WO2005047259A1

WO2005047259A1 - 4-anilino-3-quinolinecarbonitriles for the treatment of chronic myelogenous leukemia (cml)

Info

Publication number: WO2005047259A1
Application number: PCT/US2003/035322
Authority: WO
Inventors: Frank Boschelli; Jennifer Michele Golas; Kim Timothy Arndt
Original assignee: Wyeth
Priority date: 2003-11-06
Filing date: 2003-11-06
Publication date: 2005-05-26
Also published as: AU2003291245A8; AU2003291245A1

Abstract

Compounds of the formula (I): wherein: n is an integer from 0-3; X is N, CH; R is alkyl of 1 to 3 carbon atoms; R' is 2,4-diCl, 5-OMe in para, ortho, or meta position; 2,4-diCl in para position; 3,4,5tri-OMe in para position; 2-Cl, 5-OMe in para position; 2-Me, 5-OMe in para position; 2,4-di-Me in para position; 2,4-diMe-5-OMe in para position; 2,4-diCl, 5-OEt in para position; and R2 is alkyl of 1 to 3 carbon atoms, and pharmaceutically acceptable salts thereof.

Description

4-ANIL1NO-3-QUINOL1NECARBONITRILES FOR THE TREATMENT OF CHRONIC MYELOGENOUS LEUKEMIA (CML)

BACKGROUND OF THE INVENTION

Constitutive tyrosine kinase activity of Bcr-Abl promotes proliferation and survival of chronic myelogenous leukemia (CML) cells. Inhibition of Bcr-Abl tyrosine kinase activity or signaling proteins activated by Bcr-Abl in CML cells blocks proliferation and causes apoptotic cell death. The selective Abl kinase inhibitor, STI- 571 (marketed as Gleevec), is toxic to CML cells in culture, causes regression of CML tumors in nude mice, and is currently used to treat CML patients.

Expression of Bcr-Abl in hematopoetic stem cells promotes transformation and acts early in leukemogenesis. Inhibition of this kinase with STI-571 effectively controls CML in the chronic phase of the disease but more advanced patients frequently progress on STI-571. therapy. These observations suggest that additional molecular changes that are not affected by STI-571 play a role in advanced disease. In vitro models of STI-571 resistance and clinical specimens from resistant patients demonstrated that overexpression of other kinases or activation of distinct signaling pathways is associated with Bcr-Abl independence. Inhibition of the tyrosine kinase activity of Bcr-Abl is an effective strategy for targeting CML as demonstrated by the clinical efficacy of STI-571. Other molecules, including Src family kinases, play a role in downstream signaling from Bcr-Abl, and as such, are potential therapeutic targets for the treatment of STI-571 -resistant disease. Src family kinases including Lyn and Hck have been implicated in downstream signaling from Bcr-Abl.

Although the selective Abl kinase inhibitor STI-571 is efficacious and well tolerated by most patients in chronic-stage CML, patients in accelerated and blast crises stages of the disease tend to be less responsive. Consequently, there is a need for alternative agents that are effective in late-stage disease. BRIEF SUMMARY OF THE INVENTION

In accordance with the present invention are provided compounds of the structural formula I:

wherein:

n is an integer from 0-3;

X is N, CH;

R is alkyl of 1 to 3 carbon atoms; .

R¹ is 2,4-diCl, 5-OMe in para, ortho, or meta position; 2,4-diCl in para position; 3,4,5- tri-OMe in para position; 2-CI, 5-OMe in para position; 2-Me, 5-OMe in para position; 2,4-di-Me in para position; 2,4-diMe-5-OMe in para position; 2,4-diCl, 5-OEt in para position;

R² is alkyl of 1 to 3 carbon atoms, and pharmaceutically acceptable salts thereof.

The compounds of this invention may be used for preventing or inhibiting CML. In a preferred embodiment the compounds are used as part of a pharmaceutical composition.

Specific compounds of the invention include:

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoχy-7-[3-(4-methyl-1- piperazinyl)propoxy]-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-7-[3-(4-ethyl-1-piperazinyl)propoxy]-6- methoxy-3-quinolinecarbonitrile; 4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[2-(4-methyl-1- piperazinyl)ethoxy]-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-7-[2-(4-ethyl-1-piperazinyl)ethoxy]-6- methoxy-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[2-(1-methylpiperidin-4- yl)ethoxy]-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(1-methylpiperidin-4- yl)propoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-7-[(1-ethylpiperidin-4-yl)methoxy]-6- methoxyquinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-methylpiperazin-1- yl)propoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[(1 -methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-ethylpiperazin-1- yl)propoxy]quinoline-3-carbonitriie;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(1-methylpiperidin-4- yl)propoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[2-(4-methyl-1- piperazinyl)ethoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[2-(1-methylpiperidin-4- yl)ethoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(4-propyl-1- piperazinyl)propoxy]-3-quinolinecarbonitrile; 4-[(2,4-dichloro-5-methoxyanlino)-6-methoxy-7-[2-(4-methyl-1-piperazinyl)ethoxy]-3- quinolinecarbonitrile;

4-[(2,4-dichloro-5-methoxyanlino)-7-[2-(4-ethyl-1-piperazinyl)ethoxy]-6-methoxy-3- quinolinecarbonitrile;

4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[(1-methyl-3- piperazinyl)methoxy]-3-quinolinecarbonitrile;

4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[(1-methyl-2- piperazinyl)ethoxy]-3-quinolinecarbonitrile;

4-[(2,4-dichlorophenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4-yl)methoxy]-3- quinolinecarbonitrile;

6-methoxy-7-[(1-methylpiperidin-4-yl)methoxy]-4-[(3,4,5- trimethoxyphenyl)amino]quinoline-3-carbonitrile;

4-[(2-chloro-5-methoxyphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

6-methoxy-4-[(5-methoxy-2-methylphenyl)amino]-7-[(1 -methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

4-[(2,4-dimethylphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yi)methoxy]quinoline-3-carbonitrile;

6-methoxy-4-[(5-methoxy-2,4-dimethylphenyl)amino]-7-[(1-methylpiperidin-4- yl)methoxy]quino!ine-3-carbonitrile;

4-[(2,4-dichloro-5-ethoxyphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

and pharmaceutically acceptable salts thereof.

The following experimental details are set forth to aid in an understanding of the invention, and are not intended, and should not be construed, to limit in any way the invention set forth in the claims that follow thereafter. DETAILD DESCRIPTION OF THE INVENTION

wherein:

n is an integer from 0-3;

X is N, CH;

R is alkyl of 1 to 3 carbon atoms;

R¹ is 2,4-diCI, 5-OMe in para, ortho, or meta position; 2,4-diCI in para position; 3,4,5- tri-OMe in para position; 2-CI, 5-OMe in para position; 2-Me, 5-OMe in para position; 2,4-di-Me in para position; 2,4-diMe-5-OMe in para position; 2,4-diCI, 5-OEt in para position;

R² is alkyl of 1 to 3 carbon atoms, and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable salts are those derived from such organic and inorganic acids as: acetic, lactic, carboxylic, citric, cinnamic, tartaric, succinic, fumaric, maleic, malonic, mandelic, malic, oxalic, propionic, hydrochloric, hydrobromic, phosphoric, nitric, sulfuric, glycolic, pyruvic, methanesulfonic, ethanesulfonic, toluenesulfonic, salicylic, benzoic, and similarly known acceptable acids.

The term "alkyl" refers to the radical of saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In a preferred embodiment, a straight chain or branched chain alkyl has 3 or fewer carbon atoms in its backbone.

The compounds may be provided orally, by intralesionai, intraperitoneal, intramuscular or intravenous injection; infusion; liposome-mediated delivery; topical, nasal, anal, vaginal, sublingual, uretheral, transdermal, intrathecal, ocular or otic delivery. In order to obtain consistency in providing the compound of this invention it is preferred that a compound of the invention is in the form of a unit dose. Suitable unit dose forms include tablets, capsules and powders in sachets or vials. Such unit dose forms may contain from 0.1 to 300 mg of a compound of the invention and preferably from 2 to 100 mg. Still further preferred unit dosage forms contain 50 to 150 mg of a compound of the present invention. The compounds of the present invention can be administered orally. Such compounds may be administered from 1 to 6 times a day, more usually from 1 to 4 times a day. The effective amount will be known to one of skill in the art; it will also be dependent upon the form of the compound. One of skill in the art could routinely perform empirical activity tests to determine the bioactivity of the compound in bioassays and thus determine what dosage to administer.

The compounds of the invention may be formulated with conventional excipients, such as a filler, a disintegrating agent, a binder, a lubricant, a flavoring agent, a color additive, or a carrier. The carrier may be for example a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution or a solid carrier. The carrier may be a polymer or a toothpaste. A carrier in this invention encompasses any of the standard pharmaceutically accepted carriers, such as phosphate buffered saline solution, acetate buffered saline solution, water, emulsions such as an oil/water emulsion or a triglyceride emulsion, various types of wetting agents, tablets, coated tablets and capsules.

When provided orally or topically, such compounds would be provided to a subject by delivery in different carriers. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid, talc, vegetable fats or oils, gums, or glycols. The specific carrier would need to be selected based upon the desired method of delivery, for example, phosphate buffered saline (PBS) could be used for intravenous or systemic delivery and vegetable fats, creams, salves, ointments or gels may be used for topical delivery.

The compounds of the present invention may be delivered together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers useful in treatment or prevention of neoplasm. Such compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (for example, Tris-HCI, acetate, phosphate), pH and ionic strength, additives such as albumins or gelatin to prevent absorption to surfaces, detergents (for example, TWEEN 20, TWEEN 80, PLURONIC F68, bile acid salts), solubilizing agents (for example, glycerol, polyethylene glycerol), anti-oxidants (for example ascorbic acid, sodium metabisulfate), preservatives (for example, thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (for example, lactose, mannitol), covalent attachment of polymers such as polyethylene glycol, complexation with metal ions, or incorporation of the compound into or onto particulate preparations of hydrogels or liposomes, micro-emulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroblasts. Such compositions will influence the physical state, solubility, stability, rate of in vivo release, and rate of in vivo clearance of the compound or composition. The choice of compositions will depend on the physical and chemical properties of the compound capable of treating or preventing a neoplasm.

The compound of the present invention may be delivered locally via a capsule that allows a sustained release of the compound over a period of time. Controlled or sustained release compositions include formulation in lipophilic depots (for example, fatty acids, waxes, oils). The present invention further provides a compound of the invention for use as an active therapeutic substance for preventing or inhibiting CML.

The present invention further provides a method of treating CML in humans, which comprises administering to the infected individual an effective amount of a compound or a pharmaceutical composition of the invention. The dose provided to a patient will vary depending upon what is being administered, the purpose of the administration, the manner of administration, and the like. A "therapeutically effective amount" is an amount sufficient to cure or ameliorate symptoms of CML.

The compounds of this may be delivered alone or in combination with other compounds used to treat CML. Such compounds include but are not limited to GLEEVEC, hydroxyurea, IFN-ά, cytotoxic agents, or wortmannin.

The compounds of the invention are prepared as illustrated below. The compounds of this invention were prepared from: (a) commercially available starting materials (b) known starting materials which can be prepared as described in literature procedures or (c) new intermediates described in the schemes and experimental procedures herein.

Reactions are performed in a solvent appropriate to the reagents and materials employed and suitable for the transformation being effected. It is understood by those skilled in the art of organic synthesis that the various functionalities present on the molecule must be consistent with the chemical transformations proposed. When not specified, order of synthetic steps, choice of protecting groups and deprotection conditions will be readily apparent to those skilled in the art. In addition, in some instances, substituents on the starting materials may be incompatible with certain reaction conditions. Restrictions pertinent to given substituents will be apparent to one skilled in the art. Reactions, were run under inert atmospheres where appropriate.

Compounds of Formula I were prepared as described in Scheme 1. Compounds of Formula 1 wherein R is Me, X is N and n is 3 are readily obtained by treatment of 7-(3-chloropropoxy)-4-[(2,4-dichloro-5-methoxyphenyl)amino]-6- methoxy-3-quinolinecarbonitrile, 1, with N-alkylpiperazine such as N- methylpiperazine, N-ethylpiperazine, or N-propylpiperazine in the presence of sodium iodide either neat or in a solvent such as ethylene glycol dimethyl ether. The preparation of these compounds has been reported in the literature, [Boschelli, D. H., et. al., J. Med. Chem., 44, 3965 (2001)].

Analogously compounds of Formula I wherein R is Me, X is N and n is 2 are readily obtained by treatment of 7-(2-chloroethoxy)-4-[(2,4-dichloro-5- methoxyphenyl)amino]-6-methoxy-3-quinolinecarbonitrile, 2, with N-methyl or N- ethylpiperazine in the presence of sodium iodide either neat or in a solvent such as ethylene glycol dimethyl ether. The preparation of these compounds has been reported in the literature, [Ye, F. et. a\.,221th National Meeting of the American Chemical Society, San Diego, California (April, 2001)].

Scheme 1

Alternatively compounds of Formula I can be prepared via a 7-fluoro-3- quinolinecarbonitrile intermediate. Preparation of this key intermediate is shown in

Scheme 2. Anilines of formula 3 can be reacted with diethyl

(ethoxymethylene)malonate either neat or in the presence of a cosolvent such as toluene, at temperatures ranging from 60 to 120°C. Subsequent thermal cyclization, preferably in a solvent system such as 3 : 1 mixture of diphenyl ether and biphenyl at elevated temperature, such as 260°C, provides compounds of formula 4. Hydrolysis of the ester group under preferably basic conditions, such as sodium hydroxide in an alcoholic solvent such as ethanol, at elevated temperatures results in compounds of formula 5. Conversion of the acid group to the primary amide can be accomplished by treatment with an activating agent such as 1 ,1-carbonyldiimidazole followed by the addition of either ammonia gas or preferably an aqueous solution of ammonium hydroxide. Dehydration of the primary amide group of compounds of formula 6 with a reagent such as cyanuric chloride in a solvent such as N,N-dimethylformamide provides compounds of formula 7. Alternatively, anilines of formula 3 can be treated with ethyl (ethoxymethylene)cyanoacetate either neat or in the presence of a cosolvent such as toluene, at temperatures ranging from 60 to 120°C. Subsequent thermal cyclization, preferably. in a solvent system such as 3: 1 mixture of diphenyl ether and biphenyl at elevated temperature, such as 260°C, provides compounds of formula 7. Reaction of 7 with a chlorinating agent such as phosphorous oxychloride gives compounds of formula δ.Treatment of compounds of formula 8 with 2,4- dichloro-5-methoxyaniline in the presence of pyridine hydrochloride provides the key 7-fluro intermediates 9.

Scheme 2

^■~NH₂

1) CDI 2) NH₄OH

2,4-diCI, 5-OMe aniline

An alternate route to the compound of formula 8 where R² is Et is shown in Scheme 3. Using the conditions of Scheme 2, 4-benzyloxy-3-fluoroaniline is converted into the compound of formula TO. Removal of the benzyl group with thioanisole and trifluoroacetic acid provides the 6-hydroxy derivative of formula I L Treatment of V\_ with triphenyl phosphine, diethylazodicarboxylate and ethanol gives the compound of formula 8 wherein R² is ethyl.

Scheme 3

3) POCI₃ 10

11

As shown in Scheme 4 reaction of compounds of formula 9 with an alcohol of formula 12 in the presence of a base such as sodium or sodium hydride provides the compounds of the invention of Formula I. This reaction can be run in the presence of a cosolvent such as dimethylformamide or dimethyl sulfoxide at optimal temperatures of 120°C to 140°C.

Scheme 4

Determine the Abl inhibitory activity of Src kinase inhibitors:

MATERIALS AND METHODS:

Biotinylated substrate peptide: Biotin-NH-KEEEAIYAAPFAKKK-COOH (Synpep)

Kinase Buffer:

50 mM Hepes pH 7.5

10 mM MgCI2

20 ug/ml BSA

0.001% Brij-35

(Prepare 2X kinase buffer for convenience:

100mM Hepes, 20mM MgCI2, add fresh 40ug/ml BSA and 0.002% Brij)

Quench Buffer (to be added straight, 1 :1 , to rxn mix)-

50 mM Hepes pH 7.5

60 mM EDTA

20 μg/ml BSA

Lance Detection Buffer and plate blocker:

50 mM Hepes pH 7.5

20 μg/ml BSA

Add EU-antibody PT66 (Perkin Elmer, AD0068) (1 nM) and Strepfavidin Surelight- APC (Perkin Elmer, CR130-100) (4μg/ml) for 10Oμl/well just prior to using (add 100μl to 50μl rxn/50ul quench for 200μl final).

5X ATP = 500μM in water 1. Rinse 96 well plate with 200μl PBS. Preincubate 96 well black plate (Thermo LabSystems MicroFluor 2 black U-bottom microtiter plate; # 7205) with 200ul of 50 mM Hepes pH 7.5 with 20 μg/ml BSA for 10 minutes (aka lance detection buffer).

2. Kinase reaction takes place in a total volume of 50 μl kinase buffer in the 96 well plate. Use biotinylated substrate peptide at a final concentration of 2 μM, and c-Abl from Panvera (c-Abl P3049) at 2.5 ng per 50 μl reaction, (per rxn: 25μl 2x kinase buffer, 10 μl water, 5 μl diluted compound-10%DMSO/10 mM Hepes). The reaction is initiated by addition of 10ul 5X ATP (final concentration 1X = 100 μM) and carried out for 30 min @ 27° C.

3. To Stop kinase reaction add 50μl of Quench buffer and shake for 30s.

4. Add 100ul of Lance detection buffer containing EU antibody and APC-strep. Add EU-antibody PT66 (1 nM) and APC-streptavadin (4 μg/ml), for 100 μl/well just prior to using (add 100 μl to 50 ul rxn/50 μl quench for 200 μl final).

5. Incubate for 30 min @ room temp in the dark. Read Plate using the standard Lance protocol (665 nm) on the Wallac Victor.

ANALYSIS OF RESULTS: % Inhibition = (Cpm(sample)-Bkg)/(Cpm(control) -Bkg)) X 100

The data analysis plug-in for Excel (Model 63) is used to calculate IC50 values.

Abl kinase assay. Bacterially expressed Abl kinase was obtained from New England Biolabs. Kinase assays were performed in a DELFIA solid phase europium- based detection assay format (Perkin-Elmer). The peptide was as described in Dorsey et al. (46). Biotinylated peptide (2 μM) was bound to strepfavidin coated microtitration plates (Perkin Elmer CC11-205) for 1.5 hour in 1 mg/ml ovalbumin in Phospate Buffered Saline (PBS). The plates were washed for 1 hour with PBS/0.1 % Tween 80, followed by a PBS wash. The kinase reaction was incubated for 1 hour at 30°C. Abl kinase (10 units, NEB P6050L) was mixed with 50 mM Tris-HCI, pH 7.5, 10 mM MgCI₂, 80 μM EGTA, 100 μM ATP, 0.5 mM Na₃V0₄, 1% DMSO, 1 mM HEPES (pH 7) and 200 Dg/ml ovalbumin. The reaction was stopped with EDTA at a final concentration of 50 mM. The DELFIA wash protocol suggested by the manufacturer (Perkin Elmer) was modified by extending wash times to reduce background. The reaction was monitored with Eu-labeled phosphotyrosine antibody (Perkin Elmer AD0040) and DELFIA Enhancement solution (Perkin Elmer 1244-105) according to manufacturer specifications.

Anchorage Independent Src-transformed Fibroblast Proliferation Assay

Rat2 fibroblasts stably transformed- with a plasmid containing a CMV promoter controlled v-Src/HU c-Src fusion gene in which the catalytic domain of human c-Src gene as follows: Cloning and plasmid constructions: the Prague C v-Src gene from pSrcHis

(Wendler and Boschelli, Oncogene 4: 231-236; 1989) was excised with Ncol and BamHI, treated with T4 DNA polymerase, and cloned into the R\ site of pTRE (Clontech) that had been rendered flush by treatment with T4 DNA polymerase. The PRC v-Src::hu c-Src fusion was created by replacing the Bgl2-Xbal fragment encoding the carboxyl terminal ~ 250 amino acids of v-Src with the Bgl2-Xbal fragment containing the v-Src::huc-Src fusion fragment (below). A partial clone of human c-Src was amplified from a breast cDNA library (InVitrogen) using the oligonucleotide pair 5'-

CGCCTGGCCAACGTCTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTG-3' (SEQ. ID NO: 1) and 5'-

CCAACACACAAGCAGGGAGCAGCTGGGCCTGCAGGTACTCGAAGGTGGGC-3' (SEQ. ID NO: 2) and cloned into pCRScript (Stratagene). The catalytic domain of human c-Src in this clone was amplified with these oligonucleotides (fuses v-src nucleotide 734 to human c-Src nucleotide 742 and human c-Src nucleotide 1551 to v-src nucleotide 1543 in the v-Src and human c-Src ORFs). Two v-Src sequences were amplified by PCR (198 base pair v-src 5' fragment: 5'- GTGCCTATTGCCTCTCCGTTTCTGAC-3' (SEQ. ID NO: 3)(primer 1) to 5'- ACGTGGGGCAGACGTTGGCCAGGCG-3') (SEQ. ID NO: 4)(252 base pair 3' v-src fragment, 5'-CAGCTGCTCCCTGCTTGTGTGTTGG-3' (SEQ. ID NO: 5) (residues 1543-1567 in v-src ORF) to 5'-

ATGAATTCTCTAGAGGAAGACGCCATCATATTCCAAGCAG-3' (SEQ. ID NO: 6) (residues 1769-1794 from v-src ATG with Xbal and EcoRI restriction sites added (primer 4)). Primers 1 and 4 were used to generate a three-fragment PCR amplification and fusion of the v-Src:: human c-Src fusion fragment and the 5' and 3' fragments amplified from the Prague C v-Src gene and 3' untranslated region from Rous sarcoma virus. This reation creates an in-frame v-Src: :human c-Src gene fusion (amino acid residue V244 of v-Src to C248 of human c-Src on the amino terminal side and A517 of human c-Src to Q515 of v-Src). This gene fusion fragment encodes the carboxyl terminal one-third of the v-Src SH₂ domain and SH₂-catalytic domain linker fused to the human c-Src catalytic domain flanked by the v-Src carboxyl-terminal tail. A naturally occurring Bgl2 site near the 5' end of the fusion fragment and the engineeed Xbal site at the 3' end of the fragment were used to excise fragment for creation of the full-length v-Src::human c-Src fusion gene as described above. The integrity of the constructs was confirmed by DNA sequencing. Similar methods were used to clone this gene into other expression plasmids such as plRES (Clontech) for use in these studies. These transformed Rat2 fibroblasts are used for the measurement of src dependent suspension growth.

Ultra-low cluster plates (Corning Costar, Acton, MA) are seeded with 10,000 cells per well on day 1. Alternatively, Ultra-low cluster plates (Costar 3474) treated with Sigmacote (Sigma, St. Louis, MO), rinsed with 70% ethanol, after drying in the hood, are seeded with 5000 cells. Compound is added in serial two-fold dilutions from 10 micromolar to 0.009 micromolar on day 2 and MTS reagent (Promega, Madison, WI) is added on day 5 (100 microliters of MTS/medium mix + 100 microliters of medium already on the cells and the absorbance is measured at 490 nm. The results are analyzed as follows to yield an IC₅₀ for proliferation (micromolar units) as follows: % inhibition =(Abs 490 nm sample - blank)/(Abs 490 nm no cmpd control - blank) x 100%. As shown in Table 1 , compounds of the present invention inhibit src dependent cell proliferation.

Table 2

Compounds of formula I ("the compounds"), originally identified as a Src inhibitor, is shown here to be a potent antiproliferative and proapoptotic agent against CML cells in culture. The apoptotic activity of the compounds against CML cells in culture is mirrored by its activity in vivo against CML xenografts. K562 tumors regress in nude mice when the compounds are administered p.o. once a day. The Ab1 -inhibitory activity of the compounds is likely a major contributor to the antiproliferative activiety of the compounds against CML cells. Tyrosine phosphorylation of Bcr-Ab1 is eliminated at concentrations of the compounds greater than 100 nm, which alone should be sufficient to inhibit the proliferation and survival of Bcr-Ab1 -dependent myeloid cells.

For table 2 nude mice with K562 xenografts were examined at the times shown. Data is presented as a ratio of animals lacking detectable tumors relative to the number of animals per group. K562 tumors imbedded in Matrigel were staged in nude mice until tumors reached 200-300 mm³. The compound of example 1 was administered p.o. in 0.4 % methocel/0.5% Tween at 75 mg/kg once a for 5 days (8 mice/group).

Table 3

Tumor-free survival of mice with K562 xenografts receiving various oral doses of example 1 for 5 days

This invention will be more fully described in conjunction with the following specific examples which are not to be construed as limiting the scope of this invention.

Reference Example 1 Ethyl 7-fluoro-6-methoxy-4-oxo-1 ,4-dihvdro-3-quinolinecarboxylate

A mixture of 3-fluoro-4-methoxyaniline (3.00 g, 21.26 mmol) and diethyl ethoxymethylene malonate (4.59 g, 21.26 mmol) was heated at 110°C for 1 hour then cooled to room temperature. Hexane was added and the solids were collected by filtration. This material was suspended in 45 mL of a 3 : 1 mixture of diphenyl ether : biphenyl and the mixture was heated at reflux for 2 hours to provide a brown solution. The reaction mixture was cooled to room temperature and hexane was added. The resultant solid was collected by filtration washing with hexane to provide 2.62 g of ethyl 7-fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3-quinolinecarboxylate as a white solid, mp >300°C.

MS 265.9 (M+H)+

Analysis for Cι₃Hι₂FN0₄

Calcd: C, 58.87; H, 4.56; N, 5.28.

Found: C, 58.66; H, 4.16; N, 5.14. Reference Example 2 7-Fluoro-6-methoxy-4-oxo-1 ,4-dihvdro-3-quinolinecarboxylic acid

A mixture of ethyl 7-fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3- quinolinecarboxylate (2.2 g, 8.30 mmol) and 13.2 mL of 1 N sodium hydroxide and 40 mL of ethanol was heated at reflux for 3 hours then cooled to room temperature. Water was added and the mixture was acidified with acetic acid. The resultant solid was collected by filtration washing with water to provide 1.90 g of 7-fluoro-6-methoxy- 4-oxo-l ,4,-dihydro-3-quinolinecarboxylic acid as a white solid, mp 265-267°C. MS 238.1 (M+H)+ Analysis for CnHβFN.0₄ - 1.2 H₂0 Calcd: C, 51.04; H, 4.03; N, 5.4Ϊ . Found: C, 50.98; H, 3.95; N, 5.33. Reference Example 3

7-Fluoro-6-methoxy-4-oxo-1 ,4-dihvdro-3-quinolinecarboxamide

A mixture of 7-fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3-quinolinecarboxylic acid (1.0 g, 4.21 mmol) and 1, 1 '-carbonyldiimidazole (1.51 g, 9.28 mmol) in 14 mL of N,N-dimethylformamide was heated at 65°C for 2 hours then cooled to room temperature and poured into 200 mL of aqueous ammonium hydroxide on an ice water bath. The solution was allowed to stir at room temperature overnight and then concentrated to a small volume. Ice cold water was added followed by acidification with acetic acid. The resultant solid was collected by filtration washing with water to provide 821 mg of 7-fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3-quinolinecarboxamide as a white solid, mp >300°C.

MS 236.8 (M+H)+ Analysis for CnHgFNΛ - 0.2 H₂0 Calcd: C; 55.09; H, 3.94; N, 11.68. Found: C, 55.00; H, 3.63; N, 11.49. Reference Example 4

7-Fluoro-6-methoxy-4-oxo-1₁4-dihydrθτ3-quinolinecarbonitrile

A mixture of 7-fluoro-6-methoxy-4-oxo-1 ,4,-dihydro-3-quinolinecarboxamide (700 mg, 3.0 mmol) and cyanuric chloride (341 mg, 1.65 mmol) in 15 mL of N, N,- dimethylformamide was heated at 65°C for 6 hours then cooled to room temperature and an additional 206 mg of cyanuric chloride was added. The mixture was heated at 65°C for 4 hours then stirred overnight at room temperature. The reaction mixture was poured into ice water and neutralized with saturated sodium bicarbonate. The solids were collected by filtration washing with water and hexane to provide 610 mg of crude product. Purification by flash column chromatography eluting with a gradient of 3% methanol in dichloromethane to 10% methanol in dichloromethane, provided 272 mg of 7-fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3-quinolinecarbonitrile, mp 147- 149°C.

MS 216.8 (M-H)-

Analysis for C₁₁H₇FN₂0₂- 0.1 dichloromethane Calcd: C, 58.80; H, 3.19; N, 12.36. Found: C, 59.06; H, 2.96; N, 11.97. Alternative route to Reference Example 4 7-Fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3-quinolinecarbonitrile

A mixture of 3-fluoro-4-methoxyaniline (15.31 g, 108 mmol) and ethyl (ethoxymethylene)cyanoacetate (18.36 g, 108 mmol) in toluene was heated at 100- 110°C for 4.5 hours then cooled to room temperature. A 1 : 1 mixture of hexane and ethyl acetate was added and the mixture was cooled on an ice bath. The solids were collected washing with hexane to provide a first crop of 26.10 g and a second crop of 1.24 g. A 2.0 g portion of this material was added to 18 mL of a 3 : 1 mixture of diphenyl ether : biphenyl that was heated to reflux. This mixture was heated at reflux for 4 hours then cooled and poured into hexane. The solids were collected by filtration and washed with ethyl acetate and hexane to provide 624 mg of 7-fluoro-6- methoxy-4-oxo-1 ,4,-dihydro-3-quinolinecarbonitrile as a brown solid. The filtrate was concentrated, the residue was dissolved in ethyl acetate and hexane was added. The resultant solid was collected by filtration to give 1.07 g of 7-fluoro-6-methoxy-4- oxo-1 ,4-dihydro-3-quinolinecarbonitrile as a yellow solid.

Reference Example 5 4-Chloro-7-fluoro-6-methoxy-3-quinolinecarbonitrile

A mixture of 7-fluoro-6-methoxy-4-oxo-1 ,4-dihydro-3-quinolinecarbonitrile (1.0 g, 4.59 mmol) and 14 g of phosphorous oxychloride was heated at reflux for 30 minutes then concentrated in vacuo. The residue was partitioned between aqueous sodium bicarbonate and ethyl acetate. The organic layer was dried over magnesium sulfate, filtered and concentrated on to silica gel. Purification by flash column chromatography eluting with a gradient of 1 : 5 ethyl acetate : hexane to 1 : 1 ethyl acetate : hexane, provided 631 mg of 4-chloro-7-fluoro-6-methoxy-3- quinolinecarbonitrile, mp 160-162°C.

MS 236.9 (M+H)+ Analysis for C₁₁H_βCIFN O Calcd: C, 55.83; H, 2.56; N, 11.84. . Found: C, 55.66; H, 2.84; N, 11.91. Reference Example 6

4-[(2,4-Dichloro-5-methoxyphenyl)amino1-7-fluoro-6-methoxy-3-quinolinecarbonitrile

A mixture of 4-chloro-7-fluoro-6-methoxy-3-quinolinecarbonitrile (4.12 g , 18 mmol) 2,4-dichloro-5-methoxyaniline (4.56 g, 24 mmol) (Theodoridis, G.; Pestic. Sci. 1990, 30, 259) and pyridine hydrochloride (2.31 g, 19.9 mmol)^' in 45 mL of 2- ethoxyethanol was heated at 120°C for 3 hours then cooled to room temperature. The reaction mixture was added to aqueous sodium bicarbonate and stirred for 20 minutes. The solids were collected by filtration to provide 4.89 g of 4-[(2,4-dichloro-5- methoxyphenyl)amino]-7-fluoro-6-methoxy-3-quinolinecarbonitrile, mp >260°C.

HRMS theory 392.03.634; found 392.03556 (M+H)+ Analysis for C_1aH₁₂CI₂FN₃0₂- 2.0 H₂0 Calcd: C, 50.48; H, 3.77; N, 9.81. Found: C, 50.41 ; H, 2.82; N, 9.78. Reference Example 7

6-Benzyloxy-7-fluoro -4-oxo-1 , 4-dihvdro-3-quinolinec^"arbonitrile A mixture of 4-benzyloxy-3-fluoroaniline (6.06 g, 27.9 mmol) (US 5,622,967) and ethyl (ethoxymethylene)cyanoacetate (5.08 g, 30.0 mmol) was heated at 120°C for 45 minutes then cooled to room temperature. This solid was added in portions to a 3 : 1 mixture of diphenyl ether : biphenyl at 245 °C. This mixture was heated at 245°C for 3 hours then cooled and the solids were collected by filtration, washing with hexane and diethyl ether to provide 2.60 g of 6-benzyloxy-7-fluoro-4-oxo-1 , 4- dihydro-3-quinolinecarbonitrile, mp >250°C.

MS 293.1 (M-H)- Reference Example 8

6-Benzyloxy-4-chloro-7-fluoro-3-quinolinecarbonitrile

A mixture of 6-benzyloxy-7-fluoro-4-oxo-1 , 4-dihydro-3-quinolinecarbonitrile (645 mg, 2.19 mmol) and 10 mL of phosphorous oxychloride was heated at 115 °C for 1.5 hours then concentrated in vacuo. The residue was treated with ice cold aqueous ammonium hydroxide and the resultant solid was collected by filtration. Purification by flash column chromatography eluting with a gradient of 1% ethyl acetate in hexane to 6% ethyl acetate in hexane, provided 284 mg of 6-benzyloxy-4- chloro-7-fluoro-3-quinolinecarbonitrile, mp 159-160°C.

MS 313.13 (M+H)+ Analysis for C₁₇H₁₀CIFN₂O

Calcd: C, 65.15; H, 3.06; N, 8.82. Found: C, 65.29; H, 3.22; N, 8.96. Reference Example 9

4-Chloro-7-fluoro-6-hydroxy-3-quinolinecarbonitrile A mixture of 6-benzyloxy-4-chloro-7-fluoro-3-quinolinecarbonitri|e (733 mg,

2.34 mmol) and 1 mL of thioanisole in 12 mL of trifluoroacetic acid was heated at reflux for 9 hours then concentrated in vacuo. The residue was treated with ice water and then basified to pH 9-10 by the addition of aqueous ammonium hydroxide. The resultant solid was collected by filtration and washed with diethyl ether. The filtrate was extracted with 10% methanol in ethyl acetate. The organic layer was dried over sodium sulfate, filtered and concentrated in vacuo. The residue was combined with the solid obtained initially, and this material was dissolved in 5% methanol in ethyl acetate and absorbed onto silica gel. Purification by flash column chromatography eluting with a gradient of hexane to increasing amounts of ethyl acetate in hexane to 5% methanol in ethyl acetate provided 260 mg of 4-chloro-7- fluoro-6-hydroxy-3-quinolinecarbonitrile, mp >250°C.

MS 220.9 (M-H)- Analysis for C₁₀H₄CIFN₂O

Calcd: C, 53.96; H, 1.81; N, 12.58. Found: C, 54.23; H, 2.02; N, 12.06. Reference Example 10

4-Chloro-6-ethoxy-7-fluoro-3-quinolinecarbonitrile To a 0°C mixture of 4-chloro-7-fluoro-6-hydroxy-3-quinolinecarbonitrile (185 mg, 0.83 mmol), triphenylphosphine (392 mg, 1.49 mmol) and ethanol (153 mg, 3.32 mmol) in 15 mL of tetrahydrofuran was added diethylazodicarboxylate (260 mg, 1.80 mmol). The reaction mixture was kept at 0°C for 45 minutes then stirred at room temperature overnight. The reaction mixture was concentrated in vacuo and purified by flash column chromatography eluting with a gradient of 1 % ethyl acetate in hexane to 5% ethyl acetate in hexane to provide 4-chloro-6-ethoxy-7-fluoro-3- quinolinecarbonitrile, mp 165-166°C.

MS 251.0 (M+H)+ Analysis for C₁₂H₈CIFN₂0 Calcd: C, 57.50; H, 3.22; N, 11.18. Found: C, 57.24; H, 3.41; N, 11.09. Reference Example 11

4-|^'(2,4-Dichloro-5-methoxyphenyl amino1-6-ethoxy-7-fluoro-3-quinolinecarbonitrile

Following the procedure of Reference Example 6, a mixture of 4-chloro-6- ethoxy-7-fluoro-3-quinoiinecarbonitrile (197- mg, 0.78 mmol), 2,4-dichloro-5- methoxyaniline (220 mg, 1.14 mmol) and pyridine hydrochloride (120 mg, 1.04 mmol) provided, after flash column chromatography eluting with a gradient of dichloromethane to 1% methanol in dichloromethane, 183 mg of 4-[(2,4-dichloro-5- methoxyphenyl)amino]-6-ethoxy-7-fluoro-3-quinolinecarbonitrile, mp 184-186°C.

MS 406.0 (M+H)

Analysis for C₁₉H₁₄CI₂FN₃0₂- 0.5 H₂0 Calcd: C, 54.96; H, 3.64; N, 10.12. Found: C, 54.99; H, 3.59; N, 10.05. Example 1

4-F(2,4-Dichloro-5-methoxyphenyl)aminol-6-methoxy-7-f3-(4-methyl-1- piperazinyl)propoxy1-3-quinolinecarbonitrile A mixture of 7-[3-chloropropoxy]-4-[(2,4-dichloro-5-methoxyphenyl)amino]-6- methoxy-3-quinolinecarbonitrile (656 mg, 1.40 mmol) and sodium iodide (210 mg, 1.40 mmol) in 4 mL of N-methylpiperazine was heated at 80°C for 20 h._The reaction mixture was concentrated in vacuo and partitioned between ethyl acetate and saturated aqueous sodium bicarbonate. The organic layer was washed with brine, dried over sodium sulfate, filtered and concentrated in vacuo. The residue was purified by column chromatography eluting with 30% methanol in dichloromethane. The fractions containing product were collected and concentrated in vacuo. Diethyl ether was added to the residue and the light pink solid was collected by filtration to provide 560 mg (75%) of 4-[(2,4-dichloro-5-methoxyphenyl)amino]- 6-methoxy-7-[3- (4-methyl-1-piperazinyl)propoxy]-3-quinolinecarbonitrile: mp 116-120°C; MS (ES) m/z 530.2, 532.2 (M+1).

Example 2

4-[(2,4-Dichloro-5-methoxyphenyl)amino1-7-[3-(4-ethyl-1-piperazinyl)propoxy1-6- methoxy-3-quinolinecarbonitrile A mixture of 7-[3-chloropropoxy]-4-[(2,4-dichloro-5-methoxyphenyl)amino]-6- methoxy-3-quinolinecarbonitrile (3.50g, 7.50 mmol), sodium iodide (1.12 g, 7.50 mmol) and 4.8 mL of N-ethylpiperazine in 5 mL of ethylene glycol dimethyl ether was heated at 95°C for 20 h. The reaction mixture was concentrated in vacuo and partitioned between ethyl acetate and saturated aqueous sodium bicarbonate. The organic layer was washed with saturated aqueous sodium bicarbonate, followed by brine, dried over sodium sulfate, filtered and concentrated in vacuo. Diethyl ether was added to the residue and the white solid was collected by filtration to provide 1.80 g (44%) of 4-[(2,4-dichloro-5-methoxyphenyl)amino]- 7-[3-(4-ethyl-1-

' piperazinyl)propoxy]-6-methoxy-3-quinolinecarbonitrile: mp 102-104°C; MS (ES) m/z 544.3, 546.4 (M+1 ).

Example 3

4-f(2,4-Dichloro-5-methoxyphenyl)amino1-6-methoxy-7-r2-(4-methyl-1- piperazinyl)ethoxyl-3-quinolinecarbonitrile

Prepared according to the method used for the preparation of Example 1 by the reaction of 7-[2-chloroethoxy]-4-[(2,4-dichloro-5-methoxyphenyl)amino]-6- methoxy-3-quinolinecarbonitrile and N-methylpiperazine: mp 165-167°C; MS (ES) m/z 516.0, 518.2 (M+1). Example 4

4-[(2,4-Dichloro-5-methoxyphenyl)aminol-7-r2-(4-ethyl-1-piperazinyl)ethoxy1-6- methoxy-3-quinolinecarbonitrile

Prepared according to the method used for the preparation of Example 1 by the reaction of 7-[2-chloroethoxy]-4-[(2,4-dichloro-5-methoxyphenyl)amino]-6- methoxy-3-quinolinecarbonitrile and N-ethylpiperazine: mp 101-105°C; MS (ES) m/z 530.4, 532.4 (M+1).

Example 5

4-r(2,4-Dichloro-5-methoxyphenyl)aminol-6-methoxy-7-r(1-methylpiperidin-4- yl)methoxyl-3-quinolinecarbonitrile To a solution of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-7-fluoro-6-methoxy- 3-quinolinecarbonitrile (600 mg, 1.53 mmol) and 1~methylpiperidine-4-methanol (395 mg, 3.06 mmol) in 10 mL of N, N-dimethylformamide at 135°C was added sodium hydride (362 mg, 9.06 mmol) in portions. After 45 minutes the reaction mixture was poured into saturated sodium bicarbonate. After stirring for 15 minutes the solid was collected by filtration. The residue was purified by flash column chromatography, eluting with a gradient of 5% methanol in dichloromethane to 25% methanol in dichloromethane. Trituation with diethyl ether provided 396 mg of 4-[(2,4-dichloro-5- methoxyphenyl)amino]-6-methoxy-7-(1-methylpiperidin-4-yl)methoxy]-3- quinolinecarbonitrile, mp 200-202°C.

MS 501.3 (M+H)+

Analysis for C₂₅H₂₆CI₂N 0₃ - 0.8H₂O Calcd: C, 58.21 ; H, 5.39; N, 10.86. Found: C, 58.19; H, 5.23; N, 10.67. Example 6

4-f(2,4-Dichloro-5-methoxyphenyl aminol-6-methoxy-7-r2-(1-methylpiperidin-4- yl)ethoxy1-3-quinolinecarbonitrile A mixture of sodium hydride (128 mg, 3.2 mmol) and 1 -methyl-4- piperidineethanol (180 mg, 1.25 mmol) [ EP 0581538] in 5 mL of N, N- dimethylformamide was heated at 110°C for 1 hour. * 4-[(2,4-Dichloro-5- methoxyphenyl)amino]-7-fluoro-6-methoxy-3-quinolinecarbonitrile (200 mg, 0.51 mmol) was added and the reaction mixture was heated at 135°C for 5 hours. Over the next 4 hours an additional 128 mg of sodium hydride was added to the reaction mixture at 130°C. The reaction mixture was partitioned between ethyl acetate and water. The organic layer was dried over sodium sulfate, filtered and concentrated in vacuo. The residue was purified by preparative thin layer chromatography, eluting with 20% methanol in dichloromethane to provide 105 mg of 4-[(2,4-dichloro-5- methoxyphenyl)amino]- 6-methoxy-7-[(2-(1-methylpiperidin-4-yl)ethoxy]-3- quinolinecarbonitrile, mp 190-191 °C.

MS 515.19 (M+H)+

Analysis for C₂₆H₂₈CI₂N₄θ₃ - 1.0 H₂0

Calcd: C, 58.53; H, 5.67; N, 10.50. Found: C, 58.65; H, 5.57; N, 10.34.

Examples 7 and 8 are obtained analogously by the method of Example 5 and the corresponding alcohol.

Example 7 4-r(2,4-Dichloro-5-methoxyphenyl)aminol-6-methoxy-7-r3-(1-methylpiperidin-4- yl)propoxy1quinoline-3-carbonitrile

MP 144-145°C; Mass spec. 529.2 (ES +)

Example 8

4-f(2,4-Dichloro-5-methoxyphenyl)amino1-7-|^'(1-ethylpiperidin-4-yl)methoxy1-6- methoxyquinoline-3-carbonitrile

MP 192-195°C; Mass spec. 515.2 (ES +)

Example 9

4-r(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-r3-(4-methylpiperazin-1- vOpropoxylquinoline-3-carbonitrile A mixture of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-fluoro-3- quinolinecarbonitrile (200 mg, 0.49 mmol), 3-(4-methyl-piperazin-1-yl)propanol (155 mg, 0.98 mmol) (WO 20047212) and sodium hydride (196 mg, 4.6 mmol) in 5 mL of N, N-dimethylformamide was heated at 125°C for 3 hours. The reaction mixture was poured into saturated sodium bicarbonate and stirred for 1 hour. The aqueous solution was extracted with 10% methanol in dichloromethane. The organic layer was washed with brine, dried over magnesium sulfate and concentrated in vacuo. The residue was purified by preparative thin layer chromatography, eluting with 15% methanol in dichloromethane. Trituation with hexane provided 116 mg of 4-[(2,4- dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-methylpiperazin-1- yl)propoxy]quinoline-3-carbonitrile as a light brown solid, mp 137-138°C. MS 542.0 (M-H)-

Analysis for

- 0.6 H₂0 Calcd: C, 58.40; H, 5.84; N, 12.61. Found: C, 58.31; H, 5.71; N, 12.43. Example 10

4-|^"(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-f(1-methylpiperidin-4- yl)methoxy1quinoline-3-carbonitrile

A mixture of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-fluoro-3- quinolinecarbonitrile (200 mg, 0.49 mmol), 1-methylpiperidine-4-methanol (188. mg, 0.98 mmol) (WO 20047212) and sodium hydride (196 mg, 4.6 mmol) in 5 mL of N, N-dimethylformamide was heated at 125°C for 3 hours. The reaction mixture was poured into saturated sodium bicarbonate and stirred for 1 hour. The solid was collected by filtration, washed with water and dried in vacuo. The solid was purified by preparative thin layer chromatography, eluting with 15% methanol in dichloromethane. Trituation with diethyl ether provided 67 mg of 4-[(2,4-dichloro-5- methoxyphenyl)amino]-6-ethoxy-7-[(1-methylpiperidin-4-yl)methoxy]quinoline-3- carbonitrile as a light brown solid, mp 182-186°C.

MS 513.0 (M-H)-

Analysis for C₂₆H₂₈CI₂N₄0₃ - 1.4 H₂0 Calcd: C, 57.76; H, 5.74; N, 10.36. Found: C, 57.65; H, 5.43; N, 10.15. Example 11

4-r(2,4-Dichloro-5-methoxyphenyl)aminol-6-ethoxy-7-r3-(4-ethylpiperazin-1- yl)propoxy1quinoliner3-carbonitrile A mixture of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-fluoro-3- quinolinecarbonitrile (200 mg, 0.49 mmol) and 3-(4-ethyl-piperazin-1-yl)propanol (241 mg, 0.98 mmol) ) in 5 mL of N, N-dimethylformamide was heated at 125°C for 5 min. Sodium hydride (60%) (98 mg, 2.45 mmol) was added and the mixture was heated at 125°C for 1 hour. Additional sodium hydride (98 mg, 2.45 mmol) was added and the mixture was heated at 125°C for 2 hours. The reaction mixture was cooled to room temperature and poured into saturated sodium bicarbonate and stirred for 1 hour. The aqueous solution was extracted with 10% methanol in dichloromethane. The organic layer was dried over sodium sulfate and concentrated in vacuo. The residue was purified by preparative thin layer chromatography, developing with 12% methanoi in dichloromethane. Trituation with diethyl ether and hexane provided 146 mg of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-ethylpiperazin-1 - yl)propoxy]quinoline-3-carbonitrile as a light brown solid, mp 127-130°C.

MS 558.3 (M+H)+

Analysis for C₂₈H₃₃CI₂N₅θ₃ - 1.5 H₂0 Calcd: C, 57.44; H, 6.20; N, 11.96. Found: C, 57.44; H, 6.24; N, 11.79. Example 12

4-[(2,4-Dichloro-5-methoxyphenyl)amino1-6-ethoxy-7-f3-(1-methylpiperidin-4- yl)propoxy1quinoline-3-carbonitrile

A mixture of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-fluoro-3- quinolinecarbonitrile (200 mg, 0.49 mmol) and 3-(1-methyl-4-piperidinyl)propanol (154 mg, 0.98 mmol) ) in 5 mL of N, N-dimethylformamide was heated at 125°C for 5 min. Sodium hydride (60%) (98 mg, 2.45 mmol) was added and the mixture was heated at 125°C for 1 hour. Additional sodium hydride (98 mg, 2.45 mmol) was added and the mixture was heated at 125°C for 2 hours. The reaction mixture was cooled to room temperature and poured into saturated sodium bicarbonate and stirred for 1 hour. The precipitate was collected, washed with water and dried in vacuo. The residue was purified by preparative thin layer chromatography, developing with 15% methanol in dichloromethane. Trituation with diethyl ether provided 146 mg of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(1- methylpiperidin-4-yl)propoxy]quinoline-3-carbonitrile as an off-white solid, mp 148- 151°C. MS 543.2 (M+H)+

Analysis for C₂₈H₃₂CI₂N₄0₃ - 1.8 H₂0 Calcd: C, 58.39; H, 6.23; N, 9.73. Found: C, 58.40; H, 6.16; N, 9.64. Example 13

4-[(2,4-Dichloro-5-methoxyphenyl)amino1-6-ethoxy-7-[2-(4-methyl-1- piperazinyl)ethoxy1quinoline-3-carbonitrile

A mixture of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy~7-fluoro-3- quinolinecarbonitrile (200 mg, 0.49 mmol) and 2-(4-methyl,-1-piperazinyl)ethanol (141 mg, 0.98 mmol) ) in 5 mL of N, N-dimethylformamide was heated to 100°C. Sodium hydride (60%) (196 mg, 4.9 mmol) was added in portions and the mixture was heated at 125°C for 3 hours. The reaction mixture was cooled to room temperature and treated with 25 mL of water. The mixture was stirred for 2 hours. The precipitate was collected, washed with water and dried in vacuo. The residue was purified by flash column chromatography, eluting with a gradient of 5% methanol in dichloromethane to 15% methanol in dichloromethane. Trituation with diethyl ether provided 123 mg of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[2-(4- methyl-1-piperazinyl)ethoxy]quinoline-3-carbonitrile as an off-white solid, mp 141- 143°C.

MS 530.2 (M+H)+

Analysis for C₂₆H₂gCI₂N₅0₃ Calcd: C, 58.87; H, 5.51 ; N, 13.20. Found: C, 58.48; H, 5.45; N, 12.95. Example 14 4-r(2,4-Dichloro-5-methoxyphenyl)amino1-6-ethoxy-7-r2-(1-methylpiperidin-4- vDethoxylquinoline-3-carbonitrile

A mixture of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-fluσro-3- quinolinecarbonitrile (200 mg, 0.49 mmol) and 1-methyl-4-piperidinethanol (140 mg, 0.98 mmol) ) in 5 mL of N, N-dimethylformamide was heated to 100°C. Sodium hydride (60%) (162 mg, 4.05 mmol) was added in portions and the mixture was heated at 125°C for 3 hours. The reaction mixture was cooled to room temperature and treated with 25 mL of water. The precipitate was collected, washed with water and dried in vacuo. The residue was purified by flash column chromatography, eluting with first dichloromethane then a gradient of 5% methanol in dichloromethane to 30% methanol in dichloromethane. Trituation with diethyl ether provided 121 mg of 4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[2-(1-methylpiperidin-4- yl)ethoxy]quinoline-3-carbonitrile as an off-white solid, mp 174-176°C.

MS 529.1 (M+H)+

Analysis for C₂₇H₃oCI₂N₄0₃ Calcd: C, 61.25; H, 5.71; N, 10.58. Found: C, 61.40; H, 5.84; N, 10.35. Example 15 4-[(2,4-Dichloro-5-methoxyphenyl)aminol-6-methoxy-7-[3-(4-propyl-1- piperazinyl)propoxy1-3-quinolinecarbonitrile

Prepared according to the method used for the preparation of Example 1 by the reaction of 7-[3-chioroethoxy]-4-[(2,4-dichloro-5-methoxyphenyl)amino]-6- methoxy-3-quinolinecarbonitrile and N-propylpiperazine: mp 97-101 °C; MS (ES) m/z 558.2, 560.2 (M+1).

Example 16

4-r(2,4-dichloro-5-methoxyanlino)-6-methoxy-7-[2-(4-methyl-1-piperazinyl)ethoχy]-3- quinolinecarbonitrilβ

Example 17 4-|^'(2,4-dichloro-5-methoxyanlino)-7-r2-(4-ethyl-1-piperazinyl)ethoxy1-6-methoxy-3- quinolinecarbonitrile Example 18

4-[(2,4-dichloro-5-methoxyphenyl)aminol-6-methoxy-7-r(1-methyl-3- piperazinyl)methoxy1-3-quinolinecarbonitrile

Example^' 19 4-r(2,4-dichloro-5-methoxyphenyl)amino]-6-methoxy-7-r(1-methyl-2- piperazinyl)ethoxy1-3-quinolinecarbonitrile

Example 20 -f(2,4-dichlorophenyl)amino1-6-methoxy-7-[(1-methylpiperidin-4-yl)methoxy]-3- quinolinecarbonitrile Example 21

6-methoxy-7-r(1-methylpiperidin-4-yl)methoxy1-4-[(3,4,5- trimethoxyphenvπaminolquinoline-3-carbonitrile

Example 22

4-f(2-chloro-5-methoxyphenyl)amino1-6-methoxy-7-f(1-methylpiperidin-4- yl)methoxy1quinoline-3-carbonitrile

Example 23

6-methoxy-4-f(5-methoχy-2-methylphenyl)aminol-7-f(1-methylpiperidin-4- vDmethoxylquinoline-3-carbonitrile

Example 24 4-[(2,4-dimethylphenyl)amino1-6-methoxy-7-r(1-methylpiperidin-4- vPmethoxylquinoline-3-carbonitrile

Example 25

6-methoxy-4-r(5-methoxy-2,4-dimethylphenyl)aminol-7-f(1-methylpiperidin-4- vπmethoxylquinoline-3-carbonitrile Example 26 -r(2,4-dichloro-5-ethoxyphenvπaminol-6-methoxy-7-r(1-methylpiperidin-4- vDmethoxylquino!ine-3-carbonitrile

Claims

What is claimed:

1. A method of preventing or inhibiting CML comprising, providing a therapeutically effective amount of a compound of the formula

wherein:

n is an integer from 0-3;

X is N, CH;

R is alkyl of 1 to 3 carbon atoms;

R¹ is 2,4-diCI, 5-OMe in para, ortho, or meta position; 2,4-diCI in para position; 3,4,5- tri-OMe in para position; 2-CI, 5-OMe in para position; 2-Me, 5-OMe in para position; 2,4-di-Me in para position; 2,4-diMe-5-OMe in para position; 2,4-diCI, 5-OEt in para position; and

2. The method of claim 1 wherein the compound is of the formula:

X is N, CH n is 3;

R' and R are methyl; and pharmaceutically acceptable salts thereof.

3. The method of Claim 1 wherein R' is methyl.

4. The method of Claim 1 wherein X is N:

5. The method of Claim 1 wherein X is CH.

6. The method of Claim 1 wherein the compound is:4-[(2,4-Dichloro-5- methoxyphenyl)amino]-6-methoxy-7-[3-(4-methyl-1-piperazinyl)propoxy]-3- - quinolinecarbonitrile.

7. The method of Claim 1 wherein the compound is:

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-7-[3-(4-ethyl-1-piperazinyl)propoxy]-6- methoxy-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[2-(4-methyl-1- piperazinyl)ethoxy]-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-7-[2-(4-ethyl-1 -piperazinyl)ethoxy]-6- methoxy-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyi)amino]-6-methoxy-7-[3-(1-methylpiperidin-4- yl)propoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-methylpiperazin-1- yl)propoxy]quinoline-3-carbonitrile; 4~[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-ethylpiperazin-1- yl)propoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[2-(1 -methylpiperidin-4- yl)ethoxy]quinoline-3-carbonitrile; or

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(4-propyl-1- piperazinyl)propoxy]-3-quinolinecarbonitrile; and pharmaceutically acceptable salts thereof.

8. The method of Claim 1 wherein the compound is:

4-[(2,4-dichloro-5-methoxyanlino)-6-methoxy-7-[2-(4-methyl-1 -piperazinyl)ethoxy]-3- quinolinecarbonitrile;

4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[(1-methy)-2- piperazinyl)ethoxy]-3-quinolinecarbonitrile;

6-methoxy-7-[(1 -methylpiperidin-4-yl)methoxy]-4-[(3,4,5- trimethoxyphenyl)amino]quinoline-3-carbonitrile; 4-[(2-chloro-5-methoxyphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

6-methoxy-4-[(5-methoxy-2-methylphenyl)amino]-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

4-[(2,4-dimethylphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

6-methoxy-4-[(5-methoxy-2,4-dimethylphenyl)amino]-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile; and

4-[(2,4-dichloro-5-ethoxyphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile.

9. The method of claim 1 wherein the compound is a Src inhibitor and a Abl Kinase inhibitor.

10. A pharmaceutical composition comprising a CML inhibiting amount of a compound having the structure of formula I:

wherein:

n is an integer from 0-3;

X is N, CH;

R is alkyl of 1 to 3 carbon atoms;

R is 2,4-diCI, 5-OMe in para, ortho, or meta position; 2,4-diCI in para position; 3,4,5- tri-OMe in para position; 2-CI, 5-OMe in para position; 2-Me, 5-OMe in para position; 2,4-di-Me in para position; 2,4-diMe-5-OMe in para position; 2,4-diCI, 5-OEt in para position; and

11. The pharmaceutical composition of claim 10 wherein the compound is of the formula:

X is N, CH n is 3;

R' and R are methyl; and pharmaceutically acceptable salts thereof.

12. The pharmaceutical composition of Claim 10 wherein R' is methyl.

13. The pharmaceutical composition of Claim 10 wherein X is N.

14. The pharmaceutical composition of Claim 10 wherein X is CH.

15. The pharmaceutical composition of Claim 10 wherein the compound is 4- [(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(4-methyl-1- piperazinyl)propoxy]-3-quinoliήecarbonitrile.

16. The pharmaceutical composition of Claim 10 wherein the compound is:

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[2-(4-methyl-1- piperazinyl)ethoxy]-3-quinoIinecarbonitrile; 4-[(2,4-Dichloro-5-methoxyphenyl)amino]-7-[2-(4-ethyl-1-piperazinyl)ethoxy]-6- methoxy-3-quinolinecarbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[3-(4-ethylpiperazin-1 - yl)propoxy]quinoline-3-carbonitrile;

4-[(2,4-Dichloro-5-methoxyphenyl)amino]-6-ethoxy-7-[2-(1-methylpiperidin-4- yl)ethoxy]quinoline-3-carbonitrile; or

17. The pharmaceutical composition of Claim 10 wherein the compound is: 4-[(2,4-dichloro-5-methoxyanlino)-6-methoxy-7-[2-(4-methyl-1-piperazinyl)ethoxy]-3- quinolinecarbonitrile;

6-methoxy-7-[(1 -methylpiperidin-4-yl)methoxy]-4-[(3,4,5- trimethoxyphenyl)amino]quinoline-3-carbonitrile;

4-[(2,4-dichloro-5-ethoxyphenyl)amino]-6-methoxy-7-[(1-methylpiperidin-4- yl)methoxy]quinoline-3-carbonifrile.

18. The pharmaceutical composition of claim 10 wherein the compound is a Src inhibitor and a Ab1 Kinase inhibitor.

19. The method of claim 1 wherein the compounds are delivered alone or in combination with other compounds used to treat CML.

20. The method of claim 19 wherein the combination compounds comprise GLEEVEC, hydroxyurea, IFN-ά, cytotoxic agents, and wortmannin.

21. The method of claim 20 wherein the combination compound is GLEEVEC.