WO2004099412A1 - Nucleic acid molecules differentially expressed in animals exhibiting behavioural disorders - Google Patents

Nucleic acid molecules differentially expressed in animals exhibiting behavioural disorders Download PDF

Info

Publication number
WO2004099412A1
WO2004099412A1 PCT/AU2004/000595 AU2004000595W WO2004099412A1 WO 2004099412 A1 WO2004099412 A1 WO 2004099412A1 AU 2004000595 W AU2004000595 W AU 2004000595W WO 2004099412 A1 WO2004099412 A1 WO 2004099412A1
Authority
WO
WIPO (PCT)
Prior art keywords
agt
seq
nos
nucleotide sequence
homolog
Prior art date
Application number
PCT/AU2004/000595
Other languages
French (fr)
Inventor
David Harry Segal
Kenneth Russell Walder
Gregory Royce Collier
Original Assignee
Agt Biosciences Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agt Biosciences Limited filed Critical Agt Biosciences Limited
Publication of WO2004099412A1 publication Critical patent/WO2004099412A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/30—Psychoses; Psychiatry

Definitions

  • the present invention relates generally to a nucleic acid molecule which is differentially expressed in at least hypothalamus tissue of Psammomys obesus under particular degrees of behavioral modifying conditions and to human and other mammalian homologs thereof. It is proposed that the nucleic acid molecule is differentially expressed under differing conditions including anxiety or depression. More particularly, the present invention uses microarray technology to identify genetic material which is expressed under particular behavioral conditions.
  • the subject nucleic acid molecule and/or its expression product be used in therapeutic and diagnostic protocols for conditions such as treating, controlling or preventing anxiety or depression such as arising from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially- mediated behavioral conditions and/or disorders in a mammal and in particular a human.
  • the subject nucleic acid molecule and its expression product or derivatives, homologs, analogs and mimetics thereof are proposed to be useful, therefore, as therapeutic and diagnostic agents for. behavior-modifying conditions including anxiety and/or depression.
  • Depression refers to a variety of human behavioral states related to feelings of sadness, apathy, futility and despair.
  • the American Psychiatric Association characterizes depression as a dysphoric mood or loss of interest in activities that would normally be enjoyed (American Psychiatric Association, Diagnostic and statistical manual of mental disorders. Washington, D.C. Assoc. Am. Psychiatr. 4 th edition, 1994).
  • Symptoms include loss of energy, reduced appetite and sleep disturbance.
  • the definition of clinical depression is complicated by a variety of factors. Depression is a complex disorder with contributions from both genetic and environmental factors that are not well defined.
  • the neurobiology of depression is complex and features the involvement of many anatomical regions of the brain. Magnetic resonance and other imaging studies suggest that loci such as the amygdala, hypothalamus and prefrontal cortex exhibit altered activation during anxiety and depression (reviewed in Drevets, Ann. Rev. Med. 49: 341-361, 1998). Although much is known regarding the role of neurotransmitters such as serotonin and norepinephrine in depression, underlying genetic changes associated with the depressive state and their role in depression is largely unclear. The finding that chronic treatment of patients with anti-depressive drugs is typically required to lessen the severity of symptoms suggests that changes in gene expression may be important to therapeutic outcomes.
  • Non-simulation models - (a) Reserpine reversal;
  • Separation models have been used to investigate aspects of depression. Studies of separation-induced depression in monkeys, hamsters, chickens and rats have identified a range of atypical behaviors including reduced motor activity, decreased appetite and sleep disturbances (Jesberger and Richardson, Biol. Psychiatry 20: 764-784, 1985). Separation models, especially when conducted in non-human primates, show a significant symptomatic resemblance with clinical depression, however, the extent to which the model responds to drugs that are clinically effective has not been well studied. There is a need to develop more definitive separation models.
  • SEQ ID NO: Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:).
  • the SEQ ID NOs: correspond numerically to the sequence identifiers ⁇ 400>1 (SEQ ID NO:l), ⁇ 400>2 (SEQ ID NO:2), etc.
  • SEQ ID NO:2 sequence identifier number
  • a summary of the sequence identifiers is provided in Table 2.
  • a sequence listing is provided after the claims.
  • Communally-raised P. obesus exhibit a depression-like response when separated into individual cages, as shown by a reduction in food intake and body weight for a period of approximately one week. This anorexia and loss of body weight is used as a marker for the depression phenotype.
  • Assessment of animal behavior using an Open-Field Test (OFT) showed significant differences in , behavior between separated and communally-housed animals. The separated animals spent more time near the edges of the OFT apparatus and less time in the center. This effect was independent of weight loss or gain in separated animals. Other parameters such as the number of jumps and rears, the time spent moving or the number of ambulations were not significantly different in separated or communally- housed animals. The behavioral changes seen in separated animals are consistent with a depression phenotype.
  • the depression phenotype is classified as non-response, temporary response or constant response phenotype.
  • a non-response animal is deemed to include an animal which exhibits no substantial alteration in behavior or in a range of physical parameters such as weight.
  • a temporary-response animal upon separation, exhibits a change in behavior and/or physical parameters but returns substantially to behavioral and/or physical parameters exhibited prior to separation within days or weeks.
  • a constant-response animal exhibits a change in behavioral or physical parameter patterns and does not return to substantially the same patterns within days or weeks.
  • the data from the P. obesus separation model of depression indicate that the model has both face and construct validity.
  • Microarray analysis was used in time course studies using the P. obesus animal model to identify changes in expression of genetic material.
  • cDNA microarray technology provides a powerful technical means to generate a gene expression database of both known genes and unknown transcripts. Using cDNA microarrays, comparative estimates can be obtained of the level of gene expression of large numbers of genes (up to 20,000 per microarray) in each sample.
  • cDNA microarrays generally involve a large number of DNA "spots" in an orderly array chemically coupled to the surface of a solid substrate, usually but not exclusively an optically flat glass microscope slide. Fluorescently labeled cDNAs are generated from experimental and reference RNA samples and then competitively hybridized to the gene chip.
  • the experimental and reference cDNAs are labeled with a different fluorescent dye and the intensity of each fluor at each DNA spot gives an indication of the level of that particular RNA species in the experimental sample relative to the reference RNA.
  • the ratio of fluorescence can be taken as a measure of the expression level of the gene corresponding to that spot in the experimental sample.
  • AGT-301 [SEQ ID NOs:l and 6]
  • AGT-302 [SEQ ID NOs:2 and 7]
  • AGT-303 [SEQ ID NO:3]
  • AGT-304 [SEQ ID NOs:4 and 8]
  • AGT-305 [SEQ ID NOs:5 and 9].
  • the present invention contemplates the use of these sequences or mammalian including human homologs thereof or their expression products in the manufacture of medicaments and diagnostic agents for a range of behavior conditions including anxiety and/or depression.
  • the present invention provides, therefore, a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleic acid molecule or its homolog is differentially expressed in hypothalamus of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
  • the present invention further provides a nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein the nucleotide sequence is as substantially set forth in SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs: 1 and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 and/or is capable of hybridizing to one or more of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs: 5 and 9 or a complementary form thereof under low stringency conditions at 42°C
  • the present invention also provides an isolated expression product or a derivative, homolog, analog or mimetic thereof which expression product is encoded by a nucleotide sequence which is differentially expressed in hypothalamus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
  • the present invention is directed to an isolated expression product or a derivative, homolog, analog or mimetic thereof wherein the expression product is encoded by a nucleotide sequence substantially as set forth in SEQ ID NOs:l and 6, SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a nucleotide sequence having at least 30% similarity to all or part of SEQ ID NOs:l and 6, SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 and/or is capable of hybridizing to SEQ ID NOs:l and 6, SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a complementary form thereof under low stringency conditions at 42°C.
  • homolog includes other mammalian homologs such as from a human.
  • the preferred genetic sequence of the present invention are referred to herein as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • the expression products encoded by AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 are referred to herein as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, respectively.
  • the expression product may be an RNA (e.g. mRNA) or a protein. Where the expression product is an RNA, the present invention extends to RNA-related molecules associated thereto such as RNAi or intron or exon sequences therefrom or short, interfering RNA (si-RNA) or complexes comprising same.
  • compositions comprising AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or its derivatives, homologs, analogs or mimetics or agonists or antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 together with one or more pharmaceutically acceptable carriers and/or diluents.
  • the present invention is particularly directed to human homologs of the genes identified in P. obesus and their use in therapy and diagnosis.
  • Another aspect of the present invention contemplates, therefore, a method for treating a subject comprising administering to said subject a treatment effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog, analog or mimetic thereof or a genetic sequence encoding same or an agonist or antagonist of AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 activity or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 gene expression for a time and under conditions sufficient to effect treatment.
  • treatments contemplated herein include but are not limited to behavioral disorders or conditions such as anxiety and/or depression. Such disorders may result from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially-mediated behavioral condition or disorder. Treatment may be by the administration of a pharmaceutical composition or genetic sequences via gene therapy, antisense therapy or sense or RNAi- or si-RNA-mediated therapy. Treatment is contemplated for human subjects as well as animals such as animals important to livestock industry.
  • a further aspect of the present invention is directed to a diagnostic agent for use in monitoring or diagnosing conditions such as but not limited to behavioral conditions or disorders including anxiety or depression, said diagnostic agent selected from an antibody to AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or its derivatives, homologs, analogs or mimetics and a genetic sequence comprising or capable of annealing to a nucleotide strand associated with AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 useful r ⁇ ter alia in PCR, hybridization, RFLP analysis or AFLP analysis.
  • Figure 2 is a graphical representation of AGT-304 gene expression versus outer ambulations.
  • Figure 3 is a graphical representation of AGT-305 gene expression versus outer ambulations.
  • the present invention is predicated in part on the phenotypes exhibited by communally- reared or maintained P. obesus animals after separation from each other. Such separation is referred to as "social separation".
  • the phenotypes are classified as non-response, temporary response or constant response phenotype.
  • a non-response animal is deemed to include an animal which exhibits no substantial alteration in behavior or in a range of physical parameters such as weight.
  • a temporary-response animal upon separation, exhibits a change in behavior and/or physical parameters but returns substantially to behavioral and/or physical parameters exhibited prior to separation within days or weeks.
  • a constant-response animal exhibits a change in behavioral or physical parameter patterns and does not return to substantially the same patterns within days or weeks.
  • Such animals represent an animal model for behavioral conditions such as anxiety or depression.
  • the present invention provides genetic material associated ter alia with such behavioral conditions.
  • the genes are identified following differential screening of mRNA from hypothalamus tissue at various times following separation and isolation of communally- reared P. obesus animals. The selection of hypothalamus tissue is not intended to imply that differential expression does not occur in other tissue.
  • the present invention further extends to homologs in other mammals and in particular humans as well as in other animals or organisms.
  • one aspect of the present invention provides a differentially expressed isolated nucleic acid molecule from a P. obesus animal, which animal is subjected to separation or isolation from other P. obesus animals from the same community and which animal exhibits at least one phenotype selected from a non-response, temporary response or constant response phenotype.
  • Reference to a behavioral condition or disorder includes conditions such as anxiety, depression, change in eating patterns such as leading to weight loss or weight gain, stress or despair amongst a range of other conditions. It is proposed, therefore, that the subject nucleic acid molecule is useful in the study of and development of treatment and diagnostic protocols for conditions such as anxiety, depression, drug addiction and chemical substance dependence, anti-social behavior and various forms of attention deficit disorders.
  • the present invention provides, therefore, a method for assessing a behavioral disorder in P. obesus animals, said method comprising subjecting a plurality of communally-reared or maintained animals to social isolation from each other for a time and under conditions sufficient for one of three phenotypes to become apparent when said phenotypes are selected from non-response, temporary response and constant response phenotype and then screening for changes in expression of one or more nucleic acid molecules.
  • references to "communally-reared or maintained” means the animals have been maintained together since birth or since shortly after birth (i.e. within days or weeks or months of birth) or have been maintained with at least one other animal shortly after birth.
  • the "other animal” may be the same type of animal or a different type of animal.
  • the term “communally” generally means that two or more animals are maintained in a single enclosure but also extends to enclosures where the animals are physically separated from each other but are able to at least view each other or more preferably are able to engage in some form of body contact with each other such as touching, licking or grooming.
  • a "plurality" of animals means two or more animals preferably three or more and even more preferably from about four to about 500 or from about five to about 100 or from about six to 80 animals.
  • the subject animal model may be used to screen for the presence of nucleic acid molecules whose expression is altered under adverse behavioral-modifying conditions such as separation.
  • another aspect of the present invention contemplates a method for identifying a nucleic acid molecule whose expression is altered following a behavioral-modifying protocol applied to a P. obesus animal model, said method comprising subjecting a plurality of communally-reared or maintained P. obesus animals to said protocol comprising socially separating said animals and determining whether there is any alteration in expression of a nucleic acid molecule.
  • the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleic acid molecule is differentially expressed in hypothalamus tissue of communally-reared P. obesus animals subjected to isolation from other P. obesus animals from the same community.
  • the term "differentially expressed” is used in its most general sense and includes elevated levels of an expression product such as mRNA or protein or a secondary product such as cDNA in one tissue compared to another tissue or in the same tissue but under different conditions. Examples of different conditions includes differential expression in tissue from fed and fasted animals or in exercise trained and control animals. Differential expression is conveniently determined by a range of techniques including polymerase chain reaction (PCR) such as real-time PCR. Other techniques include suppression subtractive hyridization (SSH) and amplified fragment length polymorphism (AFLP) analysis. Microarray analysis of cDNA is particularly preferred.
  • PCR polymerase chain reaction
  • SSH suppression subtractive hyridization
  • AFLP amplified fragment length polymorphism
  • a homolog refers to a genetic sequence in another animal or organism which has at least about 20% identity to the reference sequence.
  • a preferred homolog is a human homolog.
  • nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NOs:l and 6 (AGT-301) or SEQ ID NOs:2 and 7 (AGT-302) or SEQ ID NO:3 (AGT-303) or SEQ ID NOs:4 and 8 (AGT-304) or SEQ ID NOs: 5 and 9 (AGT-305) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 and
  • An expression product includes an RNA molecule such as an mRNA transcript as well as a protein. Some genes are non-protein encoding genes and produce mRNA or other RNA molecules and are involved in regulation by RNA:DNA, RNA:RNA or RNA:protein interaction. Other genes encode mRNA transcripts which are then translated into proteins. A protein includes a polypeptide. The differentially expressed nucleic acid molecules, therefore, may encode mRNAs only or, in addition, proteins. Both mRNAs and proteins are forms of "expression products".
  • Reference herein to similarity is generally at a level of comparison of at least 15 consecutive or substantially consecutive nucleotides. It is particularly convenient, however, to determine similarity by comparing a total or complete sequence, after optimal alignment.
  • the term "similarity" as used herein includes exact identity between compared sequences at the nucleotide level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which may encode different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide sequence comparisons are made at the level of identity rather than similarity.
  • sequence relationships between two or more polynucleotides include “reference sequence”, “comparison window”, “sequence similarity”, “sequence identity”, “percentage of sequence similarity”, “percentage of sequence identity”, “substantially similar” and “substantial identity”.
  • a “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units in length. Because two polynucleotides may each comprise (1) a sequence (i.e.
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window” refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence.
  • the comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
  • GAP Garnier et al.
  • Altschul et al. Nucl. Acids Res. 25: 3389, 1997.
  • a detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, Chapter 15, 1994-1998).
  • a range of other algorithms may be used to compare the nucleotide and amino acid sequences such as but not limited to PILEUP, CLUSTALW, SEQUENCHER or VectorNTI.
  • sequence similarity and “sequence identity” as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by- nucleotide basis over a window of comparison.
  • a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • sequence identity will be understood to mean the “match percentage” calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.
  • Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions.
  • low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions.
  • Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions.
  • medium stringency which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions
  • high stringency which includes and encompasses from at least about 31% v/v to at least about 50% v/v form
  • T ra of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974).
  • Formamide is optional in these hybridization conditions.
  • particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1%) w/v SDS at a temperature in the range 20°C to 65°C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65°C.
  • the nucleotide sequence or amino acid sequence of the present invention may correspond to exactly the same sequence of the naturally occurring gene (or corresponding cDNA) or protein or other expression product or may carry one or more nucleotide or amino acid substitutions, additions and/or deletions.
  • the nucleotide sequences set forth in SEQ ID NOs:l and 6 (AGT-301), SEQ ID NOs:2 and 7 (AGT-302) and SEQ ID NO:3 (AGT-304) or SEQ ID NOs:4 and 8 (AGT-304) or SEQ ID NOs:5 and 9 (AGT-305) correspond to novel genes referred to in parenthesis.
  • the corresponding expression products are AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305, respectively.
  • Reference herein to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 includes, where appropriate, reference to the genomic gene or cDNA as well as any naturally occurring or induced derivatives.
  • the present invention further encompasses mutants, fragments, parts and portions of the nucleotide sequence corresponding to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:l and 6 (AGT-301) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:l and 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l and 6 or its complementary form under low stringency conditions.
  • nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:2 and 7 (AGT-302) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:2 and 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:2 and 7 or its complementary form under low stringency conditions.
  • Still yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO: 3 (AGT-303) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 or their complementary forms under low stringency conditions.
  • nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:4 and 8 (AGT-304) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:4 and 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 and 8 or its complementary form under low stringency conditions.
  • nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:5 and 9 (AGT-305) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs: 5 and 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 5 and 9 or its complementary form under low stringency conditions.
  • Reference herein to "at least 30%” includes sequences having at least about 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% similarity or identity to the reference sequence.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 has been determined, ter alia, to indicate an involvement in or associated with a behavioral condition or disorder such as anxiety or depression.
  • these genes may also be differentially expressed in other tissues including but not limited to brain, muscle, adipose tissue, pancreas or gastrointestinal tissue.
  • the nucleic acid molecule corresponding to each of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 is preferably a DNA such as a cDNA sequence or a genomic DNA.
  • a genomic sequence may also comprise exons and introns.
  • a genomic sequence may also include a promoter region or other regulatory regions.
  • a homolog is considered to be a gene from another animal species which has the same or greater than 30% similarity to one of AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 and/or which has a similar function.
  • the above-mentioned genes are exemplified herein from P. obesus hypothalamus.
  • the present invention extends, however, to the homologous gene, as determined by nucleotide sequence and/or function, from humans, primates (lower and higher primates), livestock animals (e.g. cows, sheep, pigs, horses, donkeys), laboratory test animals (e.g. mice, guinea pigs, hamsters, rabbits), companion animals (e.g.
  • nucleic acids of the present invention and in particular AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and their derivatives and homologs may be in isolated or purified form and/or may be ligated to a vector such as an expression vector.
  • Expression may be in a eukaryotic cell line (e.g. mammalian, insect or yeast cells) or in prokaryote cells (e.g. E. coli) or in both.
  • isolated is meant a nucleic acid molecule having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject nucleic acid molecule, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%), even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject nucleic acid molecule relative to other components as determined by molecular weight, encoding activity, nucleotide sequence, base composition or other convenient means.
  • the nucleic acid molecule of the present invention may also be considered, in a preferred embodiment, to be biologically pure.
  • the nucleic acid molecule may be ligated to an expression vector capable of expression in a prokaryotic cell (e.g. E. coli) or a eukaryotic cell (e.g. yeast cells, fungal cells, insect cells, mammalian cells or plant cells).
  • the nucleic acid molecule may be ligated or fused or otherwise associated with a nucleic acid molecule encoding another entity such as, for example, a signal peptide. It may also comprise additional nucleotide sequence information fused, linked or otherwise associated with it either at the 3' or 5' terminal portions or at both the 3' and 5' terminal portions.
  • the nucleic acid molecule may also be part of a vector, such as an expression vector.
  • the derivatives of the nucleic acid molecule of the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in co- suppression (including sense RNA or DNA, RNA interference (RNAi), short interfering RNA (si-RNA), single hairpin RNA (sh-RNA), multiple hairpin RNA (mh-RNA) and DNA-directed RNAi (ddRNAi).
  • RNAi RNA interference
  • si-RNA short interfering RNA
  • sh-RNA single hairpin RNA
  • mh-RNA multiple hairpin RNA
  • ddRNAi DNA-directed RNAi
  • An "RNAi” molecule may be produced by in vitro chemical synthesis or in vitro transcription or in vivo transcription.
  • a "synthetic" RNAi chemical modified at its 3' or 5' or at the level of a nucleotide or linkage between nucleotides are also herein contemplated.
  • Ribozymes and DNAzymes are also contemplated by the present invention directed to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their mRNAs.
  • Derivatives and homologs of AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305 are conveniently encompassed by those nucleotide sequences capable of hybridizing to one or more of SEQ ID NOs:l or 6, SEQ ID NOs:2 or 7 or SEQ ID NO:3 or SEQ ID NOs:4 or 8 or SEQ ID NOs:5 or 9 or a complementary form thereof under low stringency conditions.
  • Derivatives include fragments, parts, portions, mutants, variants and mimetics from natural, synthetic or recombinant sources including fusion nucleic acid molecules. Derivatives may be derived from insertion, deletion or substitution of nucleotides.
  • Another aspect of the present invention provides an isolated expression product or a derivative, homolog, analog or mimetic thereof which is produced in larger or lesser amounts in hypothalamus tissue of a communally-reared P. obesus animal separated from other P. obesus animals from the same community.
  • An expression product may be RNA or protein.
  • derivatives include amino acid insertional derivatives such as amino and/or carboxylic terminal fusions as well as intra-sequence insertions of single or multiple amino acids.
  • Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in a protein although random insertion is also possible with suitable screening of the resulting product.
  • Deletional variants are characterized by the removal of one or more amino acids from the sequence.
  • Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place.
  • An example of substitutional amino acid variants are conservative amino acid substitutions.
  • Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Additions to amino acid sequences include fusions with other peptides, polypeptides or proteins.
  • Chemical and functional equivalents of protein forms of the expression products AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 should be understood as molecules exhibiting any one or more of the functional activities of these molecules and may be derived from any source such as being chemically synthesized or identified via screening processes such as natural product screening or screening of chemical libraries.
  • the derivatives include fragments having particular epitopes or parts of the entire protein fused to peptides, polypeptides or other proteinaceous or non-proteinaceous molecules.
  • references herein to AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 includes reference to isolated or purified naturally occurring AGT-301, AGT-302, AGT-303, AGT- 304 or AGT-305 as well as any derivatives, homologs, analogs and mimetics thereof.
  • Derivatives include parts, fragments and portions of AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 as well as single and multiple amino acid substitutions, deletions and/or additions to AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 when the expression products are proteins.
  • a derivative of AGT-301, AGT-302, AGT-303, AGT- 304 or AGT-305 is conveniently encompassed by molecules encoded by a nucleotide sequence capable of hybridizing to SEQ ID NOs:l or 6 or SEQ ID NOs:2 or 7 or SEQ ID NO:3 or SEQ ID NOs:4 or 8 or SEQ ID NOs:5 or 9 under low stringency conditions.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 include chemical analogs.
  • Analogs of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 contemplated herein include, but are not limited to, modifications to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose confirmational constraints on the proteinaceous molecule or their analogs.
  • side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulfonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH 4 .
  • amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulfonic acid (TNBS);
  • the guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
  • the carboxyl group may be modified by carbodumide activation via O-acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide.
  • Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
  • Tryptophan residues may be modified by, for example, oxidation with N- bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
  • Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
  • Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate.
  • Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3- hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, omithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids.
  • a list of unnatural amino acid, contemplated herein is shown in Table 3.
  • Non-conventional Code Non-conventional Code amino acid amino acid
  • D- ⁇ -methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu D- ⁇ -methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg
  • D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg D-N-methylglutamate Dnmglu N-(l-hydroxyethyl)glycine Nthr D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser
  • peptides can be conformationally constrained by, for example, incorporation of C ⁇ and N ⁇ -methylamino acids, introduction of double bonds between C ⁇ and Cp atoms of amino acids and the formation of cyclic peptides or analogs by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.
  • the expression product may be a RNA or protein.
  • protein should be understood to encompass peptides, polypeptides and proteins.
  • the protein may be glycosylated or unglycosylated and/or may contain a range of other molecules fused, linked, bound or otherwise associated to the protein such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.
  • Reference hereinafter to a "protein” includes a protein comprising a sequence of amino acids as well as a protein associated with other molecules such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.
  • the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:l or 6 or a derivative, homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs:l or 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l or 6 or its complementary form under low stringency conditions.
  • the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:2 or 7 or a derivative, homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs:2 or 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:2 or 7 or its complementary form under low stringency conditions.
  • the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO:3 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO:3 or a nucleotide sequence capable of hybridizing to SEQ ID NO:3 or their complementary form under low stringency conditions.
  • the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:4 or 8 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs:4 or 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 or 8 or their complementary form under low stringency conditions.
  • the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:5 or 9 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs: 5 or 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 5 or 9 or its complementary form under low stringency conditions.
  • Another aspect of the present invention is directed to an isolated expression product selected from the list consisting of:-
  • a protein comprising an amino acid sequence substantially as set forth in SEQ ID NOs:4 or 8or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
  • (x) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:l or 6 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;
  • xi a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:2 or 7 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;
  • xii a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO: 3 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions
  • protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:4 or 8 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions and
  • xiv a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:5 or 9 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions.
  • the protein of the present invention is preferably in isolated form.
  • isolated is meant a protein having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject protein, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%, even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject protein relative to other components as determined by molecular weight, amino acid sequence or other convenient means.
  • the protein of the present invention may also be considered, in a preferred embodiment, to be biologically pure.
  • percentage similarity is applied to amino acid sequences and identity is applied to nucleic acid sequences.
  • the expression or non-expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 is considered to be associated with anxiety or depression amongst other disorders. Modulation of expression of these genes is proposed to be useful in the treatment or prophylaxis of behavioral conditions such as anxiety or depression. Alternatively or in addition, the level of expression represents a useful diagnostic marker of various behavioral conditions.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 permits the generation of a range of therapeutic molecules capable of modulating expression of AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 or modulating the activity of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • Modulators contemplated by the present invention include agonists and antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression.
  • Antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 expression include antisense molecules, ribozymes and co-suppression molecules (including si-RNA, sh-RNA, ddRNai and any molecule which induce RNAi including mh- RNAi).
  • Agonists include molecules which increase promoter activity or which interfere with negative regulatory mechanisms.
  • Antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 include antibodies and inhibitor peptide fragments. All such molecules may first need to be modified to enable such molecules to penetrate cell membranes.
  • viral agents may be employed to introduce genetic elements to modulate expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 act in association with other genes such as the ob gene which encodes leptin
  • the therapeutic molecules may target AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and ob genes or their translation products.
  • the present invention contemplates, therefore, a method for modulating expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a mammal, said method comprising contacting the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 gene with an effective amount of a modulator of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression for a time and under conditions sufficient to up-regulate or down- regulate or otherwise modulate expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • a nucleic acid molecule encoding AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative or homolog thereof may be introduced into a cell to enhance the ability of that cell to produce AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, conversely, AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 sense and/or antisense sequences such as oligonucleotides may be introduced to decrease expression of the genes at the level of transcription, post-transcription or translation.
  • Sense sequences preferably encode hair pin RNA molecules or double-stranded RNA molecules.
  • Another aspect of the present invention contemplates a method of modulating activity of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a mammal, said method comprising administering to said mammal a modulating effective amount of a molecule for a time and under conditions sufficient to increase or decrease AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305 activity.
  • the molecule may be a proteinaceous molecule or a chemical entity and may also be a derivative of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or its ligand.
  • mammals contemplated by the present invention include but are not limited to humans, primates, livestock animals (e.g. pigs, sheep, cows, horses, donkeys), laboratory test animals (e.g. mice, rats, guinea pigs, hamsters, rabbits), companion animals (e.g. dogs, cats) and captured wild animals (e.g. foxes, kangaroos, deer).
  • a particularly preferred host is a human, primate or livestock animal.
  • the present invention contemplates therapeutic and prophylactic use of AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 expression products or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 genetic mutants and/or agonists or antagonists agents thereof.
  • the present invention contemplates, therefore, a method of modulating expression of AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 in a mammal, said method comprising contacting the AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 genes with an effective amount of an agent for a time and under conditions sufficient to up-regulate, down-regulate or otherwise modulate expression of AGT-301, AGT-302, AGT-303, AGT- 304 and AGT-305.
  • Another aspect of the present invention contemplates a method of modulating activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 in a subject, said method comprising administering to said subject a modulating effective amount of an agent for a time and under conditions sufficient to increase or decrease AGT-301, AGT-302, AGT- 303, AGT-304 and/or AGT-305 activity or function.
  • Modulation of activity by the administration of an agent to a mammal can be achieved by one of several techniques, including, but in no way limited to, introducing into a mammal a proteinaceous or non-proteinaceous molecule which:
  • (iii) functions as an agonist of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT- 305.
  • the molecules which may be administered to a mammal in accordance with the present invention may also be linked to a targeting means such as a monoclonal antibody, which provides specific delivery of these molecules to the target cells.
  • a targeting means such as a monoclonal antibody, which provides specific delivery of these molecules to the target cells.
  • a further aspect of the present invention relates to the use of the invention in relation to mammalian disease conditions.
  • the present invention is particularly useful in treating behavioral conditions or disorders such as anxiety and/or depression.
  • another aspect of the present invention relates to a method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or sufficient to modulate the activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305.
  • the present invention relates to a method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305.
  • An agent includes proteinaceous or non-proteinaceous molecules such as antibodies, natural products, chemical entities or nucleic acid molecules (including antisense molecules, sense molecules, ribozymes, ds-RNA, ss-RNA molecules or DNA-targeting molecules).
  • AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT- 305 or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or agents capable of modulating the expression or activity of said molecules may be co-administered with one or more other compounds or other molecules.
  • co-administered is meant simultaneous administration in the same formulation or in two different formulations via the same or different routes or sequential administration by the same or different routes.
  • sequential administration is meant a time difference of from seconds, minutes, hours or days between the administration of the two types of molecules. These molecules may be administered in any order.
  • the present invention relates to the use of an agent capable of modulating the expression of AGT-301, AGT-302, AGT-303, AGT-304 mdl ox AGT-305 or a derivative, homolog or analog thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.
  • the present invention relates to the use of an agent capable of modulating the activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog, analog, chemical equivalent or mimetic thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.
  • a further aspect of the present invention relates to agents for use in modulating the expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog or analog thereof.
  • Yet another aspect relates to agents for use in modulating AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 activity or a derivative, homolog, analog, chemical equivalent or mimetic thereof.
  • Still another aspect of the present invention relates to AGT-301, AGT-302, AGT-303, AGT- 304 and/or AGT-305 or derivative, homolog or analog thereof or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or derivative, homolog, analog, chemical equivalent or mimetic thereof for use in treating a behavioral condition or disorder.
  • the mammal undergoing treatment may be a human or an animal in need of therapeutic or prophylactic treatment.
  • the present invention contemplates in one embodiment a composition comprising a modulator of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 activity and one or more pharmaceutically acceptable carriers and/or diluents.
  • the composition comprises AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative, homolog, analog or mimetic thereof and one or more pharmaceutically acceptable carriers and/or diluents.
  • compositions of active components in a form suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or other medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • solvent or other medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the active components in the required amount in the appropriate solvent with optionally other ingredients, as required, followed by sterilization by, for example, filter sterilization, irradiation or other convenient means.
  • sterilization by, for example, filter sterilization, irradiation or other convenient means.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 are suitably protected, they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet.
  • the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • compositions and preparations should contain at least 1% by weight of active compound.
  • the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit.
  • the amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 ⁇ g and 2000 mg of active compound.
  • the tablets, troches, pills, capsules and the like may also contain the following: A binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring.
  • a binder such as gum tragacanth, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint
  • tablets, pills, or capsules may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compound may be incorporated into sustained-release preparations and formulations.
  • Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the novel dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired as herein disclosed in detail.
  • the principal active component may be compounded for convenient and effective administration in sufficient amounts with a suitable pharmaceutically acceptable carrier in dosage unit form.
  • a unit dosage form can, for example, contain the principal active component in amounts ranging from 0.5 ⁇ g to about 2000 mg. Expressed in proportions, the active compound is generally present in from about 0.5 ⁇ g to about 2000 mg/ml of carrier.
  • the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
  • effective amounts of AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 will range from 0.01 ng/kg/body weight to above 10,000 mg/kg/body weight. Alternative amounts range from 0.1 ng/kg/body weight to above 1000 mg/kg/body weight.
  • the active ingredients may be administered per minute, hour, day, week, month or year depending on the condition being treated.
  • the route of administration may vary and includes intravenous, intraperitoneal, sub-cutaneous, intramuscular, buccal, intranasal, via suppository, via infusion, via drip, orally or via other convenient means.
  • the pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of modulating AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression or AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 activity.
  • the vector may, for example, be a viral vector.
  • the pharmaceutical composition may also comprise synthetic si-RNA molecules (chemically modified and non-modified) as well as a range of sh-RNA, mh- RNA and ddR Ai constructs.
  • Still another aspect of the present invention is directed to antibodies to AGT-301, AGT- 302, AGT-303, AGT-304 and AGT-305 and their derivatives and homologs insofar as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 are proteins.
  • Such antibodies may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or may be specifically raised to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or derivatives or homologs thereof.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their derivatives or homologs may first need to be associated with a carrier molecule.
  • the antibodies and/or recombinant AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 or their derivatives of the present invention are particularly useful as therapeutic or diagnostic agents.
  • An antibody "to" a molecule includes an antibody specific for said molecule.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and their derivatives can be used to screen for naturally occurring antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 which may occur in certain autoimmune diseases.
  • specific antibodies can be used to screen for AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305.
  • Techniques for such assays are well known in the art and include, for example, sandwich assays and ELISA.
  • Antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 of the present invention may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or may be specifically raised to these gene products. In the case of the latter, the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 protein may need first to be associated with a carrier molecule. Alternatively, fragments of antibodies may be used such as Fab fragments. Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies. The antibodies of this aspect of the present invention are particularly useful for immunotherapy and may also be used as a diagnostic tool or as a means for purifying AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • specific antibodies can be used to screen for AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 proteins.
  • the latter would be important, for example, as a means for screening for levels of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a cell extract or other biological fluid or purifying AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 made by recombinant means from culture supernatant fluid.
  • Techniques for the assays contemplated herein are known in the art and include, for example, sandwich assays and ELISA.
  • any second antibodies (monoclonal, polyclonal or fragments of antibodies) directed to the first mentioned antibodies discussed above. Both the first and second antibodies may be used in detection assays or a first antibody may be used with a commercially available anti-immunoglobulin antibody.
  • An antibody as contemplated herein includes any antibody specific to any region of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • Both polyclonal and monoclonal antibodies are obtainable by immunization with the enzyme or protein and either type is utilizable for immunoassays.
  • the methods of obtaining both types of sera are well known in the art.
  • Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, or antigenic parts thereof, collecting serum from the animal, and isolating specific sera by any of the known immunoadsorbent techniques.
  • antibodies produced by this method are utilizable in virtually any type of immunoassay, they are generally less favoured because of the potential heterogeneity of the product.
  • the use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product.
  • the preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art. (See, for example, Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981; Kohler and Milstein, Nature 256: 495-499, 1975; Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976.)
  • Another aspect of the present invention contemplates a method for detecting AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative or homolog thereof in a biological sample from a subject, said method comprising contacting said biological sample with an antibody specific for AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 or their antigenic derivatives or homologs for a time and under conditions sufficient for a complex to form, and then detecting said complex.
  • the presence of the complex is indicative of the presence of AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305.
  • This assay may be quantitated or semi-quantitated to determine a propensity to develop obesity or other conditions or to monitor a therapeutic regimen.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 may be accomplished in a number of ways such as by Western blotting and ELISA procedures.
  • a wide range of immunoassay techniques are available as can be seen by reference to U.S. Patent Nos. 4,016,043, 4,424,279 and 4,018,653. These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody to a target.
  • Sandwich assays are among the most useful and commonly used assays. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule.
  • a second antibody specific to the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, labeled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex of antibody-AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305-labeled antibody.
  • AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 is determined by observation of a signal produced by the reporter molecule.
  • the results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of hapten.
  • Variations on the forward assay include a simultaneous assay, in which both sample and labelled antibody are added simultaneously to the bound antibody.
  • the sample is one which might contain AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 including cell extract, tissue biopsy or possibly serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid.
  • the sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.
  • the solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
  • the solid supports may be in the form of tubes, beads, discs or microplates, or any other surface suitable for conducting an immunoassay.
  • the binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex to the solid surface which is then washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g.
  • the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • the second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
  • An alternative method involves immobilizing the target molecules in the biological sample and then exposing the immobilized target to specific antibody which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labelling with the antibody.
  • a second labelled antibody specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.
  • reporter molecule as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative.
  • the most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules.
  • an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate.
  • glutaraldehyde or periodate As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan.
  • Commonly used enzymes include horseradish peroxidase, glucose oxidase, ⁇ -galactosidase and alkaline phosphatase, amongst others.
  • the substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include alkaline phosphatase and peroxidase.
  • fluorogenic substrates which yield a fluorescent product rather than the chromogenic substrates noted above.
  • the enzyme-labelled antibody is added to the first antibody hapten complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen- antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample.
  • a "reporter molecule” also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.
  • fluorescent compounds such as fluorescein and rhodamine
  • fluorescein and rhodamine may be chemically coupled to antibodies without altering their binding capacity.
  • the fluorochrome-labelled antibody When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody absorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope.
  • the fluorescent-labelled antibody is allowed to bind to the first antibody- hapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength. The fluorescence observed indicates the presence of the hapten of interest.
  • Immunofluorescence and EIA techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.
  • Suitable fluorochromes include, but are not limited to, fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), R-Phycoerythrin (RPE), and Texas Red.
  • FITC fluorescein isothiocyanate
  • TRITC tetramethylrhodamine isothiocyanate
  • RPE R-Phycoerythrin
  • Texas Red Texas Red
  • Other exemplary fluorochromes include those discussed by International Patent Publication No. WO 93/06121. Reference also may be made to the fluorochromes described in U.S. Patent Nos. 5,573,909 and 5,326,692. Alternatively, reference may be made to the fluorochromes described in U.S. Patent Nos.
  • the present invention also contemplates genetic assays such as involving, for example, PCR analysis to detect AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their derivatives.
  • Real-time PCR is also particularly useful for assaying for particular genetic molecules.
  • SYBR green real-time PCR is particularly useful.
  • compound used interchangeably herein to refer to a chemical compound that induces a desired pharmacological and/or physiological effect.
  • the terms also encompass pharmaceutically acceptable and pharmacologically active ingredients of those active agents specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like.
  • potentiator is an example of a compound, active agent, pharmacologically active agent, medicament, active and drug which modulates the level of expression or level of activity of a nucleic acid molecule or its expression product differentially expressed or present in a communally-reared P. obesus separated from other P. obesus animals from the same community.
  • modulates includes “upregulating” and “down-regulating” expression or activity. Up-regulation encompasses increasing expression of a nucleic acid molecule as well as manipulating a component of the downstream signaling pathway.
  • antagonist is an example of a compound, active agent, pharmacologically active agent, medicament, active and drug which down- regulates the level of expression of a nucleic acid molecule or the activity of its expression product. Down-regulation involves decreasing expression or the level of activity.
  • the present invention contemplates, therefore, compounds useful in up-regulating or down-regulating expression of a nucleic acid molecule or the activity of its expression product.
  • modulating or its derivatives, such as “modulate” or “modulation”, are used to describe up- or down-regulation.
  • the compounds are proposed to have an effect on modifying behavioral conditions such as anxiety or depression.
  • Reference to a "compound”, “active agent”, “pharmacologically active agent”, “medicament”, “active” and “drug” includes combinations of two or more actives.
  • a “combination” also includes multi-part such as a two-part pharmaceutical composition where the agents are provided separately and given or dispensed separately or admixed together prior to dispensation.
  • an agent as used herein mean a sufficient amount of the agent to provide the desired therapeutic or physiological effect such as elevating or reducing the level of expression or activity.
  • Undesirable effects e.g. side effects, are sometimes manifested along with the desired therapeutic effect; hence, a practitioner balances the potential benefits against the potential risks in determining what is an appropriate “effective amount”.
  • the exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, mode of administration and the like. Thus, it may not be possible to specify an exact "effective amount”. However, an appropriate "effective amount” in any individual case may be determined by one of ordinary skill in the art using only routine experimentation.
  • pharmaceutically acceptable carrier excipient or diluent
  • a pharmaceutical vehicle comprised of a material that is not biologically or otherwise undesirable, i.e. the material may be administered to a subject along with the selected active agent without causing any or a substantial adverse reaction.
  • Carriers may include excipients and other additives such as diluents, detergents, coloring agents, wetting or emulsifying agents, pH buffering agents, preservatives, and the like.
  • a "pharmacologically acceptable" salt, ester, emide, prodrug or derivative of a compound as provided herein is a salt, ester, amide, prodrug or derivative that this not biologically or otherwise undesirable.
  • treating and “treatment” as used herein refer to reduction in severity of the behavioral disorder or condition, prevention of the occurrence of symptoms of a behavioral disorder and improvement or remediation of conditions such as anxiety or depression.
  • the present invention provides, therefore, agents which antagonize or agonize (i.e. potentiate or activate) the subject differentially expressed nucleic acid molecules or their expression products.
  • the present invention contemplates methods of screening for such agents comprising, for example, contacting a candidate drug with an expression product or mRNA or DNA encoding same.
  • a candidate drug with an expression product or mRNA or DNA encoding same.
  • Such a molecule is referred to herein as a "target” or “target molecule”.
  • the screening procedure includes assaying (i) for the presence of a complex between the drug and the target, or (ii) an alteration in the expression levels of nucleic acid molecules encoding the target.
  • One form of assay involves competitive binding assays. In such competitive binding assays, the target is typically labeled. Free target is separated from any putative complex and the amount of free (i.e. uncomplexed) label is a measure of the binding of the agent being tested to target molecule. One may also measure the amount of bound, rather than free, target. It is also possible to label the compound rather than the target and to measure the amount of compound binding to target in the presence and in the absence of the
  • Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a target and is described in detail in Geysen (International Patent Publication No. WO 84/03564). Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with a target and washed. Bound target molecule is then detected by methods well known in the art. This method may be adapted for screening for non-peptide, chemical entities. This aspect, therefore, extends to combinatorial approaches to screening for target antagonists or agonists of the target.
  • Purified target can be coated directly onto plates for use in the aforementioned drug screening techniques.
  • non-neutralizing antibodies to the target may also be used to immobilize the target on the solid phase.
  • Antibodies specific for a target may also be useful as inhibitors such as in the treatment of anxiety or depression.
  • the present invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of specifically binding the target compete with a test compound for binding to the target or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants of the target.
  • Antibodies to a target may be polyclonal or monoclonal as described above although monoclonal antibodies are preferred. Antibodies may be prepared by any of a number of means. For the detection of a target, antibodies are generally but not necessarily derived from non-human animals such as primates, livestock animals (e.g. sheep, cows, pigs, goats, horses), laboratory test animals (e.g.
  • mice, rats, guinea pigs, rabbits) and companion animals e.g. dogs, cats.
  • antibody based assays are conducted in vitro on cell or tissue biopsies.
  • an antibody is suitably deimmunized or, in the case of human use, humanized, then the antibody can be labeled with, for example, a nuclear tag, administered to a subject and the site of nuclear label accumulation determined by radiological techniques.
  • the target antibody is regarded, therefore, as a marker targeting agent. Accordingly, the present invention extends to deimmunized forms of the antibodies for use in target imaging in human and non-human subjects.
  • an antibody is destined for use as a therapeutic agent such as to inhibit a target, it will need to be deimmunized with respect to the host into which it will be introduced (e.g. a human).
  • the deimmunization process may take any of a number of forms including the preparation of chimeric antibodies which have the same or similar specificity as the monoclonal antibodies prepared according to the present invention.
  • Chimeric antibodies are antibodies whose light and heavy chain genes have been constructed, typically by genetic engineering, from immunoglobulin variable and constant region genes belonging to different species.
  • CDRs complementary determining regions
  • the deimmunizing process is specific for humans. More particularly, the CDRs can be grafted onto a human antibody variable region with or without human constant regions.
  • the non-human antibody providing the CDRs is typically referred to as the "donor” and the human antibody providing the framework is typically referred to as the "acceptor”. Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e.
  • a humanized antibody is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin.
  • a donor antibody is said to be “humanized”, by the process of "humanization”, because the resultant humanized antibody is expected to bind to the same antigen as the donor antibody that provides the CDRs.
  • Reference herein to "humanized” includes reference to an antibody deimmunized to a particular host, in this case, a human host.
  • deimmunized antibodies may have additional conservative amino acid substitutions which have substantially no effect on antigen binding or other immunoglobulin functions.
  • Exemplary conservative substitutions may be made according to Table 4.
  • the present invention contemplates a deimmunized antibody molecule having specificity for an epitope recognized by a monoclonal antibody to a target wherein at least one of the CDRs of the variable domain of said deimmunized antibody is derived from the said monoclonal antibody to said target and the remaining immunoglobulin-derived parts of the deimmunized antibody molecule are derived from an immunoglobulin or an analog thereof from the host for which the antibody is to be deimmunized.
  • This aspect of the present invention involves manipulation of the framework region of a non-human antibody.
  • mutants and derivatives of the subject antibodies extends to mutants and derivatives of the subject antibodies but which still retain specificity for the target.
  • mutant or derivatives includes one or more amino acid substitutions, additions and/or deletions.
  • CDR includes CDR structural loops which covers to the three light chain and the three heavy chain regions in the variable portion of an antibody framework region which bridge ⁇ strands on the binding portion of the molecule. These loops have characteristic canonical structures (Chothia et al, J. Mol. Biol 196: 901, 1987; Chothia et al, J. Mol. Biol. 227: 799, 1992).
  • framework region region of an immunoglobulin light or heavy chain variable region, which is interrupted by three hypervariable regions, also called CDRs.
  • the extent of the framework region and CDRs have been precisely defined (see, for example, Kabat et al, "Sequences of Proteins of Immunological Interest", U.S. Department of Health and Human Sciences, 1983).
  • the sequences of the framework regions of different light or heavy chains are relatively conserved within a species.
  • a “human framework region” is a framework region that is substantially identical (about 85% or more, usually 90-95% or more) to the framework region of a naturally occurring human immunoglobulin.
  • the framework region of an antibody that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs.
  • the CDRs are primarily responsible for binding to an epitope of the target.
  • the term “heavy chain variable region” means a polypeptide which is from about 110 to 125 amino acid residues in length, the amino acid sequence of which corresponds to that of a heavy chain of a monoclonal antibody of the invention, starting from the amino-terminal (N-terminal) amino acid residue of the heavy chain.
  • the term “light chain variable region” means a polypeptide which is from about 95 to 130 amino acid residues in length, the amino acid sequence of which corresponds to that of a light chain of a monoclonal antibody of the invention, starting from the N-terminal amino acid residue of the light chain.
  • Full-length immunoglobulin "light chains” (about 25 Kd or 214 amino acids) are encoded by a variable region gene at the NH 2 -terminus (about 110 amino acids) and a K or ⁇ constant region gene at the COOH-terminus.
  • Full-length immunoglobulin "heavy chains” (about 50 Kd or 446 amino acids), are similarly encoded by a variable region gene (about 116 amino acids) and one of the other aforementioned constant region genes, e.g. ⁇ (encoding about 330 amino acids).
  • immunoglobulin or "antibody” is used herein to refer to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes.
  • the recognized immunoglobulin genes include the K. ⁇ , ⁇ . ⁇ (IgG ls IgG 2 , IgG 3 , IgG 4 ), ⁇ . ⁇ and ⁇ constant region genes, as well as the myriad immunoglobulin variable region genes.
  • One form of immunoglobulin constitutes the basic structural unit of an antibody. This form is a tetramer and consists of two identical pairs of immunoglobulin chains, each pair having one light and one heavy chain.
  • immunoglobulins may exist in a variety of other forms including, for example, Fv, Fab, Fab' and (Fab') 2 .
  • the present invention also contemplates the use and generation of fragments of monoclonal antibodies produced by the method of the present invention including, for example, Fv, Fab, Fab' and F(ab') 2 fragments.
  • fragments may be prepared by standard methods as for example described by Coligan et al. (1991-1997, supra).
  • the present invention also contemplates synthetic or recombinant antigen-binding molecules with the same or similar specificity as the monoclonal antibodies of the invention.
  • Antigen-binding molecules of this type may comprise a synthetic stabilized Fv fragment.
  • Exemplary fragments of this type include single chain Fv fragments (sFv, frequently termed scFv) in which a peptide linker is used to bridge the N terminus or C terminus of a V# domain with the C terminus or N-terminus, respectively, of a Y L domain.
  • sFv single chain Fv fragments
  • ScFv lack all constant parts of whole antibodies and are not able to activate complement.
  • Suitable peptide linkers for joining the V # and V ⁇ domains are those which allow the V # and Vz, domains to fold into a single polypeptide chain having an antigen binding site with a three dimensional structure similar to that of the antigen binding site of a whole antibody from which the Fv fragment is derived.
  • Linkers having the desired properties may be obtained by the method disclosed in U.S. Patent No 4,946,778. However, in some cases a linker is absent.
  • ScFvs may be prepared, for example, in accordance with methods outlined in Krebber et al. (J. Immunol. Methods 201(1): 35-55,1997). Alternatively, they may be prepared by methods described in U.S. Patent No 5,091,513, European Patent No 239,400 or the articles by Winter and Milstein (Nature 349: 293, 1991) and Pl ⁇ ckthun et al. (In Antibody engineering: A practical approach, 203-252, 1996).
  • the synthetic stabilized Fv fragment comprises a disulphide stabilized Fv (dsFv) in which cysteine residues are introduced into the Y H and Vi domains such that in the fully folded Fv molecule the two residues will form a disulphide bond therebetween.
  • dsFv disulphide stabilized Fv
  • Suitable methods of producing dsFv are described, for example, in (Glockshuber et al, Biochem. 29: 1363-1367, 1990; Reiter et al, J. Biol. Chem. 269: 18327-18331, 1994; Reiter et al, Biochem. 33: 5451-5459, 1994; Reiter et al, Cancer Res. 54: 2714-2718, 1994; Webber et al, Mol. Immunol. 32: 249-258, 1995).
  • dAbs single variable region domains
  • the synthetic or recombinant antigen-binding molecule may comprise a "minibody".
  • minibodies are small versions of whole antibodies, which encode in a single chain the essential elements of a whole antibody.
  • the minibody is comprised of the V # and Vi domains of a native antibody fused to the hinge region and CH3 domain of the immunoglobulin molecule as, for example, disclosed in U.S. Patent No 5,837,821.
  • the synthetic or recombinant antigen binding molecule may comprise non-immunoglobulin derived, protein frameworks.
  • non-immunoglobulin derived, protein frameworks For example, reference may be made to (Ku & Schutz, Proc. Natl. Acad. Sci. USA 92: 6552-6556, 1995) which discloses a four-helix bundle protein cytochrome b562 having two loops randomized to create CDRs, which have been selected for antigen binding.
  • the synthetic or recombinant antigen-binding molecule may be multivalent (i.e. having more than one antigen binding site). Such multivalent molecules may be specific for one or more antigens. Multivalent molecules of this type may be prepared by dimerization of two antibody fragments through a cysteinyl-containing peptide as, for example disclosed by (Adams et al, Cancer Res. 53: 4026-4034, 1993; Cumber et al, J. Immunol. 149: 120- 126, 1992).
  • dimerization may be facilitated by fusion of the antibody fragments to amphiphilic helices that naturally dimerize (Pl ⁇ nckthun, Biochem 31: 1579- 1584, 1992) or by use of domains (such as leucine zippers jun and fos) that preferentially heterodimerize (Kostelny et al, J. Immunol. 148: 1547-1553, 1992).
  • Multivalent antibodies are useful, for example, in detecting different forms of target.
  • the present invention contemplates any compound which binds or otherwise interacts with a target, or a component of a target signaling pathway resulting in potentiation, activation or up-regulation or antagonism or down-regulation of the target.
  • peptide mimetic is intended to refer to a substance which has some chemical similarity to the target but which antagonizes or agonizes or mimics the target.
  • the target in this case may be an expression product of a differentially expressed nucleic acid molecule.
  • a peptide mimetic may be a peptide-containing molecule that mimics elements of protein secondary structure (Johnson et al, “Peptide Turn Mimetics” in Biotechnology and Pharmacy, Pezzuto et al, Eds., Chapman and Hall, New York, 1993).
  • peptide mimetics The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions such as those of antibody and antigen, enzyme and substrate or scaffolding proteins.
  • a peptide mimetic is designed to permit molecular interactions similar to the natural molecule.
  • Peptide or non-peptide mimetics may be useful, for example, to activate a target or to competitively inhibit a target.
  • the compounds of the present invention may be selected to interact with a target alone or single or multiple compounds may be used to affect multiple targets.
  • the target or fragment employed in screening assays may either be free in solution, affixed to a solid support, or borne on a cell surface.
  • One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant polynucleotides expressing the target or fragment, preferably in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays.
  • One may measure, for example, the formation of complexes between a target or fragment and the agent being tested, or examine the degree to which the formation of a complex between a target or fragment and a ligand is aided or interfered with by the agent being tested.
  • a substance identified as a modulator of target function or gene activity may be a peptide or non-peptide in nature.
  • Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
  • the designing of mimetics to a pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesize or where it is unsuitable for a particular method of administration, e.g. peptides are unsuitable active agents for oral compositions as they tend to he quickly degraded by proteases in the alimentary canal.
  • Mimetic design, synthesis and testing is generally used to avoid randomly screening large numbers of molecules for a target property.
  • the pharmacophore Once the pharmacophore has been found, its structure is modeled according to its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, x-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modeling process.
  • a range of sources e.g. spectroscopic techniques, x-ray diffraction data and NMR.
  • Computational analysis, similarity mapping which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms
  • other techniques can be used in this modeling process.
  • Modeling can be used to generate inhibitors which interact with the linear sequence or a three-dimensional configuration.
  • a template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted.
  • the template molecule and the chemical groups grafted onto it can conveniently be selected so that the mimetic is easy to synthesize, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound.
  • the mimetic is peptide-based
  • further stability can be achieved by cyclizing the peptide, increasing its rigidity.
  • the mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Further optimization or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.
  • the goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g. agonists, antagonists, inhibitors or enhancers) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g. enhance or interfere with the function of a polypeptide in vivo. See, e.g. Hodgson (Bio/Technology 9: 19-21, 1991).
  • one first determines the three-dimensional structure of a target by x-ray crystallography, by computer modeling or most typically, by a combination of approaches. Useful information regarding the structure of a target may also be gained by modeling based on the structure of homologous proteins.
  • Proteomics may be also be used to screen for components which interact with a target.
  • the present invention extends to a genetic approach to up-regulating or down-regulating expression of a gene encoding a target.
  • genetic means to induce gene silencing such as pre- or post-transcriptional gene silencing.
  • general techniques can be used to up-regulate expression such as by increasing gene copy numbers or antagonizing inhibitors of gene expression.
  • nucleic acids include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
  • modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog (such as the morpholine ring), internucleotide modifications such as uncharged linkages (e.g. methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g.
  • phosphorothioates phosphorodithioates, etc.
  • pendent moieties e.g. polypeptides
  • intercalators e.g. acridine, psoralen, etc.
  • chelators e.g. acridine, psoralen, etc.
  • alkylators e.g. ⁇ -anomeric nucleic acids, etc.
  • synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen binding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.
  • Antisense polynucleotide sequences are useful in silencing transcripts of target genes. Expression of such an antisense construct within a cell interferes with target gene transcription and/or translation. Furthermore, co-suppression and mechanisms to induce RNAi or siRNA may also be employed. Alternatively, antisense or sense molecules may be directly administered. In this latter embodiment, the antisense or sense molecules may be formulated in a composition and then administered by any number of means to target cells.
  • morpholinos are oligonucleotides composed of morpholine nucleotide derivatives and phosphorodiamidate linkages (for example, Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997). Such compounds are injected into embryos and the effect of interference with mRNA is observed.
  • the present invention employs compounds such as oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules such as those encoding a target, i.e. the oligonucleotides induce pre-transcriptional or post- transcriptional gene silencing.
  • the oligonucleotides induce pre-transcriptional or post- transcriptional gene silencing. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding the target gene transcription.
  • the oligonucleotides may be provided directly to a cell or generated within the cell.
  • target nucleic acid and “nucleic acid molecule encoding a target gene transcript” have been used for convenience to encompass DNA encoding the target, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA.
  • RNA including pre-mRNA and mRNA or portions thereof
  • cDNA derived from such RNA.
  • antisense The hybridization of a compound of the subject invention with its target nucleic acid is generally referred to as "antisense”.
  • antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
  • the functions of DNA to be interfered with can include replication and transcription.
  • Replication and transcription for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise.
  • the functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
  • the result of such interference with target transcript function is reduced levels of the target.
  • modulation and modulation of expression mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • hybridization means the pairing of complementary strands of oligomeric compounds.
  • the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds.
  • nucleobases complementary nucleoside or nucleotide bases
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • Hybridization can occur under varying circumstances.
  • An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
  • these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops.
  • the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.
  • RNAse H a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
  • antisense compound is a single-stranded antisense oligonucleotide
  • dsRNA double-stranded RNA
  • oligomeric compound refers to a polymer or oligomer comprising a plurality of monomeric units.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent intemucleoside (backbone) linkages as well as oligonucleotides having non-na urally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
  • oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those herein described.
  • the open reading frame (ORF) or "coding region” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is a region which may be effectively targeted. Within the context of the present invention, one region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
  • target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene).
  • 5'UTR 5' untranslated region
  • 3'UTR 3' untranslated region
  • the 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.
  • eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns", which are excised from a transcript before it is translated. The remaining (and, therefore, translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence.
  • Targeting splice sites i.e. intron- exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites.
  • fusion transcripts mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
  • nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base.
  • the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • linear compounds are generally preferred.
  • linear compounds may have internal nucleobase complementarity and may, therefore, fold in a manner as to produce a fully or partially double-stranded compound.
  • the phosphate groups are commonly referred to as forming the intemucleoside backbone of the oligonucleotide.
  • the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • oligonucleotides containing modified backbones or non-natural intemucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to
  • Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • the antisense oligonucleotides may be administered by any convenient means including by inhalation, local or systemic means.
  • genetic constructs including DNA vaccines are used to generate antisense molecules in vivo.
  • many of the preferred features described above are appropriate for sense nucleic acid molecules or for gene therapy applications to promote levels of targets.
  • the above discussion in relation to antisense molecules equally applies to sense molecules including a range of si-RNA, sh- RNA, mh-RNA and ddRNAi constructs or DNA vectors encoding same.
  • synthetic forms of si-RNA, sh-RNA and mh-RNA may be administered.
  • an agent which potentiates or antagonizes a target may be manufactured and/or used in a preparation, i.e. in the manufacture or formulation or a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals in a method of treatment or prophylaxis of inection. Alternatively, they may be incorporated into a patch or slow release capsule or implant.
  • the present invention extends, therefore, to a pharmaceutical composition, medicament, drug or other composition including a patch or slow release formulation comprising an agonist or antagonist of target activity or target gene expression or the activity or gene expression of a component of the target.
  • Another aspect of the present invention contemplates a method comprising administration of such a composition to a subject such as for treatment or prophylaxis of an infection or other disease condition.
  • the present invention contemplates a method of making a pharmaceutical composition comprising admixing a compound of the instant invention with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients. Where multiple compositions are provided, then such compositions may be given simultaneously or sequentially. Sequential administration includes administration within nanoseconds, seconds, minutes, hours or days. Preferably, sequential administration is within seconds or minutes.
  • Another method includes providing a wild-type or mutant target gene function to a cell. This is particularly useful when generating an animal model. Alternatively, it may be part of a gene therapy approach.
  • a target gene or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. If a gene portion is introduced and expressed in a cell carrying a mutant target allele, the gene portion should encode a part of the target protein.
  • Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation calcium phosphate co-precipitation and viral transduction are known in the art.
  • Gene transfer systems known in the art may be useful in the practice of genetic manipulation. These include viral and non-viral transfer methods.
  • viruses have been used as gene transfer vectors or as the basis for preparing gene transfer vectors, including papovaviruses (e.g. SV40, Madzak et al, J. Gen. Virol. 73: 1533-1536, 1992), adenovirus (Berkner, Curr. Top. Microbiol. Immunol. 158: 39-66, 1992; Berkner et al, BioTechniques 6; 616-629, 1988; Gorziglia and Kapikian, J. Virol. 66: 4407-4412, 1992; Quantin et al, Proc. Natl. Acad. Sci.
  • herpesviruses including HSV and EBV (Margolskee, Curr. Top., Microbiol. Immunol. 158: 67-95, 1992; Johnson et l, J. Virol. 66: 2952-2965, 1992; Fink et al, Hum. Gene Ther. 3: 11-19, 1992; Breakefield and Geller, Mol. Neurobiol 1: 339-371, 1987; Freese et al, Biochem. Pharmacol. 40: 2189-2199, 1990; Fink et al, Ann. Rev. Neurosci.
  • Non-viral gene transfer methods are known in the art such as chemical techniques including calcium phosphate co-precipitation, mechanical techniques, for example, microinjection, membrane fusion-mediated transfer via liposomes and direct DNA uptake and receptor-mediated DNA transfer.
  • Viral-mediated gene transfer can be combined with direct in vivo gene transfer using liposome delivery, allowing one to direct the viral vectors to particular cells.
  • the retroviral vector producer cell line can be injected into particular tissue. Injection of producer cells would then provide a continuous source of vector particles.
  • plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein and the resulting complex is bound to an adenovirus vector.
  • the trimolecular complex is then used to infect cells.
  • the adenovirus vector permits efficient binding, internalization and degradation of the endosome before the coupled DNA is damaged.
  • Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is non-specific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration. If the polynucleotide encodes a sense or antisense polynucleotide or a ribozyme or DNAzyme, expression will produce the sense or antisense polynucleotide or ribozyme or DNAzyme. Thus, in this context, expression does not require that a protein product be synthesized.
  • the vector also contains a promoter functional in eukaryotic cells. The cloned polynucleotide sequence is under control of this promoter. Suitable eukaryotic promoters include those described above.
  • the expression vector may also include sequences, such as selectable markers and other sequences described herein.
  • AGT-301 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.
  • the initial nucleotide sequence identified is as follows :-
  • Na,K-ATPase (Na(+),K(+)-activated ATP phosphohydrolase) is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. As these gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle, the enzyme plays an essential role in cellular physiology. It is composed of two subunits, a large catalytic subunit ( ⁇ ) and a smaller glycoprotein subunit ( ⁇ a) of unknown function. Biochemical studies have demonstrated the existence of two isoforms of the catalytic subunit, ⁇ and ⁇ (+).
  • Kidney contains predominantly the ⁇ form, whereas both ⁇ and ⁇ (+) are found in brain, adipose tissue, and skeletal muscle.
  • a third isoform, ⁇ -III has been identified in rat brain.
  • Shull and Lingrel (1987, supra) identified separate genes encoding the ⁇ and ⁇ (+) isoforms. These genes were called ⁇ -A and ⁇ -B (ATP1A2), respectively.
  • ⁇ -C and ⁇ -D are isolated two other genes, termed ⁇ -C and ⁇ -D, one of which is physically linked to the ⁇ (+) gene; these genes showed nucleotide and deduced amino acid homology to the catalytic subunit cDNA sequences but did not correspond to any previously identified isoforms.
  • the ⁇ -2 isoform of sodium-potassium-ATPase predominates in neural and muscle tissues.
  • mice deficient in ATP1A2 expression exhibited neuronal deficits.
  • the brainstem breathing centre was found to be abnormal which resulted in a fatal deficit in the development of breathing rhythm in new born pups (Mosely et alJ. Biol. Chem. 278:5317-5324, 2003).
  • Further reports of the neurophysiology of ATP1A2 knockout mice showed significant apoptosis in the amygdala and piriform cortex mice homozygous for ATP1A2 deficiency (Ikeda et al. J. Neuroscience. 23: 4667- 4676, 2003).
  • mice heterozygous for ATP1A2 deficiency exhibited a much lower level of apoptosis in these centres however it was higher than that found in wild-type animals. These heterozygous mice survived to adulthood and demonstrated behavioural phenotype consistent with increased anxiety or depression. These findings suggest a role for ATP1 A2 in the development and maintenance of brain regions that control mood and emotion.
  • AGT-302 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.
  • the initial nucleotide sequence identified is as foliows:-
  • RPA3 Homo sapiens replication protein A3, 14kDa (RPA3), mRNA
  • Replication Protein A is a three-subunit single-stranded DNA-binding protein that has been isolated from human cells.
  • RPA Replication Protein A
  • AGT-303 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.
  • the nucleotide sequence is as follows:
  • AGT-304 was identified using microarray analysis of hypothalamus, depression time- course study ofP. obesus.
  • Proteolipid protein, or lipophilin is the primary constituent of myelin.
  • Diehl et al Proc. Natl. Acad Sci. USA ⁇ 5:9807-9811, 1986, isolated the human gene encoding PLP from a human genomic library. The gene encodes a 276- amino acid polypeptide with five strongly hydrophobic domains that interact with the lipid bilayer as trans- and cis- membrane segments. Diehl et al, 1986, supra determined that the human PLP gene contains seven exons and spans approximately 17 kb.
  • the two isoforms of the myelin proteolipid protein, PLP and DM20 are very hydrophobic integral membrane proteins that account for about half of the protein content of adult CNS myelin.
  • the mRNAs encoding them are synthesized through alternative splicing of the primary transcript of a single gene.
  • the nucleotide sequence of the protein-encoding regions of the PLP gene is highly conserved among all species studied (Yool et al, Hum. Molec. Genet. 9: 987-992, 2000).
  • PLP maps distal to PGKl(phosphoglycerate kinase 1) and proximal to PRPS (phosphoribosylpyrophosphate synthetase I); however, PLP showed complete cosegregation with ⁇ -galactosidase (GLA), suggesting it is very close to this gene.
  • GLA ⁇ -galactosidase
  • Defects in PLP are a cause of spastic paraplegia-2 (spg2), a form of x-linked hereditary spastic paraplegia (xl-hsp).
  • Hsp is a group of inherited degenerative spinal cord disorders characterized by a slow, gradual, progressive weakness and spasticity (stiffness) of the legs. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. Rate of progression and the severity of symptoms is quite variable. In mouse and rat, defects in plpl are the cause of the dismyelinating diseases jimpy and rumpshaker (mouse) and md (rat).
  • AGT-305 was identified using microarray analysis of hypothalamus, depression time- course study ofP. obesus.
  • EXAMPLE 18 AGT-305 gene expression as measured by SYBR Green Real Time PCR
  • AGT-301 gene expression was regulated in vivo by intracerebroventricular (ICV) antisense treatment in P. obesus.
  • ICV intracerebroventricular

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates generally to a nucleic acid molecule which is differentially expressed in at least hypothalamus tissue of Psammomys obesus under particular degrees of behavioral modifying conditions and to human and other mammalian homologs thereof. It is proposed that the nucleic acid molecule is differentially expressed under differing conditions including anxiety or depression. More particularly, the present invention uses microarray technology to identify genetic material which is expressed under particular behavioral conditions. It is proposed that the subject nucleic acid molecule and/or its expression product be used in therapeutic and diagnostic protocols for conditions such as treating, controlling or preventing anxiety or depression such as arising from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially-mediated behavioral conditions and/or disorders in a mammal and in particular a human. The subject nucleic acid molecule and its expression product or derivatives, homologs, analogs and mimetics thereof are proposed to be useful, therefore, as therapeutic and diagnostic agents for behavior-modifying conditions including anxiety and/or depression.

Description

NUCLEIC ACID MOLECULES DIFFERENTIALLY EXPRESSED IN ANIMALS EXHIBITING BEHAVIOURAL DISORDERS.
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates generally to a nucleic acid molecule which is differentially expressed in at least hypothalamus tissue of Psammomys obesus under particular degrees of behavioral modifying conditions and to human and other mammalian homologs thereof. It is proposed that the nucleic acid molecule is differentially expressed under differing conditions including anxiety or depression. More particularly, the present invention uses microarray technology to identify genetic material which is expressed under particular behavioral conditions. It is proposed that the subject nucleic acid molecule and/or its expression product be used in therapeutic and diagnostic protocols for conditions such as treating, controlling or preventing anxiety or depression such as arising from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially- mediated behavioral conditions and/or disorders in a mammal and in particular a human. The subject nucleic acid molecule and its expression product or derivatives, homologs, analogs and mimetics thereof are proposed to be useful, therefore, as therapeutic and diagnostic agents for. behavior-modifying conditions including anxiety and/or depression.
DESCRIPTION OF THE PRIOR ART
Bibliographic details of references provided in the subject specification are listed at the end of the specification.
Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country. Stress-related disorders have become increasingly common throughout the last 50 years. Noticeably, the prevalence rates of psychiatric diseases such as anxiety and depression have steadily increased. Indeed, the World Health Organization has estimated that by 2020 depression will be second only to ischemic heart disease as a cause of disability worldwide (Murray and Lopez, Lancet 349: 1498-1504, 1997)
Depression refers to a variety of human behavioral states related to feelings of sadness, apathy, futility and despair. The American Psychiatric Association characterizes depression as a dysphoric mood or loss of interest in activities that would normally be enjoyed (American Psychiatric Association, Diagnostic and statistical manual of mental disorders. Washington, D.C. Assoc. Am. Psychiatr. 4th edition, 1994). Symptoms include loss of energy, reduced appetite and sleep disturbance. As with most psychological states, the definition of clinical depression is complicated by a variety of factors. Depression is a complex disorder with contributions from both genetic and environmental factors that are not well defined.
The neurobiology of depression is complex and features the involvement of many anatomical regions of the brain. Magnetic resonance and other imaging studies suggest that loci such as the amygdala, hypothalamus and prefrontal cortex exhibit altered activation during anxiety and depression (reviewed in Drevets, Ann. Rev. Med. 49: 341-361, 1998). Although much is known regarding the role of neurotransmitters such as serotonin and norepinephrine in depression, underlying genetic changes associated with the depressive state and their role in depression is largely unclear. The finding that chronic treatment of patients with anti-depressive drugs is typically required to lessen the severity of symptoms suggests that changes in gene expression may be important to therapeutic outcomes.
The evaluation of animal models of depression has been based on three criteria. Face validity refers to the degree of symptomatic resemblance between the model and the clinical condition; predictive validity concerns the extent to which the model responds appropriately to drugs that are clinically effective and those that are not; construct validity addresses the theoretical rationale of the model. Several approaches have been used to generate animal models of depression, with varying degrees of success. These include:-
(1) Non-simulation models :- (a) Reserpine reversal;
( ) Amphetamine potentiation;
(c) Waiting behavior models;
(d) Circadian rhythm models;
(2) Stress models:-
(a) Learned helplessness;
(b) Behavioral despair;
(c) Failure to adapt to stress;
( Chronic unpredictable stress;
(e) Chronic mild stress;
(f) Amphetamine withdrawal;
(3) Separation models :-
(a) Non-human primate models;
(b) Distress calling in isolated chicks;
(c) Separation in pair-bonded hamsters;
(d) Social isolation in rats;
(4) Brain damage models:-
(a) Olfactory bulbectomy;
(5) Genetic model:-
(a) Flinders sensitive line rats. Each of these animal models has both positive and negative aspects when evaluated using the above criteria (reviewed by Willner, Handbook of Depression and Anxiety, (J.A. den Boer and J. M. Ad. Sisten, eds.), Marcek Dekker, New York, pp. 291-316, 1994).
Separation models have been used to investigate aspects of depression. Studies of separation-induced depression in monkeys, hamsters, chickens and rats have identified a range of atypical behaviors including reduced motor activity, decreased appetite and sleep disturbances (Jesberger and Richardson, Biol. Psychiatry 20: 764-784, 1985). Separation models, especially when conducted in non-human primates, show a significant symptomatic resemblance with clinical depression, however, the extent to which the model responds to drugs that are clinically effective has not been well studied. There is a need to develop more definitive separation models.
International Patent Application No. PCT/AU02/01254 [WO 03/024206] describes an animal model of ter alia depression comprising Psammomys obesus. In accordance with the present invention, this animal model is used to identify differentially expressed genetic material.
SUMMARY OF THE INVENTION
Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
A summary of genes identified in accordance with the present invention is provided in Table 1.
Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO:l), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 2. A sequence listing is provided after the claims.
Communally-raised P. obesus exhibit a depression-like response when separated into individual cages, as shown by a reduction in food intake and body weight for a period of approximately one week. This anorexia and loss of body weight is used as a marker for the depression phenotype. Assessment of animal behavior using an Open-Field Test (OFT) showed significant differences in , behavior between separated and communally-housed animals. The separated animals spent more time near the edges of the OFT apparatus and less time in the center. This effect was independent of weight loss or gain in separated animals. Other parameters such as the number of jumps and rears, the time spent moving or the number of ambulations were not significantly different in separated or communally- housed animals. The behavioral changes seen in separated animals are consistent with a depression phenotype.
The depression phenotype is classified as non-response, temporary response or constant response phenotype. A non-response animal is deemed to include an animal which exhibits no substantial alteration in behavior or in a range of physical parameters such as weight. A temporary-response animal, upon separation, exhibits a change in behavior and/or physical parameters but returns substantially to behavioral and/or physical parameters exhibited prior to separation within days or weeks. A constant-response animal exhibits a change in behavioral or physical parameter patterns and does not return to substantially the same patterns within days or weeks. The data from the P. obesus separation model of depression indicate that the model has both face and construct validity.
Microarray analysis was used in time course studies using the P. obesus animal model to identify changes in expression of genetic material.
cDNA microarray technology provides a powerful technical means to generate a gene expression database of both known genes and unknown transcripts. Using cDNA microarrays, comparative estimates can be obtained of the level of gene expression of large numbers of genes (up to 20,000 per microarray) in each sample. cDNA microarrays generally involve a large number of DNA "spots" in an orderly array chemically coupled to the surface of a solid substrate, usually but not exclusively an optically flat glass microscope slide. Fluorescently labeled cDNAs are generated from experimental and reference RNA samples and then competitively hybridized to the gene chip. The experimental and reference cDNAs are labeled with a different fluorescent dye and the intensity of each fluor at each DNA spot gives an indication of the level of that particular RNA species in the experimental sample relative to the reference RNA. The ratio of fluorescence can be taken as a measure of the expression level of the gene corresponding to that spot in the experimental sample.
In a preferred embodiment, five expressed sequences were identified designated herein AGT-301 [SEQ ID NOs:l and 6], AGT-302 [SEQ ID NOs:2 and 7], AGT-303 [SEQ ID NO:3], AGT-304 [SEQ ID NOs:4 and 8] and AGT-305 [SEQ ID NOs:5 and 9].
A summary of the AGT genes is provided in Table 1.
The present invention contemplates the use of these sequences or mammalian including human homologs thereof or their expression products in the manufacture of medicaments and diagnostic agents for a range of behavior conditions including anxiety and/or depression.
The present invention provides, therefore, a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleic acid molecule or its homolog is differentially expressed in hypothalamus of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
The present invention further provides a nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein the nucleotide sequence is as substantially set forth in SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs: 1 and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 and/or is capable of hybridizing to one or more of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs: 5 and 9 or a complementary form thereof under low stringency conditions at 42°C and wherein the nucleic acid molecule is differentially expressed in hypothalmus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
The present invention also provides an isolated expression product or a derivative, homolog, analog or mimetic thereof which expression product is encoded by a nucleotide sequence which is differentially expressed in hypothalamus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
More particularly, the present invention is directed to an isolated expression product or a derivative, homolog, analog or mimetic thereof wherein the expression product is encoded by a nucleotide sequence substantially as set forth in SEQ ID NOs:l and 6, SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a nucleotide sequence having at least 30% similarity to all or part of SEQ ID NOs:l and 6, SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 and/or is capable of hybridizing to SEQ ID NOs:l and 6, SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a complementary form thereof under low stringency conditions at 42°C.
Reference to "homolog" includes other mammalian homologs such as from a human.
The preferred genetic sequence of the present invention are referred to herein as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305. The expression products encoded by AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 are referred to herein as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, respectively. The expression product may be an RNA (e.g. mRNA) or a protein. Where the expression product is an RNA, the present invention extends to RNA-related molecules associated thereto such as RNAi or intron or exon sequences therefrom or short, interfering RNA (si-RNA) or complexes comprising same.
Even yet another aspect of the present invention relates to a composition comprising AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or its derivatives, homologs, analogs or mimetics or agonists or antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 together with one or more pharmaceutically acceptable carriers and/or diluents.
The present invention is particularly directed to human homologs of the genes identified in P. obesus and their use in therapy and diagnosis.
Another aspect of the present invention contemplates, therefore, a method for treating a subject comprising administering to said subject a treatment effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog, analog or mimetic thereof or a genetic sequence encoding same or an agonist or antagonist of AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 activity or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 gene expression for a time and under conditions sufficient to effect treatment.
In accordance with this and other aspects of the present invention, treatments contemplated herein include but are not limited to behavioral disorders or conditions such as anxiety and/or depression. Such disorders may result from physiological or mental imbalance, alcohol and/or drug abuse or other genetically-, drug- or socially-mediated behavioral condition or disorder. Treatment may be by the administration of a pharmaceutical composition or genetic sequences via gene therapy, antisense therapy or sense or RNAi- or si-RNA-mediated therapy. Treatment is contemplated for human subjects as well as animals such as animals important to livestock industry.
A further aspect of the present invention is directed to a diagnostic agent for use in monitoring or diagnosing conditions such as but not limited to behavioral conditions or disorders including anxiety or depression, said diagnostic agent selected from an antibody to AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or its derivatives, homologs, analogs or mimetics and a genetic sequence comprising or capable of annealing to a nucleotide strand associated with AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 useful røter alia in PCR, hybridization, RFLP analysis or AFLP analysis.
TABLE1
Summary ofAGT Genes
Figure imgf000011_0001
A summary of sequence identifiers used throughout the subject specification is provided in Table 2.
TABLE 2 Summary of Sequence Identifiers
Figure imgf000012_0001
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graphical representation of AGT-302 gene expression versus jumps. AGT-302 gene expression negatively correlates with the number of jumps (p=0.025) in the Open- Field Test.
Figure 2 is a graphical representation of AGT-304 gene expression versus outer ambulations. AGT-304 gene expression negatively correlates with the number of outer ambulations (p=0.006) in the Open-Field Test.
Figure 3 is a graphical representation of AGT-305 gene expression versus outer ambulations. AGT-305 gene expression negatively correlates with the number of outer ambulations (p=0.01) in the Open-Field Test.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is predicated in part on the phenotypes exhibited by communally- reared or maintained P. obesus animals after separation from each other. Such separation is referred to as "social separation". The phenotypes are classified as non-response, temporary response or constant response phenotype. A non-response animal is deemed to include an animal which exhibits no substantial alteration in behavior or in a range of physical parameters such as weight. A temporary-response animal, upon separation, exhibits a change in behavior and/or physical parameters but returns substantially to behavioral and/or physical parameters exhibited prior to separation within days or weeks. A constant-response animal exhibits a change in behavioral or physical parameter patterns and does not return to substantially the same patterns within days or weeks.
Such animals represent an animal model for behavioral conditions such as anxiety or depression.
The present invention provides genetic material associated ter alia with such behavioral conditions. The genes are identified following differential screening of mRNA from hypothalamus tissue at various times following separation and isolation of communally- reared P. obesus animals. The selection of hypothalamus tissue is not intended to imply that differential expression does not occur in other tissue. The present invention further extends to homologs in other mammals and in particular humans as well as in other animals or organisms.
Accordingly, one aspect of the present invention provides a differentially expressed isolated nucleic acid molecule from a P. obesus animal, which animal is subjected to separation or isolation from other P. obesus animals from the same community and which animal exhibits at least one phenotype selected from a non-response, temporary response or constant response phenotype. Reference to a behavioral condition or disorder includes conditions such as anxiety, depression, change in eating patterns such as leading to weight loss or weight gain, stress or despair amongst a range of other conditions. It is proposed, therefore, that the subject nucleic acid molecule is useful in the study of and development of treatment and diagnostic protocols for conditions such as anxiety, depression, drug addiction and chemical substance dependence, anti-social behavior and various forms of attention deficit disorders.
The present invention provides, therefore, a method for assessing a behavioral disorder in P. obesus animals, said method comprising subjecting a plurality of communally-reared or maintained animals to social isolation from each other for a time and under conditions sufficient for one of three phenotypes to become apparent when said phenotypes are selected from non-response, temporary response and constant response phenotype and then screening for changes in expression of one or more nucleic acid molecules.
Reference to "communally-reared or maintained" means the animals have been maintained together since birth or since shortly after birth (i.e. within days or weeks or months of birth) or have been maintained with at least one other animal shortly after birth. The "other animal" may be the same type of animal or a different type of animal. The term "communally" generally means that two or more animals are maintained in a single enclosure but also extends to enclosures where the animals are physically separated from each other but are able to at least view each other or more preferably are able to engage in some form of body contact with each other such as touching, licking or grooming.
A "plurality" of animals means two or more animals preferably three or more and even more preferably from about four to about 500 or from about five to about 100 or from about six to 80 animals.
As stated above, the subject animal model may be used to screen for the presence of nucleic acid molecules whose expression is altered under adverse behavioral-modifying conditions such as separation. Accordingly, another aspect of the present invention contemplates a method for identifying a nucleic acid molecule whose expression is altered following a behavioral-modifying protocol applied to a P. obesus animal model, said method comprising subjecting a plurality of communally-reared or maintained P. obesus animals to said protocol comprising socially separating said animals and determining whether there is any alteration in expression of a nucleic acid molecule.
In particular, the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleic acid molecule is differentially expressed in hypothalamus tissue of communally-reared P. obesus animals subjected to isolation from other P. obesus animals from the same community.
The term "differentially expressed" is used in its most general sense and includes elevated levels of an expression product such as mRNA or protein or a secondary product such as cDNA in one tissue compared to another tissue or in the same tissue but under different conditions. Examples of different conditions includes differential expression in tissue from fed and fasted animals or in exercise trained and control animals. Differential expression is conveniently determined by a range of techniques including polymerase chain reaction (PCR) such as real-time PCR. Other techniques include suppression subtractive hyridization (SSH) and amplified fragment length polymorphism (AFLP) analysis. Microarray analysis of cDNA is particularly preferred.
A homolog refers to a genetic sequence in another animal or organism which has at least about 20% identity to the reference sequence. A preferred homolog is a human homolog.
In accordance with the present invention, a number of differentially expressed genetic sequences were identified in hypothalamus tissue in P. obesus under behavioral-modifying conditions such as isolation and/or separation. Another aspect of the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NOs:l and 6 (AGT-301) or SEQ ID NOs:2 and 7 (AGT-302) or SEQ ID NO:3 (AGT-303) or SEQ ID NOs:4 and 8 (AGT-304) or SEQ ID NOs: 5 and 9 (AGT-305) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 and/or is capable of hybridizing to one or more of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs: 5 and 9 or a complementary form thereof under low stringency conditions at 42°C and wherein said nucleic acid molecule is differentially expressed in hypothalamus muscle tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
Higher similarities are also contemplated by the present invention such as greater than about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% or above.
An expression product includes an RNA molecule such as an mRNA transcript as well as a protein. Some genes are non-protein encoding genes and produce mRNA or other RNA molecules and are involved in regulation by RNA:DNA, RNA:RNA or RNA:protein interaction. Other genes encode mRNA transcripts which are then translated into proteins. A protein includes a polypeptide. The differentially expressed nucleic acid molecules, therefore, may encode mRNAs only or, in addition, proteins. Both mRNAs and proteins are forms of "expression products".
Reference herein to similarity is generally at a level of comparison of at least 15 consecutive or substantially consecutive nucleotides. It is particularly convenient, however, to determine similarity by comparing a total or complete sequence, after optimal alignment. The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which may encode different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide sequence comparisons are made at the level of identity rather than similarity.
Terms used to describe sequence relationships between two or more polynucleotides include "reference sequence", "comparison window", "sequence similarity", "sequence identity", "percentage of sequence similarity", "percentage of sequence identity", "substantially similar" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units in length. Because two polynucleotides may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, Chapter 15, 1994-1998). A range of other algorithms may be used to compare the nucleotide and amino acid sequences such as but not limited to PILEUP, CLUSTALW, SEQUENCHER or VectorNTI.
The terms "sequence similarity" and "sequence identity" as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by- nucleotide basis over a window of comparison. Thus, a "percentage of sequence identity", for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.
Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions. Generally, low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions. In general, washing is carried out Tm = 69.3 + 0.41 (G+C)% (Marmur and Doty, J. Mol. Biol. 5: 109, 1962). However, the Tra of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974). Formamide is optional in these hybridization conditions. , Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1% w/v SDS at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1%) w/v SDS at a temperature in the range 20°C to 65°C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65°C.
The nucleotide sequence or amino acid sequence of the present invention may correspond to exactly the same sequence of the naturally occurring gene (or corresponding cDNA) or protein or other expression product or may carry one or more nucleotide or amino acid substitutions, additions and/or deletions. The nucleotide sequences set forth in SEQ ID NOs:l and 6 (AGT-301), SEQ ID NOs:2 and 7 (AGT-302) and SEQ ID NO:3 (AGT-304) or SEQ ID NOs:4 and 8 (AGT-304) or SEQ ID NOs:5 and 9 (AGT-305) correspond to novel genes referred to in parenthesis. The corresponding expression products are AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305, respectively. Reference herein to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 includes, where appropriate, reference to the genomic gene or cDNA as well as any naturally occurring or induced derivatives. Apart from the substitutions, deletions and/or additions to the nucleotide sequence, the present invention further encompasses mutants, fragments, parts and portions of the nucleotide sequence corresponding to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
Another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:l and 6 (AGT-301) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:l and 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l and 6 or its complementary form under low stringency conditions. Yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:2 and 7 (AGT-302) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:2 and 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:2 and 7 or its complementary form under low stringency conditions.
Still yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO: 3 (AGT-303) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 or their complementary forms under low stringency conditions.
Even yet another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:4 and 8 (AGT-304) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:4 and 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 and 8 or its complementary form under low stringency conditions.
Even still another aspect of the present invention provides a nucleic acid molecule or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:5 and 9 (AGT-305) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs: 5 and 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 5 and 9 or its complementary form under low stringency conditions.
Reference herein to "at least 30%" includes sequences having at least about 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% similarity or identity to the reference sequence.
The expression pattern of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 has been determined, ter alia, to indicate an involvement in or associated with a behavioral condition or disorder such as anxiety or depression. In addition to the differential expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in hypothalamus of communally-reared P. obesus animals versus separated animals, these genes may also be differentially expressed in other tissues including but not limited to brain, muscle, adipose tissue, pancreas or gastrointestinal tissue. The nucleic acid molecule corresponding to each of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 is preferably a DNA such as a cDNA sequence or a genomic DNA. A genomic sequence may also comprise exons and introns. A genomic sequence may also include a promoter region or other regulatory regions.
A homolog is considered to be a gene from another animal species which has the same or greater than 30% similarity to one of AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 and/or which has a similar function. The above-mentioned genes are exemplified herein from P. obesus hypothalamus. The present invention extends, however, to the homologous gene, as determined by nucleotide sequence and/or function, from humans, primates (lower and higher primates), livestock animals (e.g. cows, sheep, pigs, horses, donkeys), laboratory test animals (e.g. mice, guinea pigs, hamsters, rabbits), companion animals (e.g. cats, dogs) and captured wild animals (e.g. rodents, foxes, deer, kangaroos). Homologs may also be present in microorganisms and C. elegans. The nucleic acids of the present invention and in particular AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and their derivatives and homologs may be in isolated or purified form and/or may be ligated to a vector such as an expression vector. Expression may be in a eukaryotic cell line (e.g. mammalian, insect or yeast cells) or in prokaryote cells (e.g. E. coli) or in both. By "isolated" is meant a nucleic acid molecule having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject nucleic acid molecule, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%), even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject nucleic acid molecule relative to other components as determined by molecular weight, encoding activity, nucleotide sequence, base composition or other convenient means. The nucleic acid molecule of the present invention may also be considered, in a preferred embodiment, to be biologically pure. The nucleic acid molecule may be ligated to an expression vector capable of expression in a prokaryotic cell (e.g. E. coli) or a eukaryotic cell (e.g. yeast cells, fungal cells, insect cells, mammalian cells or plant cells). The nucleic acid molecule may be ligated or fused or otherwise associated with a nucleic acid molecule encoding another entity such as, for example, a signal peptide. It may also comprise additional nucleotide sequence information fused, linked or otherwise associated with it either at the 3' or 5' terminal portions or at both the 3' and 5' terminal portions. The nucleic acid molecule may also be part of a vector, such as an expression vector.
The derivatives of the nucleic acid molecule of the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in co- suppression (including sense RNA or DNA, RNA interference (RNAi), short interfering RNA (si-RNA), single hairpin RNA (sh-RNA), multiple hairpin RNA (mh-RNA) and DNA-directed RNAi (ddRNAi). An "RNAi" molecule may be produced by in vitro chemical synthesis or in vitro transcription or in vivo transcription. A "synthetic" RNAi chemical modified at its 3' or 5' or at the level of a nucleotide or linkage between nucleotides are also herein contemplated. Ribozymes and DNAzymes are also contemplated by the present invention directed to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their mRNAs. Derivatives and homologs of AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305 are conveniently encompassed by those nucleotide sequences capable of hybridizing to one or more of SEQ ID NOs:l or 6, SEQ ID NOs:2 or 7 or SEQ ID NO:3 or SEQ ID NOs:4 or 8 or SEQ ID NOs:5 or 9 or a complementary form thereof under low stringency conditions.
Derivatives include fragments, parts, portions, mutants, variants and mimetics from natural, synthetic or recombinant sources including fusion nucleic acid molecules. Derivatives may be derived from insertion, deletion or substitution of nucleotides.
Another aspect of the present invention provides an isolated expression product or a derivative, homolog, analog or mimetic thereof which is produced in larger or lesser amounts in hypothalamus tissue of a communally-reared P. obesus animal separated from other P. obesus animals from the same community.
An expression product, as indicated above, may be RNA or protein. Insofar as the product is a protein, derivatives include amino acid insertional derivatives such as amino and/or carboxylic terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in a protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterized by the removal of one or more amino acids from the sequence. Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. An example of substitutional amino acid variants are conservative amino acid substitutions. Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine. Additions to amino acid sequences include fusions with other peptides, polypeptides or proteins. Chemical and functional equivalents of protein forms of the expression products AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 should be understood as molecules exhibiting any one or more of the functional activities of these molecules and may be derived from any source such as being chemically synthesized or identified via screening processes such as natural product screening or screening of chemical libraries.
The derivatives include fragments having particular epitopes or parts of the entire protein fused to peptides, polypeptides or other proteinaceous or non-proteinaceous molecules.
Reference herein to AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 includes reference to isolated or purified naturally occurring AGT-301, AGT-302, AGT-303, AGT- 304 or AGT-305 as well as any derivatives, homologs, analogs and mimetics thereof. Derivatives include parts, fragments and portions of AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 as well as single and multiple amino acid substitutions, deletions and/or additions to AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 when the expression products are proteins. A derivative of AGT-301, AGT-302, AGT-303, AGT- 304 or AGT-305 is conveniently encompassed by molecules encoded by a nucleotide sequence capable of hybridizing to SEQ ID NOs:l or 6 or SEQ ID NOs:2 or 7 or SEQ ID NO:3 or SEQ ID NOs:4 or 8 or SEQ ID NOs:5 or 9 under low stringency conditions.
Other derivatives of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 include chemical analogs. Analogs of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 contemplated herein include, but are not limited to, modifications to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose confirmational constraints on the proteinaceous molecule or their analogs.
Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH4; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulfonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH4.
The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
The carboxyl group may be modified by carbodumide activation via O-acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide.
Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
Tryptophan residues may be modified by, for example, oxidation with N- bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate. Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3- hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, omithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids. A list of unnatural amino acid, contemplated herein is shown in Table 3.
TABLE 3 Codes for non-conventional amino acids
Non-conventional Code Non-conventional Code amino acid amino acid
α-aminobutyric acid Abu L-N-methylalanine Nmala α-amino-α-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-Nmethylhistidine Nmhis cyclopentylalanine Cpen L-N-methylisolleucine Nmile
D-alanine Dal L-N-methylleucine Nmleu
D-arginine Darg L-N-methyllysine Nmlys
D-aspartic acid Dasp L-N-methylmethionine Nmmet
D-cysteine Dcys L-N-methylnorleucine Nmnle
D-glutamine Dgln L-N-methylnorvaline Nmnva
D-glutamic acid Dglu L-N-methylornithine Nmorn
D-histidine Dhis L-N-methylphenylalanine Nmphe
D-isoleucine Dile L-N-methylproline Nmpro
D-leucine Dleu L-N-methylserine Nmser
D-lysine Dlys L-N-methylthreonine Nmthr
D-methionine Dmet L-N-methyltryptophan Nmtrp
D-ornithine Dorn L-N-methyltyrosine Nmtyr
D-phenylalanine Dphe L-N-methylvaline Nmval
D-proline Dpro L-N-methylethylglycine Nmetg
D-serine Dser L-N-methyl-t-butylglycine Nmtbug D-threonine Dthr L-norleucine Nle
D-tryptophan Dtrp L-norvaline Nva
D-tyrosine Dtyr α-methyl-aminoisobutyrate Maib
D-valine Dval α-methyl-γ-aminobutyrate Mgabu D-α-methylalanine Dmala α-methylcyclohexylalanine Mchexa
D-α-methylarginine Dmarg α-methylcylcopentylalanine Mcpen
D-α-methylasparagine Dmasn α-methyl-α-napthylalanine Manap
D-α-methylaspartate Dmasp α-methylpenicillamine Mpen
D-α-methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu D-α-methylglutamine Dmgln N-(2-aminoethyl)glycine Naeg
D-α-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn
D-α-methylisoleucine Dmile N-amino-α-methylbutyrate Nmaabu
D-α-methylleucine Dmleu α-napthylalanine Anap
D-α-methyllysine Dmlys N-benzylglycine Nphe D-α-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln
D-α-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn
D-α-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Nglu
D-α-methylproline Dmpro N-(carboxymethyl)glycine Nasp
D-α-methylserine Dmser N-cyclobutylglycine Ncbut D-α-methylthreonine Dmthr N-cycloheptylglycine Nchep
D-α-methyltryptophan Dmtrp N-cyclohexylglycine Nchex
D-α-methyltyrosine Dmty N-cyclodecylglycine Ncdec
D-α-methylvaline Dmval N-cylcododecylglycine Ncdod
D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro
D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund
D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl)glycine Nbhm
D-N-methylcysteine Dnmcys N-(3 ,3 -diphenylpropyι)glycine Nbhe
D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg D-N-methylglutamate Dnmglu N-(l-hydroxyethyl)glycine Nthr D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser
D-N-methylisoleucine Dnmile N-(imidazolylethyl))glycine Nhis
D-N-methylleucine Dnmleu N-(3-indolylyethyl)glycine Nhtrp
D-N-methyllysine Dnmlys N-methyl-γ-aminobutyrate Nmgabu N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet
D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen
N-methylglycine Nala D-N-methylphenylalanine Dnmphe
N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro
N-(l-methylpropyl)glycine Nile D-N-methylserine Dnmser N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr
D-N-methyltryptophan Dnmtrp N-( 1 -methylethyl)gly cine Nval
D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap
D-N-methylvaline Dnmval N-methylpenicillamine Nmpen γ-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys
L-ethylglycine Etg penicillamine Pen
L-homophenylalanine Hphe L-α-methylalanine Mala
L-α-methylarginine Marg L-α-methylasparagine Masn
L-α-methylaspartate Masp L-α-methyl-t-butylglycine Mtbug L-α-methylcysteine Mcys L-methylethylglycine ■ Metg
L-α-methylglutamine Mgln L-α-methylglutamate Mglu
L-α-methylhistidine Mhis L-α-methylhomophenylalanine Mhphe
L-α-methylisoleucine Mile N-(2-methylthioethyl)glycine Nmet
L-α-methylleucine Mleu L-α-methyllysine Mlys L-α-methylmethionine Mmet L-α-methylnorleucine Mnle
L-α-methylnorvaline Mnva L-α-methylornithine Morn
L-α-methylphenylalanine Mphe L-α-methylproline Mpro
L-α-methylserine Mser L-α-methylthreonine Mthr
L-α-methyltryptophan Mtrp L-α-methyltyrosine Mtyr L-α-methylvaline Mval L-N-methylhomophenylalanine Nmhphe N-(N-(2,2-diphenylethyl) Nnbbm N-(N-(3,3-diphenylproρyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)glycine
1 -carboxy- l-(2,2-diphenyl- Nmbc ethylamino)cyclopropane
Crosslinkers can be used, for example, to stabilize 3D conformations, using homo- bifunctional crosslinkers such as the bifunctional imido esters having (CH2)n spacer groups with n=l to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodumide (COOH). In addition, peptides can be conformationally constrained by, for example, incorporation of Cα and Nα-methylamino acids, introduction of double bonds between Cα and Cp atoms of amino acids and the formation of cyclic peptides or analogs by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.
All such modifications may also be useful in stabilizing the AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305 molecule for use in in vivo administration protocols or for diagnostic purposes.
As stated above, the expression product may be a RNA or protein.
The term "protein" should be understood to encompass peptides, polypeptides and proteins. The protein may be glycosylated or unglycosylated and/or may contain a range of other molecules fused, linked, bound or otherwise associated to the protein such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins. Reference hereinafter to a "protein" includes a protein comprising a sequence of amino acids as well as a protein associated with other molecules such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins. In a particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:l or 6 or a derivative, homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs:l or 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l or 6 or its complementary form under low stringency conditions.
In another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:2 or 7 or a derivative, homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs:2 or 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:2 or 7 or its complementary form under low stringency conditions.
In still another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NO:3 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NO:3 or a nucleotide sequence capable of hybridizing to SEQ ID NO:3 or their complementary form under low stringency conditions.
In yet another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:4 or 8 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs:4 or 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 or 8 or their complementary form under low stringency conditions.
In another particularly preferred embodiment, the expression product is encoded by a sequence of nucleotides comprising SEQ ID NOs:5 or 9 or a derivative homolog or analog thereof including a nucleotide sequence having at least about 30% similarity to SEQ ID NOs: 5 or 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 5 or 9 or its complementary form under low stringency conditions. Higher similarities are also contemplated by the present invention such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%.
Another aspect of the present invention is directed to an isolated expression product selected from the list consisting of:-
(i) an mRNA or protein encoded by a novel nucleic acid molecule which molecule is differentially expressed in hypothalamus tissue of communally-reard P. obesus animal subjected to isolation from other P. obesus animals from the same community or a derivative, homolog, analog, chemical equivalent or mimetic thereof;
(ii) an mRNA or protein encoded by a novel nucleic acid molecule which molecule is differentially expressed in hypothalamus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus aniamls from the same community or a derivative, homolog, analog, chemical equivalent or mimetic thereof;
(iii) AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 or a derivative, homolog, analog, chemical equivalent or mimetic thereof;
(iv) a protein encoded by a nucleotide sequence comprising SEQ ID NOs:l or 6 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(vi) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NOs:2 or 7 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30%) similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(vii) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO: 3 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(viii) a protein comprising an amino acid sequence substantially as set forth in SEQ ID NOs:4 or 8or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(ix) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NOs: 5 or 9 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30%) similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(x) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:l or 6 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;
(xi) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:2 or 7 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;
(xii) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO: 3 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions; (xiii) protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:4 or 8 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions; and
(xiv) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:5 or 9 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions.
The protein of the present invention is preferably in isolated form. By "isolated" is meant a protein having undergone at least one purification step and this is conveniently defined, for example, by a composition comprising at least about 10% subject protein, preferably at least about 20%, more preferably at least about 30%, still more preferably at least about 40-50%, even still more preferably at least about 60-70%, yet even still more preferably 80-90% or greater of subject protein relative to other components as determined by molecular weight, amino acid sequence or other convenient means. The protein of the present invention may also be considered, in a preferred embodiment, to be biologically pure.
In a preferred embodiment percentage similarity is applied to amino acid sequences and identity is applied to nucleic acid sequences.
Without limiting the theory or mode of action of the present invention, the expression or non-expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 is considered to be associated with anxiety or depression amongst other disorders. Modulation of expression of these genes is proposed to be useful in the treatment or prophylaxis of behavioral conditions such as anxiety or depression. Alternatively or in addition, the level of expression represents a useful diagnostic marker of various behavioral conditions.
The identification of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 permits the generation of a range of therapeutic molecules capable of modulating expression of AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 or modulating the activity of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305. Modulators contemplated by the present invention include agonists and antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression. Antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 expression include antisense molecules, ribozymes and co-suppression molecules (including si-RNA, sh-RNA, ddRNai and any molecule which induce RNAi including mh- RNAi). Agonists include molecules which increase promoter activity or which interfere with negative regulatory mechanisms. Antagonists of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 include antibodies and inhibitor peptide fragments. All such molecules may first need to be modified to enable such molecules to penetrate cell membranes. Alternatively, viral agents may be employed to introduce genetic elements to modulate expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305. In so far as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 act in association with other genes such as the ob gene which encodes leptin, the therapeutic molecules may target AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and ob genes or their translation products.
The present invention contemplates, therefore, a method for modulating expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a mammal, said method comprising contacting the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 gene with an effective amount of a modulator of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression for a time and under conditions sufficient to up-regulate or down- regulate or otherwise modulate expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
For example, a nucleic acid molecule encoding AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative or homolog thereof may be introduced into a cell to enhance the ability of that cell to produce AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, conversely, AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 sense and/or antisense sequences such as oligonucleotides may be introduced to decrease expression of the genes at the level of transcription, post-transcription or translation. Sense sequences preferably encode hair pin RNA molecules or double-stranded RNA molecules. Another aspect of the present invention contemplates a method of modulating activity of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a mammal, said method comprising administering to said mammal a modulating effective amount of a molecule for a time and under conditions sufficient to increase or decrease AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305 activity. The molecule may be a proteinaceous molecule or a chemical entity and may also be a derivative of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or its ligand.
Modulating levels of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 activity or function is important in the treatment of a range of conditions such as anxiety and depression. It may also be useful in the agricultural industry to assist in the generation of animals capable of existence in solitude. Accordingly, mammals contemplated by the present invention include but are not limited to humans, primates, livestock animals (e.g. pigs, sheep, cows, horses, donkeys), laboratory test animals (e.g. mice, rats, guinea pigs, hamsters, rabbits), companion animals (e.g. dogs, cats) and captured wild animals (e.g. foxes, kangaroos, deer). A particularly preferred host is a human, primate or livestock animal.
Accordingly, the present invention contemplates therapeutic and prophylactic use of AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 expression products or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 genetic mutants and/or agonists or antagonists agents thereof.
The present invention contemplates, therefore, a method of modulating expression of AGT- 301, AGT-302, AGT-303, AGT-304 and/or AGT-305 in a mammal, said method comprising contacting the AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 genes with an effective amount of an agent for a time and under conditions sufficient to up-regulate, down-regulate or otherwise modulate expression of AGT-301, AGT-302, AGT-303, AGT- 304 and AGT-305. Another aspect of the present invention contemplates a method of modulating activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 in a subject, said method comprising administering to said subject a modulating effective amount of an agent for a time and under conditions sufficient to increase or decrease AGT-301, AGT-302, AGT- 303, AGT-304 and/or AGT-305 activity or function.
Modulation of activity by the administration of an agent to a mammal can be achieved by one of several techniques, including, but in no way limited to, introducing into a mammal a proteinaceous or non-proteinaceous molecule which:
(i) modulates expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305;
(ii) functions as an antagonist of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305; and/or
(iii) functions as an agonist of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT- 305.
The molecules which may be administered to a mammal in accordance with the present invention may also be linked to a targeting means such as a monoclonal antibody, which provides specific delivery of these molecules to the target cells.
A further aspect of the present invention relates to the use of the invention in relation to mammalian disease conditions. For example, the present invention is particularly useful in treating behavioral conditions or disorders such as anxiety and/or depression.
Accordingly, another aspect of the present invention relates to a method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or sufficient to modulate the activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305.
In another aspect, the present invention relates to a method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305.
An agent includes proteinaceous or non-proteinaceous molecules such as antibodies, natural products, chemical entities or nucleic acid molecules (including antisense molecules, sense molecules, ribozymes, ds-RNA, ss-RNA molecules or DNA-targeting molecules).
In accordance with these methods, AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT- 305 or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or agents capable of modulating the expression or activity of said molecules may be co-administered with one or more other compounds or other molecules. By "co-administered" is meant simultaneous administration in the same formulation or in two different formulations via the same or different routes or sequential administration by the same or different routes. By "sequential" administration is meant a time difference of from seconds, minutes, hours or days between the administration of the two types of molecules. These molecules may be administered in any order.
In yet another aspect, the present invention relates to the use of an agent capable of modulating the expression of AGT-301, AGT-302, AGT-303, AGT-304 mdl ox AGT-305 or a derivative, homolog or analog thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.
In still yet another aspect, the present invention relates to the use of an agent capable of modulating the activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog, analog, chemical equivalent or mimetic thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.
A further aspect of the present invention relates to agents for use in modulating the expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog or analog thereof.
Yet another aspect relates to agents for use in modulating AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 activity or a derivative, homolog, analog, chemical equivalent or mimetic thereof.
Still another aspect of the present invention relates to AGT-301, AGT-302, AGT-303, AGT- 304 and/or AGT-305 or derivative, homolog or analog thereof or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or derivative, homolog, analog, chemical equivalent or mimetic thereof for use in treating a behavioral condition or disorder.
In a related aspect of the present invention, the mammal undergoing treatment may be a human or an animal in need of therapeutic or prophylactic treatment.
Accordingly, the present invention contemplates in one embodiment a composition comprising a modulator of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 activity and one or more pharmaceutically acceptable carriers and/or diluents. In another embodiment, the composition comprises AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative, homolog, analog or mimetic thereof and one or more pharmaceutically acceptable carriers and/or diluents.
For brevity, all such components of such a composition are referred to as "active components". The compositions of active components in a form suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or other medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
The preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active components in the required amount in the appropriate solvent with optionally other ingredients, as required, followed by sterilization by, for example, filter sterilization, irradiation or other convenient means. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
When AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 are suitably protected, they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 μg and 2000 mg of active compound.
The tablets, troches, pills, capsules and the like may also contain the following: A binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and formulations.
Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the novel dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired as herein disclosed in detail.
The principal active component may be compounded for convenient and effective administration in sufficient amounts with a suitable pharmaceutically acceptable carrier in dosage unit form. A unit dosage form can, for example, contain the principal active component in amounts ranging from 0.5 μg to about 2000 mg. Expressed in proportions, the active compound is generally present in from about 0.5 μg to about 2000 mg/ml of carrier. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
In general terms, effective amounts of AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 will range from 0.01 ng/kg/body weight to above 10,000 mg/kg/body weight. Alternative amounts range from 0.1 ng/kg/body weight to above 1000 mg/kg/body weight. The active ingredients may be administered per minute, hour, day, week, month or year depending on the condition being treated. The route of administration may vary and includes intravenous, intraperitoneal, sub-cutaneous, intramuscular, buccal, intranasal, via suppository, via infusion, via drip, orally or via other convenient means. The pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule capable of modulating AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression or AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 activity. The vector may, for example, be a viral vector. The pharmaceutical composition may also comprise synthetic si-RNA molecules (chemically modified and non-modified) as well as a range of sh-RNA, mh- RNA and ddR Ai constructs.
Still another aspect of the present invention is directed to antibodies to AGT-301, AGT- 302, AGT-303, AGT-304 and AGT-305 and their derivatives and homologs insofar as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 are proteins. Such antibodies may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or may be specifically raised to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or derivatives or homologs thereof. In the case of the latter, AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their derivatives or homologs may first need to be associated with a carrier molecule. The antibodies and/or recombinant AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 or their derivatives of the present invention are particularly useful as therapeutic or diagnostic agents. An antibody "to" a molecule includes an antibody specific for said molecule.
AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and their derivatives can be used to screen for naturally occurring antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 which may occur in certain autoimmune diseases. Alternatively, specific antibodies can be used to screen for AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305. Techniques for such assays are well known in the art and include, for example, sandwich assays and ELISA.
Antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 of the present invention may be monoclonal or polyclonal and may be selected from naturally occurring antibodies to the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or may be specifically raised to these gene products. In the case of the latter, the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 protein may need first to be associated with a carrier molecule. Alternatively, fragments of antibodies may be used such as Fab fragments. Furthermore, the present invention extends to recombinant and synthetic antibodies and to antibody hybrids. A "synthetic antibody" is considered herein to include fragments and hybrids of antibodies. The antibodies of this aspect of the present invention are particularly useful for immunotherapy and may also be used as a diagnostic tool or as a means for purifying AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
For example, specific antibodies can be used to screen for AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 proteins. The latter would be important, for example, as a means for screening for levels of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a cell extract or other biological fluid or purifying AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 made by recombinant means from culture supernatant fluid. Techniques for the assays contemplated herein are known in the art and include, for example, sandwich assays and ELISA.
It is within the scope of this invention to include any second antibodies (monoclonal, polyclonal or fragments of antibodies) directed to the first mentioned antibodies discussed above. Both the first and second antibodies may be used in detection assays or a first antibody may be used with a commercially available anti-immunoglobulin antibody. An antibody as contemplated herein includes any antibody specific to any region of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
Both polyclonal and monoclonal antibodies are obtainable by immunization with the enzyme or protein and either type is utilizable for immunoassays. The methods of obtaining both types of sera are well known in the art. Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, or antigenic parts thereof, collecting serum from the animal, and isolating specific sera by any of the known immunoadsorbent techniques. Although antibodies produced by this method are utilizable in virtually any type of immunoassay, they are generally less favoured because of the potential heterogeneity of the product.
The use of monoclonal antibodies in an immunoassay is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product. The preparation of hybridoma cell lines for monoclonal antibody production derived by fusing an immortal cell line and lymphocytes sensitized against the immunogenic preparation can be done by techniques which are well known to those who are skilled in the art. (See, for example, Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology Vol. II, ed. by Schwartz, 1981; Kohler and Milstein, Nature 256: 495-499, 1975; Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976.)
Another aspect of the present invention contemplates a method for detecting AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative or homolog thereof in a biological sample from a subject, said method comprising contacting said biological sample with an antibody specific for AGT-301, AGT-302, AGT-303, AGT-304 and AGT- 305 or their antigenic derivatives or homologs for a time and under conditions sufficient for a complex to form, and then detecting said complex.
The presence of the complex is indicative of the presence of AGT-301, AGT-302, AGT- 303, AGT-304 and AGT-305. This assay may be quantitated or semi-quantitated to determine a propensity to develop obesity or other conditions or to monitor a therapeutic regimen.
The presence of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 may be accomplished in a number of ways such as by Western blotting and ELISA procedures. A wide range of immunoassay techniques are available as can be seen by reference to U.S. Patent Nos. 4,016,043, 4,424,279 and 4,018,653. These, of course, include both single-site and two-site or "sandwich" assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody to a target.
Sandwich assays are among the most useful and commonly used assays. A number of variations of the sandwich assay technique exist, and all are intended to be encompassed by the present invention. Briefly, in a typical forward assay, an unlabelled antibody is immobilized on a solid substrate and the sample to be tested brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 complex, a second antibody specific to the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305, labeled with a reporter molecule capable of producing a detectable signal, is then added and incubated, allowing time sufficient for the formation of another complex of antibody-AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305-labeled antibody. Any unreacted material is washed away, and the presence of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of hapten. Variations on the forward assay include a simultaneous assay, in which both sample and labelled antibody are added simultaneously to the bound antibody. These techniques are well known to those skilled in the art, including any minor variations as will be readily apparent. In accordance with the present invention, the sample is one which might contain AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 including cell extract, tissue biopsy or possibly serum, saliva, mucosal secretions, lymph, tissue fluid and respiratory fluid. The sample is, therefore, generally a biological sample comprising biological fluid but also extends to fermentation fluid and supernatant fluid such as from a cell culture.
The solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs or microplates, or any other surface suitable for conducting an immunoassay. The binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing, the polymer-antibody complex to the solid surface which is then washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more convenient) and under suitable conditions (e.g. from room temperature to about 37°C) to allow binding of any subunit present in the antibody. Following the incubation period, the antibody subunit solid phase is washed and dried and incubated with a second antibody specific for a portion of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305. The second antibody is linked to a reporter molecule which is used to indicate the binding of the second antibody to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
An alternative method involves immobilizing the target molecules in the biological sample and then exposing the immobilized target to specific antibody which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labelling with the antibody. Alternatively, a second labelled antibody, specific to the first antibody is exposed to the target-first antibody complex to form a target-first antibody-second antibody tertiary complex. The complex is detected by the signal emitted by the reporter molecule.
By "reporter molecule" as used in the present specification, is meant a molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative. The most commonly used reporter molecules in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules.
In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognized, however, a wide variety of different conjugation techniques exist, which are readily available to the skilled artisan. Commonly used enzymes include horseradish peroxidase, glucose oxidase, β-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates, which yield a fluorescent product rather than the chromogenic substrates noted above. In all cases, the enzyme-labelled antibody is added to the first antibody hapten complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the complex of antibody-antigen- antibody. The substrate will react with the enzyme linked to the second antibody, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of hapten which was present in the sample. A "reporter molecule" also extends to use of cell agglutination or inhibition of agglutination such as red blood cells on latex beads, and the like.
Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody absorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope. As in the EIA, the fluorescent-labelled antibody is allowed to bind to the first antibody- hapten complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength. The fluorescence observed indicates the presence of the hapten of interest. Immunofluorescence and EIA techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.
Suitable fluorochromes include, but are not limited to, fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), R-Phycoerythrin (RPE), and Texas Red. Other exemplary fluorochromes include those discussed by International Patent Publication No. WO 93/06121. Reference also may be made to the fluorochromes described in U.S. Patent Nos. 5,573,909 and 5,326,692. Alternatively, reference may be made to the fluorochromes described in U.S. Patent Nos. 5,227,487, 5,274,113, 5,405,975, 5,433,896, 5,442,045, 5,451,663, 5,453,517, 5,459,276, 5,516,864, 5,648,270 and 5,723,218. The most convenient fluorochome up to the present time is SYBR green.
The present invention also contemplates genetic assays such as involving, for example, PCR analysis to detect AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their derivatives.
Real-time PCR is also particularly useful for assaying for particular genetic molecules.
SYBR green real-time PCR is particularly useful.
It is to be understood that unless otherwise indicated, the subject invention is not limited to specific formulations of components, manufacturing methods, dosage regimens, or the like, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
It must be noted that, as used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to a "compound" includes a single compound, as well as two or more compounds; reference to "an active agent" includes a single active agent, as well as two or more active agents; and so forth.
In describing and claiming the present invention, the following terminology are used in accordance with the definitions set forth below.
The terms "compound", "active agent", "pharmacologically active agent", "medicament", "active" and "drug" are used interchangeably herein to refer to a chemical compound that induces a desired pharmacological and/or physiological effect. The terms also encompass pharmaceutically acceptable and pharmacologically active ingredients of those active agents specifically mentioned herein including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the terms "compound", "active agent", "pharmacologically active agent", "medicament", "active" and "drug" are used, then it is to be understood that this includes the active agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, etc. The term "compound" is not to be construed as a chemical compound only but extends to peptides, polypeptides and proteins as well as genetic molecules such as RNA, DNA and chemical analogs thereof. Reference to a "peptide", "polypeptide" or "protein" includes molecules with a polysaccharide or lipopolysaccharide component. The term "potentiator" is an example of a compound, active agent, pharmacologically active agent, medicament, active and drug which modulates the level of expression or level of activity of a nucleic acid molecule or its expression product differentially expressed or present in a communally-reared P. obesus separated from other P. obesus animals from the same community. The term "modulates" includes "upregulating" and "down-regulating" expression or activity. Up-regulation encompasses increasing expression of a nucleic acid molecule as well as manipulating a component of the downstream signaling pathway. The term "antagonist" is an example of a compound, active agent, pharmacologically active agent, medicament, active and drug which down- regulates the level of expression of a nucleic acid molecule or the activity of its expression product. Down-regulation involves decreasing expression or the level of activity.
The present invention contemplates, therefore, compounds useful in up-regulating or down-regulating expression of a nucleic acid molecule or the activity of its expression product. The terms "modulating" or its derivatives, such as "modulate" or "modulation", are used to describe up- or down-regulation. The compounds are proposed to have an effect on modifying behavioral conditions such as anxiety or depression. Reference to a "compound", "active agent", "pharmacologically active agent", "medicament", "active" and "drug" includes combinations of two or more actives. A "combination" also includes multi-part such as a two-part pharmaceutical composition where the agents are provided separately and given or dispensed separately or admixed together prior to dispensation.
The terms "effective amount" and "therapeutically effective amount" of an agent as used herein mean a sufficient amount of the agent to provide the desired therapeutic or physiological effect such as elevating or reducing the level of expression or activity. Undesirable effects, e.g. side effects, are sometimes manifested along with the desired therapeutic effect; hence, a practitioner balances the potential benefits against the potential risks in determining what is an appropriate "effective amount". The exact amount required will vary from subject to subject, depending on the species, age and general condition of the subject, mode of administration and the like. Thus, it may not be possible to specify an exact "effective amount". However, an appropriate "effective amount" in any individual case may be determined by one of ordinary skill in the art using only routine experimentation.
By "pharmaceutically acceptable" carrier, excipient or diluent is meant a pharmaceutical vehicle comprised of a material that is not biologically or otherwise undesirable, i.e. the material may be administered to a subject along with the selected active agent without causing any or a substantial adverse reaction. Carriers may include excipients and other additives such as diluents, detergents, coloring agents, wetting or emulsifying agents, pH buffering agents, preservatives, and the like.
Similarly, a "pharmacologically acceptable" salt, ester, emide, prodrug or derivative of a compound as provided herein is a salt, ester, amide, prodrug or derivative that this not biologically or otherwise undesirable.
The terms "treating" and "treatment" as used herein refer to reduction in severity of the behavioral disorder or condition, prevention of the occurrence of symptoms of a behavioral disorder and improvement or remediation of conditions such as anxiety or depression.
The present invention provides, therefore, agents which antagonize or agonize (i.e. potentiate or activate) the subject differentially expressed nucleic acid molecules or their expression products.
The present invention contemplates methods of screening for such agents comprising, for example, contacting a candidate drug with an expression product or mRNA or DNA encoding same. Such a molecule is referred to herein as a "target" or "target molecule". The screening procedure includes assaying (i) for the presence of a complex between the drug and the target, or (ii) an alteration in the expression levels of nucleic acid molecules encoding the target. One form of assay involves competitive binding assays. In such competitive binding assays, the target is typically labeled. Free target is separated from any putative complex and the amount of free (i.e. uncomplexed) label is a measure of the binding of the agent being tested to target molecule. One may also measure the amount of bound, rather than free, target. It is also possible to label the compound rather than the target and to measure the amount of compound binding to target in the presence and in the absence of the drug being tested.
Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a target and is described in detail in Geysen (International Patent Publication No. WO 84/03564). Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with a target and washed. Bound target molecule is then detected by methods well known in the art. This method may be adapted for screening for non-peptide, chemical entities. This aspect, therefore, extends to combinatorial approaches to screening for target antagonists or agonists of the target.
Purified target can be coated directly onto plates for use in the aforementioned drug screening techniques. However, non-neutralizing antibodies to the target may also be used to immobilize the target on the solid phase. Antibodies specific for a target may also be useful as inhibitors such as in the treatment of anxiety or depression.
The present invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of specifically binding the target compete with a test compound for binding to the target or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants of the target. Antibodies to a target may be polyclonal or monoclonal as described above although monoclonal antibodies are preferred. Antibodies may be prepared by any of a number of means. For the detection of a target, antibodies are generally but not necessarily derived from non-human animals such as primates, livestock animals (e.g. sheep, cows, pigs, goats, horses), laboratory test animals (e.g. mice, rats, guinea pigs, rabbits) and companion animals (e.g. dogs, cats). Generally, antibody based assays are conducted in vitro on cell or tissue biopsies. However, if an antibody is suitably deimmunized or, in the case of human use, humanized, then the antibody can be labeled with, for example, a nuclear tag, administered to a subject and the site of nuclear label accumulation determined by radiological techniques. The target antibody is regarded, therefore, as a marker targeting agent. Accordingly, the present invention extends to deimmunized forms of the antibodies for use in target imaging in human and non-human subjects.
Where an antibody is destined for use as a therapeutic agent such as to inhibit a target, it will need to be deimmunized with respect to the host into which it will be introduced (e.g. a human). The deimmunization process may take any of a number of forms including the preparation of chimeric antibodies which have the same or similar specificity as the monoclonal antibodies prepared according to the present invention. Chimeric antibodies are antibodies whose light and heavy chain genes have been constructed, typically by genetic engineering, from immunoglobulin variable and constant region genes belonging to different species. Thus, in accordance with the present invention, once a hybridoma producing the desired monoclonal antibody is obtained, techniques are used to produce interspecific monoclonal antibodies wherein the binding region of one species is combined with a non-binding region of the antibody of another species (Liu et al, Proc. Natl. Acad. Sci. USA 84: 3439-3443, 1987). For example, complementary determining regions (CDRs) from a non-human (e.g. murine) monoclonal antibody can be grafted onto a human antibody, thereby "humanizing" the murine antibody (European Patent No. 0 239 400; Jones et l, Nature 321: 522-525, 1986; Verhoeyen et al, Science 239: 1534-1536, 1988; Richmann et al, Nature 332: 323-327, 1988). In this case, the deimmunizing process is specific for humans. More particularly, the CDRs can be grafted onto a human antibody variable region with or without human constant regions. The non-human antibody providing the CDRs is typically referred to as the "donor" and the human antibody providing the framework is typically referred to as the "acceptor". Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e. at least about 85-90%, preferably about 95% or more identical. Hence, all parts of a humanized antibody, except possibly the CDRs, are substantially identical to corresponding parts of natural human immunoglobulin sequences. Thus, a "humanized antibody" is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin. A donor antibody is said to be "humanized", by the process of "humanization", because the resultant humanized antibody is expected to bind to the same antigen as the donor antibody that provides the CDRs. Reference herein to "humanized" includes reference to an antibody deimmunized to a particular host, in this case, a human host.
It will be understood that the deimmunized antibodies may have additional conservative amino acid substitutions which have substantially no effect on antigen binding or other immunoglobulin functions. Exemplary conservative substitutions may be made according to Table 4.
TABLE 4
Figure imgf000055_0001
Figure imgf000056_0001
Exemplary methods which may be employed to produce deimmunized antibodies according to the present invention are described, for example, in Richmann et al, 1988, supra; European Patent No. 0 239 400; U.S. Patent No. 6,056,957, U.S. Patent No. 6,180,370, U.S. Patent No. 6,180,377.
Thus, in one embodiment, the present invention contemplates a deimmunized antibody molecule having specificity for an epitope recognized by a monoclonal antibody to a target wherein at least one of the CDRs of the variable domain of said deimmunized antibody is derived from the said monoclonal antibody to said target and the remaining immunoglobulin-derived parts of the deimmunized antibody molecule are derived from an immunoglobulin or an analog thereof from the host for which the antibody is to be deimmunized.
This aspect of the present invention involves manipulation of the framework region of a non-human antibody.
The present invention extends to mutants and derivatives of the subject antibodies but which still retain specificity for the target. The terms "mutant" or "derivatives" includes one or more amino acid substitutions, additions and/or deletions.
As used herein, the term "CDR" includes CDR structural loops which covers to the three light chain and the three heavy chain regions in the variable portion of an antibody framework region which bridge β strands on the binding portion of the molecule. These loops have characteristic canonical structures (Chothia et al, J. Mol. Biol 196: 901, 1987; Chothia et al, J. Mol. Biol. 227: 799, 1992).
By "framework region" is meant region of an immunoglobulin light or heavy chain variable region, which is interrupted by three hypervariable regions, also called CDRs. The extent of the framework region and CDRs have been precisely defined (see, for example, Kabat et al, "Sequences of Proteins of Immunological Interest", U.S. Department of Health and Human Sciences, 1983). The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. As used herein, a "human framework region" is a framework region that is substantially identical (about 85% or more, usually 90-95% or more) to the framework region of a naturally occurring human immunoglobulin. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs. The CDRs are primarily responsible for binding to an epitope of the target.
As used herein, the term "heavy chain variable region" means a polypeptide which is from about 110 to 125 amino acid residues in length, the amino acid sequence of which corresponds to that of a heavy chain of a monoclonal antibody of the invention, starting from the amino-terminal (N-terminal) amino acid residue of the heavy chain. Likewise, the term "light chain variable region" means a polypeptide which is from about 95 to 130 amino acid residues in length, the amino acid sequence of which corresponds to that of a light chain of a monoclonal antibody of the invention, starting from the N-terminal amino acid residue of the light chain. Full-length immunoglobulin "light chains" (about 25 Kd or 214 amino acids) are encoded by a variable region gene at the NH2-terminus (about 110 amino acids) and a K or λ constant region gene at the COOH-terminus. Full-length immunoglobulin "heavy chains" (about 50 Kd or 446 amino acids), are similarly encoded by a variable region gene (about 116 amino acids) and one of the other aforementioned constant region genes, e.g. γ (encoding about 330 amino acids).
The term "immunoglobulin" or "antibody" is used herein to refer to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes. The recognized immunoglobulin genes include the K. λ, α. γ (IgGls IgG2, IgG3, IgG4), δ. ε and μ constant region genes, as well as the myriad immunoglobulin variable region genes. One form of immunoglobulin constitutes the basic structural unit of an antibody. This form is a tetramer and consists of two identical pairs of immunoglobulin chains, each pair having one light and one heavy chain. In each pair, the light and heavy chain variable regions are together responsible for binding to an antigen, and the constant regions are responsible for the antibody effector functions. In addition to antibodies, immunoglobulins may exist in a variety of other forms including, for example, Fv, Fab, Fab' and (Fab')2.
The present invention also contemplates the use and generation of fragments of monoclonal antibodies produced by the method of the present invention including, for example, Fv, Fab, Fab' and F(ab')2 fragments. Such fragments may be prepared by standard methods as for example described by Coligan et al. (1991-1997, supra).
The present invention also contemplates synthetic or recombinant antigen-binding molecules with the same or similar specificity as the monoclonal antibodies of the invention. Antigen-binding molecules of this type may comprise a synthetic stabilized Fv fragment. Exemplary fragments of this type include single chain Fv fragments (sFv, frequently termed scFv) in which a peptide linker is used to bridge the N terminus or C terminus of a V# domain with the C terminus or N-terminus, respectively, of a YL domain. ScFv lack all constant parts of whole antibodies and are not able to activate complement. Suitable peptide linkers for joining the V# and V^ domains are those which allow the V# and Vz, domains to fold into a single polypeptide chain having an antigen binding site with a three dimensional structure similar to that of the antigen binding site of a whole antibody from which the Fv fragment is derived. Linkers having the desired properties may be obtained by the method disclosed in U.S. Patent No 4,946,778. However, in some cases a linker is absent. ScFvs may be prepared, for example, in accordance with methods outlined in Krebber et al. (J. Immunol. Methods 201(1): 35-55,1997). Alternatively, they may be prepared by methods described in U.S. Patent No 5,091,513, European Patent No 239,400 or the articles by Winter and Milstein (Nature 349: 293, 1991) and Plϋckthun et al. (In Antibody engineering: A practical approach, 203-252, 1996).
Alternatively, the synthetic stabilized Fv fragment comprises a disulphide stabilized Fv (dsFv) in which cysteine residues are introduced into the YH and Vi domains such that in the fully folded Fv molecule the two residues will form a disulphide bond therebetween. Suitable methods of producing dsFv are described, for example, in (Glockshuber et al, Biochem. 29: 1363-1367, 1990; Reiter et al, J. Biol. Chem. 269: 18327-18331, 1994; Reiter et al, Biochem. 33: 5451-5459, 1994; Reiter et al, Cancer Res. 54: 2714-2718, 1994; Webber et al, Mol. Immunol. 32: 249-258, 1995).
Also contemplated as synthetic or recombinant antigen-binding molecules are single variable region domains (termed dAbs) as, for example, disclosed in (Ward et al, Nature 341: 544-546, 1989; Hamers-Casierman et al, Nature 363: 446-448, 1993; Davies & Riechmann, E.5S ett. 339: 285-290, 1994).
Alternatively, the synthetic or recombinant antigen-binding molecule may comprise a "minibody". In this regard, minibodies are small versions of whole antibodies, which encode in a single chain the essential elements of a whole antibody. Suitably, the minibody is comprised of the V# and Vi domains of a native antibody fused to the hinge region and CH3 domain of the immunoglobulin molecule as, for example, disclosed in U.S. Patent No 5,837,821.
In an alternate embodiment, the synthetic or recombinant antigen binding molecule may comprise non-immunoglobulin derived, protein frameworks. For example, reference may be made to (Ku & Schutz, Proc. Natl. Acad. Sci. USA 92: 6552-6556, 1995) which discloses a four-helix bundle protein cytochrome b562 having two loops randomized to create CDRs, which have been selected for antigen binding.
The synthetic or recombinant antigen-binding molecule may be multivalent (i.e. having more than one antigen binding site). Such multivalent molecules may be specific for one or more antigens. Multivalent molecules of this type may be prepared by dimerization of two antibody fragments through a cysteinyl-containing peptide as, for example disclosed by (Adams et al, Cancer Res. 53: 4026-4034, 1993; Cumber et al, J. Immunol. 149: 120- 126, 1992). Alternatively, dimerization may be facilitated by fusion of the antibody fragments to amphiphilic helices that naturally dimerize (Plϋnckthun, Biochem 31: 1579- 1584, 1992) or by use of domains (such as leucine zippers jun and fos) that preferentially heterodimerize (Kostelny et al, J. Immunol. 148: 1547-1553, 1992). Multivalent antibodies are useful, for example, in detecting different forms of target.
The present invention contemplates any compound which binds or otherwise interacts with a target, or a component of a target signaling pathway resulting in potentiation, activation or up-regulation or antagonism or down-regulation of the target.
Another useful group of compounds is a mimetic. The terms "peptide mimetic", "target mimetic" or "mimetic" are intended to refer to a substance which has some chemical similarity to the target but which antagonizes or agonizes or mimics the target. The target in this case may be an expression product of a differentially expressed nucleic acid molecule. A peptide mimetic may be a peptide-containing molecule that mimics elements of protein secondary structure (Johnson et al, "Peptide Turn Mimetics" in Biotechnology and Pharmacy, Pezzuto et al, Eds., Chapman and Hall, New York, 1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions such as those of antibody and antigen, enzyme and substrate or scaffolding proteins. A peptide mimetic is designed to permit molecular interactions similar to the natural molecule. Peptide or non-peptide mimetics may be useful, for example, to activate a target or to competitively inhibit a target. Again, the compounds of the present invention may be selected to interact with a target alone or single or multiple compounds may be used to affect multiple targets.
The target or fragment employed in screening assays may either be free in solution, affixed to a solid support, or borne on a cell surface. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant polynucleotides expressing the target or fragment, preferably in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays. One may measure, for example, the formation of complexes between a target or fragment and the agent being tested, or examine the degree to which the formation of a complex between a target or fragment and a ligand is aided or interfered with by the agent being tested.
A substance identified as a modulator of target function or gene activity may be a peptide or non-peptide in nature. Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
The designing of mimetics to a pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesize or where it is unsuitable for a particular method of administration, e.g. peptides are unsuitable active agents for oral compositions as they tend to he quickly degraded by proteases in the alimentary canal. Mimetic design, synthesis and testing is generally used to avoid randomly screening large numbers of molecules for a target property.
There are several steps commonly taken in the design of a mimetic from a compound having a given target property. First, the particular parts of the compound that are critical and/or important in determining the target property are determined. In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide, e.g. by substituting each residue in turn. Alanine scans of peptides are commonly used to refine such peptide motifs. These parts or residues constituting the active region of the compound are known as its "pharmacophore".
Once the pharmacophore has been found, its structure is modeled according to its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, x-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modeling process.
In a variant of this approach, the three-dimensional structure of a target is modeled. Modeling can be used to generate inhibitors which interact with the linear sequence or a three-dimensional configuration.
A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted. The template molecule and the chemical groups grafted onto it can conveniently be selected so that the mimetic is easy to synthesize, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound. Alternatively, where the mimetic is peptide-based, further stability can be achieved by cyclizing the peptide, increasing its rigidity. The mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Further optimization or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.
The goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g. agonists, antagonists, inhibitors or enhancers) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g. enhance or interfere with the function of a polypeptide in vivo. See, e.g. Hodgson (Bio/Technology 9: 19-21, 1991). In one approach, one first determines the three-dimensional structure of a target by x-ray crystallography, by computer modeling or most typically, by a combination of approaches. Useful information regarding the structure of a target may also be gained by modeling based on the structure of homologous proteins. An example of rational drug design is the development of HIV protease inhibitors (Erickson et al, Science 249: 527-533, 1990). In addition, target molecules may be analyzed by an alanine scan (Wells, Methods Enzymol. 202: 2699-2705, 1991). In this technique, an amino acid residue is replaced by Ala and its effect on the peptide's activity is determined. Each of the amino acid residues of the peptide is analyzed in this manner to determine the important regions of the peptide.
Proteomics may be also be used to screen for components which interact with a target.
The present invention extends to a genetic approach to up-regulating or down-regulating expression of a gene encoding a target. Generally, it is more convenient to use genetic means to induce gene silencing such as pre- or post-transcriptional gene silencing. However, the general techniques can be used to up-regulate expression such as by increasing gene copy numbers or antagonizing inhibitors of gene expression.
The terms "nucleic acids", "nucleotide" and "polynucleotide" include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog (such as the morpholine ring), internucleotide modifications such as uncharged linkages (e.g. methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g. phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g. polypeptides), intercalators (e.g. acridine, psoralen, etc.), chelators, alkylators and modified linkages (e.g. α-anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen binding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.
Antisense polynucleotide sequences, for example, are useful in silencing transcripts of target genes. Expression of such an antisense construct within a cell interferes with target gene transcription and/or translation. Furthermore, co-suppression and mechanisms to induce RNAi or siRNA may also be employed. Alternatively, antisense or sense molecules may be directly administered. In this latter embodiment, the antisense or sense molecules may be formulated in a composition and then administered by any number of means to target cells.
A variation on antisense and sense molecules involves the use of morpholinos, which are oligonucleotides composed of morpholine nucleotide derivatives and phosphorodiamidate linkages (for example, Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997). Such compounds are injected into embryos and the effect of interference with mRNA is observed.
In one embodiment, the present invention employs compounds such as oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules such as those encoding a target, i.e. the oligonucleotides induce pre-transcriptional or post- transcriptional gene silencing. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding the target gene transcription. The oligonucleotides may be provided directly to a cell or generated within the cell. As used herein, the terms "target nucleic acid" and "nucleic acid molecule encoding a target gene transcript" have been used for convenience to encompass DNA encoding the target, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of the subject invention with its target nucleic acid is generally referred to as "antisense". Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as "antisense inhibition." Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. In one example, the result of such interference with target transcript function is reduced levels of the target. In the context of the present invention, "modulation" and "modulation of expression" mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
In the context of this invention, "hybridization" means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
"Complementary" as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
According to the present invention, compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid. One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals.
In the context of the subject invention, the term "oligomeric compound" refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent intemucleoside (backbone) linkages as well as oligonucleotides having non-na urally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
While oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those herein described.
The open reading frame (ORF) or "coding region" which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is a region which may be effectively targeted. Within the context of the present invention, one region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5 '-most residue of the mRNA via a 5 '-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.
Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns", which are excised from a transcript before it is translated. The remaining (and, therefore, translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e. intron- exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may, therefore, fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the intemucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural intemucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides.
Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Preferred oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
The antisense oligonucleotides may be administered by any convenient means including by inhalation, local or systemic means. In an alternative embodiment, genetic constructs including DNA vaccines are used to generate antisense molecules in vivo. Furthermore, many of the preferred features described above are appropriate for sense nucleic acid molecules or for gene therapy applications to promote levels of targets. In addition, the above discussion in relation to antisense molecules equally applies to sense molecules including a range of si-RNA, sh- RNA, mh-RNA and ddRNAi constructs or DNA vectors encoding same. Alternatively, synthetic forms of si-RNA, sh-RNA and mh-RNA may be administered.
Following identification of an agent which potentiates or antagonizes a target, it may be manufactured and/or used in a preparation, i.e. in the manufacture or formulation or a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals in a method of treatment or prophylaxis of inection. Alternatively, they may be incorporated into a patch or slow release capsule or implant.
Thus, the present invention extends, therefore, to a pharmaceutical composition, medicament, drug or other composition including a patch or slow release formulation comprising an agonist or antagonist of target activity or target gene expression or the activity or gene expression of a component of the target.
Another aspect of the present invention contemplates a method comprising administration of such a composition to a subject such as for treatment or prophylaxis of an infection or other disease condition. Furthermore, the present invention contemplates a method of making a pharmaceutical composition comprising admixing a compound of the instant invention with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients. Where multiple compositions are provided, then such compositions may be given simultaneously or sequentially. Sequential administration includes administration within nanoseconds, seconds, minutes, hours or days. Preferably, sequential administration is within seconds or minutes. Another method includes providing a wild-type or mutant target gene function to a cell. This is particularly useful when generating an animal model. Alternatively, it may be part of a gene therapy approach. A target gene or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. If a gene portion is introduced and expressed in a cell carrying a mutant target allele, the gene portion should encode a part of the target protein. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation calcium phosphate co-precipitation and viral transduction are known in the art.
Gene transfer systems known in the art may be useful in the practice of genetic manipulation. These include viral and non-viral transfer methods. A number of viruses have been used as gene transfer vectors or as the basis for preparing gene transfer vectors, including papovaviruses (e.g. SV40, Madzak et al, J. Gen. Virol. 73: 1533-1536, 1992), adenovirus (Berkner, Curr. Top. Microbiol. Immunol. 158: 39-66, 1992; Berkner et al, BioTechniques 6; 616-629, 1988; Gorziglia and Kapikian, J. Virol. 66: 4407-4412, 1992; Quantin et al, Proc. Natl. Acad. Sci. USA 89: 2581-2584, 1992; Rosenfeld et al, Cell 68: 143-155, 1992; Wilkinson et al, Nucleic Acids Res. 20: 2233-2239, 1992; Stratford- Perricaudet et al, Hum. Gene Ther. 1: 241-256, 1990; Schneider et al, Nature Genetics 18: 180-183, 1998), vaccinia virus (Moss, Curr. Top. Microbiol. Immunol. 158: 25-38, 1992; Moss, Proc. Natl. Acad. Sci. USA 93: 11341-11348, 1996), adeno-associated virus (Muzyczka, Curr. Top. Microbiol. Immunol. 158: 97-129, 1992; Ohi et al, Gene 89: 279- 282, 1990; Russell and Hirata, Nature Genetics 18: 323-328, 1998), herpesviruses including HSV and EBV (Margolskee, Curr. Top., Microbiol. Immunol. 158: 67-95, 1992; Johnson et l, J. Virol. 66: 2952-2965, 1992; Fink et al, Hum. Gene Ther. 3: 11-19, 1992; Breakefield and Geller, Mol. Neurobiol 1: 339-371, 1987; Freese et al, Biochem. Pharmacol. 40: 2189-2199, 1990; Fink et al, Ann. Rev. Neurosci. 19: 265-287, 1996), lentiviruses (Naldini et al, Science 272: 263-267, 1996), Sindbis and Semliki Forest virus (Berglund et al, Biotechnology 11: 916-920, 1993) and retroviruses of avian (Bandyopadhyay and Temin, Mol. Cell. Biol. 4: 749-754, 1984; Petropoulos et al, J. Viol. 66: 3391-3397, 1992], murine [Miller, Curr. Top. Microbiol. Immunol. 158: 1-24, 1992; Miller et al, Mol. Cell. Biol. 5: 431-437, 1985; Sorge et al, Mol. Cell. Biol. 4: 1730-1737, 1984; and Baltimore, J. Virol. 54: 401-407, 1985; Miller et al, J. Virol. 62: 4337-4345, 1988] and human [Shimada et al, J. Clin. Invest. 88: 1043-1047, 1991; Helseth et al, J. Virol. 64: 2416-2420, 1990; Page et al, J Virol. 64: 5270-5276, 1990; Buchschacher and Panganiban, J Virol. 66: 2731-2739, 1982] origin.
Non-viral gene transfer methods are known in the art such as chemical techniques including calcium phosphate co-precipitation, mechanical techniques, for example, microinjection, membrane fusion-mediated transfer via liposomes and direct DNA uptake and receptor-mediated DNA transfer. Viral-mediated gene transfer can be combined with direct in vivo gene transfer using liposome delivery, allowing one to direct the viral vectors to particular cells. Alternatively, the retroviral vector producer cell line can be injected into particular tissue. Injection of producer cells would then provide a continuous source of vector particles.
In an approach which combines biological and physical gene transfer methods, plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein and the resulting complex is bound to an adenovirus vector. The trimolecular complex is then used to infect cells. The adenovirus vector permits efficient binding, internalization and degradation of the endosome before the coupled DNA is damaged. For other techniques for the delivery of adenovirus based vectors, see U.S. Patent No. 5,691,198.
Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is non-specific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration. If the polynucleotide encodes a sense or antisense polynucleotide or a ribozyme or DNAzyme, expression will produce the sense or antisense polynucleotide or ribozyme or DNAzyme. Thus, in this context, expression does not require that a protein product be synthesized. In addition to the polynucleotide cloned into the expression vector, the vector also contains a promoter functional in eukaryotic cells. The cloned polynucleotide sequence is under control of this promoter. Suitable eukaryotic promoters include those described above. The expression vector may also include sequences, such as selectable markers and other sequences described herein.
The present invention is further described by the following non-limiting Examples.
EXAMPLE 1
Sequence of Psammomys obesus AGT-301
AGT-301 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.
The initial nucleotide sequence identified is as follows :-
GGTAGGTGGGGTAGGCTCTGGCTCTTAGCCCTGGCTTTATAGACTAGCACACCAGCAGACC AAATTCCCATCTCTCAGACTAGCAGCAAGGGCAAGACCACAAGGCAGTGTGCCATCCCACT GCCCCTGGAGTGGTCCTCTGTCTACAAGGCTCAGGTGCCACAGAAGGTCCTGTTATTTCAA CCACACACTCTTGGGAACACCCCCCATCTTTAGAATAATAAGTTCTCAGGTGCATCACGCT GTTCTGAGATGTCAGGTAGGTGCCAGTTCTCCTCCCACTCTCCCAGTCCTTCCCCTTCATG TCCATCTGCTGGACCCACATCATTTCCAGTATTGCCCAGCTGGTCCTGGAAAAGGATGTCC TGGCCATTGACAGGAATTAGCATAGAGAAGT [SEQ ID NO:l]
A more complete sequence is shown in SEQ ID NO: 6:
ATGGGTCGTGGGGCAGGGCGTGAGTACTCGCCTGCTGCCACCACAGCAGAGAATGGGGGTG GTAAGAAGAAACAGAAAGAGAAGGAGCTTGATGAGCTGAAGAAGGAGGTTGCCATGGATGA CCACAAGCTGTCCTTGGATGAGCTGGGCCGAAAATACCAGGTGGATCTGTCCAAGGGCCTC ACCAACCAGCGAGCTCAGGACATCCTGGCTAGGGATGGACCCAATGCCCTCACTCCACCCC CCACGACTCCTGAGTGGGTCAAGTTCTGTCGTCAGCTTTTTGGGGGCTTCTCTATCCTGCT GTGGATCGGGGCACTCCTCTGGTTCTTGGCCTATGGTATCCTGGCCGCCATGGAGGACGAA CCATCCAATGATAATTTATATCTAGGTATCGTGCTGGCAGCTGTAGTCATCGTCACTGGCT GCTTCTCCTACTACCAGGAAGCCAAGAGCTCCAAGATCATGGATTCCTTCAAGAACATGGT GCCTCAGCAAGCTCTGGTCATCCGAGAGGGAGAGAAGATGCAGATCAACGCGGAGGAGGTG GTGGTGGGAGACTTGGTAGAAGTGAAGGGTGGAGACCGTGTCCCTGCTGACCTCCGGATCA TCTCTTCCCACGGTTGCAAGGTGGATAACTCATCCCTAACAGGGGAGTCGGAGCCCCAGAC ACGTTCCCCTGAGTTCACCCATGAGAACCCTCTGGAGACCCGAAATATCTGTTTCTTCTCA ACTAACTGTGTGGAAGGTACTGCCAGAGGCATTGTGATTGCCACAGGAGACCGGACAGTGA TGGGCCGCATCGCCACCCTTGCCTCCGGCCTGGAGGTGGGGCAGACGCCCATAGCCATGGA GATTGAGCACTTCATCCAGCTGATCACAGGGGTGGCGGTGTTCCTGGGGGTCTCCTTCTTC GTGCTGTCCCTCATCCTGGGCTACAGCTGGCTGGAGGCCGTCATCTTTCTCATCGGCATCA TCGTAGCCAACGTGCCTGAAGGGCTTTTGGCCACTGTCACTGTATGCCTGACGCTGACAGC CAAGCGCATGGCCCGGAAGAACTGCCTGGTGAAGAACCTGGAGGCGGTGGAGACGCTGGGC TCCACATCCACCATCTGCTCGGACAAGACGGGCACGCTCACCCAGAACCGCATGACGGTGG CCCACATGTGGTTTGACAACCAGATCCACGAGGCTGACACCACGGAGGATCAGTCTGGGGC CACTTTTGACAAACGGTCCCCCACTTGGACAGCCCTGTCTCGGATTGCTGGTCTCTGCAAT CGTGCTGTCTTCAAGGCTGGACAGGAAAACATCTCTGTGTCTAAGCGGGACACAGCTGGTG ATGCCTCTGAGTCTGCTCTGCTCAAATGCATTGAGTTGTCCTGTGGCTCAGTGAGGAAGAT GAGGGACAGGAATCCTAAAGTGGCAGAAATTCCCTTCAACTCTACCAACAAATATCAGCTG TCCATCCACGAGAGAGAAGACAGCCCCCAGAGCCATGTGCTAGTAATGAAAGGAGCTCCGG AGCGCATCCTGGATCGATGCTCCACCATCCTGGTACAGGGCAAGGAGATCCCTCTCGACAA GGAGATGCAAGATGCCTTTCAAAATGCCTACATGGAGCTCGGAGGACTTGGGGAGCGTGTG CTGGGCTTCTGTCAGCTAAACCTGCCTTCTGGAAAGTTTCCTCGGGGCTTCAAATTTGACA CAGATGAGCTGAACTTTCCCACAGAGAAACTCTGCTTTGTGGGGCTCATGTCTATGATTGA TCCACCCAGAGCAGCAGTACCAGATGCTGTGGGCAAGTGCCGAAGTGCAGGCATCAAGGTG ATCATGGTGACTGGAGATCACCCTATCACAGCCAAGGCCATTGCCAAAGGGGTAGGCATTA TATCAGAGGGTAACGAGACTGTGGAGGACATTGCAGCCCGGCTCAACATTCCTGTGAGTCA AGTCAATCCCAGAGAAGCCAAGGCATGTGTAGTGCACGGCTCGGACCTGAAGGACATGACC TCAGAACAGCTGGATGAGATCCTCAGGGACCACACGGAGATTGTATTCGCCCGGACCTCCC CTCAGCAGAAACTCATCATTGTGGAGGGGTGTCAGAGGCAGGGAGCCATCGTAGCAGTGAC CGGTGATGGGGTGAACGACTCACCAGCCCTGAAGAAAGCTGACATCGGCATCGCCATGGGC ATCTCTGGCTCCGATGTCTCTAAGCAGGCGGCTGACATGATTCTTCTCGATGACAACTTTG CCTCCATCGTGACAGGCGTAGAGGAGGGCCGGCTGATCTTCGACAACTTGAAGAAGTCCAT CGCATACACCCTGACCAGCAACATCCCGGAGATCACCCCCTTCCTGCTGTTCATCATTGCC AACATCCCCCTTCCCCTGGGCACTGTGACCATCCTCTGCATCGACCTGGGCACAGATATGG TTCCTGCGATCTCATTAGCATATGAAGCAGCTGAGAGCGATATCATGAAGCGGCAGCCACG GAACTCCCAGACAGACAAGCTGGTGAACGAGAGGCTTATCAGCATGGCTTACGGACAGATT GGCATGATCCAGGCCCTGGGAGGCTTCTTCACCTACTTTGTGATCCTGGCAGAGAACGGTT TTCTGCCGTCACGGCTGCTGGGAATCCGCCTTGACTGGGATGATCGGACTACCAATGACCT GGAGGACAGCTATGGGCAAGAGTGGACCTACGAGCAGCGGAAGGTGGTGGAGTTCACGTGC CACACGGCCTTCTTCGCCAGGATCGTGGTGGTGCAGTGGGCTGACCTCATCATCTGCAAGA CCCGCCGCAACTCAGTCTTCCAGCAGGGCATGAAGAACAAGATCCTGATTTTTGGGCTCCT AGAAGAGACGGCTCTGGCTGCTTTCCTGTCTTACTGCCCGGGTATGGGGGTGGCCCTCCGA ATGTACCCGCTCAAGGTCACTTGGTGGTTCTGTGCCTTTCCCTACAGTCTCCTCATCTTCA TCTATGATGAAGTGCGAAAGCTCATCCTACGGCGGTATCCTGGGGGCTGGGTGGAGAAGGA GACATACTACTGAGCTCACTGGAAAAAAGAAGAACGGGAGAGATGGGAAGGCCTGGAGGTG TTGCTGGGGTAGTAAAGGAAAGGGCTAGGCGGAAACATGAGGTGGTATTTTAGGGGAAGAT TTGGGGAGACAGTGAACTAAATTGGCAGGCTTGGGTAAATAGACGAGGTGACTGCTCCAAC CACTCCATAGGTCCAGCTGTGAACCCTCAGACAGTAAATGTTAGGGTCACCTCCTCAGCCC CCTCTCATCCCGCTCTACCGCGTTCGTTGTCTACTTTTCCCGAAGAACTGAGGATTGTCCC GGCGGTCCCTATGTCCCAGCCCTTCACCCTCACCTGCGTTATTCAAATAGATCAACACCCA AAGATTAACCTTGTCTAATCCTGAAGAAAACCTCAGACCACCAAGCAGCTATGTCTCTGGC TTCATTCCTTTTTGCCTTCCTTACCCTCCTACCTGGAGTCTTCCCCAGCTCCTCCCCCTCA TACCTTGAAAACACCAAATTCTCCTTCTAAGAGTGCAAGAGCCTGAGGCCAGAAAAGGAAG CTGGTTGGACAGCTTCCAGCTGGTTGGCTGGTAGGTCTGTCTCCCAGCCAAGGCCAGCCAG GAACCAGAGGAGAGCTGGGCTATCAAGGAGAGGTTGGGGTGGGCTGGCTGAAGGAGACAGC AAAGAAAGAAAGGCAGGCAGTGACCAGAACTTGTCATCTTCAGTCTTCAGGTAGGTGGGGT AGGCTCTGGCTCTTAGCCCTGGCTTTATAGACTAGCACACCAGCAGACCAAATTCCCATCT CTCAGACTAGCAGCAAGGGCAAGACCACAAGGCAGTGTGCCATCCCACTGCCCCTGGAGTG GTCCTCTGTCTACAAGGCTCAGGTGCCACAGAAGGTCCTGTTATTTCAACCACACACTCTT GGGAACACCCCCCATCTTTAGAATAATAAGTTCTCAGGTGCATCACGCTGTTCTGAGATGT CAGGTAGCTGCCAGTTCTCCTCCCACTCTCCCAGTCCTTCCCCTTCATGTCCATCTGCTGG ACCCACATCATTTCCAGTATTGCCCAGCTGGTCCTGGAAAAGGATGTCCTGGCCATTGACA GGAATTAGCATAGAGAAGTTCCCAAAACAACCCTGTCTTTCAAGGACATGCAGAATCAGCT TAGGTCATGACACTGTCAGAAATTTCAGACACGAGAGAAAATCTTAAGAGACCTACCTGCC TTTGACCTTTCAGACGGCACGGCCACTGCTCTCAGACAAGTGCCCACTTTGCTTGAGACAG GAAGCTAGCTTCAGGTTCCTATGGAATAGAGTTTT [SEQ ID NO: 6]
EXAMPLE 2
AGT-301 sequence homology
Rattus norvegicus ATPase, Na+K+ transporting, alpha 2 (Atpla2) Homo sapiens ATPase, Na+K+ transporting, alpha 2 (Atpla2) EXAMPLE 3 AGT-301 gene expression
Na,K-ATPase (Na(+),K(+)-activated ATP phosphohydrolase) is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. As these gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle, the enzyme plays an essential role in cellular physiology. It is composed of two subunits, a large catalytic subunit (α) and a smaller glycoprotein subunit (βa) of unknown function. Biochemical studies have demonstrated the existence of two isoforms of the catalytic subunit, α and α (+). Kidney contains predominantly the α form, whereas both α and α (+) are found in brain, adipose tissue, and skeletal muscle. A third isoform, α-III, has been identified in rat brain. Studies by Shull and Lingrel, Proc. Natl. Acad. Sci. USA 84: 4039-4043, 1987 demonstrated that the catalytic subunit of Na,K- ATPase is encoded by multiple genes. Shull and Lingrel (1987, supra) identified separate genes encoding the α and α (+) isoforms. These genes were called α-A and α-B (ATP1A2), respectively. In addition, they isolated two other genes, termed α-C and α-D, one of which is physically linked to the α (+) gene; these genes showed nucleotide and deduced amino acid homology to the catalytic subunit cDNA sequences but did not correspond to any previously identified isoforms. The α-2 isoform of sodium-potassium-ATPase predominates in neural and muscle tissues. By Southern analysis of DNA from panels of rodent/human somatic cell hybrid lines, Yang- Feng et al, Genomics 2: 128-138, 1988 mapped the ATP1A2 gene to lcen-q32.
In a recent study, the autosomal dominant disorder familial hemiplegic migrane type 2 was found to be associated with mutations in ATP1A2 (De Fusco, M. et al Nat. Genet.33 :\92- 196, 2003) . The mutations were found to be single amino acid substitutions that inhibited the Na+K+ pump activity of ATP1A2. The mechanism of the inhibition of Na*K+ pump activity is unclear however cell localisation studies indicate the loss of function is not due to inappropriate cellular localisation of the mutant protein. To determine the functional roles of the ATP1A1 and ATP1A2 proteins, James et al, Molec. Cell 3: 555-563, 1999 generated mice with targeted disruption of either the Atplal or Atpla2 gene. Hearts from heterozygous Atpla2 mice were hypercontractile as a result of increased calcium transients during the contractile cycle. In contrast, hearts from heterozygous Atplal mice were hypocontractile. The different functional roles of these two proteins were further demonstrated since inhibition of the Atpla2 protein with ouabain increased the contractility of heterozygous Atplal hearts. These results illustrated a specific role for the ATP1A2 protein in calcium signalling during cardiac contraction.
In addition to defects in cardiac function mice deficient in ATP1A2 expression exhibited neuronal deficits. The brainstem breathing centre was found to be abnormal which resulted in a fatal deficit in the development of breathing rhythm in new born pups (Mosely et alJ. Biol. Chem. 278:5317-5324, 2003). Further reports of the neurophysiology of ATP1A2 knockout mice showed significant apoptosis in the amygdala and piriform cortex mice homozygous for ATP1A2 deficiency (Ikeda et al. J. Neuroscience. 23: 4667- 4676, 2003). Mice heterozygous for ATP1A2 deficiency exhibited a much lower level of apoptosis in these centres however it was higher than that found in wild-type animals. These heterozygous mice survived to adulthood and demonstrated behavioural phenotype consistent with increased anxiety or depression. These findings suggest a role for ATP1 A2 in the development and maintenance of brain regions that control mood and emotion.
Katzmarzyk et al, J. Clin. Endocr.. Metab. 84: 2093-2097, 1999 examined the relationship between the ATP1A2 and ATP IB 1 genes and resting metabolic rate (RMR) and respiratory quotient (RQ). RMR and RQ were adjusted for age, sex, fat mass, and fat-free mass. Sib-pair analyses indicated a significant linkage between RQ and the ATP1A2 exon 1 and exon 21-22 markers (p=0.03 and p=0.02, respectively). No linkage was detected between the ATP IB 1 markers and either RMR or RQ, and RMR was not linked with the ATP1A2 markers. There was a significant interaction (p<0.0003) between ATP1A2 exon 1 carrier status and age group for RQ. The association between carrier status and RQ was significant in younger adults (RQ of 0.76 in carriers versus 0.80 in non-carriers; p<0.0001) but was not in older adults (RQ of 0.81 in carriers versus 0.80 in noncarriers). The ATP1A2 exon 1 gene accounted for approximately 9.1% and 0.3% of the variance in RQ in younger and older adults, respectively. The results suggested that the ATP1A2 gene may play a role in fuel oxidation, particularly in younger individuals.
EXAMPLE 4 AGT-301 gene expression as measured by SYBR Green Real Time PCR
AGT-301 gene expression was significantly higher in Day 2 (p=0.004) and Day 4 (p=0.000) separated animals when compared to Day 0 controls (Table 5). In addition, gene expression was significantly higher in Day 2 and Day 4 separated animals when compared to Day 6 (p=0.009 and p=0.000, respectively) and Day 8 (p=0.022 and p=0.001, respectively) separated animals. The expression of AGT-301 was significantly elevated in this animal model of depression, which suggests that AGT-301 may be a target for the treatment of depression.
TABLE 5
Figure imgf000078_0001
EXAMPLE 5 Sequence of Psammomys obesus AGT-302
AGT-302 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus. The initial nucleotide sequence identified is as foliows:-
AAAAACTGGAACCATTGAGTTGATGGAGCCGCTTGATGAAGAAATCTCTGGAΆTTGTGGAA GTGGTTGGAAAAGTCACAGCCAAGGCAACCATAATGTGTGCATCTTATGTCCAGTTCAAGG AAGATTGTAATCGCTTTGATCTTGAACTTTACAATGAAGCTGTGAAAATTATCAATGAGTT CCCTCAGTTTTTTTCCGTTAGGGCTTGTACAACATGAATGAGCTTCTTGAATTTTTTTATG TTGCCAGTGAGCTACATTGAAGGCTGTTAAAGAAGACTCCTTCAGTTTGAGGAGAGACTC CTGTAATTTCTAATATTTAAATTG [SEQ ID NO: 2]
A more complete sequence in shown in SEQ ID NO:7:
GCAGGCTGGTACCGGTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGAAAAACTGG AACCATTGAGTTGATGGAGCCGCTTGATGAAGAAATCTCTGGAATTGTGGAAGTGGTTGGA AAAGTCACAGCCAAGGCAACCATAATGTGTGCATCTTATGTCCAGTTCAAGGAAGATTGTA ATCGCTTTGATCTTGAACTTTACAATGAAGCTGTGAAAATTATCAATGAGTTCCCTCAGTT TTTTTCCGTTAGGGCTTGTACAACATGAATGAGCTTCTTGAATTTTTTTATGATTGCCAGT GAGCTACATTGAAGGCTGTTAAAGAAGACTCCTTCAGTTTGAGGAGAGACTCCTGTAATTT CTAATATTTAAATTGNTCTTTTTTTATGTAATTTTTTTTGTAAATTTAGTGTGTGACAGTC CACAACTAAGTCTATAAATTTTTTAAAACTAGTAATTCAGTATATGGTCTGAATAAAGCAT TTTCTTGAGTTTAGATTTCTATTG [SEQ ID NO: 7]
EXAMPLE 6
AGT-302 sequence homology
Rattus norvegicus RIKEN cDNA C330026P08
Mus musculus RIKEN cDNA C330026P08 gene
Homo sapiens replication protein A3, 14kDa (RPA3), mRNA
EXAMPLE 7
AGT-302 gene expression
Replication Protein A (RPA) is a three-subunit single-stranded DNA-binding protein that has been isolated from human cells. Using PCR amplification of genomic DNA from rodent-human cell lines, Umbricht et al, J. Biol. Chem. 268: 6131-6138, 1993 mapped the gene for the 70-kD subunit (RPAl) to chromosome 17. By the same method, they mapped the genes for the 32-kD (RPA2) and the 14-kD (RPA3) subunits to chromosomes 1 and 7, respectively. Using a combination of PCR amplification of somatic cell hybrids and radiation hybrids containing chromosome 17 fragments, Umbricht et al, Genomics 20: 249-257, 1994 mapped RPAl to 17pl3.3.
A growing body of evidence shows that the folding of mRNA influences a diverse range of biologic events such as mRNA splicing and processing, and translational control and regulation. Shen et al, Proc. Natl. Acad. Sci. USA 96: 7871-7876, 1999 examined whether the folding of mRNA could be influenced by the presence of single-nucleotide polymorphisms (SNPs). Marked differences were reported in mRNA secondary structure associated with SNPs in the coding region of two human mRNAs: alanyl-tRNA synthetase and replication protein A, 70-kD subunit. Enzymatic probing of SNP-containing fragments of the mRNAs revealed pronounced allelic differences in cleavage pattern at sites 14 or 18 nucleotides away from the SNP, suggesting that a single-nucleotide variation can give rise to different mRNA folds. By using oligodeoxyribonucleotides complementary to the region of different allelic structures in the RPA70 mRNA, but not extending to the SNP itself, it was found that the SNP exerted an allele-specific effect on the accessibility of its flanking site in the endogenous human RPA70 mRNA.
Nakayama et al, Circulation 99: 2864-2870, 1999 reported that a -786T-C mutation, in the promoter region of the endothelial nitric oxide synthase (eNOS) gene reduced transcription of the gene and was strongly associated with coronary spastic angina and myocardial infarction. Miyamoto et al, Hum. Molec. Genet. 9: 2629-2637, 2000 determined that RPAl specifically binds to the mutant allele in nuclear extracts from HeLa cells. In human umbilical vein endothelial cells, inhibition of RPAl expression using antisense oligonucleotides restored transcription driven by the mutated promoter sequence, whereas overexpression of RPAl further reduced it. Serum nitrite-nitrate levels among individuals carrying the -786T-C mutation were significantly lower than among those without the mutation. The authors concluded that RPAl apparently functions as a repressor protein in the -786T-C mutation-related reduction of eNOS gene transcription associated with the development of coronary artery disease. EXAMPLE 8 AGT-302 gene expression as measured by SYBR Green Real Time PCR
AGT-302 gene expression was significantly higher in Day 2 separated animals compared to Day 6 (p=0.0267) and Day 8 (p=0.0181) separated animals (Table 6). In addition, gene expression was negatively correlated with jumps (p=0.025) in the Open-Field Test. The expression of AGT-302 was significantly elevated in this animal model of depression which suggests that AGT-302 may be a target for the treatment of depression.
TABLE 6
Figure imgf000081_0001
EXAMPLE 9 Sequence of Psammomys obesus AGT-303
AGT-303 was identified using microarray analysis of hypothalamus, depression time- course study of P. obesus.
The nucleotide sequence is as follows:
CAACCAACTCGAACCCATACTATCAAACCCCGNGACCTGAATGTGCTCACACCCACTGGCT TCTAGAATGCTTTCTGTCCAGGCTCTTCAGCTTTCCCTGGGCTCTGACATAGGAGTGACAT AGTTAACTGAGGCCTAGTGACATTGTACAGATTGTCCCTGTGTGAGAGGAACCATTTTGCA CTGCTTTCAGGTTGGTGGAAAATGTCAGAAGTGTAGAGTGGAGAACCTATTATTATTATTT TTTTAATCATTTATCCTAGAGAGGGACTCTGACCCTTGCTTTCCTAGGTAAATAGTGCTGG TGCGCTTTTAAAACTAAGGCCTCTTGATTCTTTTTCCATGATCACTATGA [SEQ ID NO: 3] EXAMPLE 10 AGT-303 sequence homology
Blast results from both nucleotide and protein databases confirm the identity of AGT-303 as the mouse RIKEN cDNA 4833439L19 gene, which is homologous to human KIAA1191 (also called 'hypothetical protein FLJ21022').
EXAMPLE 11
AGT-303 gene expression as measured by SYBR Green Real-Time PCR
Gene expression was significantly higher in Day 2 (p=0.036) and Day 4 (p=0.009) separated animals when compared to Day 0 controls (Table 7). Gene expression was significantly higher in Day 2 separated animals compared to Day 6 (p=0.019) separated animals. Gene expression was significantly higher in Day 4 separated animals compared to Day 6 (p=0.017) and Day 8 (p=0.006) separated animals. The expression of AGT-303 was significantly elevated in this animal model of depression, which suggests that AGT- 303 may be a target for the treatment of depression.
TABLE 7
Figure imgf000082_0001
EXAMPLE 12 Sequence of Psammomys obesus AGT-304
AGT-304 was identified using microarray analysis of hypothalamus, depression time- course study ofP. obesus.
The initial nucleotide sequence identified is as follows:-
GCAAGACCTCTGCCAGTATAGGCAGTCTCTGTGCTGATGCAAGAATGTATGGTGTTCTTCC ATGGAATGCTTTTCCTGGCAΆGGTCTGTGGCTCCAACCTTCTGTCCATCTGCAAAACAGCC GAGTTCCAAATGACCTTCCACCTGTTTATTGCTGCGTTTGTCGGTGCTGCAGCCACACTAG TTTCCCTGCTCACCTTCATGATTGCTGCCACTTACAACTTCGCCGTCCTTAAACTCATGGG CCGAGGCACCAAGTTCTGATTTCCCATAGAAATCTCCCTTTGTCTAATAGCGAGGCTCTAA CCACACAGCCTACAGTGCTGTGTCTCCTATCTTAACTCTGCCTTTGCCACTGATTGGCCCT CTTCTTACTTGATGAGTATAACAAGAAAGGAGAGTCTTGCAGTGATTAΆTCTCTCTCTGTG GACTCTCCCTCTTATGTACCTCTCTTAGTCATTTTGCTCCACAGCTGGTT [SEQ ID
NO : 4 ]
A more complete sequence is shown in SEQ ID NO:8:
CAAAGATACTCAGAGAGAAAAAGTAAAGGACAGAAGAAGGAGACTGGAGATACCAGGCTCC TTCCAGCTGAACAAAGTCAGCCGCAAΆGCAGACTAGCCAGCAGGCTACAATTGGAATCAGA GTGCCAAAGACATGGGCTTGTTAGAGTGCTGTGCAAGATGTCTGGTAGGGGCTCCCTTTGC TTCCCTGGTGGCCACTGGATTGTGTTTCTTTGGAGTGGCGCTGTTCTGTGGATGTGGACAC GAAGCTCTCACTGGTACAGAAAAGCTAATTGAGACCTATTTCTCCAAAAACTACCAGGACT ATGAGTATCTCATTAATGTGATTCATGCCTTCCAGTATGTCATCTATGGAACTGCCTCTTT CTTCTTCCTTTATGGGGCCCTCCTGCTGGCTGAGGGCTTCTACACCACCGGTGCAGTCAGG CAGATCTTTGGCGACTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCAACGGTAACAG GGGGCCAGAAGGGGAGGGGTTCCAGAGGCCAACATCAAGCTCATTCTTTGGAGCGGGTGTG TCATTGTTTGGGAAAATGGCTAGGACATCCCGACAAGTTTGTGGGCATCACTATGCCCTGA CTGTTGTATGGCTCCTGGNGTTTGCCTGCTCTGCTGTGCCTGTGTACATTTACTTCAATAC CTGGACCACCTGTCAGTCTATNGCCTTNNNTAGCAAGACCTCTGCCAGTATAGGCAGTCTC TGTGCTGATGCAAGAATGTATGGTGTTCTTCCATGGAATGCTTTTCCTGGCAAGGTCTGTG GCTCCAACCTTCTGTCCATCTGCAAA CAGCCGAGTTCCAAATGACCTTCCACCTGTTTAT TGCTGCGTTTGTCGGTGCTGCAGCCACACTAGTTTCCCTGCTCACCTTCATGATTGCTGCC ACTTACAACTTCGCCGTCCTTAAACTCATGGGCCGAGGCACCAAGTTCTGATTTCCCATAG AΆATCTCCCTTTGTCTAATAGCGAGGCTCTAACCACACAGCCTACAGTGCTGTGTCTCCTA TCTTAACTCTGCCTTTGCCACTGATTGGCCCTCTTCTTACTTGATGAGTATAACAAGAAAG GAGAGTCTTGCAGTGATTAATCTCTCTCTGTGGACTCTCCCTCTTATGTACCTCTCTTAGT CATTTTGCTCCACAGCTGGTTCCCACTAGAAATGGGGGATGCCTCAGAAGGTGATTCCCCA GCTGCAAGTCAGAAAGGAAGGAAAGCTCTAATTGAGTTTACAAGCATCTCCTCAAGACCAG GAATGTGTGCTTCCTTCTC [SEQ ID NO: 8] EXAMPLE 13 AGT-304 sequence homology
Proteolipid protein (Pip)
EXAMPLE 14 AGT-304 gene expression
Proteolipid protein, or lipophilin, is the primary constituent of myelin. Using a PLP- specific cDNA clone, Diehl et al, Proc. Natl. Acad Sci. USA §5:9807-9811, 1986, isolated the human gene encoding PLP from a human genomic library. The gene encodes a 276- amino acid polypeptide with five strongly hydrophobic domains that interact with the lipid bilayer as trans- and cis- membrane segments. Diehl et al, 1986, supra determined that the human PLP gene contains seven exons and spans approximately 17 kb.
The two isoforms of the myelin proteolipid protein, PLP and DM20, are very hydrophobic integral membrane proteins that account for about half of the protein content of adult CNS myelin. The mRNAs encoding them are synthesized through alternative splicing of the primary transcript of a single gene. The nucleotide sequence of the protein-encoding regions of the PLP gene is highly conserved among all species studied (Yool et al, Hum. Molec. Genet. 9: 987-992, 2000).
Using a bovine cDNA probe in Southern blot analysis of somatic cell hybrid DNA, Willard and Riordan, Science 230: 940-942, 1985 assigned the gene to human Xql3-q22. They assigned the gene to the mouse X chromosome also. Mattei et al, Hum. Genet. 72: 352- 352, 1986 mapped PLP to Xq22 by in situ hybridization. With a panel of hybrids segregating portions of the X chromosome defined by radiation-induced breaks, Willard et al, Cytogenet. Cell Genet. 46: 716, 1987 found that PLP maps distal to PGKl(phosphoglycerate kinase 1) and proximal to PRPS (phosphoribosylpyrophosphate synthetase I); however, PLP showed complete cosegregation with α-galactosidase (GLA), suggesting it is very close to this gene. PLP is found in brain, CNS, ear, foreskin, germ cell, heart, lung, parathyroid, peripheral nervous system, prostate, skin, testis and whole embryo. In humans defects in PLP are the cause of Pelizaeus-Merzbacher Disease (PMD), an X-linked neurologic disorder of myelin metabolism. Defects in PLP are a cause of spastic paraplegia-2 (spg2), a form of x-linked hereditary spastic paraplegia (xl-hsp). Hsp is a group of inherited degenerative spinal cord disorders characterized by a slow, gradual, progressive weakness and spasticity (stiffness) of the legs. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. Rate of progression and the severity of symptoms is quite variable. In mouse and rat, defects in plpl are the cause of the dismyelinating diseases jimpy and rumpshaker (mouse) and md (rat).
EXAMPLE 15
AGT-304 gene expression as measured by SYBR Green Real Time PCR
Gene expression was significantly higher in Day 0 control animals when compared to Day 6 (p=0.009) and Day 8 (p=0.017) separated animals (Table 8). Gene expression was significantly higher in Day 2 separated animals when compared to Day 6 (p=0.003) and Day 8 (p=0.006) separated animals. There was a correlation between AGT-304 gene expression and outer ambulations (p=0.006, r2=0.1722) in the open-field test (Figure 2). The expression of AGT-304 was significantly reduced in this animal model of depression, which suggests that AGT-304 may be a target for the treatment of depression.
TABLE 8
Figure imgf000085_0001
EXAMPLE 16
Sequence of Psammomys obesus AGT-305
AGT-305 was identified using microarray analysis of hypothalamus, depression time- course study ofP. obesus.
The initial nucleotide sequence identified is as follows:-
GAATTCCCGGGATATCGTCGACCCACGCGTCCGAATTCTTTTACAGGTTTTATAACTGCCT ACAACATGCTATGGAAAGAGAAACTATTTCAAACTCGCATTCCAAGATCAAAGAGAAGAAA AACCCATGTTGTACGCGTAAGAAAGGGAATCAGGGAAAAGCACACAACCTGCCTGTTACCA AAGACAATGAAAAGGAΆCTTGAAGGTGGCGATGGCGTTGAACTCAGGCTCTTCTTGGGAGA TGACTGAGGCCTGGCACAGTTCCGTCCCTGGCACACCCTGTGAGGCTGCTCTTCATAAGAG CGTCAACCTTGCAGGAGGCAΆGAGCCAGCTTCCCTCTGTTTTTGAGAGACTTAAGTGTAAA CAGCCTTTCAAGGTGGCTTTGTGCATGTTCACTCTCTGAAGACTGCTTTTAAAGCATCTTA GGAGTTACTCCACAAGTTTCCTGGGTCTGTCTGTGTG [SEQ ID NO: 5]
A more complete sequence is shown in SEQ ID NO: 9:
GAATTCCCGGGATATCGTCGACCCACGCGTCCGAATTCTTTTACAGGTTTTATAACTGCCT ACAACATGCTATGGAAAGAGAAACTATTTCAAACTCGCATTCCAAGATCAAAGAGAAGAAA AACCCATGTTGTACGCGTAAGAAAGGGAATCAGGGAAAAGCACACAACCTGCCTGTTACCA AAGACAATGAAAAGGAACTTGAAGGTGGCGATGGCCTTGAACTCAGGCTCTTCTTGGGAGA TGACTGAGGCCTGGCACAGTTCCGTCCCTGGCACACCCTGTGAGGCTGCTCTTCATAAGAG CGTCAACCTTGCAGGAGGCAAGAGCCAGCTTCCCTCTGTTTTTGAGAGACTTAAGTGTAAA CAGCCTTTCAAGGTGGCTTTGTGCATGTTCACTCTCTGAAGACTGCTTTTAAAGCATCTTA GGAGTTACTCCACAAGTTTCCTGGGTCTGTCTGTGTGAAATAGGAAAAGCAAGATTAATTC CCTTCTGAGGTAGCCTCAGCATCATTTGAGTAGGAACCCTGGGAACAACCTCACCCTAACT CCCAGCATTTTTTAGAGGAATGAGTAGGTACCCCTGATACCATCTCCCATCGTTACACTGC TGTTTGCATGGCCGGACAGCCTGGTGCTACGTGCTGCTGCACAGCTTGAGCCTTACACAAC GGTGGCACTCTTGAAGCTGTGAGCTGCACATTAGGTAAGCCTGTGCAGCTTCCCTGCCACT TAGGGAATTGGAGCAGGGGAAGGAAACAGTTTTAAAATGTCTGGGGTATGGCTTCTAAACT ATCGAGTAAAATCTGAATGATCTTCCAGGCATATAGATGGAAGGAGTGAGAAATCAAGGAA ACAGCCTAAAAGAGAGCAGTGCAGCCAGCATGCGGAAGGGCACCTGAGCTGGGTGACCTGT GCTGCAGGTTTTAGCCTCTGAACTAGA [SEQ ID NO: 9] EXAMPLE 17 AGT-305 sequence homology
Mus musculus RIKEN clone 5230400J09
EXAMPLE 18 AGT-305 gene expression as measured by SYBR Green Real Time PCR
ATG-305 gene expression was significantly higher in Day 4 (p=0.003) separated animals when compared to Day 0 controls (Table 9). In addition, gene expression was significantly higher in Day 4 separated animals compared to Day 6 (p=0.009) and Day 8 (p=0.005) separated animals. There was a negative correlation between AGT-305 gene expression and outer ambulations (p=0.01, r2=0.1582) in the open-field test (Figure 3). The expression of AGT-305 was significantly elevated in this animal model of depression, which suggests that AGT-305 may be a target for the treatment of depression.
TABLE 9
Figure imgf000087_0001
EXAMPLE 19
Altered behaviours resulting from suppression of AGT-301
AGT-301 gene expression was regulated in vivo by intracerebroventricular (ICV) antisense treatment in P. obesus.
Three days prior to surgery and antisense treatment, animals were subjected to the open- field test. Animals were placed in the centre of the open-field test and recorded for 5 minutes. Following testing the data was analysed for time spent (seconds) and the number of ambulations through the inner and outer regions of the open-field. In addition, total horizontal movement (seconds), rears and jumps was assessed.
Animals were subjected to ICV surgery and cannulae were inserted into the lateral cerebral ventricle. Two antisense oligonucleotides (SEQ ID NO: 10 and SEQ ID NO: 11) and jumble oligonucleotides (SEQ ID NO: 12) were dissolved in saline at a concentration of lμg/μl and ALZET osmotic pumps (Model 2001) were used to deliver either a mixture of the two antisense oligonucleotides or the jumbled oligonucleotides at lμl/hour into the lateral ventricle for a period of four days. Following surgery, animals were separated into individual cages for the four days of treatment. Body, weight, food intake and water intake were monitored during the separation period.
SEQ ID NO: 10:
Antisense AGT 301a 5'-GCAGGCGAGTACTCACGCCCTGCCCCACGACCCAT-3'
SEQ ID NO:l l:
Antisense AGT 301b 5'-GCAGGCGAGTACTCACGCCCTGCCCCACGTCCCAT-3'
SEQ ID NO: 12: Jumbled control 5'-AGCGCGAGGTCAACTGCCCCTCGCACCGCTTCCCA-3' After four days of antisense treatment the animals were subjected to the open-field test as previously described. Data comparing behaviour of animals before ("PRE") and after ("POST") treatment for the three experimental groups (antisense AGT-301, jumbled oligonucleotide control and saline control) are shown in Table 10.
Suppression of AGT-301 gene expression in the central nervous system by antisense treatment significantly affected the behaviour of the treated animals. Animals treated with antisense oligonucleotides AGT-301a and AGT-301b (SEQ ID NOs:10 and 11) spent significantly more time and made more ambulations in the inner region of the open field test than did either group of control animals (p<0.05 in both cases). These results are consistent with the hypothesis that suppression of AGT-301 alters the behaviour of the animals in a manner that suggests the animals are less anxious or depressed.
These results indicate that suppression of AGT-301 or its expressed products can be used to alter behaviours in mammals.
TABLE 10
Figure imgf000089_0001
Figure imgf000090_0001
* Significant difference (p=0.03) in time spent in the inner region of the open-field test in AGT 303 antisense treated animals.
Λ Significant difference (p=0.02) in the number of ambulations in the inner region of the open-field test.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
BIBLIOGRAPHY
Adams et al, Cancer Res. 53: 4026-4034, 1993
Altschul et al, Nucl. Acids Res. 25: 3389-3402. 1997
American Psychiatric Association, Diagnostic and statistical manual of mental disorders.
Washington, D.C. Assoc. Am. Psychiatr. 4th edition, 1994
Ausubel et al, "Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-
1998, Chapter 15
Baltimore, J. Virol. 54: 401-407, 1985
Bandyopadhyay and Temin, Mol. Cell. Biol 4: 749-754, 1984
Berglund et al, Biotechnology 11: 916-920, 1993
Berkner et al, BioTechniques 6: 616-629, 1988
Berkner, Curr. Top. Microbiol Immunol. 158: 39-66, 1992
Bonner and Laskey, Eur. J. Biochem. 46: 83, 1974
Breakefield and Geller, Mol. Neurobiol 1: 339-371, 1987
Buchschacher and Panganiban, J. Virol. 66: 2731-2739, 1982
Chothia et al, J. Mol. Biol. 196: 901, 1987
Chothia et al, J. Mol. Biol. 227: 799, 1992
Cumber et al, J. Immunol. 149: 120-126, 1992
Davies & Riechmann, FEBSLett. 339: 285-290, 1994
De Fusco, M. et al. Nat. Genet. 55:192-196, 2003
Diehl et al, Proc. Natl. Acad. Sci. USA 83: 9807-9811, 1986
Douillard and Hoffman, Basic Facts about Hybridomas, in Compendium of Immunology
Vol. II, ed. by Schwartz, 1981; Drevets, -4røι. Rev. Med. 49: 341-361, 1998
Erickson et al, Science 249: 527-533, 1990
Fink et al, Ann. Rev. Neurosci. 19: 265-287, 1996
Fink et al, Hum. Gene Ther. 3: 11-19, 1992
Freese et al, Biochem. Pharmacol. 40: 2189-2199, 1990
Glockshuber et al, Biochem. 29: 1363-1367, 1990
Gorziglia and Kapikian, J. Virol. 66: 4407-4412, 1992
Hamers-Casterman et al, Nature 363: 446-448, 1993
Helseth et α/., J. Virol. 64: 2416-2420, 1990
Hodgson, Bio/Technology 9: 19-21, 1991
Ikeda et al, J. Neuroscience, 25:4667-4676, 2003
James et al, Molec. Cell 3: 555-563, 1999
Jesberger and Richardson, Biol Psychiatry 20: 764-784, 1985
Johnson et al, "Peptide Turn Mimetics" in Biotechnology' and Pharmacy, Pezzuto et al,
Eds., Chapman and Hall, New York, 1993
Johnson et α/., J Virol. 66: 2952-2965, 1992
Jones et al, Nature 321: 522-525, 1986
Kabat et al, "Sequences of Proteins of Immunological Interest", U.S. Department of
Health and Human Sciences, 1983
Katzmarzyk et ., J. Clin. Endocr. Metab. 84: 2093-2097, 1999
Kohler and Milstein, European Journal of Immunology 6: 511-519, 1976
Kohler and Milstein, Nature 256: 495-499, 1975;
Kostelny et al, J. Immunol. 148: 1547-1553, 1992 Krebber et al, J. Immunol. Methods 201(1): 35-55,1997
Ku & Schutz, Proc. Natl. Acad. Sci. USA 92: 6552-6556, 1995
Liu et al, Proc. Natl. Acad. Sci. USA 84: 3439-3443, 1987
Madzak et /., J. Gen. Virol. 73: 1533-1536, 1992;
Margolskee, Curr. Top. Microbiol. Immunol. 158: 67-95, 1992
Marmur and Doty, J. Mol. Biol. 5: 109, 1962
Mattei et /., Hum. Genet. 72: 352-352, 1986
Miller et al, J. Virol. 62: 4337-4345, 1988
Miller etal, Mol. Cell. Biol. 5: 431-437, 1985
Miller, Curr. Top. Microbiol. Immunol. 158: 1-24, 1992
Miyamoto et al, Hum. Molec. Genet. 9: 2629-2637, 2000
Mosely et α/., J Biol. Chem. 275:5317-5324, 2003
Moss, Curr. Top. Microbiol. Immunol. 158: 25-38, 1992
Moss, Proc. Natl. Acad. Sci. USA 93: 11341-11348, 1996
Murray and Lopez, Lancet 349: 1498-1504, 1997
Muzyczka, Curr. Top. Microbiol. Immunol. 158: 97-129, 1992
Nakayama et α/., Circulation 99: 2864-2870, 1999
Naldini et al, Science 272: 263-267, 1996
Ohi et al, Gene 89: 279-282, 1990
Page et al, J. Virol. 64: 5270-5276, 1990
Petropoulos et al, J. Viol. 66: 3391-3397, 1992
Pliickthun et al, In Antibody engineering: A practical approach, 203-252, 1996
Plϋnckthun, Biochem 31: 1579-1584, 1992 Quantin et al, Proc. Natl. Acad. Sci. USA 89: 2581-2584, 1992
Reiter et al, Biochem. 33: 5451-5459, 1994
Reiter et al, Cancer Res. 54: 2714-2718, 1994
Reiter et al, J. Biol. Chem. 269: 18327-18331, 1994
Richmann et al, Nature 332: 323-327, 1988
Rosenfeld et al, Cell 68: 143-155, 1992
Russell and Hirata, Nature Genetics 18: 323-328, 1998
Schneider et al, Nature Genetics 18: 180-183, 1998
Shen et al, Proc. Natl. Acad. Sci. USA 96: 7871-7876, 1999
Shimada et al, J. Clin. Invest. 88: 1043-1047, 1991
Shull and Lingrel, Proc. Natl. Acad. Sci. USA 84: 4039-4043, 1987
Sorge et al, Mol. Cell Biol. 4: 1730-1737, 1984
Stratford-Perricaudet et al, Hum. Gene Ther. 1: 241-256, 1990
Summerton and Weller, Antisense and Nucleic Acid Drug Development 7: 187-195, 1997
Umbricht et al, Genomics 20: 249-257, 1994
Umbricht et al, J. Biol. Chem. 268: 6131-6138, 1993
Verhoeyen et al, Science 239: 1534-1536, 1988
Ward et al, Nature 341: 544-546, 1989
Webber et al, Mol. Immunol. 32: 249-258, 1995
Wells, Methods Enzymol 202: 2699-2705, 1991
Wilkinson et al, Nucleic Acids Res. 20: 2233-2239, 1992
Willard and Riordan, Science 230: 940-942, 1985
Willard et al, Cytogenet. Cell Genet. 46: 716, 1987 Willner, Handbook of Depression and Anxiety, (J.A. den Boer and J. M. Ad. Sisten, eds.), Marcek Dekker, New York, pp. 291-316, 1994 Winter and Milstein, Nature 349: 293, 1991 Yang-Feng et al, Genomics 2: 128-138, 1988 Yool et al, Hum. Molec. Genet. 9: 987-992, 2000

Claims

1. An isolated differentially expressed isolated nucleic acid molecule from a P. obesus animal, which animal is subjected to separation or isolation from other P. obesus animals from the same community and which animal exhibits at least one phenotype selected from a non-response, temporary response or constant response phenotype.
2. The isolated nucleic acid molecule of Claim 1 comprising a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NOs:l or 6 (AGT-301) or SEQ ID NOs:2 or 7 (AGT-302) or SEQ ID NO:3 (AGT-303) or SEQ ID NOs:4 or 8 (AGT-304) or SEQ ID NOs:5 or 9 (AGT-305) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs:l or 6 or SEQ ID NOs:2 or 7 or SEQ ID NO:3 or SEQ ID NOs:4 or 8 or SEQ ID NOs:5 or 9 and/or is capable of hybridizing to one or more of SEQ ID NOs:l or 6 or SEQ ID NOs:2 or 7 or SEQ ID NO:3 or SEQ ID NOs:4 or 8 or SEQ ID NOs:5 or 9 or a complementary form thereof under low stringency conditions at 42°C and wherein said nucleic acid molecule is differentially expressed in hypothalamus muscle tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
3. The isolated nucleic acid molecule of Claim 1 or 2 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:l or 6 (AGT-301) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:l or 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l or 6 or its complementary form under low stringency conditions.
4. The isolated nucleic acid molecule of Claim 1 or 2 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:2 or 7 (AGT-302) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:2 or 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:2 or 7 or its complementary form under low stringency conditions.
5. The isolated nucleic acid molecule of Claim 1 or 2 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO: 3 (AGT-303) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 or their complementary forms under low stringency conditions.
6. The isolated nucleic acid molecule of Claim 1 or 2 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:4 or 8 (AGT-304) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:4 or 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 or 8 or its complementary form under low stringency conditions.
7. The isolated nucleic acid molecule of Claim 1 or 2 or derivative, homolog or analog thereof comprising a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:5 and 9 (AGT-305) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:5 and 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:5 or 9 or its complementary form under low stringency conditions.
8. A method for assessing a behavioral disorder in P. obesus animals, said method comprising subjecting a plurality of communally-reared or maintained animals to social isolation from each other for a time and under conditions sufficient for one of three phenotypes to become apparent when said phenotypes are selected from non-response, temporary response and constant response phenotype and then screening for changes in expression of one or more nucleic acid molecules
9. The method of Claim 8 wherein the nucleic acid molecule comprises a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NOs:l and 6 (AGT-301) or SEQ ID NOs:2 and 7 (AGT- 302) or SEQ ID NO:3 (AGT-303) or SEQ ID NOs:4 and 8 (AGT-304) or SEQ ID NOs:5 and 9 (AGT-305) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs: 5 and 9 and/or is capable of hybridizing to one or more of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs:5 and 9 or a complementary form thereof under low stringency conditions at 42°C and wherein said nucleic acid molecule is differentially expressed in hypothalamus muscle tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
10. The method of Claim 8 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:l and 6 (AGT-301) or a derivative, homolog or mimetic thereof or having at least about 30%) similarity to all or part of SEQ ID NOs:l and 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l and 6 or its complementary form under low stringency conditions.
11. The method of Claim 8 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:2 and 7 (AGT-302) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:2 and 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:2 and 7 or its complementary form under low stringency conditions.
12. The method of Claim 8 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO: 3 (AGT-303) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 or their complementary forms under low stringency conditions.
13. The method of Claim 8 wherein the nucleic acid moelcule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:4 and 8 (AGT-304) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:4 and 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 and 8 or its complementary form under low stringency conditions.
14. The method of Claim 8 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:5 and 9 (AGT-305) or a derivative, homolog or mimetic thereof or having at least about 30%) similarity to all or part of SEQ ID NOs: 5 and 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 5 and 9 or its complementary form under low stringency conditions.
15. A method for identifying a nucleic acid molecule whose expression is altered following a behavioral-modifying protocol applied to a P. obesus animal model, said method comprising subjecting a plurality of communally-reared or maintained P. obesus animals to said protocol comprising socially separating said animals and determining whether there is any alteration in expression of a nucleic acid molecule.
16. The method of Claim 15 wherein the nucleic acid molecule comprises a nucleotide sequence encoding or complementary to a sequence encoding an expression product or a derivative, homolog, analog or mimetic thereof wherein said nucleotide sequence is as substantially set forth in SEQ ID NOs:l and 6 (AGT-301) or SEQ ID NOs:2 and 7 (AGT- 302) or SEQ ID NO:3 (AGT-303) or SEQ ID NOs:4 and 8 (AGT-304) or SEQ ID NOs:5 and 9 (AGT-305) or a nucleotide sequence having at least about 30% similarity to all or part of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs: 5 and 9 and/or is capable of hybridizing to one or more of SEQ ID NOs:l and 6 or SEQ ID NOs:2 and 7 or SEQ ID NO:3 or SEQ ID NOs:4 and 8 or SEQ ID NOs: 5 and 9 or a complementary form thereof under low stringency conditions at 42°C and wherein said nucleic acid molecule is differentially expressed in hypothalamus muscle tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus animals from the same community.
17. The method of Claim 15 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:l and 6 (AGT-301) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs: 1 and 6 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:l and 6 or its complementary form under low stringency conditions.
18. The method of Claim 15 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:2 and 7 (AGT-302) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:2 and 7 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 2 and 7 or its complementary form under low stringency conditions.
19. The method of Claim 15 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NO:3 (AGT-303) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NO: 3 or a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 or their complementary forms under low stringency conditions.
20. The method of Claim 15 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:4 and 8 (AGT-304) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs:4 and 8 or a nucleotide sequence capable of hybridizing to SEQ ID NOs:4 and 8 or its complementary form under low stringency conditions.
21. The method of Claim 15 wherein the nucleic acid molecule comprises a nucleotide sequence encoding, or a nucleotide sequence complementary to a sequence encoding an expression product wherein said nucleotide sequence is substantially as set forth in SEQ ID NOs:5 and 9 (AGT-305) or a derivative, homolog or mimetic thereof or having at least about 30% similarity to all or part of SEQ ID NOs: 5 and 9 or a nucleotide sequence capable of hybridizing to SEQ ID NOs: 5 and 9 or its complementary form under low stringency conditions.
22. An isolated expression product or a derivative, homolog, analog or mimetic thereof which is produced in larger or lesser amounts in hypothalamus tissue of a communally- reared P. obesus animal separated from other P. obesus animals from the same community.
3. An isolated expression product selected from the list consisting of:-
(i) an mRNA or protein encoded by a novel nucleic acid molecule which molecule is differentially expressed in hypothalamus tissue of communally-reard P. obesus animal subjected to isolation from other P. obesus animals from the same community or a derivative, homolog, analog, chemical equivalent or mimetic thereof;
(ii) an mRNA or protein encoded by a novel nucleic acid molecule which molecule is differentially expressed in hypothalamus tissue of a communally-reared P. obesus animal subjected to isolation from other P. obesus aniamls from the same community or a derivative, homolog, analog, chemical equivalent or mimetic thereof;
(iii) AGT-301, AGT-302, AGT-303, AGT-304 or AGT-305 or a derivative, homolog, analog, chemical equivalent or mimetic thereof;
(iv) a protein encoded by a nucleotide sequence comprising SEQ ID NOs:l or 6 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(v) a protein encoded by a nucleotide sequence substantially comprising
SEQ ID NOs:2 or 7 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(vi) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NO:3 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(vii) a protein comprising an amino acid sequence substantially as set forth in SEQ ID NOs:4 or 8 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to these sequences or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(viii) a protein encoded by a nucleotide sequence substantially comprising SEQ ID NOs: 5 or 9 or a derivative, homolog or analog thereof or a sequence encoding an amino acid sequence having at least about 30% similarity to this sequence or a derivative, homolog, analog, chemical equivalent or mimetic of said protein;
(ix) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:l or 6 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;
(x) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:2 or 7 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions;
(xi) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NO: 3 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions; (xii) protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:4 or 8 or their complementary forms or a derivative, homolog or analog thereof under low stringency conditions; and
(xiii) a protein encoded by a nucleic acid molecule capable of hybridizing to a nucleotide sequence comprising SEQ ID NOs:5 or 9 or its complementary form or a derivative, homolog or analog thereof under low stringency conditions.
24. A method for modulating expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a mammal, said method comprising contacting the AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 gene with an effective amount of a modulator of AGT- 301, AGT-302, AGT-303, AGT-304 and AGT-305 expression for a time and under conditions sufficient to up-regulate or down-regulate or otherwise modulate expression of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305.
25. The method of Claim 24 wherein the modulation is selected from an antisense molecule, a sense molecule, si-RNA, sh-RNAi, mh-RNAi and ddRNAi.
26. A method of modulating activity of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 in a mammal, said method comprising admimstering to said mammal a modulating effective amount of a molecule for a time and under conditions sufficient to increase or decrease AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 activity. The molecule may be a proteinaceous molecule or a chemical entity and may also be a derivative of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or its ligand.
27. Therapeutic and prophylactic use of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 expression products or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 genetic mutants and/or agonists or antagonists agents thereof.
28. A method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or sufficient to modulate the activity of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305.
29. The method of Claim 28 wherein the expression is modulated by a molecule selected from an anti-sense molecule, sense molecule, si-RNA, sh-RNAi, mh-RNAi and ddRNAi.
30. A method of treating a mammal suffering from or having a propensity to suffer from a behavioral condition or disorder, said method comprising administering to said mammal an effective amount of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT- 305 or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305.
31. Use of an agent capable of modulating the expression of AGT-301, AGT-302, AGT- 303, AGT-304 and/or AGT-305 or a derivative, homolog or analog thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.
32. Use of an agent capable of modulating the activity of AGT-301, AGT-302, AGT- 303, AGT-304 and/or AGT-305 or a derivative, homolog, analog, chemical equivalent or mimetic thereof in the manufacture of a medicament for the treatment or prophylaxis of a behavioral condition or disorder.
33. Use in modulating the expression of AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or a derivative, homolog or analog thereof.
34. Use in modulating AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 activity or a derivative, homolog, analog, chemical equivalent or mimetic thereof.
35. Isolated AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or derivative, homolog or analog thereof or AGT-301, AGT-302, AGT-303, AGT-304 and/or AGT-305 or derivative, homolog, analog, chemical equivalent or mimetic thereof for use in treating a behavioral condition or disorder.
36. A composition comprising a modulator of AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 expression or AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 activity and one or more pharmaceutically acceptable carriers and/or diluents. In another embodiment, the composition comprises AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative, homolog, analog or mimetic thereof and one or more pharmaceutically acceptable carriers and/or diluents.
37. Isolated antibodies to AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 and their derivatives and homologs insofar as AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 are proteins.
38. A method for detecting AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or a derivative or homolog thereof in a biological sample from a subject, said method comprising contacting said biological sample with an antibody specific for AGT-301, AGT-302, AGT-303, AGT-304 and AGT-305 or their antigenic derivatives or homologs for a time and under conditions sufficient for a complex to form, and then detecting said complex.
39. A deimmunized antibody molecule having specificity for an epitope recognized by a monoclonal antibody to a target wherein at least one of the CDRs of the variable domain of said deimmunized antibody is derived from the said monoclonal antibody to said target and the remaining immunoglobulin-derived parts of the deimmunized antibody molecule are derived from an immunoglobulin or an analog thereof from the host for which the antibody is to be deimmunized.
40. A pharmaceutical composition, medicament, drug or other composition including a patch or slow release formulation comprising an agonist or antagonist of target activity or target gene expression or the activity or gene expression of a component of the target.
41. An isolated molecule which is an antisense molecule, a sense molecule, siRNA, sh-RNAi, mh-RNAi, ddRNAi or a ribozyme specific for a sequence selected from SEQ ID NOs:l or 6, 2 or 7, 3, 4 or 8 and 5 or 9.
42. The isolated molecule of Claim 41, wherein said molecule is an antisense molecule.
43. The antisense molecule of Claim 42, wherein said antisense molecule having a sequence selected from SEQ ID NO:10 or SEQ ID NO:l l.
PCT/AU2004/000595 2003-05-07 2004-05-07 Nucleic acid molecules differentially expressed in animals exhibiting behavioural disorders WO2004099412A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46894903P 2003-05-07 2003-05-07
US60/468,949 2003-05-07

Publications (1)

Publication Number Publication Date
WO2004099412A1 true WO2004099412A1 (en) 2004-11-18

Family

ID=33435210

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2004/000595 WO2004099412A1 (en) 2003-05-07 2004-05-07 Nucleic acid molecules differentially expressed in animals exhibiting behavioural disorders

Country Status (1)

Country Link
WO (1) WO2004099412A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008526229A (en) * 2005-01-06 2008-07-24 ベニテック，インコーポレーテッド RNAi agents for stem cell maintenance
CN112119470A (en) * 2018-03-28 2020-12-22 伊坎西奈山医学院 System and method for processing connectivity values between sub-processing regions

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003024206A1 (en) * 2001-09-18 2003-03-27 Autogen Research Pty Ltd Psammomys obesus as an animal model for behavioural conditions

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003024206A1 (en) * 2001-09-18 2003-03-27 Autogen Research Pty Ltd Psammomys obesus as an animal model for behavioural conditions

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
1993, SHULL G.E. ET AL. *
DATABASE GENBANK [online] 1993, HUDSON L.D. ET AL.: "Mouse myelin proteolipid protein mRNA complete cds", Database accession no. (M15442.1.) *
DATABASE GENBANK [online] 1994, UMBRICHT C.D. ET AL.: "Homo sapiens replication protein A 14 kDa subunit (RPA) mRNA, complete cds", Database accession no. (L07493) *
DATABASE GENBANK [online] 1995, KRONQUIST ET AL.: "Human myelin proteolipid protein mRNA, complete cds", Database accession no. (M54927) *
DATABASE GENBANK [online] 2000, BOULTWOOD J. ET AL.: "Homo sapiens outative tumor suppressor MRNA", Database accession no. (AF156165.2.) *
DATABASE GENBANK [online] 2001, NAIK U.P. ET AL.: "Homo sapiens junctional adhesion molecule 1 mRNA complete sequence", Database accession no. (AF172398.2) *
DATABASE GENBANK [online] 2002, "Mus musculus similar to Riken cDNA 4833439L19", Database accession no. (XM_147750) *
DATABASE GENBANK [online] SHULL G.E. ET AL.: "Rat Na+, K+, K+-ATPase alpha(+) isoform catalytic subunit MRNA, complete cds", Database accession no. (M14512) *
LICHSTEIN D. ET AL.: "Endogenous digitalis-like Na+, K+-ATPase inhibitors and brain function", NEUROCHEM. RES., vol. 26, no. 8/9, 2001, pages 971 - 978 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008526229A (en) * 2005-01-06 2008-07-24 ベニテック，インコーポレーテッド RNAi agents for stem cell maintenance
CN112119470A (en) * 2018-03-28 2020-12-22 伊坎西奈山医学院 System and method for processing connectivity values between sub-processing regions
CN112119470B (en) * 2018-03-28 2024-03-12 伊坎西奈山医学院 System and method for processing connectivity values between sub-processing regions

Similar Documents

Publication Publication Date Title
US20070037883A1 (en) Therapeutic compositions
US20080146502A1 (en) Methods for modulating the sensation of satiety perception and agents useful for same
US20080254023A1 (en) Treating Gliosis, Glial Scarring, Inflammation or Inhibition of Axonal Growth in the Nervous System by Modulating Eph Receptor
AU2009212828A1 (en) Therapeutic, Prophylactic and Diagnostic Agents
US20070043512A1 (en) Therapeutic and prophylactic compositions and uses therefor
US20100003262A1 (en) Therapeutic, prophylactic and diagnostic agents for hepatitis b
WO2004099412A1 (en) Nucleic acid molecules differentially expressed in animals exhibiting behavioural disorders
WO2007056527A2 (en) Diagnostic and therapeutic methods and agents
US7408048B2 (en) Mammalian grainyhead transcription factors
US8669050B2 (en) Nucleic acid markers for use in determining predisposition to neoplasm and/or adenoma
EP0842272A1 (en) Novel receptor ligands and genetic sequences encoding same
WO2006029462A1 (en) A nucleic acid molecule differentially expressed in a mouse behavioural model system and uses thereof
AU2002325088A1 (en) Nucleic acid markers for use in determining predisposition to neoplasm and/or adenoma
US20090054307A1 (en) Prophylactic and therapeutic agents and uses therefor
US20060148032A1 (en) Novel phosphoprotein
US8895698B2 (en) Binding partners of antibodies specific for dendritic cell antigens
AU2005243607B2 (en) Therapeutic, prophylactic and diagnostic agents for hepatitis B
WO2003066869A1 (en) Lmt tumor suppressor gene
US20070275916A1 (en) Methods of Identifying Compounds Which Modulate Granulocite-Colony Stimulating Factor (G-Csf) Dependent Processes by Modulation of the Levels of Suppressor of Cytokine Signaling (Socs)
NZ566408A (en) Prophylactic and therapeutic agents Ndfip1 and Nedd4 and uses therefor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
122 Ep: pct application non-entry in european phase