WO2004046385A1 - A method for inter-species differentiation and identification of a gram-positive bacteria - Google Patents

A method for inter-species differentiation and identification of a gram-positive bacteria Download PDF

Info

Publication number
WO2004046385A1
WO2004046385A1 PCT/SE2003/001771 SE0301771W WO2004046385A1 WO 2004046385 A1 WO2004046385 A1 WO 2004046385A1 SE 0301771 W SE0301771 W SE 0301771W WO 2004046385 A1 WO2004046385 A1 WO 2004046385A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide
gram
rnpb
gene
analysis
Prior art date
Application number
PCT/SE2003/001771
Other languages
French (fr)
Inventor
Margareta Krabbe
James Moe
Original Assignee
Biotage Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from SE0203388A external-priority patent/SE0203388D0/en
Application filed by Biotage Ab filed Critical Biotage Ab
Priority to AU2003279664A priority Critical patent/AU2003279664A1/en
Publication of WO2004046385A1 publication Critical patent/WO2004046385A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • a method for inter-species differentiation and identification of a gram-positi e bacteria is provided.
  • the invention refers to a method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing a relevant variable regions), used as a diagnostic target, the analysis thereby resulting in a nucleotide pattern. Also, the invention refers to a kit specifically adapted for the method of the invention.
  • Gram-positive bacteria in contrast to gram-negative bacteria, are the types of bacteria that have the ability to retain crystal violet when decolorized with an organic solvent such as ethanol.
  • the reason for this difference between gram-positive and gram-negative bacteria is the composition of the cell wall.
  • the thick, homogenous cell wall of gram-positive bacteria is composed primarily of peptidoglycan, often containing a peptide interbridge.
  • Some of the most feared human pathogens causing diseases like bacteremia, abdominal-pelvic infections and endocarditis are within the Gram-positive group of bacteria.
  • Gram-positive bacteria are important human pathogens. They are an increasingly common cause of infection, particularly serious nosocomal infections and predominate in surgical wound infections (Jarvis and Martone, J Antimicrob Ther, 1992, Apr, 29 Suppl A: 19-24).
  • Staphylococci are responsible for a wide spectrum of medical conditions ranging from food poisoning to potentially life threatening infections such as septicaemia and toxic shock syndrome (TSS).
  • Coagulase-negative staphylococci (S. epidermis) have emerged as a major cause of infection and are among the most commonly isolated bacteria in clinical microbiology laboratories. Infections by S. epidermis are particularly common in hospitalised patients with indwelling foreign bodies and immuno-compromised patients .
  • the genus Streptococcus contains human pathogenic species including S. pyogenes, S. Pneumoniae and S. faecalis.
  • Enterococci were previously grouped within the Group D streptococci but are now their own genus.
  • enterococci infections account for a high number of no- cosomal infections, second only to Eschericia coll. The most commonly isolated is E. faecalis, found in the gut flora. This pathogen is a significant cause of urinary tract infections and opportunistic infections, including intra-abdominal, septicaemia and endocarditis.
  • Enterococcus faecium is a major concern for the medical community, since it often carries resistance to several types of antibiotics including quinolones and amino-glyosides. For this reason, E. faecium is often dubbed a "supergerm".
  • various hybridisation assays may be used to identify bacteria (for example: PCR and RT-PCR, branched DNA (bDNA) technology, Ligase Chain Reaction Nucleic Acid Amplification (LCR), Probe-Hybridisation Assays, RF-SBH (re- striction fragment- Southern blot hybridisation, liquid-phase hybridisation (LPH), in situ hybridisation, and integrated PCR and Probe-hybridisation assays).
  • Assays of this type often need specific substances for being able to detect a signal.
  • the clinical probes are most often labeled with non-radioisotopic molecules such as digoxigenin, alkaline phosphatase, biotin, or a fluorescent compound.
  • the detection systems are conjugate dependent and include chemiluminescent, fluorescent, and colorimetric methodologies. These may for example be PCR-based and use a specific detection method after the PCR step, such as a melting point analysis.
  • chemiluminescent, fluorescent, and colorimetric methodologies may for example be PCR-based and use a specific detection method after the PCR step, such as a melting point analysis.
  • a specific detection method after the PCR step such as a melting point analysis.
  • a contaminant may amplified in the PCR reaction.
  • assays based on the principle of molecular beacons exist. Common for these assays is that they, when used for identifying a bacterium in a sample, result in a signal of the presence or absence of the bacteria. However, no information is given concerning the genotype of the identified bacteria.
  • nucleotide sequence information In order to be able to distinguish between species or to reveal genetic variations within a bacterial species, nucleotide sequence information must often be given (if not a phenotypic test is used, which has the capacity to give detailed information, such as species determination). For example, this may be done using a conventional Sanger-sequencing protocol, which has been commercialized by ABI (www.appliedbiosystems.com), whereby a region of at least a few hundred nucleo- tides normally is required. However, by using this technology, a rather large genetic region (typically 500-1500 base pairs) is normally analysed in order to type the bacteria. An analysis of this type puts high demands in form of personnel capacity, time and money.
  • DNA-based identification methods enhances the abilities of the microbiolo- gist to quickly determine the identity of a bacterial isolate and genotyping has proven useful in epidemiological investigations and infection control. Since only short regions of the chromosome are targeted in DNA sequencing, care must be applied on the choice of region targeted. The region of choice must contain conserved DNA sequences, which can be targeted in PCR amplification of all, or many, of the genus members and closely located variable DNA sequences, which are read in the sequencing reaction.
  • WOO 1/51662 discloses a method for detection of pathogenic organisms, which method includes the inter-species differentiation between species. The method is directed towards the use of the variable P3 and/or P19 regions of the Rnase P RNA gene for as a diagnostic target. It is disclosed that the region(s) is (are) amplified and sequenced or otherwise fingerprinted using heteroduplex analysis, size determination, RFLP or melting point determination. The P3 and/or P19 regions were espe- cially useful for identification of mycobacterial and chlamydial species.
  • US-A-5574145 discloses amplification using general primers for genes, such as 16S and Rnase P. After the amplification, sequencing is performed in order to be able to construct an art specific probe. The probe is subsequently used for hybridisation. Thus, this disclosure provides a hybridisation-based analysis method. To summarise, currently there is a further need for bacterial identification methods, making it possible to quickly and accurately identify clinically important gram- positive bacteria. Among others, the cost and the specificity of the current methods are often a drawback. Also, the known methods are either slow or require the sequencing of large genetic regions, or they do not reveal enough information about the genetic type of the infected organism or of important virulence factors.
  • PCR-based assays which often is the method of choice today, often need confirmation by hybridisation of specific probes, melting curve analysis, or even-long read sequencing.
  • Many of the confirmation methods lack in performance, such as repro- ducibility, variability dependent on the performer, and lack of performance when it comes to communication of results between different laboratories. Accordingly, in a clinical situation, quick and accurate answers of whether a gram-positive bacterium is present, as well as the identity of the bacterium causing an infection or a potential future infection, is difficult to get today.
  • the invention provides a method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing the variable P10 and/or PlO.l region(s) of the rnpB-gene of the sample bacteria in a se- quencing-by-synthesis analysis, the analysis thereby resulting in a nucleotide pattern.
  • a sequencing-by-synthesis analysis By using a sequencing-by-synthesis analysis, a fast analysis is performed. Also, since the P10 and/or PlO.l regions of the mpB gene are used, the inventors have discovered that gram-positive bacteria may be inter-species differentiated.
  • the rnpB gene is composed by variable as well as conserved DNA sequences and for several genera, the frequency of positions with high nucleotide variation is higher in rnpB as compared with the 16S rRNA gene (Herrmann et al, J Clin Microbiol, 1996, 34: 1897-1902). Furthermore, the inventors have shown that rather short sequence stretches, approximately 20-50 nucleotides, are enough, or even preferred, for obtaining accurate typing data.
  • the inter-species differentiation and the genotyping information may thus be received in a single analysis/reaction, and may also be combined with the determination of various virulence factors, such as genes encoding encapsulation proteins or different toxins (endo and exotoxins, haemolysins) and genes conferring antibiotic resistance, such as vanA and mecA. Also, the results are readily communicated and show high intra-laboratory reproducibility.
  • Advantages by using the P10 and/or PlO.l regions are e.g. that (1) a PCR-fragment derived from this region gets a size that is suitable for a PyrosequencingTM-reaction, (2) within the fragment a variable sequence exists that varies in interesting gram- positive bacteria thus making it possible to distinguish between these, (3) the sequences are high-informative, i.e. it is not necessary to sequence a long stretch in order to get a species-specific sequence stretch, (4) by using these regions it is possible to construct primers that only amplifies gram positive and not gram negative bacteria, which is an advantage since you avoid problems of contaminations from the environment. This important since a plurality of PCR-cycles are performed which e.g.
  • the DNA sequences of the P10 and PlO.l regions of the rnpB gene is used to determine the bacterial species in a culture, such as either a liquid culture or a culture for which a gram stain has been carried out, but for which the species not yet has been identified.
  • This species identification strategy is used in an identifica- tion kit designed for a gram-positive panel of bacteria.
  • the specified regions may also be used in combination with additional primer sets, having different sequence specificities, to make a broader bacterial panel and potentially for bacterial species determination directly from a clinical specimen (i.e. blood, CSF, Sputum, or a swab from someone with a suspected respiratory infection of bacterial origin). Either of these tests can be used in conjunction with a panel for virulence factors or for antibiotic resistance markers.
  • Figure 1 shows the alignment of rnpB sequences from gram-positive bacteria.
  • Figure 2 is a table showing PCR amplification and DNA sequencing of the rnpB gene from gram-positive bacteria.
  • Figure 3 shows PyrosequencingTM technology results: DNA sequencing result from the rnpB gene of three gram-positive bacteria (top to bottom): Streptococcus pyogenes (AGAAGTACTTTGGCATATCAAACGACTTAGCCTTTCCTTCG, 41bases, quality scoring: passed), Staphylococcus aureus (AAATTACTCTATC- CATATCGAAAGACTTAGATATTCATTG, 40 bases, quality scoring: passed), and Enterococcus faecium (AAAGGATACTTAAG-
  • CATAGCCGAAGCCTTAGCTTGTTTTCCTGCCG 46 bases, quality scoring: passed).
  • the nucleotides were added in a cyclic fashion (CATG) and incorporation of a nucleotide is detected as a peak in the Pyrogram.
  • the sequence result is shown as a sequence string with a quality scoring (failed, check or passed).
  • Figure 4 shows a table of the discriminatory power of short-read rnpB sequences.
  • the rnpB DNA sequences (20, 30 and 40 bases) from three gram-positive bacteria were used in BLAST searches of GenBank. The hit result is given as the GenBank file found and the expect value, the probability of finding that sequence string by chance.
  • inter-species differentiation and identification is in the context of the invention meant the ability of an analysis method to distinguish between various species in a sample, and the ability to identify a specific bacterial organism.
  • sample is in the context of the invention meant any sample potentially com- prising gram-positive bacteria to be analysed by the method of the invention, and which is possible to analyse directly or indirectly (by cultivating the gram positive bacterium) by the method of the invention, such as a sample of blood, CSF (cerebro- spinal fluid), sputum or a swab from a patient with a suspected respiratory infection of bacterial origin.
  • the sample may be from a patient such as a human, or some other animal, such as a rat, mouse, dog, cat, cattle, sheep, horse or any other mammal, or it may be from a bacterial culture.
  • the invention refers to a method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing the vari- able P10 and/or PlO.l region(s) of the rnpB-gene of the sample bacteria in a sequencing-by-synthesis analysis, the analysis thereby resulting in a nucleotide pattern.
  • the main core of the invention is to provide a method for distinguishing and identifying gram-positive bacteria. This is performed by using the P 10 and/or PlO.l region(s) of the rnpB-gene as a diagnostic target in a sequencing-by-synthesis analysis.
  • the invention is based on the unexpected discovery of the inventors that the variable regions P10 and PlO.l are adequate to use for this differentiation and identification (see Example section).
  • an extension primer de- signed to extend in the P 10 and/or PlO.l region(s), is provided, and is allowed to bind to the bacterial sample DNA.
  • the primer is allowed to extend over the relevant region(s) in an extension reaction (in case of occurrence of gram-positive bacterial DNA in the sample), thereby resulting in a nucleotide pattern.
  • the nucleotide pattern represents a "signature" of the bacterial species in the sample.
  • this nucleotide pattern may be compared to a reference pattern, in an automated fashion, in order to determine the exact identity of the bacterial sample.
  • the gram-positive bacteria may be any gram-positive bacteria, comprising the bacteria of section 12 (Gram-Positive Cocci), 13 (Endospore-Forming Gram-Positive Rods and Cocci), 14 (Regular, Nonsporing, Gram-Positive Rods), 15 (Irregular,
  • Nonsporing, Gram-Positive Rods), 16 (The Mycobacteria), and 17 (Nocardioforms) of Bergeys Manual of Systematic Bacteriology (edited by Holt and Krieg, 1984- 1989).
  • the bacterias within the Genera Staphylococcus, Streptococcus and Enterococcus (in a newer edition of Bergeys Manual, Enterococci have been classi- fied in an own Genera) are most suitable for identification with the method of the present invention.
  • Examples of various gram-positive species of interest for analysis with the method of the invention comprise for example: of genera Staphylococci: S. epidermis; of genera Streptococcus: S. pyogenes, S. pneumoniae, S. faecalis and S. agalactiae; and of genera Enterococci: E. faecalis and E. faecium.
  • the most preferred gram-positive bacteria to identify with the present method are chosen from the genera Enterococci, Staphylococci and Streptococci.
  • the ubiquitous RnaseP enzyme is responsible for maturation of small RNA species, such as tRNA.
  • the enzyme consists of a 120 amino acid protein subunit and an RNA subunit, Ml, encoded by the single-copy approximately 400 bp rnpB gene (Stark et al., Proc Nat Acad Sci USA, 1978, 75:3717-3721).
  • the gene is com- posed by variable as well as conserved DNA sequences and for several genera, the frequency of positions with high nucleotide variation is higher in rnpB as compared with the 16S rRNA gene (Herrmann et al., J Clin Microbiol, 1996, 34: 1897-1902).
  • the inventors of the present invention have succeeded in showing that the P10 and/or PlO.l region(s) (Haas et al. (Nucleic Acids Research; 1996; 24:4775-4782)) of the Rnase P DNA can be used to identify gram-positive bacteria.
  • bases 61-173 is used as the variable diagnostic target region
  • bases 45-60 is a conserved region, which is used for a forward PCR-primer
  • bases 217-237 is a conserved region, that is used for a reverse PCR-primer
  • bases 174-188 is a con- served region, that is used for a reverse sequence primer.
  • extension primers are meant primers that are able to anneal to the nucleic acid molecule, and which allows incorporation of nu- cleotides at their 3 '-end.
  • An extension primer bind to the target nucleic acid at a predetermined site, each primer binding site being different, so that multiple different primer extension reactions are performed.
  • the extension primers are designed or selected so that their extension products overlap (or comprise) a site (e.g. a locus or region) of sequence variability (i.e. genetic variation) in the target nucleic acid.
  • the primers bind to the target nucleic acid at, or near to (e.g. within 1 to 40, 1 to 20, 1 to 10, 1 to 6, or 1 to 3 bases of), a variable site.
  • a variable site constitutes the genotype of the target nucleic acid.
  • the extension primer for the sequencing-by-synthesis analysis is according to the invention designed to be extendable in the region between nucleotide 61 and nucleotide 173 of the rnpB-gene (SEQ ID NO l).
  • Sequence-by-synthesis refers to sequencing methods, which rely on the detection of nucleotide incorporation during a primer-directed polymerase extension reaction.
  • the four different nucleotides i.e. A, G, T or C nucleotides
  • A, G, T or C nucleotides are added cyclically or sequentially (conveniently in a known order), and the event of incorpora- tion can be detected in various ways, directly or indirectly. This detection reveals which nucleotide has been incorporated, and hence sequencing information.
  • base which forms a pair (according to the normal rules of base- pairing, A-T and C-G) with the next base in the template target sequence, is added, it will be incorporated into the growing complementary strand (i.e. the extended primer) by the polymerase, and this incorporation will trigger a detectable signal, the nature of which is dependent upon the detection strategy selected.
  • the primer extension reactions conveniently may be performed by sequentially adding the nucleotides to the reaction mixture (i.e. a polymerase, and primer/template mixture).
  • the different nucleotides are added in known order, and preferably in a pre-determined order. As each nucleotide is added, it may be determined whether or not nucleotide incorporation takes place.
  • the "nucleotide pattern” is the product/result of the sequencing-by-synthesis analy- sis.
  • the nucleotide pattern represents the order in which nucleotides are incorporated in the primer extension reaction.
  • the nucleotide pattern is represented by a Pyrogram.
  • amplification primers are designed and used, which primers are designed to be suitable for producing the desired nu- cleic acid molecule.
  • the amplification primer(s) may be used as extension primer(s).
  • sequence and length of the amplification and extension primers will depend on the sequence of the target nucleic acid, the desired length of the product, the possible further functions of the primer (i.e. for immobilisation) and the method used for amplification and/or extension.
  • extension primers will bind near (e.g. within 1-40, 1-20, 1-10 or 1- 6, preferably within 1-3 bases), substantially adjacent to the variable site of the target nucleic acid and will be complementary to a conserved or semi-conserved region of the nucleic acid.
  • the "primer extension” reaction includes all forms of template-directed polymerase-catalysed nucleic acid synthesis reactions. Conditions and reagents for primer extension reactions are well known in the art, and any of the standard methods, reagents and enzymes etc. may be used in this step (see e.g. Sam- brook et al., (eds), Molecular Cloning: a laboratory manual (1989), Cold Spring Harbor Laboratory Press).
  • the primer extension reaction at its most basic is carried out in the presence of primer, deoxynucleotides (dNTPs) and a suitable polymerase enzyme e.g. T7 polymerase, Klenow or Sequenase Ver 2.0 (USB USA), or indeed any suitable available polymerase enzyme.
  • dNTPs deoxynucleotides
  • a suitable polymerase enzyme e.g. T7 polymerase, Klenow or Sequenase Ver 2.0 (USB USA), or indeed any suitable available polymerase enzyme.
  • RNA template reverse transcript
  • the primer is subjected to a primer extension reaction in the presence of a nu- cleotide, whereby the nucleotide is only incorporated if it is complementary to the base immediately adjacent (3') to the primer position.
  • the nucleotide may be any nucleotide capable of incorporation by a polymerase enzyme into a nucleic acid chain or molecule.
  • the nucleotide may be a deoxynucleotide (dNTP, deoxynucleoside triphosphate) or dideoxynucleotide (ddNTP, dideoxynucleoside triphosphate).
  • nucleotides may be used in the primer extension reaction: guanine (G), cytosine (C), thymine (T) or adenine (A) deoxy- or dideoxynucleotides. Therefore, the nucleotide may be dGTP (deoxyguanosine triphosphate), dCTP (deoxycytidine triphosphate), dTTP (deoxythymidine triphosphate) or dATP (deoxyadenosine triphopshate). Suitable analogues of these nucleotides may also be dye-labelled n.t, such as dye-dNTP, dye-ddNTP or the recently described dye-SS- dNTP (WOOO/53812).
  • Dideoxynucleotides may also be used in the primer extension reaction.
  • the term "dideoxynucleotide” as used herein includes all 2'- deoxynucleotides in which the 3'-hydroxyl group is modified or absent. Dideoxynucleotides are capable of incorporation into the primer in the presence of the poly- merase, but cannot enter into a subsequent polymerisation reaction, and thus function as a chain terminator.
  • reagents are optionally included in the primer extension reaction, such as those reagents, which are normally used for protocols of this kind. Normally, for instance, a polymerase enzyme is included.
  • suitable and necessary reagents will be obvious from the Example section of this text.
  • PCT/GB01/64042 describes various modifications and explanations concerning the methods and the reagents used in this invention. This document is hereby incorporated as reference.
  • nucleotides In order to be able to type more than one variable site in one reaction using more than one extension primer, it is important to choose the addition of nucleotides in such a way, that signals from different variable sites are not obtained simultaneously. In one embodiment, this may be achieved by, from a known sequence, adding the nucleotides to the reaction mix in a predetermined order. PyrosequencingTM is a sequencing method developed at the Royal Institute of Technology in Sweden (Ronaghi et al.,1998, Alderborn et al.,2000). The method is based on "sequencing by synthesis" in which, in contrast to conventional Sanger se- quencing, the nucleotides are added one by one during the sequencing reaction.
  • An automated sequencer the PSQ96TM instrument, has recently been launched by Pyrosequencing AB (Uppsala, Sweden).
  • Pyrosequencing AB Uppsala, Sweden.
  • the principle of the PyrosequencingTM technology A single stranded DNA fragment (attached to a solid support), carrying an annealed sequencing primer acts as a template for the PyrosequencingTM reaction.
  • substrate and enzyme mixes are added to the template.
  • the enzyme mix consists of four different enzymes; DNA polymerase, ATP- Sulfurylase, Luciferase and Apyrase.
  • the nucleotides are sequentially added one by one according to a specified order dependent on the template and determined by the user.
  • the DNA polymerase will incorporate it into the growing DNA strand.
  • pyrophosphate PP i5 will be released.
  • the ATP-Sulfurylase converts the PPi into ATP
  • Luciferase transforms the ATP into a light signal.
  • the fourth enzyme, Apyrase will degrade the excess nucleotides and ATPs, and the template will at that point be ready for the next reaction cycle, i.e. another nucleo- tide addition.
  • the complete enzymatic reactions (Nyren,1987, Karamohamed,1999) are shown in fig 1.
  • the PSQ 96 Instrument has been developed by Pyrosequencing AB (Uppsala, Sweden) in order to automate the sequencing reaction and to monitor the light release.
  • the PSQ 96 Instrument software presents the results as peaks in a pyrogramTM, where the height of the peaks corresponds to the number of nucleotides incorporated.
  • Dedicated softwares have been developed for SNP analysis, sequencing of shorter DNA stretches (20-50 bases), and assessment of allele frequencies. Compared to other techniques used for SNP analysis, for example hybridisation techniques, minisequencing, RFLP and SSCP, sequencing-by-synthesis presents some strong advantages.
  • Another advantage is the flexibility in primer design, i.e. the primer can be situated up to 15 nucleotides from the polymorphism, where it in minisequencing has to lay adjacent to the polymorphic site.
  • it is a rapid technique, which is a benefit compared to SSCP and RFLP.
  • the rapidity is also the main advantage compared to Sanger sequencing, when this technique is used for sequencing of shorter DNA stretches.
  • Another advantage with sequencing-by-synthesis versus Sanger sequencing is that the first base directly after the extension primer can be read with high accuracy.
  • PyrosequencingTM is a real time DNA sequencing method based on sequencing-by- synthesis. The method is proved to be a fast and accurate method for SNP (single nucleotide polymorphism) scoring, sequencing of shorter DNA stretches (signature tags), and assessment of allele frequencies.
  • Pyrosequencing AB manufactures the PSQTM 96 and the PTP Systems for low and high throughput genotyping, respectively, as well as dedicated softwares for automatic delivery of genotype and a quality assessment for each sample. A major advantage with those Systems is the combination of accuracy, speed and ease-of-use.
  • the sequencing-by-synthesis analysis is a PyrosequencingTM analysis.
  • the inventors have shown that advantageously a sequence stretch of from 20 to 50 nucleotides of the variable region(s) P10 and or PlO.l of the rnpB-gene is determined in the PyrosequencingTM reaction, since this length results in the most accurate results.
  • more than one extension reaction is performed in the same reaction vessel. In order to perform several extension reactions in one reaction vessel, more than one extension primer must be used. Thus more than one variable site or region of interest may be typed and/or identified in the same reaction.
  • multiple extension reactions are controlled by choosing the dispensation order of the nucleotides in the reaction in such a way that the resulting sequencing-by-synthesis analysis data is easily interpretable. For instance, the dispensation order may be chosen so that one of the primers is extended over its interesting region, while the other is practically kept unextended.
  • the method of the invention also comprises the determination of at least one virulence factor, such as some kind of drug resistance or susceptibility to acquire a disease or infection, or a gene encoding encapsulation proteins or different toxins (end and exotoxins, haemolysins) and genes conferring antibiotic resistance, such as vanA and mecA. For instance, the antibiotic resistance status of the sample is determined.
  • at least one virulence factor such as some kind of drug resistance or susceptibility to acquire a disease or infection, or a gene encoding encapsulation proteins or different toxins (end and exotoxins, haemolysins) and genes conferring antibiotic resistance, such as vanA and mecA.
  • VRE vankomycin-resistant enterococci
  • Enterococci cause UTI, bacteremia, wound, ab- dominal-pelvic infections and endocarditis.
  • Minor infections can usually be treated by antibiotics, such as penicillins, macrolides or tetracyclines.
  • antibiotics such as penicillins, macrolides or tetracyclines.
  • penicillins, or teicoplanin and vancomycin are reliably effective against serious en- terococcal infections such as endocarditis or meningitis.
  • Serious infections often need prolonged treatment, usually with several antibiotics being given together by injection.
  • VRE vancomycin-resistant enterococcus
  • the method of the invention is directed to determination of all the antibiotics resistance variants mentioned above, as well as other variants.
  • the method of the invention comprises that the amount of the gram-positive bacteria that is present in the sample is quantified.
  • the treatment of patient having a bacterium that is present in the sample of the patient may be optimised by for example adjusting the dosage of the antibiotics used for treatment of the patient. For instance, this may be performed by using a competitive PCR and analysis of peak heights for the output of the sequencing by synthesis analysis.
  • the nucleotide pattern obtained in the sequencing-by- synthesis analysis is used for an alignment analysis, in order to determine the bacte- rial origin of the nucleotide pattern. This may be done by using the BLAST search engine, for instance by using Genbank.
  • the nucleotide pattern is compared to a refer- ence pattern, in order to determine the bacterial origin of the nucleotide pattern.
  • Such a reference pattern may for instance be a database comprising data of various gram-positive bacterial nucleotide sequences. It may also be a nucleotide sequence that for other reasons is relevant or interesting to compare to the nucleotide pattern.
  • the comparison of the nucleotide pattern and the reference pattern is performed by:
  • the origin of the bacterial sample is identified, if present in the database.
  • the transmission and retrieval of data to and from the database is performed by conventional means, which would be known to the skilled person in the art.
  • the database is "The rnpB gene database", which is accessible from Genbank.
  • the invention refers to a kit for performing the identification and inter-species determination of the method of the invention, comprising at least one extension primer designed to be extendable in the region between nucleotide 61 and nucleotide 173 of the rnpB-gene, and amplification primers adapted for amplifying said region of the rnpB-gene.
  • the extension primer is STR:12R122 (SEQ ID NO:2) (see example section).
  • the amplification primers are preferably STP:45U18 (SEQ ID NO:3) (forward) and STR:219L16 (SEQ ID NO:4) (reverse).
  • the kit further comprises means for determining the antibiotic resistance status of the sample.
  • means for determining the antibiotic resistance status of the sample may be an extension primer and amplification primers, specifically adapted for a region in the bacterial genome, that is linked to the occurrence of antibiotic resistance.
  • Example 1 Alignment of the rnpB DNA sequences from gram-positive bacteria
  • DNA rnpB sequences were collected from NCBI and the RNaseP RNA database (Brown, 1999; http://www.mbio.ncsu.edu/RNaseP/home .html) and aligned using Multialin (Corpet, 1988; http://prodes.toulouse.inra.fr/multalin/multalin.html).
  • a variable DNA region flanked by conserved regions was targeted in PCR amplification and analysis by PyrosequencingTM technology ( Figure 1).
  • Genomic DNA from gram-positive bacteria obtained from the laboratory of Dr. Gary Procop at the Cleveland Clinic was used in PCR amplification of the rnpB tar- get.
  • One common reverse primer (STR: 219L16: 5'-GGTTTACCGCGTTCCA-3'; Figure 1) was used in all PCR reactions. This oligonucleotide was used in PCR with different forward primers, yielding different levels of specificity in the amplification reactions.
  • One generic primer, STP:45U22w (5'- Biotin - GAGGAAAGTCCATGCTCA/GCACA-3'), yielded PCR products from species of all three genera.
  • Pediococcus pentosus (CCFGP2), Leuconostoc mesenteroides (CCFGP 3), Stomatococcus sp (CCFGP4), Micrococcus sp. (CCFGP 5), Bacillus circulans (CCFGP25), Bacillus cereus (CCFGP26), Bacillus subtilis (CCFGP27), Bacillus sp (CCFGP28), Lactobacillus casei (CCFGP 29) and Listeria monocytogenes (CCFGP30).
  • PCR primers STP: 45U17 (5'- Biotin- GAGGAAAGTCCATGC TC-3') and STR: 219L16 were fully or nearly complementary to the rnpB genes from Bacillus, Listeria and Lactococcus species and therefore should have been able to amplify this gene in PCR. It is not clear why no amplification product was obtained in these cases, but it could be due to insufficient lysis of the bacteria in the DNA preparation.
  • the rnpB sequences from Micro- coccus ox Lactobacillus species were not compatible with any of the chosen oligo- nucleotides (data not shown).
  • the PCR products were prepared for sequencing by denaturation and preparation of the biotin-labeled single strand.
  • the same sequencing primer STR: 12R122 (5'- GTCACTGTGGCACTTTC -3'; Figure 1) was used in single-stranded PCR ampli- cons.
  • a cyclic dispension of nucleotides (ACGT) was used in PyrosequencingTM experiments.
  • the DNA sequence read-out, together with the data (Pyrogram) is provided automatically by the SQA software together with a quality scoring (see Figure 3).
  • the DNA sequences obtained of some of the templates e.g. S. viridans CCFGP23, figure 2 were generated from somewhat low peaks in the pyrograms. In these cases, the software reports the results with a quality score of "check", to inform the user that the sequencing reaction was sub-optimal. In most such cases, the sequencing quality is increased by optimisation of the PCR amplification preceding the sequencing reaction.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention refers to a method and a kit for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing the variable region(s) P10 and/or P10.1 of the rnpB-gene of the sample bacteria in a sequencing-by-synthesis analysis, the analysis thereby resulting in a nucleotide pattern. Hereby, bacterial identification of clinically relevant gram-positive bacteria is performed in a quick and accurate way, since typing of the rnpB-gene in combination with sequencing-by-synthesis provides an improved method in this technical field

Description

A method for inter-species differentiation and identification of a gram-positi e bacteria.
Technical field
The invention refers to a method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing a relevant variable regions), used as a diagnostic target, the analysis thereby resulting in a nucleotide pattern. Also, the invention refers to a kit specifically adapted for the method of the invention.
Technical background
Gram-positive bacteria, in contrast to gram-negative bacteria, are the types of bacteria that have the ability to retain crystal violet when decolorized with an organic solvent such as ethanol. The reason for this difference between gram-positive and gram-negative bacteria is the composition of the cell wall. The thick, homogenous cell wall of gram-positive bacteria is composed primarily of peptidoglycan, often containing a peptide interbridge. Some of the most feared human pathogens causing diseases like bacteremia, abdominal-pelvic infections and endocarditis are within the Gram-positive group of bacteria. Gram-positive bacteria are important human pathogens. They are an increasingly common cause of infection, particularly serious nosocomal infections and predominate in surgical wound infections (Jarvis and Martone, J Antimicrob Ther, 1992, Apr, 29 Suppl A: 19-24).
Staphylococci are responsible for a wide spectrum of medical conditions ranging from food poisoning to potentially life threatening infections such as septicaemia and toxic shock syndrome (TSS). Coagulase-negative staphylococci (S. epidermis) have emerged as a major cause of infection and are among the most commonly isolated bacteria in clinical microbiology laboratories. Infections by S. epidermis are particularly common in hospitalised patients with indwelling foreign bodies and immuno-compromised patients . The genus Streptococcus contains human pathogenic species including S. pyogenes, S. Pneumoniae and S. faecalis. Group A streptocooci, S pyogenes, cause pharyngitis ("strep throat"), scarlet fever, rheumatic fever, nephritis and impetigo, whereas the group B streptococci (S. agalactiae) cause neonatal meningitis and septicaemia after transmission from the normal vaginal flora of the mother.
Enterococci were previously grouped within the Group D streptococci but are now their own genus. Currently, enterococci infections account for a high number of no- cosomal infections, second only to Eschericia coll. The most commonly isolated is E. faecalis, found in the gut flora. This pathogen is a significant cause of urinary tract infections and opportunistic infections, including intra-abdominal, septicaemia and endocarditis. Enterococcus faecium is a major concern for the medical community, since it often carries resistance to several types of antibiotics including quinolones and amino-glyosides. For this reason, E. faecium is often dubbed a "supergerm".
In order to control microbial infections, various kinds of antibiotics are used, which have the capacity to kill susceptible microorganisms or at least prevent their growth. Unfortunately, however, many microorganisms, not the least many gram-positive bacteria that are of high clinical relevance, have become resistant to various types of antibiotics. This is a huge problem, not only since this raises a demand for new types of antibiotics and higher dosages, but also since it makes it extremely important, in a clinical situation, to get information about the nature of the infection from a patient suffering from, or potentially suffering from, a bacterial infection. In many cases this information must be found rapidly and very accurately, which puts high demands on the technology for identifying the bacteria. The more information the identification technology reveals about the presence or absence of an infection, the nature of the infection, the genetic identity of the infecting microorganism, the possible antibiotic resistance, and other virulence factors, the more valuable the tech- nology will be in a clinical situation. Currently, several techniques exist for bacterial identification. DNA-based identification and typing methods are becoming increasingly important for the characterization of bacterial pathogens. Conventional methods based on biochemcial proper- ties and phenotypic qualities of clinical isolates are often time-consuming and sometimes fail due to variations in morphology, metabolic status and interpretation. For instance, various hybridisation assays may be used to identify bacteria (for example: PCR and RT-PCR, branched DNA (bDNA) technology, Ligase Chain Reaction Nucleic Acid Amplification (LCR), Probe-Hybridisation Assays, RF-SBH (re- striction fragment- Southern blot hybridisation, liquid-phase hybridisation (LPH), in situ hybridisation, and integrated PCR and Probe-hybridisation assays). Assays of this type often need specific substances for being able to detect a signal. The clinical probes are most often labeled with non-radioisotopic molecules such as digoxigenin, alkaline phosphatase, biotin, or a fluorescent compound. The detection systems are conjugate dependent and include chemiluminescent, fluorescent, and colorimetric methodologies. These may for example be PCR-based and use a specific detection method after the PCR step, such as a melting point analysis. One problem with techniques of this kind it that it is difficult to be sure that not a contaminant is the cause for the positive signal, i.e. a contaminant may amplified in the PCR reaction. Also, assays based on the principle of molecular beacons exist. Common for these assays is that they, when used for identifying a bacterium in a sample, result in a signal of the presence or absence of the bacteria. However, no information is given concerning the genotype of the identified bacteria. Thus, techniques of this kind have no capacity to distinguish between various bacterial species, or to reveal genetic varia- tions within a bacterial species. Still, various tests exist, having the ability to give a species-specific answer. Yet, no assay is available having to ability to test for a plurality of species within one test.
In order to be able to distinguish between species or to reveal genetic variations within a bacterial species, nucleotide sequence information must often be given (if not a phenotypic test is used, which has the capacity to give detailed information, such as species determination). For example, this may be done using a conventional Sanger-sequencing protocol, which has been commercialized by ABI (www.appliedbiosystems.com), whereby a region of at least a few hundred nucleo- tides normally is required. However, by using this technology, a rather large genetic region (typically 500-1500 base pairs) is normally analysed in order to type the bacteria. An analysis of this type puts high demands in form of personnel capacity, time and money.
Thus, DNA-based identification methods enhances the abilities of the microbiolo- gist to quickly determine the identity of a bacterial isolate and genotyping has proven useful in epidemiological investigations and infection control. Since only short regions of the chromosome are targeted in DNA sequencing, care must be applied on the choice of region targeted. The region of choice must contain conserved DNA sequences, which can be targeted in PCR amplification of all, or many, of the genus members and closely located variable DNA sequences, which are read in the sequencing reaction.
WOO 1/51662 discloses a method for detection of pathogenic organisms, which method includes the inter-species differentiation between species. The method is directed towards the use of the variable P3 and/or P19 regions of the Rnase P RNA gene for as a diagnostic target. It is disclosed that the region(s) is (are) amplified and sequenced or otherwise fingerprinted using heteroduplex analysis, size determination, RFLP or melting point determination. The P3 and/or P19 regions were espe- cially useful for identification of mycobacterial and chlamydial species.
US-A-5574145 discloses amplification using general primers for genes, such as 16S and Rnase P. After the amplification, sequencing is performed in order to be able to construct an art specific probe. The probe is subsequently used for hybridisation. Thus, this disclosure provides a hybridisation-based analysis method. To summarise, currently there is a further need for bacterial identification methods, making it possible to quickly and accurately identify clinically important gram- positive bacteria. Among others, the cost and the specificity of the current methods are often a drawback. Also, the known methods are either slow or require the sequencing of large genetic regions, or they do not reveal enough information about the genetic type of the infected organism or of important virulence factors. Also, PCR-based assays, which often is the method of choice today, often need confirmation by hybridisation of specific probes, melting curve analysis, or even-long read sequencing. Many of the confirmation methods lack in performance, such as repro- ducibility, variability dependent on the performer, and lack of performance when it comes to communication of results between different laboratories. Accordingly, in a clinical situation, quick and accurate answers of whether a gram-positive bacterium is present, as well as the identity of the bacterium causing an infection or a potential future infection, is difficult to get today.
Thus, there is a need for providing a method that solves the problems posed above, and this is also the purpose of the present invention.
Summary of the invention
In a first aspect, the invention provides a method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing the variable P10 and/or PlO.l region(s) of the rnpB-gene of the sample bacteria in a se- quencing-by-synthesis analysis, the analysis thereby resulting in a nucleotide pattern.
By using a sequencing-by-synthesis analysis, a fast analysis is performed. Also, since the P10 and/or PlO.l regions of the mpB gene are used, the inventors have discovered that gram-positive bacteria may be inter-species differentiated. The rnpB gene is composed by variable as well as conserved DNA sequences and for several genera, the frequency of positions with high nucleotide variation is higher in rnpB as compared with the 16S rRNA gene (Herrmann et al, J Clin Microbiol, 1996, 34: 1897-1902). Furthermore, the inventors have shown that rather short sequence stretches, approximately 20-50 nucleotides, are enough, or even preferred, for obtaining accurate typing data. The inter-species differentiation and the genotyping information may thus be received in a single analysis/reaction, and may also be combined with the determination of various virulence factors, such as genes encoding encapsulation proteins or different toxins (endo and exotoxins, haemolysins) and genes conferring antibiotic resistance, such as vanA and mecA. Also, the results are readily communicated and show high intra-laboratory reproducibility.
Advantages by using the P10 and/or PlO.l regions are e.g. that (1) a PCR-fragment derived from this region gets a size that is suitable for a Pyrosequencing™-reaction, (2) within the fragment a variable sequence exists that varies in interesting gram- positive bacteria thus making it possible to distinguish between these, (3) the sequences are high-informative, i.e. it is not necessary to sequence a long stretch in order to get a species-specific sequence stretch, (4) by using these regions it is possible to construct primers that only amplifies gram positive and not gram negative bacteria, which is an advantage since you avoid problems of contaminations from the environment. This important since a plurality of PCR-cycles are performed which e.g. is sequenced by Pyrosequencing™. (5) In contrast to hybridisation based technologies (such as US-A-5574145), the number of steps of the analysis method is reduced, and the problems inherited in hybridisation-based methods, i.e. that the probe binds to the correct position (i.e. that all conditions at hybridisation are optimal for specific hybridisation) is avoided in the method of the invention. Also (6), in relation to e.g. US-A-5574145, a smaller number of samples generally need to be analysed in order to distinguish between species. Accordingly, the DNA sequences of the P10 and PlO.l regions of the rnpB gene is used to determine the bacterial species in a culture, such as either a liquid culture or a culture for which a gram stain has been carried out, but for which the species not yet has been identified. This species identification strategy is used in an identifica- tion kit designed for a gram-positive panel of bacteria. The specified regions may also be used in combination with additional primer sets, having different sequence specificities, to make a broader bacterial panel and potentially for bacterial species determination directly from a clinical specimen (i.e. blood, CSF, Sputum, or a swab from someone with a suspected respiratory infection of bacterial origin). Either of these tests can be used in conjunction with a panel for virulence factors or for antibiotic resistance markers.
Short description of the drawings
Figure 1 shows the alignment of rnpB sequences from gram-positive bacteria.
Figure 2 is a table showing PCR amplification and DNA sequencing of the rnpB gene from gram-positive bacteria.
Figure 3 shows Pyrosequencing™ technology results: DNA sequencing result from the rnpB gene of three gram-positive bacteria (top to bottom): Streptococcus pyogenes (AGAAGTACTTTGGCATATCAAACGACTTAGCCTTTCCTTCG, 41bases, quality scoring: passed), Staphylococcus aureus (AAATTACTCTATC- CATATCGAAAGACTTAGATATTCATTG, 40 bases, quality scoring: passed), and Enterococcus faecium (AAAGGATACTTAAG-
CATAGCCGAAGCCTTAGCTTGTTTTCCTGCCG, 46 bases, quality scoring: passed). In the experiment, the nucleotides were added in a cyclic fashion (CATG) and incorporation of a nucleotide is detected as a peak in the Pyrogram. The sequence result is shown as a sequence string with a quality scoring (failed, check or passed). Figure 4 shows a table of the discriminatory power of short-read rnpB sequences. The rnpB DNA sequences (20, 30 and 40 bases) from three gram-positive bacteria were used in BLAST searches of GenBank. The hit result is given as the GenBank file found and the expect value, the probability of finding that sequence string by chance.
Detailed description of the invention
By "inter-species differentiation and identification" is in the context of the invention meant the ability of an analysis method to distinguish between various species in a sample, and the ability to identify a specific bacterial organism.
By a "sample" is in the context of the invention meant any sample potentially com- prising gram-positive bacteria to be analysed by the method of the invention, and which is possible to analyse directly or indirectly (by cultivating the gram positive bacterium) by the method of the invention, such as a sample of blood, CSF (cerebro- spinal fluid), sputum or a swab from a patient with a suspected respiratory infection of bacterial origin. The sample may be from a patient such as a human, or some other animal, such as a rat, mouse, dog, cat, cattle, sheep, horse or any other mammal, or it may be from a bacterial culture.
In a first aspect, the invention refers to a method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing the vari- able P10 and/or PlO.l region(s) of the rnpB-gene of the sample bacteria in a sequencing-by-synthesis analysis, the analysis thereby resulting in a nucleotide pattern.
Thus, the main core of the invention is to provide a method for distinguishing and identifying gram-positive bacteria. This is performed by using the P 10 and/or PlO.l region(s) of the rnpB-gene as a diagnostic target in a sequencing-by-synthesis analysis. The invention is based on the unexpected discovery of the inventors that the variable regions P10 and PlO.l are adequate to use for this differentiation and identification (see Example section). To perform the invention, an extension primer, de- signed to extend in the P 10 and/or PlO.l region(s), is provided, and is allowed to bind to the bacterial sample DNA. The primer is allowed to extend over the relevant region(s) in an extension reaction (in case of occurrence of gram-positive bacterial DNA in the sample), thereby resulting in a nucleotide pattern. The nucleotide pattern represents a "signature" of the bacterial species in the sample. Moreover, this nucleotide pattern may be compared to a reference pattern, in an automated fashion, in order to determine the exact identity of the bacterial sample.
The gram-positive bacteria may be any gram-positive bacteria, comprising the bacteria of section 12 (Gram-Positive Cocci), 13 (Endospore-Forming Gram-Positive Rods and Cocci), 14 (Regular, Nonsporing, Gram-Positive Rods), 15 (Irregular,
Nonsporing, Gram-Positive Rods), 16 (The Mycobacteria), and 17 (Nocardioforms) of Bergeys Manual of Systematic Bacteriology (edited by Holt and Krieg, 1984- 1989). However, the bacterias within the Genera Staphylococcus, Streptococcus and Enterococcus (in a newer edition of Bergeys Manual, Enterococci have been classi- fied in an own Genera) are most suitable for identification with the method of the present invention.
Examples of various gram-positive species of interest for analysis with the method of the invention comprise for example: of genera Staphylococci: S. epidermis; of genera Streptococcus: S. pyogenes, S. pneumoniae, S. faecalis and S. agalactiae; and of genera Enterococci: E. faecalis and E. faecium.
The most preferred gram-positive bacteria to identify with the present method are chosen from the genera Enterococci, Staphylococci and Streptococci. The ubiquitous RnaseP enzyme is responsible for maturation of small RNA species, such as tRNA. In bacteria, the enzyme consists of a 120 amino acid protein subunit and an RNA subunit, Ml, encoded by the single-copy approximately 400 bp rnpB gene (Stark et al., Proc Nat Acad Sci USA, 1978, 75:3717-3721). The gene is com- posed by variable as well as conserved DNA sequences and for several genera, the frequency of positions with high nucleotide variation is higher in rnpB as compared with the 16S rRNA gene (Herrmann et al., J Clin Microbiol, 1996, 34: 1897-1902).
The inventors of the present invention have succeeded in showing that the P10 and/or PlO.l region(s) (Haas et al. (Nucleic Acids Research; 1996; 24:4775-4782)) of the Rnase P DNA can be used to identify gram-positive bacteria. Specifically, bases 61-173 is used as the variable diagnostic target region, bases 45-60 is a conserved region, which is used for a forward PCR-primer, bases 217-237 is a conserved region, that is used for a reverse PCR-primer, and bases 174-188 is a con- served region, that is used for a reverse sequence primer. All base numberings refer to the rnpB sequence of Streptococcus pneumoniae (SEQ ID NO:l) as given in the Rnase P database (http://www.mbio.ncsu.edu/RnaseP/home.html). This sequence (SEQ ID NO.l) is the RNA sequence corresponding to the DNA sequence, which is used as the target in the method of the invention.
For the sequencing-by-synthesis analysis (see e.g. US-A-4863849), a primer extension reaction must be performed. By "extension primers" are meant primers that are able to anneal to the nucleic acid molecule, and which allows incorporation of nu- cleotides at their 3 '-end. An extension primer bind to the target nucleic acid at a predetermined site, each primer binding site being different, so that multiple different primer extension reactions are performed. The extension primers are designed or selected so that their extension products overlap (or comprise) a site (e.g. a locus or region) of sequence variability (i.e. genetic variation) in the target nucleic acid. In other words, the primers bind to the target nucleic acid at, or near to (e.g. within 1 to 40, 1 to 20, 1 to 10, 1 to 6, or 1 to 3 bases of), a variable site. Such a variable site constitutes the genotype of the target nucleic acid. The extension primer for the sequencing-by-synthesis analysis is according to the invention designed to be extendable in the region between nucleotide 61 and nucleotide 173 of the rnpB-gene (SEQ ID NO l).
"Sequencing-by-synthesis" refers to sequencing methods, which rely on the detection of nucleotide incorporation during a primer-directed polymerase extension reaction. The four different nucleotides (i.e. A, G, T or C nucleotides) are added cyclically or sequentially (conveniently in a known order), and the event of incorpora- tion can be detected in various ways, directly or indirectly. This detection reveals which nucleotide has been incorporated, and hence sequencing information. When the nucleotide (base), which forms a pair (according to the normal rules of base- pairing, A-T and C-G) with the next base in the template target sequence, is added, it will be incorporated into the growing complementary strand (i.e. the extended primer) by the polymerase, and this incorporation will trigger a detectable signal, the nature of which is dependent upon the detection strategy selected.
The primer extension reactions conveniently may be performed by sequentially adding the nucleotides to the reaction mixture (i.e. a polymerase, and primer/template mixture). Advantageously, the different nucleotides are added in known order, and preferably in a pre-determined order. As each nucleotide is added, it may be determined whether or not nucleotide incorporation takes place.
The "nucleotide pattern" is the product/result of the sequencing-by-synthesis analy- sis. The nucleotide pattern represents the order in which nucleotides are incorporated in the primer extension reaction. In a Pyrosequencing™ reaction, the nucleotide pattern is represented by a Pyrogram.
In order to perform the invention, it may be advantageous or convenient to first am- plify the nucleic acid molecule by any suitable amplification method known in the art, such as PCR. This technique and modifications of it are well known for the skilled person in the art. Also, several sequences may need to be amplified in order to perform the invention. For the amplification, amplification primers are designed and used, which primers are designed to be suitable for producing the desired nu- cleic acid molecule. The amplification primer(s) may be used as extension primer(s).
The sequence and length of the amplification and extension primers will depend on the sequence of the target nucleic acid, the desired length of the product, the possible further functions of the primer (i.e. for immobilisation) and the method used for amplification and/or extension.
Advantageously, extension primers will bind near (e.g. within 1-40, 1-20, 1-10 or 1- 6, preferably within 1-3 bases), substantially adjacent to the variable site of the target nucleic acid and will be complementary to a conserved or semi-conserved region of the nucleic acid.
The "primer extension" reaction according to the invention includes all forms of template-directed polymerase-catalysed nucleic acid synthesis reactions. Conditions and reagents for primer extension reactions are well known in the art, and any of the standard methods, reagents and enzymes etc. may be used in this step (see e.g. Sam- brook et al., (eds), Molecular Cloning: a laboratory manual (1989), Cold Spring Harbor Laboratory Press). Thus, the primer extension reaction at its most basic is carried out in the presence of primer, deoxynucleotides (dNTPs) and a suitable polymerase enzyme e.g. T7 polymerase, Klenow or Sequenase Ver 2.0 (USB USA), or indeed any suitable available polymerase enzyme. For an RNA template, reverse transcriptase may be used. Conditions may be chosen with regard to well-known procedures in the art.
Thus, the primer is subjected to a primer extension reaction in the presence of a nu- cleotide, whereby the nucleotide is only incorporated if it is complementary to the base immediately adjacent (3') to the primer position. The nucleotide may be any nucleotide capable of incorporation by a polymerase enzyme into a nucleic acid chain or molecule. For example, the nucleotide may be a deoxynucleotide (dNTP, deoxynucleoside triphosphate) or dideoxynucleotide (ddNTP, dideoxynucleoside triphosphate). Thus, the following nucleotides may be used in the primer extension reaction: guanine (G), cytosine (C), thymine (T) or adenine (A) deoxy- or dideoxynucleotides. Therefore, the nucleotide may be dGTP (deoxyguanosine triphosphate), dCTP (deoxycytidine triphosphate), dTTP (deoxythymidine triphosphate) or dATP (deoxyadenosine triphopshate). Suitable analogues of these nucleotides may also be dye-labelled n.t, such as dye-dNTP, dye-ddNTP or the recently described dye-SS- dNTP (WOOO/53812). Dideoxynucleotides may also be used in the primer extension reaction. The term "dideoxynucleotide" as used herein includes all 2'- deoxynucleotides in which the 3'-hydroxyl group is modified or absent. Dideoxynucleotides are capable of incorporation into the primer in the presence of the poly- merase, but cannot enter into a subsequent polymerisation reaction, and thus function as a chain terminator.
Further, other suitable and necessary reagents are optionally included in the primer extension reaction, such as those reagents, which are normally used for protocols of this kind. Normally, for instance, a polymerase enzyme is included. Other suitable and necessary reagents will be obvious from the Example section of this text. Further, PCT/GB01/64042 describes various modifications and explanations concerning the methods and the reagents used in this invention. This document is hereby incorporated as reference.
In order to be able to type more than one variable site in one reaction using more than one extension primer, it is important to choose the addition of nucleotides in such a way, that signals from different variable sites are not obtained simultaneously. In one embodiment, this may be achieved by, from a known sequence, adding the nucleotides to the reaction mix in a predetermined order. Pyrosequencing™ is a sequencing method developed at the Royal Institute of Technology in Stockholm (Ronaghi et al.,1998, Alderborn et al.,2000). The method is based on "sequencing by synthesis" in which, in contrast to conventional Sanger se- quencing, the nucleotides are added one by one during the sequencing reaction. An automated sequencer, the PSQ96™ instrument, has recently been launched by Pyrosequencing AB (Uppsala, Sweden). The principle of the Pyrosequencing™ technology: A single stranded DNA fragment (attached to a solid support), carrying an annealed sequencing primer acts as a template for the Pyrosequencing™ reaction. In the first two dispensations, substrate and enzyme mixes are added to the template. The enzyme mix consists of four different enzymes; DNA polymerase, ATP- Sulfurylase, Luciferase and Apyrase. The nucleotides are sequentially added one by one according to a specified order dependent on the template and determined by the user. If the added nucleotide is matching the template, the DNA polymerase will incorporate it into the growing DNA strand. By this action, pyrophosphate, PPi5 will be released. The ATP-Sulfurylase converts the PPi into ATP, and the third enzyme, Luciferase, transforms the ATP into a light signal. Following these reactions, the fourth enzyme, Apyrase, will degrade the excess nucleotides and ATPs, and the template will at that point be ready for the next reaction cycle, i.e. another nucleo- tide addition. The complete enzymatic reactions (Nyren,1987, Karamohamed,1999) are shown in fig 1. Since no PPi is released unless a nucleotide is incorporated, a light signal will be produced only when the correct nucleotide is incorporated. The PSQ 96 Instrument has been developed by Pyrosequencing AB (Uppsala, Sweden) in order to automate the sequencing reaction and to monitor the light release. The PSQ 96 Instrument software presents the results as peaks in a pyrogram™, where the height of the peaks corresponds to the number of nucleotides incorporated. Dedicated softwares have been developed for SNP analysis, sequencing of shorter DNA stretches (20-50 bases), and assessment of allele frequencies. Compared to other techniques used for SNP analysis, for example hybridisation techniques, minisequencing, RFLP and SSCP, sequencing-by-synthesis presents some strong advantages. One is its ability to confirm that the correct SNP (single nucleotide polymorphism) position is examined, by presenting the surrounding se- quence and not only the polymorphic positions. Another advantage is the flexibility in primer design, i.e. the primer can be situated up to 15 nucleotides from the polymorphism, where it in minisequencing has to lay adjacent to the polymorphic site. Furthermore, it is a rapid technique, which is a benefit compared to SSCP and RFLP. The rapidity is also the main advantage compared to Sanger sequencing, when this technique is used for sequencing of shorter DNA stretches. Another advantage with sequencing-by-synthesis versus Sanger sequencing is that the first base directly after the extension primer can be read with high accuracy.
Pyrosequencing™ is a real time DNA sequencing method based on sequencing-by- synthesis. The method is proved to be a fast and accurate method for SNP (single nucleotide polymorphism) scoring, sequencing of shorter DNA stretches (signature tags), and assessment of allele frequencies. Pyrosequencing AB (Sweden) manufactures the PSQ™ 96 and the PTP Systems for low and high throughput genotyping, respectively, as well as dedicated softwares for automatic delivery of genotype and a quality assessment for each sample. A major advantage with those Systems is the combination of accuracy, speed and ease-of-use.
Accordingly, in one preferred embodiment the sequencing-by-synthesis analysis is a Pyrosequencing™ analysis.
Also, the inventors have shown that advantageously a sequence stretch of from 20 to 50 nucleotides of the variable region(s) P10 and or PlO.l of the rnpB-gene is determined in the Pyrosequencing™ reaction, since this length results in the most accurate results. Also, in one embodiment more than one extension reaction is performed in the same reaction vessel. In order to perform several extension reactions in one reaction vessel, more than one extension primer must be used. Thus more than one variable site or region of interest may be typed and/or identified in the same reaction. Normally, multiple extension reactions are controlled by choosing the dispensation order of the nucleotides in the reaction in such a way that the resulting sequencing-by-synthesis analysis data is easily interpretable. For instance, the dispensation order may be chosen so that one of the primers is extended over its interesting region, while the other is practically kept unextended.
Moreover, in one preferred embodiment, the method of the invention also comprises the determination of at least one virulence factor, such as some kind of drug resistance or susceptibility to acquire a disease or infection, or a gene encoding encapsulation proteins or different toxins (end and exotoxins, haemolysins) and genes conferring antibiotic resistance, such as vanA and mecA. For instance, the antibiotic resistance status of the sample is determined.
Important examples where speed of diagnosis is of great importance: Infections with MRSA, methicillin-resistant Staphylococcus aureus, usually develop in hospital pa- tients who are elderly or very sick, or who have an open wound (such as a bedsore) or a tube (such as a urinary catheter) going into their body. Estimates from CDC (Center for Disease control, Atlanta, USA) claim that as many as 80,000 patients a year get an MRSA infection after they enter the hospital. A rapid and correct diagnosis is important for treatment of the individual patient, as well as for stopping spread of the bacteria to other patients within the hospital. In this specification, a se- quencing-by synthesis analysis using the targets rnpB gene for identification of the mecA gene that confer methicillin-resistance, is for example suggested.
Another case where fast diagnosis is highly desired is the infections caused by VRE, vankomycin-resistant enterococci. Enterococci cause UTI, bacteremia, wound, ab- dominal-pelvic infections and endocarditis. Minor infections can usually be treated by antibiotics, such as penicillins, macrolides or tetracyclines. However, only penicillins, or teicoplanin and vancomycin (two expensive and potentially toxic antibiotics which can only be given by injection) are reliably effective against serious en- terococcal infections such as endocarditis or meningitis. Serious infections often need prolonged treatment, usually with several antibiotics being given together by injection.
In 1986, the first vancomycin-resistant enterococcus (VRE) was found in France and a year later the first strain was isolated in the UK. Similar strains have now been found world-wide. The genetic material which makes enterococci resistant to vancomycin, e.g. the vanA gene has probably been passed on from other types of bacteria that do not cause human disease but which are already vancomycin-resistant. Bacteria that are resistant to vancomycin are commonly also resistant to a similar antibiotic called teicoplanin, and vice versa. VRE are becoming more common in hospitals worldwide.
Thus, the method of the invention is directed to determination of all the antibiotics resistance variants mentioned above, as well as other variants.
Also, in yet another embodiment, the method of the invention comprises that the amount of the gram-positive bacteria that is present in the sample is quantified. Hereby, the treatment of patient having a bacterium that is present in the sample of the patient may be optimised by for example adjusting the dosage of the antibiotics used for treatment of the patient. For instance, this may be performed by using a competitive PCR and analysis of peak heights for the output of the sequencing by synthesis analysis.
Also, in one embodiment, the nucleotide pattern obtained in the sequencing-by- synthesis analysis is used for an alignment analysis, in order to determine the bacte- rial origin of the nucleotide pattern. This may be done by using the BLAST search engine, for instance by using Genbank.
Moreover, in yet another embodiment, the nucleotide pattern is compared to a refer- ence pattern, in order to determine the bacterial origin of the nucleotide pattern.
Such a reference pattern may for instance be a database comprising data of various gram-positive bacterial nucleotide sequences. It may also be a nucleotide sequence that for other reasons is relevant or interesting to compare to the nucleotide pattern.
Thus, in one preferred embodiment, the comparison of the nucleotide pattern and the reference pattern is performed by:
(i) transmitting the nucleotide pattern to a database comprising data of gram- positive bacterial species nucleotide sequences; (ii) retrieving data of the gram-positive bacterial species that matches the nu- cleotide pattern.
Hereby, the origin of the bacterial sample is identified, if present in the database. The transmission and retrieval of data to and from the database is performed by conventional means, which would be known to the skilled person in the art.
For example, in a preferred embodiment, the database is "The rnpB gene database", which is accessible from Genbank.
In a second aspect, the invention refers to a kit for performing the identification and inter-species determination of the method of the invention, comprising at least one extension primer designed to be extendable in the region between nucleotide 61 and nucleotide 173 of the rnpB-gene, and amplification primers adapted for amplifying said region of the rnpB-gene. Preferably, the extension primer is STR:12R122 (SEQ ID NO:2) (see example section).
The amplification primers are preferably STP:45U18 (SEQ ID NO:3) (forward) and STR:219L16 (SEQ ID NO:4) (reverse).
In one embodiment, the kit further comprises means for determining the antibiotic resistance status of the sample. Such means may be an extension primer and amplification primers, specifically adapted for a region in the bacterial genome, that is linked to the occurrence of antibiotic resistance.
Below, the invention is described with reference to the appended examples. These are however only included for clarifying purposes, and shall not be considered to limit the scope of the invention in any way.
Examples
Example 1 - Alignment of the rnpB DNA sequences from gram-positive bacteria
DNA rnpB sequences were collected from NCBI and the RNaseP RNA database (Brown, 1999; http://www.mbio.ncsu.edu/RNaseP/home .html) and aligned using Multialin (Corpet, 1988; http://prodes.toulouse.inra.fr/multalin/multalin.html). A variable DNA region flanked by conserved regions was targeted in PCR amplification and analysis by Pyrosequencing™ technology (Figure 1).
Example 2- Amplification of the rnpB gene
Genomic DNA from gram-positive bacteria obtained from the laboratory of Dr. Gary Procop at the Cleveland Clinic was used in PCR amplification of the rnpB tar- get. One common reverse primer (STR: 219L16: 5'-GGTTTACCGCGTTCCA-3'; Figure 1) was used in all PCR reactions. This oligonucleotide was used in PCR with different forward primers, yielding different levels of specificity in the amplification reactions. The three forward primers STR: 45U18 (5'-Biotin- GAGGAAAGTCCATGCTAG-3'; streptococcal species), STP: 45U18 (5'-Biotin- GAGGAAAGTCCATGCTCA-3'; staphylococcal species) and ENC: 45U18 (5'- Biotin-GAGGAAAGTCCATGCTCG-3'; enterococcal and to some extent streptococcal species) preferentially amplified rnpB from within one genera. One generic primer, STP:45U22w (5'- Biotin - GAGGAAAGTCCATGCTCA/GCACA-3'), yielded PCR products from species of all three genera.
The DNA from the following species gave weak or no amplification products with the primers used and were therefore not sequenced: Pediococcus pentosus (CCFGP2), Leuconostoc mesenteroides (CCFGP 3), Stomatococcus sp (CCFGP4), Micrococcus sp. (CCFGP 5), Bacillus circulans (CCFGP25), Bacillus cereus (CCFGP26), Bacillus subtilis (CCFGP27), Bacillus sp (CCFGP28), Lactobacillus casei (CCFGP 29) and Listeria monocytogenes (CCFGP30). An inspection of the available rnpB sequences in GenBank showed that PCR primers STP: 45U17 (5'- Biotin- GAGGAAAGTCCATGC TC-3') and STR: 219L16 were fully or nearly complementary to the rnpB genes from Bacillus, Listeria and Lactococcus species and therefore should have been able to amplify this gene in PCR. It is not clear why no amplification product was obtained in these cases, but it could be due to insufficient lysis of the bacteria in the DNA preparation. The rnpB sequences from Micro- coccus ox Lactobacillus species were not compatible with any of the chosen oligo- nucleotides (data not shown).
Example 3 - Sequencing using Pyrosequencing™ technology
The PCR products were prepared for sequencing by denaturation and preparation of the biotin-labeled single strand. The same sequencing primer STR: 12R122 (5'- GTCACTGTGGCACTTTC -3'; Figure 1) was used in single-stranded PCR ampli- cons. A cyclic dispension of nucleotides (ACGT) was used in Pyrosequencing™ experiments. The DNA sequence read-out, together with the data (Pyrogram) is provided automatically by the SQA software together with a quality scoring (see Figure 3). The DNA sequences obtained of some of the templates (e.g. S. viridans CCFGP23, figure 2) were generated from somewhat low peaks in the pyrograms. In these cases, the software reports the results with a quality score of "check", to inform the user that the sequencing reaction was sub-optimal. In most such cases, the sequencing quality is increased by optimisation of the PCR amplification preceding the sequencing reaction.
Example 4 - Discriminatory power of the identification method
The obtained DNA sequences were assessed for their information content by BLAST searches of Genbank, a subset (S. aureus, S. epidemidis and S . pyogenes) of which are shown in figure 4. The read lengths in a typical experiment
(Seq399Afro0222), was 35-45 bases and 20, 30 and 40 bases were used in the searches of GenBank. From data like this, we concluded that 20-40 bases are ideal for searches in Genbank. Too short sequences (<20) cannot be used in BLAST searches and longer DNA sequences generally increase the confidence of a putative hit sequences. On the other hand, with longer sequences comes increased time required for the analysis, as well as increased cost and risk for sequencing errors.
For the species where no rnpB sequence has been deposited in GenBank such as Streptococcus intermedius and Staphylococcus haemolyticus, no hit with P value lower than 0.28 was obtained, showing that the sequences are highly discriminatory, since no hit even in closely related organisms was obtained.
In all cases where the rnpB sequence was available in Genbank, the correct accession file was found with high confidence (low Expect value; Figure 4). Similarly, the same methodology as described here for rnpB can be applied to other genes of interest for the microbiologist, such as virulence genes (e.g. genes encoding toxins or encapsulation proteins) or genes correlated with antibiotic resistance (e.g. mutations in rpoB and the presence of the mecA genes). Many of the common problems connected to standard sequencing are not present with Pyrosequencing™ technol- ogy, such as the long time required for analysis, preparation of gels and the requirement for highly skilled personnel for performing analysis and evaluation. We tested the discriminatory power of the method by searches of GenBank, but the system also allows automatic comparison of chosen reference sequences. The DNA sequences are easy to communicate and the intra-laboratory reproducibility is also high (not shown), two important factors for the value of a molecular identification method.

Claims

Claims:
1. Method for inter-species differentiation and identification of a gram-positive bacteria in a sample, comprising analysing the variable region(s) P10 and/or PlO.l of the rnpB-gene of the sample bacteria in a sequencing-by-synthesis analysis, the analysis thereby resulting in a nucleotide pattern.
2. Method according to claim 1, whereby the gram-positive bacteria is chosen from the genera Enterococci, Staphylococci and Streptococci.
3. Method according to claim 1 or 2, whereby the variable region of the rnpB-gene is the region between nucleotide 61 and nucleotide 173 of the rnpB-gene, such as
SEQ ID NO: 1.
4. Method according to any one of the preceding claims, whereby the extension primer for the sequencing-by-synthesis analysis is designed to extend within the region between nucleotide 61 and nucleotide 173 of the rnpB-gene.
5. Method according to any one of the preceding claims, whereby the sequencing- by-synthesis analysis is a pyrosequencing analysis.
6. Method according to claim 5, whereby the pyrosequencing analysis is adapted to analyse from 20 to 50 nucleotides in the variable region of the rnpB-gene.
7. Method according to any of the preceding claims, whereby more than one exten- sion reaction is performed in the same reaction vessel.
8. Method according to any one of the preceding claims, further comprising that the antibiotic resistance status of the sample is determined.
9. Method according to any one of the preceding claims, further comprising that the amount of the gram-positive bacteria is quantified.
10. Method according to any one of the preceding claims, whereby the nucleotide pattern is used for an alignment analysis, in order to determine the bacterial origin of the nucleotide pattern.
11. Method according to any one of the preceding claims, whereby the nucleotide pattern is compared to a reference pattern, in order to determine the bacterial origin of the nucleotide pattern.
12. Method according to claim 11, whereby comparison of the nucleotide pattern and the reference pattern is performed by:
(i) transmitting the nucleotide pattern to a database comprising data of gram- positive bacterial species nucleotide sequences; (ii) retrieving data of the gram-positive bacterial species that matches the nucleotide pattern.
13. Kit for performing the identification and inter-species determination of the method of claim 1-12, comprising at least one extension primer designed to be extendable in the region between nucleotide 61 and nucleotide 173 of the rnpB- gene (SEQ ID NO: 1), as well as amplification primers adapted for amplifying said region of the rnpB-gene.
14. Kit according to claim 13, whereby the extension primer is STR: 12R122 (SEQ ID NO:2), and the amplification primers are STP:45U18 (SEQ ID NO:3) and STR:219L16 (SEQ ID NO:4).
15. Kit according to claim 13 or 14, further comprising means for determining the antibiotics resistance status of the sample.
PCT/SE2003/001771 2002-11-15 2003-11-14 A method for inter-species differentiation and identification of a gram-positive bacteria WO2004046385A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003279664A AU2003279664A1 (en) 2002-11-15 2003-11-14 A method for inter-species differentiation and identification of a gram-positive bacteria

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
SE0203388-4 2002-11-15
SE0203388A SE0203388D0 (en) 2002-11-15 2002-11-15 New method
US31970302P 2002-11-18 2002-11-18
US60/319,703 2002-11-18

Publications (1)

Publication Number Publication Date
WO2004046385A1 true WO2004046385A1 (en) 2004-06-03

Family

ID=32328458

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2003/001771 WO2004046385A1 (en) 2002-11-15 2003-11-14 A method for inter-species differentiation and identification of a gram-positive bacteria

Country Status (2)

Country Link
AU (1) AU2003279664A1 (en)
WO (1) WO2004046385A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008509664A (en) * 2004-08-10 2008-04-03 ベクトン・ディキンソン・アンド・カンパニー A method for rapid identification of microorganisms
WO2010007605A1 (en) * 2008-07-16 2010-01-21 Agriculture And Food Development Authority (Teagasc) A method of assessing bacterial load of a sample
WO2011048227A1 (en) 2009-10-22 2011-04-28 Biotools Biotechnological & Medical Laboratories, S.A. Composition, method and kit for detecting bacteria by means of sequencing

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5574145A (en) * 1989-04-20 1996-11-12 Bioresearch Ireland Isolated nucleic acid molecules targeted to the region intermidiate to the 16S and 23S rRNA genes useful as probes for determining bacteria
WO1999011653A1 (en) * 1997-09-04 1999-03-11 Smithkline Beecham Corporation Novel rnase p
EP1211324A2 (en) * 2000-11-08 2002-06-05 Becton Dickinson and Company Amplification and detection of organisms of the chlamydiaceae family
WO2002051662A1 (en) * 2000-12-23 2002-07-04 Daimlerchrysler Ag Electric energy supply system for a train or several trains
WO2002070664A2 (en) * 2001-03-02 2002-09-12 Isis Pharmaceuticals, Inc. Method for rapid detection and identification of bioagents

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5574145A (en) * 1989-04-20 1996-11-12 Bioresearch Ireland Isolated nucleic acid molecules targeted to the region intermidiate to the 16S and 23S rRNA genes useful as probes for determining bacteria
WO1999011653A1 (en) * 1997-09-04 1999-03-11 Smithkline Beecham Corporation Novel rnase p
EP1211324A2 (en) * 2000-11-08 2002-06-05 Becton Dickinson and Company Amplification and detection of organisms of the chlamydiaceae family
WO2002051662A1 (en) * 2000-12-23 2002-07-04 Daimlerchrysler Ag Electric energy supply system for a train or several trains
WO2002070664A2 (en) * 2001-03-02 2002-09-12 Isis Pharmaceuticals, Inc. Method for rapid detection and identification of bioagents

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BIRKENHEUER ADAM J. ET AL.: "Differentiation of haemobartonella canis and mycoplasma haemofelis on the basis of comparative analysis of gene sequences", AJVR, vol. 63, no. 10, 2002, pages 1385 - 1388, XP002973658 *
HAAS ELISABETH S. ET AL.: "Structure and evolution of ribonuclease P RNA in Gram-positive bacteria", NUCLEIC ACIDS RESEARCH, vol. 24, no. 23, 1996, pages 4775 - 4782, XP002915372 *
HAAS ELIZABETH S. ET AL.: "Evolutionary variation in bacterial RNase P RNAs", NUCLEIC ACIDS RESEARCH, vol. 26, no. 18, 1998, pages 4093 - 4099, XP002939804 *
HAAS ELIZABETH S. ET AL.: "Further perspective on the catalytic core and secondary structure of ribonuclease P RNA", PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 2527 - 2531, XP002973659 *
JAMES BRYAN D. ET AL.: "The secondary structure of ribonuclease P RNA, the catalytic element of a ribonucleoprotein enzyme", CELL, vol. 52, 1988, pages 19 - 26, XP000909794 *
MASSIRE CHRISTIAN ET AL.: "Derivation of the three-dimensional architecture of bacterial ribonuclease p RNAs from comparative sequence analysis", J. MOL. BIOL., vol. 279, 1998, pages 773 - 793, XP004466337 *
YOON ET AL.: "Comparative sequence analyses of the ribonuclease P (RNase P) RNA genes from LL-2,6-diaminopimelic acid-containing actinomycetes", INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY, vol. 50, 2000, pages 2021 - 2029 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008509664A (en) * 2004-08-10 2008-04-03 ベクトン・ディキンソン・アンド・カンパニー A method for rapid identification of microorganisms
US8420320B2 (en) 2004-08-10 2013-04-16 Becton, Dickinson And Company Method for rapid identification of microorganisms
WO2010007605A1 (en) * 2008-07-16 2010-01-21 Agriculture And Food Development Authority (Teagasc) A method of assessing bacterial load of a sample
WO2011048227A1 (en) 2009-10-22 2011-04-28 Biotools Biotechnological & Medical Laboratories, S.A. Composition, method and kit for detecting bacteria by means of sequencing

Also Published As

Publication number Publication date
AU2003279664A1 (en) 2004-06-15

Similar Documents

Publication Publication Date Title
JP7432237B2 (en) Polymerase chain reaction primers and probes for Mycobacterium Tuberculosis
JP4176146B2 (en) Specific and universal probes and amplification primers for the rapid detection and identification of common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US7867711B2 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
US8129108B2 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
US8187816B2 (en) Probe set, probe-immoblized carrier, and genetic testing method for detecting Anaerococcus prevotii
US8404822B2 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
US8148063B2 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
US20090305262A1 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
US20090298069A1 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
US20100081581A1 (en) Probe, probe set, probe-immobilized carrier, and genetic testing method
Courvalin Genotypic approach to the study of bacterial resistance to antibiotics
JP4377378B2 (en) Quantitative testing of bacterial pathogens
US20110287965A1 (en) Methods and compositions to detect clostridium difficile
US6355435B1 (en) Methods for detecting and enumerating Campylobacter jejuni in environmental samples and for identifying antibiotic-resistant strains
CA2814762A1 (en) Oligonucleotides relating to clostridium difficile genes encoding toxin b, toxin a, or binary toxin
US20110200995A1 (en) Optimized probes and primers and methods of using same for the detection, screening, isolation and sequencing of vancomycin resistance genes and vancomycin resistant enterococci
WO2021201091A1 (en) Primer set and probe for detecting klebsiella bacteria
WO2004046385A1 (en) A method for inter-species differentiation and identification of a gram-positive bacteria
EP3568491A1 (en) Rapid antimicrobial susceptibility testing and phylogenetic identification
CN113604589A (en) Kit for simultaneously detecting drug-resistant sites, virulence genotyping and proton pump inhibitor metabolic genotyping of helicobacter pylori
EP1957674A2 (en) Identification of usa300 community-associated methicillin-resistant staphylococcus aureus
KR20200048076A (en) Kit for diagnosing infection due to severe fever with thrombocytopenia syndrome virus
KR101518561B1 (en) Development of species-specific PCR method for detection of Acinetobacter species
US20230093543A1 (en) Multiplex pcr method for detecting microorganisms and use thereof
WO2001018017A1 (en) Methods for detecting and enumerating campylobacter jejuni in environmental samples and for identifying antibiotic-resistant strains

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP