WO2005077397A2 - Methods and compositions for treating vascular diseases - Google Patents

Abstract

The present invention relates to methods and compositions for treating vascular diseases, and in particular ischemic diseases. More specifically, the present invention relates to the use of lactadherin or a variant thereof (or a coding nucleic acid), for treating ischemic conditions in a subject, particularly a human subject.

Description

Methods and compositions for treating vascular diseases

The present invention relates to methods and compositions for treating vascular diseases, and in particular ischemic diseases. More specifically, the present invention relates to the use of lactadherin or a variant thereof (or a coding nucleic acid), for treating ischemic conditions in a subject, particularly a human subject. The invention also provides methods and compositions for regulating, detecting or monitoring angiogenesis, such as during pathological conditions in mammalians, including human subjects. Hie invention shows the implication of lactadherin in angiogenesis and thus provides novel therapeutic and diagnostic approaches, as well as novel methods for screening agents modulating angiogenesis, which target this protein. The invention also relates to various tools and reagents for use in the above compositions and methods, including antibodies, antisense, agonists, vectors, recombinant cells, transgenic nob- human animals and the like.

Blood vessel growth and maturation are highly complex and coordinated processes, involving numerous growth factors and related transduction pathways. Among them, vascular endothelial growth factor (VEGF) signaling represents a major critical rate-limiting step in both physiological and pathological angiogenesis ^l. The biological effects of VEGF are mainly mediated by its specific receptor, VEGF-R2 (KDR or Flk-1), expressed by endothelial cells. VEGF-induced neovascularization also requires integrin-mediated adhesion of endothelial cells to extracellular matrix. Many of the intracellular molecules that mediate VEGF signaling, such as small GTPase Ras or phosphatidyl-inositol 3-kinase participate in signaling events initiated by integrins . Physical interaction between integrins and VEGF-R2 also participates to VEGF-related effect on cell survival and proliferation . Recent studies have underlined an additional/alternative mechanism for vessel growth induction. Several pro-angiogenic extracellular matrix proteins are found in association with vascular endothelium and promote integrin-dependent angiogenesis even in the absence of exogenously added growth factors. Among these « angiomatrix » proteins, Del-1 has been shown to initiate angiogenesis and post-ischemic neovascularization by binding to integrin αvβ5 on resting endothelium, thereby resulting in expression of the transcription factor Hox D3 and integrin αvβ3 ⁴'⁵. The human BA46 or lactadherin is a secreted glycoprotein of milk-fat globule that shares structure domain homology with Del-1 ⁶. Mouse lactadherin is also known as milk fat globule-EGF-factor 8 (MFG-E8). Lactadherin/MFG-E8 contains two C-like domains found in blood clotting factors V/NIII and one (in human) or two (in mouse) EGF-like domains with an Arg-Gly-Asp (RGD) integrin-binding sequence ⁷. Lactadherin binds to integrins αvβ3 and αvβ5 ^8"10, which are expressed by endothelial cells. However, little is known about its physiological function. In milk, lactadherin acts as an antiviral protein, inhibiting the symptoms of rotavirus infection ⁿ. Lactadherin present on the sperm surface binds to egg for fertilization ¹². Mouse lactadherin was also recently described as a macrophage-derived protein that binds to apoptotic cells and targets them to phagocytes for engulfment ¹⁰'^13>14. The present invention now surprisingly shows that lactadherin is involved in neo- vascularization (angiogenesis), both post-ischemic and tumoral. The invention surprisingly demonstrates that lactadherin is expressed in and around blood vessels and has a critical role in NEGF-dependent neoangiogenesis. In the absence of lactadherin, both NEGF-dependent AKT-phosphorylation and neo-angiogenesis are defective. Lactadherin administration induced AKT phosporylation in human endothelial cells in vitro and strongly improved post-ischemic neovascularization in vivo in mice. These results demonstrate a critical role for lactadherin in NEGF-dependent neo vascularization and provide a rationale for evaluating lactadherin as a therapeutic agent in ischemic diseases. A first aspect of this invention thus resides in the use of a modulator of lactadherin for the manufacture of a medicament for regulating angiogenesis (in a pathological tissue, cell or organism), as well as a corresponding method of treatment. A further object of this invention resides in the use of lactadherin or an agonist thereof (including any biologically active variant of lactadherin) for the manufacture of a medicament for treating cardiovascular diseases, as well as a corresponding method of treatment. A more preferred aspect of this invention lies in the use of lactadherin or a biologically active variant thereof for the manufacture of a medicament for treating an ischemic disease. The invention also relates to methods of treating an ischemic disease comprising administering to a subject in need thereof an effective amount of lactadherin or a biologically active variant thereof. An other aspect of this invention relates to the use of lactadherin or a biologically active variant thereof for the manufacture of a medicament for stimulating neovascularization in a subject, as well as to a corresponding method of treatment. More specifically, the invention can be used to stimulate NEGF-dependent angiogenesis in a subject and/or for stimulating AKT phosphorylation in a subject. A further object of this invention resides in the use of an inhibitor or antagonist of lactadherin for the manufacture of a medicament for treating atherosclerosis, in particular for treating or preventing any consequences of atheromatous plaque (e.g. thrombosis, endothelial cell death, restenosis, etc.). A further object of this invention resides in the use of an inhibitor or antagonist of lactadherin for the manufacture of a medicament for treating cancers, in particular for treating or preventing cancer metastasis. A further aspect of this invention resides in a composition for treating an ischemic condition, comprising lactadherin or a biologically active fragment thereof, bound to a membrane or lipid vesicle, such as a liposome or an exosome. A further aspect of this invention is a composition comprising an anti-tumor agent in combination with an inhibitor or antagonist of lactadherin, for simultaneous, separate or sequential use for treating cancer in a subject. A further aspect of this invention resides in a method of detecting (a pathology caused by or associated to) angiogenesis in a subject, including for monitoring the progression of angiogenesis or the efficacy of a treatment, comprising determining, in a sample from the subject, the presence, quality or quantity of lactadherin or the corresponding DΝA or RΝA. The pathology may be any vascular disease, including ischemic diseases, atherosclerosis, or tumor metastasis. The sample may be any biopsy, biological fluid, cell, culture, and the like, which may be collected by any technique kown in the art, including be non-invasive techniques or from sample collections. A further object of this invention is a method of screening, selecting, characterizing, optimising or producing angiogenesis modulating compounds, comprising a step of determining the capacity of a candidate compound to interact with a lactadherin polypeptide or a coding DNA or RNA, or to modulate the expression or activity thereof. The activity of such compounds towards angiogenesis may be further validated or confirmed in any appropriate assay, such as in vitro or in vivo biological assays. A further aspect of this invention is a method of producing a medicament, comprising a step of screening, selecting, characterizing or optimising angiogenesis modulating compounds as disclosed above, and a further step of formulating such compounds or a functional analog thereof in a pharmaceutically acceptable carrier or excipient. A further object of this invention is an antibody, or a fragment or derivative thereof, which specifically binds an epitope contained in SEQ ID NO: 1 or 2.

As mentionned above, the invention may be used for treating various pathological conditions, including vascular diseases, in any subject, particularly in animal or human subjects, as a curative or preventive treatment. LEGEND TO THE FIGURES

Figure 1. a) representative RT-PCR showing lactadherin (Lacta) gene expression in skeletal muscle and aorta of control mice. RNA from dendritic cells are shown as positive control for both lactadherin and Del-1 expression, b) representative western- blot demonstrating lactadherin protein expression in mouse aorta. Dendritic cells (DC) and exosomes (exo) are shown as positive controls, c) Representative photomicrographs of non ischemic muscle sections from control mice stained with the anti-mouse lactadherin antiserum. Positive staining appears in red/brown (arrows). Magnification x40. d) Representative photomicrographs of human coronary artery stained with the anti-human lactadherin. Positive staining appears in red/pink (arrows), e) Upper, representative photomicrographs of Matrigel sections stained with Masson Trichrome from rhVEGF-Aι₆₅-treated Matrigel (VEGF) with or without i.p. administration of the rabbit anti-mouse lactadherin antiserum (α-Lac) . Magnification x20. Lower, Histological scores (left panel), CD-31 positive cells number (middle panel) and quantitative evaluation of cellular DNA (right panel) in the Matrigel of treated animals. n=7 per group. **ρ<0.01, ***p<0.001 versus control Matrigel; ttP<0.01, tttP<0.001 versus rhVEGF-Aiβs-treated Matrigel. Cont indicates mice treated with the pre-immune serum.

Figure 2. a) representative RT-PCR showing lactadherin (Lacta) gene expression in ischemic (I) and non ischemic (NI) skeletal muscle, 3 (D3), 7 (D7) or 28 (D28) days after surgical ischemia induction b) Representative photomicrographs and quantitative evaluation of microangiography (upper), capillary density (middle, capillary appears in white, arrows indicating representative examples of fϊbronectin-positive capillaries) and foot perfusion (lower) of ischemic animals treated with VEGF in the presence of pre- immune serum (VEGF), anti-lactadherin antiserum (VEGF + serum α-Lac), purified IgG from the rabbit anti-lactadherin antiserum (VEGF + IgG α-Lac), purified IgG from a non-neutralizing anti-thrombospondin rabbit anti-serum (VEGF + IgG cD D D). Control animals were not treated with VEGF but received the pre-immune serum (Cont) or anti-lactadherin antiserum (serum α-Lac). n=8 per group. *p<0.05, **p<0.01, ***p<0.001 versus control mice; fp<0.05, ffaκθ.01, tttpθ.001 versus VEGF-A₁₆₅- treated animals. Horizontal lane represents the basal value obtained in non-VEGF- treated ischemic mice (n=14).

Figure 3. a) Histological scores (left panel), CD-31 positive cells number (middle panel) and quantitative evaluation of cellular DNA (right panel) in rhNEGF-A₁₆s-treated Matrigel (VEGF) injected in wild-type mice (WT) or in lactadherin-deficient animals (lacta^{" "}). n=5 per group b) quantitative evaluation of microangiography (left), capillary density (middle) and foot perfusion (right) of NEGF-A₁₆₅ treated wild-type (WT) and lactadherin-deficient animals (Lacta -/-). n=7 per group in 2 independent experiments. *p<0.01, **ρ<0.01, ***p<0.001 versus NEGF-A₁₆₅-treated wild-type animals. Horizontal lane represents the basal value obtained in untreated ischemic mice (n=14). Figure 4. a) Left, representative western-blot of phospho-AKT, AKT, phospho- ERKl/2, ERK 1/2 protein contents in ischemic (I) and non ischemic (ΝI) leg, 28 days after femoral artery occlusion in NEGF-Aι₆₅ treated wild-type (WT) and lactadherin- deficient animals (Lacta -/-). Right, quantitative evaluation of phospho-AKT/AKT and phosρho-ERKl-2/ERKl-2 protein levels expressed as a ratio of ischemic to non ischemic limbs. n=7 per group. **p<0.01 versus VEGF-At₆₅-treated wild-type animals. b). Left, representative western-blot of lactadherin protein content in human umbilical vascular endothelial cells (HUVEC) treated or not with VEGF. Right, quantitative evaluation of lactadherin protein levels expressed as a percentage of untreated cells. Values are mean ± SEM, n=5 per group. *p<0.05 versus untreated HUVEC. c) representative western-blot of phospho-AKT and AKT protein content in HUVEC treated or not with VEGF and with increasing concentration of rabbit antiserum directed against a peptide containing the RGD sequence of human lactadherin (Anti-Lac). Figure 5. a) Quantitative evaluation of HUVEC binding to lactadherin (rhLacta), mutated lactadherin (rhLactaRGE) or vitronectin (VTN)-coated plates in presence of neutralizing antibodies directed against βl integrin (anti-βl) or αvβ3 integrin (anti- αvβ3), or αvβ5 integrin (anti-αvβ5), or GRGD peptide (GRGD) or antilactadherin antibody (anti-lacta). The OD obtained with rhlacta was 127±13 nm and was taken as 100% binding, b) Representative western-blot and quantitative evaluation of phospho- AKT and AKT protein content in HUVEC treated or not with recombinant human lactadherin (rhlactadherin, 0.3 μg/ml) and/or neutralizing antibodies directed against αvβ3 integrin (anti-αvβ3, 10 μg ml), or against αvβ5 integrin (anti-αvβ5, 10 μg/ml), or βl integrin (β5, 10 μg/ml). Figure 6. a) Representative western-blot of lactadherin protein level in the ischemic leg, 21 days after in vivo electro-transfer of empty pcDNA3 expression plasmid (cont) or pcDNA 3 coding for the short (Lac-S) or the long (Lac-L) forms of lactadherin. Exosomes (exo) are shown as positive controls, b) quantitative evaluation of microangiography (left), capillary density (middle) and foot perfusion (right) of mice treated with empty pcDNA3 expression plasmid (cont) or pcDNA 3 coding for the short (Lac-S) or the long (Lac-L) forms of lactadherin (n=10 per group in two independent experiments). For comparison, the levels of microangiography, capillary density and foot perfusion obtained in two separate experiments in mice treated with pcDNA 3 coding for VEGF are shown (VEGF, n=14). *p<0.05, ***p<0.01 versus mice treated with empty pcDNA3. Horizontal lane represents the basal value obtained in untreated ischemic mice (n=14). Figure 7. a) schematic representation of the mutant lactadherin genomic DNA containing inserted TM-β-geo reporter gene. gFl, gRl and gR2 indicate the primers used for genotyping. ATG = translation initiation codon, SS = signal sequence, CI, C2 = factor V/VIII-like domains, SA = splice acceptor site, TM = transmembrane domain, β-geo = β-galactosidase and neomycine resistance genes, b) representative PCR on DNA from wild type (WT), heterozygous (+/-) and homozygous (-/-) mutant animals, c) representative southern-blot on Kpnl-digested DNA from wild type (WT), heterozygous (+/-) and homozygous (-/-) mutant animals hybridized with a full-length lactadehrin cDNA probe, d) schematic representation of wild-type lactadherin (WT Lacta), and the mutant protein resulting from the reporter gene insertion (Lacta-β-geo), e) representative western blot for lactadherin (Lacta) and β-casein or actin as loading control, in milk and aorta from WT and homozygous (-/-) mice, showing the absence of lactadherin and of a large fusion protein in homozygous animals, f) spleen weight of over 40 weeks-old WT and homozygous (-/-) animals (10 mice per group), g) TUNEL- staining of spleen sections of 52-weeks old WT and homozygous (-/-) female mice. Positive staining appears in brown, h) β-galactosidase staining, showing expression of β-galactosidase instead of lactadherin in heart and aorta of homozygous (-/-) animals, i) β-galactosidase staining of blood vessels in histological section of hindlimb muscle in a homozygous animal, j) β-galactosidase staining of heart and stomach blood vessels (arrow) in a 15.5 days old heterozygous embryo.

Figure 8. a) Histological scores (left panel) and quantitative evaluation of cellular DNA (right panel) in rhbFGF-treated Matrigel (FGF, 500 ng) injected in wild-type mice (WT) or in lactadherin-deficient animals (lacta^{" "}). n=5 per group, b) quantitative evaluation of microangiography (left), capillary density (middle) and foot perfusion (right) of bFGF treated wild-type (WT) and lactadherin-deficient animals (Lacta -/-). n=6 per group. FGF-treated group receiving intramuscular electro-transfer of 25 μg of expression plasmid coding for the human form of FGF, c) representative western-blot of phospho- Akt and Akt protein content in HUVEC treated with VEGF or FGF and with or not 45 μg/ml rabbit anti-human lactadherin antiserum (Anti-Lac). DETAILED DESCRIPTION OF THE INVENTION

Within the context of this invention, the term "lactadherin" designates more specifically a mammalian lactadherin, more preferably a human lactadherin polypeptide, or a nucleic acid encoding the same. As discussed above, the human lactadherin (or BA46) is a secreted glycoprotein of milk-fat globule. Mouse lactadherin is also known as milk fat globule-EGF-factor 8 (MFG-E8). Lactadherin/MFG-E8 contains two C-like domains found in blood clotting factors V/VIII and one (in human) or two (in mouse) EGF-like domains with an Arg- Gly-Asp (RGD) integrin-binding sequence . Lactadherin binds to integrins αvβ3 and αvβ5 ^8"10, which are expressed by endothelial cells. The nucleotide and amino acid sequence of lactadherin have been disclosed in the literature, and may be found for instance in the following references:

Species Reference Accession N°(mRNA/ρrot)

Mouse (463 aa) Stubbs et al., 1990, PNAS 87: 8417 NM_008594 /P21956

Human (383 aa) Couto et al., 1996, DNA Cell Biol. 15, 281 U58516 / Q08431

Pig (409 aa) Ensslin et al., 1998, Biol. Reprod. 58, 1057 Y11683 / P79385

Bovine (427 aa) Aoki et al. 1995, BBA 1245, 385 NM_176610 /Q95114

Horse AJ010121

Rat (427 aa) Ogura et al., 1996, BBRC 225, 932 NM_012811 /P70490

The term "lactadherin" includes proteins from various species, and designates wild-type forms thereof, as well as any naturally-occurring variant thereof, such as resulting from splicings, polymorpliisms, and the like. A specific example of a lactadherin polypeptide according to this invention is a polypeptide comprising the sequence of Q08431 or a naturally occurring variant thereof. A biologically-active variant of lactadherin designates any polypeptide derived from the structure of a mammalian lactaherin, having angiogenic properties. Typically, such variants retain a C-like domain and/or an EGF-like domain with an Arg-Gly-Asp (RGD) integrin-binding sequence. Such biologically active variants may include naturally-occurring variants, as well as synthetic variants. Lactadherin variants may comprise or or several amino acid mutation, deletion and/or addition as compared to a reference wild-type sequence as discussed above. Preferred synthetic biologically active variants have at least 75% identity with the primary sequence of a wild-type lactadherin, even more preferably at least 80%, 85%, 90%, 95%, 96%, 97% or 98%. The level of identity may be determined by techniques lαiown in the art, such as the CLUSTAL method. Biologically active variants also include polypeptides comprising or consisting of fragments of lactadherin. Such fragments typically comprise at least 5 consecutive residues of lactadherin, preferably at least 8, 12, 20 or 30. Particular fragments may comprise up to 50, 75, 100 or 200 consecutive amino acid residues, or even more. Lactadherin and variants thereof may be produced by any technique known per se in the art, such as without limitation, any chemical, biological, genetic or enzymatic technique, either alone or in combination(s). Preferred techniques include the expression in any appropriate host cell of a corresponding coding nucleic acid molecule or the artificial synthesis using conventional techniques such as solid phase synthesis.

For use in the present invention, a lactadherin polypeptide may be in isolated (e.g., purified) form or contained in a vector, such as a membrane or lipid vesicle (e.g. a liposome or an exosome).

Alternatively, a nucleic acid construct encoding a human lactadherin polypeptide or a variant thereof may be used. Typically, said nucleic acid construct is a DNA or RNA molecule, which may be included in any suitable vector, such as a plasmid, cosmid, episome, artificial chromosome, phage or a viral vector. Such vectors may comprise regulatory elements, such as a promoter, enhancer, terminator and the like, to cause or direct expression of lactadherin upon administration to a subject. The vectors may further comprise one or several origins of replication and/or selectable markers. The promoter region may be homologous or heterologous with respect to the coding sequence, and provide for ubiquitous, constitutive, regulated and/or tissue specific expression, in any appropriate host cell, including for in vivo use. Examples of promoters include bacterial promoters (T7, pTAC, Trp promoter, etc.), viral promoters (LTR, TK, CMN-IE, etc.), mammalian gene promoters (albumin, PGK, etc), and the like.

Examples of plasmids include replicating plasmids comprising an origin of replication, or integrative plasmids, such as for instance pUC, pcDΝA, pBR, and the like. Examples of viral vector include adenoviral, retroviral, herpesvirus and AAN vectors. Such recombinant viruses may be produced by techniques known in the art, such as by transfecting packaging cells or by transient transfection with helper plasmids or viruses. Typical examples of virus packaging cells include PA317 cells, PsiCRIP cells, GPenv÷ cells, 293 cells, etc. Detailed protocols for producing such replication-defective recombinant viruses may be found for instance in WO95/14785, WO96/22378, US5,882,877, US6,013,516, US4,861,719, US5,278,056 and WO94/19478.

The above vectors or constructs may also be used to produce a lactadherin polypeptide in vitro or ex vivo, upon infroduction into a suitable host cell. Examples of such cells include, for instance, mammalian, yeast, plant, insect or bacterial cells, such as primary mammalian cells or established cell line cultures. Specific examples of mammalian cells include hepatocytes, fibroblasts, endothelial cells, progenitor cells, or cell lines such as 3T3, CHO, COS, Nero, 293T, etc. Amongst bacterial and yeast cells, E. coli, Saccharomyces and Kluyveromyces cells may be cited.

The invention may also be implemented with other agonists of lactadherin, i.e. any compound or treatment that stimulates or mimics the angiogenic activity or expression of lactadherin. Examples of such agonist include chemical compounds that have a lactadherin activity or that stimulates the lactadherin promoter, including any compound identified using a screening assay as disclosed in the present application.

For use in the present invention, the lactadherin polypeptide or nucleic acids or agonist may be formulated in any suitable, pharmaceutically acceptable carrier or diluent, such as saline solution, isotonic solution, gels, buffers and the like. The present invention is particularly suited for treating ischemic diseases in a human subject, particularly a vascular disease, such as (intermittent) claudication, laminitis, primitive thrombosis of vena axillaris, transient spinal ischaemia, gangrene, amputation, cardiomyopathies, dilated cardiomyopathy, infarct, myocardial infarction, stroke, angina pectoris, chronic coronary damages; crib death, coronary heart diseases and vascular thrombosis. The term treatment designates curative as well as preventive treatment, and may be used either alone or in combination with other active agents, such as growth factors (e.g., NEGF). As discussed in the experimental section, the present application shows, for the first time, that lactadherin, expressed in vascular cells and around vascular structures, is required for NEGF-induced vessel growth, and triggers a pathway leading to AKT phosphorylation and subsequent vessel growth. Lactadherin-deficient mice did not display specific vascular phenotype in physiological conditions, suggesting that lactadherin is not a critical regulatory molecule during embryogenesis. The lactadherin homologue protein, Del-1, which is not expressed in adult vascular tissue but is expressed in embryos, could play an analogue role in angiogenesis at these early stages ^"5. In adult mice, the basal neovascularization reaction in ischemic limbs is unaffected by the absence of lactadherin (in deficient mice or in the presence of anti-lactadherin antibody). Hence, lactadherin mainly modulates vessel growth in adults, especially in pathological conditions where growth factor-induced neovascularization is required to restore tissue perfusion. This is supported by our observation that lactadherin expression is enhanced by NEGF treatment and is required for NEGF-induced AKT phosphorylation and vessel growth. Lactadherin is involved in adhesion to integrins αvβ3 and αvβ5 ^8"10, suggesting that lactadherin-integrin interactions may promote the angiogenic phenotype. Consistent with this hypothesis, we observed that an antibody directed against the integrin αvβ3, as well as an antibody directed against the RGD sequence of lactadherin totally blocked HUNEC adhesion on lactadherin. Similarly, lactadherin-induced AKT phosphorylation was reduced by a neutralizing antibody directed against integrin αvβ3 or αvβ5. Taken together, these data highlight a novel unknown molecular link between NEGF signaling and integrins involving lactadherin as a crucial mediator of NEGF/integrin-related pathways. In conclusion, the present invention identifies an unprecedented role for vascular lactadherin as a critical mediator of NEGF pro-angiogenic effect in the adult pathological neovascularization process. Lactadherin also induces angiogenesis in the absence of exogenous growth factors. The present invention thus provides a rationale for evaluating lactadherin as potential candidate for promoting therapeutic neovascularization in ischemic diseases.

Furthermore, the angiogenic activity of lactadherin may be neutralised or antagonised in order to reduce angiogenesis associated to certain pathological conditions, such as atherosclerosis or cancer, particularly cancer metastasis. Accordingly, in a particular embodiment, the invention also includes the use of an inhibitor or antagonist of lactadherin for the manufacture of a medicament for treating atherosclerosis or cancers, in particular for treating or preventing any consequences of atheromatous plaque (e.g. thrombosis, endothelial cell death, restenosis, etc.) or for treating or preventing cancer metastasis. Inhibitors or antagonists of lactadherin may be any compound or treatment that reduce the expression of activity of lactadherin, e.g., that reduce expression, maturation, translation, secretion and/or binding of lactadherin to its receptors. Preferred inhibitors are selective, i.e., they essentially inhibit lactadherin without specifically or directly altering the activity of an other target. Most preferred inhibitors are compounds that reduce by at least 20% the angiogenic activity of lactadherin in vitro or in vivo, more preferably by at least 30%.

The inhibitors or antagonists may be selected for instance from inhibitory nucleic acids (e.g., antisense, ribozymes, iRΝA, siRΝA, and the like), which specifically inhibit the transcription or franslation of a lactadherin gene in a cell. Other inhibitors may be antibodies specific for lactadherin or fragments thereof.

In this regards, within the context of this invention, an antibody designates a polyclonal antibody, a monoclonal antibody, as well as fragments or derivatives thereof having substantially the same antigen specificity. Fragments include Fab, Fab'2, CDR regions, etc. Derivatives include single-chain antibodies, humanized antibodies, poly- functional antibodies, etc. These may be produced according to conventional methods, including immunization of an animal and collection of serum (polyclonal) or spleen cells (to produce hybridomas by fusion with appropriate cell lines). Following conventional methods of producing polyclonal antibodies from various species, the antigen is combined with an adjuvant (e.g., Freund's adjuvant) and administered to an animal, typically by sub-cutaneous injection. Repeated injections may be performed. Blood samples are collected and immunoglobulins or serum are separared. For producing monoclonal antibodies, an animal is immunized with the antigen, followed by a recovery of spleen cells which are then fused with immortalized cells, such as myeloma cells. The resulting hybridomas produce the monoclonal antibodies and can be selected by limit dilutions to isolate individual clones. Antibodies may also be produced by selection of combinatorial libraries of immunoglobulins.

Preferred antibodies of this invention are specific for lactadherin, i.e., they have a higher affinity for lactadherin than for other antigens, even if non-specific binding of other proteins may occur or binding with a lower affinity. Most preferred antibodies are specific for epitopes or regions of lactadherin, such as the RGD domain of lactadherin, in particular epitopes contained in SEQ ID NO: 1 or 2.

The antibodies of this invention have various applications, including therapeutic uses, diagnostic, purification, detection, prophylaxis, etc. In vitro, they can be used as screening agents or to purify the antigen from various samples, including various biological samples (e.g., blood samples). They can also be used to detect or quantify the presence (or amounts) of lactadherin in a sample collected from a subject, typically a blood sample from a mammalian, specifically a human subject.

Other inhibitors or antagonists of lactadherin include polypeptides comprising a fragment or a peptide of a lactadherin. Such a fragment or peptide typically comprise the RGD site of lactadherin. These inhibitors or antagonists can be used to reduce the angiogenic activity of lactadherin in a subject, in various pathological conditions, such as cancer (particularly cancer metastasis) and atherosclerosis. In the regard, a particular object of this invention is a method of treating atherosclerosis in a subject, comprising administering to the subject an effective amount of an inhibitor of lactadherin. A further object of this invention is a method of treating cancer metastasis in a subject, comprising administering to the subject an effective amount of an inhibitor of lactadherin.

The invention may be used in the treatment of various cancers, including solid tumors, such as breast cancer, sarcomas, renal cancer, melanoma, meningioma, hemangioblastoma, hepatocarcinoma, lung cancers, head-and-neck cancers, bladder cancer, prostate cancer, brain cancer or colon cancer.

Angiogenesis detection

A further aspect of this invention resides in methods of detecting angiogenesis in a subject, ex vivo or in vitro. Such methods can be used to detect the presence, location or stage of development of a pathology caused by or associated to angiogenesis, to monitor the progression of angiogenesis or to assess the efficacy of a treatment. These methods comprise a step of determining, in a sample from the subject, the presence, quality or quantity of lactadherin or the corresponding DNA or RNA. The pathology may be any vascular disease, including ischemic diseases, atherosclerosis, or tumor metastasis. The sample may be any biopsy, biological fluid, cell, culture, and the like, which may be collected by any technique kown in the art, including be non-invasive techniques or from sample collections.

A particular embodiment of this invention resides in methods for the diagnosis, monitoring, prognosis and/or for assessing the risk or susceptibility of a subject to ischemia, comprising determining, in a sample from the subject, the presence, quality or quantity of lactadherin or the corresponding DNA or RNA. An other particular embodiment of this invention resides in methods for the diagnosis, momtoring, prognosis and/or for assessing the risk or susceptibility of a subject to a cardiovascular disease, comprising determining, in a sample from the subject, the presence, quality or quantity of lactadherin or the corresponding DNA or

RNA. An other particular embodiment of this invention resides in methods for the diagnosis, monitoring, prognosis and/or for assessing the risk or susceptibility of a subject to cancer metastasis, comprising determining, in a sample from the subject, the presence, quality or quantity of lactadherin or the corresponding DNA or RNA.

The presence, quality or quantity of lactadherin or the corresponding DNA or RNA can be determined by a variety of techniques known in the art, including the sequencing, selective hybridization or amplification, immuno-enzymatic methods such as ELISA, RIA, EIA or Western Blot, PCR, RT-PCR, LCR, gel migration, elecfrophoresis, and the like. The sample may be any biological fluid (blood, serum, etc.), a tissue sample, a cell culture, a biopsy, etc.

Drug Screening The present invention also provides novel targets and methods for the screening of drug candidates or leads that modulate angiogenesis. The methods include binding assays and/or functional assays, and may be performed in vitro, in cell systems, in animals, etc. A particular object of this invention resides in a method of selecting, identifying, caracterizing, optimising or producing angiogenesis modulating compounds, said method comprising contacting in vitro or ex vivo a test compound with a lactadherin polypeptide or a biologically active fragment thereof, and determining the ability of said test compound to bind said polypeptide or fragment. Binding to said polypeptide or fragment provides an indication as to the ability of the compound to modulate the angiogenic activity of said target.

In a further particular embodiment, the method comprises contacting in vitro or ex vivo a recombinant host cell expressing a lactadherin polypeptide with a test compound, and determining the ability of said test compound to modulate the expression of said polypeptide and/or to modulate the activity of said polypeptide. A further particular object of this invention resides in a method of selecting, identifying, caracterizing, optimising or producing angiogenesis modulating compounds, said method comprising contacting in vitro or ex vivo a test compound with a DNA or RNA encoding lactadherin, and determining the ability of said test compound to bind said DNA or RNA. Binding to said DNA or RNA provides an indication as to the ability of the compound to modulate the angiogenic activity of said target.

A further particular object of this invention resides in a method of selecting, identifying, caracterizing, optimising or producing angiogenesis modulating compounds, said method comprising contacting in vitro or ex vivo a test compound with a nucleic acid comprising a sequence of a lactadherin gene promoter, and determining the ability of said test compound to bind said nucleic acid and/or modulate the activity of said promoter.

The determination of binding may be performed by various techniques, such as by labelling of the test compound, by competition with a labelled reference ligand, gel migration, elecfrophoresis, etc. Gene expression modulation can be assessed by measuring the levels of RNA or proteins, or with a reporter system.

The above screening assays may be performed in any suitable device, such as plates, tubes, dishes, flasks, etc. Typically, the assay is performed in multi-wells plates. Several test compounds can be assayed in parallel. Furthermore, the test compound may be of various origin, nature and composition. It may be any organic or inorganic substance, such as a lipid, peptide, polypeptide, nucleic acid, small molecule, etc., in isolated or in mixture with other substances. The compounds may be all or part of a combinatorial library of products, for instance. The cells used for the screenings may be any cell or cell line as discussed above. Further aspects and advantages of this invention will be disclosed in the following examples, which should be regarded as illusfrative and not limiting the scope of this application. EXAMPLES

METHODS

Synthesis of antibody directed against lactadherin Rabbits were immunized with the following peptides coupled to KLH: human: (CE)EISQENRGDNF(PSY) (SEQ ID NO: 1, EISQENRGDNFPSY), mouse: (C)LVTLDTQRGDIF(TEY) (SEQ ID NO: 2, LVTLDTQRGDIFTEY) (Synt:em, Nice, France). Specificity of the sera was assessed on Western blots, using recombinant lactadherin for the anti-human antiserum, and mouse dendritic cell-derived exosomes (which are very rich in lactadherin ¹⁷) for the anti-mouse serum. The signals obtained on Western blots could be blocked by 100 μg/ml of the peptide used for immunization (data not shown), and were obtained with antisera purified on peptide-bound columns. As expected from the difference in the human and mouse peptides, none of the anti-sera cross-reacted with lactadherin from the other species (data not shown).

Generation of lactadherin deficient mice

For generation of the lactadherin -/- mouse cell line, the Ola/129 embryonic stem cell clone containing a β-geo insertional mutation in the lactadherin gene was kindly provided by K. Mitchell and W. Skarnes (¹⁹, Baygenomics: http://baygenomics.ucsf.edu). This clone was used to generate chimeric C57BL/6 male mice, which were bred with C57BL/6 females to obtain heterozygous animals. Heterozygous animals were backcrossed 8 times on C57BL/6 background. For genotyping, the genomic DNA surrounding the genetrap vector insertion site was amplified by PCR and partially sequenced to allow primers design. Animals were genotyped by PCR, using the following primers : WT allele: gFl (5'gtgaatactagccataggtgcc3') and gRl (5'gatggacttgaagagactactgg3'), gene-trapped allele : gFl (as above) and gR2 (5'ggaattcctccgcaaactcctatttctg3'), in a 40 cycle-reaction as follows (94°C, 30", 56°C 45", 72°C 45"), For functional comparisons, WT and homozygous littermates, or age-matched animals obtained from heterozygous crosses of the same backcross stage (8th or more backcross), were compared. Animals were housed under specific pathogen-free conditions, and experiments were conducted according to the french veterinary guidelines. Angiogenesis assay using the Matrigel model

C57B1/6 mice, (10 week-old, Charles River, L'Arbresle, France) treated or not with antibody directed against lactadherin (i.p injection, dilution 1/100, daily) received 0.5 ml subcutaneous injection of Matrigel alone or Matrigel with human recombinant protein rhNEGF-A₁₆₅ (500 ng/ml of Matrigel) (Sigma). In additional experiments, wild- type and lactadherin-deficient mice also received rhNEGF-Aiβs -treated or rhbFGF - treated Matrigel. After the injection, the Matrigel formed rapidly a subcutaneous plug. On day 14, plugs were removed and fixed with 3.7% formaldehyde at 4°C for 12 hours, embedded in paraffin, sectioned, and stained with Masson Trichrome. To evaluate the angiogenic reaction three different scores were defined, as previously described ²⁶: score 1, no colonisation by cells or formation of a slight peripheric coat around the plug with a disorganized infiltration of cells; score 2 is characterized by a thickened cell coat with marked structural infiltration in the Matrigel; score 3 corresponds to a deep and massive infiltration with erythrocyte presence. Such scores were performed in a double- blind fashion. The histological analysis was completed with cellular density measurement using Cyquant Cell Proliferation Assay kit (Molecular probes), as previously described ²⁶. Evaluation of the angiogenic reaction was also performed using CD31 immunostaining. Five micrometer sections were prepared from paraffin- embedded Matrigel plugs. After deparaffinization and rehydratation in PBS, the sections were hybridized 45 min with antibody against CD31 to identify endothelial cells (TEBU, dilution 1/50, RM5200), as previously described ²⁶.

Angiogenesis assay using the surgically-induced hindlimb ischemia model Male C57B1/6J mice, lactadherin-deficient mice and their age-matched confrols underwent surgery to induce unilateral hindlimb ischemia, as previously described²⁷. Animals were anesthetized by isoflurane inhalation. A ligature was performed on the proximal origin of the right deep femoral artery in the following group: i) control group receiving non immune serum (i.p injection, dilution 1/100, daily) and intramuscular electro-transfer of 50 μg of control empty plasmid; ii) control group treated with rabbit anti-lactadherin antiserum (i.p injection, dilution 1/100, daily); iii) VEGF-treated group receiving intramuscular electro-transfer of 50 μg of expression plasmid coding for the human form of VEGF-A₁₆₅ and non immune serum; iv) VEGF-treated group receiving rabbit anti-lactadherin antiserum (i.p injection, dilution 1/100, daily), or purified IgG from the rabbit anti-lactadherin antiserum (i.p injection, 2.5 μg daily) or purified IgG from a non neutralizing anti-thrombospondin rabbit anti-serum (i.p injection, 2.5 μg daily). In additional experiments, mice also received intramuscular electro-transfer of 25 μg of human bFGF-encoding expression plasmid (E Laurell and H Prats), or intramuscular electro-transfer of 50 μg of pcDNA3 expression plasmid coding for either lactadherin-S or lactadherin-L. cDNA for lactadherin-S and lactadherin-L were amplified by RT-PCR and cloned from dendritic cell RNA. Three weeks after the onset of ischemia, vessel density was evaluated by 3 different methods, as previously described ²⁷: 1) high definition microangiography using Barium sulfate (1 g/ml) injected in the abdominal aorta, followed by image acquisition with a digital X-ray transducer and computerized quantification of vessel density expressed as a percentage of pixels per image occupied by vessels in the quantification area; 2) assessment of capillary densities by immunostaining with a rabbit polyclonal antibody directed against total fibronectin (dilution 1/50, Chemicon International, USA) and morphometric quantification using Histolab software (Micro visions) and 3) Laser Doppler Perfusion Imaging to assess in vivo tissue perfusion in the legs. For each assay, the ratio between ischemic and non-ischemic limbs of each animal is calculated.

Determination of protein expression

In an effort to localize lactadherin expressing cells, frozen tissue sections (7μm) were incubated with the rabbit polyclonal anti mouse-lactadherin antiserum (5 μg/ml purified Ig), followed by avidin-biotin horseradish-peroxydase visualization systems (Vectastain ABC kit elite, Vector Laboratories, Biovalley, Marne La Vallee, France). Histological analyses were performed in randomly chosen fields of a definite area, using Histolab software.

Western-blots were performed as previously described¹⁸. Antibodies against phospho- AKT (1 :500, Cell signaling, Biolabs, Hertfordshire, United Kingdom), AKT (1 :1 ,000, Cell signaling), phospho-ERK and ERK (1 :2,000, Santa-Cruz-Biotechnology) and actin (Santa Cruz-Biotechnology, dilution 1/1,000) were then used and specific chemiluminescent signal was detected as previously described ¹⁸. Cultured cells experiments

HUVEC were obtained fom Promocell (Heidelberg, Germany). Cells were used between passages 2 and 4. HUNEC were grown in cultured medium (Basal medium, Promocell) supplemented with 10% fetal bovine serum and mitogens, according to the instructions of the supplier. Cells were split to a density of 40.10 cells/cm2 24h before start of serum starvation. Cells were washed twice with PBS and 1.5 ml of medium, without serum and mitogens but complemented with 0.1 % bovine serum albumin, was added. 18h following serum starvation, cells were washed with PBS and 1.5 ml of fresh starvation medium was added containing human NEGF (10 ng/ml, R&D), human bFGF (10 ng/ml, R&D) antibody against lactadherin (9, 18 or 45 μg/ml), human recombinant lactadherin (0.3 μg/ml), antibodies against integrin αvβ3 (10 μg/ml, LM609, Chemicon), integrin αvβ5 (10 μg/ml, P1F6, Chemicon), βl (10 μg/ml, 6S69, Chemicon) where indicated. Cells were incubated for 2 hours with anti-lactadherin before addition of NEGF. Protein exfracts were obtained by lysing cells in 200 μl buffer (SDS 20%, Νa-vanadate lOOmM, Tris 0.5M pH7.4) containing protease inhibitors. Western-blot analysis was performed as described above.

Recombinant human lactadherin A stable CHO cell line expressing the cDΝA for HIS-tagged human lactadherin was generated. Lactadherin-bearing membrane vesicles secreted by these cells were isolated, and the HIS-tagged protein was purified on a nickel column. Recombinant lactadherin migrated as a single band on coomassie blue-stained SDS-gel.

Adhesion assays

96-well plates were coated with 0.1 to 10 μg/ml of recombinant human lactadherin or mutant (RGE) lactadherin or vitronectin in PBS overnight at 4°C, as previously described ²⁸. The plates were washed briefly and then blocked in 10 mg/ml BSA in PBS for 2h at 37°C. HUNEC (5.10⁴) in 100 μl of serum-free medium containing cycloheximide were plated per well for lh at 37°C with or without GRGD peptide (Sigma) or antibody against integrin αvβ3 (10 μg/ml), integrin αvβ5 (10 μg/ml), integrin βl (10 μg/ml) or anti-lactadherin (45 μg/ml). Adherent cells were counted using MTT assay.

RESULTS Vascular expression of lactadherin. We first assessed the expression of lactadherin in vascular tissues. By RT-PCR, a lactadherin mRNA was detected in mouse aorta and hindlimb muscle tissue, whereas gene expression of the angiogenic Del-1 was undetectable (Figure 1-a). We generated a rabbit antiserum against a peptide containing the RGD sequence of mouse lactadherin. This serum detected two bands of approximately 64 and 56 kDa in Western blots of mouse aorta (Figure 1-b), similar to the bands obtained from lactadherin-transfected cells ¹⁵ and from dendritic cells ¹⁶ and their exosomes (figure 1-b). In the muscle tissue, lactadherin could be detected in endothelial and smooth muscle cells of a number of arterioles and was highly expressed in interstitial cells around infiltrating vessels (figure 1-c). The vascular expression of lactadherin was confirmed in human tissue. In arteries, lactadherin is mainly expressed by adventitial microvessels, medial smooth muscle cells and some luminal endothelial cells (figure 1-d). This suggests that endogenous lactadherin may play a role in vascular-related processes.

Role of lactadherin in VEGF-induced angiogenesis. We therefore assessed the involvement of lactadherin in blood vessel growth using the Matrigel model as an in vivo angiogenesis assay (Figure 1-e). As previously described ¹⁸, rhNEGF-A₁₆₅ treatment increased cell infiltration and proliferation in the Matrigel (scores 2 and 3) when compared to controls (score 1, p<0.01). Furthermore, in rhNEGF-Ai₆₅ treated Matrigel, cells within the Matrigel formed numerous tube-like structures containing erythrocytes, demonstrating the existence of a functional vascular structure. Administration of anti-lactadherin antibody (but not of the pre-immune serum) totally abrogated this VEGF-induced cell ingrowth (Figure 1-e). Similarly, the number of CD31-positive cells was 1.9-fold increased in rhVEGF-A₁₆₅ treated Matrigel compared to confrols (p<0.001). Such an increase was blocked by anti-lactadherin antibody (Figure 1-e). Finally, cell number was also 2.9-fold higher in rhNEGF-Aι_.65-treated Matrigel, compared to controls (p<0.001). Antibody against lactadherin blunted NEGF- induced vessel growth, suggesting that lactadherin was required for the pro-angiogenic effect of the key angiogenic growth factor NEGF.

Role of lactadherin in VEGF-induced post-ischemic neovascularization. The critical role of lactadherin in NEGF pro-angiogenic effect was next assessed in the clinically relevant pathological setting of ischemia, using the surgically-induced ischemic hindlimb model in mice. NEGF administration in this model greatly enhances tissue neovascularization, setting the basis for the clinical use of exogenous NEGF to restore blood perfusion in ischemic diseases. Lactadherin mRΝA (Figure 2-a) and protein (Figure lc and data not shown) were detected in both non ischemic and ischemic legs, at different time points following ischemic injury. As expected, in vivo intramuscular elecfrotransfer of NEGF-A₁₆5 cDΝA to ischemic hindlimb markedly improved tissue neovascularization (Figure 2-b), as revealed by the 2.1 -fold increase in angiography score, the 1.5-fold increase in capillary density, and the 1.6-fold increase in tissue Doppler perfusion score. Daily injection of the anti-lactadherin rabbit serum, totally blocked NEGF-A-induced neovascularization (Figure 2-b), suggesting a critical requirement of endogenous lactadherin for NEGF pro-angiogenic effect. Equal concentrations of non-immune serum did not prevent NEGF-A effect. As additional confrols, we showed that IgG purified from the rabbit anti-lactadherin antiserum had the same inhibiting effect as the whole immune serum, whereas IgG purified from an antiserum which binds to (but does not neutralize) another endothelial cell extracellular matrix protein, thrombospondin, did not prevent NEGF-induced neovascularisation (Figure 2-b). These confrol experiments indicate that the inhibitory angiogenic reaction observed after anti-lactadherin administration is unlikely to be related to immunological side effects. It is noteworthy that freatment with anti-lactadherin anti-serum in the absence of NEGF did not affect basal neovascularization (Figure 2-b), suggesting that lactadherin is required for NEGF-induced vessel growth after tissue ischemia but that other stimuli regulate basal vessel growth in response to tissue ischemia.

Generation of lactadherin-deficient mice. To further demonstrate the role of endogenous lactadherin in NEGF-induced angiogenesis, we generated lactadherin- deficient mice. An ES cell clone obtained by a gene trap approach was used for this purpose ¹⁹. The gene-trap vector contains a splice acceptor site followed by a cDNA containing a fransmembrane (TM) domain fused to the β-galactosidase and neomycine- resistance genes (β-geo) ¹⁹ (Figure 7-a). In the ES clone used, the vector was inserted in the lactadherin gene, downstream of the CI domain, as determined by 5 '-RACE (W. Skarnes, personal communication, Figure 7-a). We confirmed this location by amplifying and sequencing the genomic DNA surrounding the gene trap vector insertion site (data not shown), and designed primers to amplify the wild-type and mutant genomic DNA (Figure 7-b). The mRNA resulting from the insertion event encodes a fusion protein containing the N-terminal sequence of lactadherin up to the CI domain, followed by a fransmembrane domain, and the β-geo protein (Lacta-β-geo, Figure 7-d). In the majority of ES cells obtained with the TM-β-geo gene-trap vector, the fusion protein is retained infracellularly in the endoplasmic reticulum and rapidly degraded, wliich results in functional invalidation of the trapped gene ²⁰. We confirmed that this was also true for the lactadherin-β-geo mice. In milk from WT mice, the anti- lactadherin antiserum detects a band at 62 kDa that was absent from milk of homozygous mice. Aorta from homozygous mutant mice also did not contain lactadherin (Figure 7-e). Thus, mice homozygous for the TM-β-geo gene trap insertion are deficient in lactadherin. They will be called hereafter lactadherin -/-. They display the same phenotype as previously described in lactadherin knock-out mice¹⁰'¹³, i.e., increased spleen size (Figure 7-f) and accumulation of TUNEL-positive apoptotic cells due to defective phagocytosis (Figure 7-g) in spleen of aging animals. In the mutant cells, although the lactadherin-β-geo fusion protein is rapidly degraded, β-galactosidase activity can be detected, as described for other trapped proteins obtained with this vector ¹⁹. We used this property to confirm expression of lactadherin in vascular structures in different tissues. Whole heart, aorta and veins from lactadherin -/- mice expressed β-galactosidase activity (blue coloration in Figure 7-f, as compared to WT organs that remained uncolored). On hindlimb muscle sections, a number of blood vessels were also positive for β-galactosidase, whereas the surrounding striated muscles were negative (Figure 7-g). These observations confirm the data obtained by immunohistochemistry with the anti-lactadherin antiserum (Figure 1-c). In lacta -/- and +/- embryos, β-galactosidase staining was present in the heart, and in blood vessels of various organs (arrow, Figure 7-h). We could not detect any obvious vascular defects in the developping homozygous embryos and no specific vascular phenotype was observed (data not shown), suggesting that lactadherin is dispensable for neovascularization during development in mice.

Neovascularization in lactadehrin-deficient mice. In order to extend our results obtained with the specific neutralizing antibody, NEGF-induced angiogenesis was analyzed in lactadherin -/- mice (Figure 3). First, we demonstrated that the histological score, the number of CD-31 positive cells and the quantity of cellular DΝA were reduced in rhNEGF-A₁₆₅-treated Matrigel of lactadherin-deficient mice compared to rhNEGF-A₁₆₅-treated Matrigel of wild-type animals (Figure 3-a). Second, in the ischemic hindlimb model, administration of NEGF to lactadherin -/- mice did not stimulate neovessel formation (p<0.01 to pO.OOl for NEGF-freated WT versus lactadherin -/- mice, Figure 3-b). On the other hand, in both assays, bFGF, another angiogenic factor, induced neo-angiogenesis in both WT and lactadherin -/- animals (Figure 8a, b). Therefore, endogenous lactadherin appears to be required for NEGF, but not bFGF-dependent neovascularisation in adult mice.

Lactadherin signaling in angiogenesis. We next analyzed the molecular mechanisms underlying this effect. The mitogenic and chemotactic effects of NEGF in endothelial cells are mediated by tyrosine phosphorylation of several targets, including exfracellular signal-related kinase (ERK) and the serine/threonine kinase AKT. Enhanced AKT signaling in the endothelium promotes angiogenesis in rabbit ischemic limb ²¹. Phosphorylation of AKT ²² and of ERK ²³ is required for NEGF-A-induced endothelial cell survival and angiogenesis. We therefore analyzed the role of endogenous lactadherin in NEGF-dependent AKT and ERK phosphorylation. As expected, NEGF induced a marked increase in phospho-AKT and phospho-ERK protein levels in the ischemic leg of treated WT animals (1.7-fold and 1.8-fold, respectively, p<0.01 versus non ischemic leg, Figure 4-a). NEGF-induced AKT phosphorylation was fully abolished in lactadherin-deficient animals, suggesting that lactadherin plays a major role in the NEGF/AKT signaling pathway. By contrast, NEGF-induced ERK phosphorylation was unaltered in lactadherin -/- animals. Therefore, endogenous lactadherin is required for NEGF-induced AKT, but not ERK phosphorylation. Because of the potential clinical applications of our findings, we next analyzed the role of lactadherin in the activation of human endothelial cells by NEGF. We generated a specific rabbit anti-human lactadherin antibody directed against the RGD sequence. As shown by western blot (figure 4-b), lactadherin was expressed in human umbilical vein endothelial cells (HUNEC), and treatment of HUNEC for 24 hours with NEGF induced a slight increase in lactadherin protein levels (p<0.05, Figure 4-b). More interestingly, the anti-human lactadherin antibody (but not an irrelevant rabbit serum, data not shown) prevented NEGF-induced AKT phosphorylation (Figure 4-c). These results show that lactadherin participates in NEGF-dependent signaling in human endothelial cells. By confrast, bFGF-induced AKT phosphorylation was not abolished by the anti-lactadherin antiserum in agreement with our findings showing no effect of lactadherin blockade on bFGF-induced angiogenesis in vivo (Figure 8c). These results show that lactadherin also participates specifically in NEGF-dependent signaling in human endothelial cells.

Lactadherin signaling involves interaction with avβS integrin. Human, bovine and murine lactadherin, via their RGD sequence, bind to αvβ3 integrin ⁸'⁹'¹⁰. αvβ3 integrin associates with NEGF receptor and thus potentiates NEGF-induced endothelial cell survival and proliferation ³. The anti-lactadherin antiserum which blocked NEGF- dependent AKT phosporylation (Figure 4-c) was raised against a peptide containing the RGD sequence of lactadherin. These observations suggested that the involvement of lactadherin in NEGF angiogenic function was mediated by its binding to αvβ3. To test this hypothesis, we produced recombinant human lactadherin, and showed that, when coated onto tissue culture wells, it allows adhesion of HUNEC (Figure 5-a). Interestingly, a RGD-to-RGE mutant lactadherin was unable to bind HUVEC indicating that the RGD sequence of lactadherin is required for cell adhesion. Our anti-lactadherin antibody fully hampered HUVEC binding on lactadherin, but did not affect cell adhesion on vitronectin (Figure 5-a). Interestingly, lactadherin-induced HUNEC adhesion was almost totally prevented (90% inhibition) by use of neutralizing anti-αvβ3 antibody (p<0.001). Addition of a neutralizing anti-αvβ5 antibody tended to reduce HUNEC binding on lactadherin, but this effect did not reach statistical significance. In contrast, anti-βl antibody did not affect HUNEC binding to lactadherin. Given the binding of lactadherin to αvβ3 integrin and, to a lesser extent, to αvβ5 integrin and given the involvement of these integrins in AKT signaling, we assessed the ability of exogenous lactadherin to promote AKT phosphorylation in HUNEC. Recombinant human lactadherin added to cell culture strongly improved AKT phosphorylation (Figure 5-b). Interestingly, lactadherin-induced AKT phosphorylation was blunted by a neutralizing antibody directed against αvβ3 integrin, as well as by an antibody against anti-αvβ5 integrin, but not by an antibody directed against βl integrin (Figure 5-b). Taken together, these results suggest that lactadherin promotes AKT phosphorylation through binding to αvβ3 and/or αvβ5 integrins and cooperates with NEGF signaling to activate the angiogenic pathway.

Therapeutic strategy based on lactadherin over-expression. In the setting of ischemia, therapeutic angiogenesis is viewed as a highly promising strategy to ensure revascularization of ischemic tissues by promoting the growth of new vessels or the maturation of pre-existing ones. Identification of novel factors that may affect vessel growth is of major therapeutic importance. In human endothelial cells, we observed that recombinant lactadherin protein promotes β3/β5-dependent AKT-phosphorylation (Figure 5-b), suggesting that lactadherin signaling may promote angiogenesis in the absence of exogenous NEGF. This prompted us to investigate the potential use of lactadherin for therapeutic strategies in ischemic diseases, by developping pcDΝA3 expression plasmid coding for two forms of mouse lactadherin, a long one (lactadherin- L) and a short one (lactadherin-S). Lactadherin-L encodes for an alternatively spliced form of lactadherin mRNA containing a proline/threonine-rich domain between the second EGF-like and the first C domains²⁴. Both forms seem to have similar biological activities ¹⁰, but the expression of the long form is restricted to lactating mammary gland ²⁴, peritoneal macrophages ¹⁰ and dendritic cells ( C.T. unpublished observations). In vivo intramuscular elecfrotransfer markedly increased lactadherin protein expression in the ischemic muscle (Figure 6-a). Administration of both lactadherin-S and lactadherin-L, in the absence of NEGF expression plasmid, strongly improved angiography score, capillary density, and tissue Doppler perfusion score when compared to the control empty plasmid (Figure 6-b). Lactadherin-S and lactadherin-L displayed similar pro-angiogenic potential, which was as potent as that previously found with NEGF administration, a more conventional therapeutic strategy (Figure 6-b). Thus, overexpression of lactadherin, in the absence of exogenously added growth factors, shows pro-angiogenic activities and may have potential therapeutic relevance in the treatment of ischemic diseases.

REFERENCES

1. Carmeliet, P. Angiogenesis in health and disease. Nat Med 9, 653-660 (2003).

2. Giancotti, F.G. & Ruoslahti, E. Integrin signaling. Science 285, 1028-1032 (1999). 3. Borges, E., Jan, Y. & Ruoslahti, E. Platelet-derived growth factor receptor beta and vascular endothelial growth factor receptor 2 bind to the beta 3 integrin through its extracellular domain. JBiol Chem 275, 39867-39873 (2000). 4. Ho, H.K. et al. Developmental endothelial locus- 1 (Del-1), a novel angiogenic protein: its role in ischemia. Circulation 109, 1314-1319 (2004). 5. Zhong, J. et al. Neovascularization of ischemic tissues by gene delivery of the extracellular matrix protein Del-1 J Clin Invest 112, 30-41. (2003). 6. Hidai, C. et al. Cloning and characterization of developmental endothelial locus- 1: an embryonic endothelial cell protein that binds the alphavbeta3 integrin receptor, in Genes Dev 12, 21-33. (1998). 7. Stubbs, J.D. et al. cDNA cloning of a mouse mammary epithelial cell surface protein reveals the existence of epidermal growth factor-like domains linked to factor Vlll-like sequences Proc Nail Acad Sci USA. 87, 8417-8421. (1990).

8. Taylor, M.R., Couto, J.R., Scallan, CD., Ceriani, R.L. & Peterson, J.A. Lactadherin (formerly BA46), a membrane-associated glycoprotein expressed in human milk and breast carcinomas, promotes Arg-Gly-Asp (RGD)-dependent cell adhesion. in DNA Cell Biol. 16, 861-869 (1997).

9. Andersen, M.H., Graversen, H., Fedosov, S.N., Petersen, T.E. & Rasmussen, J.T. Functional analyses of two cellular binding domains of bovine lactadherin. in Biochemistry 39, 6200-6206. (2000). 10. Hanayama, R. et al. (2002). Identification of a factor that links apoptotic cells to phagocytes. Nature. 9, 182-187. (2002)

11. Newburg, D.S. et al. Role of human-milk lactadherin in protection against symptomatic rotavirus infection. Lancet 351, 1160-1164. (1998).

12. Ensslin, M.A. & Shur, B.D. Identification of mouse sperm SEDl, a bimotif EGF repeat and discoidin-domain protein involved in sperm-egg binding. Cell 114, 405-417. (2003). 13. Hanayama, R. et al. Autoimmune Disease and Impaired Uptake of Apoptotic Cells in MFG-E8-Deficient Mice. Science 304, 1147-1150 (2004).

14. Akakura, S. et al. The opsonin MFG-E8 is a ligand for the alphavbeta5 integrin and triggers DOCK180-dependent Racl activation for the phagocytosis of apoptotic cells, in Exp Cell Res 292, 403-416. (2004).

15. Oshima, K., Aoki, N, Kato, T., Kitajima, K. & Matsuda, T. Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles, EurJBiochem. 269,1209-1218. (2002).

16. Miyasaka, K, Hanayama, R., Tanaka, M. & Nagata, S. Expression of milk fat globule epidermal growth factor 8 in immature dendritic cells for engulfment of apoptotic cells. Eur J Immunol 3 , 1414-1422 (2004).

17. Thery, C. et al. Molecular characterization of dendritic cell-derived exosomes. Selective accumulation of the heat shock protein hsc73. J Cell Biol 147, 599- 610. (1999). 18. Silvestre, J.S. et al. Vascular endothelial growth factor-B promotes in vivo angiogenesis. Ore Res 93, 114-123 (2003). 19. Skarnes, W.C., Moss, J.E., Hurtley, S.M. & Beddington, R.S. Capturing genes encoding membrane and secreted proteins important for mouse development, in ProcNatlAcadSci USA 92, 6592-6596 (1995). 20. Mitchell, K.J. et al. Functional analysis of secreted and fransmembrane proteins critical to mouse development. Nat Genet 28, 241-249 (2001). 21. Kureishi, Y. et al. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase AKT and promotes angiogenesis in normocholesterolemic animals. NatMed β, 1004-1010 (2000). 22. Gerber, H.P. et al. Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/AKT signal fransduction pathway. Requirement for Flk-1/KDR activation. JBiol Chem 273, 30336- 30343 (1998). 23. Hood, J.D., Frausto, R., Kiosses, W.B., Schwartz, M.A. & Cheresh, D.A. Differential alphav integrin-mediated Ras-ERK signaling during two pathways of angiogenesis. J Cell Biol Vol. 162, 933-943 (2003). 24. Oshima, K. et al. Lactation-dependent expression of an mRNA splice variant with an exon for a multiply O-glycosylated domain of mouse milk fat globule glycoprotein MFG-E8. in Biochem Biophys Res Commun 254, 522-528. (1999).

25. Avraham, H.K. et al. Vascular endothelial growth factor regulates focal adhesion assembly in human brain microvascular endothelial cells through activation of the focal adhesion kinase and related adhesion focal tyrosine kinase. JBiol Chem 278, 36661-36668 (2003).

26. Tamarat, R., Silvestre, J.S., Durie, M. & Levy, B.I. Angiotensin II angiogenic effect in vivo involves vascular endothelial growth factor- and inflammation- related pathways. Lab Invest 82, 747-756 (2002).

27. Silvestre, J.S. et al. Regulation of matrix metalloproteinase activity in ischemic tissue by interleukin-10: role in ischemia-induced angiogenesis. Circ Res 89, 259-264 (2001).

28. Hodivala-Dilke KM et al. Beta3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival. J Clin Invest 103, 229-38 (1999).

Claims

1. The use of lactadherin or a biologically active variant thereof for the manufacture of a medicament for treating an ischemic disease.

2. The use of lactadherin or a biologically active variant thereof for the manufacture of a medicament for stimulating neo- vascularization in a subject.

3. The use of claim 2, for stimulating VEGF-dependent angiogenesis in a subject.

4. The use of claim 1 or 2, for stimulating AKT phosphorylation in a subject.

5. The use of any one of the preceding claims, wherein the lactadherin is a human lactadherin polypeptide.

6. The use of claim 5, wherein said human lactadherin polypeptide is in isolated form or contained in a vector, such as a liposome or an exosome.

7. The use of one of any one of claims 1 to 4, of a nucleic acid construct encoding a human lactadherin polypeptide or a variant thereof.

8. The use of claim 7, wherein said construct is included in a vector, such as a plasmid or a viral vector.

9. The use of any one of the preceding claims, wherein the biologically active lactadherin variant has angiogenic properties of lactadherin.

10. The use of any one of claims 1 and 3-9, wherein said ischemic disease is selected from any vascular disease, such as (intermittent) claudication, laminitis, primitive thrombosis of vena axillaris, transient spinal ischaemia, gangrene, amputation, cardiomyopathies, dilated cardiomyopathy, infarct, myocardial infarction, stroke, angina pectoris, chronic coronary damages; crib death, coronary heart diseases and vascular thrombosis.