WO2004081179A2 - Regulation of rna stability - Google Patents

Abstract

The present invention relates, e.g., to a method for screening an agent for the ability to modulate RNA processing. The agent is contacted with a sample comprising i) tristetraprolin (TTP) or a related protein, or an active fragment or variant thereof, ii) a poly(A) ribonuclease (PARN) polypeptide, or an active fragment or variant thereof, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3' poly(A) tail, wherein processing of the RNA can be detected, under conditions effective for processing and, optionally, translation of the RNA; and a parameter associated with processing of the RNA is detected. The method can be conducted in a cell-free (in vitro) or cell-based format.

Description

REGULATION OF RNA STABILITY

This application claims the benefit of Provisional Application 60/451,976, filed March 6, 2003, which disclosure is incorporated by reference in its entirety herein.

FIELD OF THE INVENTION

This invention relates generally to regulation of mRNA stability, for example relating to the stimulation or inhibition of the production of polypeptides involved in disease. In particular, methods are disclosed to screen for agents that modulate RNA processing.

BACKGROUND INFORMATION Steady-state levels of cellular mRNAs are determined by the balance between their biosynthesis and turnover. Different mRNAs can exhibit marked differences in turnover rates within the same cell, and the turnover rates of individual mRNAs can also vary significantly in response to changes in the cellular environment. In mammalian cells, the removal of the poly(A) tail, or deadenylation, is thought to play an important role in mRNA degradation, and this process is thought to impact strongly on the overall decay rate of the mRNA.

Cis-acting AU-rich elements (AREs), often within the 3 '-untranslated regions (3'-UTR) of mRNAs, can confer decreased stability on mRNAs that contain them. It has been reported that the removal of an ARE can render an mRNA more stable, whereas transplantation of an ARE to a previously stable mRNA can render it less stable (Lai et al, (2001), JBiol Chem. 27, 23144- 54; Xu et al. (1997), Mol Cell Biol 17, 4611-21). AREs have been classified into three major groups (Classes I, II and TU) according to the grouping of A and U residues within the motif (Wilusz et al. (2001), Nat Rev Mol Cell Biol. 2, 237-46; Xu et al, supra; Chen et a/.(1995), Trends Biochem. Set 20, 465-70). A recently updated database has been established which divides Class II AREs further on the basis of the number of tandem repeats of the pentameric AUUUA sequence in the motif, and adds many more sequences (Bakheet et al. (2001), Nuc.

Acids Res. 29, 246-54; Bakheet et al. (2002), ARED 2.0: An update of AU-rich mRNA database, Nuc.Acids Res. 31, 421-423; the ARED web site at rc.kfshrc.edu.sa/ared). Such AREs are present in the mRΝAs encoding many clinically significant proteins, including the cytokines tumor necrosis factor (TΝFα), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-3 (IL-3) (Wilusz et al, supra; Xu et al. (1997), Mol Cell Biol 17, 4611-21). A family of tandem Cys-Cys-Cys-His (CCCH) (SEQ ID NO:28) zinc finger cellular proteins has been reported to bind to AREs comprising tandem AUUUA pentamers. The prototype of this family of proteins is tristetraprolin (TTP), also known as TIS11 and up475. See, e.g., P. J. Blackshear (2002), Biochem Soc Trans., 30, 945-952. Studies from TTP knockout mice and their control littermates suggest that TTP can promote the destabilization of TNFα and GM-CSF mRNAs in primary macrophages and bone marrow-derived stromal cells, respectively, suggesting that TTP is a normal, physiological regulator of steady-state levels of these mRNAs in specific cell types; and co-transfection studies support the interpretation that TTP can promote destabilization of such ARE-containing mRNAs. See, e.g., Carballo et al, (2000), Blood 95, 1891-9; Carballo et al. (1998), Science 281, 1001-5; Lai et al, (1999), Mol Cell Biol. 19, 4311-23; Lai et al, (2000), JBiol Chem. 275, 17827-37; Lai et al, (2002), JBiol Chem. 277,9606-13; USP 6,187,543; and WO 01/12213.

Some of the present inventors previously reported that TTP binds to and destabilizes mRNAs containing an ARE comprising AUUUA pentamers in their 3' untranslated regions. See, e.g., USP 6,187,543 and WO 01/12213. However, they did not recognize that a third polypeptide, PARN, is involved in the reaction; and they did not describe a cell-free assay for TTP-mediated PARN deadenylation of ARE-containing RNAs.

The inventors of the present application describe herein a cell-free, TTP-dependent deadenylation assay for ARE-containing mRNAs. Using this assay, they show, e.g., that the presence of TTP or its related proteins causes a dramatic, effective activation of the poly(A) ribonuclease (PARN) that is specific for mRNA substrates which contain, e.g., AREs comprising at least one (e.g., two or more tandem) AUUUA pentamers. The recognition of this tri-partite (ARE/TTP/PARN) interaction forms the basis of many of the embodiments disclosed herein.

DESCRIPTION OF THE DRAWINGS FIGs. 1 (A-C) are schematic representations of plasmid constructs and RNA probes. Dashed lines in the schematic plasmids pictured at the top of Figures 1A-C represent vector SK- sequence, whereas the solid lines represent the inserted ARE or poly(A) sequences, as indicated. The RNA probes are represented beneath each plasmid in Figures 1 A-C; in these, the dashed line represents sequence transcribed from SK-, the open box an ARE, the solid box a mutated I

ARE, the solid line the normal 3'-UTR sequence 3' of the ARE, and the box containing A's represents the ARE sequence (bp 1309 to bp 1332 of GenBahk accession number X02611) between the EcoRV and Xbal sites of SK- as indicated. The ARE sequence is represented by the identifier SEQ ID NO:29. A double stranded oligonucleotide encoding 50 A's (SEQ ID NO: 35) was inserted between the Xbal and Eagl sites. pTNFα A/C 1309-1332 (A)50/SK- was identical to pTNFα 1309-1332 (A)50/SK- except the As in the ARE were mutated to Cs. Tins mutated ARE sequence is represented by the identifier SEQ ID NO:30. FIG. IB shows A50/SK. This plasmid contains a double stranded oligonucleotide encoding 50 A's inserted between the Xbal and Eagl sites. FIG. 1C shows pGM-CSF 668-775 (A)50/SK. This plasmid contains the 3' portions of the 3'-UTR of the mouse GM-CSF cDNA. The ARE is located from bp 668 to bp 722 of the cDNA, whereas the number 775 corresponds to the 3 '-end of the cDNA.

FIGs. 2 (A-D) show cell-free deadenylation of polyadenylated, ARE-containing RNA probes. In Figures 2A-C, 293 cell extracts were incubated with ³²P-labeled RNA probes on ice (no symbol) or at 37°C (+) for 60 min, and EDTA (final concentration 20 mM) was added to stop the reaction. RNA was then isolated and subjected to electrophoresis on urea-polyacrylamide gels, followed by autoradiography. The arrow in Figures 2A-C indicates the migration position of the ARE probe and the deadenylated product of probe ARE-A50. FIG 2A shows the results of incubating the RNA probes A50 (lanes 1-4), ARE (lanes 5-8), ARE-A50 (lanes 9-12), and V (lanes 13 and 14) with extracts from 293 cells transfected with vector alone (BS+) or

CMV.hTTP.tag (hTTP). FIG 2B shows the results of incubating the RNA probes ARE-A50 (lanes 1-6) and ARE (lanes 7 and 8) with extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), or the TTP zinc finger mutant (C124R). The position of probe V migration is shown in lane 9. FIG 2C shows the results of incubating the RNA probe ARE- A50 (lanes 1-4) and the mutant probe (A C) ARE-A50 (lanes 5- 8) with extracts from 293 cells transfected with vector alone (BS+) or CMV.hTTP.tag (hTTP). The position of probe V migration is shown in lane 9. FIG 2D shows an electrophoretic mobility shift assay, using extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), or the TTP zinc finger mutant (C124R) with probes (A/C) ARE-A50 (lanes 2-4) or ARE-A50 (lanes 6-8). The final reaction products were separated on an 8% non-denaturing polyacrylamide gel followed by autoradiography. Lanes 1 and 5 (P') were loaded with probe alone (RNase Tl digested). The TTP-RNA complexes formed (TTP) and the migration position of the free probe (FP) are indicated.

FIGs. 3 (A-B) show the ability of TTP to promote deadenylation of a GM-CSF ARE probe. FIG. 3A shows extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), or the TTP zinc finger mutant (C124R) which were mixed with the GM-CSF ARE probes g668-775 (lanes 1-4) or g668-775A50 (lanes 5-10) as described in the brief description of Fig. 2. The arrow indicates the migration position of the ARE probe (lanes 1-4) as well as the deadenylated product of probe g668-775-A50 (lane 8). FIG 3B shows cell extracts as described above which were incubated with probe g668-775A50 (lanes 1-3); a gel shift assay was performed as described in the brief description of Fig. 2. Lane 4(P') was loaded with probe alone (RNase Tl digested). The TTP-RNA complexes formed (TTP) and the migration position of the free probe (FP) are indicated.

FIGs. 4 (A-D) show the effect of TTP-related proteins on probe deadenylation. FIG 4 A shows extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), CMV.cMGl.tag (cMGl), or CMV.xC3H-3 (xC3H-3) and incubated with probe ARE-A50 (lanes 1-8) or ARE (lanes 9 and 10). The reaction mixtures were incubated on ice or at 37°C (+) for 60 min, and processed as described in the brief description of Fig. 2. The arrow indicates the migration position of the deadenylated product of probe ARE-A50 (lanes 4, 6 and 8) and the ARE probe (lanes 9 and 10). The position of probe V migration is shown in lane 11. FIG 4B shows cell extracts described in FIG 4A that were incubated with probe ARE-A50 (lanes 1-4) and used in a gel shift analysis. Lane 5(P') contained probe alone (RNase Tl digested). The migration position of the free probe (FP) is indicated. FIG 4C shows extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), or the TTP TZF domain vector CMV.hTTP (97-173).tag (TZF) and incubated with probe ARE-A50; the deadenylation assay and analysis of the products were performed as describe in FIG 4A. The arrow indicates the migration position of the deadenylated product of probe ARE-A50 (lane 4). FIG 4D shows the extracts described in FIG 4C incubated with probe ARE-A50 (lanes 1-3) and used in a gel shift assay. Lane 5(P') was loaded with probe alone (RNase Tl digested). The migration positions of the TTP-RNA (TTP) and TZF-RNA (TZF) complexes and of the free probe (FP) are indicated. FIGs. 5 (A-C) show the characterization of the TTP-induced deadenylating activity. Extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), and CMV.hPARN.flag (hPARN) were incubated on ice or at 37°C (+) for 60 min, and processed as described for Fig. 2. FIG 5A shows reactions in which MgCl₂ was included in the reaction mixture to final concentrations of 3 mM (lanes 1 and 2, 4 and 5, 9 and 10, 14 and 15), 1 mM (lanes 6 and 11), 0.3 mM (lanes 7 and 12), or none (lanes 3, 8 and 13), and the mixtures were incubated and processed as described for Fig. 2. The arrow indicates the migration positions of the deadenylated product of probe ARE-A50 (lanes 5-7) and the ARE probe (lanes 14 and 15). The position of probe V migration is shown in lane 16. FIG SB shows reactions in which MgCl₂ was included in the reaction mixture to final concentrations of 3 mM (lanes 1 and 2, 4 and 5, 10 and 11), 1 mM (lanes 6 and 12), 0.3 mM (lanes 7 and 13), or none (lanes 3, 8 and 13), and the mixtures were incubated and processed as described for Fig. 2. EDTA (1 mM) was present during the incubation in lanes 9 and 15. The position of probe V migration is shown in lane 16. FIG 5C shows extracts from 293 cells transfected with vector alone (BS+) or CMV.hTTP.tag (hTTP), which were incubated with probe ARE-A50 in the absence (lanes land 3) or presence of MgCl₂ (3 mM, lanes 2 and 9; 1 mM, lane 8), or with increasing concentrations of EDTA (0-10 mM, lanes 3-7); the reactions were then used in a gel shift assay. Lane 10 (P') was loaded with probe alone (RNase Tl digested). The migration positions of the TTP-RNA complexes (TTP) and the free probe (FP) are indicated.

FIGs. 6 (A-C) show the effects of TTP and PARN expressed together to promote deadenylation. In figures 6A and 6B, extracts from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), CMV.hPARN.flag (hPARN), or either BS+ or CMV.hTTP.tag together with CMV.hPARN.flag, were incubated with probes ARE-A50, ARE, or A50, as indicated. The deadenylation assays and sample processing were performed as described in the brief description of Fig. 2. FIG 6A shows extracts that were incubated with the probes ARE or ARE-A50 at 37°C for the times indicated, except that reactions labeled 0 were incubated on ice for 60 min. The arrow indicates the migration position of the ARE probe (lanes 1 and 2) and the deadenylated product of probe ARE-A50 (lanes 6-8). The position of probe V migration is shown in lane 15. FIG 6B shows extracts that were incubated with the probe A50 at 37°C for times indicated, except that reactions labeled 0 were incubated on ice for 60 min. The position of probe V migration is shown in lane 13. FIG 6C shows extracts from 293 cells which were transfected with vector alone (BS+), CMV.hPARN.flag (hPARN), or different amounts of CMV.hTTP.tag DNA (hTTP) extract (expressed as ng of TTP vector DNA added per 10 cm plate of cells) and mixed with CMV.hPARN.flag extracts and then incubated on ice for the times indicated and processed for the deadenylation assay. The arrow indicates the migration positions of the deadenylated product of probe ARE-A50 (lanes 7-9, 11-13, and 15-17), as well as that of probe ARE (lanes 25-27).

FIGs. 7 (A-B) show the effects of affinity-purified TTP and PARN on deadenylation. Deadenylation assays were performed with the fusion proteins hTTP -FLAG or hP ARN-FLAG that had been isolated by affinity chromatography from 293 cells transfected with the appropriate expression plasmids; in some cases, these were mixed with extracts from 293 cells transfected with vector alone (BS+) or CMV.hTTP.tag (hTTP). FIG 7A shows the effects of affinity- purified hTTP-FLAG (T) or hP ARN-FLAG (P) alone or together (TP) on the deadenylation of probe ARE-A50 in the absence (lanes 1-3) or presence of extracts from 293 cells transfected with vector alone (BS+) (lanes 4-8), either on ice (no legend) or after 60 min at 37° C (+). Lanes 9 and 10 show deadenylation of the probe in extracts from cells transfected with CMV.hTTP.tag (hTTP). The arrow indicates the migration positions of the deadenylated product of probe ARE- A50 (lanes 3, 6, 8 and 10) and the ARE probe (lanes 11-14). The position of probe V migration is shown in lane 15. FIG 7B shows similar extracts which were prepared from 293 cells and either untreated (C), extracted with phenol/chloroform (E), or boiled (B), after which they were incubated with probe ARE-A50 (lanes 1-4), either in the presence of FLAG peptide (F; lanes 5- 8) or of affinity-purified hTTP-FLAG (T; lanes 9-12). The effects of 293 cell extracts from cells expressing transfected CMV.hTTP.tag (hTTP) on probes ARE-A50 (lanes 13 and 14) or ARE (lanes 15 and 16) are also shown. The arrow indicates the migration positions of the deadenylated product of probe ARE-A50 (lanes 10 and 14) and the ARE probe (lanes 15 and 16). The position of probe V migration is shown in lane 17.

FIGs. 8 (A-B) show the relatedness of TTP and TTP-like polypeptides. FIG. 8A is a diagram of a dendrogram showing the relatedness of amino acid sequences from the 64 amino acid tandem zinc finger domains of TTP and TTP-like polypeptides from various species. FIG. 8B is a diagram of a sequence alignment of the 64 amino acid tandem zinc finger domain of TTP and TTP-related polypeptides (SEQ ID NOs: 8-23, respectively, in order of appearance).

FIG. 9 is a diagram showing the nucleotide sequence of a mouse TNF ARE (SEQ ED NO: 32).

FIGs. 10 (A-C) show the effect of inactive PARN on probe deadenylation in the presence and absence of TTP. Extracts (5 μg protein) from 293 cells transfected with vector alone (BS+), CMV.hTTP.tag (hTTP), CMV.hPARN.flag (hPARN), or its mutants (D28A, E30A, D382A), or CMV.hTTP.tag together with CMV.hPARN.flag (or its mutants), were incubated with probes ARE-A50, ARE, or A50, as indicated. Deadenylation assays were carried out at 30°C in this experiment to slow the reaction rate. The buffer used in these experiments contained 100 mM KC1, 1 mM MgC12 and 10 mM HEPES (pH 7.6). Fig. 10A shows the effect of native PARN (Wt) and the three mutant PARN proteins on the deadenylation of the polyA probe (A50) in the presence and absence of TTP, as indicated, either at 0°C (-) or after 60 min at 30°C (+). BS+ refers to extracts from cells transfected with vector alone. Probe V is the remnant vector sequence with no attached polyA tail. Fig. 10B shows a western blot demonstrating the expression of native and mutant PARN species in these experiments, as indicated; the symbols are the same as in A. The expression of FLAG-tagged TTP is also indicated by a western blot with the FLAG antibody. The positions of molecular weight standards are shown on the left. Fig. 10C shows the effect of the extracts from vector alone (BS+), TTP alone, native and mutant PARN alone, and various combinations, on the deadenylation of the ARE-containing, polyadenylated probe ARE-A50, as well as the non-polyadenylated ARE-containing probe ARE. The times of incubation at 30°C are indicated; the position of the completely deadenlyated probe is indicated by the arrow.

DESCRIPTION OF THE INVENTION The present invention relates, e.g., to methods for screening agents for the ability to modulate RNA processing, e.g., TTP- and ARE-dependent, PARN-mediated deadenylation. The inventors⁵ discovery of the tripartite TTP/ARE/PARN interaction identifies a biochemical pathway effectively linking a constitutive or "housekeeping" mRNA deadenylating enzyme, PARN, to, e.g., specific cytokine mRNAs of intense clinical interest, including but not limited to mRNAs encoding tumor necrosis factor-alpha (TNFα), granulocyte-macrophage colony stimulating factor (GM-CSF) and interleukin-3 (IL-3). This link is provided, at least in part, by TTP. Methods of the invention take advantage of these specific interactions to identify agents that achieve specific mRNA deadenylations without stimulating the deadenylation and breakdown of the entire spectrum of cellular mRNAs. The methods allow the isolation of agents that specifically target clinically relevant mRNAs, while leaving the majority of polyadenylated transcripts unaffected.

For example, in macrophages stimulated by bacterial endotoxins or other environmental stimuli, TTP is involved in the specific acceleration of TNFα mRNA destruction, thus preventing the vicious spiral of TNFα self-stimulation that can lead to septic shock. Agents obtained by the methods of the invention that enhance the degradation of ARE-containing RNAs, such as TNFα mRNA, can thus specifically target the TNFα mRNA in a macrophage for degradation without affecting other mRNAs in the macrophage. Such an agent is useful for treating a variety of conditions characterized by TNFα excess, including, e.g., rheumatoid arthritis, Crohn's disease, psoriatic arthritis, etc.

Similarly, the GM-CSF and TNF mRNAs in bone-marrow derived stromal cells are targeted for destruction in such a TTP-dependent manner. Inhibitors of the GM-CSF mRNA/TTP/PARN interaction are useful for the specific stabilization of GM-CSF mRNA in these and related cell types, and are thus useful for treating a variety of conditions characterized by insufficient GM-CSF (granulocytopenic disorders).

The cell-free assays disclosed herein are particularly useful for measuring RNA processing (e.g., deadenylation (removal of a poly(A) tail from an mRNA)), and for identifying agents that modulate RNA processing. Advantages of the cell-free assays include the ability to control all of the components of a reaction mixture, to use small volumes, and to detect RNA processing with rapid, easily automated, detection methods, thereby facilitating high throughput assays.

The present invention relates, e.g., to a method for screening an agent for its ability to modulate RNA processing. The agent is contacted with a sample comprising i) tristetraprolin (TTP) or a related protein, or an active fragment or variant thereof, ii) a poly(A)-preferring 3'-5' ribo-exonuclease, e.g., a PARN polypeptide, or a related polypeptide, or an active fragment or variant thereof, wherein if PARN is in a cell, the cell optionally (preferably) comprises exogenous PARN, and iii) an RNA (e.g., a polyadenylated RNA) which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably), a 3 ' poly(A) tail, wherein processing (e.g., degradation, such as deadenylation) of the RNA can be detected (measured), under conditions effective for processing and, optionally, translation of the RNA; and a parameter associated with the processing of the RNA is detected. In this method, as in other methods discussed below, the order of contact is not critical. The above method can be conducted in a cell-free or a cell-based format.

In a cell-free format of the method, the sample preferably comprises i) a cell extract comprising TTP or a related protein, or an active fragment or variant thereof; or a substantially purified TTP or a related protein, or an active fragment or variant thereof, ii) a cell extract comprising a PARN or a related polypeptide, or an active fragment or variant thereof; or a substantially purified PARN or a related polypeptide, or an active fragment or variant thereof, and iii) an RNA (e.g., a polyadenylated RNA) which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably), a 3'poly(A) tail, wherein processing of the RNA can be detected (measured).

By a "substantially purified" polypeptide is meant a polypeptide that is at least about 90% pure (free of contaminating proteins of a cell or cell extract).

In embodiments of the cell-free format, the TTP or TTP-like polypeptide and the PARN or PARN-like polypeptide are extracted from different cells, or from the same cell; the effective conditions comprise incubating the sample, in the presence (or absence) of the agent, at e.g., about 0°C to 42°C, e.g., about 4°C, 25°C, or 37°C; and the effective conditions comprise incubating the contacted sample in the presence of an effective amount of a divalent cation, such as manganese or magnesium, e.g., about 3 mM MgCl₂. An "effective amount" of a salt (e.g., a magnesium salt) means an amount of the salt that is sufficient to allow an RNA processing event to occur.

In a cell-based format of the method, the sample preferably comprises a cell, into which is introduced i) a nucleic acid which encodes TTP or a related protein, or an active fragment or variant thereof, ii) a nucleic acid which encodes PARN or a related polypeptide, or an active fragment or variant thereof, and iii) a nucleic acid from which can be transcribed an RNA that comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably), a 3'poly(A) tail, wherein processing of the transcribed RNA can be detected; and the contacted sample is incubated under conditions effective for the expression of the nucleic acids in i), ii) and iii). In embodiments of the cell-based format, two or more of the nucleic acids of i), ii) and iii) are introduced into the cell together (e.g., co-transfected), or the nucleic acids of i) and ii) are introduced into the cell together (e.g., co-transfected); the nucleic acids are introduced into the cell by transfection (e.g., at least one of the nucleic acids is transiently transfected into the cell, and/or at least one of the nucleic acids is stably transfected into the cell); and the nucleic acids are introduced into the cell by transfection, electroporation, lipofection, with a viral vector, with a gene gun, or by a combination thereof.

Further embodiments of any of the methods of the invention include the following:

The method further comprises detecting processing of the RNA in the absence of the agent, and comparing the RNA processing in the presence and the absence of the agent; the RNA is polyadenylated; the processing is deadenylation; the processing is degradation of the body of the RNA; the ARE comprises at least one AUUUA pentamer, preferably in a sequence of at least about 9 nucleotides (e.g., two or more tandem AUUUA pentamers); the method is a high throughput assay; the detection is quantitative; the RNA processing is detected by measuring a polypeptide encoded by the reporter sequence in the RNA in iii) (In a cell-free assay, the effective conditions may comprise translating the RNA into polypeptide in vitro, and the RNA processing is detected by measuring the translated polypeptide.); the reporter sequence comprises a polynucleotide that encodes a reporter protein, wherein the coding sequence is operatively linked to an expression control sequence; wherein the encoded protein is green fluorescent protein, luciferase, β-galactosidase, chloramphenicol acetyltransferase, a growth factor (e.g., human growth factor), GM-CSF,

TNFα, IL-3, or another protein encoded by an ARE-containing mRNA, such as those listed in the ARED web site noted above; the RNA processing is detected by measuring the amount of a polypeptide or polypeptide fragment encoded by the reporter sequence in the RNA, or by measuring the activity of a polypeptide or polypeptide fragment encoded by the reporter sequence in the RNA; the RNA processing is detected by measuring the amount and/or structure of the RNA, e.g., by measuring deadenylation of the RNA; the processing (e.g-., deadenylation) is measured by real-time PCR, by Northern blots, or by an RNAse H protection assay; the RNA processing is detected by measuring the binding of the TTP or related protein, or active fragment or variant thereof (i.e., a TTP-like polypeptide), to the ARE, e.g., with a gel shift or UV-cross-linking assay; or the RNA processing is detected by measuring the binding of TTP (or a TTP-like polypeptide) to PARN (or a PARN-like polypeptide), or the binding of PARN (or a PARN-like polypeptide) to an ARE; the agent inhibits RNA processing, e.g., inhibits degradation of an ARE-containing RNA (e.g., stabilizes an ARE-containing nucleic acid); wherein the degradation is deadenylation; the agent inhibits degradation of an mRNA encoding GM-CSF; the agent is useful for treating a condition mediated by insufficient GM-CSF; the agent is useful for treating granulocytopenia; (By "insufficient GM-CSF" is meant an abnormally low amount of GM-CSF, which results in a pathological condition, such as granulocytopenia); the agent stimulates RNA processing, (e.g., enhances or stimulates the degradation of an ARE-containing nucleic acid); wherein the degradation is deadenylation; the agent enhances degradation of an mRNA encoding TNFα; the agent is useful for treating a condition mediated by TNFα excess; the agent is useful for treating an inflammatory condition (e.g., rheumatoid arthritis, Crohn's disease, or psoriatic arthritis); the agent mimics an activity of TTP; (By a "TNFα excess" is meant an abnormally high amount of TNFα, which results in a pathological condition, such as an inflammatory condition);

Another embodiment of the invention is a method for screening an agent for its ability to modulate RNA deadenylation. The agent is contacted with a sample comprising

i) a cell extract comprising a TTP polypeptide, or a substantially purified TTP polypeptide, ii) a cell extract comprising a PARN polypeptide, or a substantially purified PARN polypeptide and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3'poly(A) tail, wherein deadenylation of the RNA can be detected, under conditions effective for deadenylation and/or translation of the RNA, and deadenylation of the RNA is detected.

Another aspect of the invention is a method for identifying an agent that mimics the ability of TTP or a TTP-like polypeptide to stimulate PARN-mediated degradation (e.g., deadenylation) of an ARE-containing RNA (e.g., a polyadenylated RNA), comprising a) contacting the agent with a sample which comprises i) a PARN or PARN-like polypeptide, wherein if the PARN is in a cell, it is not endogenous to the cell, and ii) an RNA (e.g., a polyadenylated RNA), that comprises an ARE downstream of a reporter sequence, and, optionally (preferably), a 3'poly(A) tail, wherein degradation of the RNA can be measured, under conditions effective for degradation of the RNA and/or for translation of the reporter sequence, and b) detecting degradation of the RNA.

In embodiments of the preceding method, the method further comprises detecting degradation of the RNA in the absence of the agent, and comparing the degradation in the presence and absence of the agent; the degradation is deadenylation; the method further comprises contacting the agent with an ARE and determining if the agent binds to the ARE, wherein this further determining is performed before, or after, the agent is contacted with i) and ii); or the sample further comprises a type of TTP which can bind to an ARE but which does not stimulate PARN-mediated degradation of an ARE-containing mRNA. The term "a type of TTP" refers to a TTP molecule that binds to an ARE but does not stimulate PARN in this fashion. Exemplary "types" are mutants, and peptides consisting essentially of a TZF domain.

Other aspects of the invention include: a method for stimulating the degradation of an RNA (e.g., a polyadenylated RNA) molecule comprising an ARE and, optionally (preferably), a 3'poly(A) tail, in a cell-free system or in an isolated cell which comprises the RNA, comprising contacting the RNA with TTP or a TTP-like polypeptide and a PARN or PARN-like polypeptide; in this method, when an isolated cell is used, the TTP and/or PARN are preferably added exogenously to the cell. An "isolated" cell, as used herein, refers to a cell that is not in its natural context, e.g., is not in an animal. Another aspect of the invention is a method for modulating an activity of a PARN polypeptide, comprising administering to a cell, tissue, organ or patient in need thereof, an agent that inhibits or stimulates a TTP-stimulated activity of PARN; and a method for screening an agent for the ability to modulate RNA processing, comprising detecting the processing of an RNA in a sample, wherein the sample, which comprises i) TTP or a related protein, or a fragment or variant thereof, ii) a PARN polypeptide or a related polypeptide, or an active fragment or variant thereof, wherein if the PARN is present in a cell, it is not endogenous to the cell, and iii) an RNA (e.g., a polyadenylated RNA) which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably), a 3'poly(A) tail, wherein the processing of the RNA can be detected (measured), is contacted with the agent under conditions effective for processing and/or translation of the RNA.

Methods of the invention generally employ TTP or related proteins, or active fragments or variants of TTP or related polypeptides. TTP related polypeptides, and active fragments or variants of TTP and TTP related proteins, are sometimes referred to herein as "TTP-like" polypeptides.

The term, "TTP" polypeptide, as used herein, refers to the prototype of a family of Cys- Cys-Cys-His (CCCH) (SEQ ID NO:28) tandem zinc finger proteins that bind to AREs comprising AUUUA pentamers, e.g., tandem AUUUA pentamers, such as class II ARE- containing RNAs. TTP (tristetraprolin) polypeptides have been isolated and characterized from a variety of sources, e.g. , human, rat, mouse and Xenopus. See, e.g. , the members of Group m in Figure 8 herein. TTP polypeptides are generally referred to as ZFP36.

The term, "TTP-related" polypeptides, as used herein, encompasses any of the family of CCCH (SEQ ID NO:28) tandem zinc finger proteins of which TTP is a prototype, e.g., proteins belonging to groups I (ZPF36L1), π (ZPF36L2) and IV (XC3H4) shown in Figure 8A. (A polypeptide having the sequence of a full-length TTP, such as a human or rodent TTP, is excluded from this definition of "TTP-related polypeptides.") For a review of some of the members of this protein family, see, e.g., Blackshear (2002). Biochem Soc Trans 30, 945-952. TTP and TTP-like polypeptides generally comprise tandem zinc finger (TZF) protein domains that contain two typical CCCH (SEQ ID NO:28) fingers, spaced 18 amino acids apart, with the sequence RYKTEL (SEQ ID NO:l) or a variant thereof, leading into each finger. That is, they exhibit the following structural features: 1) Both fingers within the TTP zinc finger

(TZF) domain are preceded by a conserved six amino acid lead-in sequence, (R/K)YKTEL (SEQ ID NO: 31); in some embodiments (e.g., in mouse and rat), the lead-in sequence may be KYKTEP (SEQ ID NO: 33); 2) Both fingers contain the following conserved residues and spacing, Cxx(F/Y)xxxGxCxYxx(K/R)CxFxH (SEQ ID NO: 2), where x represents variable amino acids; and 3) The fingers are separated by exactly 18 amino acids, i.e., between the terminal H of the first finger and the first C of the second finger.

The term "TTP zinc finger" or "TTP zinc finger domain" includes a polypeptide fragment of 77 amino acids or less, which has a 64 amino acid sequence identical to the sequence in TTP that contains two CCCH (SEQ ID NO:28) zinc fingers spaced eighteen amino acids apart, as shown in Fig. 8B, and which, by itself, is sufficient to bind to an ARE comprising tandem AUUUA pentamers within an mRNA molecule.

The term "TTP-like zinc finger" or "TTP-like zinc finger domain" includes a polypeptide fragment that has a 64 amino acid TZF consensus sequence as set forth below, or as shown in Fig. 8B, which is not identical to a TTP zinc finger, and which, by itself, is sufficient to bind to an ARE as above within an mRNA molecule. Methods of determining whether a polypeptide of interest exhibits the above-mentioned structural features are routine and well known to those of skill in the art. For example, the TZF domains of a polypeptide can be sequenced directly, or characterized by Edman degradation or mass spectrometry; or the nucleic acid encoding the TZF domain region can be sequenced. TTP and TTP-like polypeptides can be obtained from any of a variety of sources, including invertebrates (e.g., Drosophila and yeast) and vertebrates (including carp, zebrafish, Xenopus and mammals, such as mouse, rat, bovine, human and others). TTP or TTP-like polypeptides used in methods of the invention can be obtained from natural sources, or they can be cloned and expressed in prokaryotic or eukaryotic cells. Methods of obtaining and purifying naturally occurring or cloned TTP and TTP-like molecules are described elsewhere herein. A number of publications disclose the sequence and properties of TTP and TTP-like polypeptides, and procedures for obtaining them. For example, the mammalian polypeptide ZFP36L1 (ERFl; cMGl; TIS lib, Berg-36) has been described by Barnard et al. (1993), Nucleic Acids Res 21, 3580; Gomperts et al. (1990), Oncogene 5, 1081-1083; Ning et al.(l997), Biochem Soc Trans 25, 306S; and Varnum et α/.(1991), Mol Cell Biol 11,1754-1758). The mammalian polypeptide ZFP36L2 (ERF2; TIS lid) has been described by Varnum et al, supra; and Nie et /.(1995), Gene 152, 285-286. Other examples of TTP-like proteins, with nearly identical double zinc fingers spaced 18 amino acids apart, have been identified in Drosophila and yeast (Ma et al.(l994), Oncogene 9, 3329-3334; Ma et al. (1995), Oncogene 10, 487-494; and Thompson et .(1996), Gene 174, 225-233, 1996). In addition, Xenopus homologues have been identified for the ZFP36, ZFP36L1 and ZFP36L2 mammalian proteins described above, and a fourth Xenopus homologue (XC3H-4) has been found which contains, in addition to the two CCCH (SEQ ID NO:28) zinc fingers spaced 18 amino acids apart and preceded by the R(K)YKTEL (SEQ ID NO: 31) sequence, an additional more carboxyl-terminal pair of CCCH (SEQ ID NO:28) zinc fingers that are more closely spaced and lack the lead-in R(K)YKTEL (SEQ ID NO: 31) sequence (De et α/.(1999), Gene 228, 133-145). Examples of naturally occurring TTP-related polypeptides include, but are not limited to: ERF1/CMG1; ERF2/TIS11D/XC3H-3.2; XC3H-3.1; XC3H-1; CTHl (carp); CTHl (zebrafish); and XC3H-4. In addition to the structural features described above, TTP and TTP-like polypeptides also share functional properties. Among these TTP activities are, for example, binding to an ARE; stimulation or inhibition of deadenylation, and or degradation, of an mRNA molecule containing an ARE; e.g., in the presence of PARN; and/or interacting (directly or indirectly) with PARN to stimulate its RNA degradative activity. Methods of assaying for such activities, and thus determining whether a protein of interest is TTP or a TTP-like polypeptide, are conventional and routine.

As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, "a" TTP activity means one or more TTP activities; and "an" ARE means one or more AREs.

The invention contemplates the use of active fragments of TTP or TTP-like polypeptides. Such an "active fragment" can be from any portion of the polypeptide, and of any suitable size, provided that it comprises one or more domains that exhibit a TTP activity. For example, such an active fragment may comprise a TTP zinc finger or zinc finger domain, or a TTP-like zinc finger or zinc finger domain, and/or it may contain a domain that stimulates the activation of

PARN-mediated, ARE-dependent RNA degradation. Examples of such active fragments include polypeptides that bind specifically to AREs and stimulate the activation of PARN-mediated RNA degradation; polypeptides that bind specifically to AREs but which do not stimulate the activation of PARN-mediated RNA degradation; and polypeptides that do not bind to AREs but which can stimulate the activation of PARN-mediated mRNA degradation.

For example, an active fragment of a TTP or TTP related polypeptide may consist of only the 64 amino acid tandem zinc finger (TZF) domain having the TZF amino acid consensus sequence (representatives of which are shown in Fig. 8B); or it may be a larger polypeptide comprising the TZF domain (for example, a naturally occurring polypeptide such as ZFP36L1 or ZFP36L2, or a fragment thereof); or it may be a TZF domain plus additional amino acid sequences, as long as the polypeptide can carry out one or more TTP activities. A peptide of about 70 - 80 amino acids can also be used in methods of the invention. See Lai et al. (2000) J. Biol. Chem. 275, 17827-17837 for an example of a suitable 77-mer, and Blackshear et al. (2003) J. Biol. Chem. 278, 19947-19955 for an example of a suitable 73-mer. The latter types of TTP fragments are particularly useful in assays in which RNA processing is measured by measuring the binding of a TTP fragment to an ARE. Methods of preparing fragments of TTP (or of any of the polypeptides discussed herein) are conventional. For example, one may clone and express such a fragment; one may generate such a peptide synthetically; or one may cleave a full-length polypeptide, using suitable proteases or biochemical cleavage procedures. Combinations of these methods may also be used. In some embodiments, mutant or alternative forms of TTP or TTP-like polypeptides are used, e.g., as positive or negative controls in an assay. See, e.g., Example LA herein, for a discussion of some mutant or alternative forms that may be employed.

The invention also encompasses the use of active variants of TTP or TTP-like polypeptides. The term, an "active variant" of a polypeptide, as used herein, refers to a polypeptide that comprises any of a variety of changes (modifications), either naturally occurring or deliberately generated, provided that the changes do not substantially alter normal activities of the polypeptide (i.e., provided that a variant polypeptide retains, to a measurable degree, at least one of the activities of the wild type polypeptide). One of skill in the art can readily determine if a given variant retains a TTP activity, using conventional methods, such as those described herein.

For example, residues of a TTP or TTP-like zinc finger domain may contain any of the residues found within a consensus sequence as follows (see Fig. 8B for numbering strategy; slashes indicate alternative residues; preferred amino acids are denoted by upper case letters and less preferred amino acids are denoted by lower case letters): aal-aa/: RYKTELC (S. EQ ID NO: 3) aa8: R/s aa9: P/T/r aalO: F/Y aall E/S/a aal2 E aal3 S/N/t/s aal4 G aal5 A/R/T/S/f

3.3.10 C aal7 K/R/a aal8 Y aal9 G/a/r aa20 E/A D/n aa21 K/R aa22- -aa27: CQFAHG (SEQ ID NO: 4) aa28 L/F/I/p/k aa29 H/G/i/s aa30 E/D aa31 L aa32 R/H aa33 S/Q/v/e/p aa34 L/A/P aa35 T/N/s/v aa36 R/q aa37 -aa45: HPKYKTELC (SEQ ID NO: 5) aa46 R/H aa47 T/K/s aa48 F/Y aa49 H/Y aa50 T/L/n v aa51 LQ/a/l/y aa52 G aa53 F/R/y/e/t aa54 C aaD.3 P/v/n aa56 Y aa57 G/v aa58 P/S/t/1 aa59 -aa60: RC aa61 H/l/n aa62 F aa63 I/v aa64 H

Other variants of these amino acid residues are also included. See, e.g., Table 1 of Lai et al. (2002), J. Biol. Chem. 277, 9606-9612.

Isolated naturally occurring allelic variants of TTP or TTP-like polypeptides are also encompassed by the invention. Variant TTP polypeptides used in the methods of the invention may exhibit substantial identity to comparable portions of wild type TTP or TTP-like polypeptides. The term "substantial identity" or "substantial similarity" as used herein indicates that a polypeptide (or a nucleic acid) comprises a sequence that has at least about 90% sequence identity to a reference sequence, or preferably at least about 95%, or more preferably at least about 98% sequence identity to the reference sequence, over a comparison window of at least about 10 to about 100 or more amino acids residues or nucleotides. Methods to determine sequence identity (between nucleic acids or proteins) are conventional. Alignments can be accomplished by using any effective algorithm. For pairwise alignments of DNA sequences, the methods described by Wilbur-Lipman (e.g., Wilbur et al. (1983), Proc. Natl Acad. Sci., 80, 726-730) or

Martinez/Needleman-Wunsch (e.g., Martinez (1983), Nucleic Acid Res. H, 4629-4634) can be used. Pairs of protein sequences can be aligned by the Lipman-Pearson method (e.g., Lipman et al. (1985), Science 227,1435-1441), e.g., with k-tuple set at 2, gap penalty set at 4, and gap length penalty set at 12. Various commercial and free sources of alignment programs are available, e.g. , MegAlign by DNA Star, BLAST (National Center for Biotechnology

Information), BCM (Baylor College of Medicine) Launcher, etc. Percent sequence identity can also be determined by other conventional methods, e.g., as described in Altschul et α .(1986), Bull. Math. Bio. 48, 603-616, 1986 and Henikoff et al. (1992), Proc. Natl. Acad. Sci. USA 89,10915-10919. An indication that two polypeptide sequences are substantially identical is that one protein is immunologically reactive with antibodies raised against the second protein. An indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acids encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid. Variant polypeptides of the invention include polypeptides having one or more naturally occurring (e.g., through natural mutation) or non-naturally-occurring (e.g., by deliberate modification, such as by site-directed mutagenesis) modifications, e.g., insertions, deletions, additions and/or substitutions, either conservative or non-conservative. By "conservative substitutions" is meant by combinations such as Gly, Ala; Val, He, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. Variants can include, e.g., homologs, muteins and mimetics. Many types of protein modifications, including post-translational modifications, are included. Post- translational modifications include naturally occurring or synthetically produced, covalent or aggregative conjugates with other chemical moieties, e.g., glycosyl groups, lipids, phosphates, acetyl groups, etc., as well as cleavage, such as of terminal amino acid(s). See, e.g., modifications disclosed in U.S. Pat. No. 5,935,835. The invention also encompasses variants such as polypeptides in which cysteine residues which are nonessential for biological activity are deleted or replaced with other amino acids, thereby preventing the formation of incorrect intramolecular disulfϊde bridges; naturally occurring variants arising from alternative mRNA splicing events; and altered forms reflecting genetic polymorphism (e.g., allelic variation). Other active variants may comprise added peptide sequences, either naturally occurring or heterologous, such as, e.g., leader, signal, secretory, targeting, enzymatic etc. sequences. Another type of variant of a TTP or TTP-like polypeptide is one in which the spacing between the two CCCH (SEQ ID NO:28) zinc fingers is greater or lesser than 18 amino acids, provided that the polypeptide retains the ability to bind to an ARE. For example, as many as about 10 amino acids can be added or subtracted from a TTP zinc finger domain without loss of binding activity. Active fragments or variants of TTP or TTP related polypeptides can possess activities that result in RNA processing (e.g., degradation), or they can possess inhibitory activities. For example, an active fragment or variant may bind to an ARE and/or PARN and thus stimulate degradative activity. Alternatively, an active fragment or variant may compete with full-length TTP for binding to an ARE and/or PARN, and thus may inhibit RNA processing (e.g., degradation), or an active fragment may bind to an ARE and physically protect it from degradation by a nuclease. Examples of mutant TTPs or fragments thereof which can act as such competitors (e.g., as dominant negative mutants) to inhibit an RNA degradative effect on TTP, are discussed in WO 01/12213. Other examples will be evident to the skilled worker. Whether an active fragment or variant has degradative activity or inhibits degradation can be determined routinely, e.g. , using the methods taught herein.

As used herein, the term "protein" is interchangeable with "polypeptide." A protein or polypeptide can be of any length that is compatible with the invention, including being a short peptide.

Methods of the invention generally employ PARN or related polypeptides, or active fragments or variants of PARN or related polypeptides. PARN related polypeptides, and active fragments or variants of PARN and PARN-related polypeptides, are sometimes referred to herein as "PARN-like" polypeptides.

The term "PARN" as used herein refers to a member of a family of exoribonucleases having a high specificity for degrading an mRNA poly(A) tail. These g ly(A) ribonuclease (PARN) polypeptides can be obtained from a variety of species. For example, PARN has been cloned and sequenced from human cells (Korner et al. (1998), EMBO J 17, 5427-5437) and Xenopus (Copeland et al. (2001), RNA (N.Y.) 7, 875-886. Preferably, human PARN is used in methods of the present invention.

The term "PARN-related", as used herein refers to proteins related to PARN, e.g., members of the RNAse D family of nucleases, which share the properties of PARN that render that protein suitable for use in assays of the invention. Members of the RNAse D family are found in a variety of species, and include the 3' exonuclease domain ofE.coli polymerase I.

PARN and PARN-like polypeptides share structural features, including four conserved amino acid residues that are required for enzymatic activity. Using the nomenclature for human PARN set forth by Ren et al (Ren et al. (2001), J. Biol. Chem. 277, 5982-5987), these residues are Asp²⁸, Glu³⁰, Asp²⁹² and Asp³⁸³. See also Example XU herein. The members of this family also share a tripartite exonuclease conserved domain, as identified by Korner et al. (supra). The alignment of amino acid sequences in human and Xenopus shown in Fig. 3 of Copeland et αl (2001), supra illustrates some of the conserved domains in PARN and PARN-like polypeptides

In addition to the structural features noted above, PARN and PARN-like polypeptides share functional properties (activities). For example, these polypeptides are highly processive exoribonucleases which show a high specificity for degrading poly (A) tails of mRNAs, in a magnesium dependent manner. They also may interact with (e.g., bind to) poly (A) tails.

The invention contemplates the use of "active fragments" of PARN or PARN related polypeptides. Such fragments can be of any length, provided that they exhibit at least one of the structural or functional PARN properties noted above. Suitable truncated polypeptides include the 62kD proteolytic fragment of the 74 kD Xenopus PARN reported by Copeland et al (supra), and the 54kD fragment of human PARN reported in USP 6,451,307 (Aventis). Smaller fragments can also be used. It is well within the capacity of a skilled worker to generate such smaller fragments and to determine if a given fragment retains a requisite functional property of PARN.

The invention also contemplates the use of "active variants" of PARN or PARN-like polypeptides. Such variants can take any of the forms discussed herein with reference to active variants of TTP, provided that the variant retains at least one measurable activity of PARN.

Although the discussion herein relates primarily to PARN or PARN-like polypeptides, a skilled worker will recognize that other polyA-preferring, 3' to 5' RNA exonucleases, and active fragments or variants thereof, are also included in the invention. Furthermore, the invention encompasses enzymes which normally do not act on poly(A) tails, but which are "recruited" by TTP or a TTP-like polypeptide and thus can deadenylate poly(A) tails in the presence of the TTP or TTP-like polypeptide. A skilled worker can readily determine if a particular ribonuclease is functional in a method of the invention, using conventional procedures.

Methods of the invention generally employ AU-rich elements (AREs) or nucleic acids

(e.g., RNAs) that comprise AREs. The term "ARE" as used herein includes an AU-rich element that comprises at least one AUUUA pentamer, preferably in a sequence of at least about 9 nucleotides (e.g., two or more tandem AUUUA pentameric repeats). The ARE can be, e.g., between about 8 and about 25 bases in length, e.g., approximately 9, 13, 17, or 21 bases in length, or can be any of the AREs discussed herein. For example, AREs of the invention include those found in the mRNAs listed in Table 3 of Bakheet et al. (2001), Nuc. Acids Res. 29, 246- 254:

Group I cluster (AUUUAUUUAUUUAUUUAUUUA) (SEQ ID NO:24) Group H cluster (AUUUAUUUAUUUAUUUA) (SEQ ID NO:25) Group IE cluster (^A/uAUUUAUUUAUUUA^A/u) (SEQ ID NO:26) Group IV cluster (^A/u^Λ/uAUUUAUUUA ^A/u^A/u) (SEQ ID NO:27)

For other mRNAs comprising AREs encompassed by the invention, see the ARED web site at rc.kfshrc.edu.sa/ared. See also Blackshear et al. (2003) J. Biol. Chem. 278, 19947-19955, which discloses some suitable AREs, as well as suitable TTPs, reaction conditions and assays for aspects of RNA processing, such as binding of TTP to an ARE or ARE-containing RNA.

In a previous classification scheme, some AREs of this type were classified as Class II AREs. See, e.g., Wilusz et al, supra and Xu et al, supra. An example of a Class II ARE, from mouse TNFα, is shown in Fig. 9 herein.

AREs of the invention can bind to TTP or TTP-like polypeptides. ARE sequences as short as 8 or, preferably, 9 nucleotides (e.g., UUAUUUAUU (SEQ ID NO: 34)) have been shown to bind to TTP, as have sequences of 24 nucleotides (#1309-1332 in Genbank accession number X02611). Any sequence that binds to TTP or a TTP-like polypeptide can be used in the methods of the invention. AREs used in methods of the invention can be located in their natural position in an mRNA or a RNA encoded by a cDNA, or they can be transposed to a new location, e.g., in an artificial construct. Some variant sequences that do not comprise all of the structural features of the AREs discussed above can also bind to TTP or TTP-like polypeptides and stimulate RNA processing. Such variant AREs can also be used in the methods of the invention. Such molecules are sometimes referred to herein as "ARE-like" molecules of the invention. A skilled worker can readily test a putative ARE or ARE-like molecule, using conventional procedures (such as assays disclosed herein), to determine if it possesses the functional properties of a class II ARE.

In one aspect, the present invention relates to a method for screening an agent for its ability to modulate RNA processing, comprising a) contacting the agent with a sample comprising i) tristetraprolin (TTP) or a related protein, or an active fragment or variant thereof, ii) a poly(A)ribonuclease (PARN) or PARN-like polypeptide, wherein if the PARN is in a cell, the cell optionally (preferably) comprises exogenous PARN, and iii) an RNA (e.g., a polyadenylated RNA) which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably), a 3 ' poly(A) tail, wherein processing of the RNA can be detected (measured), under conditions effective for processing and/or translation of the RNA, and b) detecting the processing of the RNA.

By the phrase "the cell comprises exogenous PARN" is meant herein that the PARN is introduced exogenously into the cell, e.g. , by transfection of a nucleic acid encoding the PARN. Although small amounts of endogenous PARN may be present in a cell, in the cell-based assays of the present invention, exogenous PARN is preferably also added.

The term "sample," as used herein, includes an animal (e.g., a human or non-human primate, or a domestic, farm, or laboratory animal, such as a horse, dog, cat, bird, ferret, cow, pig, sheep, goat, rat, mouse, rabbit, guinea pig, fish, frog, or insect); a tissue, organ, or body fluid obtained from an animal; a cell (either within an animal or taken directly from an animal, or a cell maintained in culture or from a cultured cell line); a lysate, lysate fraction, or extract (e.g., a cytosolic extract) derived from a cell; a molecule derived from a cell or cellular material (e.g., a polypeptide or nucleic acid molecule); or an experimental reaction mixture (e.g., containing a buffer and salts, substrates, and/or any other molecules needed to carry out an assay) which is to be assayed or analyzed according to the methods of the invention, for example, to identify an agent that modulates RNA processing.

In a preferred embodiment, the assay is a cell-free assay, and the sample comprises (a) one or more cell extracts comprising a TTP or TTP-like polypeptide and/or a PARN or PARN- like polypeptide, or a substantially purified TTP or TTP-like polypeptide and/or a substantially purified PARN or PARN-like polypeptide, or combinations thereof (synthetic components may also be present), and (b) a nucleic acid (e.g., an RNA) which comprises an ARE downstream of a reporter sequence and, optionally (preferably), a 3 ' poly(A) tail. In another preferred embodiment, the assay is a cell-based assay, and the sample comprises a cell into which is introduced nucleic acids encoding TTP or a TTP-like protein and PARN or a PARN-like protein, wherein the coding sequences of the nucleic acids are operatively linked to expression control sequences, and a nucleic acid that can be transcribed into a nucleic acid (e.g., an RNA) which comprises an ARE downstream of a reporter sequence and, optionally (preferably), a 3 ' poly(A) tail.

By an agent that "modulates" RNA processing is meant herein an agent that inhibits (e.g., decreases, interferes with, prevents, blocks, etc.) or stimulates (e.g., increases, potentiates, enhances, facilitates, etc.) RNA processing.

Li general, the term "RNA processing," as used herein, encompasses any of a variety of post-transcriptional processes, including, e.g., 5' capping of the RNA and degradation of the RNA. "Degradation" of an RNA can take several forms, e.g. , deadenylation (removal of a 3' poly(A) tail), and/or nuclease digestion of part or all of the body of the RNA by any of several endo- or exo-nucleases.

In any of the assays disclosed herein, a putative agent may or may not exhibit modulatory activity. In a general sense, this invention involves methods to screen a putative agent for the ability to modulate, e.g., RNA processing, whether or not the agent exhibits such modulatory activity. In one embodiment of a cell-free assay, the action of TTP (or a TTP-like polypeptide) and PARN (or a PARN-like polypeptide), in conjunction with an ARE in a target RNA which comprises a 3'poly(A) tail, results in deadenylation of the RNA; in the absence of other ribonucleases in the reaction mixture, the RNA is generally not degraded further. In another embodiment of a cell-free assay, the RNA maybe partially or fully degraded following deadenylation of the RNA, or an RNA which lacks a poly(A) tail, such a histone mRNA, may be so degraded. In another embodiment of a cell-free assay, wherein a high enough amount of a TTP or TFZ domain is present in a sample, the TTP protects against degradation of an ARE- containing RNA. A skilled worker can routinely optimize the incubation conditions in an assay to be effective for attaining any desired type of RNA processing, or for inhibiting such processing. In one embodiment of a cell-based assay disclosed herein, exogenously introduced TTP

(or a TTP-like polypeptide) and PARN (or a PARN-like polypeptide) act on a polyadenylated RNA target of interest, in a cell to deadenylate it. h certain cases (e.g., when other nucleases are present in sufficiently high enough amounts in the cell), the RNA may be further degraded, either partially (to achieve a smear on a gel) or completely (such that the RNA is no longer detectable on a gel). In another embodiment of a cell-based assay, wherein a high enough amount of a TTP or a TFZ domain is introduced into a cell, the TTP protects against degradation of an ARE-containing RNA; suitable conditions for such TTP protection can be routinely determined. A skilled worker can routinely optimize the incubation conditions in an assay to be effective for achieving any desired type of RNA processing, or for inhibiting such processing. Factors that can be varied include, e.g., temperature, salts, pH, and the relative amounts of components of the reaction.

The modulation of RNA processing can be direct or indirect. Direct modulation includes, e.g., a direct interaction with one or more components involved in RNA processing. For example, an agent that directly modulates RNA processing may interact with TTP (or a TTP-like polypeptide), PARN (or a PARN-like polypeptide), an ARE, and/or with one or more other components involved in RNA processing. In one embodiment, the agent increases (facilitates) or decreases (blocks) the binding of TTP (or a TTP- like polypeptide) to an ARE (e.g. by binding to the polypeptide, to the ARE or an RNA molecule containing the ARE, or to both the polypeptide and the polynucleotide). Without wishing to be bound by any particular mechanism, it is suggested that the inhibition of TTP binding to an ARE may prevent formation of an effective complex of TTP, the ARE and PARN, and, in some cases, other components involved in the deadenylation reaction; or it may prevent TTP from bringing PARN into proximity with an ARE-containing RNA; or it may alter the secondary and/or tertiary structure of the RNA, so as to render it more or less sensitive to PARN. An "effective complex" as used herein, means a complex that results in RNA processing, such as deadenylation. In another embodiment, the agent increases or decreases the binding of PARN (or a PARN-like polypeptide) to an ARE or to TTP (e.g. by binding to PARN, to the ARE or an RNA molecule containing the ARE, to TTP, or to a combination thereof). In another embodiment, the agent increases or decreases the displacement of other ARE- or poly(A)-protecting proteins by TTP. By "binding" of any of the components discussed above, or of others that are involved in RNA processing, is meant herein that the components undergo a physical interaction, e.g., covalent or non-covalent bonding, hydrophobic or hydrophilic interactions, Van der Waals forces, or the like.

Indirect modulation of RNA processing includes, e.g., effects on the amount or activity of one or more of the components involved in RNA processing. For example, a modulatory agent may increase or decrease the amount of TTP (or TTP-like polypeptide) available for binding to an ARE (e.g., by increasing or decreasing degradation of the mRNA encoding the polypeptide, or by increasing or decreasing degradation of the polypeptide; or by activating or inhibiting an activity of the polypeptide; or by activating or inhibiting post-translational processing or secretion of the polypeptide). Alternatively, a modulatory agent may affect the amount or activity of PARN (or a PARN-like polypeptide), or of other components involved in RNA processing. Alternatively, a modulatory agent may affect the amount or activity of an ARE (e.g. , by increasing or decreasing synthesis of an mRNA comprising the ARE, or by modifying the structure of the ARE to render it more or less available for binding to, e.g., a TTP or PARN polypeptide).

An agent that modulates RNA processing may mimic (substitute for) an activity of one of more of the components involved in RNA processing (e.g., TTP, PARN, an ARE, or another factor).

As noted above, one aspect of the invention is a cell-free screening method, in which the sample comprises, e.g., i) a cell extract comprising a TTP or a TTP-like protein, and/or a substantially purified (e.g., synthetic) TTP or TTP-like protein); ii) a cell extract comprising PARN or a PARN-like polypeptide, and/or a substantially purified (e.g., synthetic) PARN or

PARN-like protein) and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably), a 3'poly(A) tail, wherein processing of the RNA can be detected (measured); and the sample is contacted with a putative modulatory agent under conditions effective for processing and/or translation of the RNA.

In cell-free assays of the invention, an agent is generally "contacted" with a sample by introducing the agent into the sample, or vice-versa. Generally, the sample is a liquid, and the agent is introduced into it by any of a variety of physical methods, e.g., by pipetting it into the sample, by inkjet based dispersing, or by use of a replicating pin tool. A variety of automated (e.g., robotic) application devices are known in the art. The use of small volumes (e.g., wells in microtiter plates) facilitates the achievement of high throughput assays. In cell-free assays of the invention, the TTP and/or PARN components are sometimes in the form of a cell extract. Alternatively, the TTP and/or PARN components may be substantially purified (e.g., at least about 90% pure). Methods for preparing extracts and for isolating and/or purifying polypeptides and nucleic acids of the invention are conventional; some such methods are described elsewhere herein. For example, recombinant TTP and/or PARN can be engineered to contain FLAG sequences, and the proteins can be substantially purified by immunoprecipitation with an anti-FLAG antibody or by passing them through an anti-FLAG antibody affinity column. The samples in cell free extracts may comprises cell extracts, purified components, synthetic components, or combinations thereof. hi one embodiment, the polypeptides are obtained from cells in which they occur naturally. TTP is naturally found in, e.g. lung, intestine, lymph node, spleen and thymus. PARN is widely distributed; it is preferably isolated from calf thymus. Alternatively, the TTP and/or PARN can be obtained from cells in which they are produced recombinanfiy.

Methods of producing proteins, such as TTP and PARN, recombinanfiy are conventional. The sequences of a variety of TTPs and TTP-like polypeptides, and PARN and PARN-like polypeptides, and nucleic acids that encode them, are known. For example, human TTP nucleic acid and protein are: NM_003407.1 and NP_003398; and human PARN nucleic acid and protein are: NM_002582.1 and NP_002573.

Nucleic acids encoding TTP, TTP-like polypeptides, PARN and PARN-like polypeptides may differ from wild type sequences (be "variant" sequences), provided that the encoded polypeptide retains a measurable amount of one or more activities characteristic of the wild type polypeptide. For example, a variant nucleic acid may contain one or more naturally or non- naturally occurring modifications (e.g., insertions, deletions, additions, substitutions, inversions, etc.), mutations, polymorphisms, etc.; or the nucleic acid may differ from its wild type counterpart with regard to base composition, reflecting the degeneracy of the genetic code.

Other variants may be substantially identical to a wild type sequence, e.g., a nucleic acid may comprise a sequence that has at least about 90% sequence identity to a reference sequence, or preferably at least about 95%, or more preferably at least about 98% to the reference sequence, over a comparison window of at least about 10 to about 100 or more nucleotides.

Furthermore, a polynucleotide variant may comprise additional polynucleotide sequences, e.g., sequences to enhance expression, detection, uptake, cataloging, tagging, etc. For example, the polynucleotide may contain additional non-naturally occurring or heterologous coding sequences (e.g., sequences coding for leader, signal, secretory, targeting, enzymatic, fluorescent, antibiotic resistance, and other functional or diagnostic peptides) or non-coding sequences (e.g., untranslated sequences at either a 5' or 3' end, or dispersed in the coding sequence, such as introns).

As used herein, the term "nucleic acid" is interchangeable with "polynucleotide." A nucleic acid or polynucleotide can be of any length that is compatible with the invention, including being a very short oligonucleotide.

Nucleic acids encoding TTP, TTP-like, PARN or PARN-like sequences can be obtained by conventional procedures, e.g., they can be obtained from commercial sources; cleaved from larger polynucleic acids, such as genomic DNA, with appropriate restriction enzymes; generated as cDNAs with reverse transcriptases; amplified by PCR or similar procedures; or produced, at least in part, with the use of automated DNA synthesizers. Combinations of these methods may also be used.

The nucleic acids can then be cloned into suitable expression vectors, under the control of any of a variety of expression control sequences, and expressed in a variety of cell types as hosts, including prokaryotes, yeast, and mammalian, insect or plant cells, or in a transgenic plant or non-human animal. In a preferred embodiment, the nucleic acids are cloned into baculovirus vectors, which are introduced into and expressed in insect cells.

Methods of cloning nucleic acids are routine and conventional in the art. For general references describing methods of molecular biology which are mentioned in this application, e.g., isolating, cloning, modifying, labeling, manipulating, sequencing and otherwise treating or analyzing nucleic acids and/or proteins, see, e.g., Sambrook, et al. (1989), Molecular Cloning, a

Laboratory Manual, Cold Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Ausubel et al. (1995). Current Protocols in Molecular Biology, N.Y., John Wiley & Sons; Davis et al. (1986), Basic Methods in Molecular Biology, Elseveir Sciences Publishing,, Inc., New York; Hames et al. (1985), Nucleic Acid Hybridization, IL Press; Dracopoli et al. Current Protocols in Human Genetics, John Wiley & Sons, Inc.; and Coligan et al. Current Protocols in Protein Science, John Wiley & Sons, Inc.

Methods of producing proteins in transgenic plants and animals are disclosed, e.g., in Hogan et al., (1986) Manipulating The Mouse Embryo, Cold Spring Harbor Press; Krimpenfort et al, (1991) Biol Technology 9, 86; Palmiier et al, (1985) Cell 41, 343; Kraemer et al, (1985) Genetic Manipulation of The Early Mammalian Embryo, Cold Spring Harbor Laboratory Press; Hammer et al, (1985) Nature 315, 680; Purcel et al, (1986) Science 244, 1281; Wagner et al, U.S. Pat. No. 5,175,385; and Krimpenfort et al, U.S. Pat. No. 5,175,384.

In a preferred embodiment, a sequence coding for a TTP, TTP-like polypeptide, PARN or PARN-like polypeptide is placed under the control of an expression control sequence. The phrase "expression control sequence" means a polynucleotide sequence that regulates expression of a polypeptide coded for by a polynucleotide to which it is functionally ("operably") linked. Expression can be regulated at the level of the mRNA or polypeptide. Thus, the term expression control sequence includes mRNA-related elements and protein-related elements. Such elements include promoters, enhancers (viral or cellular), ribosome binding sequences, transcriptional terminators, etc. An expression control sequence is operably linked to a nucleotide coding sequence when the expression control sequence is positioned in such a manner to effect or achieve expression of the coding sequence. For example, when a promoter is operably linked 5' to a coding sequence, expression of the coding sequence is driven by the promoter. Expression control sequences can include an initiation codon and additional nucleotides to place a partial nucleotide sequence of the present invention in-frame in order to produce a polypeptide (e.g., pET vectors from Promega have been designed to permit a molecule to be inserted into all three reading frames to identify the one that results in polypeptide expression). Expression control sequences can be heterologous or endogenous to the normal gene.

Suitable expression control sequences can be selected for host compatibility and desired purpose. These include, e.g., enhancers such as from SV40, CMV, RSV, inducible or constitutive promoters, and cell-type specific elements or sequences which allow selective or specific cell expression. Promoters that can be used to drive expression, include, e.g., an endogenous promoter, MMTV, SV40, CMV, c-fos, β-globin; trp, lac, tac, or T7 promoters for bacterial hosts; or alpha factor, alcohol oxidase, or PGH promoters for yeast. See, e.g., Melton et al, (1984) Polynucleotide Res., 12(18), 7035-7056; Dunn et al. (1984), J. Mol. Bio., 166, 477- 435; U.S. Pat. No. 5,891,636; Studier et al.(l987), Gene Expression Technology, Methods in Enzymology, 85, 60-89. In addition, as discussed above, translational signals (including in-frame insertions) can be included. A natural expression control sequence of a gene may be used to express the protein recombinanfiy, e.g., a PARN expression control sequence can be used to drive the expression of a PARN polypeptide, or a TTP expression control sequence can be used to drive the expression of a TTP polypeptide As used herein, the term "conditions effective for expression" of a nucleic acid means, in part, that the nucleic acid comprises expression control sequences that allow transcription of a DNA into RNA and/or translation of an RNA (either added to a reaction mixture, or transcribed from a DNA in a reaction mixture) into a polypeptide. Effective conditions for expression of an RNA and/or a protein include any conditions which are suitable for achieving production of the RNA and/or protein, including effective temperatures, pH, salts, or the like. Some such effective conditions are discussed elsewhere herein.

A polynucleotide of the present invention can be cloned into any suitable vector. A vector is, e.g., a polynucleotide molecule which can replicate autonomously in a host cell, e.g., containing an origin of replication. In some embodiments, additional art-recognized elements, which aid in the selection of a plasmid in a cell, amplification of the plasmid, etc. are present. When expression of a protein is desired (e.g., expression of TTP or PARN), an expression vector, comprising effective expression control sequences, can be used. A skilled worker can select a vector depending on the purpose desired, e.g., to propagate and/or express the recombinant molecule in bacteria, yeast, insect, or mammalian cells. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO,

Phagescript, phiX174, pBK Phagemid, pNH8A, ρNH16a, pNH18Z, pNH46A (Stratagene); Bluescript KS+II (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR54 0, pRIT5 (Pharmacia). Eukaryotic: PWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene), pSVK3, PBPV, PMSG, pSVL (Pharmacia), pCR2.1/TOPO, pCRMϋ/TOPO, pCR4/TOPO, pTrcHisB, pCMV6-XL4, etc. However, any other vector, e.g. , plasmids, viruses, or parts thereof, may be used as long as they are replicable and viable in the desired host. The cloned nucleic acids, in a suitable vector, can be "introduced" into a cell by any of a variety of conventional, art-recognized procedures, including, e.g., transfection (e.g., mediated by DEAE-Dextran or calcium phosphate precipitation), infection via a viral vector (e.g., retrovirus, adenovirus, adeno-associated virus, lentivirus, pseudotyped retrovirus or poxvirus vectors), injection, electroporation, sonoporation, a gene gun, liposome delivery (e.g.,

Lipofectin^®, Lipofectamine^® (GIBCO-BRL, Inc., Gaithersburg, MD), Superfect^® (Qiagen, ie. Hilden, Germany) and Transfectam^® (Promega Biotec, Inc., Madison, WI), or other liposomes developed according to procedures standard in the art), or receptor-mediated and other endocytosis mechanisms. The TTP (or TTP-like) and PARN (or PARN-like) encoding nucleic acids may be introduced into the same cell (e.g., by co-transfection) and a single extract comprising both proteins may be generated (e.g., the proteins are extracted from the same cell); or the TTP (or TTP-like) and PARN (or PARN-like) encoding nucleic acids may be introduced into, and extracted from, separate cells. Any suitable cell maybe used, e.g., prokaryotic (bacterial) cells, yeast, insect cells or vertebrate cells, such as plant or animal cells.

Methods of preparing extracts from cells comprising TTP (or a TTP-like polypeptide) and/or PARN (or a PARN-like polypeptide) from any of the sources described herein are conventional. Extraction methods include, e.g., lysis with a suitable detergent (e.g., NP-40), homogenization, sonication, repeated passage through a syringe needle, or the like. Methods of stabilizing and storing such cell extracts are also conventional. See, e.g., Example IB for typical methods for preparing extracts of TTP and PARN from transfected cells.

In a preferred embodiment, the cell from which an extract is made is substantially free of endogenous TTP and/or PARN. Some cells are naturally substantially free of TTP or TTP- related polypeptides (e.g., HEK 293 ("293") cells). In other cases, it may be desirable to remove one or both of these proteins from a cell. A number of conventional methods can be used to generate cells that produce reduced levels of one or both of these proteins. For example, traditional knockouts, e.g., using homologous recombination, can be made in animals (such as a mouse), and cells can be generated from the animals or progeny thereof; such knockouts can be made in embryonic stem cells (ES cells) or other types of cells, and these cells, or cells derived from them, can be used; expression of the proteins can be blocked with antisense oligonucleotide techniques or with interfering RNA (iRNA); or antibody injection can be used. Alternatively, one can deplete TTP and/or PARN from cell extracts by, for example, specifically immunoprecipitating the undesired protein(s) e.g., with an antibody specific for the protein, or for a tag, such as FLAG, attached thereto. Such immunoprecipitation methods are conventional. The levels of a TTP and/or PARN component in a cell extract(s) may be reduced by such a method prior to, while, or after other components are added to the sample.

In one embodiment of the invention, the TTP and/or PARN are further isolated (e.g., purified) from other components of the cell extracts. By "isolated," as used herein, is meant in a form that is not found in its original enviromnent or in nature, e.g., more concentrated, more purified, separated from at least one other component with which it is naturally associated, in a buffer, in a dry form awaiting reconstitution, etc. Proteins isolated (e.g., purified) by such methods are not necessarily free of all components of the starting cell extract. For example, entities (such as, e.g., proteins or other factors) that associate with TTP and/or PARN (e.g., bind to them) may be carried along with the TTP or PARN during the isolation (e.g., purification) procedure. Therefore, a cell extract that comprises "isolated" TTP and/or PARN may comprise other entities that are also involved in TTP/P ARN mediated RNA processing.

Methods of performing isolations (e.g., purifications) of protein components are conventional. For example, a variety of conventional biochemical purification procedures are known to those of skill in the art, including, e.g., detergent extraction (e.g., non-ionic detergent, Triton X-100, CHAPS, octylglucoside, Igepal CA-630), ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography, lectin chromatography, affinity column chromatography, and gel electrophoresis. Protein refolding steps can be used, as necessary, in completing the configuration of the mature protein. Also, high performance liquid chromatography (HPLC) can be employed for purification steps. hi a preferred embodiment, recombinant TTP and/or PARN is produced as a fusion protein in frame with an epitope tag (such as, e.g., haemagglutinin (HA), FLAG, myc, 6xHis (SEQ ID NO: 37), maltose binding protein, chitinase, etc.), and the fusion protein is selectively isolated with an antibody specific for the tag. The isolation can be performed by immunoprecipitation, with antibody columns (antibody-conjugated affinity chromatography), with antibodies bound to magnetic beads, or other conventional techniques. Methods of constructing, expressing and isolating (e.g., purifying) such fusion proteins are conventional.

Some such methods are illustrated in the examples herein. Any suitable combination of isolation or purification methods can be used. In one embodiment, the TTP and/or PARN is substantially purified or is purified to homogeneity. By "substantially purified" is meant that the polypeptide is separated and is essentially free from other polypeptides, i.e., the polypeptide is the primary and active constituent. The TTP and/or PARN component in a sample may be isolated (e.g., purified) from other components of the sample (e.g., other components of an extract) before, during or after contacting the sample with a putative modulatory agent.

Another component of a sample in a cell-free assay of the invention is a nucleic acid (e.g., an RNA) that comprises, in a 5' to 3' direction, an expression control sequence, a reporter sequence, an ARE, and, optionally (preferably), a 3'poly(A) tail, wherein the processing (e.g., degradation) of the nucleic acid can be monitored. Such a nucleic acid is sometimes referred to herein as a probe, or an RNA probe. Preferably, the probe is a single stranded nucleic acid (e.g., a single stranded RNA). The properties of suitable AREs are discussed elsewhere herein. Preferably, the ARE comprises at least one AUUUA pentamer, preferably in a sequence of at least about 9 nucleotides (e.g. , two or more tandem AUUUA pentamers).

Generally, the nucleic acid (e.g., RNA) comprises a 3' poly(A) tail, which is capable of being digested by PARN. When a poly(A) tail is present, it generally comprises a chain of between about 10 and 250 adenylate residues, for example, about 50. Li some embodiments, the poly(A) tail is transcribed from a template comprising a string of T's corresponding to the transcribed poly(A) tail. In other embodiments, a poly(A) tail of appropriate length is physically attached to the 3' end of an RNA, using conventional procedures.

In some embodiments of the invention, the nucleic acid/RNA does not necessarily comprise a poly(A) tail. For example, when sufficiently large amounts of TTP, a TTP-like polypeptide, or a TZF domain, are introduced into a cell-free system or into a cell for a cell- based assay, they can stabilize an ARE-containing RNA against degradation by nucleases, whether or not the RNA is polyadenylated; such stabilization can serve as the basis for assays to identify agents that modulate this type of degradation of RNA. In such assays, in which the RNA is stabilized, the poly(A) tail is preferably absent (either not present in the starting RNA probe, or removed from it during RNA processing), h other embodiments, the addition of TTP to a sample comprising a non-polyadenylated nucleic acid RNA results in degradation of the RNA; assays based on this type of degradation can be used to identify agents that modulate the RNA degradation. Reaction conditions to optimize both of these types of RNA degradation or stabilization thereof can be determined empirically, using art-recognized procedures. In a preferred embodiment, the poly(A)-minus RNA is stabilized.

In one embodiment, the RNA probe added to a cell-free extract is a naturally occurring mRNA, which has been isolated from a natural cellular source, using conventional procedures. Suitable mRNAs include, e.g., mRNAs that comprise AREs, such as mRNAs encoding GM- CSF, TNFα, IL-3, or any of the Group I through Group IV mRNAs listed in Table 3 of Bakheet et al. (2001), Nuc. Acids Res. 29, 246-254, or on the ARED web site noted above. The mRNAs preferably comprise a 3' poly(A) tail. In another embodiment, a partial or full-length cDNA is generated from a naturally occurring ARE-containing mRNA, such as the mRNAs discussed above; and that cDNA is cloned into a vector comprising suitable expression control sequence(s), using conventional procedures. A poly(T) tail may be generated as an integral part of the cDNA, or the cDNA may be cloned adjacent to a poly(A)-encoding tail in the vector. An RNA probe can then be transcribed from the vector in vitro (using a conventional in vitro transcription system), or it can be formed in a cell following the introduction of the plasmid. Methods for introducing such a vector into a cell and harvesting the transcribed RNA are conventional. h another embodiment, the probe is an artificial one (comprising coding sequences that are not from a naturally occurring ARE-containing RNA). Such a coding sequence (generally in the form of a cDNA) is cloned into a suitable vector, e.g. , it is placed under the control of a suitable expression control sequence, and is placed 5' to an ARE, which, in turn is 5' to an optional (preferable) poly(A) sequence. This construct is then transcribed into an RNA probe, in vitro or in a cell, using conventional procedures. Portions of this DNA (or of the nucleic acid used to generate any probe used in the methods of the invention) maybe generated synthetically, using an automated DNA synthesizer. hi a probe used in the methods of the invention, the ARE element may lie immediately adjacent to a poly(A) tail (e.g., separated from it at most by a restriction enzyme cloning site), or as far away as considerable distance from the poly(A) tail. The term, a "considerable" distance, as used herein, means between about 200 bases and about 3 kb. The ARE may be at any suitable distance from the poly(A), provided that ARE/TTP/PARN-mediated RNA degradation can occur. Methods of determining if a particular separation distance results in a functional probe are conventional (e.g., using assays such as those disclosed herein). For example, the probe may reflect the distance found in naturally occurring GM-CSF mRNA (about 54 nucleotides from the start of the 5' end of the poly(A) tail), or in TNFα mRNA (about 200 nucleotides). hi some probes, the distance may be a "considerable" distance, reflecting that some naturally occurring AREs (which lie in a 5⁵ UTR) can be as far as about 3 kb from the poly(A) tail.

When starting with an ARE sequence from TNFα mRNA, one may use a 24 base "core" ARE from the mouse TNFα mRNA (bp 1309-1332 of GenBank accession number X02611). When starting with an ARE sequence from GM-CSF mRNA, one may use a sequence corresponding, e.g., to bases 3390-3467 of Genbank accession number X03020 (mouse GM- CSF) or to the 3'-UTR sequences from the mRNA bases 668-775 (bp 3399-3506).

Still other variations of ARE-containing probes may be used, in which an ARE is placed within any RNA sequence; suitable sequences will be evident to those of skill in the art. For example, ARE sequences may be placed within mRNAs that normally do not comprise poly(A) tails and which lack AREs having AUUUA repeats. Typical such RNAs include, e.g., some histone mRNAs and stable RNAs found in brain.

By adjusting the size of an RNA probe of interest, one can optimize the ability to assay on gels for RNAs which have, or have not, been deadenylated or otherwise degraded.

Any of a variety of reporter sequences are suitable for use in the methods of the invention. A "reporter sequence," as used herein, can refer either to an RNA sequence or to a polypeptide translated from the RNA, provided that the RNA or polypeptide can be detected (e.g., measured or, in some cases, quantitated). Degradation of an RNA reporter sequence can be detected directly (e.g., by detecting changes in the RNA structure, such as digestion or cleavage to a smaller molecule, deadenylation, etc.) or indirectly (e.g., by measuring a polypeptide translated from the RNA). As degradation of an RNA proceeds, the encoded polypeptide will be produced in reduced amounts, and/or its size will be reduced. Methods of detecting reporter sequences (both RNA and polypeptide) are conventional.

An RNA probe can be in the form of a modified (variant) RNA. The RNA may comprise one or more nucleotides joined via various known linkages, e.g., ester, sulfamate, sulfamide, phosphorothioate, phosphoramidate, methylphosphonate, carbamate, etc., depending on the desired purpose, e.g., resistance to nucleases, such as RNAse H, improved in vivo stability, etc. See, e.g., U.S. Pat. No. 5,378,825. Any desired nucleotide or nucleotide analog can be incorporated, e.g., 6-mercaptoguanine, 8-oxo-guanine, etc. In some cases, as is readily determined by a skilled worker, the RNA may even take the form, partially or completely, of a DNA, PNA, LNA, etc. molecule. Various other modifications can be made to the polynucleotides, such as attaching detectable markers (avidin, biotin, radioactive elements, fluorescent tags and dyes, energy transfer labels, energy-emittmg labels, binding partners, etc.) or moieties which improve hybridization, detection, and/or stability. Such modifications can occur in either the body of the RNA or in the poly(A) tail.

Any of the types of modifications (variations) discussed elsewhere herein with regard to variant nucleic acids encoding TTP or PARN polypeptides may also be present in the RNA probes used in methods of the invention, provided that a poly(A) tail (if present) can be recognized and digested by PARN; or that the RNA can be processed in other ways discussed elsewhere herein; or, in some cases, that a polypeptide can be translated from the RNA, provided that the polypeptide encoded by the variant nucleic acid exhibits at least one activity of the wild type polypeptide. Conversely, any of the types of variants discussed herein with regard to RNA probes may also be found in the nucleic acids encoding TTP or PARN.

In a preferred embodiment, an RNA probe is short enough so that poly(A)⁺ and poly(A)^" (deadenylated) species can be easily differentiated on a gel. See, e.g., the probes in Examples II and DI herein.

An RNA probe may or may not comprise a 5' cap. If desired, a 5' cap can be added to the probe, either in vitro or in a cell, using conventional procedures.

When a polypeptide translated from the RNA is to be detected in an assay, any of a variety of reporter polypeptides can be used, h a reporter sequence for which a polypeptide is to be produced, the coding sequences of the polypeptide are operatively linked to a suitable expression control sequence. Any size polypeptide (including a peptide fragment that contains only a small antigenic epitope) is suitable, provided that it can be detected (e.g., by using an appropriate, specific antibody). Methods of detecting a polypeptide on the basis of its antigenicity are conventional and include, e.g., Western analysis or ELISAs. hi some embodiments, a polypeptide is used which can be detected directly, e.g., a green fluorescent protein (GFP). In other embodiments, a protein is used which can be detected by measuring one or more of its activities (e.g., an enzymatic activity). Suitable reporter proteins are conventional in the art, and include, e.g., green fluorescent protein, luciferase, β-galactosidase, chloramphemcol acetyltransferase, growth hormones (e.g., human growth hormone), or the like, h other embodiments, a naturally occurring protein encoded by an mRNA regulated by an ARE, such as, e.g., GM-CSF, TNFα, IL-3, or any of the Group I through Group IV mRNAs listed in Table 3 of Bakheet et al (2001), supra, or encoded by any of the mRNAs listed on the ARED web site noted above, can serve as a reporter sequence. Reporter mRNAs or proteins used in assays of the invention are preferably not expressed in the transfected cell or extract, e.g., TNFα is not expressed in 293 cells. hi a cell-free assay of the invention, an agent is contacted with a sample under conditions effective for processing of the RNA and, optionally, translation of the RNA. That is, the agent, TTP and PARN (in the form of cell extracts, substantially purified polypeptides and/or synthetic molecules) and RNA probe are incubated in the presence of a suitable buffer (e.g., HEPES, Tris, phosphate or other conventional buffers), at a pH of about 6-9, preferably about 7.6 Suitable buffers can be selected routinely. For typical reaction conditions, see, e.g., Korner et al. (1998), EMBO J. 17, 5427-37 or Martinez et al. (2000), J. Biol. Chem. 275, 24222-30. Suitable salts can also be included. Monovalent salts are not critical. The selection and optimization of suitable monovalent salts (e.g., NaCl or KC1) can be determined empirically; in a preferred embodiment, about 40 mM KC1 is included. Magnesium (e.g., in the form of MgCl ) or other divalent cations, such as manganese, are required for PARN activity. See, e.g., Martinez et al, supra. For example, MgCl₂ maybe present at a concentration of between about O.OOlmM and lOOmM, preferably about 3mM. ATP is generally not required for the reaction and is preferably absent from the incubation mixture. The incubation mixture does not require detergents, or organelles sedimented by a 1000,000g for 45 min. centrifugation. Other entities may also, optionally, be present to stabilize components of the reaction, e.g., about 5% glycerol. The agent and sample may be incubated at any suitable temperature. Generally, components are assembled on ice (at about 0°C) and then incubated for an empirically determined time at between about 0°C and about 42°C, e.g., at about 0- 4°C, about 25°C or about 37°C. As shown in the examples herein, the cell-free RNA processing assay proceeds effectively at about 0°C or about 30°C.

When it is desirable to translate the reporter sequence of an RNA probe into protein, an in vitro translation system may be employed. Suitable in vitro translation systems include those from rabbit reticulocytes, wheat germ extracts, and others. Methods of preparing and using such systems are conventional and well known in the art.

In a preferred embodiment, the relative amounts of components i), ii), iii) and the agent are adjusted such that a measurable amount of RNA processing does not commence until the fourth component is added. The four components can be added in any order, and may be added singly or in combinations. Methods to optimize the relative amounts of the four components, so as to achieve optimal ratios, are conventional and routine in the art. Typical amounts of reagents for cell-free assays are disclosed in the examples herein.

In any of the assays disclosed herein, parallel reactions are generally performed in which the sample is not contacted with the agent; and the RNA processing (e.g., degradation) is compared in the presence and the absence of the agent. A reduction in RNA processing in a sample incubated in the presence of the agent compared to a sample incubated in the absence of the agent indicates that the agent has the ability to inhibit RNA processing. Conversely, an increase in RNA processing in a sample incubated in the presence of the agent compared to a sample incubated in the absence of the agent indicates that the agent has the ability to stimulate RNA processing. Alternatively, the RNA processing may be analyzed with reference to a standard curve, e.g., in which activity in the presence and absence of modulatory agents is pre- calibrated.

Also, suitable positive or negative controls may be conducted in parallel with the assay of a putative modulatory agent. Appropriate controls will be evident to those of skill in the art. Some such controls are illustrated in the examples herein.

As noted above, one aspect of the invention is a cell-based screening method, in which the sample comprises, e.g., a cell into which is introduced nucleic acids encoding i) TTP or a TTP-like polypeptide and ii) PARN or a PARN-like polypeptide, wherein the sequences encoded by the nucleic acids are operatively linked to expression control sequences, and iii) a nucleic acid that can be transcribed into an RNA comprising an ARE downstream of a reporter sequence, and, optionally (preferably) a 3' poly(A) tail, wherein the processing of the transcribed RNA can be detected; and the sample is contacted with a putative agent under conditions effective for the expression of the three nucleic acids.

Suitable nucleic acids for components i), ii) and iii) will be evident to the skilled worker, and include the nucleic acids described elsewhere herein in relation to cell-free assays. Methods for cloning, propagating and isolating these nucleic acids, and for introducing them into cells, are conventional. Methods of introducing the nucleic acids into a cell include, e.g., any of the methods described herein for introducing nucleic acids encoding TTP or PARN into cells, e.g., transfection, with a viral vector, electroporation, sonoporation, lipofection, with a gene gun, or by a combination thereof, etc. For example, at least one of the nucleic acids maybe transiently transfected into a cell, and/or at least one of the nucleic acids maybe stably transfected into a cell. When TTP, PARN or, in some cases, a reporter sequence is stably transfected, it is desirable that its expression not be so high that it is deleterious to the cell. Rather, it is preferable that the protein(s) be expressed at a threshold level such that, when the other components of an assay are introduced into the cell, the processing of an RNA probe of interest will commence. A skilled worker can readily optimize the amounts of each expressed protein, using conventional procedures.

The order in which the components of an assay are introduced into a cell is not critical. For example, two or more of the nucleic acids can be introduced into the cell together (e.g., by co-transfection), e.g., nucleic acids encoding TTP (or a TTP-like polypeptide) and PARN (or a PARN-like polypeptide) may be introduced into the cell together. An agent of interest can be introduced into the cell before, along with, or after the nucleic acids are introduced.

In cell-based assays of the invention, an agent can "contact" a sample by any of a variety of conventional protocols, which are well known in the art. Small molecules, for example, can be taken up into cells by methods such as phagocytosis, pulsing into class I MHC-expressing cells, liposomes, or the like. Compounds can also be linked to the homeodomain of Antennapedia for introduction (intemalization) into a cell (Prochiantz, Current Opin Neurobiol 6, 629-634). Cell permeable agents can be introduced into cells directly. Methods of introducing larger molecules, such as antisense oligonucleotides or antibodies, are conventional and well known in the art.

In cell-based assays of the invention, it is desirable that the cell into which the nucleic acids and agent are introduced is substantially free of endogenous TTP and/or PARN. HEK 293 cells are particularly well suited to such assays, because they are naturally substantially free of TTP or a TTP-related polypeptide. Methods of depleting cells of TTP and/or PARN are discussed elsewhere herein.

In a preferred embodiment, the relative amounts of components i), ii), iii) and the putative agent are adjusted such that a measurable amount of RNA processing does not commence until the fourth component is added. Methods to optimize the relative amounts of the four components, so as to achieve optimal ratios, are conventional and routine in the art. Effective conditions for expression of an RNA and/or a protein in a host cell include any culture conditions that are suitable for achieving production of the RNA and/or protein, including effective temperatures, pH, medium, additives to the media in which the host cell is cultured, cell densities, culture dishes, etc. Of course, conditions effective for expression of a nucleic acid also means, in part, that the nucleic acid comprises expression control sequences that allow transcription of a DNA into mRNA and/or translation of an RNA into a polypeptide.

Any of a variety of conventional, art recognized methods may be used to detect RNA processing (e.g., degradation), in either a cell-free or a cell-based assay. "Detection" of RNA processing encompasses detecting, e.g., an intermediate in the RNA processing reaction or an end product of the processing reaction. Such detection can encompass measuring, directly or indirectly, an intermediate or end product, hi some cases, the detection can also encompass quantitating (quantifying) the amount of a molecule, e.g., an intermediate or an end-product of a processing reaction. It will be evident to one of skill in the art how any of the detection methods discussed herein can be adapted to be a quantitative assay. hi one embodiment of the invention, processing of an RNA is detected by measuring the physical structure and/or amount of the RNA. For example, one can measure the size of the RNA, to determine whether the RNA is intact or is partially or completely digested (hydrolyzed), e.g., whether the non-polyadenylated "body" of an RNA is degraded; and/or one can determine if the poly(A) tail of a polyadenylated RNA has been partially or completely removed. A variety of procedures can be used for detecting the structure or amount of an RNA. If a cell-based RNA processing assay is used, it may be preferable to extract the RNA from the cell before commencing analysis, using conventional extraction procedures. If a cell-free RNA processing assay is used, the analysis may, in some embodiments, be performed directly on the sample without further isolation of the RNA; alternatively, conventional procedures maybe used to isolate the RNA of interest from other components of the assay mixture.

In one embodiment, the RNA is subjected to electrophoresis, e.g., on a suitable polyacrylamide or agarose gel, and analyzed by hybridization to an appropriate probe (Northern analysis) or analyzed by other conventional procedures. In another embodiment, the RNA is measured without being subjected to electrophoresis, e.g., by RNA dot blot analysis, or by PCR (including RT-PCR, ligation mediated PCR, real-time PCR, etc.). Real-time PCR is a particularly preferred technique. It is described, e.g., in Bustin S.A. (2002), J. Mol. Endocrinol.

29, 23-39. An RNA can be visualized by any of a variety of conventional, art-recognized procedures. For example, it maybe labeled with a radioactive marker (e.g., ³²P, ¹⁴C or ³H), or with a non-radioactive label (e.g., attached through an avidin-biotin interaction). In another embodiment, deadenylation is measured by labeling the poly(A) tail of a probe, e.g., by incorporating a fluorescent or radioactive tag on one or more of the A's in the tail (e.g., the last A of the tail, or all of the A's in the tail) and measuring the release of the label. Other assays will be evident to the skilled worker.

One of skill in the art will know how to design variations of any of the assays discussed above, in order to measure intact nucleic acids, or to measure fragments thereof (including fragments which comprise, or which lack a particular sequence that can be detected by a particular hybridization probe).

In another embodiment of the invention, processing of an RNA is detected (indirectly) by measuring a polypeptide encoded by a reporter sequence in the RNA. As the reporter RNA is processed (e.g., degraded or modified in some way that interferes with translation of a polypeptide therefrom), the size of the encoded polypeptide will be reduced, and/or it will be translated in reduced amounts, or it will fail to be translated.

A variety of procedures can be used for detecting the structure, amount or activity of a polypeptide. If a cell-based RNA processing assay is used, and the polypeptide of interest is not secreted from the cell, it may be preferable to extract the polypeptide from the cell before commencing analysis, using conventional procedures. If a cell-free RNA processing assay is used, the analysis may, in some embodiments, be performed directly on the sample without further isolation of the polypeptide; alternatively, conventional procedures maybe used to isolate the polypeptide of interest from other components of the assay mixture.

In one embodiment, the polypeptide is subjected to electrophoresis, e.g., on a suitable polyacrylamide or agarose gel, and the size and/or amount (concentration) of the polypeptide is analyzed, using conventional procedures. Such procedures include, e.g., visualization by immunodetection, e.g., immunoblotting to a suitable detectable antibody that is specific for the polypeptide, itself, or to an antibody that is specific for a tag which is fused to the polypeptide (Western analysis); by detecting an enzymatic activity of the polypeptide; by measuring a property of the polypeptide, such as luminescence or fluorescence, e.g., of GFP, radioactivity of a radioactively labeled protein; etc.

In another embodiment, the amount of the polypeptide (or an active fragment thereof) is determined without subjecting the sample to electrophoresis, e.g., by measuring the amount of the polypeptide in the sample, using any of a variety of conventional procedures. These include, e.g., immunological methods (such as, e.g., immunoassays, RIA (radioimmunoassays), ELISAs (enzyme-linked-immunosorbent assays), immunoprecipitation, etc). Fluorescence of suitable molecules, such as GFP, can be readily measured, hi a preferred embodiment, the amount of a reporter protein is determined by measuring an activity thereof, such as an enzymatic activity. For example, methods for measuring enzymatic activities of conventional reporter proteins, such as luciferase, β-galactosidase, chloramphenicol acetyltransferase, human growth hormone, chloramphenicol acetyltransferase (CAT) or the like, are well known in the art. Methods are also well known for measuring activities of proteins encoded by mRNAs which comprise AREs (e.g., GM-CSF, TNFα, IL-3, etc.).

One of skill in the art will know how to design variations of any of the assays discussed herein, in order to measure intact polypeptides, or to measure active fragments thereof (including fragments which exhibit, or which lack, a particular activity, such as having a particular epitope). In another embodiment of the invention, processing of an RNA is detected by measuring the binding of TTP (or a TTP-like polypeptide) to an ARE in the RNA, and/or to PARN (or a PARN-like polypeptide), or by measuring the binding of PARN (or a PARN-like polypeptide) to the ARE. Without wishing to be bound by any particular theory, it is suggested that the binding of TTP to an ARE and/or to PARN, or the binding of PARN to an ARE, can, under certain conditions, stimulate and/or inhibit RNA processing. Thus an assay that detects the binding of TTP (or a TTP-like polypeptide) to an ARE or an RNA comprising the ARE, and/or to PARN (or a PARN-like polypeptide), or the binding of PARN (or a PARN-like polypeptide) to an ARE, may also detect an RNA processing activity, e.g., a degradative activity, such as a deadenylation activity, of TTP (or a TTP-like polypeptide) or of PARN (or a PARN-like polypeptide) or of another protein or other component involved in RNA processing. A variety of procedures can be used for detecting such binding. If a cell-based RNA processing assay is used, it may be preferable to extract the components to be measured from the cell before commencing analysis, using conventional procedures. If a cell-free RNA processing assay is used, the analysis may, in some embodiments, be performed directly on the sample without further isolation of the bound components; alternatively, conventional procedures may be used to isolate the bound components of interest from other components of the assay mixture. In one embodiment, the binding of components involved in RNA processing (e.g., of TTP to RNA) is detemiined by gel shift analysis (following electophoresis of the sample on a suitable gel), by UV-cross-linking assays, by various fluorescence quenching assays, or the like. Such methods are conventional.

A variety of suitable read-outs for any of the assays discussed herein will be apparent to one of skill in the art. Polynucleotides or polypeptides used in the methods of the invention can be labeled according to any desired method. They can be labeled using radioactive tracers such as P, S, H, or C. The radioactive labeling can be carried out according to any method. For nucleic acids, for example, terminal labeling may be carried out at the 3' or 5' end using a radiolabeled nucleotide, polynucleotide kinase (with or without dephosphorylation with a phosphatase) or a ligase (depending on the end to be labeled). A non-radioactive labeling can also be used, e.g., by combining a polynucleotide of the present invention with residues having immunological properties (antigens, haptens), a specific affinity for certain reagents (ligands), properties enabling detectable enzyme reactions to be completed (enzymes or coenzymes, enzyme substrates, or other substances involved in an enzymatic reaction), or characteristic physical properties, such as fluorescence or the emission or absorption of light at a desired wavelength, etc.

In the methods disclosed herein, the RNA probe may be polyadenylated or non- polyadenylated. A skilled worker can readily determine which type(s) of probe can be used in a given assay method. The RNA processing measured may be, e.g. , either deadenylation or digestion of the body of an RNA. Again, a skilled worker can readily determine which type of RNA processing can be measured in a given assay method. The assays of the invention can be adapted to be high throughput assays; and the assays can be adapted to be quantitative assays.

It is generally desirable that an agent identified by a method of the invention specifically inhibits or stimulates a PARN activity that is mediated by an ARE of the invention. An agent that affects a more general PARN activity (PARN is widespread in mammalian cells) might elicit undesirable side effects if administered to a subject. A skilled worker can readily determine if an agent identified by a method of the invention exhibits the desired specificity.

Another embodiment of the invention is a method of screening an agent for its ability to modulate an activity of TTP and/or PARN, comprising a) contacting the agent with a sample comprising i) tristetraprolin (TTP) or a related protein, or an active fragment or variant thereof, ii) a poly(A)ribonuclease (PARN) polypeptide, or an active fragment or variant thereof, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably) a 3' poly(A) tail, wherein processing of the RNA can be detected, under conditions effective for processing and/or translation of the RNA, and b) detecting an activity of TTP and/or PARN.

The activity of TTP and/or PARN maybe any of the activities disclosed herein (e.g., the processing of a nucleic acid, e.g., a degradative activity, such as deadenylation; binding to PARN or TTP, respectively, or to an ARE; etc.). Methods of assaying for such activities are disclosed herein. An agent identified by this method is an agent that regulates an activity of TTP and/or

PARN.

Another embodiment of the invention is a method for modulating (e.g., stimulating) the degradation of an RNA molecule comprising an ARE, in a cell-free system or in an isolated cell comprising the RNA, comprising contacting the RNA with TTP (or a TTP-like polypeptide) and with PARN (or PARN-like polypeptide). Another embodiment is a method of modulating (e.g., stimulating) the degradation of an RNA molecule comprising an ARE, in a cell, e.g., in an animal, comprising contacting the RNA with an isolated molecule of TTP (or a TTP-like polypeptide) and with an isolated molecule of PARN (or PARN-like polypeptide). Such methods are particularly useful as research tools, e.g., for studying mechanisms of RNA processing.

Another embodiment of the invention is a method of modulating an activity of a PARN polypeptide, comprising administering to a cell, tissue, organ or patient in need thereof an agent that inhibits or stimulates a TTP-stimulated activity of PARN. Among the agents which can be administered are, e.g., antibodies against TTP and/or PARN, iRNA molecules or antisense constructs or oligonucleotides which inhibit the production of TTP and/or PARN, peptides which act as competitors with TTP and/or PARN, dominant negative mutants of TTP and/or

PARN, or any of the agents identified by the methods of the present invention. In any of the methods described herein, the order of steps is not critical. The steps may be carried out in any suitable order, and the method may comprise one or more of the steps.

Another embodiment of the invention is a kit useful for any of the methods (assays) disclosed herein. For example, the invention relates to a kit for screening an agent for the ability to modulate RNA processing, comprising a) tristetraprolin (TTP) or a related protein, or an active fragment or variant thereof, b) a poly(A)ribonuclease (PARN) polypeptide, or an active fragment or variant thereof, wherein, if the PARN is in a cell, it is not endogenous to the cell, and c) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and, optionally (preferably) a 3' poly(A) tail, wherein processing of the RNA can be detected.

Any of a variety of types of putative modulatory agents can be screened by methods of the invention.

Examples of putative modulatory agents that can be screened include, e.g., mutant TTP molecules, such as those described in WO 01/12213, which act as dominant negatives; chelators of zinc or magnesium (e.g., EDTA, EGTA, or variants thereof); aminoglycoside antibiotics, such as gentamycin or neomycin; iRNA molecules or antisense oligonucleotides that inhibit the production of TTP and/or PARN; agents that inhibit synthesis, processing, post-translational modification (e.g., phosphorylation), sub-cellular localization, secretion or activation of a TTP or PARN molecule; peptide competitors; or antibodies specific for TTP, PARN or an ARE. Such an antibody can, e.g., block a site involved in one or more of the interactions involved in the tripartite (TTP/ARE/PARN) interaction. The antibody may be a polyclonal, monoclonal, chimeric, recombinant, single chain, or partially or fully humanized antibody, as well as an Fab fragment, or the product of an Fab expression library, or a fragment thereof. The antibody may be IgM, IgG, subtypes, IgG2A, IgGl, etc. Various procedures known in the art maybe used for the production of such antibodies and fragments, or any of the putative modulatory agents discussed herein.

An agent that inhibits the binding of TTP to an ARE, and/or that inhibits RNA processing in an assay of the invention, may be a competitor of TTP. Such competitors may act in a variety of ways. For example, a competitor of TTP can compete with TTP for binding to the ARE of an RNA (e.g. a GM-CSF or a TNFα mRNA), thereby partially or completely inhibiting the binding of TTP (or a TTP-like protein) to the ARE. Alternatively, a competitor of TTP can compete with TTP for binding to PARN or to another mRNA degradative enzyme (e.g., an exonuclease (e.g., another 3' deadenylase, or a 3' exonuclease), or an endonuclease) that plays a role in TTP-induced ARE-mediated degradation.

Other agents may mimic or stimulate an activity of TTP and/or PARN, e.g., they may stimulate RNA processing. Among such stimulatory agents are, e.g., peptides which comprise the zinc finger domain of TTP or any of a variety of TTP-related proteins (including, e.g. , members of the ZFP36L1, ZFP36L2 and XC3H-4 types), or nucleic acids that encode such peptides.

Agents identified by methods of the invention that act on TTP may also act on other members of the TTP family of proteins. Therefore, an agent which modulates a TTP activity may also modulate the activity of, e.g. , ZFP36L1 , ZFP36L2, or XC3H-4, or other proteins related to them.

In addition to the types of putative modulatory agents discussed above, assays of the invention can be used to screen "small molecules," sometimes referred to herein as "compounds," for their ability to modulate RNA processing. In general, compounds that modulate the activity of TTP, TTP-like polypeptides, PARN and PARN-like polypeptides may be identified from large libraries of natural products or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, polypeptide- and nucleic acid-based compounds. Synthetic compound libraries are commercially available, e.g., from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI).

Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, e.g., Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FL), and PharmaMar, U.S.A. (Cambridge, MA). In addition, natural and synthetically produced libraries are generated, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods. h addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their effect on the activity of TTP or a TTP-like polypeptide (e.g., RNA processing) should be employed whenever possible.

When a crude extract is found to have a desired activity, further fractionation of the positive lead extract is generally performed to isolate chemical constituents responsible for the observed effect. A goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having an activity that stimulates or inhibits, e.g., RNA processing. The same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogeneous extracts are known in the art. If desired, compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value may be subsequently analyzed using animal models for diseases or conditions in which it is desirable to regulate (e.g., to inhibit, potentiate or mimic) an activity of TTP or a TTP-like polypeptide (e.g. , RNA processing).

Agents identified by the methods of the invention can be used to treat any of a variety of conditions that are affected by a polypeptide encoded by an mRNA molecule whose destruction is modulated by an ARE of the invention. For example, the condition may be characterized by an over- or under-expression of a protein encoded by such an RNA, or by an abnormally high or low activity of the protein. Typical such proteins include TNFα, GM-CSF, IL-3, and proteins encoded by Group I through Group IV mRNAs listed in Bakheet et al. (2001), supra, or on the ARED web site noted above. Agents identified by methods of the invention are useful for treating, inhibiting, or preventing such conditions and/or ameliorating the symptoms thereof.

For example, a variety of conditions characterized by an undesirably low amount of GM- CSF benefit from the administration of a degradation inhibitor that stabilizes GM-CSF mRNA, thereby stabilizing the level of GM-CSF mRNA and thus enhancing GM-CSF protein production. By "GM-CSF-related disease or condition" is meant any disease or condition in which GM-CSF plays a role, and in which an increase (or, in some cases, decrease) in GM-CSF would be useful in treating preventing, or slowing the disease or condition, or ameliorating one or more symptoms thereof Examples of GM-CSF-related diseases or conditions include, but are not limited to, conditions which are currently treated by administering recombinant GM-CFS protein. GM-CSF diseases or conditions that can be treated by inhibitors of degradation of GM-CSF mRNA include conditions characterized by insufficient numbers of myeloid cells, e.g., various forms of granulocytopenia, including the bone marrow suppression that accompanies certain forms of chemotherapy, autologous bone marrow transplantation, aplastic anemia, and other neutropenic conditions. The granulocytopenia may be relative granulocytopenia (reduction in granulocyte count below a level considered to be clinically normal) or absolute granulocytopenia (the absence of granulocytes). Treating granulocytopenia involves an increase in granulocyte count to a normal count or approaching a normal count, or it can involve an increase in granulocyte count that is significant compared to the granulocyte count prior to treatment with the agent. Diseases that are caused by a shortage of granulocytes include granulocytopenia generally, and, specifically, granulocytopenia associated with cancer chemotherapy; associated with propylthiouracil use; associated with other drug use besides chemotherapeutic agents and propylthiouracil; associated with radiotherapy for marrow ablation for bone marrow transplantation or for other conditions; primary granulocytopenia; aplastic anemia; myelofibrosis and myeloid metaplasia; systemic lupus erythematosus; congenital neutropenia, chronic neutropenic disease, cyclic neutropenia, AIDS, myelodysplastic syndromes, myeloid leukemia, acute myeloid leukemia, other forms of myeloablative treatment.

In another embodiment, agents identified by methods of the invention are useful for treatment of conditions characterized by an undesirably high amount of TNFα. Such conditions benefit from the administration of an agent that stimulates degradation of TNFα mRNA, thus reducing the amount of TNFα, and thereby reducing TNFα polypeptide production. By "TNFα- related disease or condition" is meant any disease or condition in which TNFα plays a role, and in which a decrease (or, in some cases, increase) in TNFα would be useful in treating preventing, or slowing the disease or condition, e.g., a condition characterized by an inflammatory reaction. Examples of TNFα-related diseases or conditions include a variety of neoplastic diseases, immune disorders and infections, as is well known in the art. These conditions include, but are not limited to: acute septic shock, autoimmunity, graft- versus-host disease, rheumatoid arthritis, psoriatic arthritis, Crohn's disease, cachexia (e.g., associated with cancer or AIDS), wasting syndrome, dermatitis, alopecia, myeloid hyperplasia, inflammatory arthritis (e.g., erosive arthritis), dermatitis, autoimmunity, myeloid hyperplasia,, and, in general, TNFα-dependent inflammation.

In another embodiment, agents identified by methods of the invention are useful for treating conditions characterized by an undesirably high or low amount of E -3. By "IL-3-related disease or condition" is meant any disease or condition in which IL-3 plays a role, and in which an increase or decrease in IL-3 would be useful in treating preventing, or slowing the disease, or ameliorating one or more disease symptoms. Other conditions that can be treated include conditions characterized by an undesirably high or low amount of a protein encoded by an mRNA of Group I through Group IV in Bakheet et al. (2001), supra, or on the ARED web site noted above. An agent identified by a method of the invention can be admimstered to a patient or subject which is a human or non-human primate, or to any animal that experiences a condition mediated by a protein encoded by an mRNA whose processing is regulated by an ARE (e.g., a cat, a dog, a horse, a bird, or a rodent). The agents can also be used as research tools, e.g. , to study various aspects of RNA processing, or to study proteins encoded by RNAs whose processing is regulated by an ARE, such as GM-CSF, TNFα or IL-3.

An agent identified by a method of this invention can be formulated in a pharmaceutically acceptable carrier for in vivo administration to a subject. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material maybe administered to a subject without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.

An agent identified by a method of the invention may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like. The exact amount of the agent will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity or mechanism of any disorder being treated, the particular agent or vehicle used, its mode of administration and the like.

In the foregoing and in the following examples, all temperatures are set forth in uncorrected degrees Celsius; and, unless otherwise indicated, all parts and percentages are by weight.

EXAMPLES I. Methods A. Plasmid constructs.

Expression plasmids CMV.hTTP.tag, its zinc finger mutant C124R, and its tandem zinc finger (TZF) domain alone (CMV.hTTP (97-173).tag), were made as described (Lai et al, (2000) JBiol Chem. 275,17827-37). The numbering system for the TTP mutants used the GenBank RefSeq for TTP, NP_003398. CMV.cMGl.tag and CMV.xC3H-3.tag were described previously (Lai et al, (2000) JBiol Chem. 275,17827-37). CMV.hPARN.flag, which expressed the human poly(A)-dependent 3' exoribonuclease (PARN), was constructed as follows. A cDNA coding for the open reading frame of PARN was made by RT-PCR from HeLa cell total RNA. The 5' primer for the PCR amplification was 5'ACGTggtaccGCCGAGATGAACCCCAGTG3' (SEQ ID NO: 6) and the 3' primer was 5'GTGCCACCGGTGTTCCAACTGTTGATTACAAGGACG

ACGATGACAAGTAAGctcgagCAT (SEQ ID NO: 7), where the lower case letters indicate the restriction sites for Asp718 saxdXhoI, respectively. The underlined letters in the 3' primer represent the coding sequence for the FLAG epitope. The resulting PCR product was digested with the enzymes and ligated into the Asp718 and Xhol sites of the expression vector CMV.BHG3'/BS+ (Chen et al. (2001), Cell 107, 451-64). The correct sequence of the hPARN.flag DNA insert was confirmed by dRhodamine Terminator Cycle Sequencing (Perkin- Elmer, Foster City, CA), and the sequence of hPARN was identical to bp 58-1974 (coding for the first to the last amino acids) of GenBank accession number NM_002582.1; the protein sequence is listed as NP_002573. Mutations were introduced into the PARN cDNA sequence as described in Lai et al. (1995), J. Biol. Chem. 270, 25266-72; correct sequences of all mutations were verified by dRhodamine Terminator Cycle sequencing. B. Transfection of HEK 293 cells and preparation of cell extracts.

HEK 293 cells (referred to as 293 cells) were maintained, and transient transfection of 1.2 x 10 cells (in 100 mm plates) with plasmid constructs in calcium-phosphate precipitates was performed, as described (Lai et al. (1999) Mol Cell Biol 19, 4311-23). Unless otherwise indicated, to each plate of cells was added 0.2 μg of hTTP, or 2 μg of the tandem zinc finger

(TZF), or 0.5 μg of hPARN, expression plasmid. Vector DNA (BS+) was added to each to make the total amount of co-transfected DNA 5 μg per plate. Twenty-four h after the removal of the transfection mixture, the cell monolayers were rinsed with ice-cold Ca^""^" and Mg free phosphate buffered saline (PBS) and then scraped into PBS. After centrifugation at 600g for 3 min at 4°C, the cell pellet was gently rinsed in ice-cold DEPC-treated water containing 8 μg/ml leupeptin, 0.5 mM PMSF and 2 mM DTT. The cells were resuspended in the same solution (0.5 ml per 100 mm plate of cells) on ice for 3 min, and then passed 3 times through a 27G needle. Buffer was then added to the cell lysates to achieve a final concentration of 10 mM HEPES (pH 7.6), 40 mM KCl and 5% glycerol. The lysates were centrifuged at 100,000g for 45 min at 4°C, and then glycerol was added to the supernatant to achieve a final concentration of 15%. The cell extracts were stored at -70°C.

For some experiments, the fusion proteins hTTP.flag and hPARN.flag were isolated from the 100,000g supernatants (before the addition of glycerol) using the FLAG Immunoprecipitation Kit (Sigma) and following the manufacturer's protocol. The resulting eluates were adjusted to a final concentration of 10 mM HEPES (pH 7.6), 40 mM KCl and 15% glycerol and stored at -70°C.

C. Cell-free deadenylation assays. 1. Preparation of RNA probes

Plasmid pTNFα 1309-1332 (bp 1309-1332 of GenBank accession number X02611) was constructed as described (Lai et al. (1999) Mol Cell Biol. 19, 4311-23)). Plasmid TNFα 1309- 1332 (A)50/SK- was made by inserting 50 bp (50 T's (SEQ ID NO: 36) in the strand to be transcribed from) double-stranded oligonucleotides into the Xbal-Eagl cloning sites of pTNFα 1309-1332 (Fig. 1 A). A template for RNA probe ARE-A50 was PRC amplified from this plasmid with primers Ml 3 Forward and T50Xba. The resulting double- stranded template was sequenced by dRhodamine Terminator Cycle Sequencing to make sure that the ARE was followed by 50 A's (SEQ ID NO: 35) so that the transcribed probe would end with a string of As with no other nucleotides 3' of the ρoly(A) tail. The mutant A/C TNFα 1309-1332 (A)50/Sk- was made by substituting the flanking As in the AUUUA motif with Cs, and probe A/C ARE- A50 was made by the method described above. The templates for probe ARE and V were prepared by linearizing pTNFα 1309-1332 (A)50/Sk- with Xbal or EcoRV, respectively. Plasmid pA50/SK- was made by inserting 50 bp (50 T's (SEQ ID NO: 36) in the strand to be transcribed from) of double-stranded oligonucleotides into the Xbal-Eagl cloning sites of vector SK- (Fig. IB). The template for in vitro transcription of probe A50 was PCR amplified from pA50/SK- with primers Ml 3 Forward and T50Xba and verified by sequencing.

Plasmid mGM-CSF 668-775(A)50/SK- (Fig. 1C) contained 3'-UTR sequences from mouse GM-CSF mRNA b 668-775 (bp 3399-3506 of GenBank accession number X03020) that was inserted into the Xbal and EcoR V cloning sites of SK-, then followed by 50 A's (SEQ ID NO: 35) inserted between the Xbal and EcoRV sites. The template for probe g668-775A50 was PCR amplified (primers Ml 3 Forward and T50Xba) from the plasmid and was sequenced to verify the 3' end as described above. The template for probe g668-775 was prepared by linearizing the plasmid with Xbal.

The capped RNA probes were transcribed in the presence of [α ³²P]UTP (800 Ci/mmol) and Ribo m G Cap Analog (Promega). Linearized plasmids or PCR amplification products were used as templates, and the Promega Riboprobe in vitro Transcription Systems protocol was employed. The resulting products were separated from the free nucleotides using G50 columns. 2. In vitro deadenylation assay

The reaction mixtures were assembled on ice. The reaction was initiated by adding 50 μl of probe (4 x 10⁴ cpm in an assay buffer consisting of 10 mM HEPES (pH 7.6), 40 mM KCl and 5% glycerol) into a tube containing 5 μg of protein from the 100,000g extract in 50 μl of assay buffer. MgCl₂ (3 mM) was present in the assay unless otherwise indicated. The mixtures were incubated on ice or at 37°C for the times indicated. EDTA was added to achieve a final concentration of 20 mM to terminate the reaction. The mixture was then extracted once with phenol/chloroform. An aliquot of 60 μl of aqueous phase was mixed with 60 μl of 2x formamide Stop solution (95% formamide, 0.05% bromophenol blue, 0.1 % xylene cyanol) and heated at 70°C for 5 min. Aliquots of reaction products were analyzed on 6% or 8% acrylamide gel containing 7 M urea.

D. Analysis of RNA-protein complexes by electrophoretic mobility shift assays and western blotting.

1. RNA electrophoretic mobility shift assay.

100,000g extracts prepared from 293 cells transfected with either vector alone or expression constructs driven by the CMV promoter (5 μg of protein) were incubated with 2 x 10⁵ cpm of RNA probe as described (Lai et al (1999) Mol Cell Biol. 19, 4311-23; Lai et al. (2000), JBiol Chem. 275,17827-37)

2. Western blotting.

Cell extracts were mixed with 1/5 volume of 5X SDS sample buffer (4), boiled for 5 min, then loaded onto 8% SDS-PAGE gels. Western blotting was performed by standard techniques. Membranes were incubated in tris-buffered saline/0.3% Tween 20 (TBS/T) with a polyclonal antiserum HA.11 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) (1 :2,000), or a monoclonal anti-FLAG M2 antibody (Sigma) (1:2,000), or anti-PARN antiserum (a generous gift from Mike Wormington, University of Virginia; (11)).

3. Protein cross-linking The 100,000g extracts (40 μg of protein), prepared from 293 cells transfected with vector alone or expression constructs CMV.hTTP.tag, CMV.hPARN.flag, or both, are incubated with or without 3mM MgCl₂ at 25°C for 20 min. Disuccinimidyl suberate (DSS; Pierce) is then added to achieve a final concentration of 0.1 mM and the mixtures are rotated at 4°C for 45 min. The incubations are stopped by adding iris (pH 8.0) to a final concentration of 0.1 M. Aliquots of the reaction products are loaded onto 8% SDS-PAGE gels. Western blotting is performed with antisera as described above.

II. RNA probes

Fig. 1 is a schematic depiction of the RNA probes used in this study; details of their construction are in Example 1A above. All the probes contained the same 5' sequence of 58 (or in one case 61) ribonucleotides transcribed from the multiple cloning sites (MCS) of vector SK- (Stratagene), which permitted the comparison of the degradation profiles of related probes. All probes contained a 5 '-cap. Probe ARE-A50 (Fig. 1A) consisted of 58 b transcribed from the MCS of SK-, 24 b of the core ARE from the mouse TNFα mRNA (bp 1309-1332 of GenBank Accession number X02611), followed by 50 A residues (SEQ ID NO: 35); the 3' end of the RNA did not contain any non-A ribonucleotides (see Example 1 A above). Probe A/C ARE- A50 consisted of the same components as described for ARE-A50 except that the flanking As of the AUUUA motif were replaced by Cs. Probe ARE was identical to ARE-A50 except that it did not contain a poly(A) tail. In probe V, the RNA transcript only consisted of the 58 b transcribed from the MCS of SK-. Probe A50 (Fig. IB) contained 61 b of the SK- MCS 5' of 50 A residues (SEQ ID NO: 35). Probe g668-775A50 (Fig. 1C) contained 58 b of the SK- MCS followed by the 3'-most 108 b of the mouse GM-CSF mRNA (bp 3399-3506 of GenBank accession number X03020), followed again by 50 A residues (SEQ ID NO: 35). This region of the GM-CSF mRNA contains the ARE, as indicated in Fig. 1. Probe g668-775 was identical except that it lacked the poly A tail.

III. Cell-free deadenylation of polyadenylated, ARE-containing probes

The probes described above were then used to characterize the ability of 293 cell extracts to promote RNA deadenylation in a TTP-dependent manner. These cells do not express endogenous TTP; the extracts used for these experiments were from cells transiently transfected with CMV.hTTP.tag, its derivatives, or vector alone (Chen et al. (2001), Cell 107, 451-64; Lai et al. (2002), JBiol Chem. 277, 9606-13). Similar results were obtained with extracts derived from a 20 min, 12,000 g centrifugation after cell lysis with 0.5% NP-40 as with extracts homogenized in the absence of detergent and centrifuged for 100,000 g for 45 min at 4°C. Therefore, all the results shown here were obtained with the detergent-free, high-speed extracts. Similar results were also obtained with capped and uncapped RNA substrates; all data shown herein were obtained with capped substrates.

When probes A50, ARE, ARE-A50 and V were incubated with extracts from cells transfected with vector alone, all three probes showed similar patterns of slight degradation after one hr at 37°C (Fig. 2A, compare lanes 1 and 2, 5 and 6, 9 and 10, 13 and 14). However, when these probes were incubated in parallel with the same amount of extract protein prepared from cells transfected with the human TTP expression plasmid CMV.hTTP.tag, only probe ARE-A50 was markedly more degraded (Fig. 2A, compare lanes 3 and 4, 7 and 8, 11 and 12). The disappearance of probe ARE-A50 in the presence of TTP (lane 12) was accompanied by the appearance of a new band of smaller size (arrow) which migrated to the same position as probe ARE, indicating that the new band represented the accumulation of a deadenylated form of the ARE-A50 probe. Thus, under these experimental conditions, TTP appeared to promote the degradation of only the ARE-A50 probe, but not a non- ARE-containing poly(A) probe (A50) or an ARE-containing non-polyadenylated probe (ARE). The migration position of the V probe (MCS sequences alone) is shown in lanes 13 and 14.

IV. Effect of non-bin ding TTP mutants on deadenylation, Some of the present inventors have shown previously that the increased levels of TNFα and GM-CSF mRNAs in cells derived from TTP-deficient mice were due to increased stability of those mRNAs (Carballo et al, (2000), Blood 95, 1891-9; Carballo et al. (1998), Science 281, 1001-5). Conversely, TTP promoted the instability of ARE-containing mRNAs in a 293 cell co- transfection system, apparently by first degrading the poly(A) tail of the mRNA (Lai et al. (2001), JBiol Chem. 276, 23144-54; Lai et al. (1999), Mol Cell Biol. 19, 4311-23). This mRNA destabilizing effect of TTP required its binding to the ARE of these mRNAs through its TZF domain, since TTP lost both ARE binding and mRNA destabilizing activities when key amino acids in the TZF domain were mutated (Lai et al. (2001), JBiol Chem. 276, 23144-54; Lai et al. (1999), Mol Cell Biol 19, 4311-23; Lai et al. (2002), JBiol Chem. 277, 9606-13). Therefore, the importance of the TZF domain to TTP's ability to promote RNA deadenylation was evaluated in the cell-free deadenylation assay. As shown in Fig. 2B, an extract containing the TTP zinc finger mutant C124R caused the same minimal degradation of the probe ARE-A50 as that seen with extracts from cells transfected with vector alone (Fig. 2B, compare lanes 1 and 2 to lanes 5 and 6). The mutant TTP also did not cause accumulation of the lower molecular weight band, as seen with extracts containing wild-type TTP (Fig. 2B, lanes 3 and 4), which again migrated to approximately the same position as the probe ARE (Fig. 2B, lanes 7 and 8; arrow). Thus, the ability of TTP to bind to the ARE was required to promote the deadenylation of ARE-containing, polyadenylated RNA probes.

V. Effect of a mutant ARE on TTP-induced deadenylation

Some of the present inventors have shown previously that a mutant ARE, in which all the As of the core AUUUA pentamer were changed to Gs, did not bind TTP (Lai et al (2000), JBiol Chem. 275, 17827-37). It was tested whether the deadenylation of a similar mutant probe could be stimulated by wild-type TTP. The probe used was identical to probe ARE-A50 except that the flanking As of the AUUUA motif in the ARE had been mutated to Cs. In this case, TTP did not stimulate the deadenylation of the mutant probe A C ARE-A50, despite evidence that TTP promoted the deadenylation of the normal ARE-A50 probe (Fig. 2C, compare lanes 3 and 4 to lanes 7 and 8). In a gel shift assay using the same mutant probe, A/C ARE-A50, extracts from cells transfected with vector alone, wild-type TTP or the C124R mutant formed similar complexes that migrated in similar patterns (Fig. 2D, lanes 2-4). When probe ARE-A50 was incubated with extract from cells transfected with CMV.hTTP.tag, there was formation of the usual TTP-probe complex (Fig. 2D, lane 7), which was not seen with extracts of cells transfected with the TTP mutant C124R or vector alone (Fig. 2D, lanes 6, 8). These results indicated that a probe competent to bind TTP was necessary for deadenylation to occur in this cell-free assay.

VI. Ability of TTP to promote deadenylation of a GM-CSF ARE probe

A probe was also tested that was derived from an mRNA containing a second class II ARE, which contained in the GM-CSF mRNA. This probe was important to test because its ARE ends approximately 54 b 5' of the beginning of the poly(A) tail, as occurs in the natural GM-CSF mRNA; this is in contrast to the ARE-A50 probe used for most of these experiments, in which the core ARE from TNFα mRNA was linked directly to a poly A tail, separated only by the Xbal cloning site. When the GM-CSF probe was incubated with 293 cell extracts, TTP caused degradation of the polyadenylated GM-CSF probe (Fig. 3 A, compare lanes 5 and 6 with lanes 7 and 8), again accompanied by the appearance of a smaller, deadenylated species (lane 8, arrow); however, TTP had no effect on the non-polyadenylated probe (lanes 1-4). As in the case of the TNFα probe, the TTP mutant C124R was without effect on degradation of the polyadenylated GM-CSF probe (lanes 9 and 10). As expected, native but not C124R mutant TTP could bind to the GM-CSF ARE probe in a gel shift assay (Fig. 3B).

VII. Effect of TTP-related proteins on probe deadenylation Besides TTP, mammals express two additional CCCH (SEQ ID NO:28) tandem zinc finger proteins, ZFP36L1 and ZFP36L2. Although the physiological functions of these two proteins are unknown, they have been shown, like TTP, to bind to ARE probes and stimulate the breakdown of ARE-containing mRNAs when co-expressed in cells ((Lai et al. (2000), JBiol Chem. 275, 17827-37). To examine whether these proteins caused deadenylation of the ARE- containing polyadenylated probes in this cell-free system, similar assays were performed using extracts from 293 cells transfected with CMV.cMGl.tag (the rat orthologue of ZFP36L1) or CMV.xC3H-3.tag (the Xenopus orthologue of ZFP36L2). When probe ARE-A50 was incubated with extracts from cells transfected with TTP, cMGl, or xC3H-3 expression plasmids, the probe was degraded in characteristic fashion in the presence of all three proteins (Fig. 4A, lanes 4, 6, 8), as compared with extracts from vector alone transfected cells (Fig. 4A, lanes 1 and 2). The binding of these proteins to this probe could be readily demonstrated by gel shift analysis (Fig. 4B). Thus, representatives of the two TTP-related proteins behaved like TTP in this cell-free deadenylation assay.

VIII. Effect of the TZF domain alone on deadenylation The members of this CCCH (SEQ ID NO:28) tandem zinc finger protein family share a highly conserved tandem zinc finger (TZF) region that comprises the ARE-binding domain ((Lai et al. (2000), JBiol Chem. 275, 17827-37). To determine whether the TZF region alone was sufficient to induce the deadenylating activity in 293 cell extracts, extracts from cells transfected with either full length TTP or the epitope-tagged TZF domain, consisting of amino acids 97-173 ofhuman TTP (GenBank RefSeq accession number NP_003398) were evaluated. As expected, extracts from cells expressing full-length TTP caused degradation of the probe and accumulation of the deadenylated ARE band (Fig. 4C, lanes 3 and 4, arrow). In contrast, the TZF-containing extract caused minimal degradation of the probe, and no accumulation of the deadenylated probe, after 60 min of incubation (Fig. 4C, lanes 5 and 6), similar to extracts from cells transfected with the vector alone (Fig. 4C, lanes 1 and 2). Despite the lack of activity in the deadenylation assay, the TZF domain polypeptide could readily bind to the ARE-A50 probe, as demonstrated by gel shift analysis (Fig. 4D). These data indicated that the TZF domain peptide was unable to mimic full-length TTP in this cell-free deadenylation system.

IX. Characterization of the TTP-induced deadenylating activity

The activity within the 293 cell extracts that acted with TTP to stimulate deadenylation of ARE-containing polyadenylated probes was found to be sensitive to boiling and could be extracted with phenol/chloroform, both characteristics of proteins. Since the TTP-inducible deadenylating activity was present in a non-detergent containing, 100,000 g supernatant from 293 cells, and required magnesium but not ATP (see below), studies were focused on the human enzyme poly(A) ribonuclease, or PARN. Mammalian PARN activity has been shown to depend on Mg^"1"1" but not ATP. To investigate whether PARN might be involved in the TTP-dependent deadenylation of ARE-containing probes in this cell-free system, cell extracts were prepared in

MgCl₂-free buffer, then added back various concentrations of MgCl₂. In the presence of 3 mM

MgCl₂ at 37°C, probe ARE-A50 was slightly degraded in extracts prepared from cells transfected with vector alone (Fig. 5 A, lane 2); however, in the absence of added MgCl , the probe was completely stable at 37°C (Fig. 5A, lane 3). When the probe was incubated with extracts from cells transfected with TTP, both the usual deadenylation of the probe and the appearance of the deadenylated probe decreased with decreasing concentrations of MgCl (Fig. 5 A, lanes 4-7).

These findings suggested that the ARE-containing, polyadenylated RNA probe was degraded in the presence of TTP by a Mg -dependent activity present in the 293 cell extracts. The presence or absence of ATP had no effect on the TTP-dependent deadenylating activity.

The effect of Mg^"1-1" on the degradation of probe ARE-A50 in extracts from 293 cells that over-expressed human PARN was also examined, h the presence of 3 mM MgCl₂, the PARN- containing extracts caused complete disappearance of the polyadenylated probe (Fig. 5 A, lanes 9 and 10). This activity decreased with decreasing concentrations of MgCl₂ (Fig. 5A, lanes 9-13), although there was no accumulation of the deadenylated RNA (arrow) as seen with TTP (lane 5).

There was some PARN-induced degradation of the probe in the absence of added MgCl₂ (Fig.

5A, lane 13), possibly due to trace amounts of Mg in the cell extracts (see below).

A polyadenylated probe (A50) that did not contain the ARE was minimally degraded by the 293 cell extracts from vector alone transfected cells, both in the presence and absence of added 3mM MgCl (Fig. 5B, lanes 1-3). This probe was also minimally degraded in extracts from TTP -transfected cells, either when varying concentrations of Mg^""^" were present, or in the presence of 1 mM EDTA (E) (Fig. 5B, lanes 4-9). However, when extracts from PARN- transfected 293 cells were exposed to the A50 probe, there was dramatic, MgCl -dependent degradation of the probe that did not occur in the presence of 1 mM EDTA (Fig. 5B, lanes 10- 15).

Although the experiments described above demonstrate that the TTP-dependent deadenylating activity present in 293 cell extracts on ARE-containing, polyadenylated RNA substrates was dependent on Mg^"1-1", it remained possible that the association of TTP with the

ARE was itself Mg^""^* -dependent. However, neither the gel shift patterns of endogenous 293 cell proteins forming complexes with probe ARE-A50 (Fig. 5C, lanes 1 and 2), nor TTP expressed in

293 cells (Fig. 5C, compare lanes 3,8,9), required added MgCl₂. The formation of both TTP-

ARE complexes decreased with increasing concentrations of EDTA (Fig. 5C, lanes 3-7), perhaps due to chelation of the zinc ions within TTP's zinc fingers. These data indicate that the lack of TTP-induced deadenylation seen in the absence of Mg^"1-1" was not due to inhibited TTP binding to the ARE under these conditions.

X. Effects of TTP and PARN together to promote deadenylation

To evaluate the possible synergistic activation of deadenylation caused by TTP and PARN, cells were transfected with cDNAs expressing PARN and TTP, singly and together. Extracts containing TTP alone caused a time-dependent degradation of the ARE-A50 probe and accumulation of the deadenylated probe (Fig. 6 A, compare lanes 5-8 with lanes 3 and 4). Transfection of PARN alone caused a time-dependent deadenylation of the probe, but no accumulation of the deadenylated band (Fig. 6A, lanes 9-12). However, when the effects of PARN and TTP together were evaluated under these conditions, there was complete probe degradation, and marked accumulation of the deadenylated probe (Fig. 6A, lanes 13 and 14). Note that lane 14 (TTP plus PARN) was from only a 15 min incubation, and is thus directly comparable to lane 6 (TTP alone) and lane 10 (PARN alone) at this time point. Thus, the two proteins together produced a dramatic and synergistic stimulation of probe ARE-A50 deadenylation under these conditions.

When similar experiments were performed with the A50 probe that lacked an ARE, there was no effect of TTP on probe degradation compared to extracts from cells transfected with vector alone (Fig. 6B, compare lanes 3 and 4 to lanes 1 and 2). hi extracts from cells co- transfected with PARN, the time-courses of the probe degradation profiles were essentially the same when vector alone or TTP was co-transfected (Fig. 6B, lanes 5-12). Thus, TTP had no apparent effect on the ability of PARN to cause deadenylation of a poly(A) probe that lacked an ARE. Similar experiments were performed on ice, in an attempt to slow the reaction that was essentially complete by 15 min at 37° C in the presence of both PARN and TTP (see lane 14 in Fig. 6A). At 0°C, extracts from cells transfected with vector alone or various amounts of the TTP expression plasmid did not promote destabilization of the ARE-A50 probe after 60 min (Fig. 6C, lanes 1-5). In the extract from cells transfected with PARN alone, there was barely detectable degradation of the ARE-A50 probe on ice, even after 60 min of incubation (Fig. 6C, lanes 19-22). However, in extracts from cells expressing both exogenous PARN and TTP, there was a time-dependent degradation of the probe ARE-A50 at 0°C, accompanied by a gradual increase in the accumulation of the deadenylated ARE band (arrow; Fig. 6C, lanes 6-18), and the deadenylating activity was dependent on the amount of transfected TTP DNA used. At the lowest concentration of TTP DNA used, 10 ng of CMV.hTTP.tag, there was no apparent degradation of the probe after 60 min on ice (Fig. 6C, lane 18). The TTP zinc finger mutant C124R alone did not induce any endogenous deadenylating activity (Fig. 6C, lane 23); after 60 min of incubation with extract from cells co-transfected with the PARN vector, the probe was found to be degraded to approximately the same extent as occurred with extracts from cells transfected with PARN alone (Fig. 6C, compare lanes 22 and 24).

XI. Effects of affinity-purified TTP and PARN on deadenylation

To begin to address the question of whether PARN plus TTP alone could promote the ARE-dependent deadenylation of poly(A) probes, the fusion proteins hTTP-FLAG or hP ARN- FLAG were isolated by affinity chromatography from 293 cells transfected with the expression plasmids (Fig. 7). The fusion proteins were eluted from the affinity matrix with FLAG epitope peptide in an attempt to decrease non-specific elution of contaminating proteins. When the probe ARE-A50 was incubated at 37°C with either the TTP eluate alone (T) (Fig. 7A, lane 1) or the PARN eluate alone (P) (Fig. 7 A, lane 2), there was minimal degradation of the intact probe compared to the effects of extract from cells transfected with vector alone (Fig. 7A, lane 5). However, the probe was almost completely degraded, along with formation of the characteristic lower band, when both FLAG eluates (TP) were combined (Fig. 7A, lane 3). When the FLAG- TTP (T) eluate was added to the vector-transfected extract, the ARE-A50 probe degradation profile was virtually identical to that seen when extract from TTP-transfected cells was used (Fig. 7A, compare lanes 6 and 10). The addition of PARN-FLAG (P) in the absence of TTP caused more degradation of the probe than the presence of the endogenous deadenylating activity (Fig. 7A, compare lanes 4 and 7). When both eluates (TP) were added, the probe was almost completely degraded (Fig. 7 A, lane 8), with formation of the lower band (Fig. 7A, lane 8) that migrated to the same position as probe ARE (arrow; Fig. 7A, lanes 11-14). Thus, under these conditions, the individual TTP and PARN eluates each had minimal deadenylating activity; however, the combination of the two had marked deadenylating activity towards the ARE-A50 probe. Similar results were seen when the TTP and PARN eluates were incubated together with probe ARE-A50 on ice.

To characterize further the endogenous factor(s) in 293 cells whose deadenylating activity was stimulated by TTP in the degradation of the ARE-containing poly(A) probes, 293 cell extracts were treated by phenol/chloroform extraction or by boiling. When the phenol/chloroform extracted (E) or boiled (B) 293 extracts were incubated with the ARE-A50 probe at 37°C, there was little degradation of probe as compared to untreated extract (C) (Fig. 7B, lanes 1-4). Likewise, the ARE-A50 probe stability in the FLAG peptide eluate (F) added to untreated (C), or extracted (E), or boiled (B), extracts at 37°C was comparable to that seen in the absence of the eluate (Fig. 7B lanes 5-8). When the eluted FLAG-TTP (T) was incubated with the probe there was a slight degradation of the probe, but no change in the size of the probe was seen (Fig. 7B, lane 9). However, in the presence of the untreated (C) 293 extract, almost all the probe was degraded, with the formation of the smaller band (Fig. 7B, lane 10) that migrated to the same position as that seen when extracts from 293 cells transfected with TTP were used (Fig. 7B, lane 14). FLAG-TTP added to phenol/chloroform or heat-treated 293 extracts did not cause the probe to degrade (Fig. 7B, lanes 11, 12), suggesting that the deadenylation factor(s) effectively activated by TTP was a protein and was heat-labile. Probe ARE incubated with the TTP- containing extract was also shown in this experiment (Fig. 7B, lanes 15, 16).

XII. Crosslinking of co-expressed FLAG-PARN and HA-TTP

To test whether TTP acts as a tether or adaptor molecule, physically linking PARN to the RNA by a direct physical interaction between TTP and PARN, protein crosslinking experiments are performed in cell extracts, using the bifunctional crosslinker disuccinimidyl suberate (DSS). HEK 293 cell extracts are used, in which one or both proteins are overexpressed as fusions with different epitope tags, followed by crosslinking in the presence or absence of magnesium. Western blots of the various 293 cells extracts are performed, in each case probing with a different antibody. For example, PARN-FLAG and TTP-HA are co-expressed and cross-linking is performed. Extracts are prepared from 293 cells expressing vector alone (BS+), CMV-hTTP-tag (hTTP), CMV.hPARN.flag (hPARN), or both together. The extracts are then incubated without (-) or with (+) 3 mM MgCl₂ for 20 min at 25° C. DSS (0.1 mM final concentration) is then added to some of the extracts, and the extracts are rotated gently at 4° C for 45 min. The reactions are then stopped by the addition of tris buffer (pH 8.0) to a final concentration of 0.1 M. Equivalent amounts of protein are then loaded onto three SDS-PAGE gels, transferred to nitrocellulose, and blotted with antibodies to the FLAG epitope tag, PARN itself, or the HA epitope tag. Chemiluminescence autoradiography is then performed. The migration positions of molecular weight standards are determined, as are the position of cross-linked species. A complex comprising TTP and PARN migrates at about M_r=120,000, and reacts with all three of the antibodies used, FLAG, PARN and HA.

XIII. Effect of inactive PAKN mutants

To determine whether the TTP effect could be mediated or inhibited by inactive PARN mutants, we relied on previous data demonstrating that mutation of any one of four key amino acids within the primary sequence ofhuman PARN completely inactivated the enzyme (Ren et al. (2002), J. Biol. Chem. 277, 5982-87). Therefore, similar mutations were made in our PARN expression vector, and examined both their enzymatic activity and their ability to influence TTP activity in 293 cell extracts.

First, the activity of the PARN mutants was examined on a polyA substrate (Fig. 10A); in all panels of Fig. 10, the reactions were conducted at 30°C in an attempt to slow them somewhat. As noted earlier, cell extracts enriched in transfected TTP were essentially identical to extracts from cells transfected with vector alone in their inability to promote deadenylation of the polyA substrate (Fig. 10A, compare lanes 2 and 3). Cell extracts enriched in native (i.e., non-mutant) PARN exhibited the usual ability to cause shortening of this substrate (Fig. 10A, lane 4). However, each of three PARN mutants, D28A, E30A, and D382A, when expressed in 293 cells, exhibited essentially no deadenylating activity under these conditions (Fig. 10A, lanes 5-7). The expression of TTP plus native PARN had no effect on PARN's ability to promote deadenylation of this non- ARE-containing probe (Fig. 10A, lane 8). Similarly, co-expression of TTP with the three mutant PARN proteins had no effect on their inability to promote probe deadenylation (Fig. 10A, lanes 9-11). Each of the three mutant proteins was expressed at comparable levels to the native protein, as determined by western blotting of the same extracts with the HA epitope antibody (Fig. 10B). The expression of the mutant PARN proteins was modestly increased by the co-expression of TTP in this experiment, whereas the expression of FLAG-tagged TTP was not affected by the co-expression of native or mutant PARN (Fig. 10B).

Then, the effect of TTP on the ability of co-transfected native and mutant PARN to deadenlyate the ARE-containing, polyadenylated substrate was examined. The concentrations of expressed TTP and native PARN were adjusted so that each would have relatively minor effect alone, making synergy between the two readily detectable. The deadenylation reactions were performed at 30°C for the same reason. As shown in Fig. IOC, there was essentially no probe degradation after incubation of extracts from cells transfected with vector alone for 60 min at 30°C (compare lane 19 to 18). The expression of native PARN led to a modest shortening of the probe under these conditions (Fig. IOC, compare lane 20 to lane 19). As noted with the polyA substrate, there was no difference in deadenylating activity between extracts from cells transfected with vector alone (Fig. 10C, lane 19) and those from cells transfected with the plasmids encoding the PARN mutants D28A (lane 21), E30A (lane 22), or D382A (lane 23). These data indicate that these PARN mutants had no effect on the ARE-containing, polyadenylated substrate, as noted for the polyA substrate. Next, time courses were performed of probe degradation with extracts containing TTP alone, and then extracts containing TTP plus either native or mutant PARN proteins. Under these conditions of relatively low protein concentration and 30°C incubation, TTP alone had a modest, time-dependent effect on probe degradation and accumulation of the deadenylated substrate (Fig. 10C, lanes 2-5). Co-expression of native PARN plus TTP resulted in the expected marked increase in time-dependent probe degradation accompanied by accumulation of the deadenylated probe (Fig. 10, lanes 6-8). The 60 min time point for TTP plus PARN (lane 8) exhibited markedly increased disappearance of the polyadenylated probe, and appearance of the deadenylated probe, compared to the control extract (lane 19), native PARN alone (lane 20) or TTP alone (lane 5) at the same time point. When TTP and the mutant PARN were co- transfected, there was no apparent increase in the net effect on deadenylation of this probe when compared to TTP alone (compare lanes 3-5 with lanes 9-11, 12-14, and 15-17), demonstrating that TTP could not "effectively activate" the mutant enzyme. The effects of TTP to promote probe deadenylation and the accumulation of the deadenylated probe were not inhibited by the co-expression of the mutant PARN, suggesting that the endogenous deadenylating activity that was increased in the presence of TTP was not inhibited by the presence of the mutant PARN. This apparent lack of an inhibitory effect of the mutant PARN proteins was more evident at either 37°C or when higher concentrations of TTP were used. Fig. 10C also demonstrates the complete lack of effect of TTP alone (lane 26), PARN alone (lane 27), and TTP plus PARN (lane 28) on the stability of the non-polyadenylated, ARE-containing probe. From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make changes and modifications of the invention to adapt it to various usage and conditions. Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The preceding preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

The entire disclosure of all applications, patents and publications, cited above and in the figures are hereby incorporated by reference.

Claims

We claim:

1. A method for screening an agent for its ability to modulate RNA processing, comprising a) contacting the agent with a sample comprising i) tristetraprolin (TTP) or a related polypeptide, or an active fragment or variant thereof, ii) a poly(A)-preferring, 3 '-5' ribo-exonuclease (PARN) polypeptide, or an active fragment or variant thereof, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3' poly(A) tail, wherein processing of the RNA can be detected, under conditions effective for processing and, optionally, translation of the RNA, and b) detecting processing of the RNA.

2. The method of claim 1, wherein the agent is contacted with a sample comprising i) a TTP polypeptide, ii) a PARN polypeptide, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3' poly(A) tail.

3. The method of claim 1, which is a cell-free assay, wherein the sample comprises i) a cell extract comprising TTP or a related polypeptide, or an active fragment or variant thereof, or a substantially purified TTP or TTP-like polypeptide, or an active fragment or variant thereof; ii) a cell extract comprising a PARN polypeptide, or an active fragment or variant thereof, or a substantially purified PARN polypeptide, or an active fragment or variant thereof; and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3' poly(A) tail.

4. The method of claim 3, wherein the sample comprises a cell extract comprising TTP or a related polypeptide, or active fragment or variant thereof, and a PARN polypeptide or active fragment or variant thereof, that are extracted from the same cell.

5. The method of claim 3, wherein the sample comprises i) a cell extract comprising a TTP polypeptide, or a substantially purified TTP polypeptide; ii) a cell extract comprising a PARN polypeptide, or a substantially purified PARN polypeptide, and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3' poly(A) tail.

6. The method of claim 5, wherein the sample comprises a cell extract comprising TTP or a related polypeptide, or active fragment or variant thereof, and a PARN polypeptide or active fragment or variant thereof, that are extracted from the same cell.

7. The method of claim 1, which is a cell-based assay, wherein the sample comprises a cell, into which is introduced i) a nucleic acid which encodes TTP or a related protein, or an active fragment or variant thereof, wherein the coding sequence is operatively linked to an expression control sequence, ii) a nucleic acid which encodes PARN, or an active fragment or variant thereof, wherein the coding sequence is operatively linked to an expression control sequence, and iii) a nucleic acid from which can be transcribed an RNA that comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3'poly(A) tail, wherein processing of the transcribed RNA can be detected, and the contacted sample is incubated under conditions effective for the expression of the nucleic acids of i), ii) and iii).

8. The method of claim 7, wherein the sample comprises a cell into which is introduced i) a nucleic acid which encodes TTP, wherein the coding sequence is operatively linked to an expression control sequence, ii) a nucleic acid which encodes PARN, wherein the coding sequence is operatively linked to an expression control sequence, and iii) a nucleic acid from which can be transcribed an RNA that comprises an AU-rich element (ARE) downsfream of a reporter sequence, and a 3 ' poly(A) tail.

9. The method of claim 1, 3, or 7, further comprising detecting processing of the RNA in the absence of the agent, and comparing the RNA processing in the presence and the absence of the agent.

10. The method of claim 1, 3, or 7, wherein the processing is degradation of the body of the RNA.

11. The method of claim 1, 3, or 7, which is a high throughput screening method.

12. The method of claim 1, 3, or 7, wherein the reporter sequence in (iii) is operably linked to an expression control sequence, and the RNA processing is detected by measuring the amount and/or activity of a polypeptide encoded by the reporter sequence.

13. The method of claim 1, 3, or 7, wherein the RNA processing is detected by measuring the amount and/or structure of the RNA.

14. The method of claim 13, wherein the RNA processing is detected by measuring deadenylation of the RNA.

15. The method of claim 1, 3, or 7, wherein the RNA processing is detected by measuring the binding of the TTP or related protein, or active fragment or variant thereof, to the ARE.

16. The method of claim 1, 3, or 7, which is a method for screening an agent for its ability to inhibit RNA processing.

17. The method of claim 16, which is a method for identifying an agent useful for treating a condition mediated by insufficient GM-CSF.

18. The method of claim 16, which is a method for identifying an agent useful for treating granulocytopenia.

19. The method of claim 1, 3, or 7, which is a method for screening an agent for its ability to stimulate RNA processing.

20. The method of claim 19, which is a method for identifying an agent useful for treating a condition mediated by TNF-α excess.

21. The method of claim 19, which is a method for identifying an agent useful for treating an inflammatory condition.

22. The method of claim 19, which is a method for identifying an agent useful for treating rheumatoid arthritis, Crohn's disease or arthritis.

23. A method for identifying an agent that mimics the ability of TTP or a TTP-like polypeptide to stimulate PARN-mediated degradation of an ARE-containing RNA, comprising a) contacting the agent with a sample which comprises i) a PARN polypeptide, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and ii) an RNA that comprises an ARE downstream of a reporter sequence, and a a 3 ' poly(A) tail, wherein the degradation of the RNA can be measured, under conditions effective for the degradation of the RNA and/or for the translation of the reporter sequence, and b) detecting degradation of the RNA.

24. A method for stimulating the degradation of an RNA molecule comprising an ARE, in a cell- free system or in a isolated cell, comprising contacting the RNA with TTP or a TTP-like polypeptide and a PARN or a PARN-like polypeptide, wherein, if an isolated cell is used, the PARN is added exogenously to the cell.

25. A method for screening an agent for the ability to modulate RNA processing, comprising detecting the processing of an RNA in a sample, wherein the sample, which comprises i) TTP or a related protein, or a fragment or variant thereof, ii) a PARN polypeptide or related polypeptide, or a fragment or variant thereof, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and iii) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3'poly(A) tail, wherein the processing of the RNA can be measured, is contacted with said agent , under conditions effective for the processing and/or the translation of the RNA.

26. A kit for screening an agent for the ability to modulate RNA processing, comprising a) tristetraprolin (TTP) or a related protein, or an active fragment or variant thereof, b) a poly(A)ribonuclease (PARN) polypeptide, or an active fragment or variant thereof, wherein, if the PARN is in a cell, the cell comprises exogenous PARN, and c) an RNA which comprises an AU-rich element (ARE) downstream of a reporter sequence, and a 3' poly(A) tail, wherein processing of the RNA can be detected.