WO2006091233A2 - Cellular delivery of reagents that inhibit gene expression utilizing the anthrax toxin protective antigen (pa) - Google Patents

Abstract

The present invention is directed to a method for delivering oligonucleotides, particularly, peptide nucleic acids (PNAs) and short interfering RNA (siRNA), into cells utilizing the Anthrax toxin protective antigen (PA). The present application also provides a method for regulating gene expression in a living cell.

Description

CELLULAR DELIVERY OF REAGENTS THAT INHIBIT GENE EXPRESSION UTILIZING THE ANTHRAX TOXIN PROTECTIVE ANTIGEN (PA)

CROSS REFERENCE TO RELATED APPLICATIONS

[001] The present application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No.: 60/590,679, filed 23 July 2004, the contents of which are herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

[002] The present application provides methods for delivering oHogonucleotides, particularly, antigene and antisense oligonucleotides such as siRNA and peptide nucleic acids (PNAs), into cells utilizing the Anthrax toxin protective antigen (PA). The present application also provides a method for inhibiting target gene expression in a living cell.

BACKGROUND OF THE INVENTION

[003] Technological advances in molecular genetics and genomic sequencing have led to an expanding wealth of knowledge about the genetic basis of inherited and acquired diseases. This knowledge has resulted in efforts to develop molecular tools with which to modulate gene expression both to analyze the function of normal or mutant genes, such as functional genomics, and to develop genetically targeted therapies. Antisense oligonucleotides and siRNA have received particular attention in this regard. Antisense oligomers have been variously shown in cell-free experimental models and/or in in vitro cell cultures to induce the degradation of targeted gene transcripts or to block their translation (1-4), to influence the alternative splicing of pre-mRNA transcripts (2,5,6), and to block the reverse transcription of viral RNA (4,7). However, while the use of simple, single stranded antisense oligonucleotide reagents to modulate gene expression has been conceptually attractive, their application either as experimental tools or candidate therapeutics, has in general not proven to be robust or reliable (8) for a number of reasons. [004] First, native oligonucleotide constructs (other than double stranded siRNA) are unstable in a cellular environment because of their susceptibility to degradation by endogenous nucleases (1, 8, 11). Second, the ability of oligonucleotides to interact selectively with targeted mRNA sequences is not readily predictable because of constraints imposed by the secondary structure of targeted RNA transcripts (1,9). Third, non-specific interactions of oligonucleotides with intra- and extra-cellular proteins can cause artifacts of cellular toxicity or activation that are unrelated to intended selective effects on gene expression (10). Finally, effective delivery of these reagents into cells has been a serious barrier to their use in other than in vitro experimental settings. Certain charged oligonucleotide reagents have a limited capacity to transit cellular membranes at high concentrations (1,3). However, these reagents generally require the assistance of highly artificial transfection techniques, involving lipophilic carriers and/or physical disruption of the cell membrane, in order to enter cells. While these techniques may be applicable to in vitro cell cultures, they introduce additional variables of cellular toxicity and are not applicable in vivo.

[005] A number of nucleic acid analogs, such as exemplified in Figure 1, have been developed that variously demonstrate enhanced stability, increased affinity for binding to complementary RNA sequences, and/or diminished non-specific cellular effects.

[006] Among these, phosphorothioate (PS) oligonucleotides have received extensive study as antisense reagents (1,3). In PS oligos, phosphorothioate linkages replace the phosphates in the backbone of native DNA (Figure Ia). This modification results in increased nuclease resistance but also promotes non-specific binding to proteins, which complicates the activities of PS oligonucleotides as antisense reagents (8,11). A more extensive modification of native nucleic acid structure is exemplified by Morpholino oligonucleotides (Figure Ib). Because these DNA analogs are nonionic, they do not interact non-specifically with cellular proteins like PS oligos, and their actions as antisense reagents have proven to be more predictable and specific (12). Peptide nucleic acid (PNA), (Figure Ic), is a DNA mimic that represents a further departure from native nucleic acid structure.

[007] Other inhibitors of gene expression have been described, such as, for example, antisense DNA and RNA. Many modifications, such as phosphorothioates, have been made to antisense oligonucleotides to increase resistance to nuclease degradation, binding affinity and uptake (Cazenave et al. 1989; Sun et al. 1989; McKay et al. 1996; Wei et al. 1996). In some instances, using antisense and ribozyme suppression stategies has led to the reversal of the tumor phenotype by greatly reducing the expression of a gene product or by cleaving a mutant transcript at the site of the mutation (Carter and Lemoine 1993; Lange et al. 1993; Valera et al. 1994; Dosaka-Akita et al. 1995; Feng et al. 1995; Quattrone et al. 1995; Ohta et al. 1996). Ribozymes have also been proposed as a means of both inhibiting gene expression of a mutant gene and of correcting the mutant by targeting trans-splicing (Sullenger and Cech 1994; Jones et al. 1996). Ribozymes can be designed to elicit autocatalytic cleavage of RNA targets. However the inhibitory effect of some ribozymes may be due in part to an antisense effect of the variable antisense sequences flanking the catalytic core which specify the target site (Ellis and Rodgers 1993; Jankowsky and Schwenzer 1996). Ribozyme activity may be augmented by the use of non-specific nucleic acid binding proteins or facilitator oligonucleotides (Herschlag et al. 1994; Jankowsky and Schwenzer 1996).

[008] Triple helix approaches have also been investigated for sequence specific gene suppression-triplex forming oligonucleotides have been found in some cases to bind in a sequence specific manner (Postel et al. 1991; Duval- Valentin et al. 1992; Hardenbol and Van Dyke 1996; Porumb et al. 1996). Minor groove binding polyamides have been shown to bind in a sequence specific manner to DNA targets and hence may represent useful small molecules for future suppression at the DNA level (Trauger et al. 1996). In addition, suppression has been obtained by interference at the protein level using dominant negative mutant peptides and antibodies (Herskowitz 1987; Rimsky et al. 1989; Wright et al. 1989). In some cases suppression strategies have lead to a reduction in RNA levels without a concomitant reduction in proteins, whereas in others, reductions in RNA levels have been mirrored by reductions in protein levels.

Peptide Nucleic Acid (PNA) Oligomers

[009] PNA, first described in 1991 by Nielsen et al., is a DNA mimic in which the phosphate deoxyribose backbone of DNA has been replaced by a pseudopeptide backbone composed of N-(2-amino-ethyl)glycine subunits to which nucleobases are attached by methylene carbonyl linkers (13). PNA oligomers bind to complementary RNA and DNA with very high affinity and specificity, and consequently interactions of PNA antisense oligomers with targeted RNA sequences are less affected by the secondary structure of RNA transcripts. PNA oligomers also resist nuclease and protease digestion and are highly stable in biologic fluids and within cells (1,4,14). Furthermore, because PNA lacks a repetitively charged backbone, it does not interact with polyanion-binding proteins, which have complicated the actions of phosphorothioate (PS) oligonucleotide antisense reagents when used in vitro and in vivo to selectively target gene expression (10).

[0010] Unlike PS antisense oligonucleotides, or "small inhibitory" double stranded RNA reagents (siRNA) (1), the binding of PNA antisense oligomers to targeted mRNA transcripts does not engage endogenous enzymes that degrade the RNA at the site of binding. PNA antisense reagents can effectively block the translation of targeted mRNA, particularly when directed to the 5'UTR of mRNA transcripts (4,15). PNA antisense oligomers have also been shown to influence alternative splicing of pre-mRNA transcripts when directed to alternative splice sites (5,6,16), and one of the greatest potentials of PNA reagents as tools with which to selectively modulate gene expression relates to this latter antisense effect. As reviewed recently by Sazani and KoIe (6), an estimated 60% of all human genes undergo alternative splicing following transcription to generate splice variants that have differing functions. Alternative splice variants of expressed genes have been shown to cause a number of genetic diseases, such as β- thalassemia, and to contribute to the evolution of a variety of cancers (6, 17).

[0011] While PNA has been considered to be a particularly attractive nucleic acid analog upon which to base the development of targeted anti-sense and anti-gene reagents, given its qualities of stability and high affinity binding, progress in developing PNA as a molecular tool for selectively modulating gene expression has been hampered by the fact that PNA oligomers are relatively resistant to cellular uptake. A number of techniques have been used to deliver PNA into cells for in vitro studies. However, these techniques are generally non-physiologic, variably inefficient, and not applicable in vivo (14). Certain modifications to PNA have been described, such as the addition of lysine residues (5,16) or positively charged peptides (14,18) that appear to increase the accessibility of PNA oligomers for cellular uptake, but only to a limited degree. Thus, there exists a need for an improved method of delivering PNAs to cells in vivo. SUMMARY OF THE INVENTION

[0012] The present invention discloses the development of a novel technology for delivering oligonucleotides into cells. The use of microbial toxin proteins as vehicles for the cellular delivery of oligonucleotides such as, for example, peptide nucleic acid (PNA) oligomers or siRNA is disclosed. In one embodiment, the Anthrax toxin protective antigen (PA), or any portion thereof that has the cell membrane transport function, is used as a molecular transport vehicle for the delivery of PNAs into cells. The cell is preferably a human cell. The cell may be in vitro or in vivo.

[0013] In another embodiment, the Anthrax toxin protective antigen (PA), or any portion thereof that has the cell membrane transport function, is used as a molecular transport vehicle for the delivery of small nucleic acid molecules, such as short interfering RNA (siRNA), short interfering nucleic acid (siNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA). Alternatively, morpholino oligonucleotides, pcDNAs, aptamers, or pcPNAs are utilized in the methods of the present invention. In particular, the instant invention features the use of Anthrax toxin protective antigen (PA), or any portion thereof that has the cell membrane transport function, conjugated to modulate the expression of genes.

[0014] The PA may be full length or any fragment or portion thereof that maintains the cell membrane transport function. In one embodiment of the present invention the PA is 63 kDa. Alternatively, the PA is 83 kDa. However, a range of fragments can be used.

[0015] The PA is conjugated or otherwise associated with the oligonucleotide. The linkage of the oligonucleotide to the cell transporting portion of PA can be accomplished by any means known in the art, e.g. bonding (covalent or ionic), chemical linkage such as conjugation, or fusion "proteins", i.e. synthesizing a PA attached to the oligonucleotide, i.e. PNA, backbone.

[0016] In one embodiment, the PA is used as a molecular transport vehicle for the delivery of PNAs into cells in order to modulate the expression of targeted genes. In this method, a construct for transport across a cell membrane into a cell is introduced. The construct comprises a PNA conjugated to the Anthrax toxin protective antigen (PA), or any portion thereof that has the cell membrane transport function. The cell is exposed to the construct and the construct is transported across, and permeates at least, the outer membrane of the cell.

[0017] Targeted genes may include, for example, β-globin, for the treatment of β- thalassemia. In one embodiment, Anthrax PA-mediated delivery of PNA reagents into cells serves to correct aberrant gene expression, for example, in human hematologic diseases, such as β-thalassemia.

[0018] In another embodiment, the PA is used as a molecular transport vehicle for the delivery of siRNAs into cells in order to modulate the expression of targeted genes. In this method, a construct for transport across a cell membrane into a cell is introduced. The construct comprises a siRNA conjugated to the Anthrax toxin protective antigen (PA), or any portion thereof that has the cell membrane transport function. The cell is exposed to the construct and the construct is transported across, and permeates at least, the outer membrane of the cell.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Nucleic acid analogs with activity as antisense reagents (differences from native DNA are highlighted).

[0020] Figure 2: Crystallographic structure of diphtheria toxin

[0021] Figure 3: Crystallographic structure of Anthrax "lethal factor" (LF) and "protective antigen" (PA).

[0022] Figure 4: Effect of a mutant β-globin intron-2 (IVS2-654) insertion in the luciferase gene coding sequence. Blockade of the aberrant 654 splice site by antisense (right-hand diagram) permits expression of active enzyme.

[0023] Figure 5: Luciferase rtPCR of transfected cell lines.

[0024] Figure 6: Enhanced luciferase expression induced by antisense PS oligo.

[0025] Figure 7: Correction of mRNA splicing (A) and induction of luciferase expression (B) in CHO Luc-IVS2-654 cells by antisense PNA-(Lys)8 delivered to cells by a lipophilic transfection reagent (oligofectamine).

[0026] Figure 8: Increase in luciferase expression by Luc-IVS2-654 CHO cells induced by antisense PNA-(Lys)8 oligomer at 1.0 mM (panel A) and 0.3 mM (panel B) by itself (black bars) and with Anthrax PA 1.0 mg/mL (hatched bars). [0027] Figure 9: Increased luciferase expression in Luc-IVS2-654 cells by antisense PNA + PA (0.01 - 1.0 mg/mL).

[0028] Figure 10: Cell surface binding and endocytosis of fluorochrome labeled Anthrax Lfm.

[0029] Figure 11 : FACS analysis of a T-cell lymphoma line (HUTl 02/6TG originally obtained from ATCC), which was stably transfected with a pTracer-CMV2 vector carrying the "green fluorescent protein" (GFP) and which expresses GFP constitutively is shown.

[0030] Figure 12: Homologous toxin "entry motif sequences

[0031] Figure 13: Increased luciferase expression in HeLa Luc-IVS2-705 Cells by 0.3 μM antisense (705) PNA + PA (1.0 μg/mL).

[0032] Figure 14: Correction of aberrantly spliced β-globin in the erythroid cells of a β -thalassemia patient with the β IVS2-654 mutation by an antisense PNA-(Lys)8 oligomer (0.3 μM) with Anthrax PA (0.3 μg/mL).

DETAILED DESCRIPTION OF THE INVENTION

[0033] The present invention provides a method for delivering oliogonucleotides, particularly, peptide nucleic acids (PNAs) and siRNAs, into cells utilizing the Anthrax toxin protective antigen (PA) or portion thereof which has the cell membrane transport function. The present invention also provides a method for gene regulation, including induction and repression of genes, using the delivery methods of the present invention.

[0034] As described herein, the invention relates to the cellular delivery of oligonucleotides. The oligonucleotides can be used for hybridization or binding to single- stranded and/or double-stranded nucleic acids, for example DNA or RNA. Oligonucleotides include, but are not limited to, peptide nucleic acids (PNAs), short interfering RNA (siRNA), short interfering nucleic acid (siNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), morpholino oligonucleotides, pcDNAs, aptamers, or pcPNAs.

[0035] The invention furthermore relates to the use of the PA-coηjugated oligonucleotides for the modulation and for the complete or partial inhibition of the expression of genes, for example for the complete or partial inhibition of transcription and/or of translation.

[0036] In one embodiment, the invention relates, for example, to the delivery of Anthrax toxin protective antigen (PA) or portion thereof which has the cell membrane transport function-conjugated oligonucleotides as antisense or antigene oligonucleotides. Moreover, the modified oligonucleotides of the present invention can be used as aids in molecular biology.

[0037] The invention furthermore relates to the use of the oligonucleotides as pharmaceutical and/or diagnostic or the use of the oligonucleotides for the production of pharmaceuticals and/or diagnostics. In particular, the oligonucleotides can be employed in pharmaceuticals which are suitable for the prevention and/or treatment of diseases which accompany the mis-regulation of genes or the expression of proteins. Furthermore, the oligonucleotides can be employed in diagnostic processes. Such diagnostic processes can be employed, for example, for the diagnosis or early recognition of diseases which accompany abnormally expressed (e.g., overexpression) of genes.

[0038] The functions of DNA and RNA to be regulated by the delivery methods of the present invention may include transcription and translation. For example, inhibition or activation of DNA and RNA can be initiated from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be regulated may include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. In the context of the present invention, "modulation" and "modulation of expression" mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.

[0039] The antisense approach relies on delivery of specific nucleic acid or nucleic acid analog sequences to inhibit the expression or replication of DNA at the transcriptional level ("antigene"), or mRNA at the translational level ("antisense"). From the many studies on the antigene and antisense mechanisms of action, it is clear that cellular uptake and distribution are key to therapeutic action (Helene, 1990; Akhtar, 1992; Stein, 1993).

[0040] The present invention achieves improvements to the use of both antigene and antisense technologies by utilizing the cell transporting domain of the Anthrax toxin protective antigen (PA) or portion thereof which has the cell membrane transport function PA to enhance cellular delivery of antigene and antisense compounds, such as, for example PNAs and siRNAs.

Peptide Nucleic Acids (PNAs)

[0041] In a preferred embodiment of the present invention, a cell membrane transporting domain of Anthrax PA conjugated or otherwise associated with PNA, can be used to deliver complex molecules such as peptide nucleic acid (PNA) oligomers into cells.

[0042] Peptide nucleic acids (PNAs) are similar to oligonucleotides and oligonucleotide analogs and may mimic DNA and RNA. The deoxyribose backbone of DNA is replaced in PNA by a pseudo-peptide backbone (Nielsen et al., Science, 1991, 254, 1475). Each subunit, or monomer, has a naturally occurring or non- naturally occurring nucleobase attached to the backbone. One such backbone consists of repeating units of N-(2-aminoethyl)glycine linked through amide bonds. PNA hybridizes to complementary nucleic acids through Watson and Crick base pairing and helix formation results (Egholm et al., Nature, 1993, 365, 566). The Pseudo-peptide backbone provides superior hybridization properties (Egholm et al., Nature, 1993, 365, 566), resistance to enzymatic degradation (Demidov et al., P.E. Biochem. Pharmacol., 1994, 48, 1310) and access to a variety of chemical modifications (Nielsen et al., Chemical Society Reviews, 1997, 73).

[0043] PNA binds both DNA and RNA to form PNA/DNA or PNA/RNA duplexes. The resulting PNA/DNA or PNA/RNA duplexes are bound with greater affinity than corresponding DNA/DNA or DNA/RNA duplexes, as determined by Tms. The thermal stability of PNA/DNA and PNA/RNA duplexes could be due to the lack of charge repulsion in the neutral backbone of PNA. In addition to increased affinity, PNA has also been shown to hybridize to DNA with increased specificity, as compared to DNA/DNA duplexes. When a PNA/DNA duplex mismatch is melted relative to a DNA/DNA duplex, an 8 to 20°C drop in the Tm results. Furthermore, homopyrimidine PNA oligomers form extremely stable PNA (2)-DNA triplexes with sequence- complementary targets in DNA or RNA oligomers. Finally, PNAs may bind to double- stranded DNA or RNA by helix invasion (see, e.g., Egholm, et al., Science, 1991, 254, 1497; Egholm, et al., J. Am. Chem. Soc, 1992, 114, 1895; Egholm, et al., J. Am. Chem. Soc, 1992, 114, 9677).

[0044] A further advantage of PNA, as compared to oligonucleotides, is the nuclease and protease resistance of the PNA polyamide backbone. PNA is not recognized by either nucleases or proteases and is thus not susceptible to cleavage; consequently, PNAs are resistant to degradation by enzymes, unlike nucleic acids and peptides. In antisense applications, target- bound PNA can cause steric hindrance of DNA and RNA polymerases, reverse transcripase, telomerase and ribosomes (Hanvey et al., Science, 1992, 258, 1481; Knudsen et al., Nucleic Acids Res., 1996, 24, 494; Good at el., Proc. Natl. Acad. Sci USA, 1998, 95, 2073; Good, et al., Nature Biotechnology, 1998, 16, 355).

[0045] PNA oligomers are intrinsically stable and their pseudopeptide structure is amenable to modifications whereby peptide sequences may be added either during synthesis or by peptide ligation techniques.

[0046] The binding of a PNA strand to a DNA or RNA strand can occur in one of two orientations. The orientation is said to be anti-parallel when the DNA or RNA strand in a 5^? to 3¹ orientation binds to the complementary PNA strand such that the carboxyl end of the PNA is directed towards the 5' end of the DNA or RNA and amino end of the PNA is directed towards the 3' end of the DNA or RNA. In the parallel orientation the carboxyl end and amino end of the PNA are just the reverse with respect to the 5'-3' direction of the DNA or RNA.

[0047] PNAs bind to both single stranded DNA and double stranded DNA. As noted above, in binding to double stranded DNA it has been observed that two strands of PNA can bind to the DNA. While PNA/DNA duplexes are stable in the antiparallel configuration, it was previously believed that the parallel orientation is preferred for (PNA)₂ /DNA triplexes.

[0048] The binding of two single stranded pyrimidine PNAs to a double stranded DNA has been shown to take place via strand displacement, rather than conventional triple helix formation as observed with triplexing oligonucleotides. When PNAs strand invade double stranded DNA, one strand of the DNA is displaced and forms a loop on the side of the PNA₂/DNA complex area. The other strand of the DNA is locked up in the (PNA) ₂/DNA triplex structure. The loop area (alternately referenced as a P loop) being single stranded, is susceptible to cleavage by enzymes that can cleave single stranded DNA.

[0049] The ability of PNAs to bind dsDNA via duplex or triplex invasion, and through formation of non-invasive triplexes, however, has a common sequence limitation: generally, one of the two dsDNA strands of the PNA-binding site must consist mostly of purines. Nielsen, Curr. Opin. Biotech. 10: 71-5 (1999); Nielsen, Ace. Chem. Res. 32: 624-30 (1999).

[0050] To address the sequence limitations of traditional PNAs, pseudocomplementary PNAs (pcPNAs) have been developed and may be used in the present invention. In addition to guanine and cytosine, pcPNA's carry 2,6-diaminopurine (D) and 2-thiouracil instead of adenine and thymine, respectively. pcPNAs exhibit a distinct binding mode, double-duplex invasion, which is based on the Watson-Crick recognition principle supplemented by the notion of pseudocomplentarity. Pseduocomplementarity means that two special derivatives of initially paired normal purine and pyrimidine are structurally adjusted in such a way that they (i) do not match each other, but (ii) are capable of a stable Watson-Crick-type pairing with the natural nucleobase counterparts. Izvolsky et al., Biochemistry 39: 10908-13 (2000); Lohse et al., Proc. Nat'l. Acad. Sci. USA 95: 11804-8 (1999); Kutyavin et al., Biochemistry 35: 11170-6 (1996). pcDNAs, like DNAs, can be paired with any number of different bases, but like DNAs generally reflect principles based upon Watson-Crick base-pairing. Thus, they recognize and bind with their natural A, T, (U), or G, C counterparts. Preferably, while they will bind to a natural A, T, U, G or C base, they will not bind strongly with other PNA bases. For example, 2-6 diaminipurine binds to Thymine more efficiently than does Adenine. Analogously 2-6 diaminipurine-2-thiothymial (2-thiouracil) binds to Adenine more effectively.

[0051] The use of such bases results in pc PNAs. Such PNAs will bind, for example to DNA, but not to another PNA. pcPNA pairs are thus capable of targeting designated dsDNA sites with mixed sequences of purines and pyrimidines.

-π - [0052] PNAs and pcPNAs can be made according to any method known in the art. For example, methods for the chemical assembly of PNAs are well known (See: U.S. Pat. Nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331, 5,736,336, 5,773,571 or 5,786,571, herein incorporated by reference). Chemicals and instrumentation for the support bound automated chemical assembly of Peptide Nucleic Acids are now commercially available. Both labeled and unlabeled PNA oligomers are likewise available from commercial vendors of custom PNA oligomers. Chemical assembly of a PNA is analogous to solid phase peptide synthesis, wherein at each cycle of assembly the oligomer possesses a reactive alkyl amino terminus which is condensed with the next synthon to be added to the growing polymer. Because standard peptide chemistry is utilized, natural and non- natural amino acids are routinely incorporated into a PNA oligomer. Because a PNA is a poly amide, it has a C-terminus (carboxyl terminus) and an N-terminus (amino terminus). For the purposes of the design of a hybridization probe suitable for antiparallel binding to the target sequence (the preferred orientation), the N-terminus of the probing nucleobase sequence of the PNA probe is the equivalent of the 5'-hydroxyl terminus of an equivalent DNA or RNA oligonucleotide.

[0053] PNAs may be pegylated to extend their life span in the cell where they preferentially bind complementary single stranded DNA and RNA and stop transcript elongation (Nielsen, P. E. et al. (1993) Anticancer Drug Des. 8:53-63).

[0054] A general difficulty in the use of PNAs and other agents is cell uptake. A variety of strategies to improve uptake have been explored for certain of these agents including uptake into eukaryotic cells using lipids (Lewis et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 3176), encapsulation (Meyer et al., J Biol. Chem., 1998, 273, 15621) and carrier strategies (Nyce et al., Nature, 1997, 385, 721; Pooga et al., Nature Biotechnology, 1998, 16, 857) have been made. WO 99/05302 discusses a PNA conjugate consisting of PNA and the transporter peptide transportan, in which the peptide is stated as being used for transport cross a lipid membrane and for delivery of the PNA into interactive contact with intracellular polynucleotides. U.S. Pat. No. 5,777,078 discusses a pore- forming compound which comprises a delivery agent that is stated to recognize the target cell and is linked to a pore- forming agent, such as a bacterial exotoxin. The compound is administered together with a drug such as PNA. Furthermore, the high doses of antisense reagents required for therapeutic action lead often to toxic side effects. However, despite such discussions, cellular targeting of PNAs has been limited and improved methods are needed.

Other Regulators of Gene Expression

[0055] Also encompassed in the present invention are a variety of nucleic acid complexes which may regulate gene expression. For example, the nucleic acid complexes may comprise from about 5 bases to about 200 kilobases. Any type of nucleic acid may be used, including, by way of non-limiting example, mRNA, tmRNA, tRNA, rRNA, siRNA, shRNA, PNA, ssRNA, dsRNA, ssDNA, dsDNA, DNA:RNA hybrid molecules, plasmids, artificial chromosomes, gene therapy constructs, cDNA, PCR products, restriction fragments, ribozymes, antisense constructs, and combinations thereof. Reviews of tmRNA include Muto A et al, Bacterial RNA that functions as both a tRNA and an mRNA. Trends Biochem Sci. 1998 January;23(l):25-9; and Withey J H, Friedman D I. The biological roles of trans-translation. Curr Opin Microbiol. 2002 April;5(2): 154-9. The nucleic acid may comprise one or more chemical modifications in addition to the conjugation or association with the Anthrax protective antigen or any portion thereof that has the cell membrane transport function.

Anthrax Protective Antigen (PA)

[0056] Anthrax protective antigen (PA) (from B. anthracis) is intrinsically stable and readily available as a recombinant protein, and it is also non-toxic by itself without modification by molecular engineering.

[0057] Bacterial toxins frequently have two functionally distinct moieties, termed A and B. The A moiety contains the catalytic activity, while the B moiety possesses determinants needed for the cytoplasmic delivery of the A moieties into target cells. These delivery determinants include receptor binding activity, and often, but not always, membrane penetration activity. Many bacterial toxins, such as diphtheria toxin, contain both moieties within a single polypeptide. Anthrax toxin, by contrast, is a member of the so-called binary toxins, a class in which the A and B functions inhabit separate proteins. Although separate, the proteins having the A and B functions interact during the intoxication of cells. Anthrax toxin uses a single B moiety, protective antigen (PA; 83 kDa), for the delivery of two alternative A moieties, edema factor (EF; 89 kDa) and lethal factor (LF; 89 kDa) into the cytoplasm.

[0058] The toxic "catalytic" domains of diphtheria toxin, anthrax toxin ("lethal factor" [LF] and "edema factor" [EF]) and all serotypes of botulinum toxin follow a similar route of entry into the cytosol of targeted cells. Following the binding of toxin to specific cell surface receptors, the toxin is internalized into the cell by receptor-mediated endocytosis in clathrin-coated pits (19). Following acidification in early endosomes, translocation of the toxic catalytic domain to the cytosol is facilitated by a functional transmembrane domain, which forms pores in the endosomal membrane (20). The X-ray structure of each toxin is known, and the structural domains that are required for translocation and delivery of the catalytic domains of the toxins into cells are also known. The specific cell surface receptors for each toxin and the enzymatic activities of their respective catalytic domains have also been defined.

[0059] A characteristic common to diphtheria toxin, anthrax toxin, and the various botulinum toxins is that each consists of three functional components: a toxic "catalytic" domain, a transmembrane transport domain, and a cell receptor binding domain. This basic 3-part arrangement ("receptor binding"[R] domain - "transport" [T] domain - "catalytic" [C] domain) is illustrated in the ribbon diagram of the X-ray crystallographic structure of diphtheria toxin shown in Figure 2. In this Figure, the "transport" domain has been circled.

[0060] Once the toxin binds to a target cell via the R-domain, it is internalized into the cell by receptor- mediated endocytosis from clathrin-coated pits. During endocytosis, the C-domain is cleaved off from the other two domains at a protease sensitive site in a loop that connects it with the T-domain and is adjacent to a sequence in the C-domain that is conserved among the different toxins and has been referred to as the "entry motif." The C-domain remains linked with the T-domain via disulfide bonds in the early endosomes. However, with acidification of the endosome, 5 of the α-helices within the T-domain insert into the endosomal membrane to form an 18 angstrom pore, through which the C-domain enters the cytosol of the cell. Although the mechanisms involved in transport of the "catalytic" domain via the pore created by the "transport" domain are not fully understood, it is evident that the "entry motif sequence at the terminus of the free "catalytic" domain is required for this translocation process. [0061] The functional organization of Anthrax toxin is similar to that of diphtheria toxin (DT). However, unlike DT, in which all functional domains are part of a single polypeptide chain of 535 amino acids, Anthrax toxin is a binary toxin composed of separate gene products. The cell "receptor binding" domain and the "transport" domain are contained in a single polypeptide of 83 kD called "protective antigen" (PA) (Figure 3). This protein is separate from two distinct 90 kD toxicity proteins, "lethal factor" (LF) and "edema factor" (EF). LF is depicted in Figure 3. Once PA binds to the surface of a target cell through its "receptor binding" domain, a 20 kD fragment of PA is cleaved off by an endoprotease, and the remaining 63 kD "nicked" PA protein oligomerizes to form heptamers. These heptameric complexes can bind either LF or EF and transport them into the cytosol of the cell via a trans-endosomal transport mechanism that is analogous to that used by the T-domain of diphtheria toxin to deliver the DT "catalytic domain into cells (21). The size of the transmembrane pore formed by the T-domain of Anthrax PA in acidified endosomes is somewhat larger (22-25 angstroms) than that formed by the T- domain of diptheria toxin. Furthermore, PA is not known to be toxic to cells by itself.

[0062] The present invention provides a method for delivering genetically targeted antisense reagents into cells. In a preferred embodiment, the 63 kD "nicked" PA protein is utilized to deliver PNAs or siRNAs to cells. In another embodiment, the full length, 83 kD PA is utilized. However, other fragments can readily be used. For example, those containing virtually any portion of the "nicked" fragment.

Production of PA

[0063] In a preferred embodiment, recombinant PA is utilized. Methods of producing recombinant PA have been described, for example, in WO 01/21656, incorporated herein by reference. PA fusion proteins in which the receptor binding domain have been deleted can also be constructed, to target PA to specific cell types. Any cell transport functioning, biologically active form of PA can be used in the present invention.

[0064] DNA sequences encoding PA can readily be made. For example, the sequence encoding PA is well known and can be modified by known techniques, such as deleting the undesired regions, such as variable loops, and to insert any additional desired coding sequences, such linker segments. In addition, the codons for the various amino acid residues are known and one can readily prepare alternative coding sequences by standard techniques.

[0065] Any cell transport functioning portions of the Anthrax protective antigen (PA) may be used in the methods of the present invention. Such portions have been described, for example, in WO/03/087129, incorporated herein by reference. The crystal structure of native PA has been elucidated and shows that PA includes four distinct and functionally independent domains. Domain 1 is divided into domains Ia, including amino acids 1 to 167, and Ib, including amino acids 168 to 258; domain 2 including amino acids 259 to 487; domain 3 including amino acids 488 to 595; and domain 4 including amino acids 596 to 735. Cell intoxication is thought to occur when full length PA binds to the cell surface receptor via domain 4, which contains the host cell receptor binding site. On binding to the host cell receptor, the N-terminal amino acids (1 to 167, i.e., domain Ia) of domain 1, which contains a furin protease cleavage site, are cleaved off, exposing the LF or EF binding site located in domain Ib and the adjacent domain 3. Domains 2 and 3 then form part of a heptameric pore on the cell surface, the LF or EF binds to its receptor, and the whole toxin complex undergoes receptor-mediated endocytosis into the cell. After acidification of the endosome, the toxin is translocated into the cell cytosol, where it exerts its cytotoxic effect. Thus, any portion of PA, such as those described above, which mediate binding and entry into a cell may be used in the methods of the present invention.

[0066] In addition, functional groups capable of forming covalent bonds with the amino- and carboxyl- terminal amino acids or side groups of amino acids are well known to those of skill in the art. For example, functional groups capable of binding the terminal amino group include anhydrides, carbodiimides, acid chlorides, and activated esters. Similarly, functional groups capable of forming covalent linkages with the terminal carboxyl include amines and alcohols. Such functional groups can be used to bind compounds to PA at either the amino- or carboxyl-terminus. Compounds can also be bound to PA through interactions of amino acid residue side groups, such as the SH group of cysteine (see, e.g., Thorpe et al., Monoclonal Antibody-Toxin Conjugates: Aiming the Magic Bullet, in Monoclonal Antibodies in Clinical Medicine, pp. 168-190 (1982); Waldmann, Science, 252: 1657 (1991); U.S. Patent Nos. 4,545,985 and 4,894, 443).

[0067] The procedure for attaching a compound to PA will vary according to the chemical structure of the compound. As an example, a cysteine residue can be added to the PA. This cysteine provides a convenient attachment point through which to chemically conjugate other proteins (or PNAs) through disulfide bonds.

Expression of PA

[0068] DNA sequences encoding the PA can be expressed in a wide variety of host-vector combinations. Vectors include chemical conjugates such as those described in WO 93/04701, which has targeting moiety (e.g. a ligand to a cellular surface receptor), and a nucleic acid binding moiety (e.g. polylysine), viral vectors (e.g. a DNA or RNA viral vector), plasmids, phage, etc. The vectors can be chromosomal, non- chromosomal or synthetic.

[0069] Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus, adeno-associated virus, cytomegalovirus and retroviruses. Useful expression vectors for bacterial hosts include bacterial plasmids, such as those from E. coli, including pBluescript, pGEX-2T, pUC vectors, col El, pCRl, pBR322, ρMB9 and their derivatives, wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g. lambda GTlO and lambda GTIl, and other phages. Useful expression vectors for yeast cells include the 2 micron plasmid and derivatives thereof. Useful vectors for insect cells include pVL 941.

[0070] Preferred vectors include viral vectors, fusion proteins and chemical conjugates. Retroviral vectors include Moloney murine leukemia viruses and HIV based viruses. One preferred HIV-based viral vector comprises at least two vectors wherein the gag and pol genes are from an HIV genome and the env gene is from another virus. DNA viral vectors are preferred. These vectors include herpes virus vectors such as a herpes simplex I virus (HSV) vector (Geller, A. I. et al., 15 Neurochem 64: 487, 1995; Lim, F. et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed., Oxford Univ. Press, Oxford England, 199), Geller, A. L, Proc. Natl. Acad. Sci USA 90: 7603, 1993, Geller, A. L, I ProcNatl. Acad. Sci USA 87: 1149, 1990), adenovirus vectors (LeGaI LaSaIIe et al., Science 259: 988, 1993; Davidson, et al., Nat. Genet 3: 219, 1993; Yang, et al., Virol. 69: 2004, 1995), and adeno-associated virus vectors (Kaplitt, M.G., et al., Nat. Genet. 8:148, 1994). The DNA sequence is operably linked to a promoter that permits expression in the host cell. Such promoters are well known in the art and can readily be selected. [0071] A wide variety of unicellular host cells are useful in expressing the PA of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera frugiperda (SF9), animal cells such as CHO and mouse cells, African green monkey cells such as COS 1, COS 7, BSC 1, BSC 40, and BMT 10, and human cells, as well as plant cells in tissue culture.

[0072] The anthrax PA encoded by its DNA sequence may be isolated from the fermentation or cell culture and purified using any of a variety of conventional methods including: liquid chromatography such as normal or reversed phase, using HPLC, FPLC and the like, affinity chromatography (such as with inorganic ligands or monoclonal antibodies), size exclusion chromatography; immobilized metal chelate chromatography, gel electrophoresis; and the like. One of skill in the art may select the most appropriate isolation and purification techniques. Stabilized forms of PA can readily be made, for example, by conjugates such as a poly(alkylene oxide) conjugate. The conjugate is preferably formed by covalently bonding the hydroxyl terminals of the poly(alkylene 20 oxide) and a free amino group in a portion of the PA protein that will not affect its conformation. Other art recognized methods of conjugating these materials include amide or ester linkages. Covalent linkage as well as non-covalent conjugation such as lipophilic or hydrophilic interactions can be used.

[0073] The conjugate can be comprised of non-antigenic polymeric substances such as dextran, polyvinyl pyrrolidones, polysaccharides, starches, polyvinyl alcohols, polyacryl amides or other similar substantially non- immunogenic polymers. Polyethylene glycol(PEG) is preferred. Other poly(alkylenes oxides) include monomethoxy- poly ethylene glycol polypropylene glycol, block copolymers of polyethylene glycol, and polypropylene glycol and the like. The polymers can also be distally capped with C 1-4 alkyls instead of monomethoxy groups. The poly(alkylene oxides) used must be soluble in liquid at room temperature. Thus, they preferably have a molecular weight from about 200 to about 20,000 daltons, more preferably about 2,000 to about 10,000 and still more preferably about 5,000.

[0074] Anthrax PA can be produced from nucleic acid constructs as above, which encode either the 83 kD PA or the "nicked" 63 kD PA. Alternatively, any PA, PA fragment, analog, or derivative thereof that permits cellular uptake may be used. Alternatively, ligation of a portion of Anthrax "lethal factor" (LF), containing the PA binding site together with a sequence referred to as the "entry motif (shown in Figure 3), to an antisense PNA oligomer or siRNA is disclosed.

[0075] In one embodiment, a nuclear localization signal peptide is added to the PNA or siRNA. Nuclear localization signal peptides are known to those of skill in the art and are described, for example, in, Cutrona G et al., Nature Biotechnol 18:300, 2000, Kido et al., Exper. Cell Res. 198:107-114 (1992) and Dingwall, C. and Laskey, R. Trends Biochem. ScL, 16: 478-481, 1991, hereby incorporated by reference.

[0076] Linkage of the PNA to the cell transporting portion of PA can be accomplished by any means known in the art, e.g. bonding (covalent or ionic), chemical linkage such as conjugation, fusion "proteins", i.e., synthesizing a PA attached to the PNA or siRNA backbone.

Conjugation

[0077] In one embodiment of the present invention, the anthrax PA is conjugated to the PNA or siRNA. Any methods of conjugation known in the art may be utilized, for example, as described in WO 99/05302 and WO 02/09680.

[0078] Those of ordinary skill in the art will recognize that a large variety of possible moieties can be coupled to the resultant PNA-PA conjugates. See, for example, "Conjugate Vaccines", Contributions to Microbiology and Immunology, J. M. Cruse and R. E. Lewis, Jr (eds.), Carger Press, New York, 1989, the entire contents of which are incorporated herein by reference.

[0079] Coupling may be accomplished by any chemical reaction that will bind PA and a PNA so long as both retain their respective activities. This linkage can include many chemical mechanisms, for instance covalent binding, affinity binding, intercalation, coordinate binding and complexation.

[0080] The preferred binding is, however, covalent binding. Covalent binding can be achieved either by direct condensation of existing side chains or by the incorporation of external bridging molecules. Many bivalent or polyvalent linking agents are useful in coupling protein molecules, such as the PNAs of the present invention, to other molecules, such as, for example, PA. Representative coupling agents can include organic compounds such as thioesters, carbodiimides, succinimide esters, disocyanates, glutaraldehydes, diazobenzenes and hexamethylene diamines. This listing is not intended to be exhaustive of the various classes of coupling agents known in the art but, rather, is exemplary of the more common coupling agents (see Killen and Lindstrom, J. Immunol. 133:1335-2549,1984, Jansen, F. K. , et al, Imm. Rev. 62:185-216, 1982, and Vitettaetal., supra).

[0081] Preferred linkers are described in the literature. See, for example, Ramakrislinan, S., et al., Cancer Res. 44: 201 -208 (1984), describing the use of MBS (M- maleimidobenzoyl-N-hydroxysuccinimide ester). See also Umemoto et al., U.S. Patent 5,030,719, describing the use of a lialogenated acetyl hydroxide derivative coupled to an antibody by way of an oligopeptide linker. Particularly preferred linkers include: (i) EDC (l-ethyl-3-(3-dimethylamino-propyl) carbodiimide hydrochloride, (ii) SMPT (4- succinimidyloxycarbonyl-alpha-methyl-alpha-(2 pyridyl-dithio)- toluene (Pierce Chem. Co., Cat. (21558G), (iii) SPDP (succinimidyl-6 15 [3-(2- pyridyldithio) propionamido] hexanoate (Pierce Chem. Co., Cat #2165 IG); (iv) Sulfo-LC-SPDP (sulfosuccinimidyl 6 [3-(2- pyridyldithio)-propianamide] hexanoate (Pierce Chem. Co. Cat. #2165- G); and (v) sulfo-NHS (N- hydroxysulfo succinimide: Pierce Chem. Co., Cat. #24510) conjugated to EDC.

[0082] The linkers described above contain components that have different attributes, thus leading to conjugates with differing physio-chemical properties. For example, sulfo-NHS esters of alkyl carboxylates are more stable than sulfo-NHS esters of aromatic carboxylates. NHS-ester containing linkers are less soluble than sulfo-NHS esters. Further, the linker SMPT contains a sterically hindered disulfide bond, and can form conjugates with increased stability. Disulfide linkages, are in general, less stable than other linkages because the disulfide linkage is cleaved in vitro, resulting in less conjugate available. Sulfo-NHS, in particular, can enhance the stability of carbodimide couplings. Carbodimide couplings (such as EDC) when used in conjunction with sulfo- NHS, forms esters that are more resistant to hydrolysis than the carbodimide coupling reaction alone.

[0083] Reagents and automated synthesizers are commercially available for the synthesis of peptides and PNAs. Each moiety can be further derivatized to contain reactive functionality to form a linkage. PNAs can be covalently coupled to peptides through any suitable bond. Preferred bonds include labile bonds, such as a disulfide. To form a disulfide bond in a construct between the PNA and peptide (PA), the two moieties may be derivatized to bear thiol groups, one of which can bear a leaving group.

[0084] In the scheme for conjugation, or coupling, of the nucleic acid analog and the peptide moieties, a peptide is derivatized with a nitropyridyl-leaving group (Npys) on a cysteine amino acid. The nucleic acid analog bears an unprotected cysteine thiol, and may be further derivatized with a label, such as a fluorescent dye or biotin.

[0085] Nucleophilic displacement by the PNA thiol of the Npys group of the peptide yields the disulfide-linked construct.

[0086] In an alternative embodiment, the PA and PNA are synthesized separately and are not conjugated.

[0087] In a preferred embodiment of the present invention, unconjugated PNAs are delivered to cells together with anthrax PA. In this embodiment, the PA and PNA are synthesized separately, are not linked, and are administered to the cell.

[0088] In an alternative embodiment, the PNA is conjugated to the PA and then the conjugated construct is delivered to the cell.

Gene Regulation

[0089] There is now a detailed understanding of the genetic basis of many inherited and acquired diseases. This understanding has appropriately encouraged efforts to develop genetically targeted agents for both experimental and therapeutic applications. A number of promising antisense oligonucleotide and oligonucleotide-like reagents have emerged from these efforts and have been shown to be effective tools with which to selectively modulate gene expression in in vitro studies. These reagents include peptide nucleic acid (PNA) oligomers, as discussed above, morpholino oligonucleotides, and "small inhibitory" double stranded RNA sequences (siRNA) (1). The delivery methods of the present invention are applicable to the treatment of diseases such as β-thalassemia, by regulating the aberrant expression of the β-globin gene that characterized the disease.

[0090] Thus, the present invention also provides method for gene regulation, including induction and repression of genes, using the delivery methods of the present invention. Methods and applications of gene regulation have been described, for example, in U.S. provisional application entitled "Use of Psuedocomplementary PNAs as Modifiers of Protein activity on Duplex DNA", by Frank-Kamenetskii, Demidov, and Protozanova, filed July 15, 2004, and U.S. patent application 2003124726.

[0091] In one embodiment of the present invention, a PNA is designed to correct defective β-globin gene expression in erythroid progenitor cells from patients with β- thalassemia caused by the IVS2-654 mutation. In this embodiment, the PNA is delivered to cells in combination with anthrax PA.

DEFINITIONS

[0092] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:

[0093] "B moiety" means a toxin moiety as described herein. For example, Anthrax PA or Clostridium perfringens toxin B are examples of B moieties known in the art.

[0094] "PA" means the Anthrax toxin protective antigen polypeptide described herein. It is understood that homologs and analogs have the characteristics of the anthrax PA described herein and may be used in the methods of the invention.

[0095] A "nucleotide" is a monomer unit in a polymeric nucleic acid, such as DNA or RNA, and is composed of three distinct subparts or moieties: sugar, phosphate, and nucleobase (Blackburn, M., 1996). When part of a duplex, nucleotides are also referred to as "base" or "base pairs". The most common naturally-occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T) bear the hydrogen- bonding functionality that binds one nucleic acid strand to another in a sequence specific manner. "Nucleoside" refers to a nucleotide that lacks a phosphate. In DNA and RNA, the nucleoside monomers are linked by phosphodiester linkages, where as used herein, the term "phosphodiester linkage" refers to phosphodiester bonds or bonds including phosphate analogs thereof, including associated counter- ions, e.g., IT', NW, Na', and the like.

[0096] "Polynucleotide" or "oligonucleotide" refer to linear polymers of natural nucleotide monomers or analogs thereof, including double and single stranded deoxyribonucleotides "DNA", ribonucleotides "RNA", peptide nucleic acids ("PNAs"), short interfering RNA (siRNA), short interfering nucleic acid (siNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), morpholino oligonucleotides, pcDNAs, aptamers, or pcPNAs and the like. Polynucleotides typically range in size from a few monomeric units, e.g. 8-40, to several thousand monomelic units. Whenever a DNA polynucleotide is represented by a sequence of letters, such as "ATGCCTG," it will be understood that the nucleotides are in 5'-»3' order from left to right and that "A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes thymidine, unless otherwise noted.

[0097] "Nucleic acid analogs" are structurally modified, polymeric analogs of DNA and RNA made by chemical synthesis from monomeric nucleotide analog units, and possessing some of the qualities and properties associated with nucleic acids. PNA and phosphorothioate oligonucleotides are examples of two of many nucleic acid analogs known in the art.

[0098] "Watson/Crick base-pairing" and "Watson/Crick complementarity" refer to the pattern of specific pairs of nucleotides, and analogs thereof, that bind together through hydrogen- bonds, e.g. A pairs with T and U, and G pairs with C. The act of specific base- pairing is "hybridization" or "hybridizing". A hybrid forms when two, or more, complementary strands of nucleic acids or nucleic acid analogs undergo base-pairing.

[0099] "Conjugate" or "conjugated" refer to a covalent, ionic, or hydrophobic interaction whereby the moieties of a molecule are held together and preserved in proximity.

[00100] "Linker" refers to one or more atoms comprising a chain connecting a nucleic acid analog to a moiety such as a peptide, label, modifier, stabilizing group, or the like.

[00101] "Chimera" as used herein refers to an oligonucleotide including one or more nucleotide and one or more nucleotide analog units. The monomer units are linked through phosphodiester and phosphodiester analog linkages.

[00102] "Phosphodiester analog" or "internucleotide analog" refer to analogs of natural phosphodiester 3',5'-internucleotide linkages differing in their composition and/or location of attachment to a nucleotide, including but not limited to 2',5'-linkage, 3',3'- Iinkage, 5',5'- linkage, methyl phosphonate, alkylated phosphotriester, 3'-N- phosphoramidate, and non- bridging N-substituted phosphoramidate. [00103] The terms "permeant" and "permeable" refer to the ability of a construct of the present invention to pass through a cellular membrane, or ascribed as characteristics of the susceptibility of cellular membranes to have constructs pass through them (Alberts, 1989).

[00104] "Label" refers to a group covalently attached at one or both termini of the nucleobase oligomer. The label is capable of conducting a function such as giving a signal for detection of the molecule by such means as fluorescence, chemiluminescence, and electrochemical luminescence. Alternatively, the label allows for separation or immobilization of the molecule by a specific or non-specific capture method (Andrus, 1995). Labels include, but are not limited to, fluorescent dyes, such as fluorescein and rhodarnine derivatives (Menchen, 1993; Bergot, 1994), cyanine dyes, and energy-transfer dyes (Clegg, 1992; Cardullo, 1988).

[00105] "Detection" refers to detecting, observing, or measuring a construct on the basis of the properties of a detection label.

[00106] The term "labile" refers to a bond or bonds in a molecule with the potentiality of being cleaved by reagents, enzymes, or constituents of a cell.

[00107] The term "nucleobase-modified" refers to base-pairing derivatives of AGC, T,U, the naturally occurring nucleobases found in DNA and RNA.

[00108] "Peptides" are polymers of amino acids of which the written convention is N, or amino, terminus is on the left and the C, or carboxyl, terminus is on the right. The 20 most common, natural L-amino acids are alternatively designated by three-letter or one-letter codes, known to those of skill in the art. Peptides, as used herein, are considered to include "peptide analogs", structural modifications containing one or more modifications to L-amino acid side-chains or to the amino acid backbone. An example of a backbone modified peptide analog is the N- methyl glycine "peptoid" (Zuckermann, 1992).

[00109] "Homologs" are peptides with substantially identical amino acid sequences which retain the lipid membrane-transport function and which typically differ from the preferred sequences mainly by conservative amino acid substitutions in a domain of the peptide that provides the desired lipid membrane transport portion. For example, substitution of one amino acid for another within the same class above, e. g. valine for glycine or arginine for lysine) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the protein.

[00110] "Peptide nucleic acid", PNA as used herein, refers to an antisense molecule or anti-gene agent which comprises an oligonucleotide of at least five nucleotides in length linked to a peptide backbone of amino acid residues which ends in lysine. The terminal lysine confers solubility to the composition. PNAs may be pegylated to extend their life span in the cell where they preferentially bind complementary single stranded DNA and RNA and stop transcript elongation (Nielsen, P. E. et al. (1993) Anticancer Drug Des. 8:53-63).

[00111] Generally the term "suppressors of gene expression" includes nucleic acids, peptide nucleic acids (PNAs), siRNAs, aptamers or peptides which can be used to silence or reduce gene expression in a sequence specific manner.

[00112] The antisense nucleic acids can be DNA or RNA, can be directed to 5' and/or 3' untranslated regions and/or to introns and/or to control regions or to any combination of such untranslated regions. The binding of the antisense nucleic acid prevents or lowers the functional expression of the endogenous gene. Chimeric antisense nucleic acids including a small proportion of translated regions of a gene can be used in some cases to help to optimize suppression. Likewise chimeric antisense nucleic acids including a small proportion of promoter regions of a gene can be used in some cases to help to optimize suppression.

[00113] Generally the term 'functional expression' means the expression of a gene product able to function in a manner equivalent to or better than a wild type product. In the case of a mutant gene 'functional expression' means the expression of a gene product whose presence gives rise to a deleterious effect.

[00114] As used herein, the phrase "operably linked" refers to a linkage in which a first nucleotide sequence is connected to one or more second nucleotide sequences in such a way as to be capable of altering the functioning of the second sequence(s). For example, a protein coding sequence which is "operably linked" to a promoter/operator places expression of the protein coding sequence under the influence or control of these promoter/operator sequences. Two nucleotide sequences (such as a protein encoding sequence and a promoter region sequence linked to the 5' end of the encoding sequence) are said to be operably linked if induction of promoter function results in the transcription of the protein encoding sequence mRNA and if the nature of the linkage between the two nucleotide sequences results in neither (1) the introduction of a frame-shift mutation nor (2) prevention of the regulatory sequences from directing the expression of the mRNA or protein. Thus, a promoter region is said to be "operably linked" to a nucleotide sequence if the promoter is capable of effecting transcription of that nucleotide sequence. As one of ordinary skill will appreciate, two nucleic acid sequences (such as a promoter/operator sequence and a protein encoding sequence) may be operably linked without necessarily being physically located adjacent to one another; so long as the promoter/operator sequence is capable of directing the expression of the protein encoding sequence, the sequences are said to be operably linked regardless of whether the two sequences are located immediately next to each other on the same nucleic acid molecule or are located distal to one another with one or more intervening sequences located between them.

EXAMPLES

Development of a Reporter Cell Line with which to Detect Targeted Antisense Effects of PNA Oligomers

[00115] An experimental reporter system that provides a sensitive measure of genetically targeted antisense activity was developed. A strategy that has been validated and studied extensively by KoIe and his colleagues (5,6,16) was used. Following an approach described by Kang et al. (24), we created a CHO-Kl cell line that was engineered by stable transfection to express a modified luciferase gene, into which a mutant human β-globin gene intron-2 (IVS2-654), containing an aberrant alternative splice site, had been inserted. As shown by Kang et al., binding of an antisense oligo to the aberrant 654 splice site blocks incorrect splicing of luciferase pre-mRNA and promotes the effective expression of enzymatically active luciferase protein (as illustrated in Figure 4), thereby providing a sensitive measure of selective antisense activity. We chose to base our version of this antisense reporter system on CHO-Kl cells, rather than HeLa cells, as described by Kang et al.(24), because CHO-Kl cells have been used extensively in the past to study the pathobiology of Anthrax toxin and to characterize Anthrax PA receptors (25). In addition, we chose to use an IVS2-654 insert (Figure 4) for this reporter CHO cell line rather than the IVS2-705, as used by Kang et al., because the aberrant IVS2-654 alternative splice site is reportedly less temperature sensitive and has been extensively validated in other antisense reporter systems described by Sazani and KoIe et al. (5,16). Furthermore, antisense reagents that showed activity in a luciferase- βIVS2-654 antisense reporter system could be evaluated directly for their ability to correct defective β-globin gene expression in erythroid progenitor cells from patients with β-thalassemia caused by the IVS2-654 mutation (common among Asian populations), as well as in vivo in the transgenic βIVS2-654 thalassemia mouse, that was generated by Kole's lab and is available through Jackson Labs (26,27).

[00116] In order to create a CHO-Kl (IVS2-654) reporter cell line, the human β- globin intron-2 (IVS2) sequence was amplified by PCR using primer pairs: CGCTGCTGGGTGAGTCTATGGGACCCTT (SEQ ID NO 1) and AGGGTTGGCACTGTGGGAGGAAGATAAGAG (SEQ ID NO 2). The fruitfly luciferase gene was amplified from a pGL3-control vector (Promega Inc.) into two parts: a 5' part (5 '-Luc) with primer pair TACGATTTGTGCCAGAGTCCTTC (SEQ ID NO 3)and CCATAGACTCACCCAGCAGCGCACTTGAAT (SEQ ID NO 4), and a 3' part (3 '-Luc) with primer pairs: CCTCCCACAGTGCCAACCCTATTCTCCTTC (SEQ ID NO 5) and GCCCCGACTCTAGAATTACAC (SEQ ID NO 6). The PCR product from 5'-Luc was joined with the PCR product from IVS2 by PCR using franking primer pairs first, and the resulting PCR product was then joined with the 3 '-Luc, again by PCR using outer franking primer pairs. The final PCR product, called Luc-IVS2, was digested by BcI-I and Xba-I restriction enzymes, and then ligated to the BcI-I and Xba-I digested pGL3-control vector. The Luc-IVS2 gene insert was then released from pGL3-Luc-IVS2 by restriction enzymes Hind-III and Xba-I and inserted into a Hind-III and Xba-I digested pcDNA3 vector (Invitrogen Inc.). The resulting plasmid, called Luc-IVS2, was used as a positive control vector for correct splicing of luciferase. This plasmid was also mutated (C to T) at the 654 position to reproduce the βIVS2-654 thalassemia mutation by PCR using primer pairs TCTGGGTTAAGGTAATAGCAATA (SEQ ID NO 7) and TATTGCTATTACCTTAACCCAGA (SEQ ID NO 8). The PCR product was digested with Dpn-I, reannealed, and transformed into E.coli DH5a competent cells (Invitrogen Inc.). DNA sequencing was then used to confirm that the resulting plasmid (called Luc- IVS2-654) contained the luciferase gene interrupted by the mutant intron IVS2-654.

[00117] The Luc-IVS2-654 plasmid and the control Luc-IVS2 plasmid were transfected into CHO-Kl (CHO) cells separately using Effectene™ (Qiagen Inc.). These transfected CHO cells were then maintained and selected in F12K medium containing G418 (InvivoGen Inc.) at 400 μg/ml and supplemented with 10% fetal bovine serum, 2mM L-Glutamate, and 5OU of Penicillin/Streptomycin. Individual surviving cell colonies were picked from cultures after 10 days of G418 selection, and evaluated by a luciferase activity assay (Promega Inc.). One of four Luc-IVS2-654 CHO cell colonies, found to express background luciferase activity, was chosen for pilot studies of PNA antisense activity. Figure 5 shows the luciferase mRNA species detectable by rtPCR from four CHO cell clones expressing Luc-IVS2-654, as well as a control CHO cell clone expressing luciferase with the normal βIVS2 intron. Each of the Luc-IVS2-654 clones expressed some correctly spliced luciferase message as well as the incorrectly spliced message.

[00118] The ability of an antisense reagent directed at the βIVS2-654 aberrant splice site to promote luciferase expression in the Luc-IVS-654 transfected CHO cells was validated using an 18mer antisense phosphorothioate (PS) oligonucleotide with a sequence of GCTATTACCTTAACCCAG (SEQ ID NO 9), which is complementary to sequences flanking the βIVS2-654 site. A "sense" PS oligonucleotide, with sequence CTGGGTTAAGGTAATAGC (SEQ ID NO 10), was used as a control. As shown in Figure 6, when the antisense PS oligo was delivered into the Luc-IVS2-654 CHO cells at a fairly high concentration of 45 μM by a cell scraping transfection method (28), a clear up-regulation of luciferase expression was detectable after 48 hours' culture, while the "sense" control phosphorothioate oligonucleotide induced no change in luciferase expression.

Design of a Peptide Nucleic Acid (PNA) Antisense Oligomer

[00119] An analogous antisense PNA 18mer was synthesized for us by BioSynthesis, Inc. (Lewisville, TX), which included an eight lysine residue linked to the C-terminus of the oligomer. The sequence of this PNA construct was: GCTATTACCTTAACCCAG-O-(Lys)8 (SEQ ID NO 11). Like the PS antisense oligonucleotide described above, this PNA oligomer was designed to be complementary to an 18-nucleotide region of the β-globin intron-2 that flanked position 654. The base (A) that corresponds to the mutant T at this position is underlined. We added a polylysine residue to the PNA oligomer because of prior observations reported by Blanke et al. (22). These investigators found that a cationic (Lys)8 peptide residue at the C-terminus of the "catalytic" domain of diphtheria toxin (C-DT) permitted C-DT to interact with Anthrax PA and to effectively use PA as a vehicle for intracellular transport. A nonsense PNA 18mer, that also had a (Lys)8 peptide residue at its C-terminus, was synthesized in addition and used as a control.

[00120] As shown in panel A of Figure 7, the antisense PNA-(Lys)8 oligomer, when introduced into CHO Luc-IVS2-654 cells at a concentration of 1.0 μM by oligofectamine transfection, was found to block aberrant splicing of the luciferase message such that all the luciferase mRNA detected by rtPCR was of the correctly spliced form, while the control PNA oligomer had no effect. The antisense PN A-(Ly s) 8 oligomer also actively induced the expression of luciferase activity, while the control PNA oligomer did not, as shown in panel B of Figure 7.

Anthrax "Protective Antigen" (PA) Facilitates Entry of Peptide Nucleic Acid Oligomers into CHO Cells

[00121] Having validated the Luc-IVS2-654 CHO cells as a test system with which to detect specific antisense activity by oligonucleotide reagents, we proceeded with studies to determine whether the PN A-(Ly s) 8 oligomer that we had designed demonstrated Anthrax PA-dependent antisense activity. In these studies, we chose to use recombinant "nicked" 63 kD Anthrax PA. We found that neither PA-63 by itself, nor the "nonsense" PNA-(Lys)8 control oligomer, with or without PA, induced any significant change in luciferase expression by the Luc-IVS2-654 CHO cells under any condition of reagent dose or incubation time that was examined. However, as shown in Figures 8 and 9, the antisense PNA-(Lys)8 oligomer did increase luciferase expression by the cells in a time and dose dependent manner, and this effect was significantly enhanced by Anthrax PA-63.

[00122] It was anticipated that the antisense PNA-(Lys)8 oligomer would have some activity by itself at micromolar concentrations, as was observed, for it has been reported previously by Sazani et al. (5) that a short (Lys)4 residue added to the C- terminus of a PNA oligomer would allow for some cellular uptake of the PNA at such concentrations. However, as is indicated in Figures 7 and 8, cellular uptake of PNA , such that it can exert an antisense effect, is enhanced by Anthrax PA, and this enhancement increases with time.

[00123] As shown in Figure 9, incubation of cells with antisense PNA at concentrations as low as 30 nM caused detectable increases in luciferase expression if Anthrax PA-63 was present in the incubation medium. Furthermore, at each concentration of the antisense PNA-(Lys)8 that was tested (0.03 - l.OμM) there appeared to be an optimal concentration of Anthrax PA-63, 0.01 - 1.0 μg/mL, (lighter to darker hatched bars) at which this enhancement effect was observed. It is possible that the "nicked" 63 kD Anthrax PA could bind to the PNA-(Lys)8 oligomers regardless of whether they were attached to the surface of target Luc-IVS2-654 CHO cells, and hence excess PA-63 could sequester a portion of the PNA in solution, preventing it from entering the cells via PA-mediated transport.

Use of Fluorescence Confocal Microscopy to Detect Anthrax PA-mediated Cell Binding

[00124] In order to determine whether fluorescence confocal microscopy might be used to detect to detect Anthrax PA-mediated cell binding and endocytosis of fluorchrome labeled PNA constructs, we first tested whether this technique could detect the binding and endocytosis of labeled Anthrax "Lethal Factor" (LF) by CHO cells when presented to the cells together with Anthrax PA. Studies illustrated in Figure 10 validated this technique. For these studies we labeled recombinant, mutant (non-toxic) Anthrax LF (Lfm) with the long wavelength fluorochrome, Alexa Fluor-594 (Molecular Probes, Eugene, OR) and incubated it at a concentration of 1.0 μg/mL with adherent CHO-Kl cells on a microscope stage, with or without Anthrax PA-63 (2.0 μg/mL). In the absence of Anthrax PA, there was no evident binding of fluorochrome-labeled LFm to the cells during observation periods of up to 2 hours. However, with PA, cell surface binding of labeled LFm was evident within 30 min, followed by vesicular labeling indicative of endocytosis, as shown in the 120 min example in Figure 10.

[00125] These studies indicate that confocal fluorescence microscopy could be useful for examining the kinetics of Anthrax PA-mediated cell binding and intracellular distribution of fluorochrome labeled PNA oligomers.

[00126] The preliminary studies described above show that Anthrax PA can serve as an intracellular transport vehicle for genetically targeted antisense PNA oligomers into cells. In these studies, using a simple PNA construct, PNA-(Lys)8, it was possible to observe targeted antisense effects at nanomolar concentrations of PNA. Alternative modifications to PNA oligomers (as outlined below) and the use of recombinant, native Anthrax PA, as opposed to "nicked" PA-63 may enhance the kinetics and/or efficiency of PA-mediated intracellular delivery of PNA reagents. Furthermore, since Anthrax PA is a biocompatible protein and, given its intrinsic stability, PNA is also likely to be biocompatible in vivo, there is a reasonable chance that PA-mediated delivery of PNA reagents to cells can occur in vivo such that PNA reagents might be shown to correct aberrant β-globin gene expression in an animal model of human β IVS2-654 thalassemia to a detectable degree.

[00127] We have produced a number of CHO-Kl cell lines that have been engineered to express a luciferase gene interrupted by a mutant human β-globin gene intron-2 (IVS2-654) and shown that it works as taught. Cell lines such as this, with which one can measure specifically targeted antisense effects on alternative splicing of mRNA, are particularly relevant to potential therapeutic applications of genetically targeted reagents. It has been estimated that about 60% of human genes are regulated through alternative splicing (6), and mutations that result in splicing abnormalities during mRNA processing are common among recognized mutations of globin genes that cause thalassemias (6). The IVS2-654 mutation, which was used in the Luc-IVS2-654 CHO cell lines that we have produced and was also used in EGFP-IVS2-654 reporter cell lines described by Sazani et al. (5), is among the more common causes of β-thalassemia in Asian populations (27).

[00128] In the cell line as shown in Figure 7, the proportions of aberrantly spliced and correctly spliced luciferase mRNA are roughly equal, such that the maximum antisense splicing effect that can be achieved is ~ 100% above background. Additional clones of the Luc-IVS2-654 CHO cells are screened in order to identify cells in which the expression of aberrantly spliced luciferase mRNA may be more dominant than that of the correctly spliced message, for such cells should be more robust as reporters of antisense effects. An alternative HeLa cell luciferase reporter line from GeneTools (Portland, OR), which was produced and described by Kang et al. (24) may also be utilized. This reporter cell line expresses a luciferase gene interrupted by a separate β-globin intron-2 mutation, IVS2-705. PNA antisense oligomers are introduced into the cells by Anthrax PA- mediated transport. Finally, PNA-mediated antisense in another potential reporter cell line that is available to us, i.e. a T-cell lymphoma line (HUT102/6TG originally obtained from ATCC), which was stably transfected with a pTracer-CMV2 vector carrying the "green fluorescent protein" (GFP) and which expresses GFP constitutively (as shown by FACS analysis in Figure 11) is evaluated. This cell line is used to determine if PA- mediated suppression of GFP expression by antisense PNA reagents, targeted to the 5' UTR of the GFP mRNA, can be detected.

Studies to evaluate the dose limitations and kinetics of cell delivery of antisense PNA reagents mediated by Anthrax PA.

[00129] The number of toxin molecules (e.g. diphtheria toxin) that must be delivered to cells in order to exert a lethal effect upon the cell appears to be small. Hence, the efficiency of transmembrane transport mediated by the T-domain of a toxin, such as in Anthrax PA, may be limited. This is an important consideration in evaluating the feasibility of using Anthrax PA as a vehicle for the cellular delivery of PNA oligomers or other genetically targeted reagents. We have already shown that PA- mediated transport of antisense PNA-(Lys)8 induces detectable effects on the alternative splicing of a reporter gene at concentrations as low as 30 nM PNA, and that such effects increase with time. Since PNA oligomers appear to be very stable, it is reasonable to suppose that such reagents will accumulate over time. Also, as discussed above, the efficacy of "nicked" 63 kD Anthrax PA, as used in our preliminary experiments, may be different from native 83 kD PA with respect to the delivery of PNA reagents into cells may be different.

[00130] Reporter cells (i.e. Luc-IVS2-654 CHO cells and Luc-IVS2-705 HeLa cells) are treated with PNA constructs at varying concentrations from 1.0 to 0.001 μM with or without PA-63 or PA-83 at concentrations of 1.0 to 0.01 μg/mL and cultured for up to 8 days (with passage every 2-3 days) and collected at different time points. The Luciferase activity in cell extracts is monitored. In addition, RNA is extracted from cells that have been cultured under different conditions of PNA and PA dose and collected at different time points. Luciferase mRNA is detected by rtPCR, using primer pairs TTGATATGTGGATTTCGAGTC (SEQ ID NO 12) and

TGTCAATCAGAGTGCTTTTGG (SEQ ID NO 13), as described above. The relative intensity of correctly spliced and aberrantly spliced RNA bands developed by PVR and resolved on an agarose gel is measured by quantitative image analysis. Cells are cultured in 24 or 96 well plates at initial plating concentrations of 1.0-1.5 x 10³/100μL and passed prior to reaching confluency in the culture plates. For cultures of > 2 days, cells are diluted to the initial seeding concentration and replated in fresh medium with fresh PA and PNA reagents every 48 hours.

Studies to evaluate the effects of antisense PNA oligomer constructs with varying peptide adducts

[00131] The ligation of a portion of Anthrax "lethal factor" (LF), containing the PA binding site together with a sequence referred to as the "entry motif (shown in Figure 3), to an antisense PNA oligomer might result in more efficient PA-facilitated delivery of the PNA into target cells. It will also be of interest in this regard to replace the (Lys)8 adduct with the short peptide sequence of the "entry motif of Anthrax LF (Figure 12) and to determine if PA-facilitated cell delivery of the PNA construct is preserved and enhanced. Because the antisense effect of a PNA oligomer on mRNA splicing depends in part on the ability of the PNA reagent to gain access to the nucleus of the cell once it has entered the cytosol, we will assess the effects of adding a nuclear localization signal peptide to the N-terminus of antisense PNA-(Lys)8 and or other PNA constructs that demonstrate PA-dependent effects on antisense reporter cells.

[00132] Antisense PNA oligomers with and without Lysine residues of differing lengths ([Lys]2 to [Lys]8) at the C-terminus are compared with respect to effective doses and timing of PA-dependent effects on antisense reporter cells. PNA oligomers to which the "entry motif peptide (29) of Anthrax LF (ERNKTQEEHLKE; SEQ ID NO 14) instead of or in addition to a (Lys)8 residue is evaluated in this regard. Because PNA oligomers are synthesized on a peptide sythesizer, it will be possible for these constructs to be generated by direct synthesis, as was the case with the PNA-(Lys)8 constructs that we have studied. The effects of replacing the (Lys)8 adduct with a nuclear localization signal peptide (PKKKRKV; SEQ ID NO 15) (18) is also evaluated. In separate studies, two forms of Anthrax Lethal Factor (LF) are ligated to antisense PNA oligomers and evaluated as carriers for PA-facilitated delivery of PNA into cells. One of these is the amino terminal domain of LF (LFn; residues 1-255) and the other is non-active, mutant full length LF (LFm). Both LF polypeptides genes are expressed as recombinant proteins using the IMPACT-CN intein-fusion protein system (New England Biolab). After the fusion proteins are purified with chitin-beads, on-column cleavage is induced and recombinant LFn or LFm is eluted from the column without the intein tag. These recombinant proteins have a thioester group at the C-terminus, which allows ligation with a cysteine-PNA via a native peptide bond as described by Tarn et al. (80) and the New England Biolab IMPACT-CN manual.

Studies of Anthrax PA-facilitated delivery of PNA reagents using confocal fluorescence microscopy

[00133] Fluorescence microscopy could complement the functional gene expression data by providing visual data relevant to the kinetics of cellular uptake and intracellular distribution of active PNA reagents.

[00134] Active PNA constructs are labeled with a long wave-length fluorochrome (Alexa Fluor-594) using the labeling protocol developed by the supplier, Molecular Probes, and the character of cell binding and intracellular distribution of labeled PNA constructs during the initial 5 hours of exposure to target CHO cells is monitored in real time by a confocal fluorescence microscope with digitized image recording capability and a temperature controlled cell chamber adapted to the microscope stage. PNA constructs are also biotinylated. After varying times of incubation of these constructs with target CHO cells (up to 6 days), the cells are fixed and examined by fluorescence microscopy after treatment of the fixed cells with fluorochrome-labelled avidin.

Studies to determine the ability of antisense PNA reagents to induce hemoglobin A expression in erythroid progenitor cells carrying the β-thalassemia IVS2-654 aberrant splice mutation.

In Vitro studies of erythroid progenitor cells obtained from β -thalassemia patients with the IVS2-654 mutation

[00135] It has been shown previously by Lacerra et al. (26) that an antisense morpholino oligonucleotide directed at the aberrant splice site of β IVS2-654, when introduced by hydrodynamic sheer-stress transfection into circulating erythroid progenitor cells from a β -thalassemia patient with an IVS2-654/ β^E genotype, restored Hemoglobin A expression in these cells. It will be of considerable interest to determine whether this result can be reproduced using antisense PNA constructs that show PA-dependent antisense activity in Luc-IVS2-654 or Luc-IVS2-705 reporter cell lines.

[00136] β -thalassemia patients who carry the IVS2-654 or IVS2-705 mutations are identified. Erythroid progenitor cells are grown in vitro in 15 day cultures of blood mononuclear cells isolated by density gradients; these cultures are supplemented with recombinant erythropoietin and stem cell factor as described by Lacerra et al. (26). Antisense PNA reagents are incubated with the cells at concentrations shown to be effective in luciferase reporter cell assays, with and without recombinant Anthrax PA-83 or PA-63. Fresh medium containing cytokines, PA, and PNA reagents is added to the cultures on days 4, 8, and 12 of culture periods. Total cellular RNA is isolated as described above and 50-200 ng of RNA is analyzed for correctly spliced and aberrantly spliced β-globin mRNA by rtPCR, using forward and reverse primers as described by Lacerra et al. (26). Lysates of cultured mononuclear cells (1-3 x 10⁶ ), harvested after 15 days of culture, is also be analyzed for induction of hemoglobin A by immunoblotting of cellular protein following cellulose acetate electrophoresis using affinity purified anti- human Hgb IgG, again as described by Lacerra et al. (26).

In Vivo studies of Anthrax PA-dependent induction of hemoglobin A by antisense PNA reagents directed at the aberrant IVS2-654 splice site in transgenic β IVS2-654 thalassemia mice.

[00137] Transgenic β IVS2-654 thalassemia mouse, created by Lewis et al. (27) and deposited at Jackson Labs (Bar Harbor, ME), are available. This mouse model (Hbbth-4 /Hbb+) is a heterozygote carrying a human gene with the β IVS2-654 splice muation and the normal mouse β -globin locus. This mouse shows signs of a moderate form of β -thalassemia with decreased RBC counts and increased RBC destruction. In addition, as shown by Lewis et al. (27), PCR primers the human β -globin intron-2 can be used to distinguish correctly spliced and aberrantly spliced human β -globin mRNA. Using this animal model we plan to determine whether antisense PNA constructs directed at the mutant β -globin intron-2 (IVS2-654) that show selective, Anthrax PA-dependent antisense activity in Luc-IVS2-654 reporter cells (and/or in β IVS2-654 thalassemia erythroid cells) in vitro, also have such activities in vivo. As discussed above, because of the intrinsic stability of PNA-peptide constructs, it is anticipated that such reagents, like Anthrax PA, will have bioavailability when injected intravenously in this animal model.

[00138] Breeding pairs of Hbbth-4 /Hbb+ β -thalassemia mice are obtained from Jackson Labs (Strain Name: B6;129P2-Hbbtm2Unc/J, Stock Number: 003250). Heterozygote progeny are generated and their genotype confirmed by rtPCR of human β - globin mRNA extracted from blood cells, using primers as described by Lewis et al. (27). Mice homozygous for Hbbth-4 are known to be non-vaiable. Adult Hbbth-4 /Hbb+ heterozygote mice are treated for up to 3 weeks by weekly tail vein injection of candidate antisense PNA reagents with and without Anthrax PA-83 or PA-63 at doses calculated to achieve plasma concentrations of up to 100 nM PNA and 100 ng/mL PA. IP injections of reagents in solution (200 mL) may also be used as reported will be used, as reported by Sazani et al. (16). Blood samples are obtained from treated mice at days 7, 14, 21, and 28 for RBC counts and for analysis of β -globin transcripts in erythroid cells by rtPCR. [00139] We subsequently confirmed the phenomenon of PA-facilitated transport of PNA-(Lys)8 oligomers in two other cell systems. The first of these was a HeLa cell line that was stably transfected with an alternatively modified luciferase gene. This cell line (which was the model for the CHO cell line that we created) had been produced by Kang et al. (30) and available from GeneTools (Portland, OR). In this cell line the transfected luciferase gene was interrupted by a different aberrant βIVS2 mutation, IVS2-705, but as described above, effective antisense blockade of the aberrant 705 splice site permitted active luciferase to be expressed. We designed an antisense PNA-(Lys)8 18mer directed at the mutant 705 site and arranged for it to be synthesized for us. As shown in Figure 13, this PNA construct had limited activity by itself when incubated with the HeLa reporter cells for 96 hours, but this activity was again significantly enhanced when the antisense PNA was incubated with the cells together with Antrax PA.

[00140] We also had an opportunity to obtain a blood sample from a patient in Hong Kong with β-thalassemia intermedia who had an IVS2-654(β°)/β^E genotype and was not being managed with transfusion therapy. This blood sample was generously obtained and shipped to us on ice via FedEx by Dr. Edmond Ma at the Queen Mary Hospital of the University of Hong Kong, arriving at our lab within ~48 hrs. We separated light density mononuclear cells from the blood sample by density gradient centrifugation and then cultured the cells with recombinant erythropoietin (EPO) and c- Kit ligand (SCF), as described by Lacerra et al. (33). Fresh medium containing cytokines + antisense PNA-(Lys)8 (0.3 μM), + Anthrax PA (0.3 μg/mL) was added on days 8 and 12 of culture, and cells were harvested on day 15. Although the numbers of cells harvested from the 4 experimental conditions studied were limited, we were able to isolate RNA from the cells, and, using radiolabeled rtPCR and forward and reverse primers flanking the β-globin IVS2 intron site, again as described by Lacerra et al., we were able to investigate whether correction of aberrant IVS2 splicing had been induced under any of the experimental conditions tested. As shown in Figure 14, the antisense PNA oligomer by itself had no effect on the aberrant β-globin splice defect. However, when this reagent was presented to erythroid precursor cells in culture together with PA, induction of correctly spliced β-globin transcripts occurred. Numbers of cells harvested from cultures in this preliminary study were insufficient to permitprotein extraction for a study of Hgb A induction; however, these data indicate that delivery of genetically targeted PNA oligomers by Anthrax PA occurs in human erytliroid precursor cells and is not a phenomenon restricted to artificial cell line models, as described above.

[00141] All references described herein are incorporated herein in their entirety.

REFERENCES

1. Braasch DA, Corey DR. Novel antisense and nucleic acid strategies for controlling gene expression. Biochemistry 41:4503, 2002.

2. Sazani P, Vacek MM, KoIe R. Short-term and long-term modulation of gene expression by antisense therapeutics. Curr Opin Biotechnol 13:468, 2002.

3. Gewirtz AM, Sikol DL, Ratajczak MZ. Nucleic acid therapeutics: state of the art and future prospects. Blood 92:712, 1999.

4. Ray A, Norden. Peptide nucleic acid (PNA): its medical and technical applications and promise for the future. FASEB J 14:1041, 2000.

5. Sazani P, Kang S-H, Maier MA, Wei C, Dillman J, Summerton J, Manoharan M, KoIe R. Nuclear antisense effects of neutral, anionic and cationic oligonucleotide analogs. Nucleic Acids Res 29:3965, 2001.

6. Sazani P, KoIe R. Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J Clin Invest 112:481, 2003.

7. Boulme F, Freund F, Moreau S, Neilsen PE, Gryaznov S, Toulme J-J, Litvac S. Modified (PNA, 2'-O-methyl and phosphoramidate) anti-TAR antisense oligonucleotides as strong and specific inhibitors of in vitro HIV-I reverse transcription. Nucleic Acids Res 26:5492, 1998.

8. Stein CA. Keeping the biotechnology of antisense in context. Nature Biotechnol 17:209, 1999.

9. Sohail M, Southern EM. Selecting optimal antisense reagents. Adv Drug Delivery Rev 44:23, 2000.

10. Stein CA. Two problems in antisense biotechnology: in vitro delivery and the design of antisense experinients.Biochim Biophys Acta 1489:45, 1999.

11. Eckstein F. Phosphorothioate oligodeoxynucleotides: what is their origin and what is unique about them? Antisense Nucleic Acid Drug Dev 10:117, 2000.

12. Summerton J. Morpholino antisense oligomers: the case for an RNase H- independent structural type. Biochem Biophys Acta 1489:141, 1999

13. Neilsen PE, Eghom M, Berg RH, Buchardt O. Sequence selective recognition of DNA by strand displacement with a thymine substituted polyamide. Science 254:1497, 1991.

14. Koppelhus U, Neilsen PE. Cellular delivery of peptide nucleic acid (PNA). Adv Drug Delivery Rev 55:267, 2003. 15. Moligni L, LeCoutre P, Neilsen PE, Gambacorti-Passerini c. Additive antisense effects of different PNAs on the in vitro translation of the PML/RARa gene. Nucleic Acids Res 26:1934, 1998.

16. Sazani P, Gemignani F, Kang S-H, Maier MA, Manoharan M, Persmark, Bortner D, KoIe R. Systemically delivered antisense oligomers upregulate gene expression in mouse tissues. Nature Biotechnol 20:1228, 2002.

17. Mercante DR, Mohler JL, KoIe R. Cellular response to an aantisense- mediated shift of Bcl-x pre-mRNA splicing and antineoplastic agents. J Biol Chem 277:49374, 2002.

18. Cutrona G, Carpeneto EM, Ulivi M, Roncella S, Landt O, Ferrarini M, Boffa LC. Effect in live cells of a c-myc anti-gene PNA linked to a nuclear localization signal. Nature Biotechnol 18:300, 2000.

19. Naglich, JG, Matherall, JE, Russell, DW, & Eidels L. Expression cloning of a diphtheria toxin receptor: identity with a heparin-binding EGF-like growth factor precursor. Cell 69: 1051, 1992.

20. VanderSpek JC, Mindel J, Finkelstein A, & Murphy JR. Structure function analysis of the transmembrane domain of the interleukin-2 receptor targeted fusion toxin DAB389IL-2: The amphipathic helical region of the transmembrane is essential for the efficient delivery of the catalytic domain to the cytosol of target cells. J Biol Chem 90: 8524, 1993;.

21. Wesche, J, Elliott, JL, Falnes, PO, Olsnes, S, Z& Collier, RJ. Characterization of membrane translocation by anthrax protective antigen. Biochemistry 37: 15737, 1998.

22. Blanke SR, Milne JC, Benson EL, Collier RJ. Fused polycationic peptide mediates delivery of diphtheria toxin A chain to the cytosol in the presence of anthrax protective antigen. Proc Natl Acad Sci (USA) 93:8437, 1996.

23. Williams, D, Parker, K, Bishai, W, Borowski, M, Genbauffe, F, Strom, TB, Murphy, JR. Diphtheria toxin receptor binding domain substitution with interleukin-2: genetic construction and properties of the diphtheria toxin- related interleukin-2 fusion protein. Protein Engn 1: 493, 1987.

24. Kang S-H, Cho M-J, KoIe R. Up-regulation of luciferase expression with antisense oligonucleotides: Implications and applications in functional assay development. Biochemistry 37:6235, 1998.

25. Escuyer V, Collier RJ. Anthrax protective antigen interacts with a specific receptor on the surface of CHO-Kl cells. Infect Immun 59:3381, 1991.

26. Lacerra G, Sierakowska H, Carestia C, Fucharoen S, Summerton J, Weller D, KoIe R. Restoration of hemoglobin A synthesis in erythroid cells from peripheral blood of thalassemic patients. Proc Natl Acad Sci (USA) 97:9591, 2000.

27. Lewis J, Yang B, Kim R, Sierakowska H, KoIe R, Smithies O, Maeda N. A common human β -globin splicing mutation modeled in mice. Blood 91 :2152, 1998.

28. Partridge M, Vincent A, Matthews P, Puma J, Stein D, Summerton J. A simple method for delivering morpholino antisense oligos into the cytoplasm of cells. Antisense Nucleic Acid Drug Dev 6:169, 1996.

29. Ratts R, Zeng H, Berg EA, Blue C, McComb ME, Costello CE, vanderSpek JC, Murphy JR. The cytosolic entry of diphtheria toxin catalytic domain requires a host cell cytosolic translocation factor complex. J Cell Biol 160:1139, 2003.

30. Tarn et al. Native chemical ligation. Science 266:776, 1994.

[00142] All references described herein are incorporated herein by reference in their entirety.

Claims

We claim:

1. A method for delivering oligonucleotides to a cell comprising: administering to the cell an oligonucleotide and an anthrax protective antigen (PA) or portion thereof that has cell membrane transport function.

2. The method of claim 1 , wherein the cell is in culture.

3. The method of claim 1 , wherein the cell is in a host.

4. The method of claim 1 , wherein the oligonucleotide is a peptide nucleic acid

(PNA).

5. The method of claim 1 , wherein the oligonucleotide is a short interfering RNA

(siRNA).

6. The method of claim 1, wherein the oligonucleotide is selected from the group consisting of a short interfering nucleic acid (siNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), morpholino oligonucleotide, pcDNA, aptamer, and pcPNA.

7. The method of claim 1, wherein the PA is about 63 kilodaltons.

8. The method of claim 1 , wherein the PA is about 83 kilodaltons.

9. The method of claim 1, wherein the oligonucleotide is linked to PA.

10. The method of claim 9, wherein the linkage is a covalent bond, an ionic bond, a chemical linkage, a conjugation, or is fused.

11. The method of claim 1 , wherein the cell is a human cell.

12. A method for selectively regulating gene expression in a cell in a host, wherein said method comprises: Express Mail Label No. EV 653001211 US

a. introducing a construct for transport across a cell membrane into said cell, said construct comprising an oligonucleotide and an anthrax protective antigen (PA) or portion thereof that has cell membrane transport function; and b. exposing said cell to the construct so that the construct is transported across, and permeates at least, the outer membrane of the cell.

13. The method of claim 12, wherein the target gene is β-globin from a patient with β-thalassemia.

14. The method of claim 12, wherein the cell is in vitro.

15. The method of claim 12, wherein the cell is in vivo.

16. The method of claim 12, wherein the oligonucleotide is a peptide nucleic acid (PNA).

17. The method of claim 12, wherein the oligonucleotide is a short interfering RNA (siRNA).

18. The method of claim 12, wherein the oligonucleotide is selected from the group consisting of a short interfering nucleic acid (siNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), morpholino oligonucleotide, pcDNA, aptamer, and pcPNA.