WO2005118873A2

WO2005118873A2 - Compositions and methods for detecting open chromatin and for genome-wide chromatin state profiling

Info

Publication number: WO2005118873A2
Application number: PCT/US2005/019150
Authority: WO
Inventors: Toomas Neuman
Original assignee: Cemines, Inc.
Priority date: 2004-05-28
Filing date: 2005-05-31
Publication date: 2005-12-15
Also published as: WO2005118873A3

Abstract

Methods and compositions are provided for detecting open chromatin in genomic DNA, including oligonucleotide arrays useful for detecting open chromatin and generating chromatin state profiles for biological samples. The invention further concerns the use of such arrays in diagnostic and prognostic methods, as well as in methods of monitoring treatment and evaluating the response of cells and patients to candidate or established therapeutic agents. The invention also concerns the use of such arrays for the provision of pharmacogenomic data useful in methods of tailoring treatment to individuals. The invention additionally concerns the use of such arrays for the identification of chromatin state profiles representative of cell types or cell states, which may be used to evidence cell types or cell states.

Description

COMPOSITIONS AND METHODS FOR DETECTING OPEN CHROMATIN AND FOR GENOME-WIDE CHROMATIN STATE PROFILING

FIELD OF THE INVENTION

[001] The invention relates to genomic detection methods and compositions, and in particular, to the detection of open chromatin in genomic DNA as well as oligonucleotide arrays useful for detecting open chromatin and generating chromatin state profiles for biological samples.

BACKGROUND

[002] Analysis of the human genome has identified approximately 25,000-30,000 protein-coding genes. Very little is known about how gene expression is coordinately regulated to control cell and tissue physiology.

[003] Conventional gene expression studies using array technologies have generally employed immobilized DNA molecules that are complementary to mRNA sequences. The use of such arrays enables simultaneous monitoring of the expression of multiple distinct transcripts. However, the direct detection of expressed transcripts reveals only indirectly the activity of genetic regulatory pathways that control gene expression. It is desirable to understand how genes are regulated in order to facilitate the design of novel therapeutic agents and methods directed upstream of genes that may be used to coordinately modulate gene networks or interfere with the coordinated regulation of gene networks.

[004] In vivo, eukaryotic DNA is complexed with a variety of proteins and packaged into nucleosomes to form chromatin. Modifications of chromatin structure are known to underlie gene regulation. Actively transcribed chromatin regions, referred to as "active chromatin" are more "open" (i.e., not packed into nucleosomes) than inactive chromatin regions. The "open" structure of active chromatin makes it more accessible to DNAses and susceptible to cleavage thereby. Mapping of DNase hypersensitive sites (HSSs) has traditionally represented the goid-standard experimental method for identifying regulatory elements and the location of transcriptionally active chromatin regions. Unfortunately, the labor-intensive nature of this technique has limited its application to only a small number of human genes.

[005] Open chromatin in many instances prefigures active transcription at a locus, and can be used as a 'preactivation indicator'. This "preactive" state of chromatin can exist for some time without active transcription (RNA synthesis) and can also be analyzed using techniques that detect open chromatin. [006] Compositions and methods that could be used to detect open chromatin across a large number of loci or an entire genome could provide useful information concerning the regulatory state of a cell or tissue. Such compositions and methods would also be very useful for the delineation of regulatory pathways, and could provide critical knowledge for the design and discovery of disease diagnostics and therapeutics.

[007] US Patent Application 20040014086 discloses arrays comprising DNA probes that are complementary to particular identified active chromatin elements, which are used to directly detect such active chromatin elements in genomic DNA. While useful, such arrays and methods have several important limitations. In particular, the assembly of such arrays requires prior identification of active chromatin elements, resultant arrays are useful only for assaying such previously identified active chromatin elements, and the active chromatin element direct detection technique has a limited ability to assay functionally important genomic sequences that are repeated in the genome.

[008] As it is well known that active chromatin elements are dynamic structures that vary with cell type, developmental stage, and cellular environment, arrays and methods such as those disclosed in US Patent Application 20040014086 can only detect those active chromatin elements previously identified in a limited number of assayed cell types, at a limited number of developmental stages, and under a limited number of conditions. These are particularly undesirable limitations with respect to the chromatin profiling of abnormal cells. Abnormal cells, such as cancer cells, exhibit a great deal of heterogeneity and transcriptional activity variation, and are likely to exhibit a variety of chromatin profiles that differ from normal cells and from other cancer cells.

[009] A chromatin profiling technique not requiring previous identification of active chromatin elements to detect open chromatin would be extremely useful. Further, a genome-wide chromatin profiling technique that could be used for a variety of cell types, in a variety of developmental stages, under a variety of conditions, and in response to a variety of factors, without a requirement for previous identification of active chromatin elements, would be of tremendous benefit.

[0010] Direct detection methods such as those disclosed in US Patent Application 20040014086 have a limited ability to assay functionally important genomic sequences that are repeated in the genome. Determining the particular locus affected when probing directly for an active chromatin element may be problematic when the active chromatin element comprises a sequence that recurs in genomic DNA. However, many functionally important sequences are highly recurrent in genomic DNA, providing in part for coordinated gene regulation. Techniques that could be used to probe chromatin conformation, or the "openness", of recurrent, functionally important sequences in a locus- specific manner would be of great benefit.

SUMMARY OF THE INVENTION

[0011] The present invention provides compositions and methods for detecting open chromatin in genomic DNA. The invention further provides compositions and methods for detecting open chromatin in multiple open chromatin sites in genomic DNA, thereby providing a chromatin state profile. Also provided are chromatin state profiling arrays for use in detecting open chromatin in multiple open chromatin sites in genomic DNA simultaneously and generating a chromatin state profile.

[0012] Accordingly, in one embodiment, the invention provides methods for detecting open chromatin in genomic DNA, comprising: (i) preparing a chromatin sample, (ii) treating the chromatin sample with an open chromatin DNA cleaving agent to induce cleavage of DNA in open chromatin in marked preference to other locations in the chromatin sample, (iii) performing an amplification reaction, preferably a polymerase chain reaction ("PCR"), using treated sample DNA as substrate, (iv) incubating the amplification products with a capture probe, and (v) determining the hybridization of capture probe to amplification reaction products.

[0013] In a preferred embodiment, the invention provides methods for detecting open chromatin at two or more open chromatin sites in genomic DNA simultaneously. The methods involve the use of a plurality of capture probes, and determining the hybridization of the plurality of capture probes to amplification products is done simultaneously. The plurality of capture probes are preferably present on a chromatin state profiling array.

[0014] In one embodiment, the chromatin sample is derived from a single cell. In another embodiment, the chromatin sample is from a plurality of cells.

[0015] In a preferred embodiment, the open chromatin DNA cleaving agent is DNAse I.

[0016] In a preferred embodiment, a portion of a chromatin DNA sample untreated with open chromatin DNA cleaving agent is amplified in parallel with a portion of the chromatin DNA sample treated with open chromatin DNA cleaving agent. The products of both reactions are incubated with capture probes, and a reduction in hybridization of capture probes to amplification products derived from treated sample as compared to the hybridization of capture probes to amplification products derived from untreated sample indicates the presence of open chromatin in the genomic DNA of the chromatin sample. Preferably, the products of the two amplification reactions are differentially labeled and distinguishable, and are coincubated with capture probes, wherein the ratio of the different labels is used to detect a reduction in hybridization.

[0017] PCR is a highly preferred amplification reaction. Preferably between about 30-40 cycles of PCR are done.

[0018] The amplification reaction of the invention is designed such that when a genomic DNA region that has not been cleaved by the open chromatin DNA cleaving agent is used as substrate, the reaction produces products that hybridize to a capture probe of predetermined sequence. A lack or reduction of hybridization of capture probe to amplification products indicates the presence of open chromatin in the genomic DNA region. [0019] In a preferred embodiment, the polymerase chain reaction is done using a single primer of predetermined sequence in a one-sided amplification reaction. The single primer corresponds to a genomic DNA sequence that flanks a capture probe-corresponding genomic DNA sequence such that at least one open chromatin site is interposed between the capture probe-corresponding and primer- corresponding genomic DNA sequences.

[0020] It will be understood that predetermined single primers are designed so as to provide amplification reaction products that hybridize to a capture probe of predetermined sequence when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. In a preferred embodiment, the single primer is labeled. In a preferred embodiment, determining hybridization of the capture probe to polymerase chain reaction products involves detecting the presence of the single primer label. In a preferred method for detecting open chromatin in two or more genomic DNA sequences simultaneously, a plurality of single primers are used for a plurality of single-sided amplification reactions. Alternatively, PCR amplification products may be labeled during synthesis or signal probes may be used.

[0021] In one embodiment, determining hybridization of capture probe to polymerase chain reaction products involves the use of a signal probe. The signal probe corresponds to a DNA sequence that is within the amplification products and flanks the capture probe-corresponding genomic DNA sequence such that at least one open chromatin site is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. As described herein, the signal probe hybridizes to polymerase chain reaction products that hybridize to the capture probe and are produced when genomic DNA that has not been treated with open chromatin DNA cleaving agent is used as substrate.

[0022] In another preferred embodiment, the polymerase chain reaction is done using primer pairs. In a preferred embodiment, the primer pairs have predetermined sequences and at least one primer of the primer pair corresponds to genomic DNA sequence that flanks a capture probe-corresponding genomic DNA sequence such that at least one open chromatin site is interposed between the capture probe-corresponding and primer-corresponding genomic DNA sequences. The second primer of a primer pair may correspond to genomic DNA sequence that also flanks capture probe-corresponding sequence. Alternatively, the second primer may have the capture probe sequence or overlap with the capture probe sequence, provided that primers are designed so as to provide reaction products that hybridize to a chosen capture probe when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. Additionally, such primers must be removed prior to hybridization of amplification products to capture probe. In a preferred method for detecting open chromatin in two or more genomic DNA sequences simultaneously, a plurality of primer pairs are used for a plurality of amplification reactions. In a preferred embodiment, primers are labeled and determining hybridization of the capture probe to polymerase chain reaction products involves detecting the presence of primer labels. Alternatively, PCR amplification product may be labeled during synthesis or signal probes may be used. [0023] In another preferred embodiment, the polymerase chain reaction is done using random primers, preferably hexanucleotides. Preferably, determining the hybridization of capture probe to polymerase chain reaction products involves the use of a signal probe. A signal probe corresponds to genomic DNA sequence that flanks the capture probe-corresponding genomic DNA sequence such that at least one open chromatin site is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. It will be understood that the signal probe will hybridize to polymerase chain reaction products that hybridize to capture probe and are produced with the random primers when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. Thus, the signal probe-corresponding sequence is within some of the amplification products. In a preferred embodiment, the signal probe comprises a label, and determining hybridization of capture probe to polymerase chain reaction products involves detecting the presence of the signal probe label. In a preferred method for detecting open chromatin in two or more genomic DNA sequences simultaneously, a plurality of signal probes are used.

[0024] In an alternative embodiment, primers or amplification products are labeled and signal probes are not used. Such methods may be used to detect open chromatin in the vicinity of a chosen capture probe, wherein the extent of "vicinity" is determined by the length of PCR reaction products.

[0025] In one aspect, the invention provides compositions and methods for detecting open chromatin in one or more regions of interest in genomic DNA. The regions of interest individually comprise one or more open chromatin sites.

[0026] Preferred regions of interest include upstream gene regulatory sequences, intron sequences, and previously identified active chromatin elements. However, any genomic DNA sequence for which chromatin state information may be of interest can serve as a region of interest.

[0027] Preferably, the capture probes used correspond to sequences in genomic DNA that flank regions of interest in genomic DNA. Alternatively, the capture probe-corresponding genomic DNA sequence may be in a region of interest, wherein cleavage by an open chromatin DNA cleaving agent within the region disrupts amplification of genomic DNA including such sequence.

[0028] The capture probe-corresponding genomic DNA sequence may be 5' or 3' of the region of interest. In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primers if one-sided PCR is done) corresponds to a sequence in genomic DNA that flanks the capture probe-corresponding sequence, and such that at least one open chromatin site in the region of interest is interposed between the capture probe-corresponding and the primer- corresponding genomic DNA sequences. Thus, the primers are designed so as to provide PCR products that will hybridize to capture probes and will comprise the region of interest in the absence of treatment of genomic DNA with the open chromatin DNA cleaving agent.

[0029] In another embodiment, random primers are used, preferably in combination with signal probes, and signal probes are designed to correspond to sequences in genomic DNA that flank capture probe-corresponding genomic DNA sequences such that at least one open chromatin site in the region of interest is interposed between the signal probe-corresponding and capture probe- corresponding genomic DNA sequences. Alternatively, the signal probes are designed to correspond to genomic DNA sequences that are proximal to or within the sequences of interest and distal to the capture probe-corresponding genomic DNA sequences such that the sequence of interest or a portion thereof is interposed between the signal probe-corresponding and the capture-probe corresponding sequences.

[0030] In a preferred embodiment, the capture probes used comprise sequences that are not present in and do not complement mRNAs.

[0031] In one aspect, the invention is directed to methods for assaying the in vivo activity of upstream gene regulatory sequences, thereby providing information on the regulation of transcribed sequences that are coupled to the regulatory sequences. These assays may be used with a variety of cell types under a variety of conditions. The compositions and methods provided may be used to simultaneously assay the in vivo activity of a plurality of upstream gene regulatory sequences, including all upstream gene regulatory sequences in a genome, and thereby generate upstream gene regulatory sequence activity profiles for a variety of cell types under a variety of conditions.

[0032] In a preferred embodiment, the capture probes used correspond to sequences in genomic DNA that flank the transcription start sites of genes (upstream or downstream). In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primers if one-sided PCR is done) corresponds to a sequence in genomic DNA that flanks the capture probe- corresponding sequence, and such that at least one open chromatin site in the upstream gene regulatory sequence is interposed between the capture probe-corresponding and the primer- corresponding genomic DNA sequences. Thus, the primers are designed so as to provide PCR products that will hybridize to capture probes and will comprise upstream gene regulatory sequences in the absence of treatment of genomic DNA with the open chromatin DNA cleaving agent.

[0033] In another embodiment, random primers are used, preferably in combination with signal ^• probes, and signal probes are designed to correspond to sequences in genomic DNA that flank capture probe-corresponding genomic DNA sequences such that at least one open chromatin site in the upstream gene regulatory sequence is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. Alternatively, the signal probes are designed to correspond to genomic DNA sequences that are proximal to or in upstream gene regulatory sequences and distal to capture probe-corresponding genomic DNA sequences such that the upstream gene regulatory sequence or a portion thereof comprising at least one open chromatin site is interposed between the signal probe-corresponding and the capture-probe corresponding sequences.

[0034] In a preferred embodiment, the capture probes used comprise sequences that are not present in and do not complement mRNAs and correspond to genomic DNA sequences that are upstream of transcription start sites. In a preferred embodiment, the polymerase chain reaction is done using single primers in one-sided amplification reactions.

[0035] In one aspect, the invention is directed to methods for assaying the in vivo activity of intron sequences, which are known to play regulatory roles in many genes. These assays may be used with a variety of cell types under a variety of conditions. The compositions and methods provided may be used to simultaneously assay the in vivo activity of a plurality of introns.

[0036] In a preferred embodiment, the capture probes used correspond to sequences in genomic DNA that flank the 5' or 3' end of an intron. In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primer if one-sided PCR is done) corresponds to a sequence in genomic DNA that flanks the capture probe-corresponding sequence, and such that at least one open chromatin site in the intron sequence is interposed between the capture-probe corresponding and the primer-corresponding genomic DNA sequence. Thus, the primers are designed so as to provide PCR products that will hybridize to capture probes and will comprise intron DNA sequence in the absence of treatment of genomic DNA with the open chromatin DNA cleaving agent.

[0037] In another embodiment, random primers are used, preferably in combination with signal probes, and signal probes are designed to correspond to sequences in genomic DNA that flank capture probe-corresponding genomic DNA sequences such that at least one open chromatin site in the intron sequence is interposed between the signal probe-corresponding and capture probe- corresponding genomic DNA sequences. Alternatively, the signal probes are designed to correspond to genomic DNA sequences that are proximal to or are in intron sequences and distal to capture probe-corresponding genomic DNA sequences such that an intron sequence or portion thereof comprising at least one open chromatin site is interposed between the signal probe-corresponding and the capture-probe corresponding sequences.

[0038] In a preferred embodiment, the capture probe sequences are not present in and do not complement mRNAs.

[0039] In one aspect, the invention is directed to methods for assaying the in vivo activity of previously identified active chromatin elements. These assays may be used for a variety of cell types under a variety of conditions. The compositions and methods provided may be used to simultaneously assay the in vivo activity of a plurality of previously identified active chromatin elements.

[0040] In a preferred embodiment, the capture probes used correspond to sequences in genomic DNA that flank previously identified active chromatin elements, but are not located in previously identified active chromatin elements. In an alternative embodiment, capture probe-corresponding genomic sequences are in previously identified active chromatin elements. [0041] In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primer if one-sided PCR is done) corresponds to a sequence in genomic DNA that flanks the capture probe-corresponding sequence, and such that at least one open chromatin site in the previously identified active chromatin element is interposed between the capture-probe corresponding and the primer-corresponding genomic DNA sequence. Thus, the primers are designed so as to provide PCR products that will hybridize to capture probes and will comprise previously identified active chromatin elements in the absence of treatment of genomic DNA with the open chromatin DNA cleaving agent.

[0042] In another embodiment, random primers are used, preferably in combination with signal probes, and signal probes are designed to correspond to sequences in genomic DNA that flank the capture probe-corresponding genomic DNA sequences such that at least one open chromatin site in the active chromatin element is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. Alternatively, the signal probes are designed to correspond to genomic DNA sequences that are proximal to or are in previously identified active chromatin elements and distal to capture probe-corresponding genomic DNA sequences such that a previously identified active chromatin element or a portion thereof comprising at least one open chromatin site is interposed between the signal probe-corresponding and the capture-probe corresponding sequences.

[0043] In a preferred embodiment, the capture probe sequences are not present in and do not complement mRNAs.

[0044] In one aspect, the invention provides methods for profiling the presence and distribution of open chromatin within one or more segments of genomic DNA to provide a chromatin state profile. These methods may be used with a variety of cell types under a variety of conditions. A segment of genomic DNA, for example, may be a chromosome or a fragment thereof. In a preferred embodiment, methods for determining the presence and distribution of open chromatin within an entire chromosome are provided. In another preferred embodiment, methods for determining the presence and distribution of open chromatin in a number of entire chromosomes collectively constituting an entire genome are provided.

[0045] In a preferred embodiment, a plurality of capture probes are used corresponding to a plurality of sequences in genomic DNA, wherein the plurality of sequences in genomic DNA do not overlap and are distributed at regular intervals through regions of non-repetitive DNA sequence in the genomic DNA. The intervals are preferably from between about 5,000 to about 10,000 nucleotides. In other embodiments, the intervals are larger than 10,000 or less than 5,000 nucleotides. Spacing greater than 10,000 nucleotides between capture probe-corresponding genomic sequences is used preferably in combination with appropriate long-range PCR strategies. In other embodiments, the corresponding genomic DNA sequences are distributed at irregular intervals. [0046] In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primers if one-sidέd PCR is done) corresponds to a sequence in genomic DNA that flanks the capture probe-corresponding sequence, and such that at least one open chromatin site is interposed between the capture-probe corresponding and the primer-corresponding genomic DNA sequences. Thus, the primers are designed so as to provide PCR products that will hybridize to capture probes in the absence of treatment of genomic DNA with the open chromatin DNA cleaving agent.

[0047] In another embodiment, random primers are used, preferably hexanucleotides, preferably in combination with signal probes, and signal probes are designed to correspond to sequences in genomic DNA that flank the capture probe-corresponding genomic DNA sequences such that at least one open chromatin site is interposed between the signal probe-corresponding and capture probe- corresponding genomic DNA sequences. The signal probes used will hybridize to polymerase chain reaction products that hybridize to capture probe and are produced with the random primers used when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. Thus, the signal probe-corresponding sequence is within one or more of the amplification products. In a preferred embodiment, the signal probe comprises a label, and determining hybridization of capture probe to polymerase chain reaction products involves detecting the presence of the signal probe label. In a preferred method for detecting open chromatin in two or more genomic DNA sequences simultaneously, a plurality of signal probes are used.

[0048] In a preferred embodiment, a plurality of capture probes are used corresponding to a plurality of non-overlapping sequences in genomic DNA, each of these genomic sequences being separated from another by from between about 5,000 to about 10,000 nucleotides in non-repetitive genomic DNA sequence. In other embodiments, spacing is greater than 10,000 nucleotides and appropriate long-range PCR strategies are used. In other embodiments, spacing is less than 5,000 nucleotides.

[0049] In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primers if one-sided PCR is done) corresponds to a sequence in genomic DNA that flanks the capture probe-corresponding sequence, and such that at least one open chromatin site is interposed between the capture-probe corresponding and the primer corresponding genomic DNA sequence. Thus, the primers are designed so as to provide PCR products that will hybridize to capture probes in the absence of treatment of genomic DNA with the open chromatin DNA cleaving agent.

[0050] In another embodiment, random primers are used, preferably in combination with signal probes, and signal probes are designed to correspond to sequences in genomic DNA that flank the capture probe-corresponding genomic DNA sequences such that at least one open chromatin site is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. The signal probes used will hybridize to polymerase chain reaction products that hybridize to capture probe and are produced with the random primers used when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. Thus, the signal probe-corresponding sequence is within one or more of the amplification products. In a preferred embodiment, the signal probe comprises a label, and determining hybridization of capture probe to polymerase chain reaction products involves detecting the presence of the signal probe label. In a preferred method for detecting open chromatin in two or more genomic DNA sequences simultaneously, a plurality of signal probes are used.

[0051] In a preferred embodiment, the capture probe sequences are not present in and do not complement mRNAs.

[0052] In one aspect, the invention provides compositions and methods for chromatin state profiling. "Profiling" is identifying the presence or absence of open chromatin in multiple genomic DNA sequences. Profiling may be used to determine the pattern of open chromatin specific to a particular cell or tissue, including, e.g., a diseased cell or a cell treated with a drug.

[0053] In a preferred embodiment, profiling involves detecting open chromatin in multiple genomic DNA sequences simultaneously, and involves the use of a chromatin state profiling array, as described below.

[0054] In one embodiment, profiling involves a genome-wide assay for open chromatin using a chromatin state profiling array with capture probes corresponding to sequences distributed at regular intervals throughout non-repetitive genomic DNA sequence.

[0055] In another embodiment, profiling involves assaying for open chromatin in a plurality of genomic DNA regions of interest using a chromatin state profiling array.

[0056] In one embodiment, profiling involves assaying for open chromatin in the upstream regulatory sequences of a plurality of genes using a chromatin state profiling array. In a preferred embodiment, the arrays comprise capture probes corresponding to sequences that flank transcription start sites.

[0057] In another embodiment, profiling involves assaying for open chromatin in a plurality of introns using a chromatin state profiling array. In a preferred embodiment, the arrays comprise capture probes corresponding to sequences that flank the 5' or 3' ends of introns.

[0058] In another embodiment, profiling involves assaying for open chromatin in a plurality of previously identified active chromatin elements using a chromatin state profiling array. In a preferred embodiment, the arrays comprise capture probes that do not complement previously identified active chromatin elements, but correspond to sequences that flank previously identified active chromatin elements. In an alternative embodiment, chromatin state profiling arrays wherein capture probes complement previously identified active chromatin elements are used in the present methods.

[0059] In another aspect, the invention provides methods of ascertaining the effects of candidate or established therapeutic agents on a cell, tissue, or organism. The methods generally involve obtaining a first chromatin state profile from cells not exposed to the candidate or established therapeutic agent, and a second chromatin state profile from cells exposed to the candidate or established therapeutic agent. Comparison of the first profile with the second profile reveals open chromatin sites that are affected by the agent, and patterns of regulatory responses to agents may be determined. Cells may be exposed to the agent, or cells may be from tissue that is exposed to the agent, or cells may be from an organism that is exposed to the agent.

[0060] In a similar manner, chromatin state profiles may be compared between like cells that differ in any of a number of ways. For example, profiles of cells at different developmental stages, in different microenvironments, or under different physical conditions may be generated and compared. The comparison of such profiles will reveal open chromatin sites affected by altered cellular states or environments, and identify regulatory networks that respond to these alterations.

[0061] In a similar manner, chromatin state profiles may be compared between different cell types. The cell types compared may vary slightly, moderately, or greatly in their degree of lineage divergence. The comparison of such profiles will reveal open chromatin sites that differ in conformation between different cell types, and may reveal regulatory features common to apparently divergent cell types.

[0062] The invention also provides methods for discerning the effect of altering the expression and/or activity of one or more regulatory factors on a regulatory network in a target cell or population, comprising obtaining a first chromatin state profile of the target cell or population under controlled culture conditions, obtaining a second chromatin state profile of the target cell or population under conditions wherein the expression and/or activity of the regulatory factor is altered with respect to the controlled culture conditions, and comparing the first profile with the second profile to determine which open chromatin sites are affected by the alteration of the known regulator. Altered expression and/or activity of the one or more regulatory factors may be achieved in any of the large number of ways known in the art, including but not limited to the use of RNAi, antisense, dominant negative, decoy, and bioactive small molecule strategies.

[0063] In one aspect, the invention provides diagnostic methods, prognostic methods, disease staging methods, and methods for monitoring the progress of therapy.

[0064] In one embodiment, the invention provides methods for identifying a chromatin state profile associated with a disease state, comprising (i) obtaining a first chromatin state profile or set of profiles for a tissue, wherein the first profile or set of profiles is representative of a normal healthy condition, and (ii) obtaining a second chromatin state profile or set of profiles for a tissue, wherein the second profile or set of profiles is representative of a disease condition. By comparing the first profile or set of profiles with the second profile or set of profiles, one can readily identify open chromatin sites that differ in conformation between the disease condition and the normal condition, and begin to identify regulatory network changes that underlie the disease condition. [0065] The invention thus further encompasses disease-condition associated chromatin state profiles or sets of profiles, as well as methods for diagnosing the presence of disease conditions in patients. The methods comprise obtaining a chromatin state profile for a biological sample obtained from a patient suspected of having a disease condition and comparing the chromatin state profile to a disease-condition associated chromatin state profile or set of profiles which evidence the disease condition.

[0066] In a similar manner, chromatin state profiles or sets of profiles associated with particular prognoses may be identified. Profiles from diseased cells or tissues exhibiting different behavior, including response to treatment, may be established using compositions and methods described herein. The contrast between profiles associated with different prognoses may be used to identify prognosis-associated open chromatin sites and gene regulatory sequences. A chromatin state profile for a biological sample obtained from a patient may be compared to a chromatin state profile or set of profiles associated with particular prognoses to determine the patient's prognosis.

[0067] In a similar manner, chromatin state profiles or sets of profiles associated with disease stages may be identified. Profiles from cells or tissues at different stages of disease may be established using methods described herein. The contrast between profiles associated with different stages of disease may be used to identify disease-stage associated open chromatin sites and gene regulatory sequences. A chromatin state profile for a biological sample obtained from a patient may be compared to a chromatin state profile or set of profiles associated with particular disease stages to determine the stage of the patient's disease.

[0068] In one aspect, to achieve the methods provided herein, the invention provides chromatin state profiling arrays and methods of constructing such chromatin state profiling arrays.

[0069] Accordingly, in one embodiment, the present invention provides chromatin state profiling arrays, which are positionally addressable arrays of oligonucleotides. These arrays comprise a plurality of different oligonucleotides (frequently referred to herein as capture probes), each differing in nucleotide sequence, each being affixed to a substrate at a different locus (or a small number of loci, preferably about two to three different loci, i.e., two to three copies of each capture probe attached to the substrate to minimize artifacts), each being in the range of preferably 10-25, more preferably 12- 25 nucleotides in length, though longer sequences may be used, and each being complementary to and capable of hybridizing to a known genomic DNA sequence.

[0070] In one embodiment, the invention provides chromatin state profiling arrays, comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to a different genomic DNA sequence, wherein the different genomic DNA sequences do not overlap, and wherein each genomic DNA sequence flanks a transcription start site or the 5' or 3' end of an intron. In another embodiment, each capture probe-corresponding genomic DNA sequence flanks a previously identified active chromatin element, but is not present in a previously identified active chromatin element. [0071] In a preferred embodiment, the capture probes correspond to genomic DNA sequences that flank the transcription start sites of different genes. In a preferred embodiment, the capture probe- corresponding sequences are located upstream of the transcription start sites of different genes. In another embodiment, at least one of the capture probe-corresponding sequences is located upstream of the transcription start sites of different genes. In a preferred embodiment, the capture probe sequences are not present in and do not complement mRNAs.

[0072] In another preferred embodiment, the invention provides chromatin state profiling arrays that comprise a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to a different genomic DNA sequence, wherein the different genomic DNA sequences do not overlap, and wherein the different genomic- DNA sequences are distributed at regular intervals of between about 5,000 to about 10,000 nucleotides through regions of non-repetitive DNA sequence in the genomic DNA. In other embodiments, the capture probe-corresponding sequences are distributed at intervals of less than 5,000 or greater than 10,000 nucleotides. Spacing of greater than 10,000 nucleotides is preferably used in combination with appropriate long-range PCR strategies. In other embodiments, the capture probe-corresponding sequences are distributed at irregular intervals.

[0073] Highly preferred capture probes for use in the chromatin state profiling arrays of the invention are between about 10-25, more preferably 12-25 nucleotides in length, though longer sequences may be used. Preferably the capture probes do not contain a sequence of 10 or more nucleotides that occurs in the genome of the cell or organism more than once. Preferred capture probes have sequences that are not present in and do not complement mRNAs.

[0074] In one aspect, the invention provides methods for making chromatin state profiling arrays. The methods involve selecting capture probe sequences. In a preferred embodiment, the methods further involve selecting (i.e. designing) capture probe sequences that correspond to non-repetitive genomic DNA sequences. In one preferred embodiment, the capture probe sequences correspond to genomic DNA sequences flanking the transcription start sites of genes. In another preferred embodiment, the capture probe sequences correspond to genomic DNA sequences flanking the 5' or 3' ends of introns. In another preferred embodiment, the capture probe sequences correspond to genomic DNA sequences that are not previously identified active chromatin elements, but flank previously identified active chromatin elements. In another preferred embodiment, the capture probe sequences selected correspond genomic DNA sequences that are evenly distributed through genomic DNA at intervals of between about 5,000-10,000 nucleotides. In other embodiments, the intervals between corresponding genomic DNA sequences are less than about 5,000 or more than about 10,000 nucleotides. In other embodiments, the capture probes correspond to DNA sequences that are unevenly distributed through non-repetitive genomic DNA. Once capture probe sequences are selected, the arrays of the invention may be produced by any of the large number of array fabrication methods known in the art. The method of synthesizing the array is not critical to the invention.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0075] The present invention uses a variety of DNA cleavage, amplification, and hybridization schemes to distinguish between the presence and absence of open chromatin in genomic DNA sequences. The ability to amplify a genomic DNA sequence that comprises an open chromatin site following treatment with an open chromatin DNA cleaving agent indicates that the open chromatin site is not in an open conformation, and thus that the genomic DNA sequence does not comprise open chromatin in the particular sample assayed. To determine whether the genomic DNA sequence can be amplified following treatment with an open chromatin cleaving agent, hybridization of amplification products to a capture probe of predetermined sequence is attempted. The capture probe preferably corresponds to genomic DNA sequence that flanks the open chromatin site of the genomic DNA sequence such that the open chromatin site is interposed between the capture probe-corresponding and the amplification primer-corresponding genomic DNA sequences. The capture probe hybridizes to amplification products synthesized using genomic DNA that has not been treated with the open chromatin cleaving agent.

[0076] The present invention has several advantages over other methods and arrays such as those disclosed in US Patent Application 20040014086. For example, (i) array construction does not require prior identification of open chromatin elements (except as expressed in a preferred embodiment herein), (ii) the detection of open chromatin is not limited to previously identified active chromatin elements, and (iii) active chromatin elements that comprise genomic DNA sequences that are repeated in the genome may nevertheless be assayed in a locus-specific manner.

[0077] The polymerase chain reaction is highly preferred for amplification, though other nucleic acid synthesis techniques may be used. Preferably about 30-40 cycles of PCR are done.

[0078] "Open chromatin site" as used herein refers to a portion of genomic DNA that is capable of attaining an open chromatin conformation and thus has the potential to be cleaved by an open chromatin cleaving agent.

[0079] "Open chromatin" as used herein refers to a segment of genomic DNA that has an open chromatin conformation and is thus cleavable by an open chromatin cleaving agent.

[0080] By "flanking" is meant within 10,000 nucleotides, preferably within about 100-10,000 nucleotides of a reference site. For example, a capture probe that flanks an upstream gene regulatory sequence is within 10,000, preferably between about 100-10,000 nucleotides from an upstream gene regulatory sequence.

[0081] Capture probes corresponding to genomic DNA sequences positioned at distances greater than 10,000 nucleotides from regions of interest in genomic DNA, for example, an upstream gene regulatory sequence, may be used in combination with appropriate long-range PCR strategies. r

[0082] "Corresponds to" is used herein in a positional sense. A capture probe, primer, or signal probe may be substantially complementary or homologous to, or completely complementary or identical to, its corresponding genomic DNA sequence. What is required is that the probe or primer be able to hybridize to its corresponding genomic DNA sequence, or complement thereof, under high stringency conditions.

[0083] "Proximal" and "distal" are used herein in relation to each other. That is, where A is referred to as proximal to B and distal to C, the distance from A to B is less than the distance from A to C.

[0084] By "upstream gene regulatory sequence" herein is meant a DNA sequence upstream of the transcription start site of a gene that may participate in regulating the transcription of the gene.

[0085] An "array" is a plurality of different nucleic acids immobilized at positionally-addressable locations on a solid or semi-solid phase surface.

OPEN CHROMATIN DETECTION, AND PROFILING

[0086] In a preferred embodiment, the invention provides methods for detecting open chromatin in one or more regions of interest in genomic DNA. The regions of interest individually comprise one or more open chromatin sites.

[0087] The methods comprise the steps of: (i) preparing a chromatin sample from a target cell or population, (ii) treating the chromatin sample with an open chromatin DNA cleaving agent to induce cleavage of DNA in open chromatin in marked preference to other locations in the chromatin sample, (iii) performing an amplification reaction, preferably a polymerase chain reaction, using treated sample DNA as substrate, (iv) incubating the amplification products with a capture probe, preferably on a chromatin state profiling array, and (v) determining the hybridization of capture probe to amplification reaction products.

[0088] In a preferred embodiment, the capture probes correspond to genomic DNA sequences that flank genomic DNA regions of interest. The capture probe-corresponding genomic DNA sequences may be 5' or 3' of the regions of interest.

[0089] The amplification reaction of the invention is designed such that when a genomic DNA region that has not been cleaved by the open chromatin DNA cleaving agent is used as substrate, the reaction produces products that hybridize to a capture probe of predetermined sequence. A lack or reduction of hybridization of capture probe to amplification products indicates the presence of open chromatin in the genomic DNA region.

[0090] In a preferred embodiment, the polymerase chain reaction is done using a single primer of predetermined sequence in a one-sided amplification reaction. The single primer corresponds to a genomic DNA sequence that flanks a capture probe-corresponding genomic DNA sequence such that at least one open chromatin site in the region of interest is interposed between the capture probe- corresponding and primer-corresponding genomic DNA sequences. The primers used provide reaction products that hybridize to the capture probe when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. In a preferred method for detecting open chromatin in two or more regions of interest, a plurality of single primers are used for a plurality of single-sided amplification reactions.

[0091] In another preferred embodiment, the polymerase chain reaction is done using primer pairs. In a preferred embodiment, the primer pairs have predetermined sequences and at least one primer of the primer pair corresponds to genomic DNA sequence that flanks a capture probe-corresponding genomic DNA sequence such that at least one open chromatin site in the region of interest is interposed between the capture probe-corresponding and primer-corresponding genomic DNA sequences. The primers used provide reaction products that hybridize to the capture probe when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. PCR primers having capture probe sequence or overlapping therewith may be used as one primer of a primer pair. Such primers must be removed prior to hybridization to capture probe. In a preferred method for detecting open chromatin in two or more regions of interest, a plurality of primer pairs are used for a plurality of amplification reactions.

[0092] In another preferred embodiment, the polymerase chain reaction is done using random primers, preferably hexanucleotides, preferably in combination with the use of signal probes. A signal probe corresponds to genomic DNA sequence that flanks the capture probe-corresponding genomic DNA sequence such that at least one open chromatin site in the region of interest is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. The signal probes used hybridize to one or more polymerase chain reaction products that hybridize to capture probe, which products are produced with the random primers when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate. In a preferred method for detecting open chromatin in two or more regions of interest, a plurality of signal probes are used.

[0093] In an alternative embodiment, signal probes are not used. Such methods may be used to detect open chromatin in the vicinity of a chosen capture probe, wherein the extent of "vicinity" is determined by the length of PCR reaction products.

[0094] Preferably, capture probes are present on a chromatin state profiling array. Preferably more than one copy of a particular capture probe is used. Preferably 2-3 copies of a particular capture probe are used. In one embodiment, the copies are on the same chromatin state profiling array. In another embodiment, the copies are on different chromatin state profiling arrays. Highly preferred capture probes for use in the chromatin state profiling arrays of the invention are between about 10- 25, more preferably 12-25 nucleotides in length, though longer sequences may be used. Preferably the capture probes do not contain a sequence of 10 or more nucleotides that occurs in the genome of the cell or organism more than once. Preferred capture probes have sequences that are not present in and do not complement mRNAs. [0095] It will be appreciated that in many embodiments, a plurality of cells are used to obtain the chromatin sample. In other embodiments, the chromatin sample is from a single cell, which may be diploid. Thus, in many embodiments, a chromatin sample may comprise more than one "copy" of a genomic locus. Accordingly, a chromatin sample can include a first copy of a locus that comprises an open chromatin, and a second copy of the locus that does not comprise open chromatin. While PCR amplification of untreated sample will yield products from both loci that hybridize to capture probe, PCR amplification of treated sample will only yield products from the first locus that will hybridize to capture probe. A comparison of hybridizations will reveal a reduction in hybridization. Reduction may be the complete loss (absence) of hybridization.

[0096] In a number of embodiments herein, determining hybridization of amplification products to capture probes involves detecting a reduction in hybridization of amplification products to capture probes. "Reduction" in this sense means as compared to the hybridization between capture probes and the products of amplification reactions using genomic DNA that has not been treated with the open chromatin DNA cleaving agent. Reduction includes elimination, i.e., the absence of hybridization.

[0097] In a preferred embodiment, a portion of a chromatin sample untreated with open chromatin DNA cleaving agent is amplified in parallel with a portion of the chromatin sample treated with open chromatin DNA cleaving agent. The products of both reactions are incubated with capture probes, and a reduction in hybridization of capture probes to amplification products derived from treated sample as compared to the hybridization of capture probes to amplification products derived from untreated sample indicates the presence of open chromatin in the genomic DNA of the chromatin sample. Preferably, the products of the two amplification reactions are differentially labeled and distinguishable, and are coincubated with capture probes, wherein the ratio of the different labels is used to detect a reduction in hybridization.

[0098] In a preferred embodiment, a chromatin sample is split into two subsamples, wherein the first is treated with open chromatin DNA cleaving agent and the second remains untreated. The two subamples are processed in parallel and are differentially labeled in different PCR amplification reactions so as to render PCR products from the treated and untreated subsamples readily distinguishable. The PCR products from both sample types are then coincubated with capture probes, and the ratio of treated-sample signal to untreated-sample signal (or vice versa) is used to determine the extent of open chromatin in the copies of the locus probed. In a preferred embodiment, the differentially labeled probes are further used in a first reaction with untreated sample and coincubated with capture probes as control.

[0099] Optionally, chromatin samples may be manipulated to modify the average fragment size by digestion with a sequence-specific restriction enzyme, by sonication, or using an equivalent procedure. This may be done to increase the ease of handling chromatin samples. Importantly, manipulations that extensively shear DNA, and thereby preclude the synthesis of amplification products that hybridize to capture probes and lead to "false" reductions in hybridization in the present methods, should not be used.

[00100] In a preferred embodiment, the open chromatin DNA cleaving agent is a non-sequence- specific endonuclease, preferably DNAse I. The amount/activity of DNAse I required and suitable for use in the present methods is readily determined experimentally using methods well known in the art. see for example Reitman, M., Lee, E., Westphal, H., Felsenfeld, G., An Enhancer/Locus Control Region Is Not Sufficient To Open Chromatin. MOLECULAR AND CELLULAR BIOLOGY, 1993, Vol 13, Nr. 7, p. 3990-3998.

[00101] In a preferred embodiment, the target cell population consists of cells of the same type. In another preferred embodiment, the target cell population is a mixture of cell types. In another embodiment, single cells are used.

[00102] In a preferred embodiment, capture probes correspond to genomic sequences located within about 10,000, preferably between about 100-10,000 nucleotides from the transcription start sites of genes of interest. In a preferred embodiment, one or more capture probes correspond to genomic DNA sequences located about 100-10,000 nucleotides upstream of the transcription start sites of genes of interest.

[00103] In another preferred embodiment, capture probes correspond to genomic DNA sequences located within about 10,000, preferably about 100-10,000 nucleotides from the 5' or 3' ends of introns of interest.

[00104] In another preferred embodiment, capture probes correspond to genomic sequence located within about 10,000, preferably about 100-10,000 nucleotides from a previously identified active chromatin element, and do not complement previously identified active chromatin elements. In another embodiment, one or more capture probes used complement previously identified active chromatin elements.

[00105] In some embodiments, PCR primers are labeled to facilitate the detection of PCR product hybridization to capture probes. In other embodiments, amplification products are otherwise labeled during synthesis, or signal probes comprising labels are used. Labels may be direct or indirect, and include Cy-5, Cy-3, and other fluorescent labels.

[00106] In some embodiments, a signal probe, which will hybridize to a region of a PCR product different from the region of the PCR product that hybridizes to the capture probe, is added to the PCR product/capture probe incubation to facilitate the detection of hybridization. The signal probe may be labeled, and detecting hybridization may involve detecting signal probe label.

[00107] In one aspect, the invention is directed to methods for profiling the occurrence and distribution of open chromatin within one or more segments of genomic DNA to provide a chromatin state profile for genomic DNA segments. These assays may be used with a variety of cell types under a variety of conditions. The segment of genomic DNA may be, for example, a chromosome or a fragment thereof. In a preferred embodiment, methods for determining the occurrence and distribution of open chromatin within an entire chromosome are provided. In another preferred embodiment, methods for determining the occurrence and distribution of active chromatin within a number of entire chromosomes collectively constituting an entire genome are provided. The complete genomic DNA sequence need not be known. Partial sequence information, providing for the design of capture probe sequences, and optionally amplification primer or signal probe sequences, is sufficient.

[00108] The methods comprise the steps of preparing chromatin from a target cell or population, treating the chromatin with an open chromatin DNA cleaving agent to induce cleavage at open chromatin sites in marked preference to other locations within the genome, amplifying the treated fragments (preferably by PCR), incubating the amplification products with capture probe (preferably on a chromatin state profiling array) and determining hybridization of capture probe to amplification products.

[00109] The amplification reaction of the invention is designed such that when a genomic DNA sequence that has not been cleaved by the open chromatin DNA cleaving agent is used as substrate, the reaction produces products that hybridize to a capture probe of predetermined sequence. A lack or reduction of hybridization of capture probe to amplification products indicates the presence of open chromatin in the genomic DNA sequence.

[00110] The polymerase chain reaction is a highly preferred amplification reaction. Preferably about 30-40 cycles of PCR are done.

[00111] In a preferred embodiment, the open chromatin DNA cleaving agent is a non-sequence- specific endonuclease, preferably DNAse I.

[00112] Preferably, capture probes are present on a chromatin state profiling array. Preferably more than one copy of a particular capture probe is used. Preferably 2-3 copies of a particular capture probe are used. In one embodiment, the copies are on the same chromatin state profiling array. In another embodiment, the copies are on different chromatin state profiling arrays. Highly preferred capture probes for use in the chromatin state profiling arrays of the invention are between about 10- 25, more preferably 12-25 nucleotides in length, though longer sequences may be used. Preferably the capture probes do not contain a sequence of 10 or more nucleotides that occurs in the genome of the cell or organism more than once. Preferred capture probes have sequences that are not present in and do not complement mRNAs.

[00113] In a preferred embodiment, a plurality of capture probes are used corresponding to a plurality of sequences in genomic DNA, wherein the plurality of sequences in genomic DNA do not overlap and are distributed at regular intervals through regions of non-repetitive DNA sequence in the genomic DNA. The intervals are preferably from between about 5,000 to about 10,000 nucleotides. In other embodiments, the intervals may be less than 5,000 or more than 10,000 nucleotides. Spacing greater than 10,000 nucleotides between capture probe-corresponding genomic sequences is used preferably in combination with appropriate long-range PCR strategies. In other embodiments, the corresponding genomic DNA sequences are distributed at irregular intervals.

[00114] In a preferred embodiment, a plurality of capture probes are used corresponding to a plurality of non-overlapping sequences in genomic DNA, each of these genomic sequences being separated from another by from between about 5,000 to about 10,000 nucleotides in non-repetitive genomic DNA sequence. In other embodiments, spacing is greater than 10,000 nucleotides. Spacing greater than 10,000 nucleotides between capture probe-corresponding genomic sequences is used preferably in combination with appropriate long-range PCR strategies. In other embodiments, spacing is less than 5,000 nucleotides.

[00115] In one embodiment, PCR primers are designed such that at least one primer of a primer pair (or single primers if one-sided PCR is done) flanks a capture probe-corresponding genomic DNA sequence such that at least one open chromatin site is interposed between the capture probe- corresponding and primer-corresponding genomic DNA sequences. Thus, the primers are designed to provide amplification products that will hybridize to capture probes when genomic DNA that has not been treated with open chromatin DNA cleaving agent is used as substrate. Spacing greater than 10,000 nucleotides between capture probe-corresponding genomic DNA sequences is used preferably in combination with appropriate long-range PCR strategies.

[00116] In another embodiment, random primers are used, preferably in combination with signal probes. A signal probe corresponds to genomic DNA sequence that flanks the capture probe- corresponding genomic DNA sequence such that at least one open chromatin site is interposed between the signal probe-corresponding and capture probe-corresponding genomic DNA sequences. The signal probes used hybridize to one or more polymerase chain reaction products that hybridize to capture probe, which products are produced with the random primers when genomic DNA that has not been treated with the open chromatin DNA cleaving agent is used as substrate.

[00117] In an alternative embodiment, signal probes are not used. Such methods may be used to detect open chromatin in the vicinity of a chosen capture probe, wherein the extent of "vicinity" is determined by the length of PCR reaction products.

[00118] In a preferred embodiment, the open chromatin DNA cleaving agent is a non-sequence- specific endonuclease, preferably DNAse I.

[00119] In a preferred embodiment, the target cell population consists of cells of the same type. In another preferred embodiment, the target cell population is a mixture of cell types. In another embodiment, single cells are used.

SELECTION OF CAPTURE PROBES, PCR PRIMERS, AND SIGNAL PROBES [00120] The choice of capture probes, PCR primers, and signal probes is facilitated by the wealth of genomic and gene structure data currently available. It will also be appreciated that a variety of schemes may be used in choosing capture probes, PCR primers, and signal probes for use in the invention.

[00121] Capture probes have predetermined sequences and correspond to particular genomic DNA sequences. "Correspond to" is used herein in a positional sense. A capture probe may be substantially complementary or homologous to, rather than completely complementary or identical to, its corresponding genomic DNA sequence. Capture probes will hybridize to their corresponding genomic DNA sequences, or complements thereof, under high stringency conditions. By "substantially complementary" is meant a situation wherein a probe sequence is sufficiently complementary to its corresponding genomic DNA sequence to cause hybridization of the probe to its corresponding genomic DNA sequence under high stringency conditions. A description of "high stringency conditions" may be found, for example, in Sambrook, J., Russell, D.W. Molecular Cloning. A laboratory Manual. 2000. Cold Spring Harbor Laboratory Press.; Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith. J.A. Short Protocols in Molecular Biology, 4th edition, 2002, Publisher: Current Protocols.

[00122] High stringency conditions are sequence-dependent and will differ depending on specific circumstances. Longer sequences hybridize more specifically at higher temperatures. High stringency conditions will be those in which the salt (e.g., sodium chloride) concentration is less than about 1.0 M, typically between 0.01 to 1.0 M at pH 7.0 to 8.3, and the temperature is at least about 30 °C for short probes (e.g., 10 to 50 nucleotides (nt)) and at least about 60 °C for long probes (e.g., greater than 50 nt) in an entirely aqueous hybridization medium. High stringency conditions may also be achieved with the addition of helix destabilizing agents such as formamide. The hybridization conditions may also vary when a non-ionic probe backbone (e.g., PNA) is used, as is known in the art.

[00123] Preferably, the capture probe-corresponding genomic DNA sequences are unique, meaning they are not repeated in the genome. Where the complete genomic sequence is not known, capture probes with corresponding genomic DNA sequences that appear to be unique based on known sequence information are preferred. Preferably, capture probe sequences and their complements are also not repeated in the genome.

[00124] Identifying and eliminating repetitive sequences in an effort to obtain capture probes with sequences that are not repeated in the genome and that correspond to unique genomic DNA sequences may be done by any means available in the art. For example, software programs, such as Repeatmasker, may be used to evaluate potential probe sequences and identify repetitive sequences, see Britten RJ. Proc Natl Acad Sci U S A. 2002 Oct 15;99(21):13633-5; Bedell JA, Korf I, Gish W. Bioinformatics. 2000 Nov;16(11):1040-1; Edwards YJ, Carver TJ, Vavouri T, Frith M, Bishop MJ, Elgar G. Nucleic Acids Res. 2003 Jul 1 ;31(13):3510-7; Shah SP, He DY, Sawkins JN, Druce JC, Quon G, Lett D, Zheng GX, Xu T, Ouellette BF. Bioinformatics. 2004 Apr 19;5(1):40. [00125] As an example, where a capture probe is desired to correspond to genomic sequence about 100-10,000 nucleotides from the transcription start site of a gene, short sequences (eg., 100-200 nucleotides) at those locations may be analyzed using Repeatmasker or similar software to identify and eliminate subsequences that are repeated in genomic DNA.

[00126] As another example, where capture probes are desired to correspond to genomic sequence at intervals through non-repetitive genomic DNA segments, short sequences (eg., 100-200 nucleotides) at those intervals may be analyzed using Repeatmasker or similar software to identify and eliminate subsequences that are repeated in genomic DNA

[00127] PCR primers of predetermined sequences that correspond to unique genomic DNA sequences, and which comprise and complement sequences that are not repeated in genomic DNA are preferred in some embodiments. Such primers may be designed using methods similar to those described above. In other embodiments, random primers are used, preferably hexanucleotides.

[00128] The polymerase chain reaction of the invention is designed such that when a genomic DNA sequence that has not been cleaved by an open chromatin DNA cleaving agent is used as substrate, the reaction produces products that hybridize to a capture probe of predetermined sequence. A lack or reduction of hybridization of capture probe to amplification products indicates the presence of open chromatin in the genomic DNA sequence. Preferably, between about 30-40 cycles of PCR are done.

[00129] In a preferred embodiment, the polymerase chain reaction is done using a single primer of predetermined sequence in a one-sided amplification reaction. Such single primers preferably correspond to unique genomic DNA sequences and preferably comprise and complement sequences that are not repeated in the genome. In a preferred embodiment, the single primer is labeled. In a preferred method for detecting open chromatin in two or more regions of interest, a plurality of single primers are used for a plurality of single-sided amplification reactions. Each primer preferably corresponds to a unique genomic DNA sequence, and preferably comprises and complements sequences that are not repeated in the genome.

[00130] In another preferred embodiment, the polymerase chain reaction is done using primer pairs. Primers preferably correspond to unique genomic DNA sequences, and preferably comprise and complement sequences that are not repeated in the genome. The primers may be labeled. PCR primers having capture probe sequences or overlapping therewith may be used as one primer of a primer pair. Such primers must be removed prior to hybridization of amplification products to capture probe. In a preferred method for detecting open chromatin in two or more regions of interest, a plurality of primer pairs are used for a plurality of amplification reactions.

[00131] In another preferred embodiment, the polymerase chain reaction is done using random primers, preferably hexanucleotides. In a preferred embodiment, when random primers are used, signal probes are used to determine the hybridization of capture probes to amplification products. When signal probes are not used, capture probe-corresponding sequences are preferably unique, and capture probes preferably comprise and complement sequences that are not repeated in the genome.

[00132] In other embodiments, any of the variety of other nonspecific DNA amplification methods known in the art may be used to amplify genomic DNA treated with open chromatin DNA cleaving agent.

[00133] Signal probes that correspond to unique genomic DNA sequences, and which comprise and complement sequences that are not repeated in genomic DNA are preferred. Signal probes may be designed using methods similar to those described above.

[00134] It will be understood that the arrays and methods of the invention may be used to detect open chromatin in a locus-specific manner, even though in some embodiments capture probes, and primers or signal probes, may not correspond to unique genomic DNA sequences, and may comprise or complement sequences that occur in the genome more than once. This is because in such embodiments, both capture probe, and primer or signal probe correspond to the same region of genomic DNA, which is from about 100-10,000 nucleotides in length.

PROFILE COMPARISONS

[00135] It is understood that modifications of chromatin structure underlie gene regulation, and that open chromatin sites are dynamic and vary in conformation (open and accessible to open chromatin cleaving agent, or not open and inaccessible to open chromatin cleaving agent) with cell type, developmental stage, and cellular environment. A number of important advantages of the present invention stem from the ability to readily compare chromatin state profiles between biological samples.

[00136] A chromatin state profile generally is prepared using a chromatin state profiling array. A chromatin state profile for a particular sample may be compared with one or more other chromatin state profiles for other samples. The comparative results can provide information pertaining to disease states, developmental state, susceptibility to drug therapy, homeostasis, and other information about the sampled cell or population.

[00137] A chromatin state profile for a sample may be as simple as a description of 2 to 5, 5 to 10, 10 to 25, 25 to 100, or 100 to 500 open chromatin sites. The sample may be derived from a single cell or a plurality of cells. Chromatin state profiling can be done using a combination of capture probes that are directed to different types of regions of interest, such as upstream gene regulatory sequences, previously identified active chromatin elements, and introns. Combinations of capture probes may be used on a single chromatin state profiling array of the invention.

[00138] Chromatin state profiles may be compared between like cells that differ in any of a number of ways. For example, profiles of cells at different developmental stages, in different microenvironments, or under different physical conditions may be generated and compared. The methods generally involve obtaining a first chromatin state profile from a cell or population under control conditions or from a reference state, and a second chromatin state profile from a cell or population under experimental conditions or a different state. Comparison of the first profile with the second profile reveals open chromatin sites that are affected by the experimental conditions or change in state, and such comparisons may be used to identify regulatory networks that respond to these alterations.

[00139] In one embodiment, chromatin state profiles may be compared between different cell types. The cell types compared may vary slightly, moderately, or greatly in their degree of lineage divergence. The comparison of such profiles will reveal open chromatin sites that differ in conformation between different cell types, and may reveal regulatory features common to apparently divergent cell types.

[00140] In one embodiment, the invention also provides methods for discerning the effect of altering the expression and/or activity of one or more regulatory factors on a regulatory network in a target cell or population, comprising obtaining a first chromatin state profile of the target cell or population under controlled culture conditions, obtaining a second chromatin state profile of the target cell or population under conditions wherein the expression and/or activity of the regulatory factor is altered with respect to the controlled culture conditions, and comparing the first profile with the second profile to determine which open chromatin sites are affected by the alteration of the known regulator. Altered expression and/or activity of the one or more regulatory factors may be achieved in any of the large number of ways known in the art, including but not limited to the use of RNAi, antisense, dominant negative, decoy, and bioactive small molecule strategies.

[00141] In one aspect, the invention provides diagnostic methods, prognostic methods, disease staging methods, and methods for monitoring the progress of therapy.

[00142] In one embodiment, the invention provides methods for identifying a chromatin state profile associated with a disease state, comprising (i) obtaining a first chromatin state profile or set of profiles for a tissue, wherein the first profile or set of profiles is representative of a normal healthy condition, and (ii) obtaining a second chromatin state profile or set of profiles for a tissue, wherein the second profile or set of profiles is representative of a disease condition. By comparing the first profile or set of profiles with the second profile or set of profiles, one can readily identify open chromatin sites that differ in conformation between the disease condition and the normal condition, and begin to identify regulatory network changes that underlie the disease condition.

[00143] The invention thus further encompasses disease-condition associated chromatin state profiles or sets of profiles, as well as methods for diagnosing the presence of disease conditions in patients. The methods comprise obtaining a chromatin state profile for a biological sample obtained from a patient suspected of having a disease condition and comparing the chromatin state profile to a disease-condition associated chromatin state profile or set of profiles which evidence the disease condition. [00144] In a similar manner, chromatin state profiles or sets of profiles associated with particular prognoses may be identified. Profiles from diseased cells or tissues exhibiting different behavior, including response to treatment, may be established using compositions and methods described herein. The contrast between profiles associated with different prognoses may be used to identify prognosis-associated open chromatin sites and gene regulatory sequences. A chromatin state profile for a biological sample obtained from a patient may be compared to a chromatin state profile or set of profiles associated with particular prognoses to determine the patient's prognosis.

[00145] In a similar manner, chromatin state profiles or sets of profiles associated with disease stages may be identified. Profiles from cells or tissues at different stages of disease may be established using methods described herein. The contrast between profiles associated with different stages of disease may be used to identify disease stage-associated open chromatin sites and gene regulatory sequences. A chromatin state profile for a biological sample obtained from a patient may be compared to a chromatin state profile or set of profiles associated with particular disease stages to determine the stage of the patient's disease.

[00146] In one embodiment, the invention provides methods of ascertaining the effects of candidate or established therapeutic agents on a cell, tissue, or organism. The methods generally involve obtaining a first chromatin state profile from cells not exposed to the candidate or established therapeutic agent, and a second chromatin state profile from cells exposed to the candidate or established therapeutic agent. Comparison of the first profile with the second profile reveals open chromatin sites that are affected by the agent, and patterns of regulatory responses to agents may be determined. Cells may be exposed to the agent, or cells may be from tissue that is exposed to the agent, or cells may be from an organism that is exposed to the agent.

[00147] An open chromatin site may be modified from open chromatin to compacted chromatin, or vice versa, and shift its sensitivity to an open chromatin DNA cleaving agent accordingly when a cell is exposed to a test compound. Such alterations may be identified by comparison of chromatin state profiles generated for cells in the presence and absence of test compounds.

[00148] "Test compounds" or "candidate agents" as used herein includes candidate and established therapeutic agents, and describes any molecule, e.g., protein, small organic molecule, carbohydrates (including polysaccharides), polynucleotide, lipids, etc.

[00149] Preferred test compounds include organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons, more preferably between 100 and 2000, more preferably between about 100 and about 1250, more preferably between about 100 and about 1000, more preferably between about 100 and about 750, more preferably between about 200 and about 500 daltons. Test compounds comprise functional groups necessary for structural interaction with proteins, nucleic acids, or other biomolecules, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Test compounds are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

[00150] Test compounds are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification to produce structural analogs.

[00151] The identification of one or a plurality of functional sites that is characteristic of a given disease state relative to a healthy control state, for example, provides important diagnostic information about the disease state. In one example, chromatin activity profiles are generated in accordance with the present invention for at least two samples or sets of samples, one representing healthy control human tissue and the other representing diseased human tissue, in order to identify potential active chromatin that is altered in the disease state. The invention thus provides methods for identifying chromatin activity profiles that are associated with, and thereby diagnostic for, a disease state. For example, chromatin activity profiles can be generated for a collection of samples, e.g., a variety of cancer samples, and compared to a suitable reference profile such as a profile generated from normal healthy tissue of the same type from which the cancer sample was derived. Alterations in chromatin conformation can be readily detected and quantitated by the methods described herein to identify a "signature" profile of chromatin activity that is characteristic of, and preferably diagnostic for, the disease. Profiling identifies genomic DNA regions that have utility in methods for the diagnosis and/or monitoring of the disease state with which open or compacted (uncleavable) chromatin conformations at the genomic DNA regions are associated, as well utility in the screening and discovery of drugs that modulate chromatin state at the identified genomic DNA regions related to the disease.

[00152] In another embodiment, chromatin state profiling in accordance with the present invention may be combined with mRNA expression profiling of the same cells or tissues to reveal chromatin state changes that correlate with mRNA expression changes.

[00153] Generally, the methods of profiling are as described above and comprise the steps of preparing chromatin from a target cell or population, treating the chromatin with an open chromatin DNA cleaving agent to induce DNA cleavage at active chromatin sites in marked preference to other locations in chromatin, amplifying the treated chromatin DNA (preferably by PCR), incubating the amplification products with capture probes (preferably on a chromatin state profiling array), and determining the hybridization of capture probes to amplification products. PREPARATION OF CHROMATIN

Chromatin can be prepared according to Reitman et al., Molecular and Cellular Biology, July 1993, pp. 3990-3998). Alternatively, any of the chromatin preparation techniques well known in the art may be used. The method of chromatin preparation is not critical to the invention. However, the preparation technique should not result in the extensive shearing of genomic DNA and the reduction of genomic DNA to small fragments.

BINDING OF PROBE TO ARRAY

[00154] PCR products are incubated with chromatin activity profiling arrays under conditions appropriate for sequence-specific binding. Nucleic acid-nucleic acid binding conditions are known in the art and are described, for example, in U.S. Pat. No. 6,171,794 and references cited therein. See also Sambrook, J., Russell, D.W. Molecular Cloning. A laboratory Manual. 2000. Cold Spring Harbor Laboratory Press.; Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith. J.A. Short Protocols in Molecular Biology, 4th edition, 2002, Publisher: Current Protocols.

ARRAYS

[00155] An "array" is a plurality of different nucleic acids immobilized at positionally-addressable locations on a solid or semi-solid phase surface.

[00156] In accordance with the present invention, arrays may be constructed and used to assay for the presence of open chromatin in genomic DNA regions of interest. Regions of interest include upstream gene regulatory regions, introns, and previously identified active chromatin elements. The regions of interest may pertain to particular genes of interest, for example, sets of genes encoding helix-loop-helix factors, sets of genes encoding tumor suppressors, and sets of genes encoding cell cycle regulating factors.

[00157] Accordingly, in one embodiment, the present invention provides chromatin state profiling arrays, which are positionally addressable arrays of oligonucleotides. These arrays comprise a plurality of different oligonucleotides (frequently referred to herein as capture probes), each differing in nucleotide sequence, each being affixed to a substrate at a different locus (or a small number of loci, preferably about two to three different loci, i.e., two to three copies of each capture probe attached to the substrate to minimize artifacts), each being in the range of preferably 12-25 nucleotides in length, though longer sequences may be used, and each being complementary to and capable of hybridizing to a known genomic DNA sequence or its complement.

[00158] In a preferred embodiment, the invention provides chromatin state profiling arrays, comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to the nucleotide sequence of a different segment of genomic DNA in a genome, wherein each segment is located between about 100-10,000 nucleotides from a genomic DNA sequence of interest. [00159] In one embodiment, each capture probe-corresponding genomic DNA sequence is upstream of the transcription start site of a different gene.

[00160] In another embodiment, some capture probe-corresponding genomic DNA sequences are upstream of the transcription start sites of genes while others are downstream of the transcription start sites of genes.

[00161] Such chromatin state profiling arrays differ substantially from typical gene expression detecting microarrays in that the chromatin state profiling arrays comprise capture probes that do not complement mRNAs.

[00162] In another embodiment, each capture probe-corresponding genomic DNA sequence is between about 100-10,000 nucleotides from the 5' or 3' end of an intron. In a preferred embodiment, each capture probe-corresponding genomic DNA sequence is sequence not present in [mature] mRNAs. In another embodiment, some capture probe-corresponding genomic DNA sequences are sequences not present in mRNAs.

[00163] Such chromatin state profiling arrays differ substantially from typical gene expression detecting microarrays in that the chromatin state profiling arrays comprise capture probes that do not complement mRNAs.

[00164] In another preferred embodiment, the invention provides a chromatin state profiling array, comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to the nucleotide sequence of a different segment of genomic DNA in a genome, wherein each segment is not located in a previously identified active chromatin element, but flanks a previously identified active chromatin element in the genomic DNA. Such chromatin state profiling arrays differ substantially from typical gene expression detecting microarrays in that the chromatin state profiling arrays comprise capture probes that do not complement mRNAs.

[00165] In another preferred embodiment, the invention provides chromatin state profiling arrays, comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to the nucleotide sequence of a different segment of genomic DNA in a genome, wherein the segments are distributed at regular intervals of between about 5,000 to about 10,000 nucleotides through regions of non-repetitive DNA sequence in the genomic DNA.

[00166] Such arrays differ substantially from typical gene expression detection microarrays in that the majority of capture probes of the chromatin state profiling arrays do not complement mRNAs. Rather, the capture probes, in the present embodiment, may be regarded as representing molecular 'stakes' planted throughout the genome, without reference to expressed sequences or gene structure, for the purpose of assaying for the presence of open chromatin in flanking genomic sequence.

[00167] As will be appreciated, chromatin state profiling array design and construction, particularly the choice of capture probes used in the arrays, is facilitated by the wealth of genomic and gene structure data currently available. It will also be appreciated that a variety of schemes may be used in choosing capture probes for use in the invention.

[00168] In general, for any given genomic DNA region of interest, a chromatin state profiling array may be designed and used to assay for open chromatin. The sequence of the genomic DNA region of interest need not be known. Sequence information is required only for the design of capture probes, and primers or signal probes. The capture probes may be regarded as representing molecular 'stakes' planted throughout the genome for the purpose of assaying for the presence of open chromatin in flanking genomic sequence.

[00169] The oligonucleotide sequences of the chromatin activity profiling arrays may be obtained or deposited in any of a variety of ways, for example, by amplifying the oligonucleotide sequences using PCR and subsequently depositing them with a microarraying apparatus; synthesizing the oligonucleotide sequences ex situ with an oligonucleotide synthesis device and subsequently depositing them with a microarraying apparatus; or by synthesizing the oligonucleotide sequences in situ on the microarray by, for example, piezoelectric deposition of nucleotides. The number of sequences deposited on the array may vary between about 10 and several million depending on the technology employed to create the array.

[00170] An array of the invention typically comprises at least 10, more preferably at least 100, 250, 500, 1000, 2000, 5,000 and even more than 10,000 oligonucleotides. A chromatin state profile for a cell typically describes at least 10, more preferably at least 100, 250, 500, 1000, 2000, 5,000 and even more than 10,000 open chromatin sites in some cases.

[00171] By "oligonucleotide" or "nucleic acid" or grammatical equivalents herein is meant at least two nucleotides covalently linked together. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined herein, particularly with respect to antisense nucleic acids or probes, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage, et al., Tetrahedron, 49(10):1925 (1993) and references therein; Letsinger, J. Org. Chem., 35:3800 (1970); Sprinzl, et al., Eu Biochem.. 81 :579 (1977); Letsinger, et al., Nucl. Acids Res., 14:3487 (1986); Sawai, et al., Chem. Lett., 805 (1984), Letsinger, et al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels, et al., Chemica Scripta. 26:141 (1986)), phosphorothioate (Mag, et al., Nucleic Acids Res., 19:1437 (1991); and U.S. Patent No. 5,644,048), phosphorodithioate (Briu, et al., J. Am. Chem. Soc, 111:2321 (1989)), O- methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc, 114:1895 (1992); Meier, er a/., Chem. Int. Ed. Engl.. 31:1008 (1992); Nielsen, Nature. 365:566 (1993); Carlsson, et al., Nature, 380:207 (1996), all of which are incorporated by reference)). Other analog nucleic acids include those with positive backbones (Denpcy, et al., Proc. Natl. Acad. Sci. USA, 92:6097 (1995)); non-ionic backbones (U.S. Patent Nos. 5,386,023; 5,637,684; 5,602,240; 5,216,141 ; and 4,469,863; Kiedrowshi, et al., Angew. Chem. Intl. Ed. English. 30:423 (1991); Letsinger, et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger, etal., Nucleoside & Nucleotide, 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook; Mesmaeker, et al., Bioorqanic & Medicinal Chem. Lett.. 4:395 (1994); Jeffs, et al., J. Biomolecular NMR, 34:17 (1994); Tetrahedron Lett., 37:743 (1996)) and non-ribose backbones, including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars, as well as "locked nucleic acids", are also included within the definition of nucleic acids (see Jenkins, et al., Chem. Soc Rev.. (1995) pp. 169-176). Several nucleic acid analogs are described in Rawls, C & E News, June 2, 1997, page 35. All of these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to increase the stability and half-life of such molecules in physiological environments. In addition, mixtures of naturally occurring nucleic acids and analogs can be made. Alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc.

[00172] Capture probes are preferably from about 12 to about 25 nucleotides in length, though longer sequences may be used.

[00173] Preferred arrays are miniaturized devices for performing chemical reactions, wherein each spot on the array is typically on the order of microns, and the array itself is typically several square inches. Arrays of the invention contain oligonucleotides at positionally addressable locations on the array surface. Such arrays may be constructed via microelectronic and/or microfabrication using essentially any and all techniques known and available in the semiconductor industry and/or in the biochemistry industry, provided only that such techniques are amenable to and compatible with the deposition and screening of oligonucleotide sequences.

[00174] Arrays of the invention may be prepared by any method available in the art. For example, the light-directed chemical synthesis process developed by Affymetrix (see, U.S. Pat. Nos. 5,445,934 and 5,856,174) may be used to synthesize biomolecules on chip surfaces by combining solid-phase photochemical synthesis with photolithographic fabrication techniques. The chemical deposition approach developed by Incyte Pharmaceutical uses pre-synthesized cDNA probes for directed deposition onto chip surfaces (see, e.g., U.S. Pat. No. 5,874,554).

[00175] Other useful technology that may be employed is the contact-print method developed by Stanford University, which uses high-speed, high-precision robot-arms to move and control a liquid- dispensing head for directed DNA deposition and printing onto chip surfaces (see, Schena, M. et al. Science 270:467-70 (1995)). The University of Washington at Seattle has developed a single- nucleotide probe synthesis method using four piezoelectric deposition heads, which are loaded separately with four types of nucleotide molecules to achieve required deposition of nucleotides and simultaneous synthesis on chip surfaces (see, Blanchard, A. P. et al. Biosensors & Bioelectronics 11:687-90 (1996)). Hyseq, Inc. has developed passive membrane devices for sequencing genomes (see, U.S. Pat. No. 5,202,231). These methods and adaptations of them as well as others known by skilled artisans may be used for embodiments of the invention.

[00176] Arrays generally may be of two basic types, passive and active. Passive arrays utilize passive diffusion of sample molecule for chemical or biochemical reactions. Active arrays actively move or concentrate reagents by externally applied force(s). Reactions that take place in active arrays are dependant not only on simple diffusion but also on applied forces. Most available array types, e.g., oligonucleotide-based DNA chips from Affymetrix and cDNA-based arrays from Incyte Pharmaceuticals, are passive. Structural similarities exist between active and passive arrays. Both array types may employ groups of different immobilized ligands or ligand molecules. The phrase "ligands or ligand molecules" refers to biochemical molecules with which other molecules can react. For instance, a ligand may be a single strand of DNA to which a complementary nucleic acid strand hybridizes. Preferably the reaction between ligand(s) and other molecules is monitored and quantified with one or more markers or indicator molecules such as fluorescent dyes. In preferred embodiments a matrix of ligands immobilized on the array enables the reaction and monitoring of multiple analyte molecules. A two dimensional array is particularly useful for generating a convenient profile that may be imaged.

[00177] More recent developments in array manufacture and use are also contemplated. For example, electronic arrays developed by Nanogen can manipulate and control sample biomolecules by electrical fields generated with microelectrodes, leading to significant improvement in reaction speed and detection sensitivity over passive arrays (see, U.S. Pat. Nos. 5,605,662, 5,632,957, and 5,849,486). Another active array procedure contemplated in some embodiments is the technology described in U.S. Pat. No. 6,355,491 and issued to Zhou et al. entitled "Individually addressable micro-electromagnetic unit array chips." This latter technology provides an active array wherein individually addressable (controllable) units arranged in an array generate magnetic fields. The magnetic forces manipulate magnetically modified molecules and particles and promote molecular interactions and/or reactions on the surface of the chip. After binding, the cell-magnetic particle complexes from the cell mixture are selectively removed using a magnet. (See, for example, Miltenyi, S. et al. "High gradient magnetic cell-separation with MACS." Cytometry 11 :231-236 (1990)). Magnetic manipulation also is used to separate tagged functional site sequences during sample preparation in desirable embodiments, before application of DNA to a test array.

[00178] Further examples of technology contemplated for use in making and using arrays are provided in "Genome-wide expression monitoring in Saccharomyces cerevisiae." by Wodicka, L. et al. (Nature Biotechnol. 15:1359-1367 (1997)), "Genomics and Human disease-variations on variation." by Brown, P. O. and Hartwell, L. and "Towards Arabidopsis genome analysis: monitoring expression profiles of 1400 genes using cDNA microarrays." by Ruan, Y. et al. (The Plant Journal 15:821-833 (1998)). [00179] Additional microarray technologies that may be utilized according to the present invention include, for example, electronic microarrays, including, e.g. the NanoChip Electronic Microarray, which is available from Nanogen, Inc. (San Diego, Calif.) and described in detail in U.S. Pat. No. 6,258,606, "Multiplexed Active Biologic Array"; U.S. Pat. No. 6,287,517, "Laminated Assembly for Active Bioelectronic Devices"; U.S. Pat. No. 6,284,117, "Apparatus and Method for Removing Small Molecules and Ions from Low Volume Biological Samples"; U.S. Pat. No. 6,280,590, "Channel-Less Separation of Bioparticles on a Bioelectronic Chip by Dielectrophoresis"; and U.S. Pat. No. 6,254,827, "Methods for Fabricating Multi-Component Devices for Molecular Biological Analysis and Diagnostics, and references cited therein, all of which are incorporated by reference in their entirety.

[00180] Methods of the invention may further include nanopore technologies developed by Harvard University and Agilent Technologies, including, e.g. nanopore analysis of nucleic acids. Nanopore technology can distinguish between a variety of different molecules in a complex mixture, and nanopores can be used according to the invention to readily sequence nucleic acids and/or discriminate between hybridized or unhybridized unknown RNA and DNA molecules, including those that differ by a single nucleotide only. Nanopore technology is described in U.S. Pat. No. 6,015,714, "Characterization of individual polymer molecules based on monomer-interface interactions," related patents and applications, and references cited within, all of which are incorporated by reference in their entirety.

[00181] In certain embodiments, the invention may employ surface plasmon resonance technologies, such as, for example, those available from Biocore International AB, including the Biacore S51 instrument, which provides high quality, quantitative data on binding kinetics, affinity, concentration and specificity of the interaction between a compound and target molecule. Surface plasmon resonance technology provides non-label, real-time analysis of biomolecular interactions and may be used in a variety of aspects of the present invention, including high throughput analysis of arrays. Surface plasmon resonance methods are known in the art and described, for^'example, in U.S. Pat. No. 5,955,729, "Surface plasmon resonance-mass spectrometry" and U.S. Pat. No. 5,641,640, "Method of assaying for an analyte using surface plasmon resonance," which also describes analysis in a fluid sample, which are incorporated by reference in their entirety.

[00182] Arrays of the invention include, in certain embodiments, peptide nucleic acid (PNA) biosensor chips. PNA is a synthesized DNA analog in which both the phosphate and the deoxyribose of the DNA backbone are replaced by polyamides. These DNA analogs retain the ability to hybridize with complementary DNA sequences. Because the backbone of DNA contains phosphates, of which PNA is free, an analytical technique that identifies the presence of the phosphates in a molecular surface layer would allow the use of unlabelled genomic DNA for hybridization on a biosensor chip rather than the use of DNA fragments labeled with radioisotopes, stable isotopes or fluorescent substances. A major advantage of PNA over DNA is the neutral backbone and the increased strength of PNA/DNA pairing. The lack of charge repulsion improves the hybridization properties in DNA/PNA duplexes compared to DNA/DNA duplexes, and the increased binding strength usually leads to a higher sequence discrimination for PNA-DNA hybrids than for DNA-DNA.

[00183] All citations provided herein are expressly incorporated in their entirety by reference.

EXPERIMENTAL

Example 1: The Impact of HES-1 Inactivation on HLH Gene Regulation

Methods

Cell culture and blocking of HES1 expression

[00184] Human neuroblastoma LAN5 cells were obtained from ATCC. Cells were grown in DMEM supplemented with 10% fetal bovine serum.

[00185] Antisense oligonucleotides were used to block HES1 expression.

[00186] S-oligonucleotides (phosphothioates) (Sigma Genosys) with following sequences were used: Anti-Hes1-1: 5'- ACC GGG GAC GAG GAA TTT TTC; Anti-Hes 1-2: 5'- CAC GGA GGT GCC CTG TTG CTG GGC TGG TGT GGT GTA GAC, Control s-oligonucleotide contained a scrambled sequence 5'- TCG GAG ACT TTC TGT CGG GCT GAT CGG TCG GGC TGG GGA G (Kabos, P., Kabosova, A., Neuman, T. 2002. Blocking HES1 expression initiates GABAergic differentiation and induction of _P21^{CIP1 WAF1} j_n human neural stem cells. J. Biol. Chem, 277, 8763-8766). Oligonucleotides were added to the growth media at a final concentration of 5μM. The medium with the oligonucleotides was replaced every day during the experiment.

DNAse I treatment and isolation of DNA

[00187] Nuclei were prepared from 5 X 10⁷ cells using standard technique described elsewhere. Nuclei were resuspended at a concentration of 8 OD/ml with 20 microliters of 5U/microliter DNasel [Sigma] at 37 °C for 3 min. The DNA was purified using DNA extraction KIT (Qiagen).

Oligonucleotides and microarray

[00188] Oligonucleotides, 21-25 nucleotides long corresponding to genomic DNA sequences flanking promoter regions of HLH genes were synthesized so that forward primer was located approximately 3000 nucleotides 5' from transcription initiation site and reverse primer was in the first exon.

[00189] 5' primers/oligonucleotides were printed on the array using mirrored slides (RPK0331, Amersham). Oligonucleotides were crosslinked to the slides with 500mJ, using Stratagene's Stratalinker. The slides were stored desiccated until use.

Amplification of DNA

[00190] One sided PCR using Cy3 and Cy5 labeled primers were used to amplify genomic DNA. DNAse I treated DNA was amplified using Cy3 and control DNA using Cy5. However, different amplification methods can be used. Preferably between about 30-40 cycles of PCR are done. Microarray analysis [00191] Amplified and labeled DNA was hybridized to oligonucleotide arrays.

[00192] The calculated amounts of probes were mixed and dried down in the dark. The paired probes were resuspended in 8.5 μl of 4 X hybridization buffer (Amersham, #RPK0325) and 8.5 μl of water and then mixed with 17 μl of formamide and vortexed. The mixture was heated at 95 °C for 3 min then cooled by spinning at 13K for 2 min. 30 μl of this hybridization solution was used for hybridization at 42 °C for 16 h in a humid and darkened hybridization chamber. The slides are washed in the dark with gentle agitation. The washes used were 5 min at 37 °C in Wash 1 (1 XSSC, 0.2% SDS), two 5 min washes at 37 °C in Wash 2 (0.1 X SSC, 0.2% SDS) and two 5 min washes at room temperature in Wash 3 (0.1XSSC). The slides were air-dried and scanned immediately using Alpha innotech array scanner.

Results

[00193] Here we analyzed changes of DNAse I HSS in promoter regions of 37 HLH TF genes followed by blocking expression of HES1 using human neuroblastoma LAN5 cells as a model. We blocked HES1 expression using antisense oligonucleotides and performed DNAse I treatment of control and antisense oligonucleotide treated cells. For the analysis of DNAse I HSS isolated DNA was amplified using oligonucleotides corresponding to DNA sequences in first exons of 37 HLH genes. DNA from DNAse I treated nuclei was amplified using Cy3 labeled oligonucleotides and DNA from untreated nuclei using Cy5 labeled oligonucleotides. Amplified DNA from DNAse treated and untreated nuclei was mixed together for the array analysis. Ratio of Cy3/Cy5 signal on each spot in the microarray shows the extent of sensitivity of DNA to DNAse I treatment and characterizes the chromatin activity. Microarray was made using oligonucleotides that correspond to DNA sequences localized approximately 3000 nucleotides from the transcriptional start site of 37 HLH genes.

[00194] Array analysis of DNAse I HSS shows that blocking HES1 expression results in changes of chromatin structure of many promoter regions of HLH TF genes (Table 1 )

[00195] Table 1. Blocking HES1 expression results in changes of DNAse I HSS in promoter regions of HLH TF genes.

[00196] Our data clearly show that HLH TF genes that are involved in neuronal differentiation such as neurogenin and NeuroD family members have an increased DNAse I sensitivity. This observation is in a good correlation with known function of HES1. HES1 functions as a suppressor of neuronal differentiation and blocking its expression results in stimulation of neuronal differentiation.

[00197] DNA amplification.

[00198] Isolated DNA was amplified using Cy3 or Cy5 labeled primers. Briefly, 0.1μg of DNA was mixed with amplification buffer with 15 mM MgCI2, 50 μM labeled primer, 10 mM dNTP, 5 units of Taq polymerase (Stratagene). Since each reaction contains only one primer, the amplification is linear (one sided) not exponential. Amplification was carried out using the following program: denaturation, 1 minute at 94°C, annealing, 1 minute at 55°C and synthesis, 3 minutes at 72°C.

[00199] Table 2: Primers deposited on chromatin profiling array (Forward primer 5') and primers used in one-sided PCR amplification of DNAse I treated chromatin fragments (Reverse primer 3')

GTATGAGGTGCAGTGGATAGATGA ACCGACGGACAGATAGAAAGG

ATCCTAAGTTTCTTGACATTGTTGG GTCTCGTGTGTTGTGGTGGTG

TCCCAGAATTCTCTACCTATCAAGA CAGAGGGAAGGGTAAGTTTGAGT

CCAAAGAGAAGAAAATAAGGAGGAG GTAGGTCCTGAGCAGTGATAGTCTC

TCTTACAGATGAGGAAATCAAGACC GATCTTCTCGCTTATTTCATTGTTC

TTCAAAATTGATCTCAGTGTGTGTT ATGCATCAACACAGAAGGTTAGACT

AACTGTTGAAACTCAAAGGAAAGTG GTCTCTTCTGCAACGTCTTATTTTT

AGGGGCTTGTATTAACTGATCTTCT CTGGGCTTGCAGGACTTCAT

ATCCCTTGTGTGTAGATCAGAAAAC CTCTCCATCTTGGCAGAGCTT

GTGAAACCCCGTCTCTATTAAAAAT CTAAATAGAAAGGCGTGCTTACAAA

GTTTCCTCCACATATGTATTCATCC TAGTGACCAGCTTTCTAGACTCTCA

TAAAATATTTGGGCTGTGAAAACTC GGGTCGGAAAATTAATCAGTAAAAG

TCAAAAACGTATCAAATGTCAGAGA GAAAACCACCTACCAGACTCATTT

ACACTGAATACCTTCTCTAGGTTGG AAGTAGGGCCTTTCCTGATGAC

AGGACAGAGGGTCCTGACAGT GAGGAGGAGGAAGTGGAGGAG

GACTTTGCCTTCCAGGCTCTA AGGAGGAGAAAAGAGAGAGAATGAG

CTTTACTCACTCCCCTCGTCTAGTT AGAGCTCGAATCAGAATTCATTTTA

CGTGGGTAACTCTTTGCCCATATT AAAGGTCTCTCTGGGAATGCAGGTT

CGATATATATACCGGGTTCTCTCG ΓTTTGGCGCGCAATTTTACGGGCAATT

CATTTTAAAAATTCGTTAAAAGCGC GTAAAACGCGCGCTTTAGCGCGTTAAA

GGGGCTTTTATATACTCGACTGCA TGTGTGCGATAGCATAGCATGCCTTTC

Claims

We claim:

1. A method for detecting open chromatin in genomic DNA, said method comprising: i) preparing a chromatin sample from one or more cells, said chromatin sample comprising genomic DNA comprising one or more open chromatin sites; ii) treating a first portion of said chromatin sample with an open chromatin DNA cleaving agent to produce cleaving agent-generated DNA sample fragments; iii) performing a first amplification reaction using said cleaving agent-generated DNA sample fragments as substrate, to produce treated-sample amplification products; iv) performing a second amplification reaction using a second portion of said chromatin sample, wherein said second portion is not treated with said open chromatin DNA cleaving agent, to produce untreated-sample amplification products; v) incubating said treated-sample amplification products and said untreated-sample amplification products with a capture probe; and vi) determining the hybridization of said capture probe to said treated-sample amplification products and said untreated-sample amplification products; wherein said untreated-sample amplification products hybridize to said capture probe, and wherein reduced hybridization of said capture probe to said treated-sample amplification products as compared to the hybridization of said capture probe to said untreated-sample amplification products indicates the presence of open chromatin in said genomic DNA comprising one or more open chromatin sites.

2. The method of claim 1, wherein said open chromatin DNA cleaving agent is DNAse I.

3. The method of claim 1, wherein said first amplification reaction and said second amplification reaction are polymerase chain reactions.

4. The method of claim 3, wherein said polymerase chain reactions are one-sided and use a single primer sequence.

5. The method of claim 3, wherein said polymerase chain reactions use the same primer pairs.

6. The method of claim 5, wherein one of said primer pairs corresponds to or overlaps with the sequence of said capture probe.

7. The method of claim 3, wherein said polymerase chain reactions use the same random primers and wherein said determining stepcomprises the hybridization of a signal probe to said untreated- sample amplification products.

8. The method of claim 1, wherein said capture probe corresponds to a sequence in said genomic DNA flanking said one or more open chromatin sites in said genomic DNA.

9. The method of claim 1 , wherein said genomic DNA comprising one or more open chromatin sites includes an upstream regulatory sequence of a gene.

10. The method of claim 1, wherein said genomic DNA comprising one or more open chromatin sites includes an intron sequence.

11. The method of claim 1, wherein said genomic DNA comprising one or more open chromatin sites includes a previously identified active chromatin element.

12. The method of claim 1, wherein said capture probe is present on a chromatin state profiling array.

13. The method of claim 1, wherein said capture probe comprises a nucleotide sequence that is not present in and is not complementary to the nucleotide sequence of an mRNA transcribed in said one or more cells.

14. A method for detecting open chromatin in a plurality of genomic DNA segments, wherein each genomic DNA segment comprises at least one open chromatin site, said method comprising: i) preparing a chromatin sample from one or more cells, said chromatin sample comprising said plurality of genomic DNA segments; ii) treating a first portion of said chromatin sample with an open chromatin DNA cleaving agent to produce cleaving agent-generated DNA sample fragments; iii) performing a first plurality of amplification reactions using said cleaving agent-generated DNA sample fragments as substrate, to produce treated-sample amplification products; iv) performing a second plurality of amplification reactions using a second portion of said chromatin sample, wherein said second portion is not treated with said open chromatin DNA cleaving agent, to produce untreated-sample amplification products; v) incubating said treated-sample amplification products and said untreated-sample amplification products with a plurality of capture probes; and vi) determining the hybridization of said plurality of capture probes to said treated-sample amplification products and said untreated-sample amplification products; wherein said untreated-sample amplification products hybridize to said plurality of capture probes, and wherein reduced hybridization of one or more of said plurality of capture probes to said treated- sample amplification products as compared to the hybridization of said plurality of capture probes to said untreated-sample amplification products indicates the presence of open chromatin in one or more of said genomic DNA segments.

15. The method of claim 14, wherein said plurality of capture probes corresponds to a plurality of sequences in said genomic DNA, wherein each of said plurality of sequences in said genomic DNA occurs in non-repetitive DNA sequence in said genomic DNA, and is separated from another of said plurality of sequences in said genomic DNA by about 5,000-10,000 nucleotides.

16. The method of claim 14, wherein said plurality of capture probes corresponds to a plurality of sequences in said genomic DNA, wherein said plurality of sequences in said genomic DNA are distributed at regular intervals of between about 5,000 to about 10,000 nucleotides through regions of non-repetitive DNA sequence in said genomic DNA.

17. A chromatin state profiling array for detecting the presence of open chromatin in genomic DNA, said array comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to a different genomic DNA sequence, wherein said different genomic DNA sequences do not overlap, wherein one or more of said capture probes comprises a nucleotide sequence that is not present in and is not complementary to the nucleotide sequence of an mRNA transcribed from said genomic DNA, and wherein each of said different genomic DNA sequences is within about 10,000 nucleotides from a transcription start site of a gene or within about 10,000 nucleotides from the 5' or 3' end of an intron.

18. The chromatin state profiling array of claim 17, wherein one or more of said different genomic DNA sequences is within about 10,000 nucleotides from a transcription start site of a gene.

19. The chromatin state profiling array of claim 18, wherein one or more of said different genomic DNA sequences is upstream of a transcription start site of a gene.

20. The chromatin state profiling array of claim 18, wherein each of said different genomic DNA sequences is upstream of a transcription start site of a gene.

21. The chromatin state profiling array of claim 17, wherein one or more of said different genomic DNA sequences is within about 10,000 nucleotides from the 5' or 3' end of an intron.

22. The chromatin state profiling array of claim 17, wherein each of said capture probes comprises a nucleotide sequence that is not present in and is not complementary to the nucleotide sequence of an mRNA transcribed from said genomic DNA.

23. A chromatin state profiling array for detecting the presence of open chromatin in one or more segments of genomic DNA, said array comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to a different genomic DNA sequence, wherein one or more of said capture probes comprises a nucleotide sequence that is not present in and is not complementary to the nucleotide sequence of an mRNA transcribed from said genomic DNA, and wherein said different genomic DNA sequences are distributed at regular intervals of about 5,000- 10,000 nucleotides through regions of non-repetitive DNA sequence in said genomic DNA.

24. The chromatin state profiling array of claim 23, wherein each of said capture probes comprises a nucleotide sequence that is not present in and is not complementary to the nucleotide sequence of an mRNA transcribed from said genomic DNA.

25. A chromatin state profiling array for detecting the presence of open chromatin in genomic DNA, said array comprising a plurality of capture probes, each capture probe comprising a nucleotide sequence that corresponds to a different genomic DNA sequence, wherein said different genomic DNA sequences do not overlap, wherein one or more of said capture probes comprises a nucleotide sequence that is not present in and is not complementary to the nucleotide sequence of an mRNA transcribed from said genomic DNA, wherein each of said different genomic DNA sequences is within about 10,000 nucleotides from one or more previously identified active chromatin elements, and wherein each of said different genomic DNA sequences is not in a previously identified active chromatin element.