WO2004033709A2 - Methods, probes, and kits for detecting group a streptococcus - Google Patents

Abstract

Probe compositions specific for group A Streptococcus and methods for their use are provided. In addition, methods and compositions for modulating gene expression in bacteria, in particular group A Streptococcus, are provided. Polynucleotides that encode RocA polypeptides are disclosed that positively regulate covR. The probes include at least a portion of the rocA polynucleotide sequence and can be used to detect or quantify the presence of Group A Streptococcus in a sample.

Description

METHODS, PROBES, AND KITS FOR DETECTING GROUP A

STREPTOCOCCUS

CROSS-REFERENCE TO RELATED APPLICATION

This application claims priority to copending U.S. provisional application entitled, "METHODS, PROBES, AND KITS FOR DETECTING GROUP A STREPTOCOCCUS," having serial number 60/417,032, filed October 8, 2002, which is entirely incorporated herein by reference.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

Aspects of the work described herein were supported by Public Health Services grant R37-AI20723 from the National Institutes of Health. Therefore, the U.S. government has certain rights in the invention.

TECHNICAL FIELD The present disclosure relates generally to methods and compositions for the detection and/or modulation of polynucleotides, and more particularly to methods and compositions for the detection and/or modulation of group A streptococcus polynucleotides.

BACKGROUND

Group A Streptococcus (GAS) refers to a collection of a gram-positive bacterial strains that are involved in a wide variety of diseases. For example, the human pathogen Streptococcus pyogenes is known to cause relatively mild and self- limiting infections of the throat and skin, such as pharyngitis and pyoderma, as well as life-threatening invasive diseases like septicemia, myositis, nectrotizing fasciitis, and streptococcal toxic shock syndrome (Musser, J. M. and R. M. Krause (1998) In Emerging Infections, ed. Krause, R. M. Academic, New York, pp. 185-218. The primary infection may also lead to serious sequelae like rheumatic fever, glornerulonephritis, and reactive arthritis (Bisno, A. L. (1991) Group A streptococcal infections and acute rheumatic fever ' N. Engl. J. Med. 325:783-793; Bronze, M. S. and J. E. Dale. (1996). The reemergence of serious group A streptococcal infections and acute rheumatic fever. Am. J. Med. Sci. 311 :41-54). In many cases, it appears that single GAS strains can cause all or most of these diseases. Thus, GAS strains have a significant impact on the health and well being of many individuals.

Many virulence factors of GAS strains appear to be involved in the survival, spread, and persistence of the organism inside the human host. These are (i) factors that damage or degrade the host tissues such as cysteine protease, hyaluronidase, pyrogeneic exotoxins, strepotokinase, and streptolysins, (ii) factors that are required for resistance to phagocytosis by the host immune system, such as M protein, C5a peptidase, and hyaluronic acid capsule; and (iii) proteins that promote adherence and colonization, such as M protein and protein F (Alouf, J., and H. Muller-Alouf. (1996) Cellular constituents and extracellular proteins involved in the pathogenic capacity of Streptococcus group. A. Am. Pharm. Fr. 54:49-59; Cunningham, M. W. (2000) Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev. 13 :470-511 ; Schlewert, P. M. et al. (1996); Severe invasive group A streptococcal disease; clinical description and mechanisms of pathogenesis. J. Lab Clin. Med. 127:13-22; Stevens, D. L. (1992); Invasive group A streptococcus infections. Clin. Infect. Dis. 14:2-11). GAS encounter distinct microenvironrnents during infections and probably responds to them by expressing genes that produce proteins necessary for infection at that particular site. The ability to differentially regulate a wide range of virulence factors is therefore likely to be essential for the success of GAS infections.

Proper treatment of bacterial infections and related diseases requires, in part, the proper identification of the pathogen. Accordingly, there is a need for methods and compositions for identifying GAS infections.

There is also a need for methods and compositions for modulating the virulence of GAS pathogens.

There is still another need for methods and compositions for detecting GAS specific polynucleotides. There is yet another need for methods and compositions for treating GAS infections. SUMMARY

Probe compositions and methods of their use are provided. The probe compositions can be used for detecting and quantifying the presence of group A Streptococcus in a sample and include polynucleotides that hybridize, for example under stringent conditions, to a polynucleotide of an SPyl605 or rocA gene (SEQ. ID. NO: 2) to form a detectable probe/target duplex. The polynucleotide probes can include a sequence of at least 10 nucleotides of SEQ. ED. NOs.: 2-7 and can specifically detect the presence of GAS in a sample containing other bacteria. The present disclosure also provides methods and compositions for modulating gene expression in group A Streptococcus. An exemplary method includes contacting a group A Streptococcus with a polynucleotide encoding a RocA polypeptide. RocA expressed in the bacterium can positively regulate covR, a repressor of several group A Streptococcus genes.

Pharmaceutical compositions including polynucleotides encoding RocA polypeptides are also provided. The pharmaceutical compositions can be used for treating group A Streptococcus infection in a host for example, by causing the repression or increased repression of at least one virulence gene of the group A Streptococcus infecting the host.

DESCRIPTION OF THE FIGURES Figure 1 is a diagram illustrating the construction of the Tcov-gusA reporter strain.

Figures 2 A-C are diagrams describing the construction of a rocA null mutant. Figure 3 A is a diagram of a gusA reporter system used to measure the expression from the covR promoter at the NIT locus. Figure 3B is a graph illustrationg GusA activity in wild-type and rocA mutant strains.

Figures 4A and B are a line graph and autoradiograph respectively showing the analysis oϊhasA gene transcription in the wild-type and rocA mutant strains.

Figures 5 A and B are a diagram and autoradiograph respectively showing the regulation of the has promoter by rocA requires funcional covR.

Figure 6 is an autoradiograph showing that RocA regulates its own expression. Figures 7A and B are a line graph and autoradiograph respectively showing the regulation of rocA expression by RocA is independent of functional CovR. Figure 8 is a Southern blot hybridization autoradiograph illustrating the detection the rocA gene in group A Streptococcus strains. DETAILED DESCRIPTION

GAS strains cause, directly or indirectly, a variety of diseases in mammals, particularly in humans. The proper treatment of GAS-related disease requires the identification or detection of the pathogen as well as methods and compositions for alleviating disease symptoms, reducing the virulence of GAS, identifying GAS polynucleotides, and modulating GAS polynucleotide expression. Accordingly, it has been discovered that rocA encodes a positive regulator of covR. CovR controls multiple GAS genes including genes involved in GAS virulence. It has been further discovered that rocA polynucleotides are present in GAS strains and are not present in other related streptococcus groups or other bacterial pathogens. Prior to describing the various embodiments of the invention, the following definitions are provided to facilitate the description of the embodiments. Definitions

As used herein, the following terms have the given meanings unless expressly stated to the contrary. The term "GAS" refers generally to group A Streptococcus strains, for example strains of Streptococcus pyrogenes. Exemplary GAS strains include but are not limited to M6 JRS4, RTG229, Ml SF370, Ml MGAS5005, Ml MGAS166, M3 AM3, M4 MGAS321, T5B/1201/4, M6 MGAS303, M18 MGAS300, M22 MGAS317, M22 MGAS162, M50 B514, CDC SS-90, CDC SS-91, CDC SS-482, CDC SS-633, CDC SS-634, CDC SS-635, CDC SS-721, CDC SS-745, and CDC SS- 754.

The term "rocA" refers to a gene or polynucleotide encoding a positive regulator of covR. A positive regulator means a substance, preferably a polypeptide, that activates or increases the expression of the covR gene either directly or indirectly. The polypeptide sequence of RocA (SEQ. ID. NO.: 1) is published under GenBank accession number AAK34382, and the nucleotide sequence oϊrocA (SEQ. ID. NO: 2) is published under GenBank accession number AE006592, both of which are incoφorated herein in their entirety. The terms roc A and SPyl605 can be used interchangeably, and are intended to refer to the same rocA polynucleotide sequence, for example SEQ. ID. NO.: 2. It will be appreciated that the polypeptides of the present disclosure can be further processed to activate or augment the action of the polypeptide. For example, RocA can be phophorylated or can have additonal post- translational modifications.

The term "RocA" refers to the polypeptide or a fragment thereof encoded by the rocA or SPyl605 gene.

A "nucleotide" is a subunit of a polynucleotide having a phosphate group, a 5- carbon sugar and a nitrogenous base. The 5 -carbon sugar found in RNA is ribose. In DNA, the 5-carbon sugar is 2'-deoxyribose. For a 5 '-nucleotide, the sugar contains a hydroxyl group (--OH) at the 5'-carbon-5. The term also includes analogs of such subunits, such as a methoxy group at the 2' position of the ribose (OMe). As used herein, methoxy oligonucleotides containing "T" residues have a methoxy group at the 2' position of the ribose moiety, and a uracil at the base position of the nucleotide. A "non-nucleotide unit" is a unit, which does not significantly participate in hybridization of a polymer. Such units do not, for example, participate in any significant hydrogen bonding with a nucleotide, and would exclude units having as a component one of the five nucleotide bases or analogs thereof. A "polynucleotide" is a nucleotide polymer having two or more nucleotide subunits covalently joined together. Polynucleotides can vary in length depending on the source, utility, etc. The sugar groups of the nucleotide subunits may be ribose, deoxyribose, or modified derivatives thereof such as OMe. The nucleotide subunits may by joined by linkages such as phosphodiester linkages, modified linkages or by non-nucleotide moieties that do not prevent hybridization of the polynucleotide to its complementary target polynucleotide sequence. Modified linkages include those in which a standard phosphodiester linkage is replaced with a different linkage, such as a phosphorothioate linkage, a methylphosphonate linkage, or a neutral peptide linkage. Nitrogenous base analogs also may be components of polynucleotides in accordance with the disclosure.

A "target polynucleotide" is a polynucleotide having a target polynucleotide sequence of interest that can be hybridized with a complementary polynucleotide. A "polynucleotide probe" is a polynucleotide having a nucleotide sequence (DNA or RNA) sufficiently complementary or homologous to its target polynucleotide to be able to form a detectable hybrid probe/target duplex under high stringency hybridization conditions. A polynucleotide probe is an isolated chemical species and may include additional nucleotides outside of the targeted region as long as such nucleotides do not prevent hybridization under high stringency hybridization conditions. A polynucleotide probe optionally may be labeled with a detectable moiety, including but not limited to, such as a radioisotope, a fluorescent moiety, a chemiluminescent moiety, an enzyme or a ligand, which can be used to detect or confirm probe hybridization to its target polynucleotide. Polynucleotide probes can be at least 10 nucleotides, 10-30 nucleotides, or range from 20 to several thousands nucleotides in length.

A "detectable moiety" is a molecule attached to, or synthesized as part of, a polynucleotide probe. This molecule should be uniquely detectable and will allow the probe to be detected as a result. These detectable moieties are often radioisotopes, chemiluminescent molecules, enzymes, haptens, or even unique oligonucleotide sequences, for example.

A "hybrid" or a "duplex" is a complex formed between two single-stranded polynucleotide sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases.

"Hybridization" is the process by which two complementary strands of polynucleotide combine to form a double-stranded structure ("hybrid" or "duplex"). "Complementarity" is a property conferred by the base sequence of a single strand of DNA or RNA which may form a hybrid or double-stranded DNA.'DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands. Adenine (A) ordinarily complements thymine (T) or uracil (U), while guanine (G) ordinarily complements cytosine (C).

"Mismatch" refers to any pairing, in a hybrid, of two nucleotides, which do not form canonical Watson-Crick hydrogen bonds. In addition, for the purposes of the following discussions, a mismatch can include an insertion or deletion in one strand of the hybrid, which results in an unpaired nucleotide(s). The term "stringency" is used to describe the temperature and solvent composition existing during hybridization and the subsequent processing steps. Under high stringency conditions only highly complementary polynucleotide hybrids form; hybrids without a sufficient degree of complementarity do not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two polynucleotide strands forming a hybrid. Stringency conditions are chosen to maximize the difference in stability between the hybrid formed with the target and the non-target polynucleotide. Exemplary high stringency conditions are provided in the working Examples below. The term "probe specificity" refers to a characteristic of a probe, which describes its ability to distinguish between target and non-target polynucleotide.

"T_m" refers to the temperature at which 50% of the probe is converted from the hybridized to the unhybridized form.

A "helper polynucleotide" is a polynucleotide that binds a region of a target polynucleotide other than the region that is bound by a polynucleotide probe. Helper polynucleotides impose new secondary and tertiary structures on the targeted region of the single-stranded polynucleotide so that the rate of binding of the polynucleotide probe is accelerated. Although helper polynucleotides are not labeled with a detectable label when used in conjunction with labeled polynucleotide probes, they facilitate binding of labeled probes and so indirectly enhance hybridization signals.

As used herein, the term "polypeptide" encompasses amino acid chains of any length, including full length proteins (i.e., RocA), wherein the amino acid residues are linked by covalent peptide bonds.

One skilled in the art will understand that a polynucleotide of a probe of the invention can vary and still hybridize to the target polynucleotide. In other words, probes of the present disclosure are substantially homologous or sufficiently complementary to a target polynucleotide if there is about 50% similarity between the polynucleotide of the probe and the target polynucleotide. In a preferred embodiment, the percentage is about 75%. In a more prefened embodiment, the percentage is about 85%; and in another preferred embodiment, the percentage is about 95%.

By "sufficiently complementary" or "substantially homologous" is meant polynucleotides having a sufficient amount of contiguous complementary nucleotides to form, under high stringency hybridization conditions, a hybrid that is stable for detection.

By "polynucleotide hybrid" or "probe/target duplex" is meant a structure that is a double-stranded, hydrogen-bonded structure that is sufficiently stable to be detected by means such as chemiluminescent or fluorescent light detection, autoradiography, electrochemical analysis or gel electrophoresis. Such hybrids include RNA:RNA, RNA:DNA, or DNA:DNA duplex molecules.

By "preferentially hybridize" is meant that under high stringency hybridization conditions polynucleotide probes can hybridize their target polynucleotides to form stable probe/target hybrids (thereby indicating the presence of the target polynucleotide) without forming stable probe/non-target hybrids (that would indicate the presence of non-target polynucleotide from other organisms). Thus, the probe hybridizes to target polynucleotide to a sufficiently greater extent than to non-target polynucleotide to enable one skilled in the art to accurately detect the presence of group A Streptococcus and distinguish their presence from other groups of

Streptococci. Preferential hybridization can be measured using techniques known in the art and described herein.

A "target polynucleotide sequence region" refers to a sequence (i.e., roc A or SPyl605 gene or portions thereof) present in the polynucleotide or a sequence complementary thereto found in group A Streptococcus, which is not present in polynucleotides of other groups of Streptococci. Polynucleotides having nucleotide sequences complementary to a target polynucleotide may be generated by target amplification techniques such as polymerase chain reaction or transcription mediated amplification (e.g., U.S. Pat. No. 5,824,518). Polymerase chain reaction (PCR) is a process for amplifying a specific polynucleotide segment. PCR involves the use of one or more polynucleotide primers, an agent for polymerization, and a target polynucleotide sequence region template. In PCR, successive cycles of denaturation of polynucleotide, and annealing and extension of the primers produce a large number of copies of a particular target polynucleotide sequence region. The segment copied includes a specific sequence of nucleotides from the target polynucleotide sequence region template. This specific sequence is defined by regions on the target polynucleotide sequence region template that can hybridize to the primers and the polynucleotide sequence between those regions. PCR is described in more detail in U.S. Pat. Nos. 4,683,202 and 4,800,159, both of which are incoφorated herein by reference.

The term "primer" as used herein refers to a polynucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a target polynucleotide sequence region, is induced (i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is a polydeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and source of primers. For example, depending on the complexity of the target sequence, the polynucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.

As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents.

As used herein, the term "treating" includes alleviating the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.

"Operably linked" refers to a juxtaposition wherein the components are configured so as to perform their usual function. For example, control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence, and an organelle localization sequence operably linked to protein will direct the linked protein to be localized at the specific organelle. As used herein, the term "vector" is used in reference to a vehicle used to introduce a nucleic acid sequence into a cell or GAS bacterium. A viral vector is virus that has been modified to allow recombinant polynucleotide sequences to be introduced into cell including a bacterium.

The primers herein are selected to be "substantially complementary" or "substantially homologous" to the different strands of each specific sequence to be amplified. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non- complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the target polynucleotide sequence region to be amplified to hybridize therewith and thereby form a template for synthesis of the extension product of the other primer. In other words, primers of the present disclosure are substantially homologous or sufficiently complementary to a target polynucleotide if there is about 50% similarity between the primer and the target polynucleotide. In a preferred embodiment, the percentage is about 75%. In a more preferred embodiment, the percentage is about 85%; and in another preferred embodiment, the percentage is about 95%.

EMBODIMENTS 1. Probe Compositions

One embodiment discloses hybridization probes for the detection, quantification, or identification of group A Streptococcus. Exemplary embodiments of the present disclosure are capable of distinguishing between group A Streptococcus and groups B, C, D, E, F, G, H, L, M, N, and O Streptococci. In addition, embodiments of the present disclosure are capable of distinguishing group A

Streptococcus from S. pneumoniae, S. mutans, E.feacalis, and L. lactis. In particular, embodiments of the present disclosure detect polynucleotides of the SPyl605 or rocA gene (SEQ. ID. NO.: 2), and may be used in an assay for the detection and/or quantification of group A Streptococcus. Although the covRS system appears to be present in streptococci in addition to

GAS, it has been discovered that RocA is present only in GAS. For example, the rocA gene is found in group A Streptococcus, but is not present in groups B, C, D, E, F, G, H, L, M, N, and O Streptococci as shown in FIG. 8. Therefore, probes capable of detecting all or part of the SPyl605 or rocA polynucleotides can be used to differentiate between group A Streptococcus and groups B, C, D, E, F, G, H, L, M, N, and O Streptococci. The probes can include, but are not limited to, polynucleotides (i.e., single or double strand) having sufficiently complementary or homologous polynucleotide sequences to the a portion of the SPyl605 or rocA gene (SEQ. ED. NO.: 2), such as for example SEQ. ID. NOs.: 2-7. The probes can preferentially hybridize to the aforementioned polynucleotide sequences. SEQ. ED. NO.: 3 corresponds to an about 1.78 kb fragment spanning the complete SPyl605 or rocA gene, as shown below. SEQ. ED. NO.: 4 corresponds to Hindlll fragment of about 0.9 kb. SEQ. ED. NO.: 5 corresponds to Hindlll fragment of about 0.23 kb. SEQ. ED. NO.: 6 corresponds to Hindlll fragment of about 4.3 kb. SEQ. ED. NO.: 7 corresponds to Hindlll fragment of about 1.4 kb. SEQ. ED. NOs.: 6 and 7 refer to the flanking Hindlll fragments that may vary between GAS strains.

It is well established that two single strands of deoxyribonucleic acid ("DNA") or ribonucleic acid ("RNA") or combinations thereof can associate or "hybridize" with one another to form a double-stranded structure haying two strands held together by hydrogen bonds between complementary base pairs. The individual strands of nucleic acid are formed from nucleotides that comprise the bases: adenine (A), cytosine (C), thymine (T), guanine (G), uracil (U) and inosine (I). In the double helical structure of nucleic acids, the base adenine forms hydrogen bonds with either of the bases thymine or uracil; the base guanine forms hydrogen bonds with the base cytosine; and the base inosine forms hydrogen bonds with either adenine, cytosine or uracil. At any point along the chain, therefore, one may find the classical "Watson-Crick" base pairs A:T or A:U; T:A or U:A; and G:C or C:G. However, one may also find A:G, G:U and other mismatched base pairs in addition to the traditional ("canonical") base pairs. A double-stranded nucleic acid hybrid will result if a first single-stranded polynucleotide is contacted under hybridization-promoting conditions with a second single-stranded polynucleotide having a sufficient number of contiguous bases complementary to the sequence of the first polynucleotide. DNA/DNA, RNA/DNA or RNA/RNA hybrids may be formed under appropriate conditions. Generally, a probe is a single-stranded polynucleotide having some degree of complementarity with the nucleic acid sequence ("target polynucleotides") that is to be detected. Probes can be labeled with a detectable moiety such as a radioisotope, an antigen, or a chemiluminescent moiety. Descriptions of nucleic acid hybridization as a procedure for detecting particular nucleic acid sequences are given in U.S. Pat. Nos. 4,851,330, 5,232,831, 5,541,308, 5,681,698, and 6,376,186 and are hereby incoφorated by reference. In general, polynucleotides (i.e., target and non-target polynucleotides) from a sample to be tested and an appropriate probe are first mixed and then incubated under specified hybridization conditions. The resulting hybridization reaction can then assayed to detect and quantitate the amount of probe that has formed a probe/target polynucleotide duplex structure. This information can be used to determine if a particular polynucleotide is present in the test sample. Conventionally, but not necessarily, the probe can be labeled with a detectable label to enhance detectability of the probe.

In addition, the probes can include one or more (typically 2) polymerase chain reaction primers capable of amplifying the entire SPyl605 or rocA gene or a portion of the SPyl605 or rocA gene. Thereafter, detection of the amplified polynucleotide indicates the presence of group A Streptococcus. The primers (generally between 12 to 45 nucleotides long) can be from any portion of the SPyl605 or roc A gene including SEQ. ED. NOs.: 2-7 or portions thereof capable of amplifying some or the entire SPyl605 or rocA gene. Preferably, the primers are from internal portions of roc A.

One skilled in the art will understand that a polynucleotide of a probe (i.e., SPyl605 or rocA gene, a portion of the SPyl605 or rocA gene including SEQ. ED. NOs.: 2-7) of the invention can vary and still hybridize to the target polynucleotide. Suitable probes of the present disclosure include probes that are substantially homologous to a target polynucleotide. Substantially homologous means 50% or more sequence homology between the polynucleotide of the probe and the target polynucleotide. In a preferred embodiment, the percentage is about 75%. In a more preferred embodiment, the percentage is about 85%; and in another preferred embodiment, the percentage is about 95%. 2. Probe Selection Guidelines

The following general guidelines can be used for designing probes having desirable characteristics in accordance with the present disclosure. Manipulation of one or more of the many factors that influence the extent and specificity of a hybridization reaction can determine the sensitivity and specificity of a particular probe. This is true whether or not the probe is perfectly complementary over the full length of its target polynucleotide sequence. Guidelines for preparing probes useful in connection with embodiments of the invention now follow.

First, the stability of the probe/target polynucleotide hybrid should be chosen to be compatible with the assay conditions. This may be accomplished by avoiding long A and T rich sequences, by terminating the hybrids with G:C base pairs, and by designing the probe in such a way that the melting temperature (T_m) will be appropriate for standard conditions to be employed in the assay. The nucleotide sequence of the probe should be chosen so that the length and %G and %C result in a probe having a T_m about 2-10°C higher than the temperature at which the final assay will be performed. The base composition of the probe is significant because G:C base pairs exhibit greater thermal stability when compared with A:T base pairs. Thus, hybrids involving complementary polynucleotides having a high G:C content will be stable at higher temperatures when compared with hybrids having a lower G:C content.

Ionic strength and temperature conditions at which a hybridization reaction will be conducted also should be considered when designing a probe having a negatively charged backbone, such as would be provided by phosphodiester linkages between nucleotides. It is generally known that hybridization rate increases as ionic strength of the reaction mixture increases. Similarly, the thermal stability of hybrids increases with increasing ionic strength. Conversely, hydrogen bond-disrupting reagents such as formamide, urea, DMSO and alcohols increase the stringency of hybridization. Destabilization of the hydrogen bonds by reagents in this class can greatly reduce the T_m. In general, optimal hybridization for synthetic polynucleotide probes of about 10-50 bases in length occurs approximately 5°C below the melting temperature for a given duplex. Hybridization reactions conducted below the temperature optimum may allow mismatched base sequences to hybridize, and can result in reduced probe specificity.

Second, the position at which the probe binds its target polynucleotide should be chosen to minimize the stability of hybrids formed between probe/non-target polynucleotides. This may be accomplished by minimizing the length of perfect complementarity with polynucleotides of non-target organisms, by avoiding G:C rich regions of homology with non-target sequences, and by positioning the probe to span as many destabilizing mismatches as possible. Whether a probe sequence will be useful for detecting only a specific type of organism depends largely on thermal stability difference between probe/target hybrids and probe/non-target hybrids. The difference in T_m should be as large as possible to produce highly specific probes.

The length of the target polynucleotide sequence and the corresponding length of the probe sequence also are important factors to be considered when designing a probe useful for specifically detecting Streptococcus. While it is possible for polynucleotides that are not perfectly complementary to hybridize to each other, the longest stretch of perfectly homologous base sequence will ordinarily be the primary determinant of hybrid stability.

Third, regions of SPy 1605 or rocA, which are known to form strong internal structures inhibitory to hybridization of a probe, are less preferred as targets. Probes having extensive self-complementarity also should be avoided. As indicated above, hybridization is the association of two single strands of complementary polynucleotide to form a hydrogen bonded double-stranded structure. If one of the two strands is wholly or partially double-stranded, then it will be less able to participate in the formation of a new hybrid. The rate and extent of hybridization between a probe and its target can be increased substantially by designing the probe such that a substantial portion of the sequence of interest is single-stranded. If the target polynucleotide to be detected is a genomic sequence encoding a rRNA, then that target will naturally occur in a double- stranded form. This is also the case with products of the polymerase chain reaction (PCR). These double-stranded targets are naturally inhibitory to hybridization with a probe. Finally, undesirable intramolecular and intermolecular hybrids can form within a single probe molecule or between different probe molecules if there is sufficient self-complementarity. Thus, extensive self-complementarity in a probe sequence should be avoided.

Preferably, probes useful for caπying out the procedures described below will hybridize only under conditions of high stringency. Under these conditions only highly complementary polynucleotide hybrids will form (e.g., those having at least 14 out of 17 bases in a contiguous series of bases being complementary). Hybrids will not form in the absence of a sufficient degree of complementarity. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two polynucleotide strands forming a hybrid. Stringency is chosen to maximize the difference in stability between the hybrid formed with the target and non-target polynucleotides. 3. Chemical Structure of Polynucleotides

All of the polynucleotides of the present disclosure may be modified with chemical groups, for example to enhance their performance or to make them readily detectable. Thus, it is to be understood that references to "polynucleotide probes" or "helper polynucleotides" or simply "polynucleotides" embrace polymers of native nucleotides as well as polymers that include at least one nucleotide analog or derivative.

Backbone-modified polynucleotides, such as those having phosphorothioate or methylphosphonate groups, are examples of analogs that can be used in conjunction with polynucleotides of the present disclosure. These modifications render the polynucleotides resistant to the nucleolytic activity of certain polymerases or to nuclease enzymes.

Other analogs that can be incoφorated into the structures of the polynucleotides disclosed herein include peptide polynucleotides, or "PNAs." The PNAs are compounds comprising ligands linked to a peptide backbone rather than to a phosphodiester backbone. Representative ligands include either the four main naturally occurring DNA bases (i.e., thymine, cytosine, adenine or guanine) or other naturally occurring nucleobases (e.g., inosine, uracil, 5-methylcytosine or thiouracil) or artificial bases (e.g., bromothymine, azaadenines or azaguanines, etc.) attached to a peptide backbone through a suitable linker. The PNAs are able to bind complementary ssDNA and RNA strands. Methods for making and using PNAs are disclosed in U.S. Pat. No. 5,539,082, hereby incoφorated by reference. Another type of modification that can be used to make polynucleotides having the sequences described herein involves the use of non-nucleotide linkers (e.g., U.S. Pat. No. 6,031,091 hereby incoφorated by reference) incoφorated between nucleotides in the polynucleotide chain, which do not interfere with hybridization or the elongation of a primer. 4. Polynucleotide Based Methods of Detecting

A composition that includes a polynucleotide probe, either alone or in combination with one or more helper polynucleotides, can be used for detecting the SPyl605 or rocA gene or a fragment thereof, for example in a hybridization assay.

Defined polynucleotides that can be used to practice the invention can be produced by any of several well-known methods, including automated solid-phase chemical synthesis using cyanoethylphosphoramidite precursors (Barone et al., Nucl Acids Res 12 :4051 (1984). Other well-known methods for preparing synthetic polynucleotides also can be employed.

Essentially any labeling and detection system that can be used for monitoring specific polynucleotide hybridization can be used in conjunction with the probes disclosed herein when a labeled probe is desired. Included among the collection of useful labels are: isotopic labels, enzymes, haptens, linked polynucleotides, chemiluminescent molecules, and redox-active moieties that are amenable to electrochemical detection methods. Standard isotopic labels that can be used to produce labeled polynucleotides include ³H, ³⁵S, ²P, ¹²⁵ 1, ⁵⁷Co and ¹⁴C. When using radiolabeled probes, hybrids can be detected by autoradiography, scintillation counting, or gamma counting. Non-isotopic materials can also be used for labeling polynucleotide probes.

These non-isotopic labels can be positioned internally or at a terminus of the polynucleotide probe. Modified nucleotides can be incoφorated enzymatically or chemically with modifications of the probe being performed during or after probe synthesis, for example, by the use of non-nucleotide linker groups. Non-isotopic labels include fluorescent molecules, chemiluminescent molecules, enzymes, cofactors, enzyme substrates, haptens or other ligands. Acridinium esters are particularly preferred non-isotopic labels useful for detecting probe hybrids. Indeed, any number of different non-isotopic labels can be used for preparing labeled polynucleotides in accordance with the invention. Preferred chemiluminescent molecules include acridinium esters of the type disclosed in U.S. Pat. No. 5,283,174 for use in connection with homogenous protection assays, and of the type disclosed in U.S. Pat. No. 5,656,207 for use in connection with assays that quantify multiple targets in a single reaction, both patents being hereby incoφorated by reference. U.S. Pat. 5,998,135, incoφorated herein by reference, discloses yet another method that can be used for labeling and detecting the probes of the present disclosure using fluorimetry to detect fluorescence emission from lanthanide metal labels disposed on probes, where the emission from these labels becomes enhanced when it is in close proximity to an energy transfer partner. Preferred electrochemical labeling and detection approaches are disclosed in U.S. Pat. Nos. 5,591,578 and 5,770,369, the disclosures of which are hereby incoφorated by reference. Redox active moieties useful as electrochemical labels in the present disclosure include transition metals such as Cd, Mg, Cu, Co, Pd, Zn, Fe and Ru.

Acceptability of the final product following synthesis and purification of n polynucleotide may be verified by any of several procedures. First, polyacrylamide gel electrophoresis can be used to determine the size and purity of the polynucleotide according to standard laboratory methods (Molecular Cloning: A Laboratory Manual, Sambrook et α/. (1989) Cold Spring Harbor Lab Publ., 11:51). Alternatively, High Pressure Liquid Chromatography ("HPLC") procedures can be used for this same puφose.

Hybridization between the labeled polynucleotide probe and target polynucleotide can be enhanced through the use of unlabeled "helper polynucleotides" according to the procedure disclosed in U.S. Pat. No. 5,030,557, which is incoφorated herein by reference. As indicated above, helper polynucleotides bind a region of the target polynucleotide other than the region that is bound by the assay probe. This binding imposes new secondary and tertiary structures on the targeted region of the single-stranded polynucleotide and accelerates the rate of probe binding. Helper polynucleotides can be used in combination with labeled polynucleotide probes of the present disclosure. Those having an ordinary level of skill in the art will appreciate that factors affecting the thermal stability of a probe/target hybrid also can influence probe specificity. Accordingly, the melting profile, including the melting temperature (T_m) of probe/target hybrids, should be empirically determined for each probe/target combination. A preferred method for making this determination is described in U.S. Pat. No. 5,283,174, which is incoφorated herein by reference.

One approach for measuring the T_m of a probe/target hybrid involves conducting a hybridization protection assay. According to the method of this assay, a probe/target hybrid is formed under conditions of target excess in a lithium succinate buffered solution containing lithium lauryl sulfate. Aliquots of the "preformed" hybrids are diluted in the hybridization buffer and incubated for five minutes at various temperatures starting below the anticipated T_m (typically 55° C) and increasing in 2-5 degree increments. This solution is then diluted with a mildly alkaline borate buffer and incubated at a lower temperature (for example 50° C) for ten minutes. An acridinium ester (AE) linked to a single-stranded probe will be hydrolyzed under these conditions while an acridinium ester linked to a hybridized probe will be relatively "protected." This procedure is referred to as the hybridization protection assay ("HP A"). The amount of chemiluminescence remaining is proportional to the amount of hybrid and is measured in a luminometer by addition of hydrogen peroxide followed by alkali. The data is plotted as percent of maximum signal (usually from the lowest temperature) versus temperature. The T_m is defined as the point at which 50% of the maximum signal remains.

Probes of the present disclosure can be used in solution or can be affixed to a solid support. Solid supports include for example, glass, plastic, metal, pins, beads including latex beads, nitrocellulose or nylon membranes, polystyrene, silcon, dipsticks, and biochips or microarrays. Methods and procedures for producing biochips, gene chips, or microarrays are known in the art. For example, U.S. Pat. No. 6,174,683 discloses methods and compositions relating to "biochips' and the formation of "biochips" and is incoφorated herein in its entirety. Generally, the polynucleotide probes disclosed herein can be permanently or reversibly affixed to a microarray surface. For example, the attachment of polynucleotides can be accomplished by physical adsoφtion. Polynucleotides can be attached to nitrocellulose membranes by simply air-drying or baking the with the membrane. Air-drying typically involves exposure for 2-8 hours. The alternative is oven-drying at 80°C for 2 hours. Alternatively, polynucleotides can be associated with positively charged surfaces.

Polynucleotides can also affixed to a surface using a covalent linkage. Of the various linking chemistries known in the art, the most common are amine, carbonyl, carboxyl, and thiol. Covalent linkage can be used to ensure that the orientation of the probe is controlled by designing the probe to have the covalent link in the positions that promote or enable hybridization of the probe with a target polynucleotide. This immobilization technique is most efficient when reaction takes place through the end groups. The mode of attachment can range from very simple — for example, a Schiffs base reaction where an aldehyde group reacts with an amine followed by reduction — to sophisticated, with specifically designed linkers. Glass surfaces can be coated with aminosilane to facilitate polynucleotide attachment. Alternatively, surface immobilization of polynucleotides can be accomplished using dendrimers, for example, using pre- fabricated polyamidoamine starburst dendrimers (Le Berre, V., et al. (2003) Dendrimeric coating of glass slides for sensitive DNA microarrays analysis. Nucleic Acids Res. 31(16): e88-88; and Peplies, J. et al. (2003); Optimization Strategies for DNA Microarray-Based Detection of Bacteria with 16S rRNA-Targeting Oligonucleotide Probes. Appl. Envir. Microbiol. 69(3): 1397 - 1407, both of which are incoφorate by reference in their entirety).

A controlled-chemistry linkage makes possible controlled attachment of the nucleic acid via a terminal group. A spacer of the correct size can easily be introduced to ensure that the immobilized acid can move freely to hybridize with any added probe. If attachment were to proceed via the bases, the ability of the immobilized nucleic acid to hybridize would be significantly restricted. The linking groups are used to introduce active end groups.

In one embodiment, the polynucleotides of the subject invention are isolated and obtained in substantial purity, generally as other than an intact chromosome. Usually, the polynucleotides, either as DNA or RNA, will be obtained substantially free of other naturally-occurring nucleic acid sequences, generally being at least about 50%, usually at least about 90% pure and are typically "recombinant", e.g., flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome 5. Modulating GAS Gene Expression One embodiment of the present disclosure provides compositions and methods for modulating gene expression in GAS strains. In the group A Streptococcus a two- component system known as CovRS (or CsrRS) regulates about 15% of the genes, including several important virulence factors like the hyaluronic acid capsule. Most of these genes, including covR itself, are negatively regulated by CovR. Embodiments of the present disclosure provide methods and compositions of modulating GAS gene expression by modulating the expression of covR. It has been discovered that modulation of CovR can be accomplished, for example, by increasing or decreasing the expression of regulators of covR expression, for example RocA. In particular, it has been discovered that rocA activates CovR transcription at least about threefold.

Accordingly, the present disclosure also provides a method of modulating the expression of covR by increasing or overexpressing rocA in a GAS bacterium. As described more fully in the working Examples, it has been discovered that RocA positively regulates covR. CovR represses multiple genes in GAS organisms, and increasing the expression or levels of the CovR protein can be accomplished, for example, by increasing the amount of RocA protein in the bacterium. Thus, transforming a GAS bacterium with a polynucleotide encoding RocA, for example using a plasmid vector, can upregulate CovR by providing additional RocA protein. Alternatively, a GAS bacterium can be contacted with an activator of rocA which can increase endogenous expression of RocA protein, which in turn activates covR to increase endogenous levels of CovR protein, which in turn represses the expression of GAS genes including virulence genes.

Two-component signal transduction systems, including sensor kinases and DNA-binding response regulators, allow bacteria to respond differently to diverse environmental stimuli (Hoch, J. A. (2000) Two-component and phosphorelay signal transduction. Curr. Opin. Mocrobiol. 3:165-170; Russo, F. D., and T. J. Silhavy (1993) The essential tension: opposed reactions in bacterial two-component regulatory systems. Trends Microbiol. 1:306-310; Stock, J. B. et al. (1995); Two- component signal transduction systems: structure-function relationships and mechanisms of catalysis, p. 25-51; In J. A. Hoch and T. J. Silhavy (ed.), Two- component signal transduction (Americal Society for Microbiology, Washington D.C.). Therefore, another embodiment of the present disclosure provides methods and compositions for modulating bacterial responses to environmental stimuli by modulating the expression of two-component signal transduction systems, including for example the CovRS system. The CovRS system can be modulated as described herein by increasing endogenous transcription of covR, for example, by increasing levels of RocA protein in a GAS bacterium. Levels of RocA protein in a GAS bacterium can be increased by contacting the bacterium with an activator oϊrocA to increase endogenous expression of rocA, transforming the GAS bacterium with a vector encoding RocA polypeptide, or contacting the bacterium with RocA polypeptide directly such that the RocA polypeptide is delivered to the interior of the GAS bacterium.

In the sequenced Ml, M3 and Ml 8 GAS genomes, 13 two-component systems have been identified (Ferretti, J. J., et al. (2001) Complete genome sequence of an Ml strain of Streptococcus pyogenes Proc. Natl. Acad. Sci. USA 98:4658-4663) and several of them have been studied in various GAS strains. (Federle, M. J., et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181 :3649-3657; Graham, M. R., et al. (2002); Virulence control in group A streptococcus by a two-component gene regulatory system: global expression profiling and in vivo infection modeling. Proc. Natl. Adac. Sci. USA 99:13855-13860; Heath, A. et al. (2001); Identification of a major, CsrRS-regulated secreted protein of group A streptococcus. Microb. Pathog. 31 :81-89; Kreikemeyer, B. et al. (2001); Group A streptococcal growth phase- associated virulence factor regulation by a novel operon (Fas) with homologies to two-component-type regulators requires a small RNA molecule. Mol. Microbiol. 39:392-406). Among them, CovRS (also called CsrRS) is a major regulator, repressing at least seven known or presumed virulence factors, including the hyaluronic acid capsule synthesis operon (hasABC), pyrogenic extotoxin B (speB), the streptolysin S-associated operon (sag), streptokinase (ska), mitogenic factor/streptodornase (speMF/sda), and inhibitor of innate immunity (mac) (Bernish, B., and I. van de Rijn. (1999) Characterization of a two-component system in Streptococcus pyogenes which is involved in regulation ofhyaluronic acid production. J. Biol. Chem. 274:4786-4793; Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181 :3649-3657; Heath, A. et al. (1999) A two- component regulatory system, CsrR-CsrS, represses expression of three Streptococcus pyogenes virulence factors, hyaluronic acid capsule, streptolysin S, andpyrogenic exotoxin. B. Infect. Immun. 67:5298-5305; Lei, B. et al. (2001) Evasion of human innate and acquired immunity by a bacterial homolog of CD lib that inhibits opsonophagocytosis. Nat. Med. 7:1298-1305; Levin, J. C, and M. R. Wessels (1998) Identification of csrR/csrS, a genetic locus that regulates hyaluronic acid capsule synthesis in group A streptococcus. Mol. Microbiol. 30:209-219). In addition, CovR represses its own expression. (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181 :3649-3657) A recent analysis by microarray and realtime PCR indicates that CovR controls as many as 15% of the GAS genes, either directly or indirectly. (Graham, M. R., et al. (2002) Virulence control in group A streptococcus by a two-component gene regulatory system: global expression profiling and in vivo infection modeling. Proc. Natl. Adac. Sci. USA 99:13855-13860). It, therefore, seems likely that CovR is involved in a regulatory cascade. Thus, another embodiment of the present disclosure provides a method of modulating the pathogenesis or virulence of GAS strains by increasing endogenous expression of rocA or transforming a GAS bacterium with a polynucleotide encoding a functional polypeptide of RocA. The polynucleotide can be for example, SEQ. ED. NO. 2, or a portion thereof capable of producing a biologically functional RocA polypeptide and positively regulating covR to increase the endogenous expression of CovR. A biologically functional RocA polypeptide means a polypeptide capable of positively regulating the expression of covR either directly or indirectly. Response regulators usually act by binding to DNA in the vicinity of promoter sequences. This is true for CovR as well, since recent in vitro studies have shown that CovR binds near several covR -regulated promoters (Federle, M. J., and J. R. Scott (2002) Identification of binding sites for the group A streptococcal global regulator CovR. Mol. Microbiol. 43:1161-1172; Miller, A. A. et al. (2001) Epression of virulence genes by phosphorylation-dependent oligomerization ofCsrR at target promoters in S. pyogenes. Mol. Microbiol. 40:976-990). For example, CovR binds to the promoter region of hasA, sagA, ska, speB and speMF (Federle, M. J., and J. R. Scott. (2002) Identification of binding sites for the group A streptococcal global regulator CovR. Mol. Microbiol. 43:1161-1172; Miller, A. A.et al. (2001) Repression of virulence genes by phosphorylation-dependent oligomerization ofCsrR at target promoters in S. pyogenes. Mol. Microbiol. 40:976-990). In vitro binding studies with the Vhas region identified five CovR binding sites, all of which are required for complete CovR-mediated repression in vivo (Federle, M. J., and J. R. Scott (2002) Identification of binding sites for the group A streptococcal global regulator CovR. Mol. Microbiol. 43: 1161-1172). Thus, CovR appears to regulate the expression of some genes through direct interaction with their promoter regions. Although CovR is known to regulate the expression of different virulence genes, regulation of covRS expression is not well understood. It is known that CovR negatively regulates its own transcription (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649-3657) and that Rgg, a transcriptional regulator, activates covRS transcription (Chaussee, M. S. et al. (2002) Rgg influences the expression of multiple regulatory loci to coregulate virulence factor expression in Streptococcus pyogenes. Infect. Immun. 70:762-770). In addition, covR expression is also regulated by growth conditions. For example, covRS transcription reaches its maximum during the exponential growth phase and declines as the stationary phase beings (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649- 3657; Miller, A. A. et al. (2001) Repression of virulence genes by phosphorylation- dependent oligomerization ofCsrR at target promoters in S. pyogenes. Mol. Microbiol. 40:976-990). Nutritional conditions, such as amino acid starvation, also affect covRS transcription by some unknown mechanism. (Steiner, K., and H. Malke (2000) Life in protein-rich environments: the relA-independent response of Streptococcus pyogenes to amino acid starvation. Mol. Microbiol. 38:1004-1016). Therefore, the expression of the covRS operon may be controlled by a complex regulatory network.

RocA appears to activate CovR expression, which acts as a repressor on several promoters. It has been discovered that rocA mutant strains are mucoid and show more has transcription than the wild type (Fig. 4). This is consistent with RocA positively regulating covR since in the rocA mutant, less CovR is produced, and as a result, has transcription is de-repressed. 6. Methods for Treating GAS Infections

The present disclosure also provides methods and compositions for treating GAS infections, for example GAS infections in a mammalian host such as a human. For example, bacteria causing an infection can be contacted with an agent that modulates the expression of one or more genes, for example genes related to the virulence of GAS bacteria infecting the host. Because covR represses several GAS genes including genes related to virulence, methods of treating GAS infections in a host include contacting GAS bacteria infecting the host with a positive regulator of covR. A polynucleotide, for example a recombinant polynucleotide encoding a functional RocA polypeptide, can be administered to the site of a GAS infection. The GAS bacteria causing the infection can take up the polynucleotide and express the polynucleotide to generate additional RocA protein. The polynucleotide can be vector such as a plasmid having a polynucleotide that encodes a RocA polypeptide which is operably linked to a promoter. Contacting GAS bacteria with a vector encoding a RocA polypeptide to transform the bacteria can be accomplished using any number of techniques known in the art to facilitate bacterial transformation. Alternatively, the GAS bacteria can be contacted with a RocA polypeptide which can be delivered to the bacteria in a manner to facilitate the uptake of the polypeptide by the GAS bacteria. Transforming GAS bacteria with a vector encoding a functional RocA polypeptide can cause increased levels of RocA polypeptide within the transformed bacterium which in turn causes increased expression of covR. Increased expression of covR can increase the repression of CovR regulated genes, including virulence genes. Accordingly, the virulence or pathogenesis of a GAS infection can be reduced in a host by modulating the expression of covR with RocA. In a preferred embodiment, GAS bacteria infecting a host are transformed with a vector encoding a functional polypeptide of RocA, wherein the expression of the functional RocA polypeptide represses the expression of any one of a cysteine protease, hyaluronidase, pyrogeneic exotoxins, factors that are required for resistance to phagocytosis by the host immune system, such as M protein, C5a peptidase, hyaluronic acid capsule; and combinations thereof.

Similarly, methods for treating GAS-related diseases include administering to a mammalian host, for example, a human having a GAS-related disease or infection, a vector comprising a polynucleotide that encodes a functional RocA polypeptide and is operably linked to a transcription control element, for example a promoter. Suitable promoters are known in the art and can be found in Sambrook, J. et al. 2001.

Molecular Cloning: A Laboratory Manual 3^rd edition, Cold Spring Harbor Laboratory, which is incoφorated herein it its entirety. The administered vector can alleviate symptoms in a host by for example, reducing the pathogenesis or virulence of GAS bacteria by modulating the expression of GAS genes including virulence genes, for example hyaluronidase. Exemplary GAS-related diseases include necrotizing fasciitis, Streptococcal Toxic Shock Syndrome, pharyngitis, pyoderma, septicemia, and myositis.

Yet another embodiment of the invention provides a method for treating GAS infection in host by administering "naked" DNA to host, for example at the site of infection. The administered naked DNA can encode a RocA polypeptide. Naked DNA is known in the art and is generally described in Ulmer et al. (1993) Science 259:1745-1749, and reviewed by Cohen, Science (1993). 259:1691-1692, both of which are incoφorated by reference in their entirety. Examples of naked DNA include single or double stranded polynucleotides, preferably essentially without associated proteins such as histones and nucleosomes, arid vectors, such as a plasmids. Naked DNA can be administered to a host or site of infection, for example, by injection in saline or other buffers without the need for additional complex delivery systems or components.

Still another embodiment provides pharmaceutical compositions for treating GAS infections in a host. The pharmaceutical compositions include RocA polypeptides or polynucleotides encoding a functional RocA polypeptide. The polynucleotides encoding the RocA polypeptide can be operably linked to a promoter or can be administered in the form of naked DNA. The pharmaceutical compositions can include a pharmaceutically acceptable carrier, diluent, or buffer. The compositions of the present disclosure can be administered in combination with one or more additional therapeutic agents. Suitable therapeutic agents include antibacterial agents, anti-inflammatory agents, biocides, virucides, analgesic agents, antibiotics, and protease inhibitors. Suitable antibiotics include, but are not limited to, penicillins, cephalosporins, imipenem, meropenem, vancomycin, chloramphenicol, tetracyclines, macrolides, clindamycin, oxazolidinones, quinolones, rifampin, sulfonamides, and streptogramins. 7. Methods for Screening for covR Regulators

Another embodiment of the present disclosure provides compositions and methods for identifying regulators of covR expression including inactivating rocA in a GAS bacterium, for example using transposon insertion techniques or gene knock-out or knock down techniques; contacting the GAS bacterium with test compound; detecting covR expression in the GAS bacterium contacted with the test compound; and comparing the expression of covR expression in the presence of the test compound and in the absence of the test compound. Test compounds that cause an increase of covR expression as compared to covR expression in the absence of the test compound can be selected. Such test compounds can optionally be further screened for effects on GAS virulence in GAS infected hosts. It will be appreciated that covR expression can be detected using a reporter gene such as described in the Examples below.

Test compounds can also be selected by contacting rocA mutants with a test compound and observing changes in the rocA mutant phenotype. For example, when rocA mutants used in the screen are mocoid, regulators of covR expression can be identified by selecting compounds that reduce the mucoid phenotype of rocA mutants or alter the expression of a reporter gene operably linked a promoter regulated by CovR.

The invention also provides a method of screening compounds to identify those which enhance or block the biological action oirocA expression or RocA polypeptides, such as the increased expression of covR. An agonist is a compound which increases the natural biological functions of a RocA polypeptide or which functions in a manner similar to a RocA polypeptide, while antagonists decrease, interfere with, or eliminate such functions.

For example, extracts may be prepared from bacteria that express or contain a molecule that binds a RocA polypeptide. The preparation is incubated with labeled RocA polypeptide in the absence or the presence of a candidate molecule which may be a RocA polypeptide agonist or antagonist. The ability of the candidate molecule to bind the RocA polypeptide is reflected in the binding of the labeled ligand. Molecules which bind RocA polypeptide without inducing the effects of RocA polypeptides are most likely to be good antagonists. Molecules that bind well and elicit or increase effects that are the same as or closely related to RocA polypeptides, are good agonists.

Compounds selected according to the methods described herein can be used to regulated covR expression, for example in a host with a GAS infection by administering the compound or pharmaceutically acceptable derivative to the host. The host can be any mammal, for example a human. Further screening steps can be included for example, by determining whether the selected compound also interferes with the regulation of virulence genes. Compounds that increase the expression of covR and/or decrease the expression of virulence genes can then be selected for use, for example as treatments for GAS infections or related diseases. Additional screens of toxicity and side effects can also be performed, and a compound with reduced toxicity and minimal side effects can be selected.

Embodiments of the present disclosure also provide a method for identification of molecules that bind RocA or RocA complexes, for example transcription factors, ligands, or co-factors. Genes encoding proteins that bind RocA can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan et al., Current Protocols in Immunology 1(2): Chapter 5 (1991) which is incoφorated herein it its entirety.

In an exemplary method, a labeled RocA polypeptide can be photoaffinity linked to a bacterial extract prepared from bacteria that express a molecule that binds RocA. Cross-linked material is resolved by polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film. The labeled complex containing the ligand- RocA complex can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing can be used to design unique or degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding the putative receptor molecule.

8. Kits for Detecting Group A Streptococcus Another embodiment of the present disclosure provides a kit for the detection, quantification, or identification of GAS. An exemplary kit contains a polynucleotide probe that specifically hybridizes to at least a portion of the rocA sequence (SEQ. ID. NO.: 2). Because rocA is found only in GAS, the probe will not specifically hybridize with polynucleotides from other bacteria. The kit also contains printed instructions for performing a hybridization protocol using the disclosed probes. In addition, the kit can optionally include reagents, buffers, developers, and other items known in the art to facilitate the detection of GAS via hybridization with the disclosed probes.

The probes of the kit can be affixed to a solid support, for example a dipstick, microtiter plate, pin, metal, glass, plastic surface or microarray. In one embodiment, the dipstick can be exposed to a test sample and sealed in a container for later processing.

9. Administration

The relative amounts of the active ingredient, pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated. The relative amounts may further depend on the route by which the composition is to be administered. For example, the composition may contain from about 0.1% to about 100% (w/w) active ingredient. A unit dose of a pharmaceutical composition of the invention will generally contain from about 1 milligram to about 25 grams of the active ingredient, and preferably contains from about 50 milligrams to about 5 grams of the active ingredient.

Oral formulations may be prepared, packaged, and/or sold as a discrete solid dose unit such as a tablet, a hard or soft capsule, a cachet, a troche, or a lozenge, each containing a predetermined amount of the active ingredient. Other oral formulations include powdered or granular formulations, aqueous or oily suspensions, aqueous or oily solutions, and emulsions. As used herein, an "oily" liquid is a carbon-containing liquid molecule that exhibits a less polar character than water. Tablets containing polynucleotides or polypeptides of the present disclosure may be made by compressing or molding, in a suitable device, the active ingredient(s) alone or together with one or more additional ingredients. Compressed tablets may be prepared by compressing the active ingredient, when it is in a free-flowing form such as a powder or granular preparation, alone or together with one or more binders, lubricants, excipients, surface active agents, or dispersing agents. Molded tablets may be made by molding a mixture of the active ingredient, a pharmaceutically acceptable carrier, and sufficient liquid to moisten the mixture. Pharmaceutically acceptable excipients used for manufacturing tablets include inert diluents, granulating and disintegrating agents, binding agents, and lubricating agents. Known dispersing agents include potato starch and sodium starch glycollate. Known surface active agents include sodium lauryl sulphate. Known diluents include calcium carbonate, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate. Known granulating and disintegrating agents include corn starch and alginic acid. Known binding agents include gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, and hydroxypropyl methylcellulose. Known lubricating agents include magnesium stearate, stearic acid, silica, and talc.

Tablets may be non-coated or coated so as to achieve delayed disintegration of the tablet in the gastrointestinal tract of a subject. Coating tablets may provide sustained release and absoφtion of the active ingredient. Glyceryl monostearate or glyceryl distearate may be used to coat tablets. Methods for coating tablets are known and include the methods described in U.S. Pat. Nos. 4,256,108; 4,160,452; and 4,265,874 for forming osmotically-controlled release tablets. Tablets may include sweetening agents, flavoring agents, coloring agents, preservatives, or combinations thereof.

Hard capsules and soft gelatin capsules containing an active ingredient may be manufactured using a physiologically degradable composition, such as gelatin. Hard capsules can further include inert solid diluents such as calcium carbonate, calcium phosphate, and kaolin.

Soft gelatin capsules containing an active ingredient may be manufactured using a physiologically degradable composition, such as gelatin. Such soft capsules contain the active ingredient, which may be mixed with water or an oil medium such as peanut oil, liquid paraffin, or olive oil.

Polynucleotide or polypeptide pharmaceutical formulations that are suitable for oral administration may be prepared, packaged, and sold in liquid form or as a dry product intended for reconstitution with water or another suitable vehicle before ingestion. Liquid suspensions may be prepared using known methods for suspending the active ingredient in an aqueous or oily vehicle. Aqueous vehicles include water and isotonic saline. Oily vehicles include almond oil, oily esters, ethyl alcohol, vegetable oils (e.g., arachis, olive, sesame, or coconut oil), fractionated vegetable oils, and mineral oils (e.g., liquid paraffin). Liquid suspensions may further include one or more suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents. Oily suspensions may further include a thickening agent. Known suspending agents include sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives (e.g., sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose). Known dispersing or wetting agents include naturally-occurring phosphatides such as lecithin. Dispersing or wetting agents also include condensation products of alkylene oxide with fatty acids, long chain aliphatic alcohol, partial esters derived fatty acids and hexitol, or partial esters derived from a fatty acid and hexitol anhydride (e.g. polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate). Known emulsifying agents include lecithin, monoglycerides, and diglycerides. Known preservatives include methyl, ethyl, and n-propyl-para-hydroxybenzoates, ascorbic acid, and sorbic acid. Known sweetening agents include glycerol, propylene glycol, sorbitol, sucrose, and saccharin. Known thickening agents for oily suspensions include beeswax, hard paraffin, and cetyl alcohol.

Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, except that the active ingredient is dissolved rather than suspended in the solvent. Liquid solutions may include each of the components described for liquid suspensions with it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent. Aqueous solvents include water and isotonic saline. Oily solvents include almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Powdered and granular pharmaceutical compositions may be prepared using known methods. Such formulations may be administered directly to a subject or used, for example, to form tablets, fill capsules, or prepare aqueous or oily suspensions or solutions by adding an aqueous or oily vehicle thereto. Powdered and granular pharmaceutical compositions may further include one or more dispersing or wetting agents, suspending agents, preservatives, or excipients (e.g., fillers, sweetening agents, flavoring agents, and coloring agents).

Pharmaceutical compositions of the invention may also be prepared, packaged, or sold in the form of oil-in-water emulsion or a water-in-oil emulsion. The oily phase may be a vegetable oil (e.g., olive or arachis oil), a mineral oil (e.g., liquid paraffin), or a combination thereof. Emulsions may further include one or more emulsifying stabilizing agents such as gum acacia or gum tragacanth, phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate. Emulsions may also contain additional ingredients such as sweetening agents and flavoring agents.

As used herein, "parenteral administration" is characterized by administering a pharmaceutical composition through a physical breach of a subject's tissue. Parenteral administration includes administering by injection, through a surgical incision, or through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration includes subcutaneous, intraperitoneal, intravenous, intraarterial, intramuscular, intrastemal injection, and kidney dialytic infusion techniques.

Parenteral formulations can include the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Parenteral administration formulations include suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, reconsitutable dry (i.e. powder or granular) formulations, and implantable sustained-release or biodegradable formulations. Such formulations may also include one or more additional ingredients including suspending, stabilizing, or dispersing agents.

Parenteral formulations may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. Parenteral formulations may also include dispersing agents, wetting agents, or suspending agents described herein. Methods for preparing these types of formulations are known. Sterile injectable formulations may be prepared using non-toxic parenterally-acceptable diluents or solvents, such as water, 1,3-butane diol, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic monoglycerides or diglycerides. Other parentally-administrable formulations include microcrystalline forms, liposomal preparations, and biodegradable polymer systems. Compositions for sustained release or implantation may include pharmaceutically acceptable polymeric or hydrophobic materials such as emulsions, ion exchange resins, sparingly soluble polymers, and sparingly soluble salts.

Pharmaceutical compositions may be prepared, packaged, or sold in a buccal formulation. Such formulations may be in the form of tablets, powders, aerosols, atomized solutions, suspensions, or lozenges made using known methods, and may contain from about 0.1% to about 20% (w/w) active ingredient with the balance of the formulation containing an orally dissolvable or degradable composition and/or one or more additional ingredients as described herein. Preferably, powdered or aerosolized formulations have an average particle or droplet size ranging from about 0.1 nanometers to about 200 nanometers when dispersed.

As used herein, "additional ingredients" include one or more of the following: excipients, surface active agents, dispersing agents, inert diluents, granulating agents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents, preservatives, physiologically degradable compositions (e.g., gelatin), aqueous vehicles, aqueous solvents, oily vehicles and oily solvents, suspending agents, dispersing agents, wetting agents, emulsifying agents, demulcents, buffers, salts, thickening agents, fillers, emulsifying agents, antioxidants, antibiotics, antifungal agents, stabilizing agents, and pharmaceutically acceptable polymeric or hydrophobic materials. Other "additional ingredients" which may be included in the pharmaceutical compositions are known. Suitable additional ingredients are described in Remington's Pharmaceutical Sciences. Mack Publishing Co., Genaro, ed., Easton, Pa. (1985).

The ordinarily skilled clinician can determine and prescribe an effective amount of a the polynucleotide or polypeptide of the present disclosure for a subject using the methods described herein. To do so, the physician or veterinarian may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained. Other factors include the subject's age, body weight, general health, gender, and diet, the time of administration, the route of administration, the rate of excretion, other drugs used in combination.

Any mammal including rats, mice, hamsters, rabbits, cats, dogs, pigs, sheep, cows, horses, primates and humans may benefit from the methods and compositions described herein. The mammals may receive the polynucleotides or polypeptides in any of the forms described herein. It may be advantageous to administer polynucleotides or polypeptides as described herein to mammals having high risk factors for developing GAS infections. A mammal receiving polynucleotides or polypeptides as described herein can be referred to as the subject, host, or patient.

EXAMPLES Example 1 : Bacterial strains and media.

GAS (S. pyogenes) strain JRS4 is a streptomycin resistant derivative of serotype M6 strain D471. (Scott, J. R. et al. (1986) Conversion of an M group A streptococcus to M* by transfer of a plasmid containing an M6 gene J. Exp. Med. 164:1641-1651). The GAS strain RTG229 was derived from JRS4 and contains a copy of the Tn97f5-J4 transposon on the chromosome, which provides homology for recombination of the pVIT plasmids as described previously. (Caparon, M. G, and J. R. Scott. (1991) Genetic manipulation of pathogenic streptococci. Methods Enzymol. 204:556-586; Geist, R. T. et al. (1993); Analysis of Streptococcus pyogenes promoters by using novel Tn916-based shuttle vectors for the construction of transcriptional fusion s to chloramphenicol acetyltransferase. J. Bacteriol. 175:7561- 7570). All GAS strains described here are derivatives of JRS4 and RTG229. Escherichia coli XLl-Blue (Stratagene) and TGI Rep (Sambrook, J., E. F. Fritsch, and T. Maniatis (1989) Molecular cloning: a laboratory manual, 2^nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) were used as the hosts for plasmid construction and were grown in Luria-Bertani broth with agitation (Scott, J. R. (1972) A new gene controlling lysogeny inphage PL Virology 48:282-283). GAS strains were grown at 37°C without agitation in Todd-Hewitt broth supplemented with 0.2% yeast extract (THY). Antibiotics were used a the following concentrations: ampicillin at 100 μ ml for E. coli, chloramphenicol at 30 μg/ml for E. coli and 10 μg/ml for GAS, erythromycin at 500 μg/ml for E. coli and 1 μg/ml for GAS, kanamycin at 50 μg/ml and 200 μg/ml for GAS, and spectinomyein at 100 μg/ml for both E. coli and GAS.

Example 2: Construction of the pVIT GAS strain used to measure Pcov expression.

The VIT system was used to deliver the Pcov-gusA reporter fusion in single copy to an ectopic chromosomal location to study Pcov expression (Caparon, M. G, and J. R. Scott (1991) Genetic manipulation of pathogenic streptococci. Methods Enzymol. 204:556-586). The pVIT plasmid contains regions of homology to the resident Tn916-J4 transposon on the RTG229 chromosome. A DNA fragment containing the Pcov-gusA reporter was cloned into the homologous region of p VIT for integration into the chromosome.

The covR promoter region used for translational fusions was amplified from the JRS4 chromosome by suing primers. Primer Rl-CovOrfl corresponds to the following nucleotide sequence: gaattcTGGTATTAGTTTTAGACAAAGACGC (SEQ. ID. NO.: 8) Primer Cov-GusAS corresponds to the following nucleotide sequence: tctagaTGTCATTTATACCAACCCTTATCCTCTTA (SEQ. ID. NO.: 9). The restriction site at the 5' end of each primer is indicated by lowercase letters, and the sequence homologous with the chromosome is indicated by uppercase letters. The 504-bp amplified fragment, which contains the covR promoter, untranslated sequence, and two codons, was blunt end ligated into S/wαl-digested pBluescript II KS (Stratagene) to generate pEU7415. To clone the gusA reporter gene in frame with covR, the Xbal site that was inserted into the primer was used.

The gusA gene (1.8 kb) was amplified from plasmid pNZ8008 (de Ruyter, P. G. et al. 1996. Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. (J. Bacteriol. 178:3434-3439) by using primers GusL gctctaga ATGTTACGTCCTGTAGAA (SEQ. ID. NO.: 10) and GusR gctctagaTCATTGTTTGCCTCCCTG (SEQ. D. NO.: 11) and was restricted with Xbal (site synthesized into the primer, underlined) (Fig. 1). In Fig. 1, the symbols are bent arrow, covR promoter; white box, ribosome binding site of CovR; checkered box in front of gus A, first two amino acids of CovR; broken black arrow, part of the upstream ORF present in the Pcov-gusA fusion. Arrowheads indicate primers used for PCR analysis. The orientation of Pcov-gusA relative to the native covRS locus is unknown. The Xbal fragment containing the gusA gene was ligated to -Ybαl-restricted pEU7415 to create pEU7416. The orientation of gusA and the in-frame fusion of the Pcov-gusA gene were verified by sequencing .

To insert the Pcov-gusA reporter fusion at the PVIT locus, plasmid pVIT164 (Geist, R. T. et al. (1993) Analysis of Streptococcus pyogenes promoters by using novel Tn916-based shuttle vectors for the construction of transcriptional fusion s to chloramphenicol acetyltransferase. J. Bacteriol. 175:7561-7570) was used. APstl- Sacl fragment from PEU7416 carrying Pcov-gusA was cloned into stl-SαcI-digested PVIT164 to generate pJRS2227. Plasmid PJR52227 was linearized with RvwEl and transformed into RTG229 to produce JRS2227 as described previously (Caparon, M. G., and J. R. Scott (1991) Genetic manipulation of pathogenic streptococci. Methods Enzymol. 204:556-586). JRS2227 is kanamycin resistant and erythromycin sensitive, and the presence of both junctions of the Pcov-gusA fusion at the pVIT locus was verified by PCR.

Example 3: Isolation of roc A mutants.

The procedure described by Maguin et al. (Maguin, E. et al. (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931-935) was used to generated insertion mutants of GAS. Briefly, JRS2227 was transformed with PGhost9::ISS7 and transformants were selected on THY agar containing kanamycin and erythromycin at 30°C. An overnight culture was made from a single transformed colony at 30°C with erythromycin. Cultures were diluted 100-fold in the same medium, grown for 2 h at 30°C, and then shifted to 37°C for 2.5 h to select for transposition. Insertion mutants were selected on THY agar containing kanamycin and erythromycin at 37°C.

The location of the inserted ISS7 element was identified by one of the two methods. A template generated by self-litigation of H cΛII-digested chromosomal DNA was subjected to inverse PCR by using primers GATTGTAACGTAGATAATAACCAACAGC (SEQ. ID. NO.: 12; ISS7Routl) and GCAAGAACCGAAGAAATGGAACG (SEQ. ED. NO.: 13; ISSiFoutl). The PCR product was sequenced with primer AATAGTTCATTGATATATCCTCGCTGTCA (SEQ. ED. NO.: 14; ISSi-Rout2) to identify the flanking sequences. Alternatively, the self-ligated produce was used to transform E. coli TGI and erythromycin-resistant transformants were selected. Plasmid DNA containing flanking sequence was isolated and sequenced with primer GGTCTTAATGGGAATATTAGC (SEQ. ED. NO.: 15; ISS/^"-For4) as previously described (Duwat, P. et al. (1997) Characterization of Lactococcus lactis UV-sensitive mutants obtained by ISS1 transposition. J. Bacteriol. 179:4473-4479). The flanking sequences were identified by comparison to the Ml and M5 genome sequences. Colonies in which the plasmid vector sequence had been excised from the chromosome were obtained by growth at 30°C without antibiotic selection, which permits plasmid replication. (Maguin, E., Η. Prevost, S. D. Ehrlich, and A. Grass (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931-935). Erythromycin-sensitive (Em^s) colonies, indicating that the plasmid had been excised, were selected by plating on solid medium at 37°C. Em^s colonies were confirmed for loss of the plasmid sequence by PCR with primers homologous to the flanking regions.

Two independent ISSi insertions in an open reading frame (ORF) were isolated. The ORF named rocA for "regulator of Cov," activates CovR transcription about threefold. As expected, a rocA mutant is mucoid and produces more transcript from the has promoter since the promoter is repressed by CovR. This effect is dependent on the presence of a wild-type covR gene. En contrast to its activation of Pcov, RocA negatively regulates its own expression. This autoregulation is not dependent on the presence of the covR gene. All the phenotypes of the rocA mutant were complemented by the presence of the roc A gene on a plasmid. The rocA gene is present in strains of all nine M stereotypes of GAS tested and is absent from strains representing 1 1 other groups of streptococci and related bacteria, including strains of the closely related group C and G streptococci, roc A plays an important role in the pathogenesis of GAS since it affects expression of the global regulation CovR.

Example 4: Insertional inactivation oϊrocA. To create plasmids for inactivation of the roc A gene, a fragment internal to the coding region was amplified from JRS4 with high-fidelity Herculase polymerase (Stratagene) with primers AGCATTCAAGATACCTTCATAAGTAAGTCT (SEQ. ID. NO.: 16) and TCCACTAGTGTCTATTAGTTTGGTTAAGCG (SEQ. ID. NO.: 17). The amplified fragments were blunt end ligated to Swαl-restricted pUC- Spec (Husmann, L. K., D. L. Young, S. K. Hollingshead, and J. R. Scott. (1997)

Role of putative virulence factors of Streptococcus pyogenes in mouse models of long- term throat colonization and pneumonia. Infect. Immun. 65:1422-1430), a suicide vector unable to replicated in GAS, to create PEU7457 (Fig. 2). Figure 2 shows plasmid pEU7457 (circle), which was used for insertional inactivation, contains a region internal to the rocA ORF (thick hatched box) and contains aad9, which encodes spectinomycin resistance (thick black arrow). The direction of transcription of the ORFs flanking rocA is indicated by striped arrowheads. The region oϊrocA that was cloned in complementing plasmid pJRS2266 is indicated by a bar below the chromosome. (B) JRS2268 was produced by homologous recombination (indicated by the X above the representation of the chromosome in panel A), which inserted pEU7457 into the wild-type rocA gene in the JRS2227 chromosome. (C) JRS2278 was produced by a similar targeted insertion in JRS4 by using integrational plasmid pEU7460, which contains erm, encoding erythromycin resistance (gray box), and a region internal to the roc A ORF (thick hatched box) as shown. Sumbols: dotted lines, chromosome; striped boxes, coding regions with the directions of transcription indicated by the arrowheads; bent arrow, putative promoter; triangles, ISSi insertion sites; lollipop, putative rho-independent transcription terminator. Small arrowheads below the chromosome represent primers used to confirm plasmid insertion into the chromosome. The figure is not drawn to scale. The amplified internal rocA fragment was also blunt end ligated to S/wαl-restricted pSK-Erm (a pBluescript SK derivative in which the ampicillin resistance gene has been replaced with the erythromycin resistance gene from Tn/545: 1. Stojiljkovic, unpublished data) to generatepEU7460 (Fig 2). Plasmid PEU7457 was introduced into JRS2227 by electroporation, and transformants were selected on THY agar with spectinomycin. A spectinomycin- resistant transformant resulting from homologous single-crossover integration of pEU7457 into the GAS chromosome and inactivation of the rocA gene was named JRS2268. The plasmid-chromosome junctions of JRS2268 were verified with the following primer pairs 5' junction. ccgaattcCTGATTTAATCTTTTAAGCTGT ((SEQ. ED. NO.: 18)RocASl; see Fig. 2, arrowhead 1)) and

GGAAACAGCTATGACCATG (SEQ. ID. NO.: 19) (M13Rev; see Fig 2, arrowhead 2); 3' junction, ccgaattcATTAGTAATAGATTAACATATT ((SEQ. ED. NO.: 20) RocAAl : see Fig. 2, arrowhead 4) and TGTAAAACGACGGCCAGTG ((SEQ. ED. NO.: 21) M13for: see Fig. 2, arrowhead 3). The rocA gene was also inactivated in strains JRS4, JRS948 (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649-3657), JRS964, JRS965, and JRS966 (Alouf, J., and H. Muller- Alouf (1996) Cellular constituents and extracellular proteins involved in the pathogenic capacity of Streptococcus group A. Ann. Pharm. Fr. 54:49-59; Federle, M. J., and J. R. Scott. (2002) Identification of binding sites for the group A streptococcal global regulator CovR. Mol. Microbiol. 43:1161-1172) by transformation with pEU7460 and selection for erythromycin-resistant transformants. This generated JRS2278, JRS2279, JRS2351, JRS2285 and JRS2286, respectively. These strains, in which rocA was inactivated, were verified by PCR across the plasmid-chromosome junctions by using primer pairs RocASl and M13For for the 5' function and RocAAl and M13Rev for the 3' junction.

Example 5: Construction of the røC4-complementing plasmid pJRS2266.

A PCR fragment containing all oϊrocA and 330 bp upstream of its start codon was amplified from JRS4 by using primers RocASl and RocAAl, which introduced unique EcoRI sites at both ends. The resulting 1.78 kb fragment (SEQ. ID. NO.: 3) was digested with EcoRI and ligated into EcoRI-digested pLZ12. (de Vos, W.M. 1986). Genetic improvement of starter streptococci by the cloning and expression of the gene coding for a non-bitter proteinase; biomolecular engineering programme - final report, p. 465-472. In E. Magnien (ed.), Biomolecular engineering in the

European Community: achievements of the research programme (1982-1986)-final report. (Martinus Nijhoff, Lancaster, England), a chloramphenicol resistance- encoding natural shuttle vector able to replicate in GAS, to create pJRS2266.

Example 6: Deletion of the covR gene.

Plasmid pEU7529 was used to delete covR from the GAS strains (A. Gusa and J.R. Scott, unpublished). This plasmid was constructed from pJRS943 (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus J. Bacteriol. 181 :3649-3657), which contains, in addition to the covR ORF, the upstream and downstream regions. Plasmid pJRS943 was restricted with Bsgl and Xaml to delete covR and blunt ended (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus J. Bacteriol. 181 :3649-3657). A spectinomycin resistance-encoding cassette was isolated by Smal restriction from pSL60-I (Lukomski, S. et al. (2000) Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype Ml Streptococcus pyogenes significantly decreases mouse mucosal colonization. Infect. Immun. 68:535- 542) and ligated to -9sg/--¥αm7-restricted and blunted pERS943 to create pEU7521. The ampicillin resistance gene from pEU7521 was removed by Pvul digestion, followed by self-ligation, to generate pEU7529. Plasmid pEU7529 was linearized by Sad and transformed into JRS2227 and JRS2281. Spectinomycin-resistant transformants containing the covR deletion were selected and were confirmed for the replacement of the covR gene by PCR as previously described (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649-3657). Example 7: RNA blot analysis.

GAS strains were cultured in THY, and growth was monitored by using a Klett-Summerson colorimeter with a red filter. Total RNA was isolated from different phases of growth as described previously (Biswas, I. et al. (2001) Generation and surface localization of intact M protein in Streptococcus pyogenes are dependent on sagA. Infect. Immun. 69:7029-7038), except that glycine was omitted from the medium. RNA was pelleted by sedimentation through 5.7 M CsCl (McDonald, P. M. et al. (1984) Regulation of a bacteriophage T4 late gene, SOC, which maps in an early region. Genetics 106:17-27) or by FastPrep (Bio 101) (Biswas, I. et al. (2001) Generation and surface localization of intact M protein in Streptococcus pyogenes are dependent on sagA. Infect. Immun. 69:7029-7038) as described previously. DNase I-treated RNA was assayed on Zeta-Probe membranes (Bio-Rad) as previously described (Biswas, I. et al. (2001) Generation and surface localization of intact M protein in Streptococcus pyogenes are dependent on sagA. Infect. Immun. 69:7029-7038). DNA probes were prepared by PCR amplification with the JRS4 chromosomal DNA as the template. The primer pairs used in this study are the following: covR, CAGCTATTCTTTGATATACTCTTTAGAG ((SEQ. ID. NO.: 22) 5Cov) and Cov-GusAS; gyrA, GATCTGCAGGAATACGACTCATTTCTCTTTATCCC (SEQ. ED. NO.: 23) and GTCATCCTGACCGCTTGTCAAAAGG (SEQ. ID. NO. : 24); hasA,

GAGAGAGAATTCACCTAGGAGTGTTTGATTTT ((SEQ. ED. NO.: 25) intHasAl) and GAGGAGGAATTCAGATGCCGAGTCATTA ((SEQ. ED. NO.: 26) intHasSl); sagA. GGAGGTAAACCTTATGTTAA ((SEQ. ID. NO.: 27) SagAL) and AGATTATTTACCTGGCGTAT ((SEQ. ED. NO.: 28) SagAR).

Example 8: GusA assays.

For plate assays, 10 μl volumes of overnight GAS cultures were spotted onto THY agar plates containing 200 μg of X-Glu (Gold Biotechnology, Inc.) per ml. GAS strains that produced low GusA activity were white, while strains that produced high GusA activity were blue. Specific activity of GusA was assayed from GAS cultures grown to late exponential phase as previously described (Eichenbaum, Z. et al. (1998) Use of the lactococcal nisA promoter to regulate gene expression in gram- positive bacteria: comparison of induction level and promoter strength Appl. Environ. Microbiol. 64:2763-2769). For some experiments, GAS cultures were grown in THY broth buffered with 100 MM Tris-HCl at pH 7.2. The rate of hydrolysis was standardized by comparison to known concentrations of glucuronidase (Sigma catalog no. 500-0006). One unit of GusA activity was defined as that which liberates 1 μg of phenolphthalein from (phenolphthalein glucuronide)/h/mg of protein of GAS lysate at 37°C, pH 6.8. The protein concentration was determined by the Bio- Rad protein assay standardized against bovine serum albumin (BSA).

Example 9: Construction of the Pcov-gusA reporter strain and isolation of rocA mutants.

To facilitate studies of the regulation of the CovRS operon, a Pcov-gusA reporter strain was constructed. The entire promoter region of covR, including the untranslated leader sequence and the first two codons of the covR ORF, was fused to a gusA reporter gene to create a translational fusion. By using the pVIT system, this Pcov-gusA reporter fusion was then integrated at an ectopic location and the chromosome of strain RTG229 (Geist, R. T. et al. (1993) Analysis of Streptococcus pyogenes promoters by using novel Tn916-based shuttle vectors for the construction of transcriptional fusion s to chloramphenicol acetyltransferase. J. Bacteriol. 175:7561-7570) and M6 GAS strain derived from JRS4, to generate JRS2227 (Fig. 1). In this strain, the native covRS region remains unaltered.

Ensertional mutagenesis was used to identify potential activators of covR expression. For this puφose, the insertion sequence ISSi was used because it appears to insert itself randomly into the genome of gram-positive bacteria, including various streptococci (Maguin, E et al. (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931-935; Thibessard, A. et al. (2002) Transposition ofpGh9:ISSl is random and efficient in Streptococcus thermophilus CNRZ368. Can. J. Microbiol. 48:473-478), and because it rarely inserts itself more than once into the same cell (Maguin, E. et al. (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931- 935; Spellerberg, B. et al. (1999) Identification of genetic determinants for the hemolytic activity of Streptococcus agalactiae by ISS1 transposition J. Bacteriol. 181 :3212-3219; Thibessard, A. et al. (2002) Transposition ofpGh9:ISSl is random and efficient in Streptococcus thermophilus CNRZ368. Can. J. Microbiol. 48:473- 478). This transposon was introduced into JRS2227 on pGhost9::ISS7, a plasmid whose replication is temperature sensitive (Maguin, E. et al. (1992) New thermosensitive plasmid for gram-positive bacteria. J. Bacteriol. 178:931-935). An erythromycin-resistant (Erm^r) transformant containing pGhost9::ISSi was grown overnight at 30°C, and Erm^r colonies containing the transposon were isolated at 37°C. In three different experiments, the transposition frequency (as measured by the number of Erm^r resistant colonies divided by the total number of colonies at 37°C) was between 0.3 and 0.5%, which is comparable to frequencies obtained for ISSi transposition in other streptococci. (Spellerberg, B. et al. (1999) Identification of genetic determinants for the hemolytic activity of Streptococcus agalactiae by ISS1 transposition. J. Bacteriol. 181 :3212-3219; Thibessard, A. et al. (2002) Transposition ofpGh9:ISSl is random and efficient in Streptococcus thermophilus CNRZ368. Can. J. Microbiol. 48:473-478; Ward, P. N. et al. (2001) Identification and disruption of two discrete loci encoding hyaluronic acid capsule biosynthesis genes hasA, hasB, and has C in Streptococcus uberis. Infect. Immun. 69:392-399).

The has operon is negatively regulated by CovR and is required for production of the hyaluronic acid capsule (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus J. Bacteriol. 181 :3649-3657). Inactivation of an activator of Pcov would cause increased transcription of Phas because there would be less CovR expression. This would result in a mucoid colony phenotype in the JRS4-derived GAS strain JRS2227, which produces very little capsule. Therefore, the JRS2227 colonies containing inserted ISSI were screened for a mucoid phenotype. Mucoid colonies were then tested by a plate assay by using X-Glu to monitor expression of GusA from the Pcov- gusA reporter fusion in the strain. A defect in expression of Pcov results in production of white colonies. Among the mucoid colonies, approximately 30% were white.

To eliminate any possible insertion in the covR operon, the size of the covRS region was verified by PCR amplification with primers 1 plus 2, 3 plus 4 and 5 plus 6 (Fig. 1), which include the region upstream of the covRS operon, as well as the entire covRS operon. The clones that showed wild-type-size fragments, suggesting an intact covRS region, were chosen for further analysis. The site of the ISS/ insertion was identified as described above for 31 of the mucoid white colonies. In all 31 cases, Southern hybridization analysis showed that ISS/ insertion had occurred at only one location. Among these mutants, more than one independent insertion had occurred in eight different genes. Four of these genes (SPyl032 [hylA], SPy481, SPyl505, and a conserved ORF [SPyM18_0587 absent from the Ml and M3 genomes but present in the M5 and Ml 8 genomes) had multiple insertions in the same location and thus could be sisters. Multiple independent insertions at different locations were found in each of the four remaining genes. SPyl981 (relA), SPyl605, SPyl59 and SPy0534 (aroE). Although none of the genes into which ISS/ had inserted itself showed homology to any known transcriptional regulator, SPyl605 showed some homology to sensor kinases (see below), which are involved in gene regulation. Therefore, studies were focused on SPyl605, which is renamed rocA (for "regulation of covR"; see below). The rocA gene encodes a polypeptide of 451 residues (SEQ. ID. NO.: 1). Two independent ISS/ insertions had occurred in this gene and were located within codons 25 and 91, respectively. The roc A gene is preceded by a putative promoter region upstream of the translational start codon and followed by a potential rho-independent terminator just down stream of the stop codon (Fig 2A). The gene downstream of roc A is transcribed in the opposite direction, which makes it unlikely that the ISS/ insertions would have polar effects.

Example 10: RocA regulates the expression of covR.

To be sure that the phenotype of the rocA insertion mutation did not result from additional spontaneous mutations elsewhere in the genome, the rocA gene in the nonmutagenized Pcov-gusA reporter strain JRS2227 was inactivated. A PCR- amplified fragment internal to the coding region oϊrocA was cloned into the suicide vector pUC-Spec. (Husmann, L. K., D. L. Young, S. K. Hollingshead, and J. R. Scott. (1997) Role of putative virulence factors of Streptococcus pyogenes in mouse models of long-term throat colonization and pneumonia. Infect. Immun. 65:1422-1430) to produce PEU7457. Following introduction of this plasmid into JRS2227, recombinants in which pEU7457 had been integrated into rocA were selected as Spec ^r colonies. This integration results in inactivation of the rocA gene (Fig. 2B). In these integrants, the junctions between the integrated plasmid and the chromosome were identified by PCR analysis (by using primers 1 plus 2 and 3 plus 4 [Fig. 2B]). In addition PCR with primers 1 plus 4 failed to amplify a full-length copy of roc A. Transcription of Pcov was quantitated in these strains by measuring the activity of GusA produced from Pcov-gusA reporter fusion (Fig. 3 A). For this assay, cells were grown in THY broth and harvested late in the exponential phase (Fig. 3B). The rocA mutant strain (JRS2268) showed threefold less Pcov-gusA expression than its rocA⁺ parent (JRS2227, Fig. 3C). A DNA fragment including rocA with its potential promoter region was cloned into pLZ12, which replicates in GAS, to generate pJRS2266 (Fig. 2A). As a control, JRS2268 (rocA) containing the vector pLZ12 was used. This control strain had the same GusA activity as strain JRS2268/pJRS2266, expressed about twofold more GusA than the parental rocA⁺ strain, JRS2227. Thus, when RocA was overexpressed from the multicopy plasmid, Pcov expression was not only restored but was increased above the wild-type level (Table 1). Therefore, it appears that RocA activates expression from the Pcov promoter.

Table 1. The values shown are units of glucuronidase activity (with standard errors of the mean of experiments repeated at least four times). The relative ratio of GusA activity with respect to that of the wild type (WT) is shown.

Example 11: CovR is not required for the activation of Pcov by RocA.

Because CovR represses its own transcription by binding to DNA in the Pcov region (Gusa and Scott, personal communication), it seemed possible that RocA could activate Pcov by affecting the interaction of CovR with the Pcov promoter DNA. If RocA acts on Pcov through CovR, then in the covR rocA double mutant, Pcov expression should be the same as in a covR single mutant. If RocA and CovR act independently on Pcov, however, the decrease in transcription in the rocA mutant should be independent of the status of covR (mutant or wild type). To assay this, GusA specific activity was measured at the mid-exponential phase of growth. The results (Table 2) show a 2.4-fold decrease in Pcov transcription in the rocA mutant compared to that in the rocA⁺ parent. The decrease was seen in both covR⁺ and covR mutant strains. Similarly, inactivation oϊcovR resulted in a 2.7 fold increase in Pcov- gusA transcription in both the rocA⁺ and rocA mutant strains. This strongly suggests that the two systems that regulate Pcov are independent.

Table 2. Regulation o covR expression by RocA is independent of functional CovR

Strain Genotype Gus activity (U/mg)^α

JRS2227 covR rocA 136 ± 23

JRS2281 covR⁺ rocA 50 ± 6

JRS2289 covR rocA⁺ 332 ± 62

JRS2290 covR rocA 123 ± 10

" Regulation o covR expression was measured from the Pcov-gusA fusion at mid- exponential phase. The values shown represent the average GusA activity of two independent experiments.

Example 12: Effect of RocA on transcription of the has operon.

Since the original rocA insertion mutants appeared mucoid, as expected of a strain deficient in an activator or Pcov, confirmation that the increased mucoidy resulted from an increase in transcription of the capsule-encoding operon hasABC was needed. To avoid any complications that might result from an ectopic reporter fusion assay, has operon transcript was measured directly. For this puφose the rocA locus in strain JRS4 was inactivated by single-crossover integration of pEU7460 (Fig. 2C). The plasmid-chromosome junctions of the resulting rocA mutant strain, JRS2278, were verified by PCR (by using primers 1 plus 3 and 2 plus 4) (Fig. 2C) as described above.

RNA was isolated from strains JRS4, JRS2278, and JRS2278/ρJRS2266 in the mid- and late exponential growth phases (M and L, respectively, in Fig. 4A) and assayed by hybridization to a PCR-derived hasA probe. To ensure that equal amounts of mRNA from each strain were loaded on the filter, all samples were hybridized with a gyrA probe (Fig. 4B). JRS2278 (rocA) had two- to threefold more hasA transcript than JRS4 at both stages of growth. This is as expected if RocA activates Pcov to produce more CovR repressor. The complemented strain, JRS2278/pJRS2266, produced two- to threefold less hasA transcript than the JRS4 wild-type strain. This suggests, as above (Fig. 3), that rocA is overexpressed from pJRS2266, which results in oveφroduction of CovR for repression oϊPhas.

Example 13: Regulation of Phas by RocA requires function CovR. It seemed likely that RocA decreases Phas transcription indirectly by activating Pcov to produce more CovR. To study this, two separate approaches were used, one of which relied on GusA activity produced from a Phas-gusA fusion and the other of which relied on direct measurement of the has A mRNA level.

Federle and Scott (Federle, M. J., and J. R. Scott. 2002). Identification of binding sites for the group A streptococcal global regulator CovR (Mol. Microbiol. 43:1161-1172) identified the binding sites at the Phas promoter for CovR and constructed mutants with two base substitutions at conserved T-T pairs at each of these sites. In two of these Phas mutants, Phas is still transcribed but is insensitive to repression by CovR. If RocA acts on Phas indirectly through CovR, a rocA mutation should not affect transcription of the Phas mutants that are not CovR regulated. In the Phas-gusA fusion with no mutations in the promoter region, the rocA strain produced approximately four- fold more GusA activity than the wild type (Fig. 5A). In contrast, in the Phas-gusA strain mutated at CovR binding site 1 (CB-1), there was no increase in GusA expression in the rocA mutant compared to that in the rocA* strain. Instead lower GusA activity was observed in the rocA mutant. However, in the other Phas- gusA strain, in which CB-5 is altered, mutation of the rocA gene did not change GusA specific activity (Fig. 5A). This implies that RocA probably acts on the Phas promoter indirectly through CovR.

To confirm this observation, the amount oϊhas transcript was measured. As shown above (Fig. 4), JRS2278 (rocA⁺) shows about twofold more Phas transcript than its rocA⁺ parent, JRS4. However, in JRS948 (covR), JRS2279 (covR rocA), and JRS2279/pJRS2266 (covRrocA/rocA⁺), the level oϊhas A transcript remained the same (Fig. 5B). This is consistent with the above result from the Phas promoter mutants and suggests that the increased has expression seen in the rocA mutant is mediated by CovR. Therefore, it appears that RocA decreases Phas transcription by activating transcription of Pcov and producing more CovR.

Example 14: RocA negatively regulates its own expression

Since it is not uncommon or transcriptional regulators to control their own synthesis, RNA hybridization analysis was used to test this for roc A. As before, RNA was harvested at the mid- and late exponential phases (Fig. 4A) and normalized to gyrA for the loading control on slot blots. At both stages of growth, there was two- to fourfold more rocA transcript in JRS2278 (rocA) than in JRS4 (rocA⁺) (Fig. 6). This suggests that RocA, which activates covR, negatively regulates its own expression (either directly or indirectly). Although rocA transcript appears more plentiful in the mid-exponential phase than in the late exponential phase, autoregulation persists in the later stage of growth.

The autoregulation of RocA is independent of functional CovR. The RocA sequence contains no elements suggestive of a DNA binding protein, so its negative autoregulation is likely to be indirect. RocA activates transcription of CovR, and CovR is a negative regulator of many GAS promoters, so it seemed possible that negative autoregulation oϊrocA expression might also be mediated by CovR. To investigate this, the rocA transcript levels were quantitated in a covR mutant and its wild-type parent. The RNA was harvested in the late exponential and early stationary phases from cells grown in THY broth, and hybridization to an rpsL probe was used as a loading control. No difference was detected in the amount oϊrocA transcript in RNA from JRS4 (covR⁺) and JRS948 (covR) (Fig. 7). One of the genes repressed by CovR is sagA, which encodes streptolysin S. (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649-3657), so an internal sagA fragment was also used to probe the same RNA to make sure the JRS948 strain had not mutated. As previously shown (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181 :3649-3657), JRS948 produces much more sagA transcript than its covR⁺ parent, JRS4 (Fig. 7). From these results, it appears that RocA negative autoregulation does not depend on the presence of functional CovR protein.

Example 15: RocA is present in most GAS strains and not in strains of other streptococcal species.

CovR is a major global regulator in all strains of GAS examined, and it appears from the above that RocA regulates the expression of CovR. Therefore, the prevalence oϊrocA in the different GAS strains was investigated. To investigate the distribution oϊrocA among the different streptococci, two approaches were used. First, a BLAST search with the rocA nucleotide sequence against the available GAS genome sequences showed that this gene is present in the sequenced Ml, M3, M5, and Ml 8 strains. A similar search found no significant homology to genes in any sequenced strains of other streptococcal species.

To expand these observations, Southern hybridization was used to investigate the presence of a rocA homolog in strains representing nine of the multilocus enzyme electrophoresis types of GAS (Musser, J. M. et al. (1991) Streptococcus pyogenes causing toxic-shock-like syndrome and other invasive diseases: clonal diversity and pyrogenic exotoxin expression. Proc. Natl. Acad. Sci. USA 88:2668-2672). For this analysis, a 1.78-kb fragment (SEQ. ID. NO.: 3) including the complete rocA gene was used as a probe and the hybridization was carried out under stringent conditions (Fig. 8). This probe hybridized with two H dIII fragments that differ in size and two H dIII fragments of variable size indicate that regions flanking rocA vary among the GAS strains and correspond to the predicted sizes for Ml, M3, M5, and Ml 8 strains. The two constant Htwdlll fragments were -0.92 (SEQ. ED. NO.: 4)and -0.23 kb long (SEQ. ED. NO.: 5). The 0.92-kb fragment (SEQ. ED. NO.: 4) is internal to rocA, and the 0.23-kb fragment (SEQ. ED. NO.: 5) includes 0.14 kb of upstream DNA. These results demonstrate that rocA is present only in GAS and is absent from related bacteria, including the closely related streptococci of groups C and G.

In particular, the probe failed to hybridized with representatives of group B, C, D, E, F, Η, L, M, N, or O, S. pneumoniae, S. mutans, E.feacalis and L. lactis. The strains used include GBS: B090R; GCS: C76; GDS: D76; GES: K131; GFS: F686; GGS: D166B; GΗS: F90A; GLS: D167A; GMS: D167A"X"; GNS: C559; GOS: B361. Southern hybridization was performed at 42°C overnight in Z-hybridization buffer containing high salt and formamide. The actual composition of the Z- buffer is shown below. After hybridization, the membrane was washed under stringent conditions. Briefly, membranes are washed two times in 2X SSC and 0.1%SDS at 42°C for 10 minutes each followed by two more washes in 0.5X SSC and 0.1 % SDS at 42°C for 15 minutes each.

Z-Buffer: 50% Formamide, 6X SSC, 50mM Na₂HPO₄, 2X Denhardt's Solution, 0.3% SDS. 50X Denhardt's Solution: 5 gm. Ficol, 5 gm polyvinylpyrrolidone, 5 gm BSA plus water to 500 ml. SDS: Sodium dodecyl sulfate. 20X SSC: 3M NaCl, 0.3 M trisodium citrate.

Stringency refers to the conditions of the hybridization as compared to the T_m. It is a relative term that is related to the T_m and reflects the homology between the probe and the target. For example, only a probe with a high degree of homology to the target polynucleotide will hybridize under high stringency conditions; whereas, low stringency will allow a less homologous probe to hybridize to the target polynucleotide. The stringency is controlled by changing the hybridization conditions. For example, increasing the temperature, decreasing the salt concentration, or including formamide all increase the stringency. Likewise, the stringency can be decreased by lowering the temperature, increasing the salt concentration, or decreasing the formamide concentration. The formamide concentration is typically used to lower the temperature and at the same time maintain a certain level of stringency. For example, hybridizations carried out at 60-65°C in the absence of formamide or at 42°C with 50% formamide are about equal in stringency. Stringency also applies to the wash steps. It is common to hybridize at low stringency and then to wash at a higher stringency. This insures that the probe will bind to the target polynucleotide and any non-specific hybridization can be removed during the wash steps. A single blot can be sequentially examined under different stringencies. Hybridization and washes are initially carried out at low stringency. The blot is wrapped in plastic and not allowed to completely dry. If the probe is radiolabeled, after exposure to x-ray film, the blot is washed under higher stringency and re-exposed to X-ray film. Comparison of the different auto-radiographs will allow one to determine how homologous the probe is to the target polynucleotide and the degree of cross-hybridization to other polynucleotides. It is also possible to strip the blot of the probe by incubating under conditions which do not allow for hybridization (eg., boiling in low ionic strength). The blot can then be reanalyzed with a different probe. This is a convenient method to compare the expression of two different genes by Northern blotting.

Example 16: Transcription sagA, ska, and speMF/sda in rocA mutants.

In view of the fact that has expression was increased in the rocA mutant, the transcription of genes, such as sagA, ska, and speMF/sda, that are normally repressed by CovR were measured (Federle, M. J. et al. (1999) A response regulator that represses transcription of several virulence operons in the group A streptococcus. J. Bacteriol. 181:3649-3657) No significant differences in transcription between the wild-type and rocA mutant strains were found. It is possible that the effect of the rocA mutation on these genes was very small and that the RNA slot blot assay used to measure transcript levels is not sensitive enough to detect subtle changes. Alternatively, the rocA mutation may not affect the transcription of the sagA, ska, and speMF genes. It is possible that the amount of CovR present in the rocA mutant is sufficient for complete repression of the sagA, ska, and speMF promoters but that more CovR is required for complete repression of the has promoter. However, it is also possible that the active form of CovR that regulates the sagA, ska, and speMF genes is different from the one that represses the has promoter and that the latter form is affected by the rocA mutation whereas the former form is not.

Example 17: Analysis of the RocA sequence.

The rocA gene encodes a polypeptide of 451 amino acid residues (SEQ. ED. NO.: 1). A BLSLTP (version 2.2.3) search of the nonredundant GenBank database showed limited homology to various sensor kinase homologs, with probability values ranging up to e ³⁷. The homology was restricted to the C-terminal region of RocA, and the homology did not increase significantly when only the C-terminal 220 amino acids were used for a BLASTP search. Proteins that showed homologies to RocA of great than e-^!0 include BlpH and ComD of S. pneumoniae. (de Saizieu, A. et al. (2000) Microarray-based identification of a novel Streptococcus pneumoniae regulon controlled by an autoinduced peptide. J. Bacteriol. 182:4696-4703; Havarstein, L. et al. (1996) Ldentification of the streptococcal competence- pheromone receptor. Mol. Microbiol. 21 :863-869), AgrC of S. aureus (Lina, G. S. et al. (1998) Transmembrane topology and histidine protein kinase activity of AgrC, the agr signal receptor in Staphylococcus aureus. Mol. Microbiol. 28:655-662) RgfC of S. agalactine (Spellerberg, B. et al. (2002) rgf encodes a novel two-component signal transduction system of Streptococcus agalactiae. Infect. Immun. 70:2434- 2440), and FasB and FasC of GAS (Kreikemeyer, B. et al. (2001) Group A streptococcal growth phase-associated virulence factor regulation by a novel operon (Fas) with homologies to two-component-type regulators requires a small RNA molecule. Mol. Microbiol. 39:392-406), among others. Most of these sensor kinases are activated by a small peptide and are involved in quorum sensing (Lazazzera, B. A., and A. D. Grossman (1998) 77je ins and outs of peptide signaling. Trends Microbiol. 6:288-294).

Members of the sensor kinase superfamily exhibit clusters of highly conserved residues that are presumed to play crucial roles in signal transduction. These characteristic sequence fingeφrints have been termed the H, N. F, and G boxes (Stock, A. M. et al. (2000) Two-component signal transduction. Annu. Rev. Biochem. 69:183-215; Stock, J. B., M. G. Surette, M. Levit, and P. Park (1995) Two- component signal transduction systems: structure-function relationships and mechanisms of catalysis., p. 25-51. In J. A. Hoch and T. J. Silhavy (ed.), Two- component signal transduction. Americal Society for Microbiology, Washington D.C.) The H box contains the conserved histidine residue that is involved in autophosphorylation. The other boxes are considered to be part of the kinase subdomain and are required for kinase activity (Stock, A. M. et al. (2000) Two- component signal transduction. Annu. Rev. Biochem. 69:183-215; Stock, J. B. et al. 1995). Two-component signal transduction systems: structure-function relationships and mechanisms of catalysis., p. 25-51. In J. A. Hoch and T. J. Silhavy (ed.), Two- component signal transduction. Americal Society for Microbiology, Washington D.C). In the RocA sequence, a conserved H residue in the region corresponding to the H box was not found. In fact, apart from the N box, no other conserved boxes were apparent. This suφrising deviation from the canonical homology boxes has been reported previously for some other sensor kinases (for a review, see Grebe, T. W., and J. B. Stock. (1999) The histidine protein kinase superfamily. Adv. Microb. Physiol. 41 :139-227). For example, sensor kinases in which the conserved histidine is replaced with arginine, aspartate, or tyrosine (Grebe, T. W., and J. B. Stock. (1999) The histidine protein kinase superfamily. Adv. Microb. Physiol. 41:139-227; Wu, J. et al. (1999). A novel bacterial tyrosine kinase essential for cell division and differentiation (Proc. Natl. Acad. Sci. USA 96:13068-13073) and sensor kinases in which various conserved boxes are absent (Dutta, R. et al. (1999) Histidine kinases; diversity of domain organization. Mol. Microbiol. 34:633-640; Koretke, K. K. et al. (2000) Evolution of two-component signal transduction. Mol. Biol. Evol. 17:1956- 1970; Stock, A. M. et al. (2000) Two-component signal transduction. Annu. Rev. Biochem. 69:183-215) have been documented previously. Thus, if RocA encodes a sensor kinase, it belongs to an unorthodox family with variant phosphorylation and kinase domains.

The N-terminal regions of sensor kinases are highly diverse and contain hydrophobic domains required for membrane insertions, known as the transmembrane (TM) helices. There are usually two to eight TM helices that, along with the surface- exposed regions, play a crucial role in signal recognition. TMPRED (http://www.ch.embnet.org/software/TMPRED-form.html) and Goldman-Engelman- Steitz hydrophobicity (Engelman, D. M. et al. (1986) Identifying nonpolar transbilayer helices in amino acid sequences of membrane proteins. Annu. Rev. Biophys. Biophys. Chem. 15:321-353). Analyses of the deduced primary amino acid residues predicted that the N-terminal 220 amino acids of RocA form seven TM helices with short (3- to 17-residue) interhelical regions. Thus, like sensor kinases, RocA is predicted to be membrane associated.

Analysis of the RocA sequence showed no obvious DNA binding motifs, such as zinc finger or helix-turn-helix motifs. In addition, a computer-based profile scan against the Pfam (http://us.expasy.org) protein families and conserved domain database (http://ncbi.nlm.nih.gov) did not show any domain related to DNA binding proteins. This strongly suggests that RocA is not a transcriptional regulator that binds directly to the promoter regions to modulate expression. Therefore, the regulation of Pcov and ProcA promoters by RocA is likely to be indirect.

If RocA encodes a sensor kinase, it should have a cognate response regulator. In bacteria, the genes for cognate pairs of sensor kinases and response regulators are typically found together in a single operon. However, in the region containing rocA, there are no ORFs with homology to a response regulator. Although the presence of cognate response regulators at a different locus than sensor kinases is not common, it has been observed. For example, the genes for response regulators for bar A of E. coli (Pernestig, A. K. et al. (2001) Identification ofUvrYas the cognate response regulator for the Bar A sensor kinase in Escherichia coli. J. Biol. Chem. 276:225- 231) expS of Erwinia carotovora; Eriksson, A. R. et al. (1998) Two-component regulators involved in the global control of virulence in Erwinia carotovora subsp. carotovora. Mol. Plant-Microbe Interact. 11 :743-752), and gacS oϊ Pseudomonas syringae (Rich, J. J. et al. (1994) Genetic evidence that the gacA gene encodes the cognate response regulator for the lemA sensor in Pseudomonas syringae. J.

Bacteriol. 176:7468-7475) are all present far from those encoding the coπesponding sensor kinases. Thus, if RocA is a sensor kinase, its cognate response regulator may be present elsewhere in the genome.

Since both the activation of Pcov and repression oϊ ProcA promoters by RocA was observed (Fig. 3 and 6), RocA may act as a sensor kinase to stimulate either two different regulators with opposite functions or a single response regulator with different activities. There are several situations in which a single sensor kinase activates two different response regulators. For example, in E. coli, sensor kinase CheA interacts with CheB and CheY to regulate chemotaxis (Li, J. et al. (1995) The response regulators CheB and CheY exhibit competitive binding to the kinase CheA Biochemistry 34:14626-14636). On the other hand, response regulators with two opposite functions have also been documented. For example, in the E. coli osmosensing system, response regulator OmpR functions both as an activator and as a repressor to differentially regulate the expression of the ompC and ompF genes (Kenney, L. J. (2002) Structure/function relationships in OmpR and other winged- helix transcription factors. Curr. Opin. Microbiol. 5:135-141; Pratt, L. A. et al. (1996) From acids to osmZ: multiple factors influence synthesis of the OmpF and OmpC porins in Escherichia coli. Mol. Microbiol. 20:911-917).

Claims

What is claimed is: 1. A probe composition comprising: a polynucleotide that hybridizes under a stringent condition to a polynucleotide corresponding to a region of an SPyl605 or roc A gene (SEQ. ED. NO: 2) to form a detectable probe/target duplex for detecting group A Streptococcus.

2. The probe composition of claim 1, wherein the probe composition further comprises a polymerase chain reaction primer pair for amplifying a portion of the SPylβOS or rocA gene.

3. The probe composition of claim 1, wherein the polynucleotide comprises at least 10 nucleotides.

4. The probe of claim 3, wherein the at least 10 nucleotides are substantially homologous to a portion of SEQ. ID. No.: 2.

5. The probe composition of claim 3, wherein the at least 10 nucleotides are substantially homologous to a portion of a sequence selected SEQ. ID. Nos.: 3-7.

6. The probe composition of claim 1, wherein the polynucleotide comprises about 10 to about 30 nucleotides.

7. The probe of claim 1 , wherein the probe is affixed to a solid support.

8. The probe of claim 7, wherein the solid support is selected from glass, metal, silcon, plastic, latex bead, pins, and dipsticks.

9. The probe of claim 7, wherein the probe is reversibly affixed to the solid support.

10. The probe of claim 1 ,wherein the polynucleotide does not hybridize under high stringency with polynucleotides from group B Streptococcus, group C Streptococcus, group D Streptococcus, group E Streptococcus, group F Streptococcus, group G Streptococcus, group H Streptococcus, group L Streptococcus, group M Streptococcus, group N Streptococcus, group O Streptococcus and Streptococcus pneomoniae.

11. A method for detecting the presence of group A Streptococcus, comprising the steps of: (a) contacting a target polynucleotide with a probe composition, wherein the probe composition comprises a polynucleotide that hybridizes under a high stringency condition to a polynucleotide of an SPyl605 or roc A gene to form a detectable probe/target duplex; (b) detecting a probe/target polynucleotide duplex between the target polynucleotide and the probe composition as an indicator of the presence of group A Streptococcus.

12. The method of claim 11, wherein the polynucleotide probe comprises a polymerase chain reaction primer pair for amplifying a region of the SPyl605 or rocA gene.

13. The method of claim 11 , wherein the probe composition does not hybridize under high stringency with a polynucleotide from group B Streptococcus, group C Streptococcus, group D Streptococcus, group E Streptococcus, group F Streptococcus, group G Streptococcus, group H Streptococcus, group L Streptococcus, group M Streptococcus, group N Streptococcus, group O Streptococcus and Streptococcus pneomoniae.

14. The method of claim 11, wherein the probe/target polynucleotide duplex is detected by mass spectroscopy, gel electrophoresis, fluorescence, chemiluminescence, phosphorescence, enzymatic reaction, colorimetry, or radiography.

15. A method for detecting the presence of Streptococcus pyrogenes comprising: (a) obtaining a sample comprising a target polynucleotide; (b) contacting the sample with a second polynucleotide that hybridizes with at least a portion of SEQ. ID. NO.: 2 under high stringency; and (c) detecting hybridization between the target polynucleotide and the second polynucleotide wherein the presence of hybridization between the target polynucleotide and second polynucleotide under high stringency conditions indicates the presence of Streptococcus pyrogenes.

16. The method of claim 15, wherein the sample is taken from a mammal.

17. The method of claim 16, wherein the mammal is human.

18. A kit comprising: (a) a probe composition comprising a polynucleotide that hybridizes under high stringency conditions to a polynucleotide sequence of an SPylβOS or rocA gene to form a detectable probe/target duplex; and (b) printed instructions specifying, in order of implementation, steps to be followed for detecting group A Streptococcus by detecting a complex between the probe composition and a sample polynucleotide, wherein said probe composition and said printed instructions are in packaged combination.

19. The kit of claim 18, wherein the polynucleotide probe comprises a polymerase chain reaction primer pair for amplifying some or all of the SPylόOS or rocA polynucleotide sequence.

20. A polynucleotide hybridization assay probe having sufficient homology to a polynucleotide sequence of an SPylβOS or rocA gene, to distinguish under hybridization conditions group A Streptococcus from group B Streptococcus, group C Streptococcus, group D Streptococcus, group E Streptococcus, group F Streptococcus, group G Streptococcus, group H Streptococcus, group L Streptococcus, group M Streptococcus, group N Streptococcus, group O Streptococcus and Streptococcus pneomoniae.

21. A method for distinguishing group A Streptococcus from group B Streptococcus, group C Streptococcus, group D Streptococcus, group E Streptococcus, group F Streptococcus, group G Streptococcus, group H Streptococcus, group L Streptococcus, group M Streptococcus, group N Streptococcus, and group O Streptococcus, Streptococcus pneumoniae, and Enterococcus feacalis; comprising: (a) contacting a target polynucleotide with a polynucleotide of an Spy 160S or roc.4 gene; and (b) detecting hybridization of the target polynucleotide with the polynucleotide of an Spy 160S or rocA gene, wherein hybridization indicates the presence of group A Streptococcus.

22. A method for identifying modulators oϊcovR comprising: (a) contacting a bacterium with a test compound, wherein expression oϊrocA has been inhibited in the bacterium; (b) detecting expression of covR in the bacterium contacted with the test compound; and (c) comparing the expression oϊcovR in the presence and absence of the test compound.

23. The method of claim 22, further comprising the step of selecting the test compound that causes an increase in covR expression.

24. The method of claim 22, wherein the bacterium is a group A Streptococcus.

25. The method of claim 24, wherein the bacterium is Streptococcus pyrogenes.

26. A method for identifying modulators oϊcovR comprising: (a) contacting a bacterium with a test compound, wherein the bacterium comprises a mutation in rocA resulting in a mucoid phenotype; and (b) selecting the test compound that reduces the mucoid phenotype.

27. The method of claim 26, wherein the bacterium is a group A Streptococcus.

28. A pharmaceutical composition comprising: a recombinant polynucleotide encoding a RocA polypeptide and a pharmaceutically acceptable carrier, wherein expression of said RocA polypeptide in a group A Streptococcus bacterium increases the expression of covR.

29. The pharmaceutical composition of claim 28, wherein said polynucleotide is operably linked to a promoter element.

30. The pharmaceutical composition of claim 28, wherein said polynucleotide is substantially free of protein.

31. A method for reducing the virulence of group A Streptococcus comprising: contacting a group A Streptococcus with polynucleotide encoding a RocA polypeptide, wherein said polynucleotide is expressed in said group A Streptococcus and increases the expression oϊcovR.

32. The method of claim 31 , wherein the increased expression of covR represses at least one virulence factor.

33. The method of claim 32, wherein the at least one virulence factor is selected from the group consisting of a cysteine protease, hyaluronidase, pyrogeneic exotoxins, C5a peptidase, hyaluronic acid capsule, and combinations thereof.

34. A method of modulating the virulence of group A Streptococcus comprising: modulating the expression oϊrocA in a group A Streptococcus.

35. The method of claim 34, wherein roc A is overexpressed.

36. The method of claim 34, wherein rocA expression is inhibited.

37. The method of claim 35, wherein the overexpression oϊrocA induces overexpression of covR.

38. The method of claim 37, wherein the overexpression oϊcovR increases the repression of virulence factors.

39. A method of treating a group A Streptococcus infection comprising: administering a polynucleotide encoding a RocA polypeptide to a host infected with group A Streptococcus, wherein said polypeptide increases the expression oϊcovR in said group A Streptococcus.

40. The method of claim 39, wherein said polynucleotide is operably linked to a promoter element.

41. The method of claim 39, wherein said polynucleotide is administered at a site of group A Streptococcus infection.

42. A method for treating group A Streptococcus infection in host comprising: administering to the host an agent for increasing levels of RocA in group A Streptococcus infecting the host. 43. The method of claim 42, wherein the agent comprises a polynucleotide encoding a RocA polypeptide.

43. The method of claim 42, wherein the polynucleotide comprises at least 10 nucleotides of SEQ. ID. NO. 2.

44. The method of claim 42, wherein increasing the levels of RocA increases the expression of covR.

45. The method of claim 44, wherein the increased expression oϊcovR increases the repression of at least one virulence factor.

46. The method of claim 45, wherein the at least one virulence factor is selected from a cysteine protease, hyaluronidase, pyrogeneic exotoxins, C5a peptidase, hyaluronic acid capsule, and combinations thereof.

47. A composition comprising: a group A Streptococcus bacterium comprising a vector encoding a RocA polynucleotide operably linked to a promoter.