WO2004111272A2 - Polymorphism in the human nbs1 gene useful in diagnostic of inherited predisposition to cancer - Google Patents

Abstract

The present invention relates to methods and kits for determining a predisposition and surveillance protocols for developing cancer, e.g., prostate and/or breast cancer due to germline mutation of the NBS 1 gene.

Description

Polymorphism in the human NBSl gene useful in diagnostic of inherited predisposition to cancer

FIELD OF THE INVENTION

The present invention relates generally to means and methods of diagnosis and treatment of inherited predisposition to cancer, especially prostate cancer or lobular invasive breast cancer and the use of germline change within NBSl gene for diagnosis of such predisposition. In particular, subjects of invention allow to synthesize DNA fragments and to identify genomic abnormalities which are associated with increased predisposition to mentioned cancers. In particular, the present invention relates to polynucleotides of molecular variants of the NBSl gene which are associated with inherited predisposition to prostate cancer or lobular invasive breast cancer, and to vectors comprising such variants (polynucleotides). Furthermore, the present invention relates to host cells comprising such variants or vectors and their use for the production of variants of NBSl protein. In addition, the present invention relates to variants of NBSl protein and antibodies specifically recognizing such protein. The present invention also concerns transgenic non-human animals comprising the above-described variants or vectors. Moreover, the present invention relates to methods for identification and production of drugs for therapy of cancers related to the malfunction of the NBSl gene. The present invention furthermore provides pharmaceutical and diagnostic compositions comprising the above- described DNA variants, vectors, proteins, antibodies and drugs obtainable by the above- described methods. Said the compositions are particularly useful for diagnosis and treatment of various diseases, especially cancers with drugs that are substrates, inhibitors or modulators of the NBSl gene or its product.

Several documents are cited throughout the text of this specification. Each of the documents cited herein (including any manufacturer's specifications, instructions, etc.) are hereby incorporated herein by reference; however, there is no admission that any document cited is indeed prior art as to the present invention. BACKGROUND OF THE INVENTION.

The DNA damage signaling pathway plays a crucial role in the maintenance of the integrity of the genome in response to DNA damage and has been implicated in the pathogenesis cancer. Individuals with rare inherited recessive clinical syndromes such as Nijmegen breakage syndrome (NBS), Bloom syndrome, Fanconi anaemia and ataxia telangiectasia (which are characterized by spontaneous chromosomal instability, immunodeficiency, and a predisposition to cancer) carry a mutation in one of the genes in the

DNA damage signaling pathway (1, 2). The gene for Nijmegen breakage syndrome is localized at chromosome 8q21 (3, see also US6458534). The product of the NBSl gene, (nibrin, also referred to as p95) is a component of the hMREll/hRAD50/NBSl nuclease complex (4). This complex is part of the BRCAl -associated genome surveillance complex (BASC), which is responsible for DNA damage repair (2). A five base-pair deletion in exon 6 of NBSl (657del5) is present in the majority of NBS patients from Eastern Europe (5). It should be underlined that mentioned patients are homozygous carriers of the founder mutation of the Nijmegen breakage syndrome (657del5 allele). Heterozygous NBSl mutation carriers are common in Eastern Europe

(occurring with 0.6% in the general public).

Despite of longstanding research efforts aimed to develop a mode of diagnosing increased predisposition to cancers of various sites, such diagnostic methods are still needed.

Accordingly, means and methods for diagnosis and possibly treatment of increased inherited predisposition to cancers are nevertheless highly desirable.

Thus, the technical problem of the present invention is to comply with the needs described above.

The solution to this technical problem is achieved by providing the embodiments characterized in the claims.

SUMMARY OF THE INVENTION

The present invention is based on the finding of novel, so far unknown correlation between one of form of NBSl gene and increased inherited predisposition to some cancers.

Surprisingly, according to the presented invention defined in enclosed claims, it has been established that the NBSl gene might have a role in pathogenesis of prostate cancer (9) or invasive breast carcinoma of lobular subtype. Unexpectedly, it has been stated that heterozygous carriers of the founder mutation of the Nijmegen breakage syndrome (657del5 allele) might be at increased risk of cancer, especially prostate cancer and breast cancer.

Based upon the knowledge of this phenomenon, diagnostic tests and reagents for such tests were designed for the specific detection and genotyping of NBSl alleles in humans. The determination of the NBSl gene alleles status in humans using such tests may be useful for the prevention or therapy of various diseases, especially cancers, with drugs that are substrates, inhibitors or modulators of the NBSl gene product. In a first embodiment, the invention provides polynucleotides of molecular variant NBSl genes correlated with inherited predisposition to cancer, especially prostate cancer or lobular invasive breast cancer and embodiments related thereto such as vectors, host cells, variant NBSl proteins and methods for producing the same.

In yet another embodiment, the invention provides methods for identifying and obtaining drug candidates and modulators such as inhibitors of NBSl for therapy or prevention of cancer as well as methods of diagnosing the status of such disorders/predisposition. hi a further embodiment, the invention provides pharmaceutical and diagnostic compositions comprising the above-described polynucleotides, vectors containing the same, proteins, antibodies thereto and drugs and inhibitors obtainable by the above described method.

The pharmaceutical and diagnostic compositions, methods and uses of the invention are useful for the diagnosis and treatment/prevention of inherited predisposition to cancer. DETAILED DESCRIPTION OF THE INVENTION

The finding of variations in the NBSl gene, correlated with inherited predisposition to cancer, especially prostate cancer or lobular invasive breast cancer and diagnostic tests for the discrimination of different NBSl alleles in human individuals provide a potent tool for improving the therapy and/or prevention of cancer.

Accordingly, the invention relates to polynucleotide associated with an increased inherited predisposition to cancer, especially prostate or invasive breast cancer of the lobular subtype, which polynucleotide is selected from the group consisting of: (a) a polynucleotide having the nucleic acid sequence of any one of SEQ ID NOs: or ; (b) a polynucleotide encoding a polypeptide having the amino acid sequence of any one of SEQ ID or ; (c) a polynucleotide encoding a molecular variant of the NBSl polypeptide, wherein said polynucleotide contains a nucleotide substitution, a nucleotide deletion, an additional nucleotide or an additional nucleotide and a nucleotide substitution at a position corresponding to position 18155, 18156, 18157, 18158 or 18159 of the iVB&Z gene (Genbank Accession No: AB013139); (d) a polynucleotide encoding a molecular variant of the NBSl polypeptide, wherein said polynucleotide contains a nucleotide deletion at a position corresponding to position 18155, 18156, 18157, 18158 and 18159 of the NBSl gene (Genbank Accession No: AB013139); (e) a polynucleotide encoding a molecular variant of the NBSl peptide, wherein said polypeptide is comprised of an amino acid deletion at position from 234 to 754 of the NBSl polypeptide (SEQ ID NO: 2) and possibly at least one substitution selected from among a substitution of Lys to Asn at position 219, GIn to Leu at position 220, He to GIn at position 221, Phe to Arg at position 222, Lys to GIu at position 223, GIy to Asn at position 224, Lys to lie at position 225, Thr to Tyr at position 226, Phe to He at position 227, He to Phe at position 228, Phe to GIu at position 229, Leu to Cys at position 230, Asn to GIn at position 231, Ala to Thr at position 232, Lys to Ala at position 233 of the NBSl polypeptide (SEQ ID NO: 2); and (f) a polynucleotide encoding a molecular variant of the NBSl polypeptide having the amino acid sequence of SEQ ID NO: 4. hi the context of the present invention the term "molecular variant" of the NBSl gene or protein as used herein means that said NBSl gene or protein differs from the wild type NBSl gene or protein (Genomic sequences of the NBSl gene are described, for examples, under Accession number ABOl 3139) by way of nucleotide substitutions), insertion(s) and/or deletion(s). Preferably, said nucleotide change result in a corresponding change in the amino acid sequence of the NBSl protein and are predicted to result in an impairment of the protein function.

The term "corresponding" as used herein means that a position is not only determined by the number of the preceding nucleotides and amino acids, respectively. The position of a given nucleotide or amino acid in accordance with the present invention which may be deleted, substituted or comprise one or more additional nucleotide(s) may vary due to deletions or additional nucleotides or amino acids elsewhere in the gene or the polypeptide. Thus, under a "corresponding position" in accordance with the present invention it is to be understood that nucleotides or amino acids may differ in the indicated number but may still have similar neighboring nucleotides or amino acids. Said nucleotides or amino acids which may be exchanged, deleted or comprise additional nucleotides or amino acids are also comprised by the term "corresponding position". Said nucleotides or amino acids may for instance together with their neighbors form sequences which may be involved in the regulation of gene expression, stability of the corresponding RNA or RNA editing, as well as encode functional domains or motifs of the protein of the invention.

In accordance with the present invention, the genetic variation in the NBSl gene has been investigated by sequence analysis of relevant regions of the human NBSl gene. It is a well known fact that genomic DNA of individuals, who harbor the individual genetic makeup of all genes, including NBS, can easily be isolated from individual blood samples. These individual DNA samples are then used for the analysis of the sequence of the NBSl gene alleles that are present in the individual who provided the blood sample. The sequence analysis may be carried out by PCR amplification of relevant regions of the NBSl gene, subsequent purification of the PCR products, followed by automated DNA sequencing with established methods (ABI dye terminator cycle sequencing).

One important parameter that have to be considered in an attempt to determine the individual NBSl genotype (and possibly to identify novel NBSl gene variants is the fact that each human harbors (usually, with very few abnormal exceptions) two NBSl gene copies - two NBSl alleles (diploidy), one inherited from mother and the second from father. Because of that, some individuals harbor mutation in only one copy (allele) of the gene (homozygous mutation carriers). These patients are healthy and do not exhibit abnormal phenotype. In contrast, rare individuals have mutations in both alleles (homozygous NBSl mutation carriers). Those are affected by NBS syndrome, which is characterized by phenotypic abnormalities, immunodeficiency and also a predisposition to cancer, primarily lymphoid malignances. It is important to mention that the current invention is focused on detection of predisposition to cancers among heterozygous NBSl mutation carriers. The exemplary mutation in the NBSl gene identified as correlated with inherited predisposition to cancer, especially prostate cancer or lobular invasive breast cancer in accordance with the present invention is 657del5. The methods of the mutation analysis followed standard protocols and are described in detail in the examples. The genetic testing of population variability with regard to genetic markers of inherited predisposition to cancer has been proposed as a tool useful in the identification and selection of patients which can posses such predisposition. This identification/selection can be based upon molecular diagnosis of genetic polymorphisms by genotyping DNA isolated from leukocytes in the blood of patient, for example, and characterization of possible predisposition. For the founders of health care, such as health maintenance organizations in the US and government public health services in many European countries, this pharmacogenomics approach can represent a way of both improving health care and reducing overheads because there is a large cost to cancer therapy.

The mutations in the variant NBSl genes sometime result in amino acid deletion(s), insertion(s) and in particular in substitution(s) either alone or in combination. It is of course also possible to genetically engineer such mutations in wild type genes or other mutant forms. Methods for introducing such modifications in the DNA sequence of NBSl gene are well known to the person skilled in the art; see, e.g., Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1 989) N.Y. In a preferred embodiment of the invention, the above described polynucleotide encodes a variant NBSl protein or fragment thereof, e.g., comprising one or more epitopes of the amino acid sequence encoded by SEQ ED NO: 4.

For the investigation of the nature of the alterations in the amino acid sequence of the NBS 1 protein computer programs may be used such as BRASMOL that are obtainable from the Internet. Furthermore, folding simulations and computer redesign of structural motifs can be performed using other appropriate computer programs (Olszewski, Proteins 25 (1996)@ 286- 299; Hoffman, Comput. Appl. Biosci. 11 (1 995), 675-679). Computers can be used for the conformational and energetic analysis of detailed protein models (Monge, J. MoI. Biol. 247 (1995), 995-1012; Renouf, Adv. Exp. Med. Biol. 376 (1995), 37-45). These analysis can be used for the identification of the influence of a particular mutation on binding and/or interaction with other members of hMREl l/hRAD50/NBSl nuclease complex.

Usually, said amino acid deletion, addition or substitution in the amino acid sequence of the protein encoded by the polynucleotide of the invention is due to one or more nucleotide substitution, insertion or deletion, or any combinations thereof. Preferably said nucleotide substitution, insertion or deletion results in an amino acid deletion at position from 234 to 754 of the NBSl polypeptide (SEQ ID NO: 2) and possibly at least one amino acid substitution selected from among a substitution of Lys to Asn at position 219, GIn to Leu at position 220, He to GIn at position 221, Phe to Arg at position 222, Lys to GIu at position 223, GIy to Asn at position 224, Lys to lie at position 225, Thr to Tyr at position 226, Phe to He at position 227, He to Phe at position 228, Phe to GIu at position 229, Leu to Cys at position 230, Asn to GIn at position 231, Ala to Thr at position 232, Lys to Ala at position 233 of the NBSl polypeptide (SEQ ID NO: 2). The polynucleotide of the invention may further comprise at least one nucleotide and optionally amino acid deletion, addition and/or substitution other than those specified herein above, for example those described in known state of the art. This embodiment of the present invention allows the study of synergistic effects of the mutations in the NBSl gene on the inherited predisposition to cancer in patients who bear such mutant forms of the gene or similar mutant forms that can be mimicked by the above described proteins. It is expected that the analysis of said synergistic effects provides deeper insights into the onset of inherited predisposition to cancer. From said deeper insight the development of diagnostic and pharmaceutical compositions related to cancer will greatly benefit. It is worth noting here that nbs-dependent cancers lack a functioning copy of the gene (see Example 3: LOH). Thus, in the cancer cell, there remains only the mutant copy. Therefore, for example, inhibition of the mutant allele may lead to a complete loss of the NBSl protein from the cell. This should cause the death of the cancer cell. This is one of the possible therapeutic goals of an embodiment of the present invention.

Thus, in a preferred embodiment, the present invention relates to polynucleotides of molecular variant NBSl genes, wherein the nucleotide deletion, addition and/or substitution result in altered expression of the variant NBSl gene compared to the corresponding wild type gene.

The polynucleotide of the invention may be, e.g., DNA, cDNA, genomic DNA, RNA or synthetically produced DNA or RNA or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination. Preferably said polynucleotide is part of a vector, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic engineering that comprise a polynucleotide of the invention. Such vectors may comprise further genes such as marker genes which allow for the selection of said vector in a suitable host cell and under suitable conditions.

In a further preferred embodiment of the vector of the invention, the polynucleotide of the invention is operatively linked to expression control sequences allowing expression in prokaryotic or eukaryotic cells. Expression of said polynucleotide comprises transcription of the polynucleotide, preferably into a translatable mRNA.

Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known to those skilled in the art. They usually comprise regulatory sequences ensuring initiation of transcription and optionally poly- A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers. Possible regulatory elements permitting expression in prokaryotic host cells comprise, e.g., the lac, trp or tac promoter in E coli, and examples for regulatory elements permitting expression in eukaryotic host cells are the AOXl or GALl promoter in yeast or the CMV-, SV40-, RSV-promoter (Rous sarcoma virus), CMV-enhancer, SV40- enhancer or a globin intron in mammalian and other animal cells. Beside elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as the SV40-poly-A site or the tkpoly-A site, downstream of the polynucleotide. In this context, suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDVl (Pharmacia), pCDM8, pRc/CMV, pcDNAl, pcDNA3 (In-vitrogene), pSPORTl (GIBCO BRIL). Preferably, said vector is an expression vector and/or a gene transfer or targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vector of the invention into targeted cell population. Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994). Alternatively, the polynucleotides and vectors of the invention can be reconstituted into liposomes for delivery to target cells.

The present invention furthermore relates to host cells transformed with a polynucleotide or vector of the invention. Said host cell may be a prokaryotic or eukaryotic cell; see supra. The polynucleotide or vector of the invention which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained extrachromosomally. In this respect, it is also to be understood that the recombinant DNA molecule of the invention can be used for "gene targeting" and/or "gene replacement", for restoring a mutant gene or for creating a mutant gene via homologous recombination; see for example Mouellic, Proc. Natl. Acad. Sci. USA, (1990) 4712-4716; Joyner, Gene Targeting, A Practical Approach, Oxford University Press.

The host cell can be any prokaryotic or eukaryofic cell, such as a bacterial, insect, fungal, plant, animal or human cell. Preferred fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S. cerevisiae. The term " prokaryotic" is meant to include all bacteria which can be transformed or transfected with a polynucleotide for the expression of a variant NBSl protein or fragment thereof. Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. A polynucleotide coding for a mutant form of NBSl variant proteins can be used to transform or transfect the host using any of the techniques commonly known to those of ordinary skill in the art. Methods for preparing fused, operably linked genes and expressing them in bacteria or animal cells are well-known in the art (Sambrook, supra). The genetic constructs and methods described therein can be utilized for expression of variant NBSl proteins in, e.g., prokaryotic hosts. In general, expression vectors containing promoter sequences which facilitate the efficient transcription of the inserted polynucleotide are used in connection with the host. The expression vector typically contains an origin of replication, a promoter, and a terminator, as well as specific genes which are capable of providing phenotypic selection of the transformed cells. The transformed prokaryotic hosts can be grown in fermentors and cultured according to techniques known in the art to achieve optimal cell growth. The proteins of the invention can then be isolated from the grown medium, cellular lysates, or cellular membrane fractions. The isolation and purification of the microbially or otherwise expressed polypeptides of the invention may be by any conventional means such as, for example, preparative chromatographic separations and immunological separations such as those involving the use of monoclonal or polyclonal antibodies.

Thus, in a further embodiment the invention relates to a method for the production of variant NBSl proteins and fragments thereof comprising culturing a host cell as defined above under conditions allowing the expression of the protein and recovering the produced protein or fragment from the culture. hi another embodiment the present invention relates to a method for producing cells capable of expressing a variant NBSl gene comprising genetically engineering cells with the polynucleotide or with the vector of the invention. The cells obtainable by the method of the invention can be used, for example, to test drugs according to the methods described in D. L. Spector, R. D. Goldman, L. A. Leinwand, Cells, a Lab manual, CSH Press 1998. Furthermore, the cells can be used to study known drugs and unknown derivatives thereof for their ability to complement the disorder (eg. predisposition to malignancy) caused by mutations in the NBSl gene. For these embodiments the host cells preferably lack a wild type allele, preferably both alleles of the NBSl gene and/or have at least one mutated from thereof. Alternatively, strong overexpression of a mutated allele over the normal allele and comparison with a recombinant cell line overexpressing the normal allele at a similar level may be used as a screening and analysis system. The cells obtainable by the above-described method may also be used for the screening methods referred to herein below.

Furthermore, the invention relates to a variant NBS 1 protein or fragments thereof encoded by a polynucleotide according to the invention or obtainable by the above described methods or from cells produced by the method described above. In this context it is also understood that the variant NBSl proteins according to the invention may be further modified by conventional methods known in the art. By providing the variant NBSl proteins according to the present invention it is also possible to determine the portions relevant for their biological activity or inhibition of the same, namely their participation in formation of proper hMREl l/hRAD50/NBSl nuclease complex.

The present invention furthermore relates to antibodies specifically recognizing a variant NBSl protein according to the invention. Advantageously, the antibody specifically recognizes an epitope containing one or more amino acid substitution(s) as defined above. Antibodies against the variant NBSl protein of the invention can be prepared by well known methods using a purified protein according to the invention or a (synthetic) fragment derived there from as an antigen. Monoclonal antibodies can be prepared, for example, by the techniques as originally described in Kohler and Milstein, Nature 256 (1975)7 495, and Galfrό, Meth. Enzymol. 73 (1981)9 3, which comprise the fusion of mouse myeloma cells to spleen cells derived from immunized mammals. The antibodies can be monoclonal antibodies, polyclonal antibodies or synthetic antibodies as well as fragments of antibodies, such as Fab, Fv or scFv fragments etc. Furthermore, antibodies or fragments thereof to the aforementioned polypeptides can be obtained by using methods which are described, e.g., in Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988.

These antibodies can be used, for example, for the immunoprecipitation and immuno localization of the variant NBSl proteins of the invention as well as for the monitoring of the presence of such variant NBS 1 proteins, for example, in recombinant organisms, and for the identification of compounds interacting with the proteins according to the invention. For example, surface plasmon resonance as employed in the BlAcore system can be used to increase the efficiency of phage antibodies which bind to an epitope of the protein of the invention (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183 (1 995) 1 7-1 3).

Furthermore, the present invention relates to nucleic acid molecules which represent or comprise the complementary strand of any of the above described polynucleotides or a part thereof, thus comprising at least one nucleotide difference compared to the corresponding wild type NBSl gene nucleotide sequences specified by the above described nucleotide substitutions, deletions and additions. Such a molecule may either be a deoxyribonucleic acid or a ribonucleic acid. Such molecules comprise, for example, antisense RNA. These molecules may furthermore be linked to sequences which when transcribed code for a ribozyme thereby producing a ribozyme which specifically cleaves transcripts of polynucleotides according to the invention.

Furthermore, the present invention relates to a vector comprising a nucleic acid molecule according to the invention. Examples for such vectors are described above. Preferably, the nucleic acid molecule present in the vector is operatively linked to regulatory elements permitting expression in prokaryotic or eukaryotic host cells; see supra. The present invention also relates to a method for the production of a transgenic nonhuman animal, preferably transgenic mouse, comprising introduction of a polynucleotide or vector of the invention into a germ cell, an embryonic cell, stem cell or an egg or a cell derived there from. The non-human animal can be used in accordance with the method of the invention described below and may be a nontransgenic healthy animal, or may have a disorder, preferably a disorder caused by at least one mutation in the NBSl gene. Such transgenic animals are well suited for, e.g., pharmacological studies of drugs in connection with variant forms of the above described variant NBSl proteins since these proteins or at least their functional domains are conserved between species in higher eukaryotes, particularly in mammals. Production of transgenic embryos and screening of those can be performed, e.g., as described by A. L. Joyner Ed., Gene Targeting, A Practical Approach (1993), Oxford University Press. The DNA of the embryos can be analyzed using, e.g., Southern blots with an appropriate probe.

The invention also relates to transgenic non-human animals such as transgenic mouse, rats, hamsters, dogs, monkeys, rabbits, pigs, C. elegans and fish such as torpedo fish comprising a polynucleotide or vector of the invention or obtained by the method described above, preferably wherein said polynucleotide or vector is stably integrated into the genome of said non-human animal, preferably such that the presence of said polynucleotide or vector leads to the expression of the variant MDRprotein of the invention. It may have one or several copies of the same or different polynucleotides of the variant NBSl gene. This animal has numerous utilities, including as a research model for malignancy process and therefore, presents a novel and valuable animal in the development of therapies, treatment, etc. for diseases caused by deficiency or failure of proper DNA damage repair in the cell. Accordingly, in this instance, the mammal is preferably a laboratory animal such as a mouse or rat.

Preferably, the transgenic non-human animal of the invention further comprises at least one inactivated wild type allele of the NBSl gene. This embodiment allows for example the study of the interaction of various variant forms of NBSl proteins. It might be also desirable to inactivate NBSl gene expression or function at a certain stage of development and/or life of the transgenic animal. This can be achieved by using, for example, tissue specific, developmental and/or cell regulated and/or inducible promoters which drive the expression of, e.g., an antisense or ribozyme directed against the RNA transcript of the NBSl gene; see also supra. A suitable inducible system is for example tetracycline-regulated gene expression as described, e.g., by Gossen and Bujard (Proc. Natl. Acad. Sci. 89 USA (1992) 5547-5551) and Gossen et al. (Trends Biotech. 12 (1994), 58-62). Similar, the expression of the variant NBSl gene may be controlled by such regulatory elements.

With the variant NBSl polynucleotides and proteins and vectors of the invention, it is now possible to study in vivo and in vitro the efficiency of DNA damage repair in relation to particular mutations in the NBSl gene.

Furthermore, the variant NBSl proteins of the invention can be used to determine the pharmacological profile of anticancer drugs and for the identification and preparation of further drugs which may be more effective for the treatment of cancer, in particular for the amelioration of certain phenotypes caused by the respective mutations such as those described above. In a further embodiment the present invention relates to a method of identifying and obtaining an NBSl modulator capable of modulating the activity of a molecular variant of the NBSl gene or its gene product comprising the steps of (a) contacting the protein of claim 8 or a cell expressing a molecular variant NBSl gene comprising a polynucleotide of claim 1 or 2 in the presence of components capable of providing a detectable signal in response to NBSl protein activity, with a compound to be screened under conditions to permit NBSl protein activity, and (b) detecting the presence or absence of a signal or increase of a signal generated from the NBSl protein activity, wherein the presence or increase of the signal is indicative for a putative modulator.

The term "compound" in a method of the invention includes a single substance or a plurality of substances which may or may not be identical.

Said compound(s) may be chemically synthesized or produced via microbial fermentation but can also be comprised in, for example, samples, e.g., cell extracts from, e.g., plants, animals or microorganisms. Furthermore, said compounds may be known in the art but hitherto not known to be useful as an inhibitor, respectively. The plurality of compounds may be, e.g., added to the culture medium or injected into a cell or non-human animal of the invention. If a sample containing (a) compound(s) is identified in the method of the invention, then it is either possible to isolate the compound from the original sample identified as containing the compound, in question or one can further subdivide the original sample, for example, if it consists of a plurality of different compounds, so as to reduce the number of different substances per sample and repeat the method with the subdivisions of the original sample. It can then be determined whether said sample or compound displays the desired properties, for example, by the methods described herein or in the literature (Spector et al., Cells manual; see supra).

Depending on the complexity of the samples, the steps described above can be performed several times, preferably until the sample identified according to the method of the invention only comprises a limited number of or only one substance(s).

Preferably said sample comprises substances of similar chemical and/or physical properties, and most preferably said substances are identical. The methods of the present invention can be easily performed and designed by the person skilled in the art, for example in accordance with other cell based assays described in the prior art or by using and modifying the methods as described herein. Furthermore, the person skilled in the art will readily recognize which further compounds and/or enzymes may be used in order to perform the methods of the invention, for example, enzymes, if necessary, that convert a certain compound into the precursor which in turn represents a substrate for the NBSl protein. Such adaptation of the method of the invention is well within the skill of the person skilled in the art and can be performed without undue experimentation.

Compounds which can be used in accordance with the present invention include peptides, proteins, nucleic acids, antibodies, small organic compounds, ligands, peptidomimetics, PNAs and the like. Methods for the preparation of chemical derivatives and analogues are well known to those skilled in the art and are described in, for example, Beilstein, Handbook of Organic Chemistry, Springer edition New York Inc., 175 Fifth Avenue, New York, N.Y. 10010 U.S.A. and Organic Synthesis, Wiley, New York, USA. Furthermore, said derivatives and analogues can be tested for their effects according to methods known in the art or as described. Furthermore, peptide mimetics and/or computer aided design of appropriate drug derivatives and analogues can be used, for example, according to the methods described below. Such analogs comprise molecules having as the basis structure of known MDR-substrates and/or inhibitors and/or modulators; see infra.

Appropriate computer programs can be used for the identification of interactive sites of a putative modulator/inhibitor and the NBSl protein of the invention by computer assistant searches for complementary structural motifs (Fassina, rmmunomethods 5 (1994), 114-120). Further appropriate computer systems for the computer aided design of protein and peptides are described in the prior art, for example, in Berry, Biochem. Soc. Trans. 22 (1994)7 1033-1036; Wodak, Ann. N. Y. Acad. Sci. 501 (1987)2 1-13; Pabo, Biochemistry 25 (1986), 5987. The results obtained from the above described computer analysis can be used in combination with the method of the invention for, e.g., optimizing known modulators/inhibitors. Appropriate peptidomirnetics and other inhibitors can also be identified by the synthesis of peptidornimetic combinatorial libraries through successive chemical modification and testing the resulting compounds, e.g., according to the methods described herein. Methods for the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Domer, Bioorg. Med. Chem. 4 (1996), 709 Furthermore, the three-dimensional and/or crystallographic structure of inhibitors and the NBSl protein of the invention can be used for the design of peptidomimetic drugs (Rose, Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4 (1996), 1545-1558). hi summary, the present invention provides methods for identifying and obtaining compounds which can be used in for the treatment/prevention of cancer. hi a further embodiment the present invention relates to a method of identifying and obtaining an NBSl modulator capable of modulating the activity of a molecular variant of the NBSl gene or its gene product comprising the steps of (a) contacting the protein of claim 8 with a first molecule known to be bound by NBSl protein to form a first complex of said protein and said first molecule; (b) contacting said first complex with a compound to be screened; and (c) measuring whether said compound displaces said first molecule from said first complex.

Advantageously, in said method said measuring step comprises measuring the formation of a second complex of said protein and said compound/modulator candidate.

Preferably, said measuring step comprises measuring the amount of said first molecule that is not bound to said protein.

Furthermore, it is preferred that in the method of the invention said first molecule is labeled, e.g., with a radioactive or fluorescent label.

In a still further embodiment the present invention relates to a method of diagnosing a increased inherited predisposition to cancer comprising (a) determining the presence of a polynucleotide of the invention in a sample from a subject; and/or (b) determining the presence of a variant form of NBSl protein, for example, with the antibody of the invention.

In accordance with this embodiment of the present invention, the method of testing the status of inherited predisposition to cancer can be effected by using a polynucleotide or a nucleic acid molecule of the invention, e.g., in the form of a Southern or Northern blot or in situ analysis. Said nucleic acid sequence may hybridize to a coding region of either of the genes or to a non- coding region, e.g. intron. In the case that a complementary sequence is employed in the method of the invention, said nucleic acid molecule can again be used in Northern blots. Additionally, said testing can be done in conjunction with an actual blocking, e.g., of the transcription of the gene and thus is expected to have therapeutic relevance. Furthermore, a primer or oligonucleotide can also be used for hybridizing to one of the above- mentioned NBSl genes or corresponding mRNAs. The nucleic acids used for hybridization can, of course, be conveniently labeled by incorporating or attaching, e.g., a radioactive or other marker. Such markers are well known in the art.

The labeling of said nucleic acid molecules can be effected by conventional methods. Additionally, the presence or expression of variant NBSl genes can be monitored by using a primer pair that specifically hybridizes to either of the corresponding nucleic acid sequences and by carrying out a PCR reaction according to standard procedures. Specific hybridization of the above mentioned probes or primers preferably occurs at stringent hybridization conditions. The term "stringent hybridization conditions" is well known in the art; see, for example, Sambrook et al., "Molecular Cloning, A Laboratory Manual" second ed., CSH Press, Cold Spring Harbor, 1989; "Nucleic Acid Hybridisation, A Practical Approach", Hames and Higgins eds., IRL Press, Oxford, 1985. Furthermore, the mRNA, cRNA, cDNA or genomic DNA obtained from the subject may be sequenced to identify mutations which may be characteristic fingerprints of mutations the NBSl gene. The present invention further comprises methods wherein such a fingerprint may be generated by RFLPs of DNA or RNA obtained from the subject, optionally the DNA or RNA may be amplified prior to analysis, the methods of which are well known in the art. RNA fingerprints may be performed by, for example, digesting an RNA sample obtained from the subject with a suitable RNA-Enzyme, for example RNase Tl, RNase T2 or the like or a ribozyme and, for example, electrophoretically separating and detecting the RNA fragments as described above.

Further modifications of the above-mentioned embodiment of the invention can be easily devised by the person skilled in the art, without any undue experimentation from this disclosure; see, e.g., the examples. An additional embodiment of the present invention relates to a method wherein said determination is effected by employing an antibody of the invention or fragment thereof. The antibody used in the method of the invention may be labeled with detectable tags such as a histidine flags or a biotin molecule. In a preferred embodiment of the present invention, the above described methods comprise PCR, ligase chain reaction, restriction digestion, direct sequencing, nucleic acid amplification techniques, microchips, hybridization techniques or immunoassays (Sambrook et al., loc. cit. CSH cloning, Harlow and Lane loc. cit. CSH antibodies).

In a preferred embodiment of the method of the present invention said cancer is c prostate cancer or invasive breast cancer of lobular subtype.

In a further embodiment of the above-described method, a further step comprising administering to a subject a medicament to abolish or alleviate said cancer. m a preferred embodiment of the method of the invention said medicament are chemotherapeutic agents such as adriamycin, doxorubicin, paclitaxol (taxol) and other MDR- substrates, Ambudkar SV. et al., Annu. Rev. Pharmacol. Toxicol. 39 (1999)9 361 In another preferred embodiment of the above-described methods, said method further comprises introducing (i) a functional and expressible wild type NBSl gene or (ii) a nucleotide acid molecule or vector of the invention into cells.

In this context and as used throughout this specification, "functional" NBSl gene means a gene wherein the encoded protein having part or all of the primary structural conformation of the wild type NBSl protein, i.e. possessing the biological property of participating in properly active hMREll/hRAD50/NBSl nuclease complex. This embodiment of the present invention is suited for therapy/prevention of cancer. Detection of the expression of a variant NBSl gene would allow the conclusion that said expression is interrelated to the predisposition or maintenance of a corresponding phenotype of the cancer. Accordingly, a step would be applied to reduce the expression level to low levels or abolish the same. This can be done, for example, by at least partial elimination of the expression of the mutant gene by biological means, for example, by the use of ribozymes, antisense nucleic acid molecules, intracellular antibodies or the above described inhibitors against the variant forms of these NBSl proteins.

Furthermore, pharmaceutical products may be developed that reduce the expression levels of the corresponding mutant proteins and genes.

In a further embodiment the invention relates to a method for the production of a pharmaceutical composition comprising the steps of any one of the above described methods and synthesizing and/or formulating the compound identified in step (b) or a derivative or homologue thereof in a pharmaceutically acceptable form. The therapeutically useful compounds identified according to the method of the invention may be formulated and administered to a patient as discussed above. For uses and therapeutic doses determined to be appropriate by one skilled in the art see infra.

Furthermore, the present invention relates to a method for the preparation of a pharmaceutical composition comprising the steps of the above-described methods; and formulating a drug or pro-drug in the form suitable for therapeutic application and preventing or ameliorating the disorder of the subject diagnosed in the method of the invention.

Drugs or pro-drugs after their in vivo administration are metabolized in order to be eliminated either by excretion or by metabolism to one or more active or inactive metabolites (Meyer, J. Pharmacokinet. Biopharm. 24 (1996), 449-459). Thus, rather than using the actual compound or inhibitor identified and obtained in accordance with the methods of the present invention a corresponding formulation as a pro-drug can be used which is converted into its active in the patient. Precautionary measures that may be taken for the application of pro-drugs and drugs are described in the literature; see, for review, Ozama, J. Toxicol. Sci. 21 (1996), 323-329). hi a preferred embodiment of the method of the present invention said drug or prodrug is a derivative of a medicament as defined hereinbefore.

In a still further embodiment the present invention relates to an inhibitor identified or obtained by the method described hereinbefore. Preferably, the inhibitor binds specifically to the variant NBSl protein of the invention. The antibodies, nucleic acid molecules and inhibitors of the present invention preferably have a specificity at least substantially identical to binding specificity of the natural ligand or binding partner of the NBSl protein of the invention. An antibody or inhibitor can have a binding affinity to the NBSl protein of the invention of at least

10⁵ M^"1, preferably higher than 10⁷ M^'1 and advantageously up to 10¹⁰ M^"1 in case NBSl activity should be repressed. Hence, in a preferred embodiment, a suppressive antibody or inhibitor of the invention has an affinity of at least about 10^"7 M, preferably at least about 10^"9 M and most preferably at last about ICT¹¹ M.

Furthermore, the present invention relates to the use of an oligo- or polynucleotide for the detection of a polynucleotide of the invention and/or for genotyping of corresponding individual NBSl alleles. Preferably, said oligo- or polynucleotide is a polynucleotide or a nucleic acid molecule of the invention described before.

In a particular preferred embodiment said oligonucleotide is about 10 to 100, more preferably

15 to 50 nucleotides in length comprises the nucleotide sequence included in any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NOs: 5 - 12, or a complementary sequence of any one of those. Hence, in a still further embodiment, the present invention relates to a primer or probe consisting of an oligonucleotide as defined above. In this context, the term "consisting of means that the nucleotide sequence described above and employed for the primer or probe of the invention does not have any further nucleotide sequences of the NBSl gene immediately adjacent at its 5' and/or 3' end. However, other moieties such as labels, e.g., biotin molecules, histiclin flags, antibody fragments, colloidal gold, etc. as well as nucleotide sequences which do not correspond to the NBSl gene may be present in the primer and probes of the present invention. Furthermore, it is also possible to use the above described particular nucleotide sequences and to combine them with other nucleotide sequences derived from the NBSl gene wherein these additional nucleotide sequences are interspersed with moieties other than nucleic acids or wherein the nucleic acid does not correspond to nucleotide sequences of the NBSl gene, hi addition, the present invention relates to the use of an antibody or a substance capable of binding specifically to the gene product of an NBSl gene for the detection of the variant NBSl protein of the invention, the expression of a molecular variant NBSl gene comprising a polynucleotide of the invention and/or for distinguishing NBSl alleles comprising a polynucleotide of the invention.

Moreover, the present invention relates to a composition, preferably pharmaceutical composition comprising the antibody, the nucleic acid molecule, the vector or the inhibitor of the present invention, and optionally a pharmaceutically acceptable carrier. These pharmaceutical compositions comprising, e.g., the inhibitor or pharmaceutically acceptable salts thereof may conveniently be administered by any of the routes conventionally used for drug administration, for instance, orally, topically, parenterally or by inhalation. Acceptable salts comprise acetate, methylester, HCI, sulfate, chloride and the like. The compounds may be administered in conventional dosage forms prepared by combining the drugs with standard pharmaceutical carriers according to conventional procedures. These procedures may involve mixing, granulating and compressing or dissolving the ingredients as appropriate to the desired preparation. It will be appreciated that the form and character of the pharmaceutically acceptable character or diluent is dictated by the amount of active ingredient with which it is to be combined, the route of administration and other well-known variables. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. The pharmaceutical carrier employed may be, for example, either a solid or liquid. Exemplary of solid carriers are lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, stearic acid and the like. Exemplary of liquid carriers are phosphate buffered saline solution, syrup, oil such as peanut oil and olive oil, water, enulsions, various types of wetting agents, sterile solutions and the like. Similarly, the carrier or diluent may include time delay material well known to the art, such as glyceryl mono-stearate or glyceryl distearate alone or with a wax.

The dosage regimen will be determined by the attending physician and other clinical factors; preferably in accordance with any one of the above described methods. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drags being administered concurrently. Progress can be monitored by periodic assessment.

Furthermore, the use of pharmaceutical compositions which comprise antisenseoligonucleotides which specifically hybridize to RNA encoding mutated versions of a NBSl gene according to the invention or which comprise antibodies specifically recognizing mutated NBSl protein but not or not substantially the functional wildtype form is conceivable in cases in which the concentration of the mutated form in the cells should be reduced.

Furthermore, the present invention relates to a diagnostic composition or kit comprising any one of the afore-described polynucleotides, vectors, host cells, variant NBSl proteins, antibodies, inhibitors, nucleic acid molecules or the corresponding vectors of the invention, and optionally suitable means for detection.

The kit of the invention may contain further ingredients such as selection markers and components for selective media suitable for the generation of transgenic cells and animals. The kit of the invention may advantageously be used for carrying out a method of the invention and could be, inter alia, employed in a variety of applications, e.g., in the diagnostic field or as research tool. The parts of the kit of the invention can be packaged individually in vials or in combination in containers or multicontainer units. Manufacture of the kit follows preferably standard procedures which are known to the person skilled in the art. The kit or diagnostic compositions may be used for methods for detecting expression of a mutant form of NBSl gene in accordance with any one of the above-described methods of the invention, employing, for example, immuno assay techniques such as radioimmunoassay or enzymeimmunoassay or preferably nucleic acid hybridization and/or amplification techniques such as those described herein before and in the examples or microchip techniques. Some genetic changes lead to altered protein conformational states. Restoring the normal or regulated conformation of mutated proteins is the most elegant and specific means to correct these molecular defects, although it is difficult. Pharmacological manipulations thus may aim at restoration of wild-type conformation of the protein. Thus, the polynucleotides and encoded proteins of the present invention may also be used to design and/or identify molecules which are capable of activating the wild-type function of a NBSl gene or protein. hi another embodiment the present invention relates to the use of a drug or prodrug for the preparation of a pharmaceutical composition for the treatment or prevention of a disorder diagnosed by the method described hereinbefore.

Furthermore, the present invention relates to the use of an effective dose of a nucleic acid sequence encoding a functional and expressible wild type NBSl protein for the preparation of a pharmaceutical composition for treating, preventing and/or delaying a disorder diagnosed by the method of the invention. A gene encoding a functional and expressible NBSl protein can be introduced into the cells which in turn produce the protein of interest. Gene therapy, which is based on introducing therapeutic genes into cells by ex- vivo or in- vivo techniques is one of the most important applications of gene transfer. Suitable vectors and methods for in- vitro or in- vivo gene therapy are described in the literature and are known to the person skilled in the art; see, e.g., Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res. (1996), 911-919; Anderson, Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res. 77 (1995), 1077-1086; Wang, Nature Medicine 2 (1996), 714-716; WO94/29469; WO 97/00957 or Schaper, Current Opinion in Biotechnology 7 (1996)3 635-640, and references cited therein. The gene may be designed for direct introduction or for introduction via liposomes, or viral vectors (e.g. adenoviral, retroviral) into the cell. Preferably, said cell is a germ line cell, embryonic cell, or egg cell or derived therefrom, most preferably said cell is a stem cell. As is evident from the above, it is preferred that in the use of the invention the nucleic acid sequence is operatively linked to regulatory elements allowing for the expression and/or targeting of the NBSl protein to specific cells. Suitable gene delivery systems that can be employed in accordance with the invention may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes viruses, retroviruses, adenoviruses, and adeno-associated viruses, among others. Delivery of nucleic acids to a specific site in the body for gene therapy may also be accomplished using a biolistic delivery system, such as that described by Williams (Proc. Nati. Acad. Sci. USA 88 (1991), 2726-2729). Standard methods for transfecting cells with recombinant DNA are well known to those skilled in the art of molecular biology, see, e.g., WO 94/29469; see also supra. Gene therapy may be carried out by directly administering the recombinant DNA molecule or vector of the invention to a patient or by transfecting cells with the polynucleotide or vector of the invention ex vivo and infusing the transfected cells into the patient.

In a preferred embodiment of the uses and methods of the invention, said disorder is cancer as mentioned above.

Further applications of the polymorphisms described with the present invention and means and methods that can be used in accordance with the above described embodiments can be found in the prior art, for example, as described in US-A-5,856,104, wherein the there described means and methods for forensics, Paternity testing, correlation of polymorphisms with phenotypic traits, genetic mapping of phenotypic traits, etc. can be equally applied in accordance with the present invention.

Further, the present invention provides a method for detecting a predisposition to prostate cancer in a subject, including detecting in a biological sample from the subject an alteration in the sequence of a NBSl gene, wherein the alteration is indicative of a predisposition to prostate cancer. The subject may be a human, e.g., of Slavic origin.

The present invention also provides a method for detecting a predisposition to breast cancer in a subject, including detecting in a biological sample from the subject an alteration in the sequence of a NBSl gene, wherein the alteration is indicative of a predisposition to breast cancer. In some embodiments of the invention, the breast cancer is invasive breast cancer of the lobular subtype. The subject may be a human, e.g., of Slavic origin. hi some embodiments of the invention, the alteration is a germline alteration, e.g., 657del5. The alteration may be present in the sequence of a single allele of the NBSl gene, or the alteration may be present in the sequence of two alleles of the NBSl gene. The alteration may be a mutation in the NBSl gene, e.g., a mutation caused an insertion into the gene, a deletion of the gene, or a change of nucleotide(s) in the gene. In some embodiments, the alteration in the gene affects, e.g. inhibits, the production of protein encoded by the NBSl gene. The alteration may result in the production of a different, e.g. a truncated, protein in comparison to the protein that would be produced by the NBSl gene. Such a protein may not possess the functional capabilities possessed by the protein encoded by the NBSl gene. In some embodiments, the alteration can be detected by ASO PCR, SSCP, direct sequencing, microchips, ASA, or RFLP-PCR. The predisposition may be an inherited predisposition. In some embodiments, the biological sample may be a tissue sample such as blood, and the biological sample may include leukocytes. In some embodiments of the invention, the breast cancer is invasive breast cancer of the lobular subtype.

The present invention further provides a diagnostic kit for identifying a predisposition to breast cancer or prostate cancer in a subject, including packaging material and at least two different polynucleotides capable of amplifying at least a region of a NBSl gene. In some embodiments of the invention, the amplified region, includes mutation 657del5. hi some embodiments of the invention, the kit may contain polynucleotides Nbsexόf, Nbsexόr and Nbsdel5. The kit may also contain instructions, e.g., instructions for using the kit to identify a predisposition to breast cancer or prostate cancer in a subject.

The methods and kits provided herein are useful for determining a predisposition for cancers such as prostate and lobular invasive breast cancer, and they are also useful for diagnosing cancers such as prostate and breast cancers at earliest clinical stages.

An alteration in the NBSl gene, e.g., the 657del5 alteration, may be detected by any assay available to the art worker that is capable of detecting an alteration, e.g., using nucleotide extension assays, sequencing assays, hybridization assays, and/or amplification assays. An alteration may be detected by performing assays on any form of DNA or RNA obtained from the subject. For example, the art worker could identify an alteration using allele-specific oligonucleotide-PCR (ASO PCR), assays to detect single-stranded conformation polymorphism (SSCP), direct sequencing, allele-specific amplification (ASA), allele-specific hybridization (ASH), and/or restriction fragment length polymorphism analysis after PCR amplification (RFLP-PCR). Hybridization conditions may be performed under various conditions selected by the art worker. Some examples are described hereinbelow.

"Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of polynucleotide hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 138:267 (1984); Tm 81.5 C + 16.6 (log M) +0.41 (%GC) 0.61 (% form) 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is reduced by about I⁰C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 1O⁰C. Generally, stringent conditions are selected to be about 5⁰C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4⁰C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10⁰C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20⁰C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired T, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T of less than 45°C (aqueous solution) or 32⁰C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of polynucleotides is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid Probes, part I chapter 2 "Overview of principles of hybridization and the strategy of polynucleotide probe assays" Elsevier, New York (1993). Generally, highly stringent hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.

An example of highly stringent wash conditions is 0.15 M NaCl at 72⁰C for about 15 minutes. An example of stringent wash conditions is a 0.2X SSC wash at 65⁰C for 15 minutes (see, Molecular Cloning: A Laboratory Manual; Sambrook et al., 3rd Ed., Cold Spring Harbor Laboratory Press, (2001) for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is IX SSC at 45⁰C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4 - 6X SSC at 4O⁰C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 3O⁰C and at least about 6O⁰C for long probes (e.g., >50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Polynucleotides that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a polynucleotide is created using the maximum codon degeneracy permitted by the genetic code.

Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65⁰C. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, IM NaCl, 1% SDS (sodium dodecyl sulphate) at 37⁰C, and a wash in IX to 2X SSC (2OX SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37⁰C, and a wash in 0.5X to IX SSC at 55 to 6O⁰C.

Several polynucleotides are described here that are useful for detecting the alterations, and the art worker in would be able to design other polynucleotides that would be useful in detecting the alteration. Thus the present invention also provides polynucleotides comprising, consisting essentially of, or consisting of any of SEQ ID NOs 6-12.

Human tumors are often associated with genomic instability, and the DNA damage signaling pathway has a crucial role in maintaining of the integrity of genome in response to DNA damaging factors. This pathway may play an important role in pathogenesis of prostate cancer. DNA damage signaling is disrupted by mutations causing human chromosomal breakage syndromes such as Nijmegen syndrome (NBS), Bloom syndrome, Fanconi anaemia and ataxia telangiectasia (AT), which are characterized by spontaneous^* chromosomal instability, immunodeficiency, and a predisposition to cancer (Digweed, 1993; and Futaki et al., 2001). The Nijmegen breakage syndrome gene NBSl was mapped to chromosome 8q21 and cloned (see Varon et al., 1998; U.S. Patent No. 6,458,534; and Genbank, Accession AB013139). The product of the NBS 1 gene, nibrin (also referred to as p95) is an integral component of the hMREll/hRAD50/NBSl nuclease complex, which is a part of BRCAl-asociated genome surveillance complex (BASC) responsible for DNA damage repair (Futaki et al, 2001). A truncating 5 bp deletion in exon 6 of the NBSl gene was detected in the vast majority of NBS patients. Most of the reported NBS patients are of the Slavic origin and carry a major 657del5 founder mutation. This mutation is present with an unexpectedly high earner frequency in Poland, Ukraine, and the Czech Republic (Varon et al., 2000). The role of NBSl gene in prostate and lobular invasive breast cancer development has not yet been investigated.

As described herein, NBSl appears to act as a classical tumor suppressor gene because biallelic NBSl inactivation was observed in most tumors. However, some degree of haploinsufficiency and possible dominant-negative effect of NBSl mutations are not ruled out because it has not been established that NBSl heterozygous cells have impaired DNA repair capacity. The NBSl founder allele is predicted to result in a truncated protein of 219 of 754 amino acids (ρ26). p26 lacks crucial domain necessary for MREI l interaction. It is not known whether this mutant protein possesses any residual activity or exerts a dominant-negative effect. However, the 657del5 allele also creates an aberrant translation initiation site, which generates a partially functional variant of the NBSl protein (ρ70). p70 contains the MREl 1 binding domain but does not confer full function within the MREIl complex. In light of this, it is possible that p70 may produce a dominant-negative effect.

Furthermore, the present invention relates to the use of a germline alteration in the sequence of the NBSl gene for identification of inherited predisposition to prostate cancer or invasive breast cancer of lobular subtype by human subject. Preferably, said germline alteration is mutation 657del5, and investigated human subject is person of Slavic origin. Presence of the germline alteration may be detected by at least one method selected among ASO PCR, SSCP, microchips, direct sequencing, ASA, RFLP-PCR.

Furthermore, the present invention relates to the diagnostic kit for identification of inherited predisposition to prostate cancer or invasive breast cancer of lobular subtype by method based on PCR, which comprises at least two different oligos allowing amplification of the region including of a germline alteration in the sequence of the NBSl gene, wherein possibly the amplified region includes mutation 657del5. Preferably, said kit comprises primers Nbsexόf, Nbsexόr and Nbsdel5. The present invention relates also to protocol for early detection of breast cancer distinct from regular standards due to occurrence of NBS 1 germline mutation. These and other embodiments are disclosed or are obvious from and encompassed by the description and examples of the present invention. Further literature concerning any one of the methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries, using for example electronic devices and databases available on Internet.

The pharmaceutical and diagnostic compositions, uses, methods of the invention can be used for the diagnosis and treatment of all kinds of diseases hitherto unknown as being related to or dependent on variant TVBiSi genes. The compositions, methods and uses of the present invention may be desirably employed in humans, although animal treatment is also encompassed by the methods and uses described herein. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 depicts a LOH analysis in microdissected PC tissues from the proband of family 8 (lines 1-5) and the proband of family 9 (lines lb-5b) using the markers adjacent to NBSl gene (linesl-3 and lb-3b) and using exonβ-specific PCR (lines 4- 5, 4b-5b). Loss of the wild type allele in cancer tissue is shown by arrows. Dots point at allele with the NBS 1 founder mutation.

Figure 2 depicts a pedigree of families with NBSl mutation. Segregation of NBSl mutation with prostate cancer is shown in families 8, 9 11, 12. The individual's age is indicated at the right side of each cancer. A dot (•) at the lower right corner indicated that a blood sample was analyzed. An plus (+) at the upper right corner of the symbol indicates the presence of the NBSl founder mutation, and a minus (-) shows mutation negative relatives. Arrows point at probands. Completely blackened symbols denote patients with cancer for whom pathology records were available; ³Λ blackened symbols indicate patients with cancer for whom histopathology were unavailable; The cancer type is shown underneath each symbol. Additional family A, diagnosed in Hereditary Cancer Center in Szczecin, does not belong to groups of consecutive PC cases.

Figure 3 depicts a fragment of the genomic sequence of NBSl gene, including exon 6. The sequence of exon 6 is shown in bold, and the 657del5 mutation is shown in italics, (also, see Genbank, Accession Number AB013139; Matsuura et al, 1998)).

The invention will now be described by reference to the following biological examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention. Example 1. Establishing the correlation between the germline alteration in the sequence of the NBSl gene and inherited predisposition to prostate cancer or breast cancer on example of analysis of 657 del5 founder mutation in the NBSl gene. The association between 657del5 and prostate cancer. Patients

Cases suspected of prostate cancer are admitted to Clinics of Urology in Szczecin. Criteria of suspicion of prostate cancer are: elevated PSA level above 4,0 ng/ml or abnormal findings in per recum examination. Prostate cancer is diagnosed in the Clinics on the basis of USG-guided DRECUT biopsy performed in the suspected cases. Biopsy tissues, stained using standard procedures, were evaluated by pathologists in Department of Genetics and Pathology in Szczecin. Final diagnosis was confirmed one pathologist - prof. Jan Lubiήski.

All 359 men diagnosed with prostate cancer at the University Hospital in Szczecin, Poland between 1999 and 2002 were invited to participate in this study. Of these, 340 (95%) agreed to participate. All cases were recruited within six months of the date of diagnosis. Family histories of cancer were obtained from each subject. Thirty-five patients (10.3%) had one or more first- or second-degree relative with prostate cancer (familial cases). We also included a second set of 21 familial cases of prostate cancer from men who were referred for evaluation at the Hereditary Cancer Center by family doctors or urologists because of familial aggregation of prostate cancers. In total there were 56 familial cases and 305 nonfamilial cases. The familial cases from the incident sample contained, on average, 2.1 cases of prostate cancer (mean age of onset 67.3 years) and the familial cases from the Hereditary Cancer Center sample contained 2.6 cases of prostate cancer (mean age of onset 63.3 years). There were 1500 unaffected controls. One thousand controls were selected at random from the computerized patient lists of three family practices in Szczecin (508 females and 492 males; age range 26 to 89 years). In addition, a second control group of 500 unselected newborns from Szczecin for whom a sample of umbilical cord blood samples was available was included. Figure 2 depicts the pedigree of families with a NBSl mutation.

The association between 657del5 and breast cancer of lobular subtype Patients

Studied group included 2012 unselected women with breast cancer. Breast cancer cases were recruited from 8 hospitals throughout Poland (Table 1). Patients were consecutively ascertained from the pathology departments of the treating hospitals. Only primary invasive breast cancer cases were included (cases of DCIS and LCIS were excluded). Patients were collected between 2002 and 2003. Two thousand controls from the general population were used for the study of the association between the NBSl founder allele and breast cancer (1000 unselected adults from Szczecin and 1000 newborn children in 2003 form six hospitals throughout Poland (Szczecin, Bialystok, Gorzόw, Katowice and Wroclaw). The aim of the control group was to estimate the NBSl 657 del5 frequency in the general population.

Table 1. Prevalence of mutant NBSl founder allele among breast cancer patients in eight regions of Poland

Example 2. Detection of 657del5 mutation in the NBSl gene

We used ASO-PCR and sequencing for detection of NBSl founder mutation in DNA isolated from peripheral blood leukocytes.

Five ml peripheral blood was obtained and mixed with 100 μl IM EDTA, then was centrifuged in 50 ml polypropylene tubes by 10 minutes at 3000g in 4⁰C. Serum in upper faze was removed, and pellet containing cells was mixed with 45 ml buffer 2X (0,1M NH₄Cl , 0,25M KHCO₃, ImM EDTA) and was left for 15 minutes in 4⁰C. Then mixture was centrifuged at 3000g for 10 minutes in 4⁰C. Supernatant was removed after centrifugation. The remaining pellet with leukocytes was suspended in 2X buffer and centrifuged 10 minutes at 3000g in 4⁰C. This purification of leukocytes in 2X buffer and centrifugation was repeated three times until pure leukocyte pellet was obtained. Then leukocytes were mixed with 3ml digestion buffer (5OmM NaCl, 25mM MgCl₂, ImM EDTA; pH 8.0) with 200 μl 10% SDS and 500 μg Proteinase K. Digestion was carried out 24h in 37⁰C.

DNA was purified using phenol/chloroform. In brief, digestion products was mixed with 3ml phenol buffered 0,5M Tris HCl (pH 8,4), and then 3ml chloroform and isoamyl alcohol mixture (mixed in proportion 1:25 vol/vol). Mixture was agitated for about 1 minute and centrifuged 10 minutes at 800Og in 2O⁰C. After centrifugation upper faze was replaced to new tube, and mixed with equal volume of chloroform and thereafter centrifuged 10 minutes at 8000g. The described above purification with chloroform was repeated 3-times until protein ring in interfaze had disappeared.

The purified water faze containing DNA was mixed with 5M NaCl in proportion 10:1 (vol/vol) and 96% ethanol in the proportion of water faze with NaCl to ethanol 1 :10 (vol/vol). Mixture was left overnight in 2O⁰C. The resultant DNA pellet was placed in a new tube and purified with 70% ethanol, centrifuged at 300Og for 5 minutes, and ethanol was poured out. Then purified DNA pellet was dried in open tube for 30 minutes at 37⁰C. DNA resuspended in 400 μl TE buffer (25mM Tris HCl, ImM EDTA; pH 8.4) was stored in 4⁰C until use. Allele specific - PCR (ASO-PCR)

ASO-PCR reaction was carried out in DNA ThermalCycler 9600 (Perkin Elmer) in Volume of 25 μl included: 1 μl (50ng) genomic DNA, 4 pmol Nbsexόf primer, 6 pmol Nbsex6r primer, 10 pmol Nbsdel5 primer, 2.5 μl PCR buffer (10OmM Tris-HCl, 50OmM KCL, 15mM MgCl₂, lmg/ml gelatin; pH 8.6), 200 μM each dATP, dCTP, dGTP i dTTP and 1 U Taq DNA polymerase, hi each reaction 2 positive controls (controls with DNA from NBS 1 heterozygote and NBSl homozygote) and 2 negative controls (control DNA from NBSl mutation negative patient and control without DNA) were used. ASO-PCR conditions: a) Initial denaturation - 95⁰C 5 minutes b) 11 cycles , each of: denaturation - 94⁰C 30 s primer annealing — 62 to 56⁰C 30 s * primer elongation - 72⁰C 30s c) 30 cycles, each of: denaturation - 94⁰C 30 s primer annealing - 56⁰C 30 s primer elongation - 72⁰C 30 s

* - during first 11 cycles primer annealing temperature was lowered by 0,6⁰C in each cycle beginning from 62⁰C in the first one and ending to 56⁰C in the 11^th cycle (in detail: 1^st cycle - 62⁰C, 2^nd - 61,4⁰C, 3^rd - 60,8⁰C, 4^th - 60,2⁰C, 5^th -59,6⁰C, 6^th - 59⁰C, 7^th -58,4⁰C, 8^th - 57,8⁰C₅ 9^th - 57,2⁰C, 10^th - 56,6⁰C, 11^th - 56⁰C) Sequence of primers used in ASO-PCR: Nbsexόf, 5' CACCTCTTGATGAACCATCT (SEQ ID NO:6) Nbsexόr, 5' CGTTAACAACTACTGATAAGAG (SEQ E) NO:7)

Nbsdel5, 5' GGACGGCAGGAAAGAAATCTT ( 657del5 specific primer) (SEQ ID N0:8) 5 μl of PCR products was mixed with 10 μl loading buffer and was electrophoresed in agarose gel (1,5% agarose gel(SeaKem FMC), IX bufor TBE, 25 μg/ml bromku etydyny) at 6V/cm for 30 minutes. Separated products were visualized in UV light. All cases, in which additional, shorter PCR product was observed, were sequenced in order to confirm the presence of NBSl founder mutation. Sequencing Template PCR

Exon 6 of the NBSl gene was amplified with Nbsexόf i Nbsexβr primers in conditions as described in ASO-PCR with the only difference - in template PCR Nbsdel5 primer was not used. Purification of PCR products

Products of amplification of exon 6 was pippeted in Microcon-100 sample reservoir (Amicon) placed into vial, 400 μl dH₂O was added to the reservoir and were centrifuged at 185Og for 15 minutes. After centrifugation sample reservoir was inserted into a new vial, filled with 400 μl dH₂O and centrifuged at 1850g for 15 minutes. The latter was repeated 3-times. Sample reservoir was placed upside down in a new vial and then spinned 3 minutes at 900Og. All spins were carried out at 25⁰C. About 5 μl of purified PCR product was seen in the vial and it was diluted in 20 μl dH₂O. Sequencing PCR

Asymmetric sequencing PCR was performed in Gene Amp PCR System 9600 thermocycler (Perkin Elmer) in volume of 20 μl containing: 1 pmol Nbsexlόf primer, 4 μl purified PCR product, 8 μl BigDye Terminator Ready Reaction Kit v3.0 (Applied Biosystems). In addition, sequencing reaction with Nbsdelδr primer was carried to confirm results with the forward primer.

Sequencing conditions: Initial denaturation - 96⁰C 30s 30 cycles, each of: denaturation - 94⁰C 30 s primer annealing - 56⁰C 30 s primer elongation - 72⁰C 30 s

20 μl of sequencing product were placed into 0,5 ml Eppendorf tube, 60 μl 96% ethanol and 2μl 3M sodium citrate (pH 4,6) was added. Probes were centrifuged 20 minutes at 3 00Og in 25⁰C. Then supernatant was removed and 200μl 70% ethanol was added to purify the pellet. After 5 minute centrifugation in 3000g at 25⁰C supernatant was removed. The pellet was dried in Eppendorf Concentrator 5301 for 20 - 30 min, and then resuspended in 4 μl of loading buffer (150 μl deionized formamide, 50 μl 5OmM EDTA, 0.05% Dextran Blue). Samples were denaturated for 4 minutes at 94⁰C, put on ice, and loaded onto denaturating polyacrylamide gel (4% 19:1 polyacrylamide gel, Ix TBE, 6M urea). Electrophoresis was carried our in ABI PRISM 377 DNA Sequencer (Applied Biosystems). Data collection and analysis was performed using ABI PRISM 377 Collection Software and Sequencing Analysis Software Version 3.0 (Applied Biosystems).

Example 3. Loss of heterozygosity analysis (LOH) in prostate and breast cancers Microdissection and DNA isolation

To analyze if NBSl wild type allele is lost in prostate cancer and breast cancer, we carried out LOH analysis in microdissected tumors from NBSl mutation carriers - 9 prostate cancer and 5 breast cancer tumors. LOH was carried out using markers adjacent to NBSl gene - D8S88, D8S1811, and fluorescently labeled NBSl exon6-specific primers (9).

Five micron sections of formalin-fixed, paraffin embedded tissues were cut onto slides. From each patient, tissues were sectioned onto 6 slides. One was hematoxylin/eosin stained. The remaining were used for microdissection. Sections were deparaffinized in two changes of xylene for 5 minutes. Sections were hydrated through a series of graded alcohols (in 96% ethanol (2- times), 70% ethanol and dH₂O in each for 5 minutes). The slides were stained in hematoxilin. Using light microscope the homogenous fields of cancer cells were chosen in HE stained sections. Those fields was carefully microdissected using needle from slides stained with hematoxilin only under light microscope avoiding contamination with nonmalignant cells. Microdissected tissues were put into 1,5 ml Eppendorf tubes, hi parallel, normal tissues were cut out from the same slides and put into separate tubes.

Then, microdissected tissues were digested in 1 ml digestion buffer (5OmM TrisHCl, ImM CaCl₂, pH 8.0) with 20 μl 10% SDS and 500 μg proteinase K. hi each series negative cotrols without tissue were used. Enzymatic digestion was carried out in 55⁰C for 2 weeks. At 3^rd and 6^th day of digestion additional 100 μg proteinaze K was added. After digestion, proteinase was heat inactivated at 96⁰C for 10 minutes. 500 μl of digestion product was purified in Microcon-100 tubes (Amicon) according to described above procedure. After purification, about 5 μl of solution containing DNA was diluted in 50 μl dH₂O. LOH analysis LOH analysis was performed in 3 PCR reactions with fluorescent primers:

1) PCRl with primers D8S88f - 5' TCCAGCAGAGAAAGGGTTAT (SEQ ID NO:9); D8S88r - 5' GGCAAAGAGAACTCATCAGA (SEQ ID NO: 10)

2) PCR2 with primers D8S1811f - 5' CCCACCCCCAAAATGC (SEQ ID NO:11); D8S1811r - 5' GGGTTTAGGGAAGTGCAGAA (SEQ ID NO: 12).

3) PCR3 with primers Nbsexόf and Nbsexόr flanking NBS 1 exon 6 containing 657del5.

PCR reaction was carried out in DNA ThermalCycler 9600 (Perkin Elmer) in volume of 25 μl which included: 4 μl DNA isolated from tissues, 2.5 μl PCR buffer (10OmM Tris-HCl, 50OmM KCL, 15mM MgCl₂, lmg/ml gelatin; pH 8.6), 200 μM each dATP, dCTP, dGTP i dTTP, 1 U Taq DNA Polymerase and 10 μg bovine serum albumin (BSA - Fermentas). PCR 1 mixture included additionally 5 pmol D8S88f and D8S88r primers, PCR2 - 5 pmol D8S1811f and D8S 181 Ir primers, PCR3 - 5 pmol Nbsex6f and Nbsexόr primers. In each PCR reaction positive and negative controls were used. PCR conditions: c) Initial denaturation - 95⁰C 5 minutes d) 42 cycles , each of: denaturation - 94⁰C 30 s primer annealing -56⁰C 30 s primer elongation - 72⁰C 30s

One μl of PCR product was diluted in 10 μl loading buffer (150 μl formamid, 50 μl 5OmM EDTA, 0.05% Dextran Blue). After denaturation for 4 minutes at 94⁰C samples were put into ice and loaded onto denaturating polyacrylamide gel (4% 19:1 polyacrylamide gel, Ix TBE, 6M urea). Electrophoresis was carried our in ABI PRISM 377 DNA Sequencer (Applied Biosystems). Data collection and analysis was performed using ABI PRISM 377 Collection Software and GenScan Analysis Software Version 3.0 (Applied Biosystems). A signal reduction in one allele of at least 70 % was taken as the threshold of recognition for LOH. Statistical analysis was performed using Ch-square test.

The NBSl mutation was present in nine of 340 unselected prostate cancer cases (2.6%), compared to only nine of 1500 (0.6%) control individuals from the general population (odds ratio 4.5; 95%CI 1.7 to 11.5; p=0.002). The 657del5 germline mutation was present in five of the 56 (9%) familial cases (odds ratio = 16; 95% CI = 5.2 to 50; p < 0.0001). We investigated the segregation of the NBSl mutant allele with prostate cancer in four families. We were able to establish the mutation status in two affected males from each family. In each family the NBSl mutation was present in both affected members.

The 657 del5 allele was found in 17 (0.8%) of 2012 consecutive breast cancers, compared to 8 in 2000 controls (odds ratio 1.9; 95% CI = 0.8 to 4.2, p=0.17). Paraffin embedded tissues were obtained from 12 breast tumors form NBSl mutation carriers. The type of these tumors was verified by two pathologists after H&E and immunohistochemical staining. Nine of 12 breast cancers were large cell infiltrating lobular carcinomas (see Table 2). H&E sections were available from 491 out of 2012 studied cases. All of them were from one center: a regional oncology hospital in Szczecin. Two pathologist established the breast cancer subtype in all 491 cases. Lobular carcinomas were diagnosed in 53 of the 491 breast consecutive cancers. Of these 53 breast cancer patients, NBSl mutations were detected in 4 (7.5%) cases (OR 18.4, 95%CI 5.5 - 62, p<0.0001). Thus, the NBSl mutation is associated with large cell infiltrating lobular carcinoma or the breast.

Table 2. Histopathological data of carriers of 657del5 alteration among woman with breast cancer

Loss of the wild type NBSl allele was observed in 7 of 8 prostate cancers (fig. 1) and 5 of 5 breast cancers. The data on the loss of heterozygosity suggest that NBSl functions as a classical tumor suppressor gene. Loss of heterozygosity at NBSl locus has also been shown in ovarian cancers and malignant melanoma (8, 10). Clinically, the Nijmegen breakage syndrome is a recessive genetic condition. The heterozygote state may not be deleterious at the cellular level but loss of heterozygosity renders cells hemizygous for the mutant allele. Cultured cells homozygous for the NBSl mutation are prone to chromosomal aberrations (10).

The NBSl founder allele appears to be responsible for about one in 11 families with two or more cases of prostate cancer in Poland. Based on a relative risk of 4.5 and a mutation prevalence of 1 in 167, we estimate that the gene is responsible for about 2% of prostate cancers in this country. We did not observe statistically significant excess of the NBSl founder allele in women with unselected breast cancer. However 657 del5 was associated with increased risk of lobular breast carcinoma (OR 18.4, p<0.0001). Given the geographic distribution of reported clinical cases of the Nijmegen breakage syndrome, the 657del5 mutation may also be an important contributor to prostate and lobular breast cancer in patients of Slavic origin from other countries (the 657del5 allele is responsible for all cases of the Nijmegen breakage syndrome in all Slavic populations reported to date).

Thus, diagnosis of these cancers, especially in this ethnic group, may be facilitated by using the simple ASO-PCR assay for the major NBSl founder mutation. Diagnosis of prostate and breast cancers in other non-Slavic populations may also be similarly facilitated.

The risk for prostate cancer is about 3% in Polish population with 40 million people. Regarding the 2,6% prevalence of NBSl founder mutation in prostate cancer subjects, about 15 000 NBSl carriers will develop prostate cancer, that is about 14% of all men affected by the founder NBSl mutation. As there was a significant difference in prevalence of 657del5 mutation in familial cases compared to consecutive cases (odds ratio = 16; 95% CI = 5.2 to 50; p < 0.0001), prostate cancer risk is higher if a relative of NBSl carrier is affected by prostate cancer.

This is also the first report showing that NBSl mutation the most probably predisposes to lobular subtype of invasive breast cancer. The risk for invasive lobular breast cancer is about 0.5% in around 20 mln population of Polish women, m regards to the 8% prevalence of NBSl founder allele in lobular invasive breast cancer subjects about 8000 NBSl female carriers will develop breast cancer, that is about 8% of woman with NBSl founder mutation.

The mean ages of diagnosis of prostate and breast cancers are 68 and 58 respectively. The latter is significantly lower (50 years) for breast cancer diagnosed among NBSl mutation carriers. Therefore mammography for NBSl mutation positive woman should be started earlier, probably not later than at age of 40 years. References:

1. Digweed, M. Human genetic instability syndromes: single gene defects with increased risk of cancer. Toxicol. Lett., 67: 259-281, 1993.

2. Futaki, M., Lui, J.M. Chromosome breakage syndromes and the BRCAl genome surveillance complex. Trends MoI. Med., 7: 560-565, 2001.

3. Varon, R., et al., Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell, 93: 467-76, 1998.

4. Carney, J.P., et al., The hMrel l/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell, 93: 477-86, 1998.

5. Varon, R., et al. Clinical ascertainment of Nijmegen breakage syndrome (NBS) and prevalence of the major mutation, 657del5, in three Slav populations. Eur. J Hum. Genet., 5: 900-902, 2000.

6. Seemanova, E. An increased risk for malignant neoplasms in heterozygotes for a syndrome of microcephaly, normal intelligence, growth retardation, remarkable facies, immunodeficiency and chromosomal instability. Mutat. Res., 238: 321-4, 1990.

7. Gόrski, B., et al.,. Germline 657del5 mutation in the NBSl gene in breast cancer patients. Int. J. Cancer, 70(5: 379-81, 2003.

8. Dςbniak, T., et al., J. Germline 657del5 mutation in the NBSl gene in patients with malignant melanoma of the skin. Melanoma Res., 13: 365-370, 2003.

9. Cybulski C, et al., NBSl is a prostate cancer susceptibility gene. Cancer Res. 2004 Feb 15;64(4):1215- 9.

10. van der Burgt et al.. Nijmegen breakage syndrome. J. Med. Genet., 33: 153-6, 1996.

11. Plisiecka-HaLasa, J. et al., Nijmegen breakage syndrome gene (NBSl) alterations and its protein (nibrin) expression in human ovarian tumours. Ann. Hum. Genet., 66: 353-9, 2002.

Claims

59 Claims

1. A polynucleotide associated with an increased inherited predisposition to cancer, especially prostate or invasive breast cancer of the lobular subtype, which polynucleotide is selected from the group consisting of: (a) a polynucleotide having the nucleic acid sequence of any one of SEQ ID NOs: or ; (b) a polynucleotide encoding a polypeptide having the amino acid sequence of any one of SEQ ID or ; (c) a polynucleotide encoding a molecular variant of the NBSl polypeptide, wherein said polynucleotide contains a nucleotide substitution, a nucleotide deletion, an additional nucleotide or an additional nucleotide and a nucleotide substitution at a position corresponding to position 18155, 18156, 18157, 18158 or 18159 of the NBSl gene (Genbank Accession No: ABOl 3139); (d) a polynucleotide encoding a molecular variant of the NBSl polypeptide, wherein said polynucleotide contains a nucleotide deletion at a position corresponding to position 18155, 18156, 18157, 18158 and 18159 of the NBSl gene (Genbank Accession No: AB013139); (e) a polynucleotide encoding a molecular variant of the NBSl peptide, wherein said polypeptide is comprised of an amino acid deletion at position from 234 to 754 of the NBSl polypeptide (SEQ ID NO: 2) and possibly at least one substitution selected from among a substitution of Lys to Asn at position 219, GIn to Leu at position 220, lie to GIn at position 221, Phe to Arg at position 222, Lys to GIu at position 223, GIy to Asn at position 224, Lys to He at position 225, Thr to Tyr at position 226, Phe to lie at position 227, He to Phe at position 228, Phe to GIu at position 229, Leu to Cys at position 230, Asn to GIn at position 231, Ala to Thr at position 232, Lys to Ala at position 233 of the NBSl polypeptide (SEQ ID NO: 2); and (f) a polynucleotide encoding a molecular variant of the NBSl polypeptide having the amino acid sequence of SEQ ID NO: 4.

2. The polynucleotide of claim 1, wherein the nucleotide deletion, addition and/or substitution result in altered expression of the variant NBSl gene, when compared to the corresponding wild type gene.

3. A vector comprising the polynucleotide of claim 1 or 2.

4. The vector of claim 3, wherein the polynucleotide is operatively linked to expression control sequences, allowing expression in prokaryotic or eukaryotic cells.

5. A host cell genetically engineered with the polynucleotide of claim 1 or 2 or the vector of claim 3 or 4. 60

6. A method for producing a molecular variant of the NBSl protein or a fragment thereof, which is associated with an increased inherited predisposition to cancer, especially prostate or invasive breast cancer of the lobular subtype, comprising (a) culturing the host cell of claim 5; and (b) recovering said protein or fragment from the culture.

7. A method for producing cells capable of expressing a molecular variant of the NBSl gene associated with an increased inherited predisposition to cancer, especially prostate or invasive breast cancer of the lobular subtype, comprising genetically engineering cells with the polynucleotide of claim 1 or 2 or the vector of claim 3 or 4.

8. An NBSl protein or fragment thereof, associated with an increased inherited predisposition to cancer, encoded by the polynucleotide of claim 1 or 2 or obtainable by the method of claim 6 or from cells produced by the method of claim 7.

9. An antibody which binds specifically to the protein of claim 8.

10. The antibody of claim 9 which specifically recognizes an epitope containing one or more amino acid substitutions) as defined in claim 1 or 2.

11. A nucleic acid molecule complementary to a polynucleotide of claim 1 or 2.

12. A nucleic acid molecule capable of specifically recognizing and cleaving the polynucleotide of claim 1 or 2.

13. A vector comprising the nucleic acid molecule of claim 11 or 12.

14. A transgenic non-human animal comprising at least one polynucleotide of claim 1 or 2 or the vector of claim 3 or 4.

15. The transgenic non-human animal of claim 14 further comprising at least one inactivated wild type allele of the NBSl gene.

16. The transgenic non-human animal of claim 14 or 15, which is a mouse or a rat.

17. A method of identifying and obtaining an NBSl modulator capable of modulating the activity of a molecular variant of the NBSl gene or its gene product comprising the steps of (a) contacting the protein of claim 8 or a cell expressing a molecular variant NBSl gene comprising a polynucleotide of claim 1 or 2 in the presence of components capable of providing a detectable signal in response to NBSl protein activity, with a compound to be screened under conditions permitting NBSl protein activity, and (b) detecting the presence or absence of a signal or increase of a signal generated from NBSl protein activity, wherein the presence or increase of the signal is indicative for a putative modulator. 61

18. The method of claim 17 wherein said cell is a cell of claim 5, obtained by the method of claim 7 or is comprised in the transgenic non-human animal of any one of claims 14 to 16.

19. A method of identifying and obtaining an NBSl modulator capable of modulating the activity of a molecular variant of the NBSl gene or its gene product, comprising the steps of (a) contacting the protein of claim 8 with the first molecule known to be bound to the NBSl protein to form a first complex of said protein and said first molecule; (b) contacting said first complex with a compound to be screened; and (c) measuring whether said compound displaces said first molecule from said first complex.

20. The method of claim 19, wherein the said measuring step comprises measuring the formation of a second complex of said protein and said compound.

21. The method of claim 19 or 20, wherein said measuring step comprises measuring the amount of said first molecule that is not bound to said protein.

22. The method of any one of claims 19 to 21 wherein said first molecule is one of part of the hMREl l/hRAD50/NBSl nuclease complex.

23. The method of any one of claims 19 to 22 wherein said first molecule is labeled.

24. A method of diagnosing an increased inherited predisposition to cancer comprising (a) determining the presence of a polynucleotide of claim 1 or 2 in a sample from a subject; and/or (b) determining the presence of a protein of claim 8.

25. The method of claim 24, wherein said cancer is prostate or invasive breast cancer of the lobular subtype.

26. The method of claim 24 or 25 comprising PCR, ligase chain reaction, restriction digestion, direct sequencing, nucleic acid amplification techniques, microchips, hybridization techniques or immunoassays.

27. The method of any one of claims 24 to 26, further comprising administering to a subject a medicament to abolish or alleviate said cancer.

28. The method of any one of claims 24 to 27, further comprising introducing (i) a functional and expressible wild type NBSl gene or (ii) a nucleotide acid molecule of claim 11 or 12 or the vector of claim 13 into cells.

29. A method for the production of a pharmaceutical composition comprising the steps of the method of any one of claims 17 to 23; and (c) synthesizing and/or formulating the compound identified and obtained in step (b) or a derivative thereof in a pharmaceutically acceptable form. 62

30. A method for the preparation of a pharmaceutical composition comprising formulating a drug or pro-drug in a form suitable for therapeutic application and preventing or ameliorating the cancer of the subject diagnosed in the method of claim 24 or 25.

31. The method of claim 29 or 30 wherein said compound drug or pro-drug is a derivative of a medicament as defined in claim 27.

32. An inhibitor identified or obtainable by the method of any one of claims 17 to 23.

33. The inhibitor of claim 32 which binds specifically to the protein of claim 8.

34. Use of an oligo- or polynucleotide for the detection of a polynucleotide of claim 1 or 2 and/or for genotyping of individual NBSl alleles.

35. The use of claim 34 wherein said polynucleotide is a polynucleotide of claim 1 or 2 or a nucleic acid molecule of claim 11 or 12.

36. The use of claim 34 wherein said oligonucleotide is about 15 to 50 nucleotides in length and comprises the nucleotide sequence included in any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NOS: 5 - 12, or a complementary sequence of any one of those.

37. A primer or probe consisting of an oligonucleotide as defined in claim 36.

38. Use of an antibody or a substance capable of binding specifically to the gene product of an NBSl gene for the detection of the protein of claim 8, the expression of a molecular variant of the NBSl gene comprising a polynucleotide of claim 1 or 2 and/or for distinguishing NBSl alleles comprising a polynucleotide of claim 1 or 2.

39. A composition comprising the polynucleotide of claim 1 or 2, the vector of claim 3 or 4, the host cell of claim 5 or obtained by the method of claim 7, the protein of claim 8, the antibody of claim 9 or 10, the nucleic acid molecule of claim 11 or 12, the vector of claim 13, the inhibitor of claim 32 or the primer or probe of claim 37.

40. The composition of claim 39 which is a diagnostic or a pharmaceutical composition.

41. Use of an effective dose of a drug or pro-drug for the preparation of a pharmaceutical composition for the treatment or prevention of a disorder in a subject comprising a polynucleotide of claim 1 or 2 in its genome.

42. The use of claim 41 wherein said disorder is cancer, especially prostate or invasive breast cancer of the lobular subtype.

43. A method for detecting a predisposition to prostate cancer or breast cancer in a subject, comprising detecting in a biological sample from the subject an alteration in the sequence of a NBSl gene, wherein the alteration is indicative of a predisposition to prostate cancer. 63

44. The method of claim 43, wherein the alteration is a germline alteration.

45. The method of claim 43, wherein the germline alteration is 657del5.

46. The method of claim 43, wherein the subject is a human.

47. The method of claim 46, wherein the human is of Slavic origin.

48. The method of claim 43, wherein the alteration is detected by ASO PCR, SSCP, direct sequencing, ASA, microchips or RFLP-PCR.

49. The method of claim 43, wherein the predisposition is an inherited predisposition.

50. The method of claim 43, wherein the biological sample is a tissue sample.

51. The method of claim 50, wherein the tissue sample is blood.

52. The method of claim 43, wherein the biological sample comprises leukocytes.

53. The method of claim 43, wherein the breast cancer is invasive breast cancer of the lobular subtype.

54. Use of a germline alteration in the sequence of the NBSl gene for detection of inherited predisposition to prostate cancer or breast cancer in a subject.

55. Use of claim 54 wherein said germline alteration is mutation 657del5.

56. Use of claim 54, wherein the subj ect is a human.

57. Use of claim 56, wherein the human is of Slavic origin.

58. Use of claim 54, wherein the breast cancer is invasive breast cancer of the lobular subtype.

59. Use as claimed in any one of claims 54 to 58 wherein the presence of the germline alteration is detected by at least one method selected from among ASO PCR, SSCP, microchips, direct sequencing, ASA, or RFLP-PCR.

60. A diagnostic kit for identifying a predisposition to breast cancer or prostate cancer in a subject, comprising packaging material and at least two different polynucleotides capable of amplifying at least a region of a NBSl gene.

61. The kit of claim 60, wherein the amplified region includes mutation 657del5.

62. The kit of claim 60, comprising polynucleotides Nbsex6f (SEQ ED NO:6), Nbsex6r (SEQ E) NO:7) andNbsdel5 (SEQ ID NO:8).

63. Protocol for early detection of breast cancer distinct from regular standards due to occurrence of NBSl germline mutation.