such that they anneal to the 5 '-end region of the cDNA of interest based on the reported sequence (for PsHMCOMT2, see gi|33413893; for PsCRX, see gi|6478215). For regulatory region PsHMCOMT2, the reverse primers used were Ps-HMCOMT2-PR3 (5'-
GATGGAAACTTCTTGTGTTGCAGCA-3'; SEQ ID NO:32) and Ps- HMCOMT2-PR2 (5'-GCATCTAAACTACCCATTAGATATGCGA-S'; SEQ ID NO:33). For regulatory region PsCRX, the reverse primers used were Ps- CR-PR3 (5'-CTGTATCGAAGTGTCTATAACCCACCTCT-S'; SEQ ID NO:16) and Ps-CR-PR2 (5'-CCAATTTCACTCTTTCAGACCCTTGA-S '; SEQ ID NO: 17). After the first round of TAIL-PCR using AD2 primers and the PR3 primer for the targeted regulatory region, a 1-μl aliquot of the PCR product was used to perform the second round of amplification using the AD2 primers and the PR2 primer for the targeted regulatory region. The amplification product of the second round PCR reaction was separated by agarose gel electrophoresis to isolate DNA bands of desired length and intensity. The bands were isolated from the gel using a Qiagen DNA purification kit. The isolated DNA products were ligated to the pCR2.1-Topo vector (Invitrogen) for cloning and subsequent sequencing.
To clone the regulatory region EcbMCH3 (SEQ ID NO:1), genomic DNA of Es 'chscholzia californica was digested with restriction enzymes Xbal and Nhel prior to ligation to a linker/adaptor consisting of a top strand (5'- GGCCCGGGCTGCGATCATCAAGGAAGTAAGCGTGGTCGACGGCCCG GGCTGC-3'; SEQ ID NO:20) and a shorter complementary bottom strand (5'- P-CTAGGCAGCCCGGGCCGTCGACCAC-NH2-3'; SEQ ID NO:21). The GATC 5 '-overhang of the linker/adaptor is compatible with the overhangs of the genomic fragments resulting from Xbal and Nhel digestion. A first round of PCR amplification was performed using the YES3-5 primer (5 ' -
GATCATCAAGGAAGTAA-S'; SEQ ID NO:22), which anneals to the linker/adaptor, and the Ec-NMCH3-PR1 primer (5'-
GAGGAGGATGGGCTTCTCCATA-3'; SEQ ID NO:23), which is specific to the coding region of the NMCH3 gene based on the reported sequence (gi|3127030). The PCR product was diluted one hundred-fold, and a 1-μl aliquot was used to perform the second round of PCR using the NAP2 primer (5'- TCGACGGCCCGGGCTGCCTAG-3'; SEQ ID NO:24) and the Ec-NMCH3- PR2 primer (5'-AGCTACCTGATATTCTTGGGAGGAGA-S'; SEQ ID NO:25), which is specific to the 5' untranslated region of the NMCH3 gene. The PCR products were separated by agarose gel electrophoresis, and desired DNA bands were isolated as described above. The isolated DNA products were ligated to the pCR2.1-Topo vector (Invitrogen) for cloning and subsequent sequencing. To clone the regulatory regions PsROMT (SEQ ID NO:2), PsSAT (SEQ
ID NO:4), and PsCR3 (SEQ ID NO:6), a genomic library was constructed from opium poppy genomic DNA that was partially digested with restriction enzyme Sau3A. The genomic fragments were ligated to the BamHI site of the pZeroBackground vector (Invitrogen). To amplify the desired DNA fragment corresponding to the regulatory regions PsROMT, PsSAT, and PsCR3 , PCR amplification was performed using either the M13-F forward primer (5'- GTAAAACGACGGCCAG-3'; SEQ ID NO:26) or the M13-R reverse primer (5'-CAGGAAACAGCTATGAC-S'; SEQ ID NO:27) in combination with reverse primers specific to the 5' end region of the cDNA sequence of interest. The reverse primers were designed such that they anneal towards the 5 '-end region of the cDNA of interest based on the reported sequence (for PsROMT, see gi|33286371; for PsSAT, see gi|14861416; for PsCR3, see gi|6478215). For regulatory region PsROMT, the specific reverse primers used were Ps-ROMT- PR3 (5'-CCATTGAATCCACGAATGCGA-S'; SEQ ID NO:28) and Ps-ROMT- PR2 (5 '-GCTTGCCCTTTCAACCTTTCTTCT-S'; SEQ ID NO:29). For regulatory region PsSAT, the specific reverse primers used were Ps-SAT-PR3 (5'-GGAGTTGTGGGTTTAATGGTTTCCT-S'; SEQ ID NO:30) and PS-SAT- PR2 (5'-ATCACTTCAACAGCAGCACTATACATTGT-S'; SEQ ID N0:31). For regulatory region PsCR3, the specific reverse primers used were Ps-CR-PR3 (5'-CTGTATCGAAGTGTCTATAACCCACCTCT-S '; SEQ ID N0:16), PS-CR- PR2 (5'-CCAATTTCACTCTTTCAGACCCTTGA-S'; SEQ ID NO: 17), and Ps- CR-PRl (5'-CAGGTACACCACCGATCTCCATTCT-S'; SEQ ID NO:18). The first round of PCR amplification was performed using the PR3 set of primers in combination with either M13-F or M13-R. An aliquot of the PCR product was electrophoresed in an agarose gel to qualitatively determine which of the Ml 3 primers was producing a desirable product. The second round of amplification was performed using a 1-μl aliquot of the remaining first-round PCR reaction with the PR2 set of primers in combination with the positive Ml 3 primer. The PCR products were separated by agarose gel electrophoresis, and desired DNA bands were isolated as described above. The isolated DNA products were ligated to the pCR2.1-Topo vector (Invitrogen) for cloning and subsequent sequencing. The regulatory regions EcBBE and PsBBE also were cloned using PCR.
The regulatory region EcBBE refers to nucleotides 435 to 1504 of a California poppy BBEl gene (gi|2897943). The regulatory region PsBBE refers to nucleotides 1644 to 2649 of an opium poppy BBEl gene (gi|3282516).
Genomic DNAs were isolated using the Qiagen DNA Isolation Kit from leaf tissues collected from plants of Eschscholzia californica (Source: Thompson and Morgan, Jackson, NJ) and Papaver somniferum cv. Bea's Choice (Source: The Basement Shaman, Woodstock, IL).
Standard molecular biology techniques were used to generate a set of T- DNA binary vector constructs containing regulatory regions described above operably linked to luciferase coding sequences. Each construct also contained a gene conferring resistance to the herbicide Finale®. The constructs were introduced into Agrobacterium. Each Agrobacterium transformant was grown in an incubator-shaker at 280C in 150 μl of YEB broth containing 100 μg/mL spectinomycin, 50 μg/mL rifampicin, and 20 μM acetosyringone. The Agrobacterium cells were harvested by centrifugation at 4,000 rpm for at least 25 minutes. The supernatant was discarded, and each pellet was resuspended in a solution of 10 mM MgCl; 10 mM MES, pH 5.7; and 150 μM acetosyringone to an optical density (OD600) of about 0.05 to 0.1.
Example 2 - Generation and analysis of Papaver somniferum leaf disks containing alkaloid regulatory region: :luciferase constructs Leaf disks were prepared from wild-type Papaver somniferum plants using a paper puncher. The leaf disks were infected with Agrobacteria containing constructs including regulatory regions operably linked to luciferase coding sequences, as described in Example 1. Infection was performed by immersing the leaf disks in about 5 to 10 mL of a suspension of Agrobacterium culture for about 2 min. The treated leaf disks were quickly blot-dried in tissue paper and transferred to a plate lined with paper towels wetted with IX MS solution (adjusted to pH 5.7 with 1 N KOH and supplemented with 1 mg/L BAP and 0.25 mg/L NAA). The leaf disks were incubated in a growth chamber under a long-day light/dark cycle at 22°C for 5 days prior to analysis.
Additional leaf disks from wild-type Papaver somniferum plants were infected with Agrobacterium containing a binary construct comprising a CaMV 35S constitutive promoter operably linked to a luciferase reporter coding sequence. These leaf disks were used as positive controls to indicate that the method of Agrobacterium infection was working. Separate leaf disks were transiently infected with Agrobacterium containing a binary construct including a CaMV 35S promoter operably linked to a GFP coding sequence. These leaf disks served as reference controls to indicate that the luciferase reporter activity in the treated disks was not merely a response to treatment with Agrobacterium.
Treated leaf disks were collected five days after infection and placed in a square Petri dish. Each leaf disk was sprayed with 10 μM luciferin in 0.01% Triton X-100. Leaves were then incubated in the dark for at least a minute prior to imaging with a Night Owl™ CCD camera from Berthold Technology.
Expression of the luciferase reporter gene was detected in leaf disks transformed with a construct containing the PsCRX, PsHMC0MT2, Ps€R3, or CaMV 35S regulatory region operably linked to a luciferase coding sequence. Luciferase expression was also detected in leaf disks transformed with a construct containing the EcNMCH3 and EcBBE regulatory regions, each operably linked to a luciferase coding sequence. However, no luciferase expression was detected in leaf disks transformed with the PsBBE regulatory region operably linked to a luciferase coding sequence, or in leaf disks transformed with the PsROMT or PsSAT regulatory region operably linked to a luciferase coding sequence.
Example 3 - Generation oϊNicotiana plants containing alkaloid regulatory region: :luciferase constructs and regulatory protein constructs Stable Nicotiana tabacum screening lines were generated by transforming Nicotiana leaf explants with T-DNA binary vector constructs containing regulatory regions described in Example 1 operably linked to luciferase coding sequences. The transformation was performed essentially as described by Rogers et al., Methods in Enzymology 118:627 (1987).
Leaf disks were cut from leaves of the screening lines using a paper puncher. The leaf disks were transiently infected with Agrobacterium clones containing T-DNA binary vector constructs comprising a CaMV 35S promoter operably linked to a coding sequence for one of the regulatory proteins listed in Table 1. Transient infection of the leaf disks was performed as described in Example 2.
As controls, leaf disks from wild-type Nicotiana tabacum plants were transiently infected with Agrobacteria containing a binary vector comprising a CaMV 35S promoter operably linked to a luciferase reporter coding sequence. These leaf disks were used as positive controls to indicate that the method of Agrobacterium infection was working. Some leaf disks from Nicotiana screening plants were transiently infected with Agrobacteria containing a binary construct of a CaMV 35S promoter operably linked to a GFP coding sequence. These leaf disks served as reference controls to indicate that the luciferase reporter activity in the treated disks was not merely a response to treatment with Agrobacterium .
Treated leaf disks were collected five days after infection and placed in a square Petri dish. Each leaf was sprayed with 10 μM luciferin in 0.01% Triton X-100. Leaves were then incubated in the dark for at least one minute prior to imaging with a Night Owl™ CCD camera from Berthold Technology. The exposure time depended on the screening line being tested. In most cases, the exposure time was between 2 and 5 minutes. Qualitative scoring of luciferase reporter activity from each infected leaf was preformed by visual inspection and comparison of images, taking into account the following criteria: (1) if the luminescence signal was higher in the treated leaf than in the 35S-GFP-treated reference control (considered as the background activity of the regulatory region), and (2) if the first criterion occurred in at least two independent transformation events carrying the regulatory region-luciferase reporter construct. Examples of regulatory proteins that were observed to transiently transactivate alkaloid regulatory regions are listed in Table 1. Table 1 : Combinations of regulatory regions and regulatory proteins producing expression of a reporter gene operably linked to each regulatory re ion
Figure imgf000023_0001
Legend:
L = Luciferase
EcBBΕ = Eschscholzia californica berberine bridge enzyme gene promoter
EcNMCH3 = Eschscholzia californica N-methylcoclaurine 3 '-hydroxylase gene promoter PsHMCOMT2 = Papaver somniferum hydroxy N-methyl S-coclaurine 4-0- methyltransferase 2 gene promoter PsROMT = Papaver somniferum (R,S)-reticuline 7-0-methyltransferase gene promoter PsSAT = Papaver somniferum (7S)-salutaridinol 7-0-acetyltransferase gene promoter

Claims

WHAT IS CLAIMED IS:
1. An isolated polynucleotide comprising a regulatory region having a nucleotide sequence selected from the group consisting of:
(a) SEQ ID NO: 1; (b) SEQ ID NO:2;
(c) SEQ ID NO:3;
(d) SEQ ID NO:4;
(e) SEQ ID NO:5;
(f) SEQ ID NO:6; (g) a nucleotide sequence complementary to the nucleic acid of (a), (b),
(c), (d), (e), or (f); and
(h) a nucleic acid at least 300 nucleotides in length and having at least 70% sequence identity to said nucleic acid of (a), (b), (c), (d), (e), (f), or (g).
2. The polynucleotide of claim 1 , wherein said regulatory region is at least 500 nucleotides in length.
3. A nucleic acid construct comprising the polynucleotide of claim 1 operably linked to a heterologous nucleic acid.
4. The nucleic acid construct of claim 3, wherein said heterologous nucleic acid encodes a polypeptide.
5. A transgenic plant or plant cell, said plant or cell comprising at least one nucleic acid construct, said construct comprising the polynucleotide of claim 1 operably linked to a heterologous nucleic acid.
6. The transgenic plant or cell of claim 5, wherein said plant or cell comprises first and second nucleic acid constructs, each said construct comprising a polynucleotide of claim 1 operably linked to a heterologous nucleic acid.
7. The transgenic plant or cell of claim 6, wherein said regulatory region of said polynucleotide in said first nucleic acid construct is different from said regulatory region of said polynucleotide of said second nucleic acid construct.
8. The transgenic plant or cell of claims 5-7, wherein said plant or cell is a plant.
9. The transgenic plant of claim 8, wherein said plant is a dicotyledonous plant.
10. A seed from the transgenic plant of claim 8.
11. The transgenic plant or cell of claim 5, wherein said heterologous nucleic acid encodes a regulatory protein involved in alkaloid biosynthesis.
12. The transgenic plant or cell of claim 5, wherein said heterologous nucleic acid encodes an enzyme involved in alkaloid biosynthesis.
13. The transgenic plant or cell of claim 12, wherein said heterologous nucleic acid encodes an enzyme selected from the group consisting of salutaridinol 7-O-acetyltransferase, salutaridine synthase, salutaridine reductase, morphine 6-dehydrogenase; and codeinone reductase.
14. The transgenic plant or cell of claim 5, wherein said heterologous nucleic acid is transcribed into an interfering RNA against a protein involved in alkaloid biosynthesis.
15. A method for making a plant, comprising introducing into a plant at least one nucleic acid construct, said construct comprising the polynucleotide of claim 1, operably linked to a heterologous nucleic acid.
16. The method of claim 15, wherein said heterologous nucleic acid encodes a regulatory protein involved in alkaloid biosynthesis.
17. The method of claim 15, wherein said heterologous nucleic acid encodes an enzyme involved in alkaloid biosynthesis.
18. The method of claim 17, wherein said heterologous nucleic acid encodes an enzyme selected from the group consisting of salutaridinol 7-0- acetyltransferase, salutaridine synthase, salutaridine reductase, morphine 6- dehydrogenase; and codeinone reductase.
19. The method of claim 15, wherein said heterologous nucleic acid is transcribed into an interfering RNA against a protein involved in alkaloid biosynthesis.
20. The method of claim 15, wherein said plant is a Papaveraceae plant.
PCT/US2006/006354 2005-04-20 2006-02-22 Regulatory regions from papaveraceae WO2006115575A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US67330705P 2005-04-20 2005-04-20
US60/673,307 2005-04-20

Publications (1)

Publication Number Publication Date
WO2006115575A1 true WO2006115575A1 (en) 2006-11-02

Family

ID=36585111

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/006354 WO2006115575A1 (en) 2005-04-20 2006-02-22 Regulatory regions from papaveraceae

Country Status (2)

Country Link
US (1) US7312376B2 (en)
WO (1) WO2006115575A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107460183A (en) * 2017-06-01 2017-12-12 北京工业大学 The method for isolating and purifying Salsolinol synzyme
CN110872589A (en) * 2007-05-25 2020-03-10 22世纪有限责任公司 Nucleic acid sequences encoding transcription factors regulating alkaloid synthesis and their use for improving plant metabolism

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9758790B2 (en) 2004-12-08 2017-09-12 Ceres, Inc. Modulating the level of components within plants
US20090304901A1 (en) * 2006-01-25 2009-12-10 Steven Craig Bobzin Modulating plant protein levels
US8222482B2 (en) * 2006-01-26 2012-07-17 Ceres, Inc. Modulating plant oil levels
US20100005549A1 (en) * 2006-06-14 2010-01-07 Shing Kwok Increasing uv-b tolerance in plants
US20130191941A1 (en) 2006-07-05 2013-07-25 Shing Kwok Modulating light response pathways in plants, increasing light-related tolerances in plants, and increasing biomass in plants
US8362322B2 (en) 2006-10-27 2013-01-29 Ceres, Inc. Modulating lignin in plants
US20100151109A1 (en) * 2006-12-15 2010-06-17 Amr Saad Ragab Modulation of plant protein levels
CA3100435C (en) 2008-02-15 2024-01-30 Ceres, Inc. Drought and heat tolerance in plants
US8298794B2 (en) * 2008-10-09 2012-10-30 Ceres, Inc. Cinnamyl-alcohol dehydrogenases
EA036343B1 (en) 2009-07-20 2020-10-29 Серес, Инк. Increasing transgenic plant biomass
WO2011140329A1 (en) 2010-05-06 2011-11-10 Ceres, Inc. Transgenic plants having increased biomass
WO2012058223A1 (en) 2010-10-27 2012-05-03 Ceres, Inc. Transgenic plants having altered biomass composition
WO2013025485A1 (en) 2011-08-12 2013-02-21 Ceres, Inc. Transcription terminators
BR112014013853A2 (en) 2011-12-09 2020-01-14 Ceres Inc use of an isolated nucleic acid, method of obtaining a transgenic plant cell, method of obtaining a transgenic plant, method of producing a plant, method of producing biomass, method of biomass processing, method of altering the composition of biomass , biomass composition modulation method, production method of a forage product
US9686926B2 (en) * 2013-04-29 2017-06-27 Tfsb, Llc Chia (Salvia hispanica L.) variety Sahi Alba 914
US9101100B1 (en) 2014-04-30 2015-08-11 Ceres, Inc. Methods and materials for high throughput testing of transgene combinations
CA2941315C (en) 2016-08-12 2018-03-06 Api Labs Inc. High thebaine poppy and methods of producing the same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002101052A2 (en) * 2001-06-11 2002-12-19 Johnson & Johnson Research Pty Limited Salutaridinol 7-o-acetyltransferase and derivatives thereof

Family Cites Families (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4936904A (en) * 1980-05-12 1990-06-26 Carlson Glenn R Aryl-4-oxonicotinates useful for inducing male sterility in cereal grain plants
US5380831A (en) * 1986-04-04 1995-01-10 Mycogen Plant Science, Inc. Synthetic insecticidal crystal protein gene
US4654465A (en) * 1985-07-18 1987-03-31 Agracetus Genic male-sterile maize
US5188958A (en) * 1986-05-29 1993-02-23 Calgene, Inc. Transformation and foreign gene expression in brassica species
JPS62291904A (en) * 1986-06-12 1987-12-18 Namiki Precision Jewel Co Ltd Mafufacture of permanent magnet
US4946778A (en) * 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US4801540A (en) * 1986-10-17 1989-01-31 Calgene, Inc. PG gene and its use in plants
US4727219A (en) * 1986-11-28 1988-02-23 Agracetus Genic male-sterile maize using a linked marker gene
US4987071A (en) * 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5254678A (en) * 1987-12-15 1993-10-19 Gene Shears Pty. Limited Ribozymes
US5766847A (en) * 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5034323A (en) * 1989-03-30 1991-07-23 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5143854A (en) * 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5959177A (en) * 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US5859330A (en) * 1989-12-12 1999-01-12 Epitope, Inc. Regulated expression of heterologous genes in plants and transgenic fruit with a modified ripening phenotype
US5484956A (en) * 1990-01-22 1996-01-16 Dekalb Genetics Corporation Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin
US6946587B1 (en) * 1990-01-22 2005-09-20 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US5204253A (en) * 1990-05-29 1993-04-20 E. I. Du Pont De Nemours And Company Method and apparatus for introducing biological substances into living cells
US5432068A (en) * 1990-06-12 1995-07-11 Pioneer Hi-Bred International, Inc. Control of male fertility using externally inducible promoter sequences
US6207881B1 (en) * 1990-09-10 2001-03-27 The United States Of America As Represented By The Department Of Agriculture Control of fruit ripening through genetic control of ACC synthase synthesis
SE467358B (en) * 1990-12-21 1992-07-06 Amylogene Hb GENETIC CHANGE OF POTATISE BEFORE EDUCATION OF AMYLOPECT TYPE STARCH
US5612487A (en) * 1991-08-26 1997-03-18 Edible Vaccines, Inc. Anti-viral vaccines expressed in plants
US6118047A (en) * 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
US6326527B1 (en) * 1993-08-25 2001-12-04 Dekalb Genetics Corporation Method for altering the nutritional content of plant seed
US5410270A (en) * 1994-02-14 1995-04-25 Motorola, Inc. Differential amplifier circuit having offset cancellation and method therefor
US5777079A (en) * 1994-11-10 1998-07-07 The Regents Of The University Of California Modified green fluorescent proteins
CA2208783C (en) * 1994-12-30 2010-09-28 Planet Biotechnology, Inc. Methods for producing immunoglobulins containing protection proteins in plants and their use
CA2213340C (en) * 1995-03-03 2011-07-26 Novartis Ag Control of gene expression in plants by receptor mediated transactivation in the presence of a chemical ligand
EP0871707A4 (en) * 1995-05-19 2000-10-25 Phytera Inc Manipulation of plant cell and tissue cultures
US5925806A (en) * 1995-06-06 1999-07-20 Mcbride; Kevin E. Controlled expression of transgenic constructs in plant plastids
EP0862651A2 (en) * 1995-10-16 1998-09-09 Chiron Corporation Method of screening for factors that modulate gene expression
US5958745A (en) * 1996-03-13 1999-09-28 Monsanto Company Methods of optimizing substrate pools and biosynthesis of poly-β-hydroxybutyrate-co-poly-β-hydroxyvalerate in bacteria and plants
US5824779A (en) * 1996-04-26 1998-10-20 Wisconsin Alumni Research Foundation Phytase-protein-pigmenting concentrate derived from green plant juice
US5900525A (en) * 1996-04-26 1999-05-04 Wisconsin Alumni Research Foundation Animal feed compositions containing phytase derived from transgenic alfalfa and methods of use thereof
DE19617687C2 (en) * 1996-05-03 2000-11-16 Suedzucker Ag Process for the production of transgenic plants producing inulin
JPH10117776A (en) * 1996-10-22 1998-05-12 Japan Tobacco Inc Transformation of indica rice
GB9710475D0 (en) * 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
US20040203109A1 (en) * 1997-06-06 2004-10-14 Incyte Corporation Human regulatory proteins
US6452067B1 (en) * 1997-09-19 2002-09-17 Dna Plant Technology Corporation Methods to assay for post-transcriptional suppression of gene expression
JP2002500022A (en) 1998-01-08 2002-01-08 ジョンソン アンド ジョンソン リサーチ プロプライアトリー リミテッド Plant transformation and regeneration methods
AUPP249298A0 (en) * 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
US20040214330A1 (en) * 1999-04-07 2004-10-28 Waterhouse Peter Michael Methods and means for obtaining modified phenotypes
US6004804A (en) * 1998-05-12 1999-12-21 Kimeragen, Inc. Non-chimeric mutational vectors
US6010907A (en) * 1998-05-12 2000-01-04 Kimeragen, Inc. Eukaryotic use of non-chimeric mutational vectors
US6087558A (en) * 1998-07-22 2000-07-11 Prodigene, Inc. Commercial production of proteases in plants
US7858848B2 (en) * 1999-11-17 2010-12-28 Mendel Biotechnology Inc. Transcription factors for increasing yield
US7223904B2 (en) * 1999-02-18 2007-05-29 Mendel Biotechnology, Inc. Plant gene sequences II
US7345217B2 (en) * 1998-09-22 2008-03-18 Mendel Biotechnology, Inc. Polynucleotides and polypeptides in plants
US7663025B2 (en) * 1999-03-23 2010-02-16 Mendel Biotechnology, Inc. Plant Transcriptional Regulators
US7511190B2 (en) * 1999-11-17 2009-03-31 Mendel Biotechnology, Inc. Polynucleotides and polypeptides in plants
US6664446B2 (en) * 1999-03-23 2003-12-16 Mendel Biotechnology, Inc. Transgenic plants comprising polynucleotides encoding transcription factors that confer disease tolerance
US20030061637A1 (en) * 1999-03-23 2003-03-27 Cai-Zhong Jiang Polynucleotides for root trait alteration
AU1696000A (en) 1998-12-04 2000-08-01 Universiteit Leiden Strictosidine glucosidase from catharanthus roseus and its use in alkaloid production
WO2000046383A2 (en) 1999-02-05 2000-08-10 Rijksuniversiteit Leiden Method of modulating metabolite biosynthesis in recombinant cells
EP1033405A3 (en) 1999-02-25 2001-08-01 Ceres Incorporated Sequence-determined DNA fragments and corresponding polypeptides encoded thereby
US6835540B2 (en) * 2001-03-16 2004-12-28 Mendel Biotechnology, Inc. Biosynthetic pathway transcription factors
US20100293669A2 (en) * 1999-05-06 2010-11-18 Jingdong Liu Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
EP1181359A1 (en) * 1999-05-28 2002-02-27 Sangamo Biosciences Inc. Gene switches
JP2003504032A (en) * 1999-07-01 2003-02-04 カルジーン エルエルシー Regulation of gene expression in eukaryotic cells
US6423885B1 (en) * 1999-08-13 2002-07-23 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods for obtaining modified phenotypes in plant cells
CZ20021274A3 (en) * 1999-09-16 2002-09-11 Monsanto Technology Llc Regulating sequence for controlling gene expression in plants
US6294717B1 (en) * 1999-10-15 2001-09-25 Ricetec, Ag Inbred rice lines A0044 and B0044
GB9925459D0 (en) * 1999-10-27 1999-12-29 Plant Bioscience Ltd Gene silencing
US7151201B2 (en) * 2000-01-21 2006-12-19 The Scripps Research Institute Methods and compositions to modulate expression in plants
US20020023281A1 (en) * 2000-01-27 2002-02-21 Jorn Gorlach Expressed sequences of arabidopsis thaliana
JP4028956B2 (en) * 2000-10-11 2008-01-09 独立行政法人農業生物資源研究所 BZIP transcription factor that regulates the expression of rice storage protein
AU2002243386A1 (en) * 2000-10-24 2002-06-18 Donald Danforth Plant Science Center Rf2a and rf2b transcription factors
CA2427347C (en) * 2000-10-31 2011-01-18 Commonwealth Scientific And Industrial Research Organisation Method and means for producing barley yellow dwarf virus resistant cereal plants
US7279317B2 (en) * 2001-01-12 2007-10-09 California Institute Of Technology Modulation of COP9 signalsome isopeptidase activity
CA2452602A1 (en) * 2001-06-22 2003-01-03 The Regents Of The University Of California Compositions and methods for modulating plant development
JP2003144175A (en) * 2001-11-19 2003-05-20 Inst Of Physical & Chemical Res Environmental stress-responding promoter
US20050108791A1 (en) * 2001-12-04 2005-05-19 Edgerton Michael D. Transgenic plants with improved phenotypes
US7176027B2 (en) * 2001-12-20 2007-02-13 Pioneer Hi-Bred International, Inc. Genes and regulatory DNA sequences associated with stress-related gene expression in plants and methods of using the same
ES2346645T3 (en) * 2002-03-14 2010-10-19 Commonwealth Scientific And Industrial Research Organisation PROCEDURES AND MEANS OF SUPERVISION AND MODULATION OF GENICAL SILENCING.
AU2003209814B2 (en) * 2002-03-14 2008-12-04 Commonwealth Scientific & Industrial Research Organisation Modified gene-silencing RNA and uses thereof
US20040053876A1 (en) * 2002-03-26 2004-03-18 The Regents Of The University Of Michigan siRNAs and uses therof
US20060194959A1 (en) * 2002-07-15 2006-08-31 Nickolai Alexandrov Sequence-determined DNA fragments encoding SRF-type transcription factors
US20040078852A1 (en) * 2002-08-02 2004-04-22 Thomashow Michael F. Transcription factors to improve plant stress tolerance
AU2003295333A1 (en) * 2002-09-17 2004-04-08 Ceres, Inc. Biological containment system
US20040216190A1 (en) * 2003-04-28 2004-10-28 Kovalic David K. Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement
US7402667B2 (en) * 2003-10-14 2008-07-22 Ceres, Inc. Promoter, promoter control elements, and combinations, and uses thereof
US20050223434A1 (en) * 2003-09-23 2005-10-06 Ceres, Inc. Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics
US20060143729A1 (en) * 2004-06-30 2006-06-29 Ceres, Inc. Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics
BRPI0415431A (en) * 2003-10-14 2006-12-05 Ceres Inc processes and compositions for altering seed phenotypes
US20060015970A1 (en) * 2003-12-12 2006-01-19 Cers, Inc. Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics
WO2006005023A2 (en) 2004-06-30 2006-01-12 Ceres Inc. Promoter, promoter control elements and combinations, and uses thereof
CA2598436A1 (en) * 2005-02-22 2006-08-31 Ceres, Inc. Modulating plant alkaloids

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002101052A2 (en) * 2001-06-11 2002-12-19 Johnson & Johnson Research Pty Limited Salutaridinol 7-o-acetyltransferase and derivatives thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FACCHINI P J ET AL: "Expression patterns conferred by tyrosine/dihydroxyphenylalanine decarboxylase promoters from opium poppy are conserved in transgenic tobacco", PLANT PHYSIOLOGY, AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, US, vol. 118, no. 1, September 1998 (1998-09-01), pages 69 - 81, XP002324144, ISSN: 0032-0889 *
HAUSCHILD ET AL: "isolation and analysis of a gene bbe1 encoding the berberine bridge enzyme from California poppy Eschscholzia californica", PLANT MOLECULAR BIOLOGY, SPRINGER, DORDRECHT, NL, vol. 36, February 1998 (1998-02-01), pages 473 - 478, XP002111517, ISSN: 0167-4412 *
PARK S-U ET AL: "Analysis of promoters from tyrosine/dihydroxyphenylalanine decarboxylase and berberine bridge enzyme genes involved in benzylisoquinoline alkaloid biosynthesis in opium poppy", PLANT MOLECULAR BIOLOGY, SPRINGER, DORDRECHT, NL, vol. 40, no. 1, 1 May 1999 (1999-05-01), pages 121 - 131, XP002324114, ISSN: 0167-4412 *
PAULI H H ET AL: "MOLECULAR CLONING AND FUNCTIONAL HETEROLOGOUS EXPRESSION OF TWO ALLELES ENCODING (S)-N-METHYLCOCLAURINE 3'-HYDROXYLASE (CYP80B1), ANEW METHYL JASMONATE-INDUCIBLE CYTOCHROME P-450-DEPENDENT MONO-OXYGENASE OF BENZYLISOQUINOLINE ALKALOID BIOSYNTHESIS", PLANT JOURNAL, BLACKWELL SCIENTIFIC PUBLICATIONS, OXFORD, GB, vol. 13, no. 6, 1998, pages 793 - 801, XP000992757, ISSN: 0960-7412 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110872589A (en) * 2007-05-25 2020-03-10 22世纪有限责任公司 Nucleic acid sequences encoding transcription factors regulating alkaloid synthesis and their use for improving plant metabolism
CN107460183A (en) * 2017-06-01 2017-12-12 北京工业大学 The method for isolating and purifying Salsolinol synzyme
CN107460183B (en) * 2017-06-01 2020-05-22 北京工业大学 Method for separating and purifying Salsolnol synthetase

Also Published As

Publication number Publication date
US7312376B2 (en) 2007-12-25
US20060265777A1 (en) 2006-11-23

Similar Documents

Publication Publication Date Title
US7312376B2 (en) Regulatory regions from Papaveraceae
US8232380B2 (en) Shade regulatory regions
US20080295205A1 (en) P450 Polynucleotides, Polypeptides, and Uses Thereof
US7795503B2 (en) Modulating plant alkaloids
US20170175140A1 (en) Methods for using a 5&#39;-exonuclease to increase homologous recombination in eukaryotic cells
US7335510B2 (en) Modulating plant nitrogen levels
WO2007127522A2 (en) Modulating alkaloid biosynthesis
US20150067922A1 (en) Gene targeting and genetic modification of plants via rna-guided genome editing
WO2017004375A1 (en) Haploid inducer line for accelerated genome editing
US7329797B2 (en) Modulating plant carbon levels
US7595433B2 (en) Modulations of amino acid and sugar content in plants
WO2007117693A2 (en) Regulatory protein-regulatory region associations related to alkaloid biosynthesis
US7897839B2 (en) Methods for modifying plant characteristics
US8222388B2 (en) Broadly expressing regulatory regions
WO2007127501A2 (en) Novel endosperm regulatory regions
US20090178160A1 (en) Modulation of Triterpenoid Content in Plants
US20200048646A1 (en) Gene editing and transgene free mutant plants
CN101535483A (en) Modulating plant nitrogen levels
US20100005549A1 (en) Increasing uv-b tolerance in plants

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06720995

Country of ref document: EP

Kind code of ref document: A1