WO2006048778A1 - Markers of predisposition to addictive states - Google Patents

Abstract

The invention relates to a polymorphism in the dopamine transporter gene that is linked to the response of a subject to a challenge to the dopamine and related neurotransmitter systems. In particular, the invention relates to methods of diagnosing whether a subject is susceptible or predisposed to an addictive state such as cocaine abuse. In other embodiments, the methods may be used for diagnosis and/or prognosis of a neurological disease state. The invention also provides methods of identifying compounds which modify the activity of the dopamine transporter gene. In addition, the invention allows differential clinical treatment regimes to be put in place for individuals carrying the susceptibility genotype(s).

Description

MARKERS OF PREDISPOSITION TO ADDICTIVE STATES

FIELD OF THE INVENTION

The present invention relates to a polymorphism in the dopamine transporter gene that is linked to the response of a subject to a challenge to the dopamine and related neurotransmitter systems. In particular, the present invention relates to methods of diagnosing whether a subject is susceptible or predisposed to an addictive state such as cocaine abuse. Furthermore, the present invention provides methods of identifying compounds which modify the activity of the dopamine transporter gene. In addition, the present invention allows differential clinical treatment regimes to be put in place for individuals carrying the susceptibility or protective genotype(s).

BACKGROUND OF THE INVENTION

Cocaine is a highly addictive pyschostimulant that causes sensations of euphoria and craving, resulting in physiological as well as psychological damage. Although cocaine use leads to a multitude of physiological complications, its primary target of action is the central nervous system. Cocaine withdrawal following abstinence causes, among other symptoms, an intense craving for the abused drug, which in turn frequently results in the relapse into renewed drug use. Epidemiological studies point to a high incidence of multiple substance abuse among cocaine users, a finding that has significant societal and medical repercussions.

It has been found that addictive drugs such as nicotine, cocaine, amphetamine, methamphetamine, ethanol, heroin, and morphine enhance (in some cases directly, in other cases indirectly or even trans-synaptically) extracellular dopamine (DA) levels within the mesotelencephalic reward/reinforcement circuitry of the forebrain, presumably producing the enhanced brain reward that constitutes the drug user's "high". Alterations in the function of these DA systems have also been implicated in drug craving and in relapse to the drug-taking habit in recovering addicts. For example, cocaine acts on these DA systems by binding to the dopamine transporter (DAT) and preventing DA reuptake into the presynaptic terminal. The increased concentration of extracellular dopamine results in elevated stimulation of neurons in brain regions related to reward and reinforcement behaviour, thus explaining cocaine's pleasurable and addictive effects (Ritz et al., 1987).

The dopamine transporter is a principal regulator of dopaminergic neurotransmission. Dopamine is a key neurotransmitter in brain areas involved in movement and behaviour, particularly reward pathways. The gene encoding DAT (SLC6A3) consists of 15 exons and regulatory elements spanning ~60kb on chromosome 5pl5.3 (Vandenbergh et al., 1992). Studies have assessed possible associations between variants in the dopamine transporter and psychiatric disorders. However, the majority of these studies have examined only one or two polymorphisms in the gene and have thus only captured part of the genetic information contained within the gene.

The most widely studied DAT polymorphism is a 40-bp variable number tandem repeat (VNTR) in the 3 'untranslated region (UTR) of the gene with repeat copy numbers ranging from three to eleven (Vandenbergh et al., 1992). Numerous studies have investigated association between alleles and/or genotypes of the 3'UTR-VNTR and clinical phenotypes thought to be related to dysregulation of dopamine transmission, such as attention deficit hyperactivity disorder (Chen et al., 2003), Parkinson's disease (Le Couteur et al., 1997), schizophrenia (Persico et al., 1997), cocaine-induced paranoia (Gelernter et al., 1994), severity of alcohol withdrawal (Sander et al., 1997) and methamphetamine-induced psychosis (Ujike et al., 2003). However, the functional effect of this polymorphism is uncertain as the data do not indicate a consistent effect of different alleles and genotypes on gene expression (Martinez et al., 2001 ; Michelhaugh et al., 2001).

Family and twin studies suggest a substantial genetic component in the vulnerability of individuals to become dependent after exposure to drugs such as cocaine (Merikangas et al., 1998; Bierut et al., 1998; Kendler et al., 1998). As a result, there is a need to identify genetic factors which contribute to addictive state and/or neurological disorders. Once identified, these factors can be exploited as markers for, inter alia, detecting an individuals' vulnerability to additive states such as cocaine abuse or likelihood of response to certain types of treatment for addiction such as drug replacement therapy or counselling.

SUMMARY QF THE ENTVENTION

The present inventor has identified a 30bp VNTR located in intron 8 of the dopamine transporter gene which is associated with additive states such as cocaine abuse.

Thus, in a first aspect the present invention provides a method of diagnosing whether a subject is susceptible or predisposed to an addictive state, the method comprising determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

The addictive state can be any chemical or environmental induced condition where the subject is unable to, or has difficulty in, controlling their actions. In most instances, the addictive state will be the uncontrollable desire to consume mind altering and/or harmful chemicals (drugs) typically resulting from the prolonged use of the chemical. Drug addiction is well known, and includes, but is not limited to, cocaine or crack, smoking or other tobacco/nicotine use, alcohol, kat, food, caffeine, ecstasy, opium, heroin, marijuana, amphetamine, methamphetamine, and/or addictive compounds related to any of the above.

In a preferred embodiment, the addictive state is cocaine abuse.

With regard to food, it is preferred that the addictive food is selected from, but not limited to, high sugar containing foods, high fat containing foods, and/or chocolate. However, the invention can also be used to diagnose whether a subject is susceptible or predisposed to a non-chemically induced behavioural addictive state. An example of such a non-chemically induced behavioural addictive state is gambling.

The present inventor examined a number of alleles and genotypes of the 30bp tandem repeat of intron 8 of the dopamine transporter gene. Allele 2 (5 copies of the repeat) and allele 3 (6 copies of the repeat) represent about 90% of the alleles analysed. To date, only one "common" genotype (namely, found in a relatively large number of individuals) has been shown to have a clear link to a subject's susceptibility or predisposition to an addictive state, namely an individual homozygous for allele 3. Thus, in a preferred embodiment, a subject is susceptible or predisposed to an addictive state if they are homozygous for an allele of the dopamine transporter gene which comprises 6 copies of the 30bp tandem repeat in intron 8. On the other hand, individuals who are homozygous for allele 2 or, particularly, heterozygous for alleles 2 and 3, appear to be less susceptible or predisposed to an addictive state (at least when compared to individuals homozygous for allele 3).

Allele 4 (more than 6 copies of the repeat) and allele 5 (slightly larger than allele 4) of the intron 8 30bp tandem repeat represent 0.1-0.5% of observed alleles. Individuals heterozygous for alleles 4 or 5 when analysed together show a stronger predisposition (odds ratios of ~8 versus ~1.5) to an addictive state than individuals homozygous for allele 3 when compared with all other genotypes or with those containing allele 2. Allele 3 homozygotes, however, are up to 60% of the population whereas allele 4 heterozygotes are <1%.

Thus, in another embodiment, a subject is susceptible or predisposed to an addictive state if they possess an allele of the dopamine transporter gene which comprises more than 6 copies of the 30bp tandem repeat in intron 8. In an embodiment, a subject is susceptible or predisposed to an addictive state if they possess an allele of the dopamine transporter gene which comprises 6 to 9 copies of the 30bp tandem repeat in intron 8.

Preferably, both alleles of the 30bp tandem repeat in intron 8 of the subject are analysed.

The present invention does not discount the possibility that upon the analysis a sufficient number of individuals with other rarer alleles, an association may be found with another genotype and increased or decreased susceptibility or predisposition to an addictive state. Considering the present disclosure, the skilled person could readily perform such further analysis upon obtaining a suitable number of samples.

Data provided herein suggests that alleles 30bp tandem repeat of intron 8 of the human dopamine transporter gene may impact upon the function of the gene. However, the present invention also encompasses the possibility the 30bp tandem repeat is linked to a functional polymorphism either in the DAT gene, or a gene in close proximity thereto.

Dopamine transporter activity has also been reported to be associated with an individual's susceptibility or predisposition to numerous neurological conditions. Thus, in a further aspect, the present invention provides a method of diagnosing whether a subject is susceptible or predisposed to a neurological disease linked to dopamine transporter activity, the method comprising determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

The neurological condition can be any disease known, or found to be, associated with activity of the dopamine transporter. Examples include, but are not limited to, attention deficit hyperactivity disorder, Parkinson's disease, schizophrenia, manic depression, and the psychoses. In addition, the intron 8 30bp tandem repeat may influence normal personality traits or gene/environment interactions.

In a preferred embodiment, at least one of the 30bp tandem repeats comprises the sequence GTGTCTGAGTGTGTATGTTGCATGGTATGT (SEQ ID NO:1), GTGTCTGTGTGTGTATATTGCATGGTATGT (SEQ ID NO:2), TGTGTCTGTGTGTGTATATTGCATGGTATG (SEQ ID NO:3), or

TGTGTCTGAGTGTGTATGTTGCATGGTATG (SEQ ID NO:4). Naturally, the repeat units can also be represented as the reverse complement of these sequences.

The methods of diagnosis of the invention can be performed by any means known in the art for detecting polymorphisms, particularly variable number tandem repeat polymorphisms.

In a preferred embodiment, the methods comprise amplifying the region of the genome comprising the 30bp tandem repeat within intron 8 of the dopamine transporter gene. Preferably, the amplification is performed using the polymerase chain reaction.

Alternatively, or in addition to amplification, the methods comprise sequencing the region of the genome comprising the 30bp tandem repeats within intron 8 of the dopamine transporter gene.

Furthermore, the present invention includes the use of markers in linkage disequilibrium with the 30bp tandem repeat. Such markers can be used to indirectly characterize the genotype of an allele of the 30bp tandem repeat of intron 8 of the DAT gene, and can readily be identified using techniques known in the art. Thus, in another embodiment, the method comprises analysing the subject for a marker which is in linkage disequilibrium with an allele of the 30bp tandem repeat within intron 8 of the dopamine transporter gene.

The methods of the diagnosis of the invention will typically be performed on a sample obtained from the subject. The sample can be any biological material which comprises genomic DNA. Examples of such samples include, but are not limited to, blood, serum, plasma, hair follicles, buccal swab and saliva.

In a further aspect, the present invention provides an oligonucleotide which can be used in a reaction to amplify the region of the human genome comprising the 30bp tandem repeat within intron 8 of the dopamine transporter gene. Such oligonucleotides are useful in the methods of the invention.

Preferably, the oligonucleotide is greater than 12 nucleotides in length, hybridizes to a region of the human dopamine transporter gene within about 2kb of the 30bp tandem repeat of intron 8, and is capable of being used to amplify said region comprising said repeat. Examples of such oligonucleotides include, but are not limited to, those comprising a sequence selected from the group consisting of: CTTGGGGAAGGAAGGG (SEQ ID NO: 5), TGTGTGCGTGCATGTGG (SEQ ID NO:6), GCAAGGCTTCTGAACTGGTC (SEQ ID NO:7), CAGCAAAGCCTTTTTCCTTG (SEQ ID NO:8),

TCCATGCTTGCAACAGAAAG(SEQ ID NO:9), CTCCATGCTTGCAACAGAAA (SEQ ID NO: 10),

TCTGGCGTAGATGCTGTCAC (SEQ ID NO: 11), GTCTGGCGTAGATGCTGTCA (SEQ ID NO: 12), CTGGAGTTGTCTCCGAGAGG (SEQ ID NO: 13), CAGAGACCAAACTGCGTTGA (SEQ ID NO: 14), TCAGAGACCAAACTGCGTTG (SEQ ID NO: 15),

TTATCTCCGAAGCCACCATC (SEQ ID NO: 16),

CACCATAGAACCAGGCCACT (SEQ ID NO: 17),

AGGCACCTGACTCCTGCTTA (SEQ ID NO: 18),

GGCACCTGACTCCTGCTTAG (SEQ ID NO: 19),

AGGGGGATAAAGGGAAAGGT (SEQ ID NO:20),

TGACTCTGGGACCAAGCTCT (SEQ ID N0:21),

CTGTCCAGGTGCTGAAGTGA (SEQ ID NO:22),

AACAGGGACAGGAGGAAGGT (SEQ ID NO:23),

TTCCCTTCCTAGGGCTTCAT (SEQ ID NO:24),

TGTGTGCACATTTCCAGGAT (SEQ ID NO:25) and GCACACAGGTACCCCAGAGT (SEQ ID NO:26), or a complement thereof, or a variant thereof, or which hybridizes to the same region of the human dopamine transporter gene as the above.

Preferably, the oligonucleotide hybridizes to a region of the human dopamine transporter gene within about lkb, more preferably within about 500bp, even more preferably within about lOObp of the 30bp tandem repeat of intron 8.

In a further aspect, the present invention provides a kit for diagnosing whether a subject is susceptible or predisposed to an addictive state, the kit comprising at least one component for determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene. In another aspect, the present invention provides a kit for diagnosing whether a subject is susceptible or predisposed to a neurological disease linked to dopamine transporter activity, the kit comprising at least one component for determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

Preferably, a kit of the invention comprises at least on oligonucleotide, more preferably two oligonucleotides, of the invention.

Evidence suggests that more than six copies of 30bp tandem repeat within intron 8 of the dopamine transporter gene may result in different levels of gene expression in response to certain biochemical stimuli which may explain why, for example, individuals homozygous for allele 3 are more susceptible or predisposed to an addictive state. This observation means that assays can be designed using the 30bp tandem repeat within intron 8 of the dopamine transporter gene to identify compounds which can be used to treat an addictive state.

Thus, in a further aspect, the present invention provides a method of identifying a compound which modifies the activity of a 30bp tandem repeat within intron 8 of the dopamine transporter gene, wherein there are more than six copies of the repeat, the method comprising, a) providing a construct comprising more than six repeats and a reporter gene, b) placing the construct in a cellular or cell-free expression system capable of expressing the reporter gene, c) exposing the expression system to a candidate compound, d) determining if the candidate compound decreases or inhibits reporter gene expression when compared to a control lacking more than six repeats, and e) selecting a compound that decreases or inhibits reporter gene expression. Preferably, the expression system comprises at least one stimulating factor. More preferably, the stimulating factors increases Ca²⁺ and/or cAMP signalling within a cell. Such factors are well known in the art and include KCl and/or Forskolin, and could include the direct use of addictive drugs such as cocaine or nicotine.

In another embodiment, the expression system further comprises cocaine, preferably cocaine hydrochloride.

In one embodiment, the construct defined in part a) comprises six repeats.

Preferably, the control is a construct comprising five repeats of the 30bp tandem repeat of intron 8 of the human dopamine transporter gene, and a reporter gene.

Preferably, the repeats are in an intronic position 5' relative to the reporter gene.

In a further aspect, the present invention provides a method of identifying a compound that binds to a 30bp tandem repeat within intron 8 of the dopamine transporter gene, the method comprising exposing a candidate compound to the repeat under suitable conditions, and determining whether the compound has bound the repeat. Considering the present disclosure, such a method could readily be performed by the skilled person. Also provided is a compound identified using a method of the invention. In an embodiment, the compound is a protein.

Individuals determined to be more susceptible or predisposed to an addictive state using the methods of the invention may need to treated in a different manner than those who are less susceptible or predisposed. This may include higher doses of the appropriate drug, longer treatment, alternative/additional drugs, increased patient monitoring or support and/or psychological interventions.

Accordingly, in a further aspect the present invention provides a method of treating an addictive state in a subject, the method comprising; i) performing a method of diagnosis of the invention, ii) determining the appropriate treatment based on whether the subject is predisposed to the addictive state, and iii) administering said treatment.

In another aspect, the present invention provides a method of treating a neurological disease in a subject, the method comprising; i) performing a method of the invention, ii) determining the appropriate treatment based on whether the subject is predisposed to the neurological disease, and iii) administering said treatment.

As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS Figure 1. Frequency of Int8-VNTR allele 2 and 3 in cases, controls and reference populations. Case and control allele frequencies (in % terms) for both samples. For comparison, the allelic distribution in two populations from the ALFRED database, "Europeans, Mixed" and African American, are also shown.

Figure 2. Genomic sequence around intron 8 of the human dopamine transporter gene (includes 3' end of intron 8, exon 9, and the 5' end of intron 9). Intron 8 VNTR highlighted. In this example, there is 6 copies of the repeat which is referred to herein as "allele 3". Figure 3. Genomic sequence of the 30bp repeat of intron 8 of different alleles of the human dopamine transporter gene. A) Sequencing results of an individual homozygous for allele 2. B) Sequencing results of an individual homozygous for allele 3. C) Sequencing results of a pool of 25 homozygous individuals for allele 2. D) Sequencing results of a pool of 25 homozygous individuals for allele 3.

Figure 4. Amplification products of various alleles the human of DAT gene comprising the VNTR of intron 8.

Figure 5. Expression of DAT Int8-VNTR alleles in expression constructs. A) Is a representation of the two reporter plasmids utilized. B) Provides the relative expression of DAT Int8-VNTR allele in different reporter construct orientations. Data is presented using unrecombined plasmid as a control in each experiment, the relative expression over the unrecombined plasmid yields a fold increase measure of activity. Cells were left for 48 hours post transfection before assay, each experiment was performed three times and in triplicate.

Figure 6. Differential expression of Intron 8 alleles when exposed to cocaine, no challenge and chemical stimuli.

KEY TO SEQUENCE LISTING

SEQ ID NO's 1 to 4 - Examples of repeat units of 30bp tandem repeats within intron 8 of the human DAT gene.

SEQ ID NO's 5 to 34 and 40 to 104 - Oligonucleotide primers.

SEQ ID NO:35 - Genomic sequence around allele 3 of intron 8 of the human dopamine transporter gene (includes 3' end of intron 8, exon 9, and the 5' end of intron 9).

SEQ ID NO:36 - Repeat units of allele 2 of intron 8 human DAT gene.

SEQ ID NO:37 - Repeat units of allele 3 of intron 8 human DAT gene.

SEQ ID NO:38 - Sequence obtained from pool of 25 homozygous individuals for repeat units of allele 2 of intron 8 human DAT gene.

SEQ ID NO:39 - Sequence obtained from pool of 25 homozygous individuals for repeat units of allele 3 of intron 8 human DAT gene.

DETAILED DESCRIPTION OF THE INVENTION

General Techniques and Definitions

Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry). Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley - Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all update s until present), and are incorporated herein by reference.

The "dopamine transporter gene" has been cloned and characterized in a number of mammalian species including humans (Schumtz et al., 2004). This gene has also been referred to in the art as DAT, DATl and SLC6A3. The human gene is present on chromosome 5 at 5pl5.3 and spans about nucleotide 1445909 to about nucleotide 1498545 of chromosome 5 (on the complement strain as determined by Schumtz et al., 2004). The human gene comprises 15 exons and 14 introns and is available as Genbank Accession No. NC_000005. The region of the human gene spanning the 30bp repeat of intron 8 is provided in Figure 2.

The term "30bp tandem repeat of intron 8 of the dopamine transporter gene", and variations thereof, refers generally to the region of the human DAT gene as highlighted in Figure 2. Allele 2 of the DAT gene comprises 5 copies of the repeat, one with the sequence GTGTCTGTGTGTGTATATTGCATGGTATGT (SEQ ID NO:2) and four copies of the sequence GTGTCTGAGTGTGTATGTTGCATGGTATGT (SEQ ID NO:1). Allele 3 of the DAT gene comprises 6 copies of the repeat, one with the sequence GTGTCTGTGTGTGTATATTGCATGGTATGT (SEQ ID NO:2) and five copies of the sequence GTGTCTGAGTGTGTATGTTGCATGGTATGT (SEQ ID NO:1). Due to the 5' and 3' sequences flanking the repeat the exact repeat unit is unclear, more specifically the above repeats can also be represented as TGTGTCTGTGTGTGTATATTGCATGGTATG (SEQ ID NO:3) and TGTGTCTGAGTGTGTATGTTGCATGGTATG (SEQ ID NO:4-) respectively. Both alternatives form part of the invention described herein. Whilst only two variants of the repeat have been detected thus far, it is possible that further minor sequence variations may exist. Such possible variations are also encompassed by the present invention as it is the repeat number that has been shown to be linked to the addictive state. The term "30bp" is used herein as an approximate term as repeat units may exist that are slightly shorter or longer than 30bp (for examples, 1, 2, 3, or 4 nucleotides shorter or longer). The present invention also includes the possibility that upon further study of the less common alleles (namely alleles other than 2 and 3) such as alleles 4 and 5 (see also Figure 4), at least some of these other alleles may be linked to, for example, cocaine abuse. Whilst the larger alleles described herein have been shown to be associated with addictive states and neurological diseases, there is the possibility that the deleterious alleles have a upper size limit after which their effect decreases such that alleles larger than allele 5 have a neutral or protective effect.

The term "allele" is intended to mean an alternative form of a genetic segment or a region of a gene of interest that provides a genetic indicator in accordance with the present invention. More specifically, an allele of the present invention is a form of the 30bp variable number tandem repeat (VNTR) region of intron 8 of the dopamine transporter gene.

A "polymorphism" as used herein denotes a variation in the nucleotide sequence between alleles of the locus of the invention, of different individuals.

The "sample" refers to a material which comprises the subject's genomic DNA. The sample can be used as obtained directly from the source or following at least one step to at least partially purify DNA from the sample obtained directly from the source. The sample can be prepared in any convenient medium which does not interfere with the methods of^" the invention. Typically, the sample is an aqueous solution or biological fluid as described in more detail below. The sample can be derived from any source, such as a physiological fluid, including blood, serum, plasma, buccal swab, saliva, sputum, ocular lens fluid, sweat, faeces urine, milk, ascites fluid, mucous, synovial fluid, peritoneal fluid, transdermal exudates, pharyngeal exudates, bronchoalveolar lavage, tracheal aspirations, cerebrospinal fluid, semen, cervical mucus, vaginal or urethral secretions, amniotic fluid, and the like. Herein, fluid homogenates of cellular tissues such as, for example, hair, skin and nail scrapings, meat extracts are also considered biological fluids. Pretreatment may involve preparing plasma from blood, diluting viscous fluids, and the like. Methods of treatment can involve filtration, distillation, separation, concentration, inactivation of interfering components, and the addition of reagents. The selection and pretreatment of biological samples prior to testing is well known in the art and need not be described further.

The term "diagnosis" or "diagnosing" refers to the identification of a disease or addictive state or a predisposition or susceptibility for developing a disease or addictive state in a mammal, based on, at least in part, a genetic indication thereof. Accordingly, the term "diagnosis" or "diagnosing" may encompass a prognosis.

As used herein, the term "subject" refers a mammal. Preferably, the mammal is a human.

"Linkage disequilibrium" refers to co-inheritance of two alleles at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given control population. The expected frequency of occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in "linkage disequilibrium". Preferably, a marker locus and intron 8 of the DAT gene are sufficiently close on a chromosome that they will be inherited together in more than 50% of meioses, e.g., not randomly. This definition includes the situation where the marker locus forms part of the DAT gene. Furthermore, this definition includes the situation where the marker locus comprises a polymorphism that is responsible for the trait of interest (in other words the marker locus is directly "linked" to the phenotype). In particular embodiments of the invention, genetically linked loci may be 45, 35, 25, 15, 10, 5, 4, 3, 2, or 1 or less cM apart on a chromosome. Preferably, the markers are less than 5 cM apart and most preferably about 0 cM apart.

As used herein, the term "gene" is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the protein coding region of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full- length mRNA. The sequences which are located 5' of the coding region and which are present on the mRNA are referred to as 5' non-translated sequences. The sequences which are located 3' or downstream of the coding region and which are present on the mRNA are referred to as 3' non-translated sequences. A genomic form or clone of a gene contains the coding region which is interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.

Genetic Screening

The genetic assays of the methods of the invention may involve any suitable method for identifying polymorphisms or markers in disequilibrium therewith, such as: sequencing of the DNA at one or more of the relevant positions; differential hybridisation of an oligonucleotide probe designed to hybridise at the relevant positions of the desired sequence; denaturing or non-denaturing gel electrophoresis following digestion with an appropriate restriction enzyme, preferably following amplification of the relevant DNA regions; Sl nuclease sequence analysis; non-denaturing gel electrophoresis, preferably following amplification of the relevant DNA regions; conventional RFLP (restriction fragment length polymorphism) assays; selective DNA amplification using oligonucleotides which are matched for the wild-type sequence and unmatched for the mutant sequence or vice versa; or the selective introduction of a restriction site using a PCR (or similar) primer matched for the wild-type or mutant genotype, followed by a restriction digest. As indicated above, the assay may be indirect, i.e. capable of detecting a polymorphism at another position or gene which is known to be linked to a polymorphism of the 30bp repeat of the DAT gene. The probes and primers may be fragments of DNA isolated from nature or may be synthetic.

In a particularly preferred method, a portion of the genome comprising the 30bp repeat of intron 8 of the DAT gene is amplified using suitable oligonucleotide primers such as those described herein. The amplified product(s) are separated by an appropriate procedure such as on a 1.5% agarose gel. Preferably, the procedure includes the analysis of control DNA samples, for example with one control sample comprising allele 2, another control sample that comprises allele 3, and a further control that comprises allele 4 and/or allele 5. Differences in the size of the products (which can be detected using techniques well known in the art such as staining with ethidium bromide) will readily identify if the individual tested is homozygous for allele 2, homozygous for allele 3, is heterozygous comprising both allele 2 and allele 3, or whether they have other alleles, such as allele 4 or allele 5, of the 30bp repeat of intron 8 of the DAT gene.

Amplification of DNA may be achieved by the established PCR methods or by developments thereof or alternatives such as the ligase chain reaction, QB replicase and nucleic acid sequence-based amplification.

In an alternative method, following amplification the products are sequenced. Preferably the products are sequenced without subcloning such that if two different alleles are present in the individual being tested their presence can easily be identified. If the products are subcloned a suitable number of subclones would need to be sequenced to ensure that both alleles have been analysed.

In order to facilitate subsequent cloning of amplified sequences, primers may have restriction enzyme sites appended to their 5' ends. Thus, all nucleotides of the oligonucleotide primers are derived from the gene sequence of interest or sequences adjacent to that gene except the few nucleotides necessary to form a restriction enzyme site. Such enzymes and sites are well known in the art. The primers themselves can be synthesized using techniques which are well known in the art. Generally, the primers can be made using synthesizing machines which are commercially available.

A non-denaturing gel may be used to detect differing lengths of fragments resulting from digestion with an appropriate restriction enzyme. The DNA is usually amplified before digestion, for example using the polymerase chain reaction (PCR) method and modifications thereof.

In another method, a pair of PCR primers are used which hybridise to one allele but not another. Whether amplified DNA is produced will then indicate which allele is present. Another method employs similar PCR primers but, as well as hybridising to only one of the alleles, they introduce a restriction site which is not otherwise there in any known allele.

PCR techniques that utilize fluorescent dyes may also be used to detect the genetic locus of interest. These include, but are not limited to, the following five techniques. i) Fluorescent dyes can be used to detect specific PCR amplified double stranded DNA product (e.g. ethidium bromide, or SYBR Green I). ii) The 5' nuclease (TaqMan) assay can be used which utilizes a specially constructed primer whose fluorescence is quenched until it is released by the nuclease activity of the Taq DNA polymerase during extension of the PCR product. iii) Assays based on Molecular Beacon technology can be used which rely on a specially constructed oligonucleotide that when self-hybridized quenches fluorescence (fluorescent dye and quencher molecule are adjacent). Upon hybridization to a specific amplified PCR product, fluorescence is increased due to separation of the quencher from the fluorescent molecule. iv) Assays based on Amplifluor (Intergen) technology can be used which utilize specially prepared primers, where again fluorescence is quenched due to self-hybridization. In this case, fluorescence is released during PCR amplification by extension through the primer sequence, which results in the separation of fluorescent and quencher molecules. v) Assays that rely on an increase in fluorescence resonance energy transfer can be used which utilize two specially designed adjacent primers, which have different fluorochromes on their ends. When these primers anneal to a specific PCR amplified product, the two fluorochromes are brought together. The excitation of one fluorochrome results in an increase in fluorescence of the other fluorochrome. Such assays may also use a ligase so that the two annealed primers joined together.

Oligonucleotides

Oligonucleotides of the invention hybridize to a dopamine transporter gene, preferably a human dopamine transporter gene, or a region of the genome of the subject genetically linked thereto, under stringent conditions. The term "stringent hybridization conditions " and the like as used herein refers to parameters with which the art is familiar. Nucleic acid hybridization parameters may be found in references which compile such methods, Sambrook, et al. {supra), and Ausubel, et al. {supra). For example, stringent hybridization conditions, as used herein, can refer, for example, to hybridization at 65 °C in hybridization buffer (3.5xSSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.5 niM NaH₂PO₄ (pH7), 0.5% SDS, 2 mM EDTA). Alternatively, the oligonucleotides (which may also be referred to as "primers" or "probes") hybridize to the region of the genome of interest under conditions used in nucleic acid amplification techniques such as PCR.

In one aspect, the present invention provides an oligonucleotide which can be used in a reaction to amplify the region of the human genome comprising the 30bp tandem repeat within intron 8 of the dopamine transporter gene. Preferably, the oligonucleotide is greater than 12 nucleotides in length, hybridizes to a region of the human dopamine transporter gene within 2kb of the 30bp tandem repeat of intron 8, and is capable of being used to amplify said region comprising said repeat. Examples of such oligonucleotides are described herein, however, other oligonucleotides for use in the methods of the invention can readily be produced by the skilled addressee. For example, the genomic region surrounding the 30bp tandem repeat of intron 8 of the human dopamine transporter gene (see Genbank Accession No. NC_000005) can be scanned and suitable oligonucleotides designed by the skilled person. Alternatively, genomic sequence surrounding the 30bp tandem repeat of intron 8 of the human dopamine transporter gene can be examined by a suitable computer program to design suitable oligonucleotides. An example of such a computer program is described by Rozen and Skaletsky (2000).

Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either. Although the terms nucleic acid and oligonucleotide have overlapping meaning, oligonucleotide are typically relatively short single stranded molecules. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a target nucleic acid molecule. Preferably, the oligonucleotides are at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, even more preferably at least 25 nucleotides in length.

Usually, monomers of a nucleic acid or oligonucleotide are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a relatively short monomeric units, e.g., 12-18, to several hundreds of monomeric units. Analogs of phosphodiester linkages include: phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate.

The present invention includes oligonucleotides that can be used as, for example, probes to identify nucleic acid molecules, or primers to produce nucleic acid molecules. Oligonucleotide of the present invention used as a probe are typically conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.

Oligonucleotides of the invention are useful in methods of diagnosing whether a subject is susceptible or predisposed to an addictive state. Such methods, for example, employ nucleic acid hybridization and in many instances include oligonucleotide primer extension by a suitable polymerase (as used in PCR). A variant of an oligonucleotide of the invention includes molecules of varying sizes of, and/or are capable of hybridising to the genome close to that of, the specific oligonucleotide molecules defined herein. For example, variants may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or less nucleotides as long as they still hybridise to the target region. Furthermore, a few nucleotides may be substituted without influencing the ability of the oligonucleotide to hybridise the target region. In addition, variants may readily be designed which hybridise close (for example, but not limited to, within 50 nucleotides) to the region of the genome where the specific oligonucleotides defined herein hybridise.

Assays Comprising Reporter Genes

In one aspect, the present invention provides a method of identifying a compound which modifies the activity of a 30bp tandem repeat within intron 8 of the dopamine transporter gene, wherein the method utilizes a construct comprising a reporter gene.

Reporter genes which may be used in accordance with the invention include those which encode a fluorescent product, such as green fluorescent protein (GFP), luciferase, or other autonomous fluorescent of luminescent proteins of this type or those which encode an enzyme product, such as for example chloramphenicol acetyl transferase (CAT), β- galactosidase and alkaline phosphatase, which is capable of acting on a substrate to produce a detectable product.

Reporter gene assays using reporter gene expression constructs are well known in the art and commonly used in the art to test the promoter activity of a given DNA fragment. They may also be adapted, as in the present invention, to screen for compounds capable of modulating gene expression.

The reporter gene expression construct is preferably incorporated into a replicable expression vector so that it may be conveniently introduced into a eukaryotic host cell. The eukaryotic host cell must be one which contains the appropriate transcription machinery for RNA Polymerase II transcription, and is preferably a cultured mammalian cell. In a preferred embodiment, the host cell is a cell type which is known to express DAT in vivo or is a transformed cell line derived from a cell type known to express DAT in vivo.

An expression vector may be inserted into the host cell in a manner which allows for transient transfection or alternatively may be stably integrated into the genome of the cell (i.e. chromosomal integration). Chromosomal integration is generally preferred for drug screening because the expression constructs will be maintained in the cell and not lost during cell division, also there is no need to separately control for the effects of copy number.

Stable integration of a reporter gene expression construct into the genome of eukaryotic host cell may be achieved using a variety of known techniques. The most simple approach is selection for stable integration following transfection of a host cell with a plasmid vector. As an example, a plasmid vector comprising a reporter gene expression construct consisting of the 30bp repeat of intron 8 of the DAT gene, a suitable promoter region, and also a gene encoding a dominant selectable marker, such as neomycin phosphotransferase, is first constructed using standard molecular biology techniques. The plasmid vector is then used to transfect eukaryotic host cells using one of the standard techniques such as, for example, lipofection. Following transfection stable cell lines in which the plasmid DNA has become randomly integrated into the chromosome are selected with growth on appropriate media. For plasmids carrying the neomycin phosphotransferase gene this is achieved using the antibiotic G418. Plasmid vectors suitable for use in the construction of stable cell lines are commercially available (for example the pCI-neo vector from Promega corporation, Madison Wis., USA).

Stable integration into mammalian chromosomes may also be achieved by homologous recombination, a technique which has been commonly used to achieve stable integration of foreign DNA into embryonic stem cells as a first stage in the construction of transgenic mammals. Stable integration into eukaryotic chromosomes can also be achieved by infection of a host cell with a retroviral vector containing the appropriate reporter gene expression construct.

Furthermore, as the skilled address will appreciate, cell-free expression systems can also be used in the method of drug screening of the invention.

It will be appreciated that a wide variety of compounds can be tested using the method of the invention to see whether they are capable of down-regulating reporter gene expression, and hence have potential pharmacological activity. The compound may be of any chemical formula and may be one of known biological or pharmacological activity, a known compound without such activity or a novel molecule such as might be present in a combinatorial library of compounds. The method of the invention may be easily adapted for screening in a medium-to-high throughput format.

Kits

In one embodiment, kits of the present invention include, in an amount sufficient for at least one assay, an oligonucleotide primer of the invention which preferentially hybridizes to a region of the DAT gene under hybridization assay conditions. The kit may also comprise other reagents useful in the methods of the invention such as a DNA polymerase, preferably a thermostable DNA polymerase, nucleotide precursors, and/or a suitable buffer. The kit may also comprise reagents for extracting genomic DNA from a sample.

Typically, the kits will also include instructions recorded in a tangible form (e.g., contained on paper or an electronic medium) for using the packaged oligonucleotide in a detection assay for determining the presence of the target nucleic acid sequence in a test sample. The assay described in the written instructions may include steps for isolating and purifying the target nucleic acid prior to detection with the amplifying a target sequence contained in the target nucleic acid. The instructions will typically indicate the reagents and/or concentrations of reagents and at least one assay method parameter which might be, for example, the relative amounts of reagents to use per amount of sample. In addition, such specifics as maintenance, time periods, temperature and buffer conditions may also be included.

EXAMPLES

Example 1 - Identification of a 30bp VNTR located in Intron 8 of the Dopamine

Transporter Gene which is associated with Addictive States

Methods Patients

Six hundred and ninety-nine cocaine abusers, 668 males, 31 females (mean age: 26.7 years; SD= 7.2) were ascertained (Turchi et al, 2002). The study group consisted of drug users who were in treatment from August 1997 to October 1998 in one outpatient and six inpatient units located in the city of Sao Paulo, Brazil. Inclusion criteria were: age 18 years and older, a history of cocaine abuse and under drug treatment at the selected centers. Individuals with another psychiatric diagnosis, such as psychosis, or a chronic physical illness such as diabetes or other metabolic disorders were excluded.

All current cocaine users were then interviewed using a structured interview to collect data on sociodemographic characteristics, sexual behaviors, and drug use profile. All subjects satisfied an ICDlO diagnosis of cocaine dependence. Blood samples were collected from all participants for genetic and other analyses. A total of 63.8% of the participants reported having smoked cocaine (crack) over the previous month and 51.5% had snorted cocaine over the same period. The overall lifetime prevalence for heroine use in the sample was <5% (Guindalini et al., submitted to BMC public health).

Controls

Eight hundred and sixty-six healthy controls, 592 males, 274 females (mean age: 31.7 years, SD=9.9), were recruited from the Blood Transfusion Unit of the Hospital das Clinicas, Faculty of Medicine, University of Sao Paulo. Each blood donor was screened using a short questionnaire investigating contagious diseases and the use of any kind of drag. Subjects with a past history of drug abuse or with recent use of an illegal drug were excluded. During the act of donation a short interview was conducted and subjects with a lifetime history of a psychiatric disorder requiring admission to hospital or suffering from a psychiatric condition at time of interview were excluded. Other Details

Ethnic classifications were determined by interviewer monitored self-report. Nine hundred and thirty-two individuals (500 cases, 432 controls; mean age 26.86, SD + 7.39 and 95% male; mean age 35.68, SD + 11.2 and 62% male, for cases and controls respectively) were classified as Brazilian Caucasian - that is of mixed European background (Italian, Portuguese, German). Six hundred eighteen individuals were classified as a Mixed Brazilian African/Caucasian group includes (195 cases, 423 controls; mean age 26.24, SD + 6.6 and 81%; mean age 36.19, SD + 10.6 and 74% male for cases and controls respectively). This group was of mixed European and African background. During the ascertainment of controls, care was taken to ensure the same ethnic classification was used, and that the sampling was from the same population groups in Sao Paulo.

All the subjects included in this study gave written informed consent and this project was approved by the Ethical Committee of University of Sao Paulo and other relevant local ethics committees.

VNTRs

In silico analyses of publicly available human DATl sequence (http://genome.ucsc.edu, July 2003 release, NCBI v.31) revealed a large number of genomic VNTRs in introns. The 40-bp 3' untranslated region VNTR (designated here as 3'UTR), and a VNTR in intron 8 (Int8) (also referred to herein as the "30bp tandem repeats within intron 8") of the gene were selected for the investigation.

In order to help estimate haplotype patterns of this region, we also selected a novel VNTR (37bp VNTR) located -10kb 3' to the 3'UTR VNTR and a putatively functional 15bp insertion/deletion polymorphism located in intron 14 of the gene (Indel_14; Greenwood et al, 2003). The 37 bp VNTR is described as a 6.1 copies of a 37 bp repetitive element polymorphism and the Int8 also as 6.1 copies but of a 30bp element in the Simple Repeat table of the Human Genome in the UCSC "Golden Path" database (http://genome.ucsc.edu; Benson et al., 1999).

The three markers were amplified by PCR (polymerase chain reaction) using the following conditions: 5' denaturation at 95°C; then 35 cycles of 1 min at 95⁰C, 1 min at 60⁰C and 1 min at 72°C. The oligonucleotide primers used were:

Int8-VNTRF: 5 'CTTGGGG AAGG AAGGG 3' (SEQ ID NO:5); M8-VNTR: 5'TGTGTGCGTGCATGTGGS' (SEQ ID NO:6); 3'UTR-VNTR-F: 5'TGGCACGCACCTGAGAGS' (SEQ ID NO:27); 3 'UTR-VNTR-R: 5'GGCATTGGAGGATGGGGS' (SEQ ID N0:2S); 37bp- VNTR-F: 5'CTTGCTTCCGCAGAGCTAATS ' (SEQ ID NO:29); 37bp- VNTR-R: 5'GGCACTTCCTGAGAGCAGAGS ' (SEQ ID NO:30). Amplification products were separated on 3% agarose gel containing ethidium bromide and visualized under UV light.

Alleles of the Int8 and 37bp VNTRs were called according to their relative size (smallest = allele 1) whereas the coding system utilizing the range from 3 to 11 copies was applied for the 40bp 3'UTR VNTR (Vandenbergh et al., 1992).

SNPs

In a previous study analyzing variation within DATl₅ Greenwood and colleagues (2002) selected a number of SNPs that span the gene from the distal promoter through the 3' UTR that are suitable for linkage disequilibrium analyses. We decided to genotype seven of these SNPs: rs2963238 (C/A) and rsll564752 (G/T) in intron 1, rs27048 (AIG) in lntron 8, rs6347 (A/G) in exon 9, rs6876225 (AJC) in intron 12, rsll564773 (AJG) in intron 14 and rs 1042098 in the 3'UTR of the gene.

Markers for Stratification Analysis

We selected 17 SNPs and 7 highly polymorphic microsatellites markers thai; exhibit large allele frequency differences among the three main Brazilian ancestral populations (Europeans, Africans and Native Americans; M Shriver, personal communication). Genotyping of all SNPs selected for this study was performed blind to status using an amplifluor assay, and was performed under contract by K-Biosciences (Cambridge, UK; http://www.kbioscience.co.uk/). The primers used for stratification analysis are provided in Table 1.

Statistical Analyses

Population substructure in the study sample was studied using the program LPOP (Purcell and Sham, 2004) to define clusters of ancestry similar individuals using nrultilocus genotypes. In order to identify the best model for the Brazilian population, we performed runs combining various available parameters in the program and different numbers of genetic clusters (K=I to K=IO) represented by the individuals genotyped.

Genotype and allele frequencies were compared using a χ² test, and p values were assessed using SPSS vlθ.0 and checked via simulation (CLUMP v.2.2; Sham and. Curtis, 1995). The role of other clinical variables was tested with ANOVA or a non-parametric test, as appropriate. GENECOUNTING software v.2.0 (Zhao, 2004, http://www.mds.qmw.ac.ulc/statgeri/dcurtis/software.html) and WHAP

(http://www.genome.wi.mit.edu/~shaun/whapΛ were used to estimate haplotype frequencies. Table 1. Primers used for stratification analysis.

Microeatellite_^ Primer F (5^3I Primer JR (5*-3'> ;

FAM GTGGCATAAATCAGGACCTCT GTTTCTTCCCCTTTTCTAGGTGGAATCT

D3S3045 (SEQ ID NO:40) (SEQ ID NO:41)

HEX GCCAGATACATGGCTAAGGAG GTTTCTTGGGCTGTATGGGCAAAGTAT

D4S2623 (SEQ ED NO:42) (SEQ ID NO:43)

HEX CATGTTTATAGAGCAGCCTTCC GTTTCTTAGGCATTTCTCTTTGCCTTT

D5S1501 (SEQ ID NO:44) (SEQ ID NO:45)

HEX GGGACACAGTTTAGAGAACAACA CTTTCGGTTTTTACCCTCTCA

D8SS60 (SEQ ID NO:46) (SEQ ID NO.47)

FAM TCCTCTTAGTGAGAAATGAGACCA AGGCCAAAGATAGATAGCAAGG

D13S285 (SEQ ED NO:48) (SEQ ID NO.49)

FAM CATTTTCTTCCCCCTTTCCT GGCAGCAGGAACTATACCATTT

D21S2055 (SEQ ED NO:50) (SEQ ID NO.51)

FAM CTGGAACAACTTCCAGCAGA GCACACACACTCACTCACACA

D22SU69 (SEQ ID NO:52) (SEQ ID NO:53)

K)

O

SNPs Primer NQR <S^r- 3^») Primer MUT (5¹- 3!) Primer COM (S' -3^»)

GCCCTCATTAGTCCTTGGCTCTTAT CCCTCATTAGTCCTTGGCTCTTAC GTCAGCGCCTGTGCTTCCAA rs2814778 (SEQ DD NO:54) (SEQ ID NO:55) (SEQ ID NO:56)

AGTGAGTTTTATAGTTTTGCATGTTTGCAT GTGAGTTTTATAGTTTTGCATGTTTGCAC TGGAAGTGAAAAGATGATAACCACCATC rsl506069 (SEQ BD NO:57) (SEQ ID NO:58) (SEQ ID NO:59)

GACCATAAGACACTATAGGCTTCG GGACCATAAGACACTATAGGCTTCA CCACAGTGTACCTCAACATGTAATATTGA rsl435090 (SEQ ID NO:60) (SEQ ID NO:61) (SEQ ID NO:62)

GAATAGTGCTGTGATATTCATGTTCTTGA GAATAGTGCTGTGATATTCATGTTCTTGT GGAGTAAGAGCAGGTAACTAAACCAG rsl861498 (SEQ ID NO:63) (SEQ ID NO:64) (SEQ ID NO-65)

AAATAACCTTAACTAAGACAACAACCCT AATAACCTTAACTAAGACAACAACCCG CATTCGCTCTTAAGTATGTTTTCTTGGTC τsl344870 (SEQ ID NO:66) (SEQ ID NO.67) (SEQ ID NO.68)

CGAGGACATCATGCCAAGTGGAA GAGGACATCATGCCAAGTGGAG ACAGTATTTGTCCTTTTGTGTCTGGCTTA rs2077681 (SEQ ID NO:69) (SEQ ID NO:70) (SEQ ID NO:71)

AAAGCAAACAGGATAATTGTCTTCATATG AATAAAGCAAACAGGATAATTGTCTTCATATA TTTGCCTCCTGCAAGATTCTCGATG rsl320892 (SEQ ID NO:72) (SEQ ID NO:73) (SEQ ID NO:74)

ACTTAGTTAAACTTATGATAATCCACTCTC CACTTAGTTAAACTTATGATAATCCACTCTT CAGAAGACAGATGGATCTCGGAGAA rsl987956 (SEQ ID NO:75) (SEQ ID NO:76) (SEQ ID NO:77)

TATACTGTCACCTAAGGTTGCTG CTTATACTGTCACCTAAGGTTGCTA GAGACACCCAGAGATGGAAGGC τsl980888 (SEQ ID NO:78) (SEQ ID NO:79) (SEQ ID NO:80)

GTTAAAAGGAGAACAACTATGATGCC CATGTTAAAAGGAGAACAACTATGATGCT CTCCAGGAATGGTCACCGCTGA rs2207782 (SEQ ID NO:81) (SEQ ID NO:82) (SEQ ID NO:83)

GGATTGTGCAATGCCAGACG GCTGGATTGTGCAATGCCAGACA ATACTTCATAGAGTCTTATCTTGCCAGG τsl891760 (SEQ ID NO:84) (SEQ ID NO:85) (SEQ ID NO:86)

GAATACTTCTTCATGTCTGAGTGATTATTA AATACTTCTTCATGTCTGAGTGATTATTC GGGAAATATCATCAATGCCATATTATTAGC rs2078588 (SEQ ID NO:87) (SEQ ID NO:88) (SEQ ID NO:89)

AGACCCAGCGCTGCGTAGG CTAGACCCAGCGCTGCGTAGA ACCTCTCGGTCAAATCTCCCGG rsll53849 (SEQ ID NO:90) (SEQ ID NO:91) (SEQ ID NO:92)

CCTCTTTCGCTCATGCACTTGAT CCTCTTTCGCTCATGCACTTGAG CACCACAGGCTCTTGATAAAGTGTC rsl369290 (SEQ ID NO:93) (SEQ ID NO:94) (SEQ ID NO:95)

GCCGTCATTTCTCTTGGGTACG TGCCGTCATTTCTCTTGGGTACA GACTCAGCAATTCCACTCCCAGATA rs386569 (SEQ ID NO:96) (SEQ ID NO:97) (SEQ ID NO:98)

GAACCCTTCATGGCATTCAATTCG GAACCCTTCATGGCATTCAATTCC CCAGTGGAAGAGTATTTCAAGAAAGAGA rs718092 (SEQ ID NO:99) (SEQ ID NO: 100) (SEQ ID NO: 101)

GACCTTTCCTATTTTTATTGTGGTTGTGA GACCTTTCCTATTTTTATTGTGGTTGTGT AACCTAGCAGTCTCGGGCATGG rsl415878 (SEQ ID NO: 102) (SEQ ID NO: 103) (SEQ ID NO: 104)

Odds ratios and 95% confidence intervals were derived from logistic regression. In addition, pair-wise LD was calculated using the LD pairs program from GC utilities (Zhao, 2004). Hardy Weinberg Equilibrium was tested by calculating a chi-square statistic with 1 degree of freedom for the SNPs and by using CLUMP, which uses simulations of the data to generate a distribution of χ2 statistics to assess the significance of the test derived χ2, for the multiallelic markers tested.

Comparison of Allele Frequencies with CEPH Diversity Panel Data

The Allele Frequency Database (ALFRED; http://alfred.med.yale.edu) (Howard et al., 2002), was used to access frequencies of intron 8 alleles in populations thought to be of most direct relevance to the current study: (1) the African- American panel and (2) the Europeans Mixed panel of US Caucasians for comparison with the observed allele frequencies in the Brazilian Caucasian and Mixed African/Caucasian groups.

Results

Initial Genotyping

The allele counts and frequencies are indicated in Table 2a, b, c, d for the Int8 VNTR, Indel_14, the 3'UTR VNTR and 37bp VNTR, respectively. No significant case-control difference was observed for either the 3'UTR (genotype-wise χ2= 14.4; d.f.=14; p>0.05), 37bp (χ2= 6.4; d.f,=6; p>0.05) VNTRs or Indel_14 (χ2=3.6; d.f =2; p>0.05). An association was found with cocaine abuse and the Int8 VNTR (χ2= 30.4; d.f.=12; p=0.002).

Stratification analysis using different parameter options in the LPOP program consistently indicated that a three population (K=3) model best fitted the data (AIC=I 14907). Other models, were also promising, such as a four population model (K=4; AIC=I 14923). However individuals in the three population model were assigned to the classes with posterior probability greater than for the four population model (data not shown). Moreover, posterior comparison demonstrated that this population substructure did not significantly differ among the cases and controls (^=3.8, d.f.=2; p=0.15).

For Int8, allele and genotype wise analyses were also assessed excluding the rare alleles and only considering genotypes 22, 23, and 33 (as they were >95% of the total alleles and genotypes observed). The individual probability of belonging to each of the three population groups indicated by LPOP was used as a covariate in the regression analyses. The allele-wise Odds Ratio (OR) was 1.19, with 95% confidence interval 1.03-1.36, p=0.014 and the genotypic odds ratios considering a recessive model for the 3 allele, e.g. 33 genotype versus 23 and 22, was 1.45, 95% CI 1.18-1.78, p=0.0008. Table 2. Most common allele numbers and frequency (%) of the 3 VNTRs and the Indel_14 polymorphism in Healthy Controls and Cocaine Abusers in the Brazilian sample.

The 4/5 allele association

Alleles 4 and 5 when combined as one category of the VNTR were found to be associated with cocaine dependence with OR=8.34 (1.00-184,48, p<0.05 on Fisher's exact test or simulations in Clump) versus allele 2. Individuals with genotypes containing alleles 4 and 5 represent 0.69% of cases and 0.14% of controls.

Comparison of Data with CEPH Diversity Panel Data

In an attempt to verify the influence of genetic stratification in the sample, it was decided to compare the allele frequencies of the intronδ VNTR between the Brazilian Caucasian group and Mixed African/Caucasian group with populations from the CEPH diversity panels using the ALFRED database (Howard et al., 2002) namely: 1. "Europeans, Mixed" - 44 samples collected by K. Kidd from unrelated individuals of European ancestry living in the United States and Canada - and

2. "African-American" - This sample is of 91 cell lines (182 chromosomes) from the NIGMS Cell Repository, Corielle Institute for Medical Research and was collected throughout the United States of America. These represent a broad cross-section of African Americans.

Figure 1 summarizes the results of the comparison. The frequency of the alleles in the Brazilian Caucasian group showed to be very similar to the Europeans Mixed population (70% versus 71% for the allele 3, respectively). The observed allelic distribution among the Brazilian Mixed African/Caucasian group was intermediate between the values for "Europeans, Mixed" and African American.

Additional Genotyping

Genotype and allele frequencies for the rs2963238, rsll564752, rs27048, rs6347, rs6876225, rsll564773 and rsl042098 SNPs did not show a significant difference between cases and controls (data not shown). In addition, both controls and cases were in Hardy Weinberg Equilibrium (p>0.05) for all SNPs and VNTRs tested. Additional clinical variables such as type of cocaine used, age of onset or sex did not show an association/interaction with the markers genotyped (data not shown).

Linkage Disequilibrium and Haplotype Analysis

The pairwise LD analyses (see Table 3) revealed a pattern of disequilibrium along the DAT gene similar to that reported by Greenwood et al. (2003). High levels of disequilibrium were observed between the two 3' VNTRs and SNP rs 1042098, the Indel_14 insertion/deletion, SNP rsl 15664773 in intron 14, together with SNP rs6876225 in intron 12 (D' > 0.6, pO.0001); and between the two SNPs located in the intron 1 (D'= 0.74, pO.0001). In addition, the Int8 VNTR, and SNPs in intron 8 and exon 9, revealed a third region of the gene with significant level of disequilibrium (D'> 0.7, pO.0001).

Haplotype analyses including all markers demonstrated a trend (pO.l) for association with cocaine abuse (LRT=24.28; d.f.=16; p=0.08). However when the Int8 VNTR was dropped from the analyses, no trend was observed (LRT=23.45; J/ =18; p=0.174).

Based on the LD results, we then analyzed haplotypes within each of these regions, separately, and tested their interaction with the intron 8 VNTR by removing and then adding it to the analysis. Haplotype 1 consists of 6 markers in the 3' region of the gene (3'UTR through intron 12), Haplotype 2 includes the three markers between intron 8 and exon 9, and Haplotype 3 comprises the two SNPs in the intron 1. Table 3. Pairwise LD Values - Absolute value of D'

Absolute value of D ¹

Marker's names and locations: 1- rsl 1564752 (intronl); 2-rs2963238 (intronl); 3- rs27048 (intronδ); 4-Int_8 VNTR (intronδ); 5- K) rs6347 (exon9); 6- rs6876225 (intronl2); 7-Indel_14 (intronl 4); 8- rsl 1564773 (intronl4); 9- rsl042098 (3'UTR); 10-3'UTR VNTR 5 (3 'utr); 11 -37bp VNTR (3 'UTR).

• Haplotype 1 did not show significant association with cocaine abuse (LRT=

12.75, p=0.12), however when the Int8 VNTR was added to the haplotype analyses, a positive association became evident (LRT=20.40, p=0.008).

• Moreover, analyses of Haplotype 2 (which includes the Int8 VNTR) demonstrated an association between these markers (LRT=14.77, p=0.02) and cocaine abuse, but when the Int8 VNTR was dropped from the haplotype, no association was observed with Haplotype 2 (LRT=2.33, p=0.49).

• Haplotype 3 did not demonstrate a significant association with cocaine abuse (LRT=0.31, p=0.85), but when the Int8 VNTR was added, a positive association was detected (LRT=I 0.55, p=0.03).

Genomic Sequence Analysis of the Alleles oflntron 8 of the Dopamine Gene Associated with Cocaine Abuse

The genomic sequence around intron 8 of the human dopamine transporter gene (includes the 3' end of intron 8, exon 9, and the 5' end of intron 9) as provided in Genbank Accession No. NC_000005 (Schmutz et al, 2004) is shown in Figure 2. Intron 8 VNTR highlighted. In this instance, there is 6 copies of the repeat which is referred to herein as "allele 3".

The region spaning the 30bp repeat unit of individuals homozygous for alleles 2 and 3 were characterized by standard techniques. Individual homozygotes for the allele 2 (namely genotype 22) show in the DNA sequence 5 copies of the repeat motif (Figure 3A). On the other hand, individuals homozygous for the allele 3 (namely genotype 33) show 6 copies of the same repeat motif (Figure 3B). The 6 repeat allele is typically comprised of 5 type A repeats (SEQ ID NO: 1) and one type B repeat (SEQ ID NO:2) with two base pair differences compared with A. Allele 2 typically comprises 4 type A repeats and one type B repeat.

In order to investigate the occurrence of undetected SNPs within the repeats it was decided to sequence pools containing DNA of 25 individual homozygotes for each allele were sequenced as well as 3 individual homozygotes for each allele. The reads were generated on an Applied Biosy stems 3730 DNA Analyzer platform and analyzed by Sequencher ™ software v4.0.5. On analysis it appeared that the repeat units were perfectly identical to each other in all reads, with 5 (4 A + IB) and 6 (5 A + IB) copies of the repeat on the 2 and 3 alleles, respectively. Thus, as shown in Figures 3 C and 3D no obvious SNPs could be observed. Evidence suggests that "allele 4" comprises at least one (more likely only one) extra copy of the repeat when compared to "allele 3" while "allele 5" contains a slightly larger repeat number (probably 2 or 3 repeats larger than allele 3).

Amplification products of various alleles the human of DAT gene comprising the VNTR of intron 8 are provided in Figure 4.

Example 2 - Analysis of the influence of the 30bp VNTR located in Intron 8 of the Dopamine Transporter Gene on Reporter Gene Transcription

Methods Cell Growth

SN4741 is a mouse substantia nigra derived dopaminergic neuronal cell line and was cultured at 33⁰C, 5% CO2 in D-MEM with Glutamax supplemented with 10% FCS, 1% glucose, and penicillin-streptomycin. Post transfection, cells were incubated in the same conditions (Son et al., 1999).

Construction of Reporter Gene Constructs

The plasmids p5' DAT2, p5' DAT3, p3' DAT2 and p3'DAT3 contained alleles of the DAT VNTR found in intronδ of the DAT gene. Primers were designed to amplify the variable region in individuals homozygous for either allele 2 or 3. Forward 5'-GCTTGGGGAAGGAAGGG-S ' (SEQ ID NO:31) and Reverse 5'- TGTGTGCGTGCATGTGG-3' (SEQ ID NO:32).

The PCR product for each fragment was gel purified using the Qiaquick gel extraction kit (Qiagen), and then cloned into the TA cloning plasmid pcRII-TOPO (Invitrogen), validity and directionality being confirmed by DNA sequencing. For p5' DAT2 and p5' DAT3 the fragment was then excised by Acc65l and Xhol and ligated into the MCS of pGL3-P (Promega) introducing the fragment upstream of the start codon of the luciferase gene. For p3' DAT2 and p3' DAT3 the fragment was excised with BamHl and Xhol and ligated into the BamHl and Sail site of pGL3-P introducing the fragment downstream of the stop codon of the luciferase gene. To introduce the two common Int8 allelic variants into the intron of the renilla vector phRLsv40 (Promega), a plasmid supplied by Dr J. Bubb containing an Ascl linker within its intronic region was utilized. The primers were modified: Forward 5'- TTGGCGCGCCGCTTGGGGAAGGAAGGG-3' (SEQ ID NO:33) and Reverse 5'- TTGGCGCGCCGTGTGCGTGCATGTGG-3' (SEQ ID NO:34) to include Ascl restriction sites enabling direct ligation of the PCR product into phRLsv40. All plasmids were confirmed for validity and directionality by DNA sequencing. Transfection

~lxlθ⁴ cells were plated onto 24 well plates 24 hours prior to transfection with Transfast (Promega). Transfections were optimised according to manufacturers' instructions. In brief, reporter plasmid (0.5 μg per well) was mixed with serum free cell media (200μl per well) and Transfast was added at a ratio of 2:1 (3μl per well). Cells were then washed twice with PBS, DNA media mixture added for 1 hour, after which 1 ml of relevant cell media containing 10%FBS was added.

Reporter Gene Assay

After 48 hours cells were washed twice with PBS, then lysed with Passive Lysis buffer (Promega). After 15 min agitation at room temperature, the cell lysate was centrifuged briefly at 1000Og. Supernatants were assayed for reporter gene expression by using the relevant Promega assay system. Supernatants (20μl) was added to lOOμl of assay reagent in opaque 96 well plates and the light emission was measured over a given time interval with the Life Sciences Labsystems Luminoskan, model RT. Cells where appropriate were serum deprived, exposed to a potassium evoked depolarisation or a potassium evoked depolarisation combined with Forskolin or cocaine hydrochloride (Sigma). Forskolin was used at lOμM final concentration. Depolarsation of SN4741 cells was achieved using final concentrations of 1OmM CaCl₂ and 4OmM KCl. The cells were also exposed to cocaine hydrochloride at concentrations of 1 μM and lOμM. Luciferase/renilla results were normalized to total protein concentration, which was measured with the BCA protein assay kit (Pierce) in accordance with the manufacturers instructions. Results are means +/- S.D. or +/- S.E. of three or more experiments performed in triplicate using cells of the same or similar passage number.

Results

The function of both 3' and intron 8 VNTRs was tested separately in conventional reporter gene constructs (Promega). The intron 8 VNTR common alleles (alleles 2 and 3) had no activity in a reporter gene assay when cloned in the 3' location, however when the intron 8 VNTR alleles were cloned in the region 5' to the reporter gene both the 2 and 3 copy demonstrated a repressor function (Figure 5). The 3'UTR VNTR was cloned in the 3' location and displayed no activity (data not shown) although when cloned in the 5' position it demonstrated enhancer function (Michelhaugh et al., 2001). Since the location of both the intron 8 and 3' UTR VNTR demonstrated differential function the intron 8 domain was cloned in a more relevant orientation, using a modified renillia vector with a polyclonal site within an intron for testing such intronic VNTR domains as functional units. The intron element when cloned in this domain demonstrated a small but statistically significant increase (p<0.05) in reporter gene expression for the 2 allele of the Int8 VNTR.

The response of the Int8-VNTR-2 and Int8-VNTR-3 alleles to distinct challenges was tested:

(l) Two concentrations of cocaine hydrochloride (SIGMA), 1 and 10 μM, were used to assess the specific response of the intron 8 alleles to the drug. In both cases an -40% reduction was observed (p<0.01) with an increased effect for the

10 μM concentration. Cocaine has been observed to modulate many neuronal genes in part through activation of specific transcription factors pathways including those regulated by members of the API family such as c-fos and c-jun (Hope et al., 1992; Moratalla et al., 1993). (2) Induction of Ca₂ ⁺ signaling by depolarizing the membrane potential of the cell via addition of KCl (40 mM) to the medium which resulted in an increased expression from the allele 3 vector but not for allele 2 (p<0.01). In cultured cells, it has been shown that increasing extracellular K+ results leads to an increase in cytosolic Ca2+ and results in enhanced (Cre dependant) transcription. (Dobson et al., 1994; Tabuchi et al., 2002)

(3) The co-administration of Forskolin (lOμM), a membrane permeable actrvator of adenylate cyclase, and K+ (40 mM). In this system, the Int8-VNTR-3 allele demonstrated a large increase (6-fold) in reporter gene expression in response to synergistic challenge (p«0.001) over the 2 allele. It has previously been shown that these stimuli act synergistically on gene expression supported by reporter gene constructs both in clonal cell lines and in organotypic CNS cultures (Dobson et al., 1994; Walker et al., 2000) including the promoter of the preprotachykinin A gene which is also a cocaine regulated gene in vivo (Kosofsky et al., 1994). These data are graphed in Figure 6, which shows the relative effect of cocaine and the other stimuli on the expression of the vectors, with the vector containing the 3 allele showing an increased response to stimuli compared to the 2 allele at every treatment. Example 3 - Discussion

The present inventor examined a total of 699 cocaine abusers and 866 controls and identified a positive association with alleles and genotypes of the 30bp VNTR in intron 8 of the dopamine transporter gene. Association and haplotype analyses using other polymorphisms in and near the gene (the 3'UTR VNTR, a novel 37bp VNTR, Indel_14 polymorphism and SNPS 11+1036, 11+478 and 18+2086) indicate that the Int8 VNTR is the variant responsible for the observed association, despite significant linkage disequilibrium existing between it and some of the other variants. Moreover, functional analyses indicates that the risk that at least the allele 3 mediates a differential and increased response to stress in reporter constructs in comparison with the other common and "protective" allele 2.

The sample was divided in two populations upon analysis for stratification with more complex models being rejected as inferior, as suggested by Pritchard et al. (2000). It appeared that one of these populations was primarily Caucasian and the other a mixed African-Caucasian group, given the known ancestral allele frequencies. This population substructure was approximately equal among the cases and controls and in both sub-populations the same pattern of association was observed. This adds weight to the observed association with the intron 8 VNTR, suggesting that population stratification is not responsible for the positive result. In addition, the functional evidence shows that the risk allele 3 exhibits differential responses to stimuli in comparison to the protective or 2 allele which does not, and is strongly supportive of the association finding. This effect may be mediated by either an increase or decrease in the rate of transcription or differential effects on the stability of the RNA produced. Specifically, it was demonstrated that a differential effect on reporter gene expression supported by the Int8-VNTR 3 allele when placed in the intron of an expression vector and transfected into a mouse dopaminergic (substantia nigra derived) cell line, SN4741, which expresses the dopamine transporter (Michelhaugh et al., 2001).

The data indicate that under basal growth conditions the 3 allele confers less expression of the reporter construct than the 2 allele. However, when challenged with the addition of KCl and Forskolin to the cell culture medium, differential response of the two alleles is observed with the 3 allele supporting an increased regulation of reporter gene expression (6x normal), while the 2 allele does not exhibit any change. Synergistic activation of K+ induced depolarization and Forskolin has previously been used to modulate regulation from a variety of distinct transcriptional regulatory domains responses in gene expression (Dobson, 1994; Morrison et al., 1994a; Morrison et al., 1994b; Walker et al., 2000). By contrast, and perhaps of more relevance to the phenotype being examined, the effects observed were opposite when the cells were exposed to cocaine, with decreased expression of the 3 allele being observed with little or no response of allele 2. From Figure 6, a clear trend can be observed with the 3 allele mediating large differential responses to stimuli, with expression of the 2 allele remaining (comparatively) constant across the treatments.

Given the stress response characteristics of the reporter gene containing the Int8 VNTR in reporter constructs, and the neurochemical and neurotoxic effects of cocaine it would seem reasonable to assume that people possessing the 33 genotype will exhibit a differential response in terms of DAT gene expression when exposed to cocaine. If, as the data suggest, expression may rise rapidly upon stimulation, this could leave an individual in a dopamine depleted state after an initial dose of cocaine. Conceivably, this could contribute to the described salience and sensitisation responses observed in abusers. The association of the 4 and 5 alleles containing genotypes with cocaine dependence is larger than the recessive allele three effect in terms of odds ratio (~8 versus ~ 1.5).

It is well know in the art that addictive phenotypes are typically non-substance specification. More particularly, predisposition to addiction to one substance generally suggests that the individual is also susceptible to other addictive states. In addition, it is known in the art that a predisposition to an addictives state is also positively correlated with susceptibility to neurological conditions such as, but not limited to, depression and attention deficit hyperactivity disorder (Rounsaville et al., 1991; Ross et al., 1988; Regier et al., 1990; Brown et al., 1996; Schubiner et al., 2000; Robbins, 2002; Batel, 2000). With regard to attention deficit hyperactivity disorder, methyphenidate (amphetamine analogue) which is used to treat this condition binds and inhibits DAT. Accordingly, it is expected that the markers of the invention will be useful for diagnosing a wide variety of addictive states and neurological conditions (particularly attention deficit hyperactivity disorder). To summarise a robust association has been found between an addictive state and alleles and genotypes in the dopamine transporter.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

All publications discussed above are incorporated herein in their entirety.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

REFERENCES

Batel, P. (2000) Eur Psychiatry 15:115-122.

Benson, G. (1999) Nucl Acids Res 27:573-580. Bierut, LJ, et al. (1998) Arch Gen Psychiatry 55 :982-988.

Brown, RA, et al. (1996) JAm Acad Child Adolesc Psychiatry 35:1602-1610.

Chen, CK, et al. (2003) MoI Psychiatry 8:393-396.

Dobson, SP, et al. (1994) Neurosci Letters 167:19-23.

Gelernter, J, et al. (1994) Neuropsychopharmacology 11:195-200. Greenwood, TA, et al. (2002) MoI Psychiatry 7:165-173.

Greenwood, TA et al. (2003) Genomics 82:511-520.

Hope, B, et al. (1992) Proc Nat Acad Sci, USA 89: 5764-5768.

Howard, M, et al. (2002) Science 296:261b-262b.

Kendler, KS and Prescott, CA. (1998) Br J Psychiatry 173:345-350. Kosofsky, BE, et al. (1994) Child Neurol. 9:234-241.

Le Couteur, DG, et al. (1997) Mov Disord. 12:760-763.

Martinez, D, et al. (2001) Neuropsychopharmacology 24:553-560.

Merikangas, KR, et al. (1998) Arch Gen Psychiatry 55:973-979.

Michelhaugh, SK, et al. (2001) J Neurochem. 79:1033-1038. Moratalla, R., et al. (1993) J Neurosci 13:423-433.

Morrison, CF, et al. (1994a) MoI Cell Neurosci 5: 165-175.

Morrison, CF, et al. (1994b) Neurosci Lett 181 : 117-120.

Persico, AM and Macciardi, F. (1997) Am J Med Genet, Neuropsychiatr Genet. 74:53-

57. Pritchard, JK, et al. (2000) Am. J. Hum. Genet., 67:170-181.

Purcell S, and Sham P (2004) Hum Hered 58:93-107.

Regier, DA, et al. (1990) JAMA 264:2511-2518.

Ritz, MC, et al. (1987) Science 237:1219-1223.

Robbins, TW. (2002) Nat Med 8:24-25. Ross, HE, et al. (1988) Arch Gen Psychiarty 45:1023-1031.

Rounsaville, BJ, et al. (1991) Arch Gen Psychiatry 48:33-42.

Rozen, S. and Skaletsky HJ. (2000) In: Krawetz S, Misener S (eds) Bioinformatics

Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp

365-386. Sander, T, et al. (1997) Biol Psychiatry 41 :299-304.

Schmutz, J, et al. (2004) Science 431:931-945. Schubiner, H, et al. (2000) J Clin Psychiatry 61 :244~251. Sham, PC and Curtis, D. (1995) Ann Hum Genet 59:97-105. Son, JH, et al. (1999) JNeurosci 19:10-20. Tabuchi, A, et al. (2002) J Biol Chem 277: 35920-35931. Turchi, M.D. et al. (2002) JAcq Immune DefSynd 30: 527-532. Ujike, H, et al. (2003) Pharmacogenomics J. 3:242-247. Vandenbergh, DJ, et al. (1992) Genomics 14:1104-1106. Walker, PD, et al. (2000) JNeurochem 75: 882-885. Zhao, JH. (2004) Bioinformatics 20:1325-1326.

Claims

1. A method of diagnosing whether a subject is susceptible or predisposed to an addictive state, the method comprising determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

2. The method of claim 1, wherein the addictive state is caused by at least one of: cocaine, nicotine, alcohol, food, ecstasy, kat, caffeine, opium, heroin, marijuana, amphetamine, methamphetamine or gambling.

3. The method of claim 1, wherein the addictive state is cocaine abuse.

4. The method according to any one of claims 1 to 3, wherein a subject is susceptible or predisposed to an addictive state if they are homozygous for an allele of the dopamine transporter gene which comprises 6 copies of the 30bp tandem repeat in intron 8.

5. The method according to any one of claims 1 to 3, wherein a subject is susceptible or predisposed to an addictive state if they posses an allele of the dopamine transporter gene which comprises more than 6 copies of the 30bp tandem repeat in intron 8.

6. A method of diagnosing whether a subject is susceptible or predisposed to a neurological disease linked to dopamine transporter activity, the method comprising determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

7. The method of claim 6, wherein the neurological condition is selected from the group consisting of: attention deficit hyperactivity disorder, Parkinson's disease, schizophrenia, manic depression, and the psychoses.

8. The method according to any one of 1 to 7, wherein at least one of the 30bp tandem repeats comprises the sequence GTGTCTGAGTGTGTATGTTGCATGGTATGT (SEQ ID NO: 1), GTGTCTGTGTGTGTATATTGCATGGTATGT(SEQIDNO:2), TGTGTCTGTGTGTGTATATTGCATGGTATG(SEQIDNO:3),or TGTGTCTGAGTGTGTATGTTGCATGGTATG(SEQIDNO:4).

9. The method according to any one of 1 to 8, wherein the method comprises amplifying the region of the genome comprising the 30bp tandem repeat within intron 8 of the dopamine transporter gene.

10. The method of claim 9, wherein the amplification is performed using the polymerase chain reaction.

11. The method according to any one of 1 to 10, wherein the method comprises sequencing the region of the genome comprising the 30bp tandem repeats within intron 8 of the dopamine transporter gene.

12. The method according to any one of claims 1 to 11, wherein the method comprises analysing the subject for a marker which is in linkage disequilibrium with an allele of the 30bp tandem repeat within intron 8 of the dopamine transporter gene.

13. An oligonucleotide which can be used in a reaction to amplify the region of the human genome comprising the 30bp tandem repeat within intron 8 of the dopamine transporter gene.

14. The oligonucleotide of claim 13, wherein the oligonucleotide is greater than 12 nucleotides in length, hybridizes to a region of the human dopamine transporter gene within about 2kb of the 30bp tandem repeat of intron 8, and is capable of being used to amplify said region comprising said repeat.

15. The oligonucleotide of claim 13 or claim 14 which comprises a sequence selected from the group consisting of: CTTGGGGAAGGAAGGG (SEQ ID NO:5), TGTGTGCGTGCATGTGG (SEQ ID NO:6), GCAAGGCTTCTGAACTGGTC (SEQ ID NO:7), CAGCAAAGCCTTTTTCCTTG (SEQ ID NO:8), TCCATGCTTGCAACAGAAAG (SESQ ID NO:9), CTCCATGCTTGCAACAGAAA (SEQ ID NO: 10), TCTGGCGTAGATGCTGTCAC (SEQ ID NO: 11), GTCTGGCGTAGATGCTGTCA (SEQ ID NO: 12), CTGGAGTTGTCTCCGAGAGG (SEQ ID NO: 13), CAGAGACCAAACTGCGTTGA (SEQ ID NO: 14), TCAGAGACCAAACTGCGTTG (SEQ ID NO: 15), TTATCTCCGAAGCCACCATC (SEQ ID NO: 16), CACCATAGAACCAGGCCACT (SEQ ID NO: 17), AGGCACCTGACTCCTGCTTA (SEQ ID NO: 18), GGCACCTGACTCCTGCTTAG (SEQ ID NO: 19), AGGGGGATAAAGGGAAAGGT (SEQ ID NO:20), TGACTCTGGGACCAAGCTCT (SEQ ID NO:21), CTGTCCAGGTGCTGAAGTGA (SEQ ID NO:22), AACAGGGACAGGAGGAAGGT (SEQ ID NO:23), TTCCCTTCCTAGGGCTTCAT (SEQ ID NO:24), TGTGTGCACATTTCCAGGAT (SEQ ID NO:25) and GCACACAGGTACCCCAGAGT (SEQ ID NO:26), or a complement thereof, or a variant thereof, or which hybridizes to the same region of the human dopamine transporter gene as the above.

16. A kit for diagnosing whether a subject is susceptible or predisposed to an addictive state, the kit comprising at least one component for determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

17. A kit for diagnosing whether a subject is susceptible or predisposed to a neurological disease linked to dopamine transporter activity, the kit comprising at least one component for determining the number of 30bp tandem repeats within intron 8 of an allele of the dopamine transporter gene.

18. The kit of claim 16 or claim 17, wherein the kit comprises an oligonucleotide according to any one of claims 13 to 15.

19. A method of identifying a compound which modifies the activity of a 30bp tandem repeat within intron 8 of the dopamine transporter gene, wherein there are more than six copies of the repeat, the method comprising, a) providing a construct comprising more than six repeats and a reporter gene,

. b) placing the construct in a cellular or cell-free expression system capable of expressing the reporter gene, c) exposing the expression system to a candidate compound, d) determining if the candidate compound decreases or inhibits reporter gene expression when compared to a control lacking more than six repeats, and e) selecting a compound that decreases or inhibits reporter gene expression.

20. The method of claim 19, wherein the more than six repeats are in a 5' position relative to the reporter gene.

21. The method of claim 19 or claim 20, wherein the expression system comprises at least one stimulating factor.

22. The method of claim 21, wherein the stimulating factor is KCl and/or forskolin.

23. The method according to any one of claims 19 to 22, wherein the construct comprises six repeats.

24. The method according to any one of claims 19 to 23, wherein the control comprises a construct comprising five repeats of the 30bp tandem repeat of intron 8 of the human dopamine transporter gene, and a reporter gene.

25. A method of identifying a compound that binds to a 30bp tandem repeat within intron 8 of the dopamine transporter gene, the method comprising exposing a candidate compound to the repeat under suitable conditions, and determining whether the compound has bound the repeat.

26. A compound identified using a method according to any one of claims 19 to 25.

27. A method of treating an addictive state in a subject, the method comprising; i) performing the method of claim 1, ii) determining the appropriate treatment based on whether the subject is predisposed to the addictive state, and iii) administering said treatment.

28. A method of treating a neurological disease in a subject, the method comprising; i) performing the method of claim 6, ii) determining the appropriate treatment based on whether the subject is predisposed to the neurological disease, and iii) administering said treatment.