WO2006096727A2 - Methods for detecting integrated dna - Google Patents

Abstract

Disclosed are methods for detecting a target DNA integrated into a host cell chromosome. The methods are generally directed to the removal of non-integrated DNA from permeabilized and salt-extracted cells and the retention of host cell chromosomes containing the integrated target DNA. In some variations, the method for the detection of integrated viral DNA, which generates data of increased prognostic value because the presence of some viruses in host cells is more harmful when the viral genome is in integrated versus episomal form. In other embodiments, the method is for monitoring integration of a recombinant vector, or a fragment thereof, containing a transgene.

Description

METHODS FOR DETECTING INTEGRATED DNA

CROSS-REFERENCES TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 60/659,122, filed March 7, 2005, which is incorporated herein by reference in its entirety.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0002] The research described in this application was supported in part by the National Cancer Institute, National Institutes of Health SBIR Grants 1R43CA88396-01 and 2R44CA88396-02. The government may have certain rights in this invention.

BACKGROUND OF THE INVENTION

[0003] The severity of some diseases that are caused by viruses is correlated with the presence of integrated versus episomal viral DNA. For example, one factor generally considered indicative of progression to cancer is integration of HPV viral DNA into the host genome. Integration of viral DNA appears to occur randomly, although fragile sites are believed to play a role (see Wilke et al, Hum. MoI. Genet. 5:187-195, 1996), as well as nuclear matrix attachment regions (Shera et al., J. Virol 75:12339-12346, 2001). Insertional inactivation of tumor suppressor genes, such as the Fragile Histidine Triad locus, may be involved in some cases (see id.). Consistent chromosomal abnormalities or aneuploidies have also been described (see Heselmeyer et al, Genes Chromosomes Cancer 19:233-240, 1997).

[0004] Methods of DNA detection provide a useful tool for determining the presence or absence of particular nucleic acids in cells. Current methods include, for example, in situ hybridization as well as targeted amplification (e.g., by PCR) of DNA isolated from cells followed by detection of the amplified DNA. However, conventional detection methods are generally unable to distinguish a foreign DNA that has integrated into a host cell chromosome from non-integrated DNA.

[0005] There is therefore a need in the art for DNA detection methods that are capable of distinguishing between integrated and non-integrated target DNAs. Such methods would have a variety of applications for monitoring DNA integration events in cells. Compared to traditional detection methods, a method of detecting integrated DNA would facilitate a more accurate prognosis of diseases or disorders correlated with DNA integration. Further, such a detection method would be useful, e.g., for monitoring integration of a recombinant transgene in vitro or ex vivo. The present invention as described herein meets these needs and more.

BRIEF SUMMARY OF THE INVENTION

[0006] The present invention provides a method for determining integration of a target DNA. The method is based, inter alia, on the selective removal of non-integrated DNA from the cell by salt-extraction, followed by detection of any integrated target DNA in or from the salt-extracted cell in the absence of non-integrated DNA. Generally, the method includes the following steps: (a) permeabilizing a cell from a sample to be tested; (b) treating the permeabilized cell with an extracting salt solution to release non-integrated target DNA, if present, into the salt solution while retaining chromosomal DNA with integrated target DNA, if present; (c) separating the salt-extracted cell from the salt solution; and (d) determining the presence or absence of the target DNA in the salt-extracted cell, whereby the presence of the target DNA indicates the presence of integrated target DNA. Steps (a) and/or (b) can be performed while the cell is immobilized on a substrate such, for example, a glass slide or coverslip. Typically, the cell contains for is suspected of containing the target DNA.

[0007] hi certain embodiments of the method, the ionic strength of the salt solution is equivalent to that of a monovalent salt {e.g., sodium chloride) of about 150 mM to about 900 mM. Extracting salt solutions suitable for used in accordance with the present invention include, e.g., a kosmotropic salt such as, for example, ammonium sulfate. Particularly suitable concentrations of ammonium sulfate in the extracting salt solution are in the range of about 50 mM to about 300 mM. hi other variations, the extracting salt solution includes sodium chloride or lithium iodosalicylate.

[0008] Typically, the cell is permeabilized with a detergent, hi some embodiments, the cell is permeabilized with a non-ionic detergent such as, for example, BIGCHAP, Deoxy- BIGCHAP, digitonin, a polyoxyethylene ester, a polyoxyethylene ether, a polyoxyethylenesorbitan ester, a sorbitan ester, Tergitol, Triton X-100, Triton X-114, or Tyloxapol. hi other variations, the cell is permeabilized with a zwitterionic detergent such as, e.g., CHAPS, CHAPSO, phospatidylcholine, and 1-propane sulfonate. A particularly suitable pH range for use in permeabilizing detergent solutions is about 6.3 to about 7.4. hi one specific embodiment, the pH of the solution is about 6.8. [0009] Alternatively, the cell is permeabilized with a suitable non-detergent permeabilizing agent such as, for example, a non-detergent sulfobetaine or a bile acid salt (e.g., sodium deoxycholate).

[0010] In some embodiments of the method, the separation of the salt-extracted cell from the salt solution includes filtering the salt-extracted cell through a filter membrane such as, e.g., a 2 μm hydrophobic polycarbonate filter. Following filtration through the membrane, the cell is typically transferred to a suitable substrate such as, for example, the surface of a glass substrate. One particularly suitable means for transferring the cell includes depositing the salt-extracted cell onto the substrate by cytocentrifigation.

[0011] An exemplary procedure for determining the presence or absence of a target DNA in the salt-extracted cell includes the following steps: (i) contacting DNA from the salt- extracted cell with a labeled nucleic acid probe that specifically hybridizes to the target DNA under stringent hybridization conditions, whereby the nucleic acid probe hybridizes to the target DNA, if present; (ii) removing unbound labeled nucleic acid probe; and (iii) detecting the presence or absence of label bound to the DNA from the salt-extracted cell, hi specific variations, determining the presence or absence of a target DNA in the salt-extracted cell includes in situ hybridization such as, e.g., fluorescence in situ hybridization.

[0012] An alternative method for determining the presence or absence of a target DNA includes contacting DNA from the salt-extracted cell with primers specific for the target DNA under conditions suitable for amplification of the target DNA, whereby a target DNA amplicon is produced if the target DNA is present; and determining the presence or absence of the target DNA amplicon. hi a specific variation, determining the presence or absence of the target DNA amplicon includes contacting the amplified DNA with a labeled nucleic acid probe that specifically hybridizes to the target DNA under stringent hybridization conditions, whereby the labeled nucleic acid probe hybridizes with the target DNA amplicon, if present; and determining presence or absence of labeled probe bound to the target DNA amplicon. Amplification of the target DNA can include, for example, amplification by PCR (e.g., quantitative PCR). Further, where the target DNA is a viral DNA, the primers can be strain- specific or strain-independent.

[0013] hi yet another embodiment, determining the presence or absence of a target DNA includes (i) isolating DNA from the salt-extracted cell; (ii) fragmenting the isolated DNA; (iii) hybridizing the fragmented DNA to target RNA immobilized onto a solid support, where the target RNA corresponds to the integrated target DNA to be detected; and (iv) detecting any RNArDNA hybrids with an antibody that specifically recognizes RNA:DNA hybrids. In specific variations, the fragmentation of the isolated DNA is mechanical or enzymatic.

[0014] In certain embodiments, the method of the present invention further includes (e) permeabilizing a second cell from the sample to be tested; (f) determining the presence or absence of the target DNA in the second cell; and (g) comparing a signal that is indicative of the presence of the target DNA from step (d) to a signal that is indicative of the presence of the target DNA from step (f).

[0015] In an exemplary embodiment of the present invention, the target DNA is a viral DNA such as, for example, human papillomavirus (HPV) DNA (e.g., HPV- 16). Where the viral DNA to be detected is HPV- 16, determining the presence or absence of the target viral DNA can include, for example, determining the presence or absence of the E6 to Ll region of HPV- 16. hi other embodiments, the target DNA is a recombinant vector such as, for example, a recombinant vector containing a transgene. Recombinant vectors amenable to determination of integration using the present methods include, for example, viral vectors (e.g., adeno-associated virus or lentivirus vectors) and plasmid DNA vectors. In particular variations, the recombinant vector is a gene therapy vector.

[0016] In certain variations, the cell is of epithelial origin and/or the biological sample is a tissue sample from a patient. Where the tissue sample is from a patient, the method can further include obtaining the tissue sample from the patient. Typically, the patient is a human patient, hi one specific embodiment in which the target DNA is human papillomaviral (HPV) DNA, the tissue sample from a patient includes cervical tissue, such as, e.g., cervical tissue obtained by performing a Pap smear or a cervical brush sampling.

[0017] hi yet other embodiments of the method, the biological sample is a population of cells from a stable cell line. Where the biological sample is a stable cell line, the method can further include culturing the cell, such as, for example, in suspension or on a substrate (e.g., glass slide or cover slip) to which the cell adheres.

[0018] Typically, where the target DNA is a viral DNA, the biological sample to be tested is known or suspected to be infected with a virus having episomal and integrated phases in its life-cycle (e.g. , a tissue sample known or suspected to be infected with human papilloma virus (HPV)). [0019] In certain embodiments, the method further comprises assessing the integrity of genomic DNA in the salt-extracted cell. One suitable method for determining genomic DNA integrity includes determining the presence or absence of the 5S ribosomal RNA gene cluster within the extracted cell nucleus.

[0020] In one aspect of the present invention, the method is a method for monitoring integration of a gene therapy vector comprising a transgene, or a fragment of the vector, in a subject to which the gene therapy vector has been administered. The method for monitoring integration of a gene therapy vector or fragment thereof generally includes (a) isolating a cell from a subject; (b) permeabilizing the cell; (c) treating the permeabilized cell with an extracting salt solution , where any non-integrated gene therapy vector or fragment thereof, if present, is released from the cell into the salt solution but chromosomal DNA, with an integrated gene therapy vector or fragment thereof, if present, is retained in the cell; (d) separating the salt-extracted cell from the salt solution; and (e) determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell, whereby the presence of the vector or fragment indicates the presence of the integrated gene therapy vector or integrated fragment thereof. In particular variations, the gene therapy vector is a plasmid DNA vector or a viral vector such as, for example, an adeno-associated virus or lentivirus vector. Typically, the subject has or is at risk of developing a disease or disorder amenable to treatment or prevention with the gene therapy vector. In such embodiments, the method optionally includes monitoring the subject for at least one symptom associated with the disease or disorder.

[0021] In typical embodiments of the method for monitoring integration of a gene therapy vector or fragment thereof, determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell comprises determining the presence or absence of the transgene. In other, non-mutually exclusive variations, determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell includes the following steps: (i) contacting DNA from the salt-extracted cell with a labeled nucleic acid probe that specifically hybridizes to the gene therapy vector or fragment thereof under stringent hybridization conditions, whereby the nucleic acid probe hybridizes to the gene therapy vector or fragment thereof, if present; (ii) removing unbound labeled nucleic acid probe; and (iii) detecting the presence or absence of label bound to the DNA from the salt- extracted cell. In specific embodiments, determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell includes in situ hybridization such as, e.g., fluorescence in situ hybridization. The probe can be, e.g., vector-specific or transgene-specific.

[0022] The present invention also provides a kit for use in detection of integrated DNA. Typically, the kit includes one or more probes or primers that specifically hybridize to a target DNA under stringent hybridization conditions; and one or more of the following components: (i) a detergent for performing permeabilization of a cell; (ii) an extracting salt solution; and (iii) if the kit comprises a first primer, a second primer that specifically hybridizes to the target DNA, whereby a target DNA amplicon is produced when the first and second primers are contacted with the target DNA under conditions suitable for amplification of the target DNA. In various embodiments, the target DNA is a viral DNA (e.g. , human papilloma viral DNA) or a recombinant vector such as, for example, a viral vector (e.g., an adeno-associated virus lentivirus vector) or a plasmid DNA vector. In a particular variation, the kit includes the detergent such as, for example, a non-ionic detergent (e.g., BIGCHAP, Deoxy-BIGCHAP, digitonin, a polyoxyethylene ester, a polyoxyethylene ether, a polyoxyethylenesorbitan ester, a sorbitan ester, Tergitol, Triton X-100, Triton X-114, or Tyloxapol) or a zwitterionic detergent (e.g., CHAPS, CHAPSO, phospatidylcholine, or 1- propane sulfonate. In other specific variations, the kit includes the extracting salt solution such as, for example, an extracting salt solution comprising a kosmotropic salt (e.g., ammonium sulfate), sodium chloride, or lithium iodosalicylate.

DEFINITIONS

[0023] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al. , Dictionary of Microbiology and Molecular Biology (2d ed. 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); Hale & Marham, The Harper Collins Dictionary of Biology (1991); Stedman's Medical Dictionary (27th ed. 2000); King and Stansfield, A Dictionary of Genetics (Oxford University Press, 4th ed. 1990); εmdHawley's Condensed Chemical Dictionary (John Wiley and Sons, 13th ed. 1997). As used herein, the following terms and phrases have the meanings ascribed to them unless specified otherwise. [0024] The terms "a," "an," and "the" include plural referents, unless the context clearly dictates otherwise.

[0025] The term "target DNA" means a DNA which is to be detected or which is to serve as a template for priming {e.g., PCR or random priming). A target DNA can be single- stranded or double-stranded, although, for uses described herein, double-stranded targets are generally made single-stranded using known methods. A target DNA can include, for example, viral DNA or a recombinant vector such as, e.g., a vector containing a transgene.

[0026] "Integrated DNA" refers to foreign DNA has physically integrated into a chromosome of a host cell. The terminal ends of the integrated DNA is covalently attached to the host cell chromosome DNA. "Non-integrated DNA" refers to DNA that has been introduced into a host cell but not physically integrated into the chromosome of the host cell.

[0027] "Viral DNA" refers to a complete or partial genome of a virus. "Episomal viral DNA" refers to non-integrated viral DNA, i.e., viral DNA that has not integrated into a host cell chromosome. Episomal viral DNA can exist in a host cell in linear or circular form. Episomal viral DNA can be present in the host cell nucleus, cytoplasm or both. Episomal viral DNA can be non-covalently attached to chromosomes, for example, through viral proteins or host proteins.

[0028] The term "vector" refers a self-replicating nucleic acid molecule, typically DNA, capable of transferring a nucleic acid segment to a host cell. Vectors include, e.g., viral vectors and plasmid DNA vectors. The term "recombinant vector" means a vector containing a nucleic acid segment heterologous to the vector {e.g., a foreign gene). A "gene therapy vector" refers to a recombinant vector that is designed for use in gene therapy. "Gene therapy" as used herein means the delivery of a heterologous nucleic acid segment to a subject for the purpose of treating or preventing, or potentially treating or preventing, a disease or disorder in the subject. Accordingly, the term "gene therapy vector" does not denote any particular therapeutic or prophylactic effect of the vector in the subject and includes, e.g., a vector that is being tested for safety or for therapeutic or prophylactic efficacy.

[0029] The terms "subject" and "patient" are used interchangeably and refer to a human or nonhuman animal that is tested for the presence of integrated vDNA. [0030] The term "sample" generally refers to a material of biological origin that includes cells. Samples can include, e.g., an in vitro cell culture or tissue obtained from a patient. Samples can be purified or semi-purified to remove certain constituents (e.g., extracellular constituents or non-target cell populations).

[0031] The term "permeabilize" means chemically disrupting lipid-containing plasma membranes of a cell to allow molecules to pass into or out of the cell, where the molecules could not pass into or out of the cell if membranes were intact.

[0032] The term "salt extraction" refers to separation of at least some cellular constituents from other cellular constituents by treatment of a cell with a salt solution (an "extracting salt solution") having an ionic strength sufficient to disrupt at least some non-covalent molecular interactions, typically hydrogen bonding or hydrophilic interactions. Extracting salt solutions achieve separation of cellular constituents by, inter alia, impacting protein structure. Extracting salts suitable for use in accordance with the methods provided herein include, e.g., salts suitable for nuclear fractionation procedures, as well as other salts or mixtures of salts, used at appropriate ionic strengths as described further herein.

[0033] The ability of salts to impact protein structure is determined, e.g. , by their placement in the Hofrneister series, a measure of the ability of different salts to precipitate egg white proteins (see F. Hofrneister, Zur Lehre von der Wirkung der Salze, Arch. Exp. Pathol. Pharmakol. (Leipzig) 24:247-260 (1888); translated in W. Kunz, J. Henle and B. W. Ninham, 'Zur Lehre von der Wirkung der Salze' (about the science of the effect of salts: Franz Hofmeister's historical papers, Curr. Opin. Coll. Interface Sd. 9:19-37 (2004)). Kosmotropic anions, in decreasing order of their strength, include citrate > sulfate > phosphate. Chaotropic anions include iodate, nitrate and chlorate. F^", Cl^", and Br^" are intermediate between kosmotropes and chaotropes. Kosmotropic cations include, e.g., ammonium, cesium, and rubidium. Chaotropic cations include, e.g., magnesium, lithium, and calcium. Sodium and potassium are intermediate between kosmotropic and chaotropic cations.

[0034] The term "nuclear fractionation" refers to a process whereby a cell nucleus is fractionated from other cellular constituents while preserving morphology. Nuclear fractionation typically includes (1) permeabilization of the cell to allow soluble cytoplasmic and nuclear proteins to diffuse out of the permeabilized cell; (2) salt extraction of all remaining cytoplasmic proteins (with the exception of intermediate filaments); and (3) treatment of genomic DNA with DNAse, followed by incubation in an extracting salt solution, to remove the majority of genomic DNA, histone proteins, and non-histone nuclear proteins, thereby leaving nuclear proteins and structure corresponding to the nuclear matrix. Salts suitable for salt extraction during nuclear fractionation include, for example, ammonium sulfate, sodium chloride, and lithium iodosalicylate.

[0035] "Detergent" means a molecule that has a hydrophilic region and a hydrophobic region that disrupts lipid-containing plasma membranes of a cell. The molecular weight of a detergent is usually less than 1500 daltons. Detergents are considered amphipathic molecules, in that they contain both polar and non-polar groups. In aqueous environments, the polar region interacts with water, and the non-polar regions interact with non-polar regions of other detergent molecules, forming a structure termed a "micelle." Interaction of detergents with other structures containing non-polar groups, such as lipids in cell membranes, results in the partitioning of cell lipid molecules with detergent micelles, resulting in removal of lipids from the membrane. Detergents can be characterized as ionic, non-ionic, or zwitterionic. Ionic detergents contain polar groups which are charged, either negatively or positively, and are termed cationic or anionic detergents. Non-ionic detergents contain non-charged polar groups. Zwitterionic detergents contain non-charged polar groups, but are capable of breaking protein-protein interactions, as ionic detergents do.

[0036] Compounds such as bile acid salts (e.g., sodium deoxycholate) and a class of molecules termed non-detergent sulfobetaines (NDSBs) have virtually identical functions as detergents, therefore are considered to be functionally equivalent to traditional detergents described herein.

[0037] "Chaotropic salt" refers to a compound that has the ability to destabilize proteins and membranes by, inter alia, having ionic interactions with protein that are stronger than interactions with water, thereby disrupting the regular hydrogen bond structures in aqueous solutions and disrupting hydrogen bonds that hold a protein in its unique structure.

Typically, chaotropic salts also increase the solubility of nonpolar substances in aqueous solutions, thereby disrupting hydrophobic interactions, which also promotes protein denaturation.

[0038] "Kosmotropic salt" refers to a compound that has the ability to enhance the stability of proteins and membranes by, inter alia, increasing the ordered nature of water around hydrophobic groups on protein molecules. [0039] The term "substrate" means a solid surface on which cells are deposited before, during, or after detection of integrated DNA.

[0040] The term "nucleotide," in addition to referring to the naturally occurring ribonucleotide or deoxyribonucleotide monomers, shall be understood to refer to related structural variants thereof, including derivatives and analogs, that are functionally equivalent with respect to the particular context in which the nucleotide is being used (e.g., hybridization to complementary base), unless the context clearly indicates otherwise.

[0041] The term "nucleic acid" and "polynucleotide" are synonymous and refer to a polymer having multiple nucleotide monomers. A nucleic acid can be single- or double- stranded, and can be DNA (cDNA or genomic), RNA, synthetic forms, and mixed polymers, and can also be chemically or biochemically modified or can contain non-natural or derivatized nucleotide bases. Such modifications include, for example, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, and the like), charged linkages (e.g., phosphorothioates, phosphorodithioates, and the like), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, and the like), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, and the like). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Typically, the nucleotide monomers are linked via phosphodiester bonds, although synthetic forms of nucleic acids can comprise other linkages (e.g., peptide nucleic acids as described in Nielsen et ah, supra, Science 254, 1497-1500, 1991). "Nucleic acid" or "polynucleotide" do not refer to any particular length of polymer and can, therefore, be of substantially any length, typically from about six (6) nucleotides to about 10⁹ nucleotides or larger, hi the case of a double-stranded polymer, "nucleic acid" or "polynucleotide" can refer to either or both strands.

[0042] A "probe" is defined as a nucleic acid capable of binding to a target nucleic acid of substantial complementarity through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. "Substantial complementarity" means full or partial complementarity sufficient to allow specific hybridization of the probe to the target nucleic acid. Typically, two nucleic acid regions are substantially complementary when, e.g., at least 90% of the respective bases are complementary, more typically when at least 95% and preferably when 100% of the respective bases are complementary. A probe can include natural (i.e., A, G, C, or T) or modified bases (e.g., 7-deazaguanosine, or inosine). In addition, the bases in a probe can be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization. For example, probes can be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages.

[0043] The phrase "hybridizing specifically to" refers to the selective binding, duplexing, or hybridizing of a probe to a target nucleic acid, having a particular nucleotide sequence, under stringent conditions when that nucleic acid is present in a sample. Stringent conditions-are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Qualitative and quantitative considerations for establishing stringent hybridization conditions in accordance with the present invention are known in the art. (See, e.g., Ausubel et ah, Short Protocols in Molecular Biology (4th ed., John Wiley & Sons 1999); Sambrook and Russell, Molecular Cloning: A Laboratory Manual (3d ed., Cold Spring Harbor Laboratory Press 2001); Nucleic Acid Hybridisation: A Practical Approach (B.D. Hames & SJ. Higgins eds., IRL Press 1985).) Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.05 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Stringent hybridization conditions can include, for example, 6xNaCl/sodium citrate (SSC) at about 45 ⁰C for a hybridization step, followed by a wash of 2xSSC at 50 ⁰C; or, alternatively, e.g., hybridization at 42 ⁰C in 5xSSC, 20 mM NaPO₄, pH 6.8, 50% formamide, followed by a wash of 0.2xSSC at 42 °C.

[0044] The term "primer" refers to a polynucleotide capable of acting as a point of initiation of template-directed nucleic acid synthesis under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. Primers, therefore, include a target-binding region that hybridizes to a target nucleic acid (the template). The appropriate length of the target-binding region for a primer depends on the intended use of the primer but typically ranges from 6 to 40 nucleotides. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template. The term primer site refers to the area of the target nucleic acid to which a primer hybridizes. The term "primer pair" means a set of primers including a 5' upstream primer that hybridizes with the complement of the 5' end of the nucleic acid sequence to be amplified and a 3' downstream primer that hybridizes with the complement of the 3' end of the sequence to be amplified.

[0045] With respect to viral DNA, the term "strain-specific polynucleotide region" or "strain-specific region" refers to a region of a target viral DNA having sufficiently low sequence identity among different strains of a virus (for example, the E2 regions of HPV- 16 and HPV-18) to allow the different strains to be distinguished by a nucleic acid probe or primer that binds to the region. A strain-specific region of a target viral DNA typically has no more than 90% or 95% sequence identity with the corresponding region of other viral strains, hi other variations, a strain-specific region has less than 85%, less than 80%, less than 70%, or less than 60% sequence identity with the corresponding region of other viral strains.

[0046] The term "strain-specific probe" or "strain-specific primer" refers to a nucleic acid probe or primer that hybridizes to a strain-specific region of a viral nucleic acid with sufficient specificity to distinguish different strains of the virus.

[0047] The term "strain-independent polynucleotide region" or "strain-independent region" refers to a region of viral DNA that has sufficiently high sequence identity among different strains of a virus such a probe or primer that specifically binds to the region of one strain will specifically hybridize to the corresponding region of different strain.

[0048] With respect to viral DNA, the term "strain-independent probe" or strain- independent primer" refer to a nucleic acid probe or primer that specifically hybridizes to a strain-independent region.

[0049] With respect to a recombinant vector comprising a transgene, the term "vector- specific probe" or "vector-specific primer" refer to a nucleic acid probe or primer that specifically hybridizes to the parental vector, but not the transgene; and the term "transgene- specific probe" or "transgene-specific primer" refer to a nucleic acid probe or primer that specifically hybridizes to the transgene, but not the parental vector.

[0050] A "target DNA amplicon" is a section of target DNA (e.g., a target viral DNA) that is amplified using an amplification method such as, for example, P CR.

[0051] "Malignant transformation" refers to the process whereby a cell in an organism gains the property of locally invasive and destructive growth and metastasis.

BRIEF DESCRIPTION OF THE DRAWINGS [0052] Figure 1. Detection of HPV-16 DNA in detergent-permeabilized SiHa and W12 Cells. Cells grown on glass coverslips were detergent permeabilized in Triton X-100, fixed in paraformaldehyde, then subjected to in situ hybridization using digoxigenin-labeled HPV- 16 DNA and biotin-labeled cloned U2 snRNA DNA probes. HPV DNA was detected using fluorescein-conjugated anti-digoxigenin antibody and U2 DNA detected using Cy-3 conjugated streptavidin. (A, B) Detection of approximately 2-5 copies of integrated HPV-16 DNA (A) and approximately 10-20 copies of U2 DNA (B) in SiHa cells. (C, D) Detection of episomal HPV-16 in Wl 2 cells. Multiple low intensity hybridization signals (C) are consistent with the pattern expected for in situ detection of episomal DNAs. Successful hybridization was confirmed by detection of two discrete U2 DNA foci (D). Total genomic DNA in the cell nucleus is stained with DAPI and is shown as a homogeneous signal.

[0053] Figure 2. Immunofluorescence Detection of Proteins in Salt-extracted Cells. CaSki and Wl 2 cells were grown on glass coverslips and either detergent permeabilized, or detergent permeabilized and ammonium sulfate extracted, as described. Cells were incubated in human anti-centromere autoimmune serum and mouse monoclonal anti-SC-35 spliceosome protein, then antibody detected using fluorescein anti-human and Cy-3 anti- mouse IgG. In cells detergent permeabilized only (A-D), centromere protein staining shows small defined punctate signal, consistent with detection of chromosomal centromeres in both CaSki (A) and W12 (B) cell. Similarly, staining for the spliceosome SC-35 protein shows characteristic nuclear "speckle" domains in CaSki (C) and Wl 2 (D) cells. After extraction using 300 mM (NH₄)₂SO₄ (E-H), centromere staining pattern in CaSki (E) and W12 (F) cells appears normal. Conversely, SC-35 staining is absent in both lines (G; Caski, H; W12). Total genomic DNA in the cell nucleus, stained with DAPI, is shown as a homogeneous signal. [0054] Figure 3. Detection of HPV DNA in Salt-extracted Cells. Wl 2 and SiHa cells were grown on coverslips, then extracted and hybridized as described above. In W12 cells, a speckled, diffuse HPV hybridization signal is noted in non-permeabilized, non-extracted (A); and detergent permeabilized (B) cells. Detection of the genomic U2 snRNA gene locus in the same cells reveals two distinct foci in each nucleus (Inset; A, B) Following extraction using 150 mM ammonium sulfate (C), only a single prominent HPV signal remains. Both U2 DNA signals are unchanged (C; inset). Similarly, after extraction using 30OmM (NH₄)₂SO₄ (D), only a prominent HPV signal remains. Both U2 signals are unchanged (D; inset). Hybridization to SiHa cells extracted using 30OmM (NH₄)₂SO₄ (E), reveals that HPV DNA and U2 DNA (E; inset) are unchanged from non-extracted controls (Figure 1), indicating that genomic integrity is not perturbed by salt extraction at the concentrations shown. The HPV DNA focus detected in extracted Wl 2 cells (C, D) reflects detection of integrated HPV DNA in the Wl 2 cell line, as revealed by HPV DNA hybridization to Wl 2 metaphase chromosomes (F). Total genomic DNA in the cell nucleus and metaphase chromosomes was stained with DAPI, and is shown as a homogeneous signal in all panels.

[0055] Figure 4. PCR Analysis of Episomal HPV DNA Extraction. High sensitivity detection of HPV DNA and cellular XIST DNA using multiplex PCR. SiHa and Wl 2 cells contain two copies of the X-linked XIST gene, used here as an internal PCR copy number control. SiHa cells contain 1-2 copies of integrated HPV-16 DNA, whereas W12 cells contain approximately 100 copies of episomal HPV-16 DNA, as well as a low copy HPV-16 integrant on a unidentified acrocentric chromosome. In SiHa cells (lane 1), HPV and XIST amplicon levels are of similar intensity, due to similar target DNA levels, hi non-extracted W12 cells (lane 2), HPV target DNA copy number exceeds that of XIST DNA, generating more abundant HPV amplicon. After 5OmM (lane 3) and 10OmM (NH4)2SO4 (lane 4) extraction, HPV DNA copy number is reduced to a level similar to XIST DNA, a result consistent with removal of episomal DNA from W12 cells.

[0056] Figure 5. Detection of HPV DNA in Non-Extracted, and Salt-Extracted Exfoliated Cervical Epithelial Cells from Clinical Samples. Exfoliated cervical epithelial cells were obtained by cervical brush sampling from patients with abnormal cervical cytology and/or positive HPV DNA hybrid capture test results. HPV DNA hybridization was performed on non-salt extracted samples as controls, and on aliquots from the same samples after extraction with 10OmM ammonium sulfate extraction, hi non-salt extracted HPV-infected cervical cells, HPV DNA is visualized as a intense, diffuse signal throughout the infected cell nucleus (A). Following salt extraction ,HPV DNA is shown to exhibit a distinct punctate pattern (B), which is restricted to the cell nucleus. This pattern is consistent with that seen for detection of integrated HPV DNA in model cell lines.. The presence of diffuse HPV DNA in non- extracted cells (A) could potentially mask the presence of integrated HPV DNA (B).

DETAILED DESCRIPTION OF THE INVENTION I. General

[0057] The present invention is directed to a method for detecting integration of a target DNA in a cell. The method generally includes permeabilizing a cell from a sample to be tested; treating the permeabilized cell with an extracting salt solution such that non-integrated target DNA, if present, is released from the cell into the salt solution but chromosomal DNA, with integrated target DNA, if present, is retained in the cell; separating the salt-extracted cell from the salt solution; and determining the presence or absence of the target DNA in the salt- extracted cell. The presence of the target DNA in the separated, salt-extracted cell indicates integration of the target DNA into a chromosome of the cell.

[0058] The method has various applications, including, for example, diagnosis of a disease or disorder associated with viral infection, as well as monitoring of integration of a vector (e.g., a recombinant vector comprising a transgene) in cells. For example, the severity of some diseases that are caused by viruses is correlated with the presence of integrated versus episomal viral DNA. Detecting only integrated viral DNA from a sample, and not episomal viral DNA, results in a more accurate prognosis. Integration is implicated in conferring a selective growth advantage to transformed cells, enabling higher expression of viral genes directly associated with cellular transformation and abrogation of cell cycle checkpoint control, and an increase in disease severity (see Arends et ai, supra; Cooper and McGee, MoI. Pathol. 50:1-3, 1997; Jeon et al, J. Virol. 69:2989-2987, 1995; Lazo, Br. J. Cancer 80:2008-2018, 1999; Vernon et al.Jnt. J. Cancer 74:50-56, 1997; Villa, supra).

[0059] Accordingly, in certain embodiments, the present invention is directed to detecting integrated viral DNA in infected cells rendered substantially free of episomal viral DNA. Because integrated and episomal viral DNAs are typically identical in sequence, sequence- specific detection methods such as PCR do not always distinguish between integrated and episomal viral DNA in the absence of a mechanism for separating the two before detection. The present methods provide a mechanism for separating integrated and episomal viral DNA before a detection step. As set forth herein, the separation involves permeabilizing cell membranes followed by exposing the permeabilized cells to an extracting salt solution. This process allows smaller, non-chromosomal nucleic acids to be removed from the cell, including episomal viral DNA. The process does not perturb the cells to the point where substantial amounts of chromosomal DNA, with integrated viral DNA, are released. After these steps, a detection step is performed.

[0060] For purposes of setting forth the sample preparation, cell permeabilization, salt- extraction, separation, and DNA detection steps of the present invention, the method for detecting integrated target DNA is described further hereinbelow in Sections II- VIII with particular reference to viral DNA. These steps are equally applicable to cells containing other forms of foreign DNA such as, for example, a recombinant vector. Accordingly, the described method is applicable to any target DNA for which a determination of integration into a host cell chromosome is desired, and such embodiments of the method are also encompassed by present invention.

II. Viruses that can be Detected

[0061] The present invention is useful, inter alia, for detecting viral DNA that exists in both episomal and integrated forms. After primary infection of a host cell, viral DNA is typically released into the nucleus, where it can exist as a DNA episome (see Arends et al, supra; Lazo, supra; Villa, supra). Long-term stability and episome retention in the nucleus is typically mediated by protein-protein and protein-nucleic acid interactions involving viral and host molecules (see Lehman and Botchan, Proc. Natl. Acad. Sd USA 95:4338-4343, 1998; Skiadopoulos and McBride, J. Virol. 72:2079-2088, 1998; Tm et al., J. Virol. 72:3610-3622, 1998). Episomal DNA retention in the nucleus is advantageous for viruses because it usually leads to more even distribution of viral DNA to daughter cells during cell division.

[0062] Viruses that can be detected using the present methods include any virus that can exist in a cell in both integrated and episomal form, including, for example, human papilloma virus (HPV), Epstein-Barr virus (Debiec-Rychter et al., Am. J. Pathol. 163:913-922, 2003), human immunodeficiency virus (HIV) (Zanussi et al, AIDS Res. Hum. Retroviruses 16:931- 933, 2000), HTLV-I and HTLV-2 (Thorstensson et al, Transfusion 42:780-791, 2002), Human Herpesvirus-6 (Lusso and Gallo, Baillieres Clin. Haematol 8:201-23, 1995), adeno- associated virus (Winocour et al, Virology 190:316-29, 1992), adenovirus (Doerfler et α/., Cold Spring Harb Synip Quant Biol. 39:505-521, 1975)., hepatitis B virus (Bartholomeusz and Schaefer, Rev. Med. Virol. 14:3-16, 2004), Polyoma virus (Hirsch and Steiger, Lancet Infect. Dis. 3:611-23, 2003). Also suitable for detection using the present methods are plant viruses that exist both in integrated and episomal forms, such as, e.g., Banana Streak Virus (Lheureux et al, Theor. Appl. Genet. 106:594-8, 2003). The aforementioned viruses, and other viruses that are detectable in integrated form using the present methods, are further described in, e.g., Fields Virology (Knipe et al. eds., Lippincott Williams & Wilkins, 4th ed. 2001).

III. Sample Preparation

[0063] Cells tested for the presence of integrated versus episomal viral DNA are typically obtained from a sample known or suspected to be infected with a virus having episomal and integrated phases in its life-cycle. Alternatively, cells are tested as a routine screening procedure in the absence of knowledge or suspicion that the sample is infected.

[0064] Clinical samples can be harvested from patients. Clinical samples can be isolated using a variety of methods depending on the identity of the virus being tested. Tissue is obtained that, if a patient is infected with a particular virus, is expected to contain viral DNA in integrated form, episomal form, or both. For example, the presence of viral DNA in blood cells, such as HIV, can be tested by taking blood samples from patients. Tissue from internal organs such as liver can be obtained using standard biopsy techniques. Any human tissue can be sampled using known tissue extraction techniques.

[0065] Cervical tissue is particularly suitable for HPV testing. In some methods, the patient is known or suspected to be infected with HPV. Alternatively, samples are taken from a patient as a routing screening procedure in the absence of knowledge or suspicion that the patient is infected. The sample is obtained using any suitable method known in the art for the collection of cervical tissue samples, including, for example, using a type of wooden spatula, a cotton swab, or a brush. Other methods include, e.g., using devices such as curettes and sleeved cytobrushes {see Boardman et al, Obstet. Gynecol. 101:426-30, 2003). A preferred method of obtaining the sample is using a cervical brush. An example of a cervical brush is a Fisherbrand Cervex Brush™ Cervical Cell Sampler, which comprises a cervical brush and a collection tube into which the brush is inserted after specimen collection.

[0066] In some embodiments, the tissue sample is fixed during the collection process.

Typically, the fixative for cytologic specimens is alcohol {e.g., 95% ethanol, 100% methanol, 80% isopropanol, and the like), which causes cells to shrink by removing intracellular water. In such variations, the method further includes reversal of fixation following sample collection and prior to salt-extraction.

[0067] In other variations of the present invention, samples are taken from sources other than humans. Viruses infect organisms such as livestock, food crops, ornamental plants, and other organisms. Any tissue from any organisms can be tested for the presence of integrated versus episomal viral DNA using the present methods.

[0068] Optionally, cells from a biological source are cultured before analysis. Tissue culture methods for culturing human cells are well-known in the art. {See, e.g., Tissue Culture Methods and Applications (Kruse et al. eds., Academic Press, New York, 1973); Paul, Cell and Tissue Culture (Church Livingston, Edinburgh, 1975).

[0069] After collection, the cell samples are optionally suspended in a solution such as, e.g., buffered physiological saline containing a preservative to prevent growth of contaminating organisms. Suspension in solution typically removes dead cell debris and non- cell tissue, and other contaminating matter.

[0070] Optionally, cells are adhered to a substrate at some point after collection and before a detection step. For example, cells can be adhered to a substrate immediately after collection or after suspension in solution after collection. The cells are then permeabilized and exposed to an extracting salt solution {e.g., kosmotropic salt solution), followed by a detection step. Alternatively, the cells are permeabilized and exposed to an extracting salt solution before being adhered to a substrate.

[0071] Any of various methods are available for adhering cells to a substrate. One suitable method involves adhering the cells to glass cover slips or slides using cytocentrifugation. Cytocentrifugation typically involves placing cells into a specially-designed funnel which opens onto a glass slide. Using a cytocentrifuge (such as a CytoSpin® cytological centrifuge, Electron Corp., Waltham, MA), the cells are uniformly deposited onto the slide or coverslip by centrifugal force. The slide or coverslip can be coated or non-coated. Particularly suitable coatings include, for example, collagen protein, fibronectin protein, chemical groups containing reactive primary amines, and silanes. Alternatively, cytocentrifugation is not performed until after episomal viral DNA has been removed from the cell to prevent episomal viral DNA from nonspecifically adhering to the substrate. Alternately, cells can be adhered to a substrate by pipeting cells suspended in solution onto the substrate. Different methods of depositing cells on substrates can be used without hindering the ability to distinguish episomal and integrated viral DNA.

IV. Permeabilizing Cells

[0072] Cells are permeabilized by detergent prior to salt treatment designed to mediate the release of episomal viral DNA from the cell. The cells are preferably permeabilized to the point where the plasma and nuclear membranes are substantially removed, resulting in the release of the majority of phospholipids and soluble cytoplasmic and nuclear proteins (Fey et al., J. Cell Biol., 102:1654-1665, 1986).

[0073] Cells are typically permeabilized using a detergent. A detergent molecule is characterized by a hydrophilic "head" region and a hydrophobic "tail" region. The result of this characteristic is the formation of thermodynamically stable micelles with hydrophobic cores in aqueous media. This hydrophobic core provides an environment that allows for the dissolution of hydrophobic molecules such as lipids that make up cell membranes. Detergents permeabilize cells by partially disrupting cell membranes through binding to membrane lipids. The extent of disruption of cell membranes typically depends on the concentration and type of detergent used.

[0074] Detergents are classified as anionic, cationic, zwitterionic, non-ionic. Other molecules which are functionally similar to detergents include bile salts and non-detergent sulfobetaines.

[0075] Detergents suitable for use in accordance with the present invention are those detergents that do not substantially denature the majority of cell proteins, thereby maintaining sufficient cell morphology for cytological analysis using the methods described herein.

[0076] For example, anionic and cationic detergents typically modify protein structure to a greater extent than zwitterionic and non-ionic detergents. The degree of modification typically varies with the individual protein and the particular detergent. Ionic detergents are also more sensitive to pH, ionic strength, and the nature of a counterion.

[0077] Alternatively, non-ionic detergents are typically non-denaturing, but are less effective at disrupting protein aggregation. Suitable non-ionic detergents for permeabilizing cells include, e.g., BIGCHAP, Deoxy-BIGCHAP, digitonin, a polyoxyethylene ester, a polyoxyethylene ether, a polyoxyethylenesorbitan ester, a sorbitan ester, Tergitol, Triton X- 100, Triton X-114, Tyloxapol, octyl glucoside, nonyl glucoside, and BRIJ-35.

[0078] Zwitterionic detergents uniquely offer some intermediate class properties that are typically superior to the other three detergent types in some applications. Offering the low- denaturing and net-zero charge characteristics of non-ionic detergents, zwitterionics also efficiently disrupt protein aggregation. Suitable zwitterionic detergents include, for example, CHAPS, CHAPSO, phospatidylcholine, and 1 -propane sulfonate.

[0079] Cells are typically treated with the detergent in a solution having a pH of about 6.3 to about 7.6, more typically in a solution having a pH of about 6.5 to about 7.4, and even more typically about 6.6 to about 7.0. One particularly suitable pH is a pH of about 6.8.

[0080] An exemplary permeabilizing solution for cervical cells is 100 niM NaCl, 300 mM sucrose, 10 mM pipes pH 6.8, 3 mM MgCl₂, 1 mM EGTA, containing 0.5-1.0 % Triton X- 100. For example, cells can be exposed to this solution for 20 minutes at 4⁰C. hi general, increasing, e.g., the duration of cell exposure to the detergent buffer, or the concentration of the detergent in the buffer, leads to increased cell permeabilization.

[0081] For example, Tween 20 can be used at a final concentration of about 0.5% to 1.0%, with incubation times from 2 minutes to 30 minutes, on ice. Digitonin extraction can be performed at a final detergent concentration of between 0.5% and 1.0%, for 2 min to 30 minutes, on ice. Saponin can be used at a concentration of about 0.1% to 0.5%, for between 2 and 30 minutes, on ice.

[0082] The appropriate level of exposure of a particular cell to a permeabilizing agent will typically depend on the components of the cell membranes (e.g., lipids, fatty acids, and transmembrane proteins), which will depend on such factors as cell type, tissue type, physiological state, the organism from which the cells are obtained, and the like. Underpermeabilization has a variety of detrimental effects depending on the type of experimental procedure being performed. For example, immunohistochemical detection of cytoplasmic and nuclear proteins can be substantially prevented if the cell membranes are not sufficiently permeable to the detection molecules. Effective removal of episomal viral DNA can be hindered due to the inability of the released episomal viral DNA to exit the nucleus or cell being analyzed. Preferably, cells are permeabilized to a level where essentially all cell membranes are removed, and remaining cell constituents consist of the cytoskeletal protein framework, the nuclear lamina, nuclear chromatin and chromatin binding proteins, and the nuclear matrix protein structure and components. It is believed that chromatin is retained in the nucleus as a result of the nuclear lamina remaining intact after detergent permeabilization.

[0083] The concentration of detergent used is a concentration sufficient to release soluble intracellular proteins from the cell and nucleus resulting from dissociation of the cytoplasmic and nuclear membranes. The appropriate concentration of detergent is titratable using routine methods. Such routine methods for determining an appropriate level of exposure to a permeabilizing agent typically involve exposing a specific cell type to varying levels of detergent, varying types of detergent, varying durations of exposure to detergent, and/or combinations of these and other parameters. Soluble intracellular and nuclear proteins can be used as markers to assess the level of cell permeabilization. For example, proteins that reside in the cytoplasm in soluble form can be assayed for after permeabilization using 2- dimensional gel electrophoresis to determine if they are present or absent, indicating whether cells have been permeabilized enough. Underpermeabilization causes these proteins to remain inside the cell. Soluble proteins that reside in the nucleus can be used to determine if the nuclear membrane has been sufficiently permeabilized. A simple method for determining sufficient detergent permeabilization involved examination of the cells using phase contrast microscopy. The cytoplasmic membrane will be absent in detergent permeabilized cells, and the amount of phase dense material in the cell nucleus diminished (Staufenbiel and Deppert, J. Cell Biol. 98:1886-1894, 1984).

V. Removing Episomal Viral DNA from Cells

[0084] After permeabilization, cells are treated with an extracting salt solution, the function of which is to dissociate the bond(s) between episomal viral DNA and viral proteins, viral DNA and host proteins, and/or viral proteins and host proteins. Salts disrupt protein-protein and protein-nucleic acid interactions by disrupting the regular hydrogen bonds that bind target proteins to their binding partner(s). Although it is not necessary to understand the mechanism behind this phenomenon to practice the invention, it is generally believed that to prevent episomal loss during cell division and to allow for proper partitioning of episomal DNA into daughter cells during cell division, episomal DNAs are tethered to host chromosomal DNA by viral proteins. For example, episomal HPV DNA is tethered to host chromosomal DNA by viral E2 protein binding. Additionally, viral DNA may be tethered to host chromosomal DNA by intermediary host proteins which bind to both host chromosomal DNA and to viral E2 protein. Treatment with appropriate extracting salts (e.g., chaotropic or kosmotropic salts) is believed to overcome ionic interactions or hydrogen bonding which link viral DNA to viral and/or host proteins.

[0085] Typical extracting salt solutions that can be used to release episomal viral DNA include, for example, mixtures of choatropic, kosmotropic, or both types of salts together, (e.g., ammonium sulfate, tetraethylammonium chloride (TEA), NaClO₄, NaBr, potassium thiocyanate, and/or potassium iodide).

[0086] The concentration of salt used in the salt-treating step is a concentration sufficient to release episomal DNA from the cell, leaving endogenous cellular DNA and integrated viral DNA within the cell. The appropriate concentration of salt is titratable using methods described herein. Various markers can be used as indicators of effective salt concentration, and to determine the extent of chromosomal DNA release from cells. These include, for example, the spliceosome associated SC-35 protein and centromere binding proteins. The SC-35 protein is reportedly localized in the nucleus by protein-protein, and possibly protein- RNA interactions (Fu and Maniatis, Nature 343:437-41, 1990). Release of this protein from salt extracted cells is indicative of bond disruption of nuclear proteins and nuclear scaffold proteins. By contrast, centromere binding proteins are covalently attached to chromosome centromeric DNA sequences (Earnshaw and Rothfield, Chromosoma 91:313-321, 1985), and are therefore not expected to be released from the salt extracted nucleus. To determine the status of genomic and integrated viral DNA, salt extracted cells can be assayed by FISH using probes to particular DNA regions which have previously been demonstrated to be released from the salt extracted nucleus. One example is the 5S ribosomal RNA gene cluster, which has been reported to form readily identifiable strands of DNA seen emanating from the residual salt extracted nucleus (Moen et ah, Hum MoI Genetics 4(Review):1779-1789. 1995.) Detection of 5S ribosomal DNA outside the cell nucleus, or in a diffuse pattern within the nucleus, after exposure to a particular concentration of salt is indicative of chromosome release and an undesirably high concentration of salt. Titration of salts in conjunction with, for example, immunohistochemical detection of SC-35 and centromere binding proteins, or FISH detection of 5S ribosomal DNA, allows the practitioner to determine the range of salt concentration that is effective for releasing episomal viral DNA but not host cell chromosomes (see Figure 2). In addition, immunohistochemical detection of SC-35 and centromere binding proteins, or FISH detection of 5S ribosomal DNA can be used to titrate other parameters of exposure to salts besides concentration, such as pH, temperature, duration of exposure of the cells to the salt, and combinations of these and other parameters. [0087] Typically, the ionic strength of the extracting salt solution is equivalent to that of about 150 mM to about 1.5 M or about 150 mM to about 1.2 M monovalent salt {e.g., sodium chloride), more typically about 150 mM to about 900 mM, about 300 mM to about 900 mM, or about 450 mM to about 900 mM, and even more typically about 300 mM to about 600 mM or about 450 mM to about 600 mM. Within these ranges, episomal viral DNA is typically released from the cell whereas chromosomal DNA is typically not released from the cell.

[0088] For example, concentrations of ammonium sulfate for episomal viral DNA extraction are typically about 100 mM to about 500 mM or about 100 mM to about 400 mM, more typically about 100 mM to about 300 mM or about 150 mM to about 300 mM, and even more typically about 100 mM to about 200 mM or about 150 mM to about 200 mM. m one specific embodiment, the concentration of ammonium sulfate is about 150 mM.

VI. Separating Episomal DNA from Cells

[0089] Once cells are permeabilized and have been exposed to an extracting salt solution, the cells are preferably washed to remove episomal viral DNA. Washing is performed through any method that removes episomal viral DNA but does not disrupt the cells enough to dislodge chromosomes. For example, cells can be resuspended in a buffer such as cytoskeletal buffer (CSK; Yey et al. J. Cell Biol, 102:1654-1665, 1986), pelleted by centrifugation, and resuspended in fresh buffer following decanting or aspiration of supernatant.

[0090] A preferred method of washing the cells is to place the cells onto a filter that has pores large enough to allow episomal viral DNA to pass through but small enough to prevent the passage of whole cells. For example, a micron pore size polycarbonate filter can be used. The micron pore size permits flow through of released episomal DNA, with retention of cells on the filter surface. Additionally, episomal viral DNA will not adhere to the polycarbonate filter material because it is uncharged. A buffer such as CSK or PBS is added to the cells of the filter surface. Optionally, the buffer is passed through the filter by gravity, hi alternative variations, a vacuum force is applied.

[0091] Other filter types, such as, e.g., tetrafluoroethylene (Teflon) can also be used.

[0092] Alternative methods of washing include, for example, resuspension of cells in buffer, followed by pelleting the cells by centrifugation and decanting or aspiration of supernatant. [0093] Optionally, after washing, the filter is placed cell side down onto a glass slide and the cells are transferred to the slide by applying gentle pressure to the filter back. Alternatively, the filter-glass slides are placed in a cytocentrifuge and centrifugal force transfers the cells from the filter surface to the glass slide.

VII. Detecting Integrated Viral DNA

A. Methods of Detection of Integrated Viral DNA

[0094] After removal of episomal viral DNA, cells are analyzed for the presence of integrated viral DNA(s). Any method that can be used to detect a specific DNA sequence can be used for this purpose.

[0095] Optionally, a detection reagent, typically a nucleic acid probe, is labeled or amenable to labeling, either directly or indirectly, via a secondary detection reagent that binds to the detection reagent. Such labeling can be, for example, fluorescent, enzymatic, isotopic, magnetic, or paramagnetic, among others. Examples of fluorescent labels include PI, FITC, PE, PC5 (PE-Cy5), ECD (PE-Texas Red), and Cy-Chrome (R-PE), which are typically detected using 630 nm, 525 nm, 575 nm, 675 nm, 610 nm, and 650 nm band pass filters. For enzymatic-based labeling, the detection reagent is labeled with an enzyme, which is detected using a corresponding substrate for the enzyme that is processed to a chromogenic product under appropriate conditions; alternatively, unbound enzyme is used to detect a detection reagent labeled with the enzyme substrate. Processing of the substrate by the enzyme generates a detectable signal, hi some methods, the signal from a detection reagent is amplified using a secondary label. For example, in specific variations, a primary detection reagent labeled with fluorescein is incubated 15-30 minutes with rabbit anti-fluorescein IgG conjugated with biotin (Accurate Chemical & Scientific). After washing with PBS buffer, GMDs are incubated for 15-30 minutes with avidin-FITC or avidin-phycoerythrin (Sigma, St. Louis, MO). Because, on average, each anti-fluorescein is labeled with five biotin molecules and each biotin molecule can bind 2-4 avidin molecules, a 10-20 fold amplification in signal is obtained. If more than one detection reagent is used, then the different detection reagents are differentially labeled {e.g., using different fluorophores)

[0096] Labeled probes particularly suitable for use in accordance with the methods described herein include, e.g., hairpin-labeled oligonucleotide probes, which are described in co-pending U.S. Patent Application No. 60/485,471. [0097] In particular embodiments, the probe comprises nucleic acid(s) capable of detecting two or more different types of virus (e.g., two or more related viral types such as, for example, different strains of a particular family of viruses). Particularly suitable for use with the present methods is a nucleic acid probe that specifically hybridizes to a target viral DNA region conserved among different viruses (e.g., different types of HPV such as, for example, strains representing the most prevalent HPV types found in infected cervical epithelium). In other, non-mutually exclusive embodiments, the probe is a cocktail comprising two or more different nucleic acids having specificity for different target viral DNA regions.

[0098] In some variations, a labeled probe specific for a target viral DNA is used to detect integrated viral DNA in a cell via in situ hybdridization (ISH). Briefly, in situ hybridization typically includes the following major steps: (1) fixation of cells or tissue to be analyzed by depositing cells, either as single cell suspensions or as tissue preparation, on solid supports such as glass slides and fixed by choosing a fixative which provides the best spatial resolution of the cells and the optimal hybridization efficiency; (2) prehybridization treatment of the cells or tissue to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the cells or tissue; (4) posthybridization washes to remove nucleic acid fragments not bound in the hybridization and (5) detection of the hybridized nucleic acid fragments. The reagent used in each of these steps and their conditions for use vary depending on the cell source, probe, etc., of the particular application. Several guides to the techniques are available (see, e.g., Gall et al, Meth. Enzymol. 21 :470-480, 1981, and Angerer et al, in Genetic Engineering: Principles and Methods (Setlow and Hollaender eds., 7:43-65, Plenum Press, New York 1985), in addition to protocols described in Pinkel et al, Proc. Natl. Acad. ScL USA 85:9138-9142, 1988, WO 93/18186, EPO Publication. No. 430,402, and Hall et al, Blood 84 (10 Suppl. 1):97A, 1994).

[0099] Fluorescence in situ hybdridization (FISH) is particularly suitable for detection. Numerous methods are available to label DNA probes for use in FISH, including, e.g., indirect methods whereby a hapten such as biotin or digoxigenin is incorporated into DNA using enzymatic reactions. Following hybridization to a metaphase chromosome spread or interphase nuclei, a fluorescent label can be attached to the hybrid through the use of immunological methods. Alternatively, the fluorescent dye is directly incorporated into the probe and detected without the use of an intermediate step. Suitable FISH dyes include, e.g., fluorescein, rhodamine, Texas Red, and Cascade Blue. Optionally, multiprobe FISH analysis can be performed by labeling different probes with different haptens or fluorescent dyes.

[0100] Detection of viral DNA by FISH can also be performed as follows. Probes are labeled with biotin, dinitrophenol, or digoxigenin-labeled nucleotides using, e.g., nick translation. Salt-extracted cells are fixed on a solid substrate (e.g., coverslips or glass slides) and denatured in, for example, formamide/2xSSC for 2 minutes at 7O⁰C. Denatured cells are chilled {e.g., in ice cold 70% ethanol), then dehydrated {e.g., through graded ethanol and air dried). Hybridization probes (at, for example, final concentrations 50 ng-100 ng/hybridization) are denatured {e.g., in 100% formamide at 95⁰C for 10 minutes), rapidly chilled on ice, then added to hybridization buffer (for example, an equal volume is added to 2x hybridization buffer {e.g., 4x SSC/20% dextran sulfate/2% bovine serum albumin)). For multiprobe FISH, differentially labeled probes are combined, e.g., prior to denaturization. The denatured substrate is contacted with the hybridization solution (for example, denatured coverslips are placed face-down onto probe solution on Parafilm™). After a sufficient incubation period {e.g., overnight at 37⁰C), the substrate is washed (for example, in 2x SSC at 37⁰C for 10 minutes, then in 2xSSC/50% formamide, Ix SSC, 0.2x SSC and O.lx SSC at 37⁰C for 10 minutes). Following post-hybridization washing, labeled probes are detected using, for example, conventional fluorescence detection using labeled conjugates. For example, depending on target selection and probe label, suitable labeled conjugates include Cy-2 or Cy-3 conjugated streptavidin, fluorescein or cyanine-3 conjugated anti-dinitrophenol antibody, and fluorescein labeled anti-digoxigenin. Alternatively, for high sensitivity hybridization signal detection, signal amplification methods are employed (for example, catalyzed reporter deposition such as, e.g., Tyramide Signal Amplification System, using cyanine-3 or fluorescein conjugated tyramide molecules). Also suitable for use in the present methods are fluorophores that are spectrally similar to conventional labels, such as, e.g., Alexa488 {e.g., Alexa488 conjugated anti-dinitrophenol or Alex488 conjugated tyramide molecules, Molecular Probes Inc., Eugene, OR), which is spectrally similar to fluorescein.

[0101] In some variations, in situ detection of viral DNA includes the use of flow cytometry {e.g., FACS) to analyze salt-extracted cells for the presence of viral DNA labeled with a suitable detection reagent.

[0102] In some methods, genomic DNA is extracted from cells and subjected to any of various methods for analyzing DNA. Suitable methods for analyzing extracted DNA include, e.g., Southern blotting and filter blotting. Methods for Southern blotting and filter blotting useful in accordance with the present invention are well-known in the art and are described in, e.g., Sambrook and Russell, Molecular Cloning: A Laboratory Manual (3rd ed. 2001); Current Protocols in Molecular Biology (Ausubel et al. eds., 1994); and Sambrook et al, Molecular Cloning: A Laboratory Manual (2nd ed. 1989).

[0103] Other detection methods include amplifying a target viral DNA by any of various known nucleic acid amplification techniques. Both thermal cycling amplification methods and isothermal amplification methods are useful in accordance with the present invention. Suitable thermal cycling methods include, for example, the Polymerase Chain Reaction (PCR) (U.S. Patent Nos. 4,683,202, 4,683,195, and 4,965,188);; DNA Ligase Chain Reaction (LCR) (International Patent Application No. WO 89/09835); and transcription-based amplification (Kwoh et al, Proc. Natl. Acad. ScL USA 86:1173-1177, 1989). Suitable isothermal amplification methods include, e.g., Rolling Circle Amplification; Strand Displacement Amplification (SDA) (Walker et al, Proc. Natl Acad. ScI USA 89:392-396, 1992); Q-β replicase (Lizardi et al, Bio/Technology 6:1197-1202, 1988); Nucleic Acid-Based Sequence Amplification (NASBA) (Sooknanan and Malek, Bio/Technology 13:563-65, 1995); and Self-Sustained Sequence Replication (3SR) (Guatelli et al, Proc. Natl Acad. ScI USA 87:1874-1878, 1990). Amplification products are separated, typically by electrophoresis, and detected using methods known in the art, such as, for example, visualization of stained DNA (e.g. , visualization of ethidium bromide stained DNA under UV) or hybridization with labeled probe.

[0104] Nucleic acids can be amplified using a primer pair, specific for a target viral sequence, for primer extension and amplification of the target viral DNA. Conditions suitable for amplification of a target nucleic acid using a primer pair (i.e., a 5' upstream primer and a 3' downstream primer) are known in the art (e.g. , PCR amplification methods). (See, e.g., Sambrook and Russell, supra; Ausubel et al, supra; Sambrook et al, supra; PCR Applications: Protocols for Functional Genomics (Innis et al. eds., Academic Press 1999).)

[0105] Because the number of integrated copies of viral DNA may correlate with severity and onset of many virally-induced diseases, determining the number of viral genomes integrated into the host cell genome has prognostic value. Therefore, in some variations, the number of integrated copies of the viral genome is determined. Quantitative methods of detection are known in the art and include, e.g., methods of quantitative amplification (see, e.g., U.S. Patent Nos. 6,713,297 and 6,180,349).

[0106] For example, one method of quantitative PCR (also referred to as quantitative competitive PCR or QC-PCR), is used widely for PCR quantitation and is particularly suitable for use in accordance with the present invention. Quantitative PCR relies on the inclusion of a known amount of an internal control competitor in each reaction mixture. To obtain relative quantitation, the unknown target PCR product is compared with the known competitor PCR product, typically via gel electrophoresis. The relative amount of target- specific and competitor DNA is measured, and this ratio is used to calculate the starting number of target templates. The larger the ratio of target specific product to competitor specific product, the higher the starting DNA concentration. Success of a quantitative PCR assay relies on the development of an internal control that amplifies with the same efficiency as the target molecule. Methods for using quantitative PCR to determine DNA copy are known and are described in, e.g., U.S. Patent No. 6,180,349.

[0107] In certain variations of the present invention, the method for determining the presence of integrated viral DNA as set forth herein includes assessing the integrity of genomic DNA following salt-extraction of a cell. Assessment of genomic DNA integrity can be carried out, for example, by staining for centromere binding proteins, such as described further herein (see, e.g., Example 1, infra). In some embodiments, assessment of genomic DNA integrity in performed in a control sample. Alternatively, such assessment is performed on the same sample that is analyzed for presence of integrated viral DNA (e.g., staining for centromere binding protein and probing for integrated viral DNA in the same cell in situ). Assessment also can be performed by analyzing within the same cell for both the presence of integrated viral DNA and of a genomic sequence shown to be released from a cell by high salt extraction.

B. Determining Strain Type

[0108] In other aspects, the detection methods described above are used to determine not only the presence of integrated viral DNA (and, optionally, the copy number of integrated viral genomes), but also one or more particular strains of integrated viral DNA. Certain strains of viruses are correlated with prognostic indicators such as increased severity, accelerated or delayed onset of disease, drug resistance, and other parameters. [0109] As an example, there is a strong causal relationship between infection by high-risk, oncogenic Human Papilloma Virus types such as HPV-16 and HPV-18, and later development of cervical cancer (see NIH Consensus Statement, supra; Arends et al, supra; Villa, supra). Strain identification can be accomplished, for example, through the use of strain-specific primers (such as, e.g., those disclosed in the examples, infra). Strain-specific probes for use in hybridization methods such as Southern Blotting and FISH can also be used for this purpose. Strain-specific probes for various viruses useful in accordance with the methods described herein are known in the art. For example, Enzo Biochem has commercialized HPV DNA probe mixtures that are specific for different families of HPV viral types, such as, e.g., HPV type 6 and 11, type 16 and 18, and 16, 18, 31, 33 and 51.

PanPath B. V. has commercialized probe preparations specific for HPV types 6, 11, 16, 18, 31 and 33.

[0110] Some patients are infected with multiple strains of the same virus. It is therefore also desirable to detect the total amount of integrated viral DNA, regardless of strain, using primers or probes that recognize regions of viral DNA that are common to all strains. Strain- independent probes for various viruses suitable for use in accordance with the present invention are also known. For example, PCR primers, designated FAP59 and FAP64, have been described which are designed to amplify a wide range of different HPV types (see Foτslund etal., J. Gen. Vir. 80:2437-43, 1999).

VIII. Interpreting Data/Prognosis

[0111] It is useful to determine the probability of cells developing a disease or disorder associated with a virus based on the results of the present methods. For example, cells can be classified according to the presence of integrated copies of a particular viral type versus episomal viral DNA determined for a sample using the methods described herein.

[0112] Accordingly, in certain embodiments, the detection of integrated viral DNA is used as an indication (either alone or in combination with other classification schemes) of the probability for developing a viral associated disease or disorder, based on a known correlation between viral integration and the disease or disorder. For example, the presence of integrated HPV DNA is indicative of risk for malignant transformation of the HPV- infected tissue. The methods provided herein can therefore be used to assess the risk of malignant transformation in cells infected, or suspected of being infected, with HPV. [0113] In some variations, the determination of the presence or absence of integrated viral DNA is performed independent of other classiflcation(s) of the patient sample. For example, in a specific embodiment of the method as described herein for determining the presence or absence of integrated HPV DNA₅ patient samples are analyzed for integrated viral DNA irrespective of the results of cytological classification.

[0114] In alternative variations, cells are classified using a system that includes classification based on the amount of integrated versus episomal viral DNA, as described herein, with one or more additional classifications. For example, cells can be classified using a system that includes (a) classification according to the amount of integrated versus episomal viral DNA and (b) classification of cellular morphology. For the classification of cervical epithelial cytology, one particularly suitable classification system is the 5-tiered Bethesda Classification System, which consists of the following categories: (1) Negative, (2) ASCUS (atypical squamous cells of undetermined significance), (3) LSIL (low grade squamous intraepithelial lesions), (4) HSIL (high grade squamous intraepithelial lesions) and (5) carcinoma. Table 1 summarizes the Bethesda Classification System as it relates to HPV infection and cervical dysplasia.

*Table 1. Classification of Clinical Samples

Cervical intraepithelial neoplasm Carcinoma in situ NA Not applicable

[0115] hi some embodiments, when the cell sample includes cervical cells, the probability determination can include a determination of the presence of integrated viral DNA depending on the cytological classification. For cytological classifications as normal, condyloma, or HSIL, the probability determination will typically not further benefit from HPV DNA detection. A cytological classification of the cell sample as normal means there is no indication of the patient being at risk of developing cervical cancer. A classification as condyloma is generally considered to indicate HPV infection by types considered low risk for later development of cervical cancer; condyloma is typically not considered to be a precancerous condition. Further, a classification as HSIL or malignant lesion are automatically referred for further follow-up, typically surgery; typically, no additional HPV testing is considered necessary, as surgical intervention is generally considered the normal practice in such a case (although assessment of viral DNA integration may be used, e.g., in classifying patients and assessing correlations of clinical treatment and outcome with viral integration, see infra).

[0116] hi contrast, where cells are classified as ASCUS or LSIL, HPV detection methods as described herein can be used to further determine the probability of malignant transformation. A classification as ASCUS or LSIL means abnormal cells are present in the sample, but are not overtly cancerous. Patients with LSIL samples may be referred for colposcopy, where a more refined examination of the cervix is performed, and if necessary, further biopsy samples obtained. In this case, HPV testing is considered beneficial in terms of identifying whether HPV types associated with later development of cervical cancer are detected. Samples cytologically classified as ASCUS have abnormal but non-cancerous cells present. HPV testing is considered beneficial in terms of identifying whether high risk HPV types are present. In both LSIL and ASCUS classifications, the ability to identify whether HPV DNA integration has occurred likely will provide the clinician with additional, useful information, specifically as to whether the earliest events linked to development of cancer, viral DNA integration, has occurred.

[0117] Determining the presence or absence of integrated viral DNA in patient samples can also be used in epidemiological studies, such as, e.g., to determine correlations of particular viral integration events with development of a viral associated disease or disorder.

[0118] Further, the detection of integrated viral DNA may be used, e.g., for determining and assessing correlations of clinical treatment and outcome with viral integration. For example, the detection of integrated viral DNA may be used after the completion of a clinical trial to elucidate differences in response to a given treatment for a disease or disorder associated with viral infection, hi some embodiments, the methods described herein are used to identify subsets of patients with respect to integration or non-integration of viral DNA and who have high or low response to treatment. Such information regarding response to treatment can be used in many aspects of the development of treatments (e.g., the design of new trials, patient targeting, and the like).

IX. Other Embodiments of the Method

[0119] As noted above, the present methods for detecting integrated target DNA are useful with respect to any foreign DNA for which a determination of integration into a host cell chromosome is desired. For example, the introduction of foreign DNA into host cells, with the aim of expressing a foreign gene, is a goal of gene therapy and transgenic experiments and methods. Among the general methods that have been described for accomplishing this are, e.g., transfection of naked DNA and infection with a recombinant virus, engineered to contain the foreign gene of interest. Extension of the methods described herein to detection of such foreign target DNAs in cells allows a determination of whether a foreign gene has become integrated into the host genome or remains unintegrated.

[0120] For example, transfection of naked DNA, such as plasmids, is accomplished by use of, e.g., cationic lipid-mediated transfer methods, gene gun, or electroporation. The size of foreign DNA introduced can be quite large (e.g. , up to about 150 kb reported by electroporation). The majority of transfected DNA molecules introduced into cells do not integrate, but exist as episomes in the cytoplasm and nucleus of the host cell. As a result of DNA repair mechanisms, however, low levels of transgene integration into the host genome does occur, giving rise to stable transfectants. In typical transfection experiments, negative selection is used to select for cells containing integrated transgenes. In vivo, this cannot be accomplished. Since transgene integration is random, deleterious effects can arise if transgene integration occurs in vital regions of the genome.

[0121] Viral vectors are another means of introducing foreign genes into host cells. Typical viral vectors include, for example, adenovirus, lentivirus (retrovirus), adeno- associated virus (parvovirus), and herpes virus. Other viral vectors include, e.g., Epstein-Barr virus constructs, SV-40 (papovavirus), and papillomavirus. Adeno-associated virus (AAV) and the lentivirus vectors are specifically used due to their ability to integrate.

[0122] Accordingly, in other embodiments of the method, the integration of a recombinant vector (e.g., viral or plasmid DNA vector) or fragment thereof is assessed using the method of detecting an integrated target DNA as described herein. In specific embodiments, cell samples to be tested are isolated from a subject to which a recombinant vector has been administered. In typical variations, cell samples are analyzed by FISH or PCR before and after extraction, targeting either the recombinant vector, or a foreign gene that has been inserted into the vector, for detection. The detection of an integrated recombinant vector (e.g., a vector comprising a transgene) is useful, for example, for monitoring the integration of a gene therapy vector or a fragment thereof in a subject. For naked DNA transfection, the method is typically useful to confirm absence of integration. For viral mediated gene transfer, the method is useful, e.g., to confirm presence of a transgene, as well as to determine how efficient and wide-spread transgene delivery is (i.e., how many cells have the transgene). Such determinations are further useful for correlating efficacy or toxicity data with integration or non-integration of a gene therapy vector or fragment thereof.

X. Kits for Performing Methods

[0123] Also provided are kits for utilizing the methods and reagents of the present invention to detect integrated target DNA in cells. Typically, the kit is compartmentalized for ease of use and contains at least one first container providing a probe or primer specific for a target DNA, as described herein (e.g., probe or primer specific for a viral DNA or a recombinant vector such as, for example, a vector comprising a transgene). Containers providing reagents for detecting integrated target DNA, such as detergent and extracting salt solutions (e.g., chaotropic and/or kosmotropic salt solutions), can also be included in the kit. Additional containers can include any reagents or other elements recognized by the skilled artisan for use in DNA detection assays. Kits can also include substrates for cell analysis such as glass slides or glass coverslips. Kits can also contain reagents for performing detection reactions. For example, kits can contain reagents for performing FISH. Alternatively, kits can contain reagents for amplification-based target DNA detection such as polymerization agents (e.g., DNA polymerase such as, for example, the Klenow fragment), buffers, labeled or unlabeled free nucleotides. Instructions for performing an integrated target DNA detection method as described herein can also be included in the kit.

[0124] In variations in which the target DNA is a viral DNA, kits for detection of the target nucleic acid are useful for, e.g., diagnosis of a disease or disorder associated with a particular virus. For example, the viral DNA can be human papilloma virus, human immunodeficiency virus, Epstein-Barr virus, and other viruses.

[0125] As can be appreciated from the disclosure above, the present invention has a wide variety of applications. Accordingly, the following examples are offered by way of illustration, not by way of limitation. All references cited herein are incorporated by reference in their entirety for all purposes.

EXAMPLE 1

Materials and Methods

[0126] Reagents: Unless otherwise noted, all chemicals and reagents were from Sigma- Aldrich Chemical, St. Louis, MO.

[0127] Cells and Cell Culture Conditions: Human Papillomavirus (HPV)-positive cervical cancer cell lines CaSki, SiHa, and Wl 2 were obtained from collaborators or from American Type Culture Collection (ATCC, Rockville, MD) and cultured appropriately. CaSki and SiHa contain approximately 600 and ~2-5 copies of integrated HPV- 16 respectively {see Baker et al., J. Virol. 61:962-971, 1987; Meissner, J Gen. Virol. 80:1725-1733, 1999). The W12 line contains approximately 100 copies of HPV- 16 DNA, primarily episomal (Stanley et ah, Int. J. Cancer 43:672-676, 1989). The human RL cell line was used as an HPV-negative control. A summary of cell lines used is in Table 2.

[0128] In Situ Nuclear Fractionation: Cervical cancer cells grown on glass coverslips were detergent permeabilized in CSK buffer (100 mM NaCl, 300 mM sucrose, 10 mM pipes pH 6.8, 3 mM MgCl₂, 1 mM EGTA, containing 0.5% Triton X-100) for 20 minutes at 4°C (Fey et al., J. Cell Biol. 102:1654-1665, 1986). Nuclear fractionation extraction was then performed by incubating cells in CSK buffer containing different concentrations of (NH₄)₂SO₄, (50 mM to 0.65M) on ice for 20-60 minutes (Ma et al, J. Cell Biol. 146:531-542, 1999). Alternately, cells were simultaneously permeabilized and extracted by preparing a CSK solution containing detergent and ammonium sulfate. Following extraction, cells were washed in PBS, fixed using 4% paraformaldehyde in Ix PBS For 10 min, then stored in 70% ethanol at 4⁰C until used.

Table 2. Description of Cell Lines Used

[0129] DNA Probes and Probe Labeling: In situ hybridization detection of HPV-16 DNA was performed using a plasmid DNA construct containing a 6 kb HPV-16 insert covering the E6 to Ll gene regions. As an internal hybridization control, a plasmid DNA clone containing a 5.8 kb insert recognizing the U2 small nuclear RNA gene cluster on chromosome 17 was used (Van Arsdell and Weiner, MoI. Cell Biol. 4:492-499, 1984). Probes were labeled with biotin, dinitrophenol, or digoxigenin-labeled nucleotides (Perkin Elmer Life Sciences, Boston, MA or Roche Biochemicals, Indianapolis, IN) using nick translation (BioNick Kit, Life Technologies, Gaithersburg, MD) according to manufacturers instructions.

[0130] Fluorescence In Situ Hybridization: Using published protocols (Johnson et ah, Meth. in Cell Biology, 35:73-99, 1991), fixed cells on coverslips were denatured in 70% formamide/2xSSC for 2 minutes at 7O⁰C, chilled in ice cold 70% ethanol, then dehydrated through graded ethanol and air dried. Differentially labeled hybridization probes (final concentrations 50 ng-100 ng/hybridization) were combined and denatured in 100% foπnamide at 95⁰C for 10 min, rapidly chilled on ice, then added to an equal volume of 2x hybridization buffer (4x SSC/20% dextran sulfate/2% bovine serum albumin). The hybridization solution was pipetted onto Parafilm™, and the denatured coverslips placed face-down onto the probe solution. After overnight hybridization at 37⁰C, slides were washed in 2x SSC at 37⁰C for 10 minutes, then in 2xSSC/50% foπnamide, Ix SSC, 0.2x SSC and O.lx SSC at 37⁰C for 10 minutes.

[0131] Hybridization Probe Detection: Following post-hybridization washing, labeled probes were detected using one of two methods. The first method was conventional fluorescence detection using labeled conjugates. Depending on target selection, Cy-2 or Cy-3 conjugated streptavidin (Jackson ImmunoResearch, West Grove, PA), fluorescein or cyanine- 3 anti-dinitrophenyl antibody, or fluorescein labeled anti-digoxigenin (Roche) were used, typically at 1 :250 to 1 : 1000 dilutions in blocking buffer. Detection also was performed using the Tyramide Signal Amplification System (TSA™; Perkin Elmer Life Sciences) using published modifications (Bobrow and Moen, In Current Protocols In Cytometry (J.P. Robinson et al. eds., John Wiley & Sons, New York, NY., 2000), pp. 8.9.1-8.9.16).

[0132] Immunohistochemistrγ Staining of Nuclear Antigens: Cells grown on glass coverslips were simultaneously incubated with a human anti-centromere protein autoimmune sera (Earnshaw and Rothfield, supra; Sigma), and a mouse monoclonal anti-SC-35 spliceosome antibody (Fu and Maniatis, supra; Sigma) for 1 hour at 37°C. After washing, bound antibody was detected using fluorescein conjugated anti-human (green) and Cy-3 conjugated anti-mouse (red) antibodies for 30 min at 37°C. Samples were washed and analyzed using fluorescence microscopy as described.

[0133] Fluorescence Microscopy and Image Acquisition: Samples were mounted on microscope slides using a phenylenediamine anti-fade solution (Johnson et al. , supra). Fluorescence microscopy analysis and digital image capture was performed using a Nikon Eclipse microscope (Carl Zeiss, Inc., Thornwood, NY) equipped with a cooled CCD camera (Photometries Ltd., Tucson, AZ). Images were captured using IP Lab Spectrum software (Scanalytics, Inc., Fairfax, VA). Final images were composed using Photoshop™ software (Adobe Systems Inc., San Jose, CA).

[0134] Solution-Based Extraction: Cells in suspension were also extracted using conditions described above. To insure that any changes in amount of viral DNA present after treatment was due to extraction conditions, equal aliquots of cells were used as control and test samples. After treatment, cells were pelleted and total viral and genomic DNA isolated using the DNeasy Tissue kit (Qiagen Inc., Valencia, CA) according to manufacturers instructions. Purified DNA was resuspended in elution buffer (Qiagen). For PCR amplification (described below), appropriate dilutions were derived from DNA levels present in non-extracted control cells, and applied to test samples. For dissimilar target DNA levels {see Table 2), separate amplification reactions on different total DNA dilutions were performed then combined for electrophoresis.

[0135] Polymerase Chain Reaction Amplification of Viral and Cellular Sequences: PCR amplification of HPV- 16 DNA and the cellular XIST gene was performed using primers which generate a 591 bp HPV- 16 amplicon (P. Chatis, personal communication) and a 924 bp Xist exon 1 amplicon (Genbank Accession M97168), from the X-linked XIST gene. Synthetic primers were obtained either from Oligos Etc., Bethel, ME or Biosource International, Foster City, CA. Primer sequences, shown in Table 3. were as follows:

Table 3. PCR Primers for Amplification of HPV-16 DNA

HPV-16 E6 Forward 5'-GCAAGCAACAGTTACTGCGACGT

HPV- 16 E7 Reverse 5 ' - ACGAATGTCTACGTGTGTGCTTTGTAC

XISTExon 1 Forward 5'-GCTGCAGCCATATTTCTTACTCTCTCGG

XIST Exon 1 Reverse 5'-CGAGTTATGCGGCAAGTCTAAATGGCG [0136] PCR amplification was performed using the Elongase™ Enzyme Mix (Life Technologies) according to manufacturers instructions. 35 amplification cycles were performed using the following parameters: 94°C 30 sec; 64⁰C 30 sec, ramping to 68⁰C at a rate of 0.17sec; 68°C 5 min. PCR reactions were analyzed by l%-2% agarose gel electrophoresis, and DNA bands visualized using GelStar™ stain (BMA, Rockland, ME). The amount of DNA amplified was adjusted to correspond to 100 copies of DNA target (see Table 2), unless otherwise described.

Results

[0137] In Situ Hybridization of HPV Infected Cells: Assessing the efficiency of extracting viral episomal DNA using in situ hybridization (ISH) was performed by comparing differences in the hybridization signal patterns in salt-extracted and non-extracted cells. Using the SiHa and CaSki cell lines described above, both containing only integrated HPV- 16 DNA, and W12, containing predominantly episomal HPV-16 DNA), HPV DNA signal patterns were examined in non-extracted cells using fluorescence in situ hybridization

(FISH). Several publications describe discrete dot-like hybridization signals for integrated viral DNAs in SiHa and CaSki cells (see Adler et al, Cell Biol. 108:321-324, 1997; Kerstens et al, J. Histochem. Cytochem. 48:709-718, 2000; Lizard et al, Cytometry 34:180-186, 1998; J. Virol Methods 72:15-25, 1998; Unger et al., J. Histochem. Cytochem. 46:535-540, 1998). Using two-color FISH with differentially labeled probes to HPV-16 DNA and to the cellular U2 small nuclear RNA gene cluster (U2 DNA), used as a hybridization control, two discrete HPV-16 DNA hybridization foci (Figure IA) and two U2 DNA signals (Figure IB) were seen in SiHa cells. In CaSki cells, multiple discrete HPV-16 DNA signals were seen. The hybridization patterns for both cell lines are in agreement with published results (for example, Moen et al, Hum. MoI Gen. 4 Review:1779-1789, 1995; Adler et al, supra). In W12 cells, the HPV-16 DNA probe hybridization pattern showed multiple signals and diffuse staining throughout the nucleus (Figure 1C). U2 DNA was visualized as two discrete hybridization foci, confirming successful hybridization to Wl 2 cells. (Figure ID).

[0138] Determination of Initial and Optimal Ammonium Sulfate Extraction Conditions: In vitro studies show that episomal HPV DNA is localized and retained in the nucleus by a combination of viral and host cell protein-protein and protein-nucleic acid interactions (Lehman and Botchan, supra; Skiadopoulos and McBride, supra; Tan et al, supra). To initially determine effective ammonium sulfate concentrations sufficient for extraction, immunohistochemical detection of two different nuclear proteins after extraction using a range of ammonium sulfate concentrations was used (Fig. 2).

[0139] Ammonium sulfate concentrations ranging from 50 mM to 650 mM were evaluated for effectiveness in dissociating two distinct classes of nuclear antigens, the spliceosome associated SC-35 protein, and the centromeric binding proteins. The SC-35 protein is reportedly localized in the nucleus by protein-protein, and possibly protein-RNA interactions (Fu and Maniatis, supra), whereas the centromere binding proteins are covalently attached to chromosome centromeric DNA sequences (Earnshaw and Rothfield, supra).

[0140] CaSki and W12 cells grown on glass coverslips were Triton X-100 detergent permeabilized as describe above, then extracted using ammonium sulfate concentrations ranging from 5OmM to 650 mM. Cells were then fixed in paraformaldehyde as described, and SC-35 and centromere binding nuclear proteins detected using immunohistochemical methods. Control cells were treated identically, absent ammonium sulfate treatment. In non- extracted CaSki (A, C) and Wl 2 (B, D) cells, centromere proteins (A, B) form prominent punctate signal, consistent with detection of chromosomal centromeres. Staining for SC-35 spliceosome protein results in a defined "speckled" pattern, consistent with detection of nuclear splicing factor domains (C, D). Following salt extraction using from 100 mM to 150 mM ammonium sulfate, SC-35 signal in both cell lines is partially reduced, with no noticeable change in centromere proteins (not shown). After extraction using 30OmM salt, centromere staining is essentially normal in both CaSki cells (E) and Wl 2 cells (F). In contrast, SC-35 signal was absent in both CaSki (G) and W12 cells (H). At (NH₄)₂SO₄ concentrations above 300 mM, the centromere proteins signal is seen to increasingly form aggregates, possibly indicating changes in chromatin conformation. The most effective ammonium sulfate concentration for extracting non-covalently attached nuclear proteins in W12 cells is in the range of 100 mM to 300 mM.

[0141] Removal ofEpisomal HPVDNA Using In Situ Nuclear Fractionation: An ammonium sulfate concentration between 10OmM and 30OmM was established as the effective range for removing non-covalently attached nuclear proteins from Wl 2 cells. To determine whether these conditions were appropriate for elution of episomal HPV DNA, in situ hybridization was used to assess both the efficiency of episomal DNA extraction and retention of cellular and integrated viral sequences. As described, the HPV- 16 DNA in situ hybridization pattern in non-extracted control cells showed diffuse hybridization signal only in the Wl 2 cell line containing episomal HPV.

[0142] The efficiency of episomal HPV-16 DNA elution from Wl 2 cells was assessed by comparing the HPV DNA in situ hybridization pattern in extracted cells to that seen in non- extracted control cells (Fig. 3). Simultaneous hybridization to cellular U2 DNA was performed and detected using differential fiuorochrome labeling as a hybridization control and to assay for non-specific loss of genomic sequences. W12 cells grown on glass coverslips either were directly fixed in paraformaldehyde (non-extracted control); detergent permeabilized and then fixed; or detergent permeabilized, extracted using ammonium sulfate concentrations ranging from 15OmM to 65OmM, and then fixed. After hybridization, bound digoxigenin-labeled HPV DNA probe was detected with fluorescein-conjugated anti- digoxigenin antibody and bound biotin-labeled U2 DNA probe detected using Cy3- conjugated streptavidin. In non-permeabilized, non-extracted cells (Fig. 3A) and detergent permeabilized cells (Fig. 3B), multiple punctate, and low intensity diffuse HPV- 16 signal was seen. The endogenous U2 DNA forms two distinct foci (inset; A, B). In Wl 2 cells extracted with 150 mM (NH₄)₂SO₄, only a single distinct punctate HPV- 16 hybridization signal is visible (C). No multiple low intensity diffuse HPV- 16 signals were observed, even after use of high sensitivity tyramide signal amplification. No change in signal morphology was noted for the control endogenous U2 DNA (C; inset). Essentially identical results were obtained following extraction using 300 mM (NH₄)₂SO₄ (D) and 200 mM (NH₄)₂SO₄.

[0143] Detection of Integrated Viral DNA in Extracted cells: Retention of integrated viral DNA is a component of successful application of the nuclear fractionation assay. Fluorescence in situ hybridization (FISH) was the primary method for verifying that both integrated viral and genomic DNA sequences remained in the extracted nucleus following ammonium sulfate treatment. Two cell lines, SiHa and CaSki, contain only integrated HPV- 16 DNA. Wl 2 cells contain predominantly episomal HPV- 16 DNA in addition to integrated HPV- 16 DNA (Fig. 3). Following extraction using ammonium sulfate concentrations ranging from 150 mM to 500 mM, cells were fixed in paraformaldehyde and hybridized using labeled HPV and U2 DNA probes as described above, hi SiHa cells containing low copy number integrated HPV-16 DNA (Fig. 3), no alteration to hybridization signal morphology was noted for HPV DNA (E) or the control endogenous U2 DNA (Inset; E) after extraction using 300 mM (NH₄)₂SO₄, indicating that salt extraction did not negatively impact cellular DNA. Signal morphology in extracted SiHa cells was identical to non-extracted cells (Fig. 1). Essentially identical results were obtained with the CaSki cell line, which contains approximately 600 copies of integrated HPV- 16 DNA at 14-16 distinct chromosomal sites (not shown). At salt concentrations above 300 mM, HPV DNA signals in CaSki cells were observed to become more punctate, and in both SiHa and CaSki cells, DAPI staining of total genomic DNA revealed released DNA surrounding the extracted cell, indicating that higher salt concentrations induce release of cellular DNA, potentially resulting in physical damage and loss of DNA.

[0144] PCR Analysis of DNA from Extracted Cells: In addition to in situ hybridization, polymerase chain reaction amplification of HPV DNA was used to assess extraction efficiency in control and extracted cells. PCR primer pairs which generate a 591 base pair (bp) HPV- 16 amplicon and a 924 bp amplicon from the cellular ZZiST gene were selected. Total DNA isolated from non-extracted control cells and from cells extracted using ammonium sulfate concentrations ranging from 5OmM to 20OmM was subjected to multiplex PCR amplification (Fig. 4). In SiHa cells (lane 1), bothZZSTand HPV-16 amplicon levels were similar following extraction using 100 mM (NH₄)₂SO₄. In non-extracted Wl 2 cells

(lane 2), HPV amplicon intensity was substantially higher than that of XIST, as expected from the increased HPV DNA copy number relative to XIST. Following 50 mM (NH₄)₂SO₄ extraction (lane 3), and 100 mM (NH₄)₂SO₄ extraction (lane 4), HPV amplicon level decreased to a range essentially identical to that of the ZZiST amplicon, indicating that target HPV DNA was reduced to a copy number suggestive of a low or single copy gene.

[0145] Retention of Cellular Genomic Sequences and Integrated Viral DNA: As discussed, methods for eluting episomal HVP DNA must not cause loss of integrated viral or cellular genomic DNA. Retention of these DNAs were evaluated using FISH detection of HPV and the cellular U2 DNA, as described above. Initially, SiHa and CaSki cells, containing only integrated HPV DNA, were extracted using ammonium sulfate concentrations ranging from 15OmM to 50OmM. Compared to non-extracted control cells, essentially normal hybridization patterns were seen after salt extraction at concentrations up to 300 mM (Fig. 3E). At higher concentrations, staining of total genomic DNA with DAPI revealed a chromatin "halo" surrounding the extracted cell, indicative of chromatin release from the nucleus (Gerdes et al, J. Cell Biol. 126:289-304, 1994). In CaSki cells, HPV DNA hybridization signals were more numerous and punctate, suggesting loss of integrity of the integrated viral DNA. In Wl 2 cells, a prominent HPV hybridization signal was consistently observed in nuclei before and after extraction (Fig. 3 A-D), even following conditions which removed episomal viral DNA. The morphology of the residual punctate HPV signal resembled that exhibited by low copy integrated DNA in SiHa cells. Furthermore, results suggesting that a minor fraction of HPV DNA in the Wl 2 cell line was integrated have been described (Stanley et al, supra). To ascertain whether the W12 cell line contained integrated HPV DNA, FISH analysis of metaphase chromosome preparations was performed. Results show the presence of integrated HPV on an unidentified acrocentric chromosome. Two distinct HPV signals localize to the chromatid pair of a single chromosome, a pattern diagnostic of a chromosomally localized target DNA (Fig. 3F). Although poor chromosomal banding and morphology prevented identification of the integrant acrocentric chromosome, the presence of U2 DNA signal on two additional chromosomes excluded chromosome 17. Together, these results show that ammonium sulfate concentrations from 15OmM to 20OmM, a range that effectively elutes episomal HPV DNA from W12 cells, does not result in the loss of either integrated HPV DNA or endogenous cellular genes. Visible release of chromatin initially is readily seen at concentrations in excess of 40OmM.

EXAMPLE 2

[0146] Clinical Specimens: Cervical brush biopsy specimens from patients are suspended in PBS solution, as described for model cell lines in Example 1, supra. Samples are preferably obtained using a cervical brush.

[0147] Nuclear Fractionation: Cell samples are resuspended in PBS, a concentrated solution containing (NH₄)₂SO₄ and components of the cytoskeletal (CSK) permeabilization buffer are added to achieve appropriate final concentrations ((NH₄)₂SO₄: 50 mM to 300 mM; 100 mM NaCl, 300 mM sucrose, 10 mM pipes pH 6.8, 3 mM MgCl₂, 1 mM EGTA, 1.0% Triton X-100; adapted from Fey et al., supra; Ma et al., supra). Extraction is performed at 4⁰C for 20 min to 1 hour. Cells are fixed in 4% paraformaldehyde, washed in PBS and stored at 4°C until analyzed.

[0148] Cytocentrifugation of Cells for In situ Analysis: Aliquots of matched extracted and non-extracted control cells and patient samples are cytocentrifuged onto coated glass slides at 10Ox g using a CytoSpin cytological centrifuge (ThermoShandon, Pittsburgh, PA). The slides are immersed in 4% paraformaldehyde in PBS for 10 min at room temperature to fix the cell sample, washed in PBS, then stored in 70% ethanol at 4°C until used. (Alternatively, non-treated cells can first be cytocentrifuged as described, then subjected to detergent permeabilization and salt extraction after being cytocentrifuged.) [0149] Immunohistochemistry Staining of Nuclear Antigens for Controls Cells from patient samples are incubated simultaneously with a human autoimmune sera reactive against centromeric proteins (Earnshaw and Rothfield, supra; Sigma), and a mouse monoclonal anti- SC-35 spliceosome antibody (Fu and Maniatis, supra; Sigma) for 1 hour at 37⁰C. After washing, bound antibody is detected using fluorescein conjugated anti-human and Cy-3 conjugated anti-mouse antibodies for 30 min at 37⁰C. After washing, samples are analyzed using fluorescence microscopy.

[0150] DNA Probes and Probe Labeling: Commercially available biotin-labeled probes capable of detecting multiple HPV type DNA (BioPap), and HPV Typing probes specific for types 6/11, 16/18, and 31/33/35, have been used (Enzo Biochem Inc., Long Island, NY).

Table 4. PCR Primers

FAP 59 and 64 are degenerate sequence primers; W=(T, C); I=inosine; Y=(C, T); V=(A, C, G); H=(A, C, T).

[0151] Primers can be custom synthesized (BioSource Inc., Foster City, CA). HPV-16 E6/E7 specific primer sequences were supplied by Dr. Pamela Chatis (Perkin Elmer Life Sciences, Inc., Boston MA and Infectious Disease Division, Beth Israel Deaconess Medical Center, Boston MA). The HPV-16 E2, HPV-18, ZEST and FAP 59/64 sequences are from literature sources or Genbank (HPV 16/18, Park et al, 1997; XIST, Genbank accession M97168; FAP 59/64, Forslund et al, J. Gen. Virol. 80:2437-2443, 1999). Amplification can be performed using the Elongase™ Enzyme Mix (Life Technologies, Gaithersburg, MD) according to manufacturers instructions. 35 amplification cycles, for example, can be performed using the following parameters: 94°C 30 sec; 64°C 30 sec, ramping to 68°C at a rate of 0.1°C/sec; 68°C 5 min. Amplification using the degenerate primers can be performed using published conditions (Forslund et al., supra). Aliquots of PCR reactions are analyzed by l%-2% agarose gel electrophoresis, and DNA bands visualized using GelStar™ stain (BMA, Rockland, ME).

[0152] Fluorescence In Situ Hybridization: Fixed cells are hydrated in 2x SSC (Ix=I 50 rnM NaCl, 15 mM Na-citrate, pH 7.0) and then denatured in 75% formamide/2xSSC for 3 minutes at 70⁰C. Denatured cells are rapidly chilled in ice cold 70% ethanol, then dehydrated through graded ethanol and air dried. Labeled hybridization probe is denatured at 95°C for 10 min, then rapidly chilled on ice. Aliquots of the denatured probe are then pipetted onto the cells. Following overnight hybridization at 37°C, slides are washed in 2x SSC at 37⁰C for 10 minutes, then in 2xSSC/50% formamide, Ix SSC₅ 0.2x SSC and O.lx SSC at 37°C for 10 minutes (adapted from Johnson et al., supra).

[0153] Hybridization Probe Detection: Catalyzed reporter deposition (Tyramide Signal Amplification System (TSA™); Molecular Probes Inc.)) using Alexa 568 or Alexa 488- conjugated tyramide molecules was used for detection of HPV DNA (Bobrow and Moen, 2000). Horseradish peroxidase conjugated streptavidin diluted 1 :100 in 4xSSC/0.5% casein solution was used to bind to the hybridized biotinylated probe. Following washing in 4xSSC/0/05% Triton X-100, tyramide deposition was performed using labeled tyramide diluted 1 : 100 in amplification diluent (Molecular Probes Inc.) for 15 min at room temperature. Unreacted tyramide was removed by washing as above. Total DNA was counterstained using DAPI, and coverslips mounted on the slides using antifade compound.

[0154] Viral DNA Extraction for PCR Analysis: Total viral and genomic DNA from known amounts of extracted cells, or of matched control non-extracted cells can be isolated using the DNeasy Tissue kit (Qiagen Inc., Valencia, CA) according to manufacturers instructions. For high-throughput analysis, DNA can be purified using the QIAamp 96-well purfication kit (Qiagen), according to manufacturers instructions. To correlate changes in target DNA copy number with extraction conditions, equal aliquots of control and test samples are used. For clonal cell line controls, amount of isolated DNA used for amplification is adjusted to correspond to the copy number present in the non-extracted control; and, when necessary, purified DNA concentration is adjusted to compensate for differences in amplification target copy number. For clinical samples, amount of DNA amplified is determined empirically.

[0155] PCR Genotyping of HPV DNA : Since HPV type may not be known for detection of integrated viral DNA in clinical samples, degenerate sequence primers which amplify approximately 85% of the different HPV types tested are used, as described in Forslund et al., supra. In addition to using HPV- 16 and HPV- 18 specific primers to both confirm presence of HPV and to identify samples containing type 16 and 18, PCR using these degenerate primers (designated FAP 59 and 64) can be performed. Amplification of the XIST gene exon 1 serves as a PCR and cell copy number control. Primer sequences and amplicon size are listed in Table 4.

[0156] Quantitative Analysis of Extraction: Amount of amplicon formed during PCR amplification can be assessed, for example, by densitometric analysis of DNA bands. Photographs of gel images can be digitally scanned, and images imported into NIH Image software (current version 1.62) for DNA band intensity measurement using the Gel Densitometry function of the software. Gel band peak height can be used as the measured variable. Alternately, densitometry can be performed using the Kodak ImageStation 440CF imaging system and software (Eastman Kodak Co., Rochester, NY).

[0157] Fluorescence Microscopy and Image Acquisition: Samples can be coversliped using a phenylenediamine anti-fade solution (Johnson et al, supra). Fluorescence microscopy analysis and digital image capture will be performed using a Nikon Eclipse microscope (Nikon Instruments, Melville, NY) equipped with a cooled CCD camera (Photometries Ltd., Tucson, AZ). Images will be captured using IP Lab Spectrum software (Scanalytics, Inc., Fairfax, VA), and final images composed using Photoshop™ software (Adobe Systems Inc., San Jose, CA).

[0158] Filter-based Separation of Viral Episomal DNA: Aliquots of matched, paraformaldehyde-fixed extracted and non-extracted patient samples are applied to 2 μM pore polycarbonate filters using a syringe filter holder (Millipore Corp., Bedford, MA) and application of positive or negative pressure using a syringe. The filter-bound cells can be transferred to coated glass slides (ThermoShandon) by placing the filter, cell side down, onto the slide and uniformly applying gentle pressure. Cells can be fixed in 4% paraformaldehyde, washed in PBS for 10 minutes at room temperature then stored in 70% ethanol at 4⁰C until processed for in situ hybridization. EXAMPLE 3

[0159] Clinical Specimens: Cervical brash biopsy specimens from patients were suspended in PBS solution, as described for model cell lines in Example 1, supra.

[0160] Nuclear Fractionation: Cell samples were resuspended in PBS, a concentrated solution containing (NH₄)₂SO₄ and components of the cytoskeletal (CSK) permeabilization buffer were added to achieve appropriate final concentrations ((NEU)₂SO₄: 50 mM to 300 mM; 100 mM NaCl, 300 mM sucrose, 10 mM pipes pH 6.8, 3 mM MgCl₂, 1 mM EGTA, 0.5% Triton X-100; adapted from Fey et al, supra; Ma et al, supra). Extraction was performed at 4°C for 20 min to 1 hour. Cells were fixed in 4% paraformaldehyde, washed in PBS, and stored at 4⁰C until analyzed.

[0161] Cytocentrifugation of Cells for hi ήta Analysis: Aliquots of matched extracted and non-extracted control cells and patient samples were cytocentrifuged onto coated glass slides at 10Ox g using a CytoSpin cytological centrifuge (ThermoShandon, Pittsburgh, PA). The slides were immersed in 4% paraformaldehyde in PBS for 10 min at room temperature to fix the cell sample, washed in PBS, then stored in 70% ethanol at 4°C until used. (Alternatively, non-treated cells can first be cytocentrifuged as described, then subjected to detergent permeabilization and salt extraction after being cytocentrifuged.)

[0162] Cytocentrifugation of Cells for In ύta Analysis: Aliquots of cells from patient samples were cytocentrifuged onto coated glass slides at 10Ox g using a CytoSpin cytological centrifuge (ThermoShandon, Pittsburgh, PA). The slides were immersed in the extraction buffer containing (NH₄)₂SO₄ and components of the cytoskeletal (CSK) permeabilization buffer at appropriate final concentrations ((NH₄)₂SO₄: 50 mM to 300 mM; 100 mM NaCl, 300 mM sucrose, 10 mM pipes pH 6.8, 3 mM MgCl₂, 1 mM EGTA, 0.5% Triton X-100; adapted from Fey et al, supra; Ma et al, supra). Extraction was performed at 4⁰C for 20 min to 1 hour. Cells were fixed in 4% paraformaldehyde, washed in PBS and stored at 4°C until analyzed.

[0163] DNA Probes and Probe Labeling: Commercially available biotin-labeled probes capable of detecting multiple HPV type DNA (BioPap), and HPV Typing probes specific for types 6/11, 16/18, and 31/33/35, were used (Enzo Biochem Inc., Long Island, NY).

[0164] Fluorescence In Situ Hybridization : Fixed cells were hydrated in 2x S S C ( 1 x= 150 mM NaCl, 15 mM Na-citrate, pH 7.0) and then denatured in 75% formamide/2xSSC for 3 minutes at 70⁰C. Denatured cells were rapidly chilled in ice cold 70% ethanol, then dehydrated through graded ethanol and air dried. Labeled hybridization probe was denatured at 95°C for 10 min, then rapidly chilled on ice. Aliquots of the denatured probe were then pipetted onto the cells. Following overnight hybridization at 37°C, slides were washed in 2x SSC at 37°C for 10 minutes, then in 2xSSC/50% formamide, Ix SSC, 0.2x SSC and 0. Ix SSC at 37°C for 10 minutes (adapted from Johnson et al, supra).

[0165] Hybridization Probe Detection: Catalyzed reporter deposition (Tyramide Signal Amplification System (TS A™); Molecular Probes Inc.)) using Alexa 568 or Alexa 488- conjugated tyramide molecules was used for detection of HPV DNA (Bobrow and Moen, 2000). Horseradish peroxidase conjugated streptavidin diluted 1 : 100 in 4xSSC/0.5% casein solution was used to bind to the hybridized biotinylated probe. Following washing in 4xSSC/0/05% Triton X-100, tyramide deposition was performed using labeled tyramide diluted 1 : 100 in amplification diluent (Molecular Probes Inc.) for 15 min at room temperature. Unreacted tyramide was removed by washing as above. Total DNA was counterstained using DAPI, and coverslips mounted on the slides using antifade compound.

[0166] Fluorescence Microscopy and Image Acquisition: Samples were coverslipped using a phenylenediamine anti-fade solution (Johnson et ah, supra). Fluorescence microscopy analysis and digital image capture were performed using a Nikon Eclipse microscope (Nikon Instruments, Melville, NY) equipped with a cooled CCD camera (Photometries Ltd., Tucson, AZ). Images were captured using IP Lab Spectrum software (Scanalytics, Inc., Fairfax, VA), and final images composed using Photoshop™ software (Adobe Systems Inc., San Jose, CA).

Results

[0167] In Situ Hybridization to Non-Extracted Exfoliated Cervical Cells: To determine the HPV DNA hybridization pattern in non-salt extracted patient cells, samples from women previously diagnosed with various stages of cellular atypia, and/or confirmed HPV DNA- positive by commercial DNA hybrid capture detection methods were analyzed using fluorescence in situ hybridization with a commercially available HPV DNA probe cocktail. Based on previous published data, it is not expected that all cells analyzed will contain HPV DNA (see, e.g., Kenny et al, J. Histochem. Cytochem., 50:1219-1227, 2002). In Figure 6, representative HPV-infected cells are shown. A diffuse HPV DNA hybridization signal was seen in non-salt extracted cells, which overlaps the cell nucleus (A). A majority of cells examined in the field contained no detectable HPV DNA hybridization signal. As a control, exfoliated cervical cells obtained from women with no reported cervical cytological abnormalities, and/or confirmed HPV DNA negative by commercial DNA hybrid capture detection methods were similarly analyzed. No cells were observed to contain diffuse nuclear HPV DNA hybridization signal.

[0168] In Situ Hybridization to Salt Extracted Exfoliated Cervical Cells: To determine the HPV DNA hybridization pattern in salt-extracted patient cells, aliquots from the same samples described above were cytocentrifuged onto glass slides and treated by salt extraction using 100 mM ammonium sulfate, as previously described. Samples were paraformadehyde fixed, and hybridized using the same commercial HPV DNA probe preparation described. A subset of cells were observed that contain a markedly punctate HPV DNA hybridization signal. A representative cell was shown to contain a punctate HPV DNA hybridization signal that localized to the cell nucleus (B). The punctate hybridization pattern in consistent with that expected for detection of integrated HPV DNA. A majority of cells examined in the field contained no detectable HPV DNA hybridization signal. As a control, exfoliated cervical cells, obtained from women with no reported cervical cytological abnormalities and/or confirmed HPV DNA negative by commercial DNA hybrid capture detection methods, were similarly analyzed. No cells were observed to contain either diffuse or punctate nuclear HPV DNA hybridization signal.

[0169] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A method for determining integration of a target DNA in a cell, comprising: (a) permeabilizing a cell from a sample to be tested;

(b) treating the permeabilized cell with an extracting salt solution , wherein non-integrated target DNA, if present, is released from the cell into the salt solution but chromosomal DNA, with integrated target DNA, if present, is retained in the cell;

(c) separating the salt-extracted cell from the salt solution; and (d) determining the presence or absence of the target DNA in the salt-extracted cell, whereby the presence of the target DNA indicates the presence of integrated target DNA.

2. The method of claim 1, wherein the ionic strength of the salt solution corresponds to that of a monovalent salt solution of about 150 mM to about 900 mM.

3. The method of claim 1 , wherein the cell is permeabilized with a detergent.

4. The method of claim 3, wherein the detergent is a non-ionic detergent.

5. The method of claim 4, wherein the non-ionic detergent is selected from the group consisting of BIGCHAP, Deoxy-BIGCHAP, digitonin, a polyoxyethylene ester, a polyoxyethylene ether, a polyoxyethylenesorbitan ester, a sorbitan ester, Tergitol, Triton X-100, Triton X-114, and Tyloxapol.

6. The method of claim 5, wherein the detergent is Triton X-100.

7. The method of claim 3, wherein the detergent is a zwitterionic detergent.

8. The method of claim 7, wherein the zwitterionic detergent is selected from the group consisting of CHAPS, CHAPSO, phospatidylcholine, and 1 -propane sulfonate.

9. The method of claim 3, wherein the cell is treated with the detergent in a solution having a pH of 6.3 to 7.4.

10. The method of claim 9, wherein the pH of the solution is 6.8.

11. The method of claim 1 , wherein the cell is permeabilized with a non- detergent sulfobetaine.

12. The method of claim 1 , wherein the cell is permeabilized with a bile acid salt.

13. The method of claim 12, wherein the bile acid salt is sodium deoxycholate.

14. The method of claim 1 , wherein the extracting salt solution comprises a salt selected from the group consisting of ammonium sulfate, sodium chloride, and lithium iodosalicylate.

15. The method of claim 1 , wherein the extracting salt solution comprises a kosmotropic salt.

16. The method of claim 15, wherein the kosmotropic salt is ammonium sulfate.

17. The method of claim 16, wherein the concentration of ammonium sulfate in the kosmotropic salt solution is about 50 mM to about 300 mM.

18. The method of claim 1 , wherein the separating step comprises filtering the salt-extracted cell through a filter membrane.

19. The method of claim 18, wherein the filter membrane is a 2 μm hydrophobic polycarbonate filter.

20. The method of claim 1 , wherein determining the presence or absence of the target DNA in the salt-extracted cell comprises:

(i) contacting DNA from the salt-extracted cell with a labeled nucleic acid probe that specifically hybridizes to the target DNA under stringent hybridization conditions, whereby the nucleic acid probe hybridizes to the target DNA, if present; (ii) removing unbound labeled nucleic acid probe; and (iii) detecting the presence or absence of label bound to the DNA from the salt-extracted cell.

21. The method of claim 20, wherein the separating step comprises filtering the salt-extracted cell through a filter membrane and transferring the cell to the surface of a glass substrate.

22. The method of claim 21, wherein the transferring step comprises depositing the salt-extracted cell onto the substrate by cytocentrifigation.

23. The method of claim 20, wherein determining the presence or absence of the target DNA in the salt-extracted cell comprises in situ hybridization.

24. The method of claim 23 , wherein the in situ hybridization is fluorescence in situ hybridization.

25. The method of claim 1 , wherein determining the presence or absence of the target DNA in the salt-extracted cell comprises: contacting DNA from the salt-extracted cell with primers specific for the target DNA under conditions suitable for amplification of the target DNA, whereby a target DNA amplicon is produced if the target DNA is present; and determining the presence or absence of the target DNA amplicon.

26. The method of claim 25, wherein determining the presence or absence of the target DNA amplicon comprises contacting the amplified DNA with a labeled nucleic acid probe that specifically hybridizes to the target DNA under stringent hybridization conditions, whereby the labeled nucleic acid probe hybridizes with the target DNA amplicon, if present; and determining presence or absence of labeled probe bound to the target DNA amplicon.

27. The method of claim 25, wherein the amplification of the target DNA comprises PCR.

28. The method of claim 27, wherein the PCR is quantitative PCR.

29. The method of claim 25, wherein the target DNA is a viral DNA.

30. The method of claim 25, wherein the primers are viral strain-specific.

31. The method of claim 25, wherein the primers are viral strain- independent.

32. The method of claim 31 , wherein the primers specifically hybridize to the strain-independent region of the viral DNA.

33. The method of claim 1 , further comprising

(e) permeabilizing a second cell from the sample to be tested;

(f) determining the presence or absence of target DNA in the second cell; and

(g) comparing a signal that is indicative of the presence of target DNA from step (d) to a signal that is indicative of the presence of target DNA from step (f).

34. The method of claim 1 , wherein determining the presence or absence of the target DNA in the salt-extracted cell comprises

(i) isolating DNA from the salt-extracted cell;

(ii) fragmenting the isolated DNA; (iii) hybridizing the fragmented DNA to target RNA immobilized onto a solid support, the target RNA corresponding to the integrated target DNA to be detected; and

(iv) detecting any RNA:DNA hybrids with an antibody that specifically recognizes RNA:DNA hybrids.

35. The method of claim 34, wherein the fragmenting is mechanical.

36. The method of claim 34, wherein the fragmenting is enzymatic.

37. The method of claim 1 , wherein the target DNA is viral DNA.

38. The method of claim 1 , wherein the viral DNA is human papillomavirus (HPV) DNA.

39. The method of claim 38, wherein the HPV is HPV-16.

40. The method of claim 39, wherein determining the presence or absence of HPV-16 comprises determining the presence or absence of the E6 to Ll region of HPV-16.

41. The method of claim 1 , wherein the target DNA is a recombinant vector.

42. The method of claim 41 , wherein the recombinant vector contains a transgene.

43. The method of claim 42, wherein the recombinant vector is a gene therapy vector.

44. The method of claim 43, wherein the gene therapy vector is a viral vector.

45. The method of claim 44, wherein the viral vector is an adeno- associated virus or a lentivirus vector.

46. The method of claim 41 , wherein the recombinant vector is a plasmid DNA vector.

47. The method of claim 1 , wherein at least one of steps (a) and (b) is performed while the cell is immobilized on a substrate.

48. The method of claim 47, wherein the substrate is a glass slide or coverslip.

49. The method of claim 1 , wherein the cell is of epithelial origin.

50. The method of claim 1 , wherein the biological sample is a tissue sample from a patient.

51. The method of claim 50, further comprising obtaining the tissue sample from the patient.

52. The method of claim 50, wherein the tissue sample is from a human patient.

53. The method of claim 52, wherein the target DNA is human papillomaviral (HPV) DNA and the tissue sample comprises cervical tissue.

54. The method of claim 53, wherein the obtaining step comprises performing a Pap smear.

55. The method of claim 53, wherein obtaining the tissue sample from the patient comprises performing a cervical brush sampling.

56. The method of claim 1 , wherein the biological sample is a population of cells from a stable cell line.

57. The method of claim 56, further comprising culturing the cell.

58. The method of claim 57, wherein the cultured cell adheres to a substrate.

59. The method of claim 58, wherein the substrate is a glass slide or cover slip.

60. The method of claim 57, wherein the cell is cultured in suspension.

61. The method of claim 37, wherein the target DNA is a viral DNA and the sample to be tested is known or suspected to be infected with a virus comprising the target DNA and having episomal and integrated phases in its life-cycle.

62. The method of claim 61 , wherein the virus having episomal and integrated phases in its life-cycle is a human papilloma virus.

63. The method of claim 1 , further comprising assessing the integrity of genomic DNA in the salt-extracted cell.

64. The method of claim 63, wherein the assessment of genomic DNA integrity comprises determining the presence or absence of DNA sequences from the 5 S ribosomal RNA gene cluster within a region outside the extracted cell nucleus.

65. A method for determining integration of a viral DNA in a cell, comprising: (a) permeabilizing a cell from a sample to be tested; (b) treating the permeabilized cell with an extracting salt solution, wherein episomal viral DNA, if present, is released from the cell into the salt solution but chromosomal DNA, with integrated viral DNA, if present, is retained in the cell;

(c) separating the salt-extracted cell from the salt solution; and (d) determining the presence or absence of the viral DNA in the salt-extracted cell, whereby the presence of the viral DNA indicates the presence of integrated viral DNA.

66. A method for determining integration of a human papillomavirus (HPV) DNA in a cell, comprising:

(a) permeabilizing a cell from a sample to be tested; (b) treating the permeabilized cell with an ammonium sulfate solution, wherein episomal HPV DNA, if present, is released from the cell into the ammonium sulfate solution but chromosomal DNA, with integrated HPV DNA, if present, is retained in the cell;

(c) separating the ammonium sulfate-extracted cell from the ammonium sulfate solution; and (d) determining the presence or absence of the HPV DNA in the ammonium sulfate-extracted cell, whereby the presence of the HPV DNA indicates the presence of integrated HPV DNA.

67. A method for monitoring integration of a gene therapy vector or a fragment thereof in a subject to which the gene therapy vector has been administered, said vector comprising a transgene, the method comprising:

(a) isolating a cell from the subject;

(b) permeabilizing the cell;

(c) treating the permeabilized cell with an extracting salt solution , wherein any non-integrated gene therapy vector or fragment thereof, if present, is released from the cell into the salt solution but chromosomal DNA, with an integrated gene therapy vector or fragment thereof, if present, is retained in the cell;

(d) separating the salt-extracted cell from the salt solution; and

(e) determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell, whereby the presence of the vector or fragment indicates the presence of the integrated gene therapy vector or integrated fragment thereof.

68. The method of claim 67, wherein the gene therapy vector is a viral vector.

69. The method of claim 68, wherein the gene therapy vector is an adeno- associated virus or lentivirus vector.

70. The method of claim 67, wherein the gene therapy vector is a plasmid DNA vector.

71. The method of claim 67, wherein determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell comprises determining the presence or absence of the transgene.

72. The method of claim 67, wherein determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell comprises: (i) contacting DNA from the salt-extracted cell with a labeled nucleic acid probe that specifically hybridizes to the gene therapy vector or fragment thereof under stringent hybridization conditions, whereby the nucleic acid probe hybridizes to the gene therapy vector or fragment thereof, if present;

(ii) removing unbound labeled nucleic acid probe; and (iii) detecting the presence or absence of label bound to the DNA from the salt-extracted cell.

73. The method of claim 72, wherein determining the presence or absence of the gene therapy vector or fragment thereof in the salt-extracted cell comprises in situ hybridization.

74. The method of claim 73 , wherein the in situ hybridization is fluorescence in situ hybridization.

75. The method of claim 72, wherein the probe is a transgene-specific probe.

76. A kit comprising: (a) at least a first probe or primer that specifically hybridizes to a target DNA under stringent hybridization conditions; and (b) at least one of

(i) a detergent for performing the permeabilization step; (b) an extracting salt solution; and (c) if the kit comprises a first primer, a second primer that specifically hybridizes to the target DNA, whereby a target DNA amplicon is produced when the first and second primers are contacted with the target DNA under conditions suitable for amplification of the target DNA.

77. The kit of claim 76, which comprises the detergent.

78. The kit of claim 77, wherein the detergent is a non-ionic detergent.

79. The kit of claim 78, wherein the non-ionic detergent is selected from the group consisting of BIGCHAP, Deoxy-BIGCHAP, digitonin, a polyoxyethylene ester, a polyoxyethylene ether, a polyoxyethylenesorbitan ester, a sorbitan ester, Tergitol, Triton X- 100, Triton X-114, and Tyloxapol.

80. The kit of claim 77, wherein the detergent is a zwitterionic detergent.

81. The kit of claim 80, wherein the zwitterionic detergent is selected from the group consisting of CHAPS, CHAPSO, phospatidylcholine, and 1 -propane sulfonate.

82. The kit of claim 76, which comprises the extracting salt solution.

83. The kit of claim 82, wherein the extracting salt solution comprises a salt selected from the group consisting of ammonium sulfate, sodium chloride, and lithium iodosalicylate.

84. The kit of claim 82, wherein the extracting salt solution comprises a kosmotropic salt.

85. The kit of claim 84, wherein the kosmotropic salt is ammonium sulfate.

86. The kit of claim 76, wherein the target DNA is a viral DNA.

87. The kit of claim 86, wherein the viral DNA is a human papilloma viral DNA.

88. The kit of claim 76, wherein the target DNA is a recombinant vector.

89. The kit of claim 88, wherein the recombinant vector is a viral vector.

90. The kit of claim 89, wherein the viral vector is an adeno-associated virus or lentivirus vector.

91. The kit of claim 88, wherein the recombinant vector is a plasmid DNA vector.