WO2004009541A2 - Antisense modulation of endothelial lipase expression - Google Patents

Antisense modulation of endothelial lipase expression Download PDF

Info

Publication number
WO2004009541A2
WO2004009541A2 PCT/US2003/022410 US0322410W WO2004009541A2 WO 2004009541 A2 WO2004009541 A2 WO 2004009541A2 US 0322410 W US0322410 W US 0322410W WO 2004009541 A2 WO2004009541 A2 WO 2004009541A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
kcal
mol
acid
oligo
Prior art date
Application number
PCT/US2003/022410
Other languages
French (fr)
Other versions
WO2004009541A3 (en
Inventor
B. Ganesh Bhat
Original Assignee
Pharmacia Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pharmacia Corporation filed Critical Pharmacia Corporation
Priority to JP2004523535A priority Critical patent/JP2005533505A/en
Priority to EP03765691A priority patent/EP1539689A2/en
Publication of WO2004009541A2 publication Critical patent/WO2004009541A2/en
Publication of WO2004009541A3 publication Critical patent/WO2004009541A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/582—Recycling of unreacted starting or intermediate materials

Definitions

  • the present invention provides compositions and methods for modulating the expression of Endothelial Lipase (EL).
  • this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Endothelial Lipase.
  • Such oligonucleotides have been shown to modulate the expression of Endothelial Lipase.
  • the triglyceride lipase gene family plays a central role in dietary fat absorption, energy homeostasis, and plasma lipoprotein metabolism. Its members include pancreatic lipase, lipoprotein lipase (LPL), hepatic lipase, and endothelial lipase (EL) alternatively referred to as endothelial cell-derived lipase (LIP G).
  • LPL lipoprotein lipase
  • EL endothelial lipase
  • LIP G endothelial cell-derived lipase
  • the latter three enzymes function in the plasma compartment and are critical to the metabolism of lipids carried on plasma lipoproteins.
  • EL exhibits almost exclusively phospholipase Al activity (little to no triglyceride lipase activity).
  • EL Over expression of EL in the livers of wild type C56B1/6 mice or hapoAI-Tg mice induced by adenovirus exhibit dramatically reduced HDL cholesterol and apoAI concentrations and profoundly altered plasma lipoprotein levels (Jaye M, et al. Nat Genet. 1999, 21:424-8).
  • Another phospholipase, s- PLA2 when over expressed in hapoAI-Tg mice causes a reduction in HDL cholesterol and apoAI with reduced HDL particle size.
  • EL is up regulated in endothelial cells in response to the cytokines, IL-lb and T ⁇ F-a, as well as in response to shear and cyclic stress, all factors implicated in the pathogenesis of atherosclerosis and plaque instability.
  • An antisense oligomer that is specific to EL could be a pharmacological agent to treat dyslipidemia and atherosclerosis.
  • Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of EL expression.
  • the present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding EL, and which modulate the expression of EL.
  • Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided.
  • methods of modulating the expression of EL in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention.
  • methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of EL by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
  • the present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding EL, ultimately modulating the amount of EL produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding EL.
  • target nucleic acid and “nucleic acid encoding EL” encompass DNA encoding EL, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA.
  • the specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid.
  • This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense".
  • the functions of DNA to be interfered with include replication and transcription.
  • the functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
  • the overall effect of such interference with target nucleic acid function is modulation of the expression of EL.
  • modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
  • inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target.
  • Targeting an antisense compound to a particular nucleic acid is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated.
  • This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
  • the target is a nucleic acid molecule encoding EL.
  • the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
  • a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene.
  • the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5' -ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the “AUG start codon”.
  • a minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'- CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
  • translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formyl methionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding EL, regardless of the sequence(s) of such codons.
  • stop codon of a gene may have one of three sequences, i.e. 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5 '-TAG and 5 s - TGA, respectively).
  • start codon region and “translation initiation codon region” “refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5 5 or 3') from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon.
  • target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene.
  • 5'UTR 5' untranslated region
  • 3'UTR 3' untranslated region
  • the 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
  • the 5' cap region may also be a preferred target region.
  • mRNA splice sites i.e., intron-exon junctions
  • intron-exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA. [0010] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
  • adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds.
  • “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides.
  • oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position.
  • the oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target.
  • an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
  • Antisense compounds are commonly used as research reagents and diagnostics.
  • antisense oligonucleotides which are able to inhibit gene expression with dazzling specificity, are often used by those of ordinary skill to elucidate the function of particular genes.
  • Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly.
  • modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • antisense oligonucleotides are a preferred form of antisense compound
  • the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below.
  • the antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides).
  • Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases.
  • a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
  • the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
  • the normal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non- natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2' -5' linked analogs of these, and those having inverted
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
  • Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • oligonucleosides include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. 5,034,506;
  • both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound, one such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
  • Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH 2 -NH-O-CH 2 -, -CH 2 -N (CH 3 ) -O-CH 2 - [known as a methylene (methylimino) or MMI backbone], - CH 2 -O-N (CH 3 ) -CH 2 -, - CH 2 N(CH 3 )-N(CH 3 )-CH 2 - and -O-N(CH 3 )-CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as -O-P-O-CH 2 -] of the above referenced U.S.
  • Modified oligonucleotides may also contain one or more substituted sugar moieties.
  • Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • oligonucleotides comprise one of the following at the 2' position: to C 10 , (lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O- alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ON0 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • a preferred modification includes 2' -methoxyethoxy ( -O-CH 2 CH 2 OCH 3
  • a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2 s - O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH 2 -O-CH 2 - N (CH 2 ) , also described in examples herein below.
  • Oligonucleotides may also include nucleobase (often referred to in the art simply as "base”) modifications or substitutions. As used herein,
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo,
  • nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858- 859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
  • 5-substituted pyrimidines 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds,
  • oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
  • moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,
  • antisense compounds which are chimeric compounds.
  • Chimeric antisense compounds or “chimeras,” in the context of this invention are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
  • oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex.
  • RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
  • Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. 5,013,830; 5,149,797;
  • the antisense compounds used in accordance with this invention may be conveniently, and routinely made through the well-known technique of solid phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
  • the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291;
  • the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug versions of the oligonuclectides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like.
  • Suitable amines are N, N'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. ofPharma Sci., 1977, 66, 119).
  • the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
  • the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
  • a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates.
  • Suitable pharmaceutically acceptable salts include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N- substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2- acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid
  • Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
  • Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
  • salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.
  • acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
  • salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygal
  • the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits.
  • an animal preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of EL, is treated by administering antisense compounds in accordance with this invention.
  • the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
  • Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.
  • the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding EL, enabling sandwich and other assays to easily be constructed to exploit this fact.
  • Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding EL can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of EL in a sample may also be prepared.
  • the present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention.
  • compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
  • Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
  • the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention may also be formulated as suspensions in aqueous, non- aqueous or mixed media.
  • Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • the pharmaceutical compositions may be formulated and used as foams.
  • Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
  • the preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.
  • Emulsions [0047]
  • the compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter.
  • Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
  • emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety.
  • w/o water-in-oil
  • o/w oil-in-water
  • Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.
  • Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti- oxidants may also be present in emulsions as needed.
  • Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil- in-water (w/o/w) emulsions.
  • Such complex formulations often provide certain advantages that simple binary emulsions do not.
  • Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation.
  • Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams.
  • Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
  • Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
  • Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms,
  • Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
  • the ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations.
  • Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
  • Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
  • Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum.
  • Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
  • polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, . montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
  • non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1 , p.
  • Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersedphase droplets and by increasing the viscosity of the external phase.
  • polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
  • cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
  • synthetic polymers for example, carbomers, cellulose ethers, and carb
  • emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives.
  • preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
  • Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
  • Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
  • antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • compositions of oligonucleotides and nucleic acids are formulated as microemulsions.
  • a microemulsion may be defined as a system of water, oil and amphiphile, which is a single optically isotropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
  • microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules
  • Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the stracture and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
  • microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
  • Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants.
  • the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
  • Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
  • the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
  • the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
  • materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
  • Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs.
  • Lipid based microemulsions both o/w and w/o have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205).
  • Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drags, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications.
  • microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
  • Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention.
  • Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.
  • Liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
  • Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior.
  • the aqueous portion contains the composition to be delivered.
  • Cationic liposomes possess the advantage of being able to fuse to the cell wall.
  • Noncationic liposomes although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
  • lipid vesicles In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome, which is highly deformable and able to pass through such fine pores.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, P. 245).
  • Important considerations in the ' preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
  • Liposomes are useful for the transfer and delivery of active ingredients to the site of action.
  • liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
  • Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drags. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drag, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
  • liposomes to deliver agents including high-molecular weight DNA into the skin.
  • Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
  • Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [0068] Liposomes, which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs.
  • pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
  • liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
  • Neutral liposome compositions for example, can be formed from dimyristoyl
  • DMPC dimyristoyl phosphatidylglycerol
  • anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drags to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising Novasome TM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10- stearyl ether) and NovasomeTM LI (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin- A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma.
  • Liposomes also include "sterically stabilized" liposomes, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G MI , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • Liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn- dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).
  • Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C 12 15G that contains a PEG moiety. Hlum et al.
  • U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
  • U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
  • WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.
  • Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drag delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge- activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin.
  • Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their stracture.
  • Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
  • Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
  • the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
  • Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
  • the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
  • the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic.
  • Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
  • Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N- alkylbetaines and phosphatides.
  • the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals.
  • Most drugs are present in solution in both ionized and nonionized forms.
  • usually only lipid soluble or lipophilic drags readily cross cell membranes. It has been discovered that even non-lipophilic drags may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer.
  • Penetration enhancers In addition to aiding the diffusion of non-lipophilic drags across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
  • Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
  • surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa. is enhanced.
  • these penetration enhancers include, for example, sodium lauryl sulfate, ⁇ olyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252).
  • Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (l-monooleoyl-.rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1 -monocaprate, l-dodecylazacycloheptan-2- one, acylcarnitines, acylcholines, C r ⁇ o alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate
  • bile salts include any of the naturally occurring components of bile as well as any of their synthetic derivatives.
  • the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences
  • Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced.
  • chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339).
  • Chelating agents of the invention include but are not limited to disodium.
  • ethylenediaminetetraacetate citric acid
  • salicylates e.g., sodium salicylate, 5-methoxysalicylate and homovanilate
  • N-acyl derivatives of collagen laureth-9
  • N-amino acyl derivatives of beta-diketones enamines
  • Non-chelating non-surfactants are non-chelating non-surfactants.
  • nonchelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
  • This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti- inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol, 1987, 39, 621-626).
  • Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention.
  • cationic lipids such as lipofectin (Junichi et al, U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides.
  • Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
  • compositions of the present invention also incorporate carrier compounds in the formulation.
  • carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
  • a nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
  • the recovery of a partially phosphorothioate oligonuclectide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
  • a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
  • the excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxyprop
  • compositions of the present invention can also be used to formulate the compositions of the present invention.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives.
  • Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
  • Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Other Components include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Other Components may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
  • compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
  • auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
  • Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dextran.
  • the suspension may also contain stabilizers.
  • Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
  • chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5- fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES).
  • anticancer drugs such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5- fluorour
  • Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention.
  • compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 S found to be effective in in vitro and in vivo animal models.
  • dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drag in bodily fluids or tissues.
  • 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA).
  • Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein incorporated by reference.
  • the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds.
  • Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides are synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling VA or ChemGenes, Needham MA).
  • N6-benzoyl-9-beta-D- arabinofuranosyladenine is selectively protected in moderate yield as the 3',5'- ditetrahydropyranyl (THP) intermediate.
  • THP 3',5'- ditetrahydropyranyl
  • Deprotection of the THP and N6- benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'-dirnethoxytrityl-(DMT) and 5'-DMT-3'- phosphoramidite intermediates.
  • 2' -deoxy-2' -fluorocytidine is synthesized via animation of 2'-deoxy- 2' -fluorouridine, followed by selective protection to give N4-benzoyl-2'-deoxy- 2' -fluorocytidine. Standard procedures are used to obtain the 5' -DMT and 5 s - DMT-3 ' phosphoramidites . 2'-O-(2-Methoxyethyl) modified amidites
  • 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504. 2,2'-Anhydro[l-(beta-D-arabinofuranosyl)-5-methyluridinel
  • 5-Methyluridine ribosylthymme, commercially available through Yamasa, Choshi, Japan
  • diphenylcarbonate (90.0 g, 0.420 M)
  • sodium bicarbonate 2.0 g, 0.024 M
  • the mixture is heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution is concentrated under reduced pressure.
  • the resulting syrup is poured into diethylether (2.5 L), with stirring.
  • the product formed a gum.
  • the ether is decanted and the residue is dissolved in a minimum amount of methanol (ca. 400 mL).
  • the solution is poured into fresh ether (2.5 L) to yield a stiff gum.
  • the ether is decanted and the gum is dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid that is crushed to a light tan powder.
  • 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine 160 g, 0.506 M is co- evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the reaction stirred for an additional one hour. Methanol (170 mL) is then added to stop the reaction.
  • a first solution is prepared by dissolving 3 ' -O-acetyl-2' -O- methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH 3 CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1 L), cooled to -5°C and stirred for 0.5 h using an overhead stirrer.
  • POCl 3 is added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours.
  • the first solution is added dropwise, over a 45 minute period, to the latter solution.
  • the resulting reaction mixture is stored overnight in a cold room. Salts are filtered from the reaction mixture and the solution is evaporated. The residue is dissolved in EtOAc (1 L) and the insoluble solids are removed by filtration. The filtrate is washed with 1x300 mL of NaHCO 3 and 2x300 mL of saturated NaCI, dried over sodium sulfate and evaporated. The residue is triturated with EtOAc to give the title compound.
  • N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) is dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) is added with stirring. After stirring for 3 hours, TLC showed the reaction to be approximately 95% complete. The solvent- 'is evaporated and the residue azeotroped with MeOH (200 mL).
  • N4-Benzoyl-2' -O-methoxyethyl-5 ' -O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) is dissolved in CH 2 C1 2 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) are added with stirring, under a nitrogen atmosphere. The resulting mixture is stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete). The reaction mixture is extracted with saturated NaHCO 3 (1x300 mL) and saturated NaCI (3x300 mL).
  • 2'-(Dimethylaminooxyethoxy) nucleoside amidites [00118] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
  • Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
  • reaction vessel is cooled to ambient and opened.
  • TLC Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate
  • the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol.
  • the remaining solution can be partitioned between ethyl acetate and water.
  • the product will be in the organic phase.
  • the residue is purified by column chromatography (2kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate fractions are combined, stripped and dried to product as a white crisp foam, contaminated starting material, and pure reusable starting material.
  • 5'-O-tert-butyldiphenylsilyl-2'-O-[(2- formadoximinooxy)ethyl]-5- methyluridine (1.77g, 3.12mmol) is dissolved in a solution of IM pyridinium p- toluenesulfonate (PPTS) in dry MeOH (30.6mL). Sodium cyanoborohydride (0.39g, 6.13mmol) is added to this solution at 10°C under inert atmosphere. The reaction mixture is stirred for 10 minutes at 10°C.
  • PPTS IM pyridinium p- toluenesulfonate
  • reaction vessel is removed from the ice bath and stirred at room temperature for 2 h, the reaction monitored by TLC (5% MeOH in CH 2 C1 2 ).
  • Aqueous NaHCO 3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x20mL). Ethyl acetate phase is dried over anhydrous Na 2 SO 4 , evaporated to dryness.
  • Residue is dissolved in a solution of IM PPTS in MeOH (30.6mL). Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes.
  • reaction mixture cooled to 10°C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) is added, and reaction mixture stirred at 10°C for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO 3 (25mL) solution is added and extracted with ethyl acetate (2x25mL). Ethyl acetate layer is dried over anhydrous Na 2 SO 4 and evaporated to dryness.
  • Triethylamine trihydrofluoride (3.91mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5'-O-tert-butyldiphenylsiryl-2'- O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH 2 C1 2 ). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH 2 C1 2 to get 2'-O- (dimethylaminooxyethyl)-5-methyluridine.
  • reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2-cyanoethyl-N,N,N 1 ,N 1 - tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added.
  • the reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere.
  • the progress of the reaction is monitored by TLC (hexane:ethyl acetate 1:1).
  • the solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHCO 3 (40mL). Ethyl acetate layer is dried over anhydrous Na 2 SO 4 and concentrated.
  • Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2-N,N- dimethylaminooxyethyl)-5-methyluridine-3 ' -[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam.
  • 2'-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.
  • the 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside.
  • Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer.
  • 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2' -O-(2ethylacetyl) guanosine by treatment with adenosine deaminase.
  • Standard protection procedures should afford 2'-O-(2-ethylacetyl)-5'- O-(4,4' -dimethoxytrityl) guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl- 2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine which may be reduced to provide 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2- ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine.
  • the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N- isobutyryl-6-O-di ⁇ henylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
  • 2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'O-CH 2 -O-CH 2 -N(CH 2 ) 2 , or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
  • the bomb is cooled to room temperature and opened.
  • the crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL).
  • the excess phenol is extracted into the hexane layer.
  • the aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated.
  • the residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
  • the thiation wait step is increased to 68 sec and is followed by the capping step.
  • the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCI solution.
  • Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference.
  • Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference.
  • 3 '-Deoxy-3' -methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
  • Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
  • Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein incorporated by reference.
  • 3 ' -Deoxy-3 ' -amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference.
  • Phosphotriester oligonucleotides are prepared as described in U.S.
  • Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference.
  • Ethylene oxide linked oligonucleosides are prepared as described in
  • PNAs Peptide nucleic acids
  • PNA Peptide nucleic acids
  • Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers" or "wingmers”.
  • Oligonucleotides are synthesized using the automated synthesizer and 2 5 -deoxy- 5'-dimethoxytrityl-3'-O-phosphorarnidite for the DNA portion and 5'- dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings.
  • the standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl.
  • the fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3: 1 ammonia/ethanol at room temperature overnight then lyophilized to dryness.
  • oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCI with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis are periodically checked by "P nuclear magnetic resonance spectroscopy, and for some studies oligonuclectides are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171.
  • Oligonucleotide Synthesis - 96 Well Plate Format Oligonucleotides are synthesized via solid phase P(I I) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format. Phosphodiester intemucleotide linkages are afforded by oxidation with aqueous iodine. Phosphorothioate intemucleotide linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
  • Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites can be purchased from commercial vendors (e.g. PE- Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites.
  • Oligonucleotides are cleaved from support and deprotected with concentrated NH 4 OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • Oligonucleotide Analysis - 96 Well Plate Format The concentration of oligonucleotide in each well is assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACETM MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACETM 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
  • CE capillary electrophoresis
  • the effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 6 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR. T-24 cells:
  • the human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells are routinely cultured in complete McCoy's 5 A basal media (Gibco Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
  • cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • A549 cells A549 cells:
  • the human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA).
  • A549 cells are routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
  • NHDF cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
  • Human neonatal dermal fibroblast can be obtained from the Clonetics Corporation (Walkers ville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier.
  • HEK cells can be obtained from the Clonetics Corporation (Walkers ville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier. HEK cells:
  • HEK Human embryonic keratinocytes
  • Clonetics Corporation Walkersville MD
  • HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville MD) formulated as recommended by the supplier.
  • Cells are routinely maintained for up to 10 passages as recommended by the supplier.
  • the human breast carcinoma cell line MCF-7 is obtained from the American Type Culure Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
  • cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • the mouse lung epithelial cell line LA4 is obtained from the American Type Culure Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf serum (Gibco/Life Technologies,
  • Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000-6000 cells/ well for use in RT- PCR analysis. [00164] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • the concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
  • Antisense modulation of EL expression can be assayed in a variety of ways known in the art.
  • EL mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred.
  • RNA analysis can be performed on total cellular RNA or ⁇ oly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp.
  • both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample.
  • mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer- probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing).
  • standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples.
  • Protein levels of EL can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS).
  • Antibodies directed to EL can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional antibody generation methods.
  • Poly(A)+ mRNA is isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for ⁇ oly(A)+ mRNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 ⁇ L cold PBS.
  • 60 ⁇ L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCI, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 ⁇ L of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 ⁇ L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCI).
  • the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes.
  • 60 pL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70°C is added to each well, the plate is incubated on a 90°C hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.
  • elution buffer 5 mM Tris-HCl pH 7.6
  • Total mRNA is isolated using an RNEAS Y 96 TM kit and buffers purchased from Qiagen Inc. (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 ⁇ L cold PBS. 100 ⁇ L Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 100 ⁇ L of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEAS Y 96 TM well plate attached to a QIAVAC TM manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 15 seconds.
  • Buffer RW1 1 mL of Buffer RW1 is added to each well of the RNEASY 96 TM plate and the vacuum again applied for 15 seconds.
  • 1 mL of Buffer RPE is then added to each well of the RNEASY 96 TM plate and the vacuum applied for a period of 15 seconds.
  • the Buffer RPE wash is then repeated and the vacuum is applied for an additional 10 minutes.
  • the plate is then removed from the QIAVAC manifold and blotted dry on paper towels.
  • the plate is then re-attached to the QIAVAC TM manifold fitted with a collection tube rack containing 1.2 mL collection tubes.
  • RNA is then eluted by pipetting 60 ⁇ L water into each well, incubating 1 minute, and then applying the vacuum for 30 seconds. The elution step is repeated with an additional 60 ⁇ L water.
  • the repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
  • Quantitation of EL mRNA levels is determined by real-time quantitative PCR using the ABI PRISM 7700 Sequence Detection System (PE- Applied Biosystems, Foster City, CA) according to manufacturer's instructions.
  • ABI PRISM 7700 Sequence Detection System PE- Applied Biosystems, Foster City, CA
  • This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time.
  • PCR polymerase chain reaction
  • products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
  • a reporter dye e.g., JOE, FAMTM, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA
  • a quencher dye e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA
  • annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase.
  • cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence- specific fluorescent signal is generated.
  • additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI
  • PRISM 7700 Sequence Detection System In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • PCR reagents can be obtained from PE- Applied Biosystems, Foster City, CA.
  • RT-PCR reactions are carried out by adding 25 ⁇ L PCR cocktail (Ix TAQMAN TM buffer A, 5.5 MM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD TM , and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 ⁇ L poly(A) mRNA solution.
  • the RT reaction is carried out by incubation for 30 minutes at 48°C.
  • Probes and primers to human EL were designed to hybridize to a human EL sequence, using published sequence, information (GenBank accession number NM_006033 is herein incorporated as Figure 1).
  • the PCR primers were: forward primer: CCGGACGGGAGCTGAATAT SEQ ID NO : 3909 reverse primer: CAGTTTCCGCTGGGTTTCC SEQ ID NO : 3910 and the PCR
  • FAMTM PE-Applied Biosystems, Foster City, CA
  • TAMRA PE-Applied Biosystems, Foster City, CA
  • forward primer CCCACCGTGTTCTTCGACAT SEQ ID NO : 3912
  • reverse primer TTTCTGCTGTCTTTGGGACCTT SEQ ID NO : 3913 and the
  • PCR probe is: 5' JOE- CGCGTCTCCTTTGAGCTGTTTGCA SEQ ID NO : 3914- TAMRA 3' where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
  • JOE PE-Applied Biosystems, Foster City, CA
  • TAMRA PE-Applied Biosystems, Foster City, CA
  • oligonucleotides are designed to target different regions of the human EL RNA, using published sequences (NM_006033; incorporated herein as Figure 1).
  • the oligonucleotides are shown in Table 1.
  • "Position" indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds.
  • the indicated parameters for each oligo were predicted using RNAstructure 3.7 by David H. Mathews, Michael Zuker, and Douglas H. Turner. The parameters are described either as free energy (The energy that is released when a reaction occurs. The more negative the number, the more likely the reaction will occur.
  • the oligomer should have little self-structure, either intramolecular (in the table the free energy of which is described as 'intramolecular oligo') or bimolecular (in the table the free energy of which is described as 'intermolecular oligo'). Breaking up any self-structure amounts to a binding penalty.
  • All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings".
  • the wings are composed of 2'- methoxyethyl (2'-MOE) nucleotides.
  • Cytidine residues in the 2'-MOE wings are 5-methylcytidines. All cytidine residues are 5- methylcytidines.
  • GCGAAACCAGAGCTCCCGGC 1676 SEQ ID NO:26 -21.5 -30.2 77 -7.9 -0.4 -8.7
  • TTGGCGTCTTTCTCTCTTGT 583 SEQ ID NO:31 -21.1 -25.8 77.2 -4.7 0 -4.6
  • TACTCTGCTTGCTATTCTGC 2655 SEQ ID NO: 146 -18 -24.5 73.3 -6.5 0 -4.5
  • AAGTGTCTCAGATATTGTGT 2941 SEQ ID NO: 150 -17.9 -20.9 65.6 -3 0 -2.8
  • TGCAGTCTTCTAAGGGCTGG 465 SEQ ID NO: 151 -17.8 -25.7 75.5 -6.2 -1.7 -4.9
  • GATACCGCTCATCGTCCATC 524 SEQ ID NO: 152 -17.8 -27 74.4 -9.2 0.3 -3.1
  • AACTCGGCTTGTCCTGATTC 1110 SEQ ID NO: 153 -17.8 -25.2 72.2 -7.4 0 -3.8
  • TTCTCAGGGTCTTCTGTACA 1639 SEQ ID NO: 159 -17.7 -24.6 75.5 -6 -0.7 -6.1
  • TCCTCTTGTTCCTCATTTTC 1224 SEQ ID NO: 165 -17.6 -25.1 75.4 -7.5 0 -1.9
  • GGCTTGTCCTGATTCACCAG 1105 SEQ ID NO: 173 -17.4 -27.2 77.3 -9.8 0 -5
  • GACCAGTTGTTCCCAGTGCT 1875 SEQ ID NO: 174 -17.4 -29.1 82.1 -11.7 0 -3.7
  • GTGTTCTCAGGGTCTTCTGT 1642 SEQ ID NO: 183 -17.2 -26.4 82.2 -8.3 -0.7 -3.7
  • GATTTTATGGATGGCTCTAT 3224 SEQ ID NO: 186 -17.1 -21.3 64.7 -4.2 0 -3.7
  • GAGCATCCTGGCAATGCTGT 680 SEQ ID NO: 188 -17 -27.3 76.6 -7.3 -3 -11.2
  • CTGCTTGCTATTCTGCTAGT 2651 SEQ ID NO: 192 -17 -25.1 74.9 -7.6 -0.2 -4.5
  • GTTTGTCTCACGTCTGGGGC 3186 SEQ ID NO: 238 -16.3 -27.9 81.5 -11.6 0 -4.6
  • TCAGGCTATGTGGATAAGGT 3685 SEQ ID NO: 239 -16.3 -23.1 69 -6.8 0 -4.1
  • AAAGGTACGGGGCTCCCCGC 307 SEQ ID NO: 240 -16.2 -31 79 -11.2 -3.5 -14.6
  • AAGTCCTCCTCGGTGTAGAC 1450 SEQ ID NO: 244 -16.2 -26.4 75.9 -10.2 0 -3.7
  • TGCTTGCTATTCTGCTAGTG 2650 SEQ ID NO:255 -16.1 -24.2 72.6 -7.6 -0.2 -4.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
  • TTAGCTGTCATGTTGAAACT 484 SEQ ID NO: 289 -15.8 -20.4 62.3 -3.9 -0.1 -8.6
  • TAGCTGTCATGTTGAAACTG 483 SEQ ID NO:295 -15.7 -20.3 61.9 -3.9 -0.1 -8.6
  • ACATTTTGCTGTTCCTCTTG 1236 SEQ ID NO:298 -15.7 -23.9 71.1 -8.2 0 -3.6
  • ATACTCTGCTTGCTATTCTG 2656 SEQ ID NO:304 -15.7 -22.7 68.7 -7 0 -4.5
  • TTTTATGGATGGCTCTATAT 3222 SEQ ID NO:305 -15.7 -20.4 62.7 -4.2 -0.1 -4.6
  • ATCCAAACCTGTGATTCGGC 812 SEQ ID NO:308 -15.6 -24.9 68.9 -9.3 0 -3.2
  • TAGACATTTGCTCAATTAAA 2358 SEQ ID NO:313 -15.6 -16.9 53.7 -1.2 0 -3.6
  • GGGAGGCAAGGACTCGCTGC 2 SEQ ID NO: 380 -14.9 -28.6 78.7 -13.7 0.3 -5.7
  • TTTTAGCTGTCATGTTGAAA 486 SEQ ID NO:381 -14.9 -19.5 60.5 -3.9 -0.1 -8.6
  • ATCGTCCATCCGTGAATGAT 514 SEQ ID NO: 382 -14.9 -24.4 67.8 -9.5 0 -3
  • AAGAGCTATAGCAGCGCAGT 1928 SEQ ID NO: 389 -14.9 -24.8 71.5 -7.6 -2.3 -11
  • GCAAGATACCAGGCCTGCCA 2208 SEQ ID NO: 391 -14.9 -29.4 78.3 -12.7 -0.3 -11.7
  • AATAGACATTTGCTCAATTA 2360 SEQ ID NO:392 -14.9 -17.6 55.5 -2.7 0 -3.6
  • AACTCCACTGGGTTCCAAAT 2433 SEQ ID NO: 393 -14.9 -24 67.4 -8.5 -0.3 -5.9
  • GGCTGCACCACTAACTAGTA 3084 SEQ ID NO:396 -14.9 -25.1 71.7 -9.5 -0.4 -7.1
  • CTGCCATCCTGACATGAGTC 2194 SEQ ID NO: 434 -14.6 -26.4 75.1 -10.7 -1 -5.2
  • TTTTGCTGTTCCTCTTGTTC 1233 SEQ ID NO -.443 -14.5 -24.7 75.2 -10.2 0 -3.6
  • GACATTTGCTCAATTAAAAA 2356 SEQ ID NO -.445 -14.5 -15.8 50.7 -1.2 0 -3.6
  • TCATTCTTCCTCTCCTGCTT 3334 SEQ ID NO: 449 -14.5 -27.3 79.8 -12.8 0 -3.6
  • GCTGCACCACTAACTAGTAT 3083 SEQ ID NO: 459 -14.4 -23.9 69.1 -9.5 0 -6.3
  • TACAAAATGTCAGTTTCCGC 1623 SEQ ID NO: 464 -14.3 -21.2 62.1 -6.9 0 -3.6
  • CTGTACAAAATGTCAGTTTC 1626 SEQ ID NO: 465 -14.3 -18.7 58.6 -3.3 -1 -6.1
  • CTCAATTTCTCCCATGTTCT 1328 SEQ ID NO:472 -14.2 -24.5 71.4 -10.3 0 -4.3
  • ATCTGAGTCCTCTCCCTGGC 3101 SEQ ID NO: 484 -14.2 -30 85.2 -14.5 -1.2 -6.6
  • TATCTTCCAGCCGTCCCTCT 333 SEQ ID NO: 486 -14.1 -30.6 83.3 -16.5 0 -3.2
  • AAAATCTGCATCGTCCGGAG 878 SEQ ID NO: 487 -14.1 -23.1 64.5 0 -8.5
  • GTTCCTCTTGTTCCTCATTT 1226 SEQ ID NO:491 -14.1 -25.9 77.3 -11.8 0 -1.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInte - total formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
  • GTAAGTGTCTCAGATATTGT 2943 SEQ ID NO: 507 -14 -20.6 65.1 -6.6 0 -2.8
  • CTGTCATGTTGAAACTGCAG 480 SEQ ID NO: 512 -13.9 -21.3 63.7 -6.7 -0.1 -8.7
  • ATGCCTGCCCGGGTTTTTAG 1258 SEQ ID NO: 514 -13.9 -29 78.1 -13.8 -0.7 -10.3
  • AAGCCTCAGGGTCCCTAATG 2545 SEQ ID NO -.519 -13.9 -27 74.7 -12.5 -0.3 -7
  • ATGGATGGCTCTATATAAAA 3218 SEQ ID NO:531 -13.8 -18 55.8 -4.2 0 -4
  • AATCATTCTTCCTCTCCTGC 3336 SEQ ID NO:532 -13.8 -25.6 74.6 -11.8 0 -2.6
  • CTGAGAAACCAATCCAGTGT 2052 SEQ ID NO:533 -13.7 -22.4 64.3 -8.7 0 -3.7
  • CAGGCTATGTGGATAAGGTG 3684 SEQ ID NO:536 -13.7 -22.7 67.3 -9 0 -4.1
  • GGACATTCCCGAGAAAAA 723 SEQ ID NO:540 -13.6 -21 59.6 -6.9 -0.1 -3.6

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Cardiology (AREA)
  • Molecular Biology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Antisense compounds, compositions and methods are provided for modulating the expression of Endothelial Lipase (EL). The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EL. Methods of using these compounds for modulation of EL expression and for treatment of diseases associated with expression of EL are provided.

Description

ANTISENSE MODULATION OF ENDOTHELIAL LIPASE
EXPRESSION
FIELD OF THE INVENTION [001] The present invention provides compositions and methods for modulating the expression of Endothelial Lipase (EL). In particular, this invention relates to antisense compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding Endothelial Lipase. Such oligonucleotides have been shown to modulate the expression of Endothelial Lipase.
BACKGROUND OF THE INVENTION
[002] The triglyceride lipase gene family plays a central role in dietary fat absorption, energy homeostasis, and plasma lipoprotein metabolism. Its members include pancreatic lipase, lipoprotein lipase (LPL), hepatic lipase, and endothelial lipase (EL) alternatively referred to as endothelial cell-derived lipase (LIP G). The latter three enzymes function in the plasma compartment and are critical to the metabolism of lipids carried on plasma lipoproteins. EL exhibits almost exclusively phospholipase Al activity (little to no triglyceride lipase activity). Phospholipase Al activity of EL inhibited by apoCLI, whereas LPL, which acts on very low density lipoprotein (VLDL), is activated by apoCLI. Of different lipases tested, only EL has been shown to promote significant hydrolysis of high density lipoprotein (HDL) lipid under in vitro conditions and it was concluded that EL modulates lipoprotein metabolism, at least in part, through its phospholipase activity. (McCoy MG, et al. J Lipid Res. 2002, 43:921-9). Over expression of EL in the livers of wild type C56B1/6 mice or hapoAI-Tg mice induced by adenovirus exhibit dramatically reduced HDL cholesterol and apoAI concentrations and profoundly altered plasma lipoprotein levels (Jaye M, et al. Nat Genet. 1999, 21:424-8). Another phospholipase, s- PLA2, when over expressed in hapoAI-Tg mice causes a reduction in HDL cholesterol and apoAI with reduced HDL particle size. EL is up regulated in endothelial cells in response to the cytokines, IL-lb and TΝF-a, as well as in response to shear and cyclic stress, all factors implicated in the pathogenesis of atherosclerosis and plaque instability. Up regulation of EL by these factors implicates a role of this novel lipase in atherogenesis and its sequel. Although not demonstrated in animals and based on literature data available, it appears that inhibiting EL could elevate HDL and would have a beneficial effect on atherosclerosis progression. An antisense oligomer that is specific to EL could be a pharmacological agent to treat dyslipidemia and atherosclerosis.
[003] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of EL expression.
SUMMARY OF THE INVENTION
[004] The present invention is directed to antisense compounds, particularly oligonucleotides, which are targeted to a nucleic acid encoding EL, and which modulate the expression of EL. Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of EL in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of EL by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION [005] The present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding EL, ultimately modulating the amount of EL produced. This is accomplished by providing antisense compounds, which specifically hybridize with one or more nucleic acids encoding EL. As used herein, the terms "target nucleic acid" and "nucleic acid encoding EL" encompass DNA encoding EL, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds, which specifically hybridize to it, is generally referred to as "antisense". The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression of EL. In the context of the present invention, "modulation" means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation, of gene expression and mRNA is a preferred target. [006] It is preferred to target specific nucleic acids for antisense. "Targeting" an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding EL. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result. Within the context of the present invention, a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5' -ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon," the "start codon" or the "AUG start codon". A minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'- CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo. Thus, the terms "translation initiation codon" and "start codon" can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formyl methionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, "start codon" and "translation initiation codon" refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding EL, regardless of the sequence(s) of such codons.
[007] It is also known in the art that a translation termination codon (or
"stop codon") of a gene may have one of three sequences, i.e. 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5 '-TAG and 5s- TGA, respectively). The terms "start codon region" and "translation initiation codon region "refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 55 or 3') from a translation initiation codon. Similarly, the terms "stop codon region" and "translation termination codon region "refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. [008] The open reading frame (ORF) or "coding region," which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA or corresponding nucleotides on the gene. The 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5' cap region may also be a preferred target region. [009] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as "exons" and are spliced together to form a continuous mRNA sequence. mRNA splice sites, i.e., intron-exon junctions, may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred targets. It has also been found that introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA. [0010] Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. [0011] In the context of this invention, "hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases, which pair through the formation of hydrogen bonds. "Complementary," as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. [0012] Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
[0013] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
[0014] While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleo sides). Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 25 nucleobases. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal I linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage. [0015] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non- natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. [0016] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2' -5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5'-3' or 2'-5' to 5'-2\ Various salts, mixed salts and free acid forms are also ( included.
[0017] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
[0018] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. [0019] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. 5,034,506;
5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
[0020] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound, one such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500. [0021] Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-O-CH2-, -CH2-N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone], - CH2-O-N (CH3) -CH2-, - CH2N(CH3)-N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of the above referenced U.S. patent 5,489,677, and the amide backbones of the above referenced U.S. patent 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. patent 5,034,506. [0022] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)„O]mCH3, O(CH2)n,OCH3, O(CH2)nNH2, O(CH2)nCH3s O(CH2)nONH2, and O(CH2nON[(CH2)nCH3)]2 where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2' position: to C10, (lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O- alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ON02, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2' -methoxyethoxy ( -O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE)
(Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2s- O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2- N (CH2) , also described in examples herein below.
[0023] Other preferred modifications include 2'-methoxy (2'-O CH3), 2s- aminopropoxy (2'-O CH2 CH2 CH2NH2) and 2' -fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2' -5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety. [0024] Oligonucleotides may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein,
"unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- deazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858- 859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds,
Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276- 278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. [0025] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. 3,687,808, as well as U.S.4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,750,692 and 5,681,941, each of which is herein incorporated by reference.
[0026] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates, which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al, Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 365'-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0027] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference. [0028] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds, which are chimeric compounds. "Chimeric" antisense compounds or "chimeras," in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease, which cleaves the RNA strand of RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0029] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. 5,013,830; 5,149,797;
5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference in its entirety. [0030] The antisense compounds used in accordance with this invention may be conveniently, and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
[0031] The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291;
5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556;
5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016;
5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
[0032] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0033] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonuclectides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published December 9, 1993 or in WO 94/26764 to Imbach et al. [0034] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. [0035] Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N, N'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al., "Pharmaceutical Salts," J. ofPharma Sci., 1977, 66, 119). The base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N- substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2- acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids, such as the 20 alpha-amino acids involved in the synthesis of proteins in nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2- hydroxyethanesulfonic acid, ethane- 1,2-disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfoic acid^naphthalene-2-sulfonic acid, naphthalene- 1,5- disulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate, N- cyclohexylsulfamic acid (with the formation of cyclamates), or with other acid organic compounds, such as ascorbic acid. Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible. [0036] For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. [0037] The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. For therapeutics, an animal, preferably a human, suspected of having a disease or disorder, which can be treated by modulating the expression of EL, is treated by administering antisense compounds in accordance with this invention. The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example. [0038] The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding EL, enabling sandwich and other assays to easily be constructed to exploit this fact. Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding EL can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of EL in a sample may also be prepared. [0039] The present invention also includes pharmaceutical compositions and formulations, which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. [0040] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
[0041] Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
[0042] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0043] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
[0044] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0045] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non- aqueous or mixed media. Aqueous suspensions may further contain substances, which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
[0046] In one embodiment of the present invention the pharmaceutical compositions may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention. Emulsions [0047] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 301). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti- oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil- in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion. [0048] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). [0049] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285). [0050] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, . montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
[0051] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N. Y., volume 1 , p. 199). [0052] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersedphase droplets and by increasing the viscosity of the external phase. [0053] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
[0054] The application of emulsion formulations via dermatological, oral, and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions. [0055] In one embodiment of the present invention, the compositions of oligonucleotides and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile, which is a single optically isotropic, and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules
(Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 1852'5). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the stracture and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271). [0056] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously. [0057] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
[0058] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol, 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drags, peptides or oligonucleotides. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
[0059] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.
Liposomes
[0060] There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drag delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. [0061] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Noncationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
[0062] In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome, which is highly deformable and able to pass through such fine pores. [0063] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, P. 245). Important considerations in the' preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes. [0064] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes. As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act. [0065] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drags. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drag, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin. [0066] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
[0067] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes, which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980 - 985) [0068] Liposomes, which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
[0069] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl
1 phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
[0070] Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265). [0071] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drags to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome ™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10- stearyl ether) and Novasome™ LI (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin- A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466). [0072] Liposomes also include "sterically stabilized" liposomes, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765). [0073] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Set, 1987, 507, 64) reported the ability of monosialoganglioside GM1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Patent No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside Gjor a galactocerebroside sulfate ester. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn- dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.). [0074] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G that contains a PEG moiety. Hlum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half- lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Patent Nos. 4,426,330 and 4,534,899). Klibanov et al. (FERS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamme (PΕ) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEGderivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in
European Patent No. EP 0445 131 Bl and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Patent Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Patent No. 5,213,804 and European Patent No. EP 0496 813 Bl). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al.). U.S. Patent Nos. 5,540,935 (Miyazaki et al.) and 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces. [0075] A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Patent No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA. U.S. Patent No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising antisense oligonucleotides targeted to the raf gene. [0076] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drag delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge- activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin. [0077] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285)
[0078] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their stracture. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
[0079] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps. [0080] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class. [0081] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N- alkylbetaines and phosphatides.
[0082] The use of surfactants in drag products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285). Penetration Enhancers [0083] Ln one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids particularly oligonucleotides, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drags readily cross cell membranes. It has been discovered that even non-lipophilic drags may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drags across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. [0084] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
Surfactants:
[0085] Ln connection with the present invention, surfactants (or "surface- active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa. is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, ρolyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol, 1988, 40, 252).
Fatty acids: .
[0086] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (l-monooleoyl-.rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1 -monocaprate, l-dodecylazacycloheptan-2- one, acylcarnitines, acylcholines, Crιo alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol, 1992, 44, 651-654).
Bile salts:
[0087] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds. McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate'and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA, 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1- 33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
Chelating Agents: [0088] Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium. ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9, and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Re , 1990, 14, 43-51).
Non-chelating non-surfactants:
[0089] As used herein, nonchelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti- inflammatory agents such as diclofenac sodium, indomethacin, and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol, 1987, 39, 621-626). [0090] Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of oligonucleotides. [0091] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
Carriers
[0092] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonuclectide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177-183).
Excipients
[0093] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
[0094] Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. [0095] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
[0096] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. Other Components [0097] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.' The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
[0098] Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, and/or dextran. The suspension may also contain stabilizers. [0099] Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorabicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5- fluorouracil (5-FU), floxuridine (5-FUdR), methotrexate (MTX), colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 1206-1228). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively), other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially. [00100] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially. [00101] The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50S found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drag in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years. [00102] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
EXAMPLES
Example 1
Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and 2'- alkoxy amidites
[00103] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites are available from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA). Other 2'-O-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein incorporated by reference. For oligonucleotides synthesized using 2'-alkoxy amidites, the standard cycle for unmodified oligonucleotides is utilized, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds. [00104] Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides are synthesized according to published methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21, 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling VA or ChemGenes, Needham MA).
2' -Fluoro amidites
2'-Fluorodeoxyadenosine amidites
[00105] 2' -fluoro oligonucleotides are synthesized as described previously
[Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841] and United States patent 5,670,633, herein incorporated by reference. Briefly, the protected nucleoside N6-benzoyl-2'-deoxy-2'-fluoroadenosine is synthesized utilizing commercially available 9-beta-D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha-fluoro atom is introduced by a SN2-displacement of a 2'-beta-trityl group. Thus N6-benzoyl-9-beta-D- arabinofuranosyladenine is selectively protected in moderate yield as the 3',5'- ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N6- benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5'-dirnethoxytrityl-(DMT) and 5'-DMT-3'- phosphoramidite intermediates. 2'-Fluorodeoxyguanosine
[00106] The synthesis of 2'-deoxy-2'-fluoroguanosine is accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-beta-D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyrylarabinofuranosylguanosme. Deprotection of the TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di- THP protected arabinofuranosylguanine. Selective O-deacylation and triflation is followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies are used to obtain the 5'-DMT- and 5'-DMT-3'-ρhosρhoramidites. 2'-Fluorouridine
[00107] Synthesis of 2' -deoxy-2' -fluorouridine is accomplished by the modification of a literature procedure in which 2,2'anhydro-l-beta-D- arabinofuranosyluracil is treated with 70% hydrogen fluoride-pyridine. Standard procedures are used to obtain the 5' -DMT and 5 '-DMT-3 '-phosphoramidites. 2'-Fluorodeoxycytidine
[00108] 2' -deoxy-2' -fluorocytidine is synthesized via animation of 2'-deoxy- 2' -fluorouridine, followed by selective protection to give N4-benzoyl-2'-deoxy- 2' -fluorocytidine. Standard procedures are used to obtain the 5' -DMT and 5s- DMT-3 ' phosphoramidites . 2'-O-(2-Methoxyethyl) modified amidites
[00109] 2'-O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504. 2,2'-Anhydro[l-(beta-D-arabinofuranosyl)-5-methyluridinel [00110] 5-Methyluridine (ribosylthymme, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) are added to DMF (300 mL). The mixture is heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution is concentrated under reduced pressure. The resulting syrup is poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether is decanted and the residue is dissolved in a minimum amount of methanol (ca. 400 mL). The solution is poured into fresh ether (2.5 L) to yield a stiff gum. The ether is decanted and the gum is dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid that is crushed to a light tan powder. The material is used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid. 2'-O-Methoxyethyl-5-methyluridine [00111] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M), tris(2- methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) are added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160°C. After heating for 48 hours at 155-160°C, the vessel is opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue is suspended in hot acetone (1 L). The insoluble salts are filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) is dissolved in CH CN (600 mL) and evaporated. A silica gel column (3 kg) is packed in CH2C12 /acetone /MeOH (20:5:3) containing 0.5% Et3NH. The residue is dissolved in CH2C12 (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product is eluted with the packing solvent to give the title product. Additional material can be obtained by reworking impure fractions. 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine [00112] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) is co- evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) is added and the reaction stirred for an additional one hour. Methanol (170 mL) is then added to stop the reaction. The solvent is evaporated and triturated with CH3CN (200 mL) The residue is dissolved in CHC1 (1.5 L) and extracted with 2x500 mL of saturated NaHCO3 and 2x500 mL of saturated NaCI. The organic phase is dried over Na2SO4, filtered, and evaporated. The residue is purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/hexane/ acetone (5:5: 1) containing 0-5% Et3NH. The pure fractions are evaporated to give the title product. 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine [00113] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) are combined and stirred at room temperature for 24 hours. The reaction is monitored by TLC by first quenching the TLC sample with the addition of MeOH. Upon completion of the reaction, as judged by TLC, MeOH (50 mL) is added and the mixture evaporated at 35°C. The residue is dissolved in CHC13 (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCI. The water layers are back extracted with 200 mL of CHC13. The combined organics are dried with sodium sulfate and evaporated to a residue. The residue is purified on a 3.5 kg silica gel column and eluted using EtOAc/hexane(4:l). Pure product fractions are evaporated to yield the title compounds.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4- triazoleuridine [00114] A first solution is prepared by dissolving 3 ' -O-acetyl-2' -O- methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) is added to a solution of triazole (90 g, 1.3 M) in CH3CN (1 L), cooled to -5°C and stirred for 0.5 h using an overhead stirrer. POCl3 is added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours. The first solution is added dropwise, over a 45 minute period, to the latter solution. The resulting reaction mixture is stored overnight in a cold room. Salts are filtered from the reaction mixture and the solution is evaporated. The residue is dissolved in EtOAc (1 L) and the insoluble solids are removed by filtration. The filtrate is washed with 1x300 mL of NaHCO3 and 2x300 mL of saturated NaCI, dried over sodium sulfate and evaporated. The residue is triturated with EtOAc to give the title compound. 2'-0-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine [00115] A solution of 3 '-O-acetyl-2 '-O-methoxyethyl-5'-O-dimethoxytrityl- 5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH4OH (30 mL) is stirred at room temperature for 2 hours. The dioxane solution is evaporated and the residue azeotroped with MeOH (2x200 mL). The residue is dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH3 gas is added and the vessel heated to 100°C for 2 hours (TLC showed complete conversion). The vessel contents are evaporated to dryness and the residue is dissolved in EtOAc (500 mL) and washed once with saturated NaCI (200 mL). The organics are dried over sodium sulfate and the solvent is evaporated to give the title compound. N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine [00116] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) is dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) is added with stirring. After stirring for 3 hours, TLC showed the reaction to be approximately 95% complete. The solvent- 'is evaporated and the residue azeotroped with MeOH (200 mL). The residue is dissolved in CHC13 (700 mL) and extracted with saturated NaHCO, (2x300 mL) and saturated NaCI (2x300 mL), dried over MgSO4 and evaporated to give a residue. The residue is chromatographed on a 1.5 kg silica column using EtOAc/hexane (1:1) containing 0-5% Et3NH as the eluting solvent. The pure product fractions are evaporated to give the title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine-3?- amidite
[00117] N4-Benzoyl-2' -O-methoxyethyl-5 ' -O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) is dissolved in CH2C12 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra(isopropyl)phosphite (40.5 mL, 0.123 M) are added with stirring, under a nitrogen atmosphere. The resulting mixture is stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete). The reaction mixture is extracted with saturated NaHCO3 (1x300 mL) and saturated NaCI (3x300 mL). The aqueous washes are back-extracted with CH2C12 (300 mL), and the extracts are combined, dried over MgSO and concentrated. The residue obtained is chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1) as the eluting solvent. The pure fractions were combined to give the title compound. 2'-O-(Aminooxyethyl) nucleoside amidites and 2'-O- (dimethylaminooxyethyl) nucleoside amidites
2'-(Dimethylaminooxyethoxy) nucleoside amidites [00118] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine. 5'-O-tert-Butyldiphenylsilyl -O2 -2'-anhydro-5-methyluridine [00119] O2 -2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, lOO.Og, 0.4'6 mmol), dimethylaminopyridine (0.66g, 0.013eq, 0.0054mmol) are dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring. tert-Butyldiphenylchlorosilane
(125.8g, 119.0mL, l.leq, 0.458mmol) is added in one portion. The reaction is stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a complete reaction. The solution is concentrated under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2x1 L) and brine (1 L). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil is dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600mL) and the solution is cooled to -10°C. The resulting crystalline product is collected by filtration, washed with ethyl ether (3x200 mL), and dried (40°C, 1mm Hg, 24 h) to a white solid 5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[00120] In a 2 L stainless steel, unstirred pressure reactor is added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) is added cautiously at first until the evolution of hydrogen gas subsides. 5'-O-tert-Butyldiphenylsilyl-O2-2'anhydro- 5-methyluridine (149 g, 0.3' 1 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are added with manual stirring. The reactor is sealed and heated in an oil bath until an internal temperature of 160°C is reached and then maintained for 16 h (pressure < 100 psig). The reaction vessel is cooled to ambient and opened. TLC (Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate) indicated about 70% conversion to the product. In order to avoid additional side product formation, the reaction is stopped, concentrated under reduced pressure (10 to 1mm, Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue is purified by column chromatography (2kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate fractions are combined, stripped and dried to product as a white crisp foam, contaminated starting material, and pure reusable starting material.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine [00121] 5' -O-tert-Butyldiphenylsilyl-2' -O-(2-hydroxyethyl)-5- methyluridine (20g, 36.98mmoI) is mixed with triphenylphosphine (11.63g, 44.36mmol) and N-hydroxyphthalimide (7.24g, 44.36mmol). It is then dried over P2O5 under high vacuum for two days at 40°C. The reaction mixture is flushed with argon and dry THF (369.8mL, Aldrich, sure seal bottle) is added to get a clear solution. Diethyl-azodicarboxylate (6.98mL, 44.36mmol) is added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop. After the addition is complete, the reaction is stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent is evaporated in vacuum. Residue obtained is placed on a flash column and eluted with ethyl acetate:hexane (60:40), to get 2'-O-([2-phthalimidoxy)ethyl]-5'-t- butyldiphenylsilyl-5-methyluridine as white foam. 5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5- methyluridine
[00122] 2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5- methyluridine (3.1g, 4.5mmol) is dissolved in dry CH2C12 (4.5mL) and methylhydrazine (300mL, 4.64mmol) is added dropwise at -10°C to 0°C. After 1 h the mixture is filtered, the filtrate is washed with ice cold CH2C12 and the combined organic phase is washed with water, brine and dried over anhydrous Na2SO . The solution is concentrated to get 2'-O(aminooxyethyl) thymidine, which is then dissolved in MeOH (67.5mL). To this formaldehyde (20% aqueous solution, w/w, 1.1 eq.) is added and the resulting mixture is stirred for 1 h. Solvent is removed under vacuum; residue chromatographed to get 5'-O-tert- butyldiphenylsilyl-2' -O-[(2-formadoximinooxy) ethyl]-5-methyluridine as white foam.
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine [00123] 5'-O-tert-butyldiphenylsilyl-2'-O-[(2- formadoximinooxy)ethyl]-5- methyluridine (1.77g, 3.12mmol) is dissolved in a solution of IM pyridinium p- toluenesulfonate (PPTS) in dry MeOH (30.6mL). Sodium cyanoborohydride (0.39g, 6.13mmol) is added to this solution at 10°C under inert atmosphere. The reaction mixture is stirred for 10 minutes at 10°C. After that the reaction vessel is removed from the ice bath and stirred at room temperature for 2 h, the reaction monitored by TLC (5% MeOH in CH2C12). Aqueous NaHCO3 solution (5%, lOmL) is added and extracted with ethyl acetate (2x20mL). Ethyl acetate phase is dried over anhydrous Na2SO4, evaporated to dryness. Residue is dissolved in a solution of IM PPTS in MeOH (30.6mL). Formaldehyde (20% w/w, 30mL, 3.37mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. Reaction mixture cooled to 10°C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) is added, and reaction mixture stirred at 10°C for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO3 (25mL) solution is added and extracted with ethyl acetate (2x25mL). Ethyl acetate layer is dried over anhydrous Na2SO4 and evaporated to dryness. The residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH2C1 to get 5'-O- tertbutyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5- methyluridine as a white foam.
2'-O-(dimethylaminooxyethyl)-5-methyluridine
[00124] Triethylamine trihydrofluoride (3.91mL, 24.0mmol) is dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5'-O-tert-butyldiphenylsiryl-2'- O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH2C12). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH2C12 to get 2'-O- (dimethylaminooxyethyl)-5-methyluridine.
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine [00125] 2' -O-(dimethylaminooxyethyl)-5-methyluridine (750mg, 2.17mmol) is dried over P2Os under high vacuum overnight at 40°C. It is then co- evaporated with anhydrous pyridine (20mL). The residue obtained is dissolved in pyridine (1 ImL) under argon atmosphere. 4-dimethylaminopyridine (26.5mg, 2.60mmol), 4,4'-dimethoxytrityl chloride (880mg, 2.60mmol) is added to the mixture and the reaction mixture is stirred at room temperature until all of the starting material disappeared. Pyridine is removed under vacuum and the residue chromatographed and eluted with 10% MeOH in CH2C12 (containing a few drops of pyridine) to get 5'-O-DMT-2'-0(dimethylamino-oxyethyl)-5- methyluridine.
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3?-[(2" cyanoethyl)-N,N- diisopropylphosphoramidite] [00126] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08g, 1.67mmol) is co-evaporated with toluene (20mL). To the residue N,N- diisopropylamine tetrazonide (0.29g, 1.67mmol) is added and dried over P20, under high vacuum overnight at 40°C. Then the reaction mixture is dissolved in anhydrous acetonitrile (8.4mL) and 2-cyanoethyl-N,N,N1,N1- tetraisopropylphosphoramidite (2.12mL, 6.08mmol) is added. The reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction is monitored by TLC (hexane:ethyl acetate 1:1). The solvent is evaporated, then the residue is dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHCO3 (40mL). Ethyl acetate layer is dried over anhydrous Na2SO4 and concentrated. Residue obtained is chromatographed (ethyl acetate as eluent) to get 5'-O-DMT-2'-O-(2-N,N- dimethylaminooxyethyl)-5-methyluridine-3 ' -[(2-cyanoethyl)-N,N- diisopropylphosphoramidite] as a foam.
2'-(Aminooxyethoxy) nucleoside amidites
[00127] 2'-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2'-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(454s" dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramidite]
[00128] The 2'-O-aminooxyethyl guanosine analog may be obtained by selective 2'-O-alkylation of diaminopurine riboside. Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2' -O-(2ethylacetyl) guanosine by treatment with adenosine deaminase. (McGee, D. P. C, Cook, P. D., Guinosso, C. J., WO 94/02501 Al 940203.) Standard protection procedures should afford 2'-O-(2-ethylacetyl)-5'- O-(4,4' -dimethoxytrityl) guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl- 2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine which may be reduced to provide 2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2- ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine. As before the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N- isobutyryl-6-O-diρhenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'- dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N- diisopropylphosphoramiditel.
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites [00129] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2'-O-dimethylaminoethoxyethyl, i.e., 2'O-CH2-O-CH2-N(CH2)2, or 2'-DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine [00130] 2[2-(Dimethylamino)ethoxylethanol (Aldrich, 6.66 g, 50 mmol) is slowly added to a solution of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas evolves as the solid dissolves. O2-, 2' - anhydro-5-methyluridine (1.2 g, 5 mmol), and sodium bicarbonate (2.5 mg) are added and the bomb is sealed, plaped in an oil bath and heated to 155°C for 26 hours. The bomb is cooled to room temperature and opened. The crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL). The excess phenol is extracted into the hexane layer. The aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue is columned on silica gel using methanol/methylene chloride 1 :20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid. 5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy) ethyl)]-5- methyl uridine [00131] To 0.5 g (1.3 mmol) of 2'-O-[2(2-N,N- dimethylaminoethoxy)ethyl)l-5-methyl uridine in anhydrous pyridine (8 mL), triethylamine (0.36 mL) and dimethoxytrityl chloride (DMT-C1, 0.87 g, 2 eq.) are added and stirred for 1 hour. The reaction mixture is poured into water (200 mL) and extracted with CH2C12 (2x200 mL). The combined CH2C12 layers are washed with saturated NaHCO3 solution, followed by saturated NaCI solution and dried over anhydrous sodium sulfate. Evaporation of the solvent followed by silica gel chromatography using MeOH: CH2Cl2:Et3N (20:1, v/v, with 1% triethylamine) gives the title compound. 5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5=methyI uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite
[00132] Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxyN,N- diisopropyl phosphoramidite (1.1 mL, 2 eq.) are added to a solution of 5'-O- dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyluridine (2.17 g, 3 mmol) dissolved in CH2C12 (20 mL) under an atmosphere of argon. The reaction mixture is stirred overnight and the solvent evaporated. The resulting residue is purified by silica gel flash column chromatography with ethyl acetate as the eluent to give the title compound.
Example 2 Oligonucleotide synthesis [00133] Unsubstituted and substituted phosphodiester (P=O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine. [00134] Phosphorothioates (P=S) are synthesized as for the phosphodiester oligonucleotides except the standard oxidation bottle is replaced by 0.2 M solution of 3H-l,2-benzodithiole-3-one 1,1 -dioxide in acetonitrile for the step wise thiation of the phosphite linkages. The thiation wait step is increased to 68 sec and is followed by the capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55 °C (18 h), the oligonucleotides are purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCI solution. Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference. [00135] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference.
[00136] 3 '-Deoxy-3' -methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
[00137] Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference. [00138] Alkylphosphonothioate oligonucleotides are prepared as described in WO 94/17093 and WO 94/02499 herein incorporated by reference. [00139] 3 ' -Deoxy-3 ' -amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference. [00140] Phosphotriester oligonucleotides are prepared as described in U.S.
Patent 5,023,243, herein incorporated by reference.
[00141] Borano phosphate oligonucleotides are prepared as described in U.S.
Patents 5,130,302 and 5,177,198, both herein incorporated by reference.
Example 3
Oligonucleoside Synthesis
[00142] Methylenemethylimino linked oligonucleosides, also identified as
MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P=O or P=S linkages are prepared as described in U.S. Patents 5,378,825; 5,386,023; 5,489,677;
5,602,240; and 5,610,289, all of which are herein incorporated by reference.
[00143] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference. [00144] Ethylene oxide linked oligonucleosides are prepared as described in
U.S. Patent 5,223,618, herein incorporated by reference.
Example 4 PNA Synthesis [00145] Peptide nucleic acids (PNAs) are prepared in accordance with any of the various procedures referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 523. They may also be prepared in accordance with U.S. Patents 5,539,082; 5,700,922; and 5,719,262, herein incorporated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides
[00146] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end" type wherein the "gap" segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "gapmers" or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers".
[2'-O-Me]"[2'-deoxy]--[2'-O-Me] Chimeric Phosphorothioate Oligonucleotides [00147] Chimeric oligonucleotides having 2' -O-alkyl phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 380B, as above. Oligonucleotides are synthesized using the automated synthesizer and 25-deoxy- 5'-dimethoxytrityl-3'-O-phosphorarnidite for the DNA portion and 5'- dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings. The standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3: 1 ammonia/ethanol at room temperature overnight then lyophilized to dryness. Treatment in methanolic ammonia for 24 hrs at room temperature is then done to deprotect all bases and sample is again lyophilized to dryness. The pellet is resuspended in IM TBAF in THF for 24 hrs at room temperature to deprotect the 2' positions. The reaction is then quenched with IM TEAA and the sample is then reduced to 1/2 volume by rotovac before being desalted on a G25 size exclusion column. The oligo recovered is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry. [2' -O-(2-Methoxyethyl)]--[2'-deoxy]--[2'-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides [00148] [2'-O-(2-methoxyethyl)]-[2'-deoxy]— [-2'-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides are prepared as per the procedure above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of phorothioate oligonucleotides are prepared as per the procedure abo 2'-O- (methoxyethyl) amidites for the 2'-O-mefhyl amidites. [2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy Phosphorothioate]--[2'- O-(2-Methoxyethyl)] Phosphodiester] Chimeric Oligonucleotides [00149] [2'-O-(2-methoxyethyl phosρhodiester]-[2'-deoxy phosphorothioate]~[2' -O-(methcixyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites, oxidization with iodine to generate the phosphodiester intemucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate intemucleotide linkages for the center gap.
[00150] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States patent 5,623,065, herein incorporated by reference.
Example 6
Oligonucleotide Isolation
[00151] After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55 °C for 18 hours, the oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCI with 2.5 volumes ethanol. Synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis are periodically checked by "P nuclear magnetic resonance spectroscopy, and for some studies oligonuclectides are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171.
Example 7
Oligonucleotide Synthesis - 96 Well Plate Format [00152] Oligonucleotides are synthesized via solid phase P(I I) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format. Phosphodiester intemucleotide linkages are afforded by oxidation with aqueous iodine. Phosphorothioate intemucleotide linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites can be purchased from commercial vendors (e.g. PE- Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected betacyanoethyldiisopropyl phosphoramidites. [00153] Oligonucleotides are cleaved from support and deprotected with concentrated NH4OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis - 96 Well Plate Format [00154] The concentration of oligonucleotide in each well is assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) in either the 96 well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the compounds on the plate are at least 85% full length.
Example 9
Cell culture and oligonucleotide treatment
[00155] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 6 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR. T-24 cells:
[00156] The human transitional cell bladder carcinoma cell line T-24 is obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells are routinely cultured in complete McCoy's 5 A basal media (Gibco Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
[00157] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. A549 cells:
[00158] The human lung carcinoma cell line A549 can be obtained from the American Type Culture Collection (ATCC) (Manassas, VA). A549 cells are routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. NHDF cells:
[00159] Human neonatal dermal fibroblast (NHDF) can be obtained from the Clonetics Corporation (Walkers ville MD). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville MD) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier. HEK cells:
[00160] Human embryonic keratinocytes (HEK) can be obtained from the Clonetics Corporation (Walkersville MD). HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville MD) formulated as recommended by the supplier. Cells are routinely maintained for up to 10 passages as recommended by the supplier.
MCF-7 cells:
[00161] The human breast carcinoma cell line MCF-7 is obtained from the American Type Culure Collection (Manassas, VA). MCF-7 cells are routinely cultured in DMEM low glucose (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
[00162] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
LA4 cells:
[00163] The mouse lung epithelial cell line LA4 is obtained from the American Type Culure Collection (Manassas, VA). LA4 cells are routinely cultured in F12K medium (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 15% fetal calf serum (Gibco/Life Technologies,
Gaithersburg, MD). Cells are routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000-6000 cells/ well for use in RT- PCR analysis. [00164] For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
Treatment with antisense compounds:
[00165] When cells reached 80% confluency, they are treated with oligonucleotide. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEM™-l reduced-serum medium (Gibco BRL) and then treated with 130 μL of OPTI-MEM™-l containing 3.75 μg/mL LIPOFECTIN™ (Gibco BRL) and the desired concentration of oligonucleotide. After 4-7 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16- 24 hours after oligonucleotide treatment.
[00166] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
Example 10
Analysis of oligonucleotide inhibition of EL expression [00167] Antisense modulation of EL expression can be assayed in a variety of ways known in the art. For example, EL mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or ρoly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1- 4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer- probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed as multiplexable. Other methods of PCR are also known in the art. [00168] Protein levels of EL can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to EL can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley Sons, Inc., 1997. [00169] Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.110.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
Example 11 Poly(A)+ mRNA isolation
[00170] Poly(A)+ mRNA is isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for ρoly(A)+ mRNA isolation are taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 μL cold PBS. 60μL lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCI, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 μL of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCI). After the final wash, the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 pL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70°C is added to each well, the plate is incubated on a 90°C hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate. [00171] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
Example 12
Total RNA Isolation
[00172] Total mRNA is isolated using an RNEAS Y 96™ kit and buffers purchased from Qiagen Inc. (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 μL cold PBS. 100 μL Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 100 μL of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEAS Y 96™ well plate attached to a QIAVAC™ manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 15 seconds. 1 mL of Buffer RW1 is added to each well of the RNEASY 96™ plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE is then added to each well of the RNEASY 96™ plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash is then repeated and the vacuum is applied for an additional 10 minutes. The plate is then removed from the QIAVAC manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVAC™ manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then eluted by pipetting 60μL water into each well, incubating 1 minute, and then applying the vacuum for 30 seconds. The elution step is repeated with an additional 60μL water.
[00173] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
Example 13
Real-time Quantitative PCR Analysis of EL mRNA Levels
[00174] Quantitation of EL mRNA levels is determined by real-time quantitative PCR using the ABI PRISM 7700 Sequence Detection System (PE- Applied Biosystems, Foster City, CA) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE, FAM™, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA) is attached to the 5' end of the probe and a quencher dye (e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE- Applied Biosystems, Foster City, CA) is attached to the 3' end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3' quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence- specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI
PRISM 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
[00175] PCR reagents can be obtained from PE- Applied Biosystems, Foster City, CA. RT-PCR reactions are carried out by adding 25μL PCR cocktail (Ix TAQMAN™ buffer A, 5.5 MM MgCl2, 300 μM each of dATP, dCTP and dGTP, 600 μM of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLD™, and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 μL poly(A) mRNA solution. The RT reaction is carried out by incubation for 30 minutes at 48°C. Following a 10 minute incubation at 95°C to activate the AMPLITAQ GOLD™, 40 cycles of a two-step PCR protocol are carried out: 95°C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/extension). [00176] Probes and primers to human EL were designed to hybridize to a human EL sequence, using published sequence, information (GenBank accession number NM_006033 is herein incorporated as Figure 1). For human EL the PCR primers were: forward primer: CCGGACGGGAGCTGAATAT SEQ ID NO : 3909 reverse primer: CAGTTTCCGCTGGGTTTCC SEQ ID NO : 3910 and the PCR
probe is: FAM™-AGGCGCATCCGGGTGAAGTCTG SEQ ID NO : 3911 - TAMRA where FAM™ (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. For human cyclophilin the PCR primers were: forward primer: CCCACCGTGTTCTTCGACAT SEQ ID NO : 3912 reverse primer: TTTCTGCTGTCTTTGGGACCTT SEQ ID NO : 3913 and the
PCR probe is: 5' JOE- CGCGTCTCCTTTGAGCTGTTTGCA SEQ ID NO : 3914- TAMRA 3' where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye. Example 14
Antisense inhibition of human EL expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy gap
[00177] In accordance with the present invention, a series of oligonucleotides are designed to target different regions of the human EL RNA, using published sequences (NM_006033; incorporated herein as Figure 1). The oligonucleotides are shown in Table 1. "Position" indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds. The indicated parameters for each oligo were predicted using RNAstructure 3.7 by David H. Mathews, Michael Zuker, and Douglas H. Turner. The parameters are described either as free energy (The energy that is released when a reaction occurs. The more negative the number, the more likely the reaction will occur. All free energy units are in kcal/mol.) or melting temperature (the temperature at which two anneal strands of polynucleic acid separate. The higher the temperature, greater the affinity between the 2 strands.) When designing an antisense oligonucleotide (oligomers) that will bind with high affinity, it is desirable to consider the structure of the target RNA strand and the antisense oligomer. Specifically, for an oligomer to bind tightly (in the table described as 'duplex formation'), it should be complementary to a stretch of target RNA that has little self-structure (in the table the free energy of which is described as 'target structure'). Also, the oligomer should have little self-structure, either intramolecular (in the table the free energy of which is described as 'intramolecular oligo') or bimolecular (in the table the free energy of which is described as 'intermolecular oligo'). Breaking up any self-structure amounts to a binding penalty. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'deoxynucleotides, which is flanked on both sides (5' and 3' directions) by four-nucleotide "wings". The wings are composed of 2'- methoxyethyl (2'-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P=S) throughout the oligonucleotide. Cytidine residues in the 2'-MOE wings are 5-methylcytidines. All cytidine residues are 5- methylcytidines.
Table 1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
' TGCATCGTCCGGAGAGAGCC
872 SEQ ID NO:l -24.1 -28.9 78.2 -3.8 -0.1 -10 CCGGGGTTGCGGGGTTGAGA
1555 SEQ ID NO: 2 -23.8 -30.4 80.7 -5.3 -1.2 -5.6 ATTATTGACCGCATCCGTGT
644 SEQ ID NO: 3 -23.5 -25.6 70.4 -1.4 -0.3 -3.6 GTATTATTGACCGCATCCGT
646 SEQ ID NO: 4 -23.3 -25.3 70 -1.4 -0.2 -3.6 TTATTGACCGCATCCGTGTA
643 SEQ ID NO: 5 -23.1 -25.3 69.9 -1.4 -0.5 -3.6
GCATCGTCCGGAGAGAGCCT
871 SEQ ID NO: 6 -23.1 -29.8 80.3 -6 0 -9
CTGCATCGTCCGGAGAGAGC
873 SEQ ID NO: 7 -23.1 -27.8 76.6 -3.8 0 -9.6 TCCGGGGTTGCGGGGTTGAG
1556 SEQ ID NO: 8 -23.1 -30.2 81.1 -5.3 -1.8 -6.6 GGTATTATTGACCGCATCCG
647 SEQ ID NO: 9 -23 -25.3 69.3 -1.4 -0.6 -4.6 TATTGACCGCATCCGTGTAA
642 SEQ ID NO: 10 -22.9 -24.5 67.5 -1.6 0.1 -3.6
ACGGCTCGCTCATGCTCACA 1066 SEQ ID NO: 11 -22.9 -28.6 78 -4.6 -1 -5.9
CGGCTCGCTCATGCTCACAT 1065 SEQ ID NO: 12 -22.7 -28.4 77.3 -4.6 -1 -5.3
GGCTCGCTCATGCTCACATT 1064 SEQ ID NO: 13 -22.4 -27.7 78 -4.6 -0.5 -5
GGCGTCTTTCTCTCTTGTGT 581 SEQ ID NO: 14 -22.2 -26.9 80.7 -4.7 0 -4
TATTATTGACCGCATCCGTG
645 SEQ ID NO: 15 -22.1 -24.1 66.9 -1.4 -0.2 -3.6 GTCCGGGGTTGCGGGGTTGA
1557 SEQ ID NO: 16 -22.1 -31.4 84.3 -7.5 -1.8 -6.6 TCTGCATCGTCCGGAGAGAG
874 SEQ ID NO: 17 -22 -26.4 74.1 -3.8 0 -8.5 GTGTCTCAGATATTGTGTGT
2939 SEQ ID NO: 18 -21.9 -22.8 71.5 -0.8 0 -2.8
GCATGCCTGCCCGGGTTTTT 1260 SEQ ID NO: 19 -21.8 -31.8 83.5 -8.6 -1 -10.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GAATCCTTCCATTGGGTGGG
1836 SEQ ID NO : 20 -21.8 -26.5 74.3 -3.3 -1.3 -6.4 CTGGGGCATATTGGTGGGAA
3173 SEQ ID NO : 21 -21.8 -25.5 72.1 -3.7 0 -3.2
CTTCACCCGGATGCGCCTGA
1589 SEQ ID NO: 22 -21.6 -30.8 78.8 -8.3 -0.7 -7.8 TGGTATTATTGACCGCATCC
648 SEQ ID NO: 23 -21.5 -24.5 69.1 -1.6 -1.3 -4.7
GGCATGCCTGCCCGGGTTTT 1261 SEQ ID NO: 24 -21.5 -32.9 85.6 -8.6 -2.8 -12.5
TTCACCCGGATGCGCCTGAT 1588 SEQ ID NO: 25 -21.5 -29.9 77 -7.4 -0.9 -7.8
GCGAAACCAGAGCTCCCGGC 1676 SEQ ID NO:26 -21.5 -30.2 77 -7.9 -0.4 -8.7
ACTTCACCCGGATGCGCCTG
1590 SEQ ID NO: 27 -21.4 -30.4 78.1 -8.3 -0.5 -7.8 GTTCCTCGTCAGGCAGAGTA
2088 SEQ ID NO:28 -21.4 -27.3 79.9 -5 -0.7 -4.8
GGTGGCTTTTCCAAGAAGTT 2893 SEQ ID NO: 29 -21.4 -24.2 70.6 -1.5 -1.2 -5.2
TCACCCGGATGCGCCTGATA 1587 SEQ ID NO:30 -21.3 -29.5 76.1 -7.4 -0.6 -7.8
TTGGCGTCTTTCTCTCTTGT 583 SEQ ID NO:31 -21.1 -25.8 77.2 -4.7 0 -4.6
ACGCGTGTAGGTGTGGAGGA 905 SEQ ID NO-.32 -21.1 -26.9 75.9 -5.1 0 -8.8
CGGGGTTGCGGGGTTGAGAC 1554 SEQ ID NO: 33 -21.1 -28.6 77.9 -7.5 0 -4
ACCGCTCATCGTCCATCCGT 521 SEQ ID NO -.34 -21 -30.7 80 -9.2 -0.2 -3.1
CGTCTTTCTCTCTTGTGTGC
579 SEQ ID NO: 35 -21 -25.7 77.6 -4.7 0 -2.6 GCGTCTTTCTCTCTTGTGTG
580 SEQ ID NO: 36 -21 -25.7 77.6 -4.7 0 -3.4 TGGCGTCTTTCTCTCTTGTG
582 SEQ ID NO:37 -21 -25.7 76.6 -4.7 0 -4.6
CACCCGGATGCGCCTGATAT 1586 SEQ ID NO: 38 -21 -29.1 74.6 -7.4 -0.5 -7.4
GACTTCACCCGGATGCGCCT
1591 SEQ ID NO: 39 -21 -31 79.5 -9.3 -0.5 -7.8 AGAATCCTTCCATTGGGTGG
1837 SEQ ID NO: 40 -21 -25.3 72 -3.3 -0.9 -5.4 CCTCGTCAGGCAGAGTACAG
2085 SEQ ID NO: 41 -21 -26.5 76.1 -5 -0.2 -5.5 TCCTCGTCAGGCAGAGTACA
2086 SEQ ID NO: 42 -21 -26.9 77.5 -5 -0.7 -6.6 GTCTTTCTCTCTTGTGTGCA
578 SEQ ID NO: 3 -20.9 -25.6 79.2 -4.7 0 -5.2
GCTCGCTCATGCTCACATTT 1063 SEQ ID NO: 44 -20.9 -26.6 75.8 -4.6 -1 -4.6
GACGGCTCGCTCATGCTCAC 1067 SEQ ID NO: 45 -20.9 -28.5 78.2 -6.5 -1 -5.9
ATTGACCGCATCCGTGTAAA 641 SEQ ID NO: 46 -20.8 -24.1 66 -2.6 -0.5 -3.6
ACTGCAGTCTTCTAAGGGCT 467 SEQ ID NO: 47 -20.7 -25.6 75.6 -3.9 0 -10
ACATTGGCGTCTTTCTCTCT 586 SEQ ID NO: 48 -20.7 -25.4 75 -4.7 0 -4
1558 CGTCCGGGGTTGCGGGGTTG -20.7 -31.6 82.4 -9.1 -1.8 -6.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO-.49
AATCCTTCCATTGGGTGGGT 1835 SEQ ID NO: 50 -20.7 -27.1 76.4 -5 -1.3 -6.4
AGTGTCTCAGATATTGTGTG 2940 SEQ ID NO: 51 -20.7 -21.6 68 -0.8 0 -2.8
CATTGGCGTCTTTCTCTCTT 585 SEQ ID NO: 52 -20.6 -25.3 74.8 -4.7 0 -4.6
AGGCATGCCTGCCCGGGTTT 1262 SEQ ID NO: 53 -20.6 -32.8 85.6 -8.6 -3.6 -14
CCGTCCGGGGTTGCGGGGTT
1559 SEQ ID NO: 54 -20.5 -33.6 85.8 -11.3 -1.8 -9.4 CGTTCCTCGTCAGGCAGAGT
2089 SEQ ID NO: 55 -20.5 -28.4 80.1 -7 -0.7 -4.8
TGGGGCATATTGGTGGGAAC 3172 SEQ ID NO:56 -20.5 -24.8 70.8 -3.6 -0.4 -4.8
CATCGTCCGGAGAGAGCCTC 870 SEQ ID NO: 57 -20.4 -28.4 77.7 -7.2 -0.6 -8.2
GCTGTTCCTCTTGTTCCTCA 1229 SEQ ID NO -.58 -20.4 -28.4 83.2 -8 0 -2.8
ACCCGGATGCGCCTGATATT 1585 SEQ ID NO: 59 -20.4 -28.5 74 -7.4 -0.5 -7.4
TTCCTCGTCAGGCAGAGTAC 2087 SEQ ID NO -.60 -20.4 -26.3 76.8 -5 -0.7 -5.3
GTCTCAGATATTGTGTGTAT
2937 SEQ ID NO: 61 -20.4 -21.3 67.2 -0.8 0 -2.8 TGTCTCAGATATTGTGTGTA
2938 SEQ ID NO: 62 -20.4 -21.3 67.1 -0.8 0 -2.8 CCCTGGTATTATTGACCGCA
651 SEQ ID NO: 63 -20.3 -27 72.9 -5.3 -1.3 -4.7 TGGTGGCTTTTCCAAGAAGT
2894 SEQ ID NO-.64 -20.3 -24.1 70.1 -2.5 -1.2 -5.2
AACGCGTGTAGGTGTGGAGG 906 SEQ ID NO: 65 -20.2 -25.6 72.1 -4.5 0 -9.7
CCCGTCCGGGGTTGCGGGGT
1560 SEQ ID NO: 66 -20.2 -35.5 88.5 -12.4 -2.8 -13 TACCGCTCATCGTCCATCCG
522 SEQ ID NO: 67 -20.1 -29.2 76.3 -8.6 -0.2 -3.1
GACCGCATCCGTGTAAAGCT
638 SEQ ID NO: 68 -20.1 -26.7 71.6 -5.9 -0.5 -5.5 GAAACCAGAGCTCCCGGCCT
1674 SEQ ID NO: 69 -20.1 -30.5 78.3 -9.5 -0.8 -8.7
ATTGGCGTCTTTCTCTCTTG 584 SEQ ID NO:70 -19.9 -24.6 73.4 -4.7 0 -4.6
GTGCTTCAGAGAGTGAGCTG
2305 SEQ ID NO: 71 -19.9 -24.8 75 -3.1 -1.8 -6.5 TGTGCTTCAGAGAGTGAGCT
2306 SEQ ID NO: 72 -19.9 -24.8 75 -3.1 -1.8 -5.8 GGGGCATATTGGTGGGAACT
3171 SEQ ID NO: 73 -19.9 -25.7 72.9 -4.5 -1.2 -5.7
TCTGGGGCATATTGGTGGGA 3174 SEQ ID NO: 74 -19.9 -26.6 76.3 -6.7 0 -4
TGACCGCATCCGTGTAAAGC
639 SEQ ID NO: 75 -19.8 -25.8 69.7 -5.3 -0.5 -4.1 ACCCTGGTATTATTGACCGC
652 SEQ ID NO: 76 -19.8 -26.5 72.4 -5.9 -0.6 -4.2 ATCTGCATCGTCCGGAGAGA
875 SEQ ID NO :77 -19.8 -26.4 73.7 -6 0 -8.5
TGCGAAACCAGAGCTCCCGG 1677 SEQ ID NO: 78 -19.8 -28.4 73.1 -7.9 -0.4 -8.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo CTTTCTCTCTTGTGTGCAGG
576 SEQ ID NO: 79 -19.7 -25.2 76.5 -5.5 0 -5.3 TCTTTCTCTCTTGTGTGCAG
577 SEQ ID NO: 80 -19.7 -24.4 75.5 -4.7 0 -5.3 TGCTGTTCCTCTTGTTCCTC
1230 SEQ ID NO: 81 -19.7 -27.7 81.9 -8 0 -3.6 AAGGCATGCCTGCCCGGGTT
1263 SEQ ID NO: 82 -19.7 -32 82.6 -8.6 -3.6 -14.8 CCAGCCGTCCCTCTGGACCA
327 SEQ ID NO: 83 -19.6 -33.8 86.4 -11.5 -2.7 -8.7 TACATTGGCGTCTTTCTCTC
587 SEQ ID NO: 84 -19.5 -24.2 72.3 -4.7 0 -4.6 CGCGTGTAGGTGTGGAGGAC
904 SEQ ID NO: 85 -19.5 -26.9 75.9 -7.4 0 -6.2 CTTCCATTGGGTGGGTCCTC
1831 SEQ ID NO: 86 -19.5 -29.1 82.9 -8.2 -1.3 -6.4 CTGGTATTATTGACCGCATC
649 SEQ ID NO: 87 -19.4 -23.4 67.4 -2.6 -1.3 -4.7 ATCGTCCGGAGAGAGCCTCT
869 SEQ ID NO: 88 -19.4 -28.6 78.6 -7.7 -1.4 -9.5 TTGCTGTTCCTCTTGTTCCT
1231 SEQ ID NO: 89 -19.4 -27.4 80.3 -8 0 -3.6 TCCAGCCGTCCCTCTGGACC
328 SEQ ID NO: 90 -19.3 -33.5 87.3 -11.5 -2.7 -8.7 ATACCGCTCATCGTCCATCC
523 SEQ ID NO :91 -19.3 -28.4 76.5 -8.6 -0.2 -3 TCTCAGATATTGTGTGTATT
2936 SEQ ID NO: 92 -19.3 -20.2 64 -0.8 0 -2.8 CTCGCTCATGCTCACATTTT
1062 SEQ ID NO -.93 -19.2 -24.9 71.8 -4.6 -1 -4.4 TCTCCCAAGTCCTCCTCGGT
1456 SEQ ID NO: 94 -19.1 -31.1 84.5 -12 0 -3 GTCTCCCAAGTCCTCCTCGG
1457 SEQ ID NO: 95 -19.1 -31.1 84.5 -12 0 -3 ATCTTCCAGCCGTCCCTCTG
332 SEQ ID NO: 96 -19 -30.9 83.7 -11.9 0 -3.2 TCCCAAGTCCTCCTCGGTGT
1454 SEQ ID NO: 97 -19 -31 84 -12 0 -3 AGGTACGGGGCTCCCCGCAG
305 SEQ ID NO: 98 -18.9 -33.1 85.1 -11.2 -2.6 -13.7 GCATCCTGGCAATGCTGTGT
678 SEQ ID NO: 99 -18.9 -27.9 78.3 -7.3 -1.7 -9 AAAGGCATGCCTGCCCGGGT
1264 SEQ ID NO: 100 -18.9 -31.2 79.9 -8.6 -3.6 -14.8 CTTGCGAAACCAGAGCTCCC
1679 SEQ ID NO: 101 -18.8 -27.4 72.9 -7.9 -0.4 -8.4 GTCTGGGGCATATTGGTGGG
3175 SEQ ID NO: 102 -18.8 -27.2 78.5 -8.4 0 -4 AACTGCAGTCTTCTAAGGGC
468 SEQ ID NO: 103 -18.7 -24 71 -3.9 0 -10.8 TCGTCCGGAGAGAGCCTCTT
868 SEQ ID NO: 104 -18.7 -28.7 79 -8.4 -1.4 -10 AGGTGGGCTCAATTTCTCCC
1335 SEQ ID NO: 105 -18.7 -27.8 19 -8.3 -0.6 -5.8 CGTAAAAGGTGGGCTCAATT
1341 SEQ ID NO: 106 -18.7 -21.6 62.3 -2.9 0 -5.8 CTCCCAAGTCCTCCTCGGTG
1455 SEQ ID NO: 107 -18.7 -30.7 82.4 -12 0 -3
1553 GGGGTTGCGGGGTTGAGACA -18.7 -28.5 79.3 -9.1 -0.5 -4.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular isition oligo binding ation Duplex ture oligc oligo
SEQ ID NO: 108
TTGCGAAACCAGAGCTCCCG
1678 SEQ ID NO: 109 -18.7 -27.3 71.2 -7.9 -0.4 -8.4 CTCGTCAGGCAGAGTACAGG
2084 SEQ ID NO: 110 -18.7 -25.7 75 -7 0 -5.3 GAACGCGTGTAGGTGTGGAG
907 SEQ ID NO: 111 -18.6 -25 70.9 -5.5 0 -9.7 ACTCGGCTTGTCCTGATTCA
1109 SEQ ID NO: 112 -18.6 -26.6 75.8 -7.4 -0.3 -4.1 CTGTTCCTCTTGTTCCTCAT
1228 SEQ ID NO: 113 -18.6 -26.6 78.4 -8 0 -1.9 TTTGCTGTTCCTCTTGTTCC
1232 SEQ ID NO: 114 -18.6 -26.6 78.6 -8 0 -3.6 TGACGTAAAAGGTGGGCTCA
1344 SEQ ID NO: 115 -18.6 -23 65.7 -4.4 0 -5.6 GGTCTCCCAAGTCCTCCTCG
1458 SEQ ID NO: 116 -18.6 -31.1 84.5 -12 -0.1 -2.7 GTTCTCAGGGTCTTCTGTAC
1640 SEQ ID NO: 117 -18.6 -25.1 78.3 -6 -0.1 -4 AAACCAGAGCTCCCGGCCTG
1673 SEQ ID NO: 118 -18.6 -29.9 76.9 -9.5 -1.8 -8.7 GATCTAGAATTGGTGGCTTT
2904 SEQ ID NO: 119 -18.6 -22.1 66.6 -3.5 0 -6.2 AGGATTTTATGGATGGCTCT
3226 SEQ ID NO: 120 -18.6 -22.8 68.2 -4.2 0 -3.7 TCTTCCAGCCGTCCCTCTGG
331 SEQ ID NO: 121 -18.5 -32.1 86.3 -11.9 -1.7 -5.8 CATGCCTGCCCGGGTTTTTA
1259 SEQ ID NO: 122 -18.5 -29.7 78.8 -9.9 -0.7 -10.3 ACTCTGCTTGCTATTCTGCT
2654 SEQ ID NO: 123 -18.5 -25.7 76 -6.5 -0.4 -4 AGATCTAGAATTGGTGGCTT
2905 SEQ ID NO: 124 -18.5 -22 66.5 -3.5 0 -6.2 GGTACGGGGCTCCCCGCAGC
304 SEQ ID NO: 125 -18.4 -34.9 88.9 -12.9 -3.5 -14.6 TCTTGTTCCTCATTTTCTTG
1221 SEQ ID NO: 126 -18.4 -22.8 69.9 -4.4 0 -1.9 ATCCTTCCATTGGGTGGGTC
1834 SEQ ID NO: 127 -18.4 -28.2 80.8 -8.4 -1.3 -6.4 GCTCATCGTCCATCCGTGAA
518 SEQ ID NO: 128 -18.3 -27.6 75.2 -8.7 -0.3 -3.8 CCTGGTATTATTGACCGCAT
650 SEQ ID NO: 129 -18.3 -25 69.5 -5.3 -1.3 -4.7 GGAACGCGTGTAGGTGTGGA
908 SEQ ID NO: 130 -18.3 -26.2 73.1 -7 0 -9.7 GGTGGGCTCAATTTCTCCCA
1334 SEQ ID NO: 131 -18.3 -28.5 79.7 -8.3 -1.9 -7.3 CCCAAGTCCTCCTCGGTGTA
1453 SEQ ID NO: 132 -18.3 -30.3 81.7 -12 0 -3 GGATTTTATGGATGGCTCTA
3225 SEQ ID NO: 133 -18.3 -22.5 67.4 -4.2 0 -3.7 CGAAACCAGAGCTCCCGGCC
1675 SEQ ID NO: 134 -18.2 -30.4 76.3 -11.3 -0.8 -7.8 TTGACCGCATCCGTGTAAAG
640 SEQ ID NO: 135 -18.1 -24.1 66.2 -5.3 -0.5 -3.6 CCTCTTGTTCCTCATTTTCT
1223 SEQ ID NO: 136 -18.1 -25.6 75.7 -7.5 0 -1.8 ACGTAAAAGGTGGGCTCAAT
1342 SEQ ID NO: 137 -18.1 -21.7 62.5 -3.6 0 -5.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
GTGTGCTTCAGAGAGTGAGC 2307 SEQ ID NO: 138 -18.1 -25.1 76.6 -5.9 -1 -5.2
TTGGTGGCTTTTCCAAGAAG 2895 SEQ ID NO: 139 -18.1 -23 67.2 -3.6 -1.2 -5.4
ATCTAGAATTGGTGGCTTTT 2903 SEQ ID NO: 140 -18.1 -21.6 65.6 -3.5 0 -6.2
TCGCTCATGCTCACATTTTA 1061 SEQ ID NO: 141 -18 -23.7 69.3 -4.6 -1 -3.8
GGACGGCTCGCTCATGCTCA 1068 SEQ ID NO: 142 -18 -29.5 80.2 -10.4 -1 -6.1
AGACTTCACCCGGATGCGCC 1592 SEQ ID NO: 143 -18 -30.1 78 -11.4 -0.5 -7.8
TCCTTCCATTGGGTGGGTCC 1833 SEQ ID NO: 144 -18 -30.2 84.5 -11.3 -0.8 -6.4
CTCTGCTTGCTATTCTGCTA 2653 SEQ ID NO: 145 -18 -25.2 74.8 -6.5 -0.4 -4.5
TACTCTGCTTGCTATTCTGC 2655 SEQ ID NO: 146 -18 -24.5 73.3 -6.5 0 -4.5
GACGTAAAAGGTGGGCTCAA 1343 SEQ ID NO: 147 -17.9 -22.3 63.7 -4.4 0 -5.8
AAGAATCCTTCCATTGGGTG 1838 SEQ ID NO -.148 -17.9 -23.4 67.2 -5 -0.2 -7
GCGTTCCTCGTCAGGCAGAG 2090 SEQ ID NO: 149 -17.9 -29 80.9 -10.3 -0.6 -5.5
AAGTGTCTCAGATATTGTGT 2941 SEQ ID NO: 150 -17.9 -20.9 65.6 -3 0 -2.8
TGCAGTCTTCTAAGGGCTGG 465 SEQ ID NO: 151 -17.8 -25.7 75.5 -6.2 -1.7 -4.9
GATACCGCTCATCGTCCATC 524 SEQ ID NO: 152 -17.8 -27 74.4 -9.2 0.3 -3.1
AACTCGGCTTGTCCTGATTC 1110 SEQ ID NO: 153 -17.8 -25.2 72.2 -7.4 0 -3.8
TGTTCCTCTTGTTCCTCATT 1227 SEQ ID NO: 154 -17.8 -25.8 76.7 -8 0 -1.9
TCCCGTCCGGGGTTGCGGGG 1561 SEQ ID NO: 155 -17.8 -34.7 86.9 -13.4 -3.4 -14
TTCCATTGGGTGGGTCCTCA 1830 SEQ ID NO: 156 -17.8 -28.9 82 -9.7 -1.3 -8.8
CCGCTCATCGTCCATCCGTG 520 SEQ ID NO: 157 -17.7 -30.5 79.3 -12.3 -0.2 -3.1
AGGAACGCGTGTAGGTGTGG 909 SEQ ID NO: 158 -17.7 -25.6 72.1 -7 0 -9.7
TTCTCAGGGTCTTCTGTACA 1639 SEQ ID NO: 159 -17.7 -24.6 75.5 -6 -0.7 -6.1
GTGGCTTTTCCAAGAAGTTC 2892 SEQ ID NO: 160 -17.7 -23.4 69.6 -4.4 -1.2 -7.7
AAGATCTAGAATTGGTGGCT 2906 SEQ ID NO: 161 -17.7 -21.2 63.9 -3.5 0 -6.4
AAGGTACGGGGCTCCCCGCA 306 SEQ ID NO: 162 -17.6 -32.4 82.3 -11.2 -3.5 -14.6
AGCTGTCATGTTGAAACTGC 482 SEQ ID NO: 163 -17.6 -22.4 66.7 -3.9 -0.8 -6.1
CGGCTTGTCCTGATTCACCA 1106 SEQ ID NO: 164 -17.6 -28 76.7 -9.8 -0.3 -4.4
TCCTCTTGTTCCTCATTTTC 1224 SEQ ID NO: 165 -17.6 -25.1 75.4 -7.5 0 -1.9
TTCATGGAGTTTCAGAGATA 3138 SEQ ID NO: 166 -17.6 -20.4 63.7 -2.8 0 -4.7
637 ACCGCATCCGTGTAAAGCTG -17.5 -26.1 70.2 -8.1 -0.2 -5.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total formTm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO : 167
ATGTGGCCCACAGGCATCTG 949 SEQ ID NO: 168 -17.5 -28.8 79.3 -8.8 -2.5 -9.2
GTGACGTAAAAGGTGGGCTC 1345 SEQ ID NO: 169 -17.5 -23.5 67.6 -6 0 -5.3
CAAGATCTAGAATTGGTGGC 2907 SEQ ID NO: 170 -17.5 -21 63.1 -3.5 0 -7
CAGCCGTCCCTCTGGACCAA 326 SEQ ID NO: 171 -17.4 -31.1 80.7 -11.5 -2.2 -8.7
AGATACCGCTCATCGTCCAT 525 SEQ ID NO: 172 -17.4 -26.6 73.1 -8.6 -0.3 -3.5
GGCTTGTCCTGATTCACCAG 1105 SEQ ID NO: 173 -17.4 -27.2 77.3 -9.8 0 -5
GACCAGTTGTTCCCAGTGCT 1875 SEQ ID NO: 174 -17.4 -29.1 82.1 -11.7 0 -3.7
TCCCCCAGGCCCCAGGTGCC 2509 SEQ ID NO: 175 -17.4 -39 96.1 -20.2 -1.3 -8.3
CTTCCAGCCGTCCCTCTGGA 330 SEQ ID NO: 176 -17.3 -32.3 85.7 -12.3 -2.7 -7.8
AATCTGCATCGTCCGGAGAG 876 SEQ ID NO: 177 -17.3 -25.1 70.2 -7.2 0 -8.5
TGTGGCCCACAGGCATCTGA 948 SEQ ID NO: 178 -17.3 -29.4 80.7 -8.8 -3.3 -9.1
TCGGCTTGTCCTGATTCACC 1107 SEQ ID NO: 179 -17.3 -27.7 77.4 -9.8 -0.3 -4.4
GTAAAAGGTGGGCTCAATTT 1340 SEQ ID NO: 180 -17.3 -20.9 62.2 -3.6 0 -5.9
AGGTCTCCCAAGTCCTCCTC 1459 SEQ ID NO: 181 -17.3 -30.3 85.6 -12 -0.9 -4.6
CATCCTGGCAATGCTGTGTC 677 SEQ ID NO: 182 -17.2 -26.5 75.6 -0.4 -7.7
GTGTTCTCAGGGTCTTCTGT 1642 SEQ ID NO: 183 -17.2 -26.4 82.2 -8.3 -0.7 -3.7
CCCCCAGGCCCCAGGTGCCT 2508 SEQ ID NO: 184 -17.2 -39.5 95.9 -20.2 -2.1 -9.8
CAGCGTTCCTCGTCAGGCAG 2092 SEQ ID NO: 185 -17.1 -29.1 80.6 -11.1 -0.7 -8.2
GATTTTATGGATGGCTCTAT 3224 SEQ ID NO: 186 -17.1 -21.3 64.7 -4.2 0 -3.7
GTTTTAGCTGTCATGTTGAA 487 SEQ ID NO: 187 -17 -21.4 66 -3.9 -0.1 -6.6
GAGCATCCTGGCAATGCTGT 680 SEQ ID NO: 188 -17 -27.3 76.6 -7.3 -3 -11.2
ACTTGCGAAACCAGAGCTCC 1680 SEQ ID NO: 189 -17 -25.6 70.2 -7.9 -0.4 -8.4
AGCGTTCCTCGTCAGGCAGA 2091 SEQ ID NO: 190 -17 -29 80.9 -11.1 -0.7 -8.2
TGCTATTCTGCTAGTGATCA 2646 SEQ ID NO: 191 -17 -23.1 70 -5.4 -0.4 -6.9
CTGCTTGCTATTCTGCTAGT 2651 SEQ ID NO: 192 -17 -25.1 74.9 -7.6 -0.2 -4.5
AGCATCCTGGCAATGCTGTG 679 SEQ ID NO: 193 -16.9 -26.7 75.1 -7.3 -2.5 -10.5
AAAAGGTGGGCTCAATTTCT 1338 SEQ ID NO: 194 -16.9 -21.3 63 -4.4 0 -6
TCTCAGGGTCTTCTGTACAA 1638 SEQ ID NO: 195 -16.9 -23.8 72.4 -6 -0.7 -6.2
GTTCCCAGTGCTCCAGGGTC 1867 SEQ ID NO: 196 -16.9 -31.4 89.4 -13.2 -1.2 -6.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CTTTTCCAAGAAGTTCAACA
2888 SEQ ID NO: 197 -16.9 -20.1 60.5 -3.2 0 -6.8
GGGCATATTGGTGGGAACTG
3170 SEQ ID NO: 198 -16.9 -24.5 70.2 -6.3 -1.2 -5.7
GGTACATTTTGCTGTTCCTC
1239 SEQ ID NO: 199 -16.8 -25 74.5 -8.2 0 -5.2
CCAGTTGTTCCCAGTGCTCC
1873 SEQ ID NO: 200 -16.8 -30.7 85.6 -13.9 0 -3.7
TGCCATCCTGACATGAGTCA
2193 SEQ ID NO: 201 -16.8 -26.2 74.2 -7.3 -2.1 -7.1
AAGATACCGCTCATCGTCCA
526 SEQ ID NO: 202 -16.7 -25.9 70.9 -8.6 -0.3 -3.5
CTTGTTCCTCATTTTCTTGG
1220 SEQ ID NO: 203 -16.7 -23.6 71 -6.9 0 -2.9
CATTTTGCTGTTCCTCTTGT
1235 SEQ ID NO: 204 -16.7 -24.9 74.1 -8.2 0 -3.6
CTTCAAGAGGTCTCCCAAGT
1466 SEQ ID NO: 205 -16.7 -25.3 73.1 -7.6 -0.9 -4.8
CCCGAGCAAGATACCAGGCC
2213 SEQ ID NO: 206 -16.7 -29.4 76.2 -12.7 0 -6.4
ATTGGTGGCTTTTCCAAGAA
2896 SEQ ID NO: 207 -16.7 -23 66.9 -4.6 -1.7 -6.1
GTGTCAACGGCTTGCCCCAG
51 SEQ ID NO: 208 -16.6 -30.3 80.3 -12.8 -0.8 -7.4
AGTGTCAACGGCTTGCCCCA
52 SEQ ID NO -.209 -16.6 -30.3 80.3 -12.8 -0.8 -7.4
CTGCAGTCTTCTAAGGGCTG
466 SEQ ID NO: 210 -16.6 -25.4 74.8 -7.4 -1.3 -8.1
GTGGCCCACAGGCATCTGAA
947 SEQ ID NO :211 -16.6 -28.7 78.3 -8.8 -3.3 -9.3
TGCTTCAGAGAGTGAGCTGG
2304 SEQ ID NO: 212 -16.6 -24.8 74.1 -6.4 -1.8 -6.5
GCTATTCTGCTAGTGATCAA
2645 SEQ ID NO -.213 -16.6 -22.4 67.7 -5.8 0 -6.7
TGGCTTTTCCAAGAAGTTCA
2891 SEQ ID NO: 214 -16.6 -22.9 67.5 -5.3 -0.8 -9.3
CTCATCGTCCATCCGTGAAT
517 SEQ ID NO: 215 -16.5 -25.8 71.1 -8.7 -0.3 -3.8
GTACATTTTGCTGTTCCTCT
1238 SEQ ID NO: 216 -16.5 -24.7 73.9 -8.2 0 -4.6
GTACAAAATGTCAGTTTCCG
1624 SEQ ID NO: 217 -16.5 -20.6 61.1 -4.1 0 -5.1
TGTACAAAATGTCAGTTTCC
1625 SEQ ID NO: 218 -16.5 -19.8 60.5 -3.3 0 -5.9
TGTTCCCAGTGCTCCAGGGT
1868 SEQ ID NO: 219 -16.5 -31 87 -13.2 -1.2 -6.3
AGACCAGTTGTTCCCAGTGC
1876 SEQ ID NO: 220 -16.5 -28.2 80.4 -11.7 0 -3.6
AGGTACATTTTGCTGTTCCT
1240 SEQ ID NO: 221 -16.4 -24.6 73.1 -8.2 0 -5.2
AAAGGTGGGCTCAATTTCTC
1337 SEQ ID NO: 222 -16.4 -22.4 66.7 -6 0 -5.4
TCCAGTGGCAGAGTCTGGGA
1387 SEQ ID NO: 223 -16.4 -28.1 81.5 -9.5 -2.2 -9.6
TTCCAGTGGCAGAGTCTGGG
1388 SEQ ID NO: 224 -16.4 -27.6 80.4 -9 -2.2 -9.6
TCTTCAAGAGGTCTCCCAAG
1467 SEQ ID NO: 225 -16.4 -24.5 71.4 -7.1 -0.9 -4.8
1641 TGTTCTCAGGGTCTTCTGTA -16.4 -24.9 77.3 -7.6 -0.7 -3.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID MO : 226
CACTTGCGAAACCAGAGCTC 1681 SEQ ID NO: 227 -16.4 -24.3 67.8 -7.9 0.3 -8
TTCCCAGTGCTCCAGGGTCA 1866 SEQ ID NO: 228 -16.4 -30.9 86.5 -13.2 -1.2 -6.3
CCAGCGTTCCTCGTCAGGCA 2093 SEQ ID NO: 229 -16.4 -31.1 83.7 -13.8 -0.7 -8.2
CCAAAAGGTACGGGGCTCCC 310 SEQ ID NO: 230 -16.3 -28.4 74.1 -11.2 -0.7 -7.2
GCTTGTCCTGATTCACCAGA 1104 SEQ ID NO: 231 -16.3 -26.6 76 -9.8 -0.2 -3.8
GCCTGCCCGGGTTTTTAGGT 1256 SEQ ID NO: 232 -16.3 -31.4 84.4 -13 -0.7 -12.3
GGGTGACGTAAAAGGTGGGC 1347 SEQ ID NO: 233 -16.3 -24.6 69.2 -8.3 0 -4.7
CCAAGTCCTCCTCGGTGTAG 1452 SEQ ID NO: 234 -16.3 -28.3 78.6 -12 0 -3
TCGTCAGGCAGAGTACAGGC 2083 SEQ ID NO: 235 -16.3 -26.6 77.6 -10.3 0 -5.4
ATAGACATTTGCTCAATTAA 2359 SEQ ID NO: 236 -16.3 -17.6 55.5 -1.2 0 -3.6
ACCGGCCATCATTCTGGCCC 2687 SEQ ID NO: 237 -16.3 -32.2 83.3 -11.6 -4.3 -11.3
GTTTGTCTCACGTCTGGGGC 3186 SEQ ID NO: 238 -16.3 -27.9 81.5 -11.6 0 -4.6
TCAGGCTATGTGGATAAGGT 3685 SEQ ID NO: 239 -16.3 -23.1 69 -6.8 0 -4.1
AAAGGTACGGGGCTCCCCGC 307 SEQ ID NO: 240 -16.2 -31 79 -11.2 -3.5 -14.6
AAACTGCAGTCTTCTAAGGG 469 SEQ ID NO -.241 -16.2 -21.5 64.4 -3.9 0 -10.8
TGTCAATGTGGCCCACAGGC 954 SEQ ID NO: 242 -16.2 -28.4 78.3 -10 -2.2 -9.2
GAAAGGCATGCCTGCCCGGG 1265 SEQ ID NO -.243 -16.2 -30.6 77.9 -10.7 -3.6 -14.8
AAGTCCTCCTCGGTGTAGAC 1450 SEQ ID NO: 244 -16.2 -26.4 75.9 -10.2 0 -3.7
CCTTCCATTGGGTGGGTCCT 1832 SEQ ID NO: 245 -16.2 -30.7 84.5 -13.1 -1.3 -6.4
GCAAGAGCTATAGCAGCGCA 1930 SEQ ID NO:246 -16.2 -26.1 73.3 -7.6 -2.3 -11
TAGAATTGGTGGCTTTTCCA
2900 SEQ ID NO: 247 -16.2 -23.4 68.6 -6.1 -1 -5.1 CTAGAATTGGTGGCTTTTCC
2901 SEQ ID NO: 248 -16.2 -23.6 69.4 -7.4 0 -3.7 ATTTTATGGATGGCTCTATA
3223 SEQ ID NO: 249 -16.2 -20.4 62.7 -4.2 0 -3.7
CATGTTGAAACTGCAGTCTT 476 SEQ ID NO: 250 -16.1 -21.4 64.1 -3.9 0 -10.8
AAATCTGCATCGTCCGGAGA 877 SEQ ID NO: 251 -16.1 -24.4 67.8 -7.7 0 -8.5
AAACTCGGCTTGTCCTGATT llll SEQ ID NO: 252 -16.1 -24.1 68.4 -7.4 -0.3 -3.8
ATTTTGCTGTTCCTCTTGTT 1234 SEQ ID NO: 253 -16.1 -24.3 73.3 -8.2 0 -2.9
GCCTCCCCCAGGCCCCAGGT 2512 SEQ ID NO: 254 -16.1 -39.9 98.2 -21.4 -2.4 -9.7
TGCTTGCTATTCTGCTAGTG 2650 SEQ ID NO:255 -16.1 -24.2 72.6 -7.6 -0.2 -4.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CAACCGGCCATCATTCTGGC
2689 SEQ ID NO:256 -16.1 -28.2 75.3 -9.7 -2.4 -8
GCAACCGGCCATCATTCTGG
2690 SEQ ID NO:257 -16.1 -28.2 75.3 -11.6 -0.1 -7.4
TGTATATGCAAACATTCCAA
3602 SEQ ID NO: 258 -16.1 -19.1 57.5 -2.5 -0.2 -5.6
CCTCAGGCTATGTGGATAAG
3687 SEQ ID NO: 259 -16.1 -23.6 68.8 -6.8 -0.5 -4.1
CAAAAGGTACGGGGCTCCCC
309 SEQ ID NO:260 -16 -28.4 74.1 -11.2 -1.1 -9.1
AATGTGGCCCACAGGCATCT
950 SEQ ID NO: 261 -16 -28.1 77 -8.8 -3.3 -9.4
CAAAACTCGGCTTGTCCTGA
1113 SEQ ID NO: 62 -16 -24 67 -7.4 -0.3 -3.7
TATTTCCAGTGGCAGAGTCT
1391 SEQ ID NO: 263 -16 -25 74.8 -9 0 -6.8
CAAGTCCTCCTCGGTGTAGA
1451 SEQ ID NO: 264 -16 -26.9 76.3 -10.9 0 -3
CCATTGGGTGGGTCCTCAGC
1828 SEQ ID NO: 265 -16 -30.2 84.6 -13.3 -0.8 -5.3
TCCATTGGGTGGGTCCTCAG
1829 SEQ ID NO -.266 -16 -28.8 81.9 -11.4 -1.3 -8.8
GTTGTTCCCAGTGCTCCAGG
1870 SEQ ID NO: 267 -16 -29.9 84.7 -13.9 0 -3.7
GCAGCGCAGTCCCCTCCCGC
1918 SEQ ID NO: 268 -16 -37.1 92.6 -19.5 -1.5 -8.5
TTGCTATTCTGCTAGTGATC
2647 SEQ ID NO: 269 -16 -22.5 69.2 -5.8 -0.4 -5
TCTGCTTGCTATTCTGCTAG
2652 SEQ ID NO-.270 -16 -24.3 73 -7.6 -0.4 -4.5
AGAATTGGTGGCTTTTCCAA
2899 SEQ ID NO: 271 -16 -23 66.9 -5.4 -1.5 -5.8
CTCAGGCTATGTGGATAAGG
3686 SEQ ID NO-.272 -16 -22.8 67.7 -6.8 0 -3.3
GGTTTTAGCTGTCATGTTGA
488 SEQ ID NO: 273 -15.9 -23.3 71.3 -6.8 0 -8.6
CACCCTGGTATTATTGACCG
653 SEQ ID NO: 274 -15.9 -25.4 69.5 -8.1 -1.3 -5
AAGGAACGCGTGTAGGTGTG
910 SEQ ID NO: 275 -15.9 -23.7 67.4 -7 0 -9.2
CGCTCATGCTCACATTTTAC
1060 SEQ ID NO: 276 -15.9 -23.5 68.3 -6.5 -1 -4.4
CTCGGCTTGTCCTGATTCAC
1108 SEQ ID NO: 277 -15.9 -26.6 75.8 -10.1 -0.3 -4.4
GGCAAAACTCGGCTTGTCCT
1115 SEQ ID NO: 278 -15.9 -26.4 72.3 -9.8 -0.5 -4.7
GGCTCAATTTCTCCCATGTT
1330 SEQ ID NO: 279 -15.9 -26.2 74.8 -10.3 0 -4.3
ATCTTCAAGAGGTCTCCCAA
1468 SEQ ID NO:280 -15.9 -24.5 71.1 -7.6 -0.9 -4.8
GACACTTGCGAAACCAGAGC
1683 SEQ ID NO:281 -15.9 -23.8 66.3 -7.9 0 -4.1
AACCGGCCATCATTCTGGCC
2688 SEQ ID NO: 282 -15.9 -29.5 77.6 -9.7 -3.9 -10.9
GAATTGGTGGCTTTTCCAAG
2898 SEQ ID NO: 283 -15.9 -23 66.9 -5.4 -1.7 -6.1
CGTCTGGGGCATATTGGTGG
3176 SEQ ID NO: 284 -15.9 -26.8 75.6 -10.9 0 -4
3227 TAGGATTTTATGGATGGCTC -15.9 -21.6 65.6 -5.7 0 -3.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO -.285
CAGTCTTCTAAGGGCTGGCT 463 SEQ ID NO:286 -15.8 -26.6 77.8 -9.7 -1 -6.3 TGTTGAAACTGCAGTCTTCT
474 SEQ ID NO: 287 -15.8 -22 66.4 -3.9 0 -12.8 TCATGTTGAAACTGCAGTCT
477 SEQ ID NO:288 -15.8 -21.7 65.3 -3.9 0 -12.1
TTAGCTGTCATGTTGAAACT 484 SEQ ID NO: 289 -15.8 -20.4 62.3 -3.9 -0.1 -8.6
CGTCCGGAGAGAGCCTCTTG 867 SEQ ID NO:290 -15.8 -28.3 77.1 -10.9 -1.4 -10
GTCAATGTGGCCCACAGGCA 953 SEQ ID NO:291 -15.8 -29.1 79.6 -10 -3.3 -8.7
TGGAAGTCACCCCCATTGGG 979 SEQ ID NO:292 -15.8 -28.8 76.7 -11.3 -1.7 -8.8
CTCAGGGTCTTCTGTACAAA 1637 SEQ ID NO:293 -15.8 -22.7 68.2 -6 -0.7 -6.2
CTTCATGGAGTTTCAGAGAT 3139 SEQ ID NO:294 -15.8 -21.6 66.5 -5.8 0 -5.3
TAGCTGTCATGTTGAAACTG 483 SEQ ID NO:295 -15.7 -20.3 61.9 -3.9 -0.1 -8.6
TGGACGGCTCGCTCATGCTC 1069 SEQ ID NO-.296 -15.7 -28.8 78.9 -12 -1 -6.1
TTCCTCTTGTTCCTCATTTT 1225 SEQ ID NO:297 -15.7 -24.8 74 -9.1 0 -1.9
ACATTTTGCTGTTCCTCTTG 1236 SEQ ID NO:298 -15.7 -23.9 71.1 -8.2 0 -3.6
AAGGTGGGCTCAATTTCTCC 1336 SEQ ID NO:299 -15.7 -25.1 72.7 -9.4 0 -5.8
TAAAAGGTGGGCTCAATTTC 1339 SEQ ID NO -.300 -15.7 -20.1 60.6 -4.4 0 -6 TTTCCAGTGGCAGAGTCTGG
1389 SEQ ID NO:301 -15.7 -26.5 78.1 -9 -1.8 -9.6 CAAGAGGTCTCCCAAGTCCT
1463 SEQ ID NO:302 -15.7 -27.2 76.4 -11 -0.2 -4.8
GTATGGTCAGTGCAACCCAT 2253 SEQ ID NO:303 -15.7 -26.3 74.5 -9.5 -1 -7.4
ATACTCTGCTTGCTATTCTG 2656 SEQ ID NO:304 -15.7 -22.7 68.7 -7 0 -4.5
TTTTATGGATGGCTCTATAT 3222 SEQ ID NO:305 -15.7 -20.4 62.7 -4.2 -0.1 -4.6
ATGTTGAAACTGCAGTCTTC
475 SEQ ID NO:306 -15.6 -21.1 64.4 -3.9 0 -11.1 CATCGTCCATCCGTGAATGA
515 SEQ ID NO:307 -15.6 -25.1 68.9 -9.5 0 -3
ATCCAAACCTGTGATTCGGC 812 SEQ ID NO:308 -15.6 -24.9 68.9 -9.3 0 -3.2
ATTTCCAGTGGCAGAGTCTG
1390 SEQ ID NO:309 -15.6 -25.3 75.2 -9 -0.1 -8.9 TCCCAGTGCTCCAGGGTCAA
1865 SEQ ID NO:310 -15.6 -30.1 83.2 -13.2 -1.2 -6.3
CCATCCTGACATGAGTCAGC 2191 SEQ ID NO:311 -15.6 -26.2 74.7 -7.3 -3.3 -9.6
GCAGTATGGTCAGTGCAACC 2256 SEQ ID NO:312 -15.6 -26.1 75.6 -9.6 -0.8 -7
TAGACATTTGCTCAATTAAA 2358 SEQ ID NO:313 -15.6 -16.9 53.7 -1.2 0 -3.6
ACTCCACTGGGTTCCAAATG 2432 SEQ ID NO:314 -15.6 -24.7 69.5 -8.5 -0.3 -4.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
TCAAGATCTAGAATTGGTGG
2908 SEQ ID NO: 315 -15.6 -19.6 60.4 -3.5 0 -8
TTCTTCCTCTCCTGCTTGGT
3331 SEQ ID NO: 316 -15.6 -28.6 83.1 -12.5 -0.1 -4.1
GGAGTTGCTCATCCTGCCCC
245 SEQ ID NO: 317 -15.5 -32 86.8 -15.3 -1.1 -5.1
AGCCGTCCCTCTGGACCAAA
325 SEQ ID NO: 318 -15.5 -29.7 77.4 -11.5 -2.7 -8.7
GCAGTCTTCTAAGGGCTGGC
464 SEQ ID NO: 319 -15.5 -27.5 80.4 -10.3 -1.7 -6
GTTGAAACTGCAGTCTTCTA
473 SEQ ID NO: 320 -15.5 -21.7 66 -3.9 0 -12.8
CGAGCATCCTGGCAATGCTG
681 SEQ ID NO:321 -15.5 -26.9 73.1 -8.4 -3 -11.2
CATTTTCTTGGCATTGTAGC
1211 SEQ ID NO: 322 -15.5 -22.9 69.1 -7.4 0 -4
GTGGGCTCAATTTCTCCCAT
1333 SEQ ID NO: 323 -15.5 -27.3 77 -9.7 -2.1 -7.5
ACACTTGCGAAACCAGAGCT
1682 SEQ ID NO: 324 -15.5 -24.1 66.9 -7.9 -0.4 -5.3
CAGTTGTTCCCAGTGCTCCA
1872 SEQ ID NO: 325 -15.5 -29.4 83 -13.9 0 -3.7
AGCAAGAGCTATAGCAGCGC
1931 SEQ ID NO: 326 -15.5 -25.4 72.5 -7.6 -2.3 -11
CTTGCTATTCTGCTAGTGAT
2648 SEQ ID NO: 327 -15.5 -23 69.6 -6.8 -0.4 -4.3
CCCTCAGGCTATGTGGATAA
3688 SEQ ID NO:328 -15.5 -25.6 72.1 -9 -1 -4.3
CCGGTAAGACCCTTCTCTCG
153 SEQ ID NO: 329 -15.4 -27.8 74.6 -11.5 -0.7 -6.6
ACCAAAAGGTACGGGGCTCC
311 SEQ ID NO: 330 -15.4 -26.6 71.4 -11.2 0 -6.2
TGGCCCACAGGCATCTGAAT
946 SEQ ID NO :331 -15.4 -27.5 75 -8.8 -3.3 -9.3
TTGTTCCTCATTTTCTTGGC
1219 SEQ ID NO.-332 -15.4 -24.5 73.5 -9.1 0 -3
CTCTTGTTCCTCATTTTCTT
1222 SEQ ID NO: 333 -15.4 -23.7 72.2 -8.3 0 -1.9
TACATTTTGCTGTTCCTCTT
1237 SEQ ID NO: 334 -15.4 -23.6 70.7 -8.2 0 -3.6
TGCCTGCCCGGGTTTTTAGG
1257 SEQ ID NO: 335 -15.4 -30.2 80.7 -13 -0.7 -11.8
TGTGTGCTTCAGAGAGTGAG
2308 SEQ ID NO:336 -15.4 -23.3 71.6 -7.4 -0.2 -4.6
ATCATTCTTCCTCTCCTGCT
3335 SEQ ID NO: 337 -15.4 -27.2 79.3 -11.8 0 -3.6
GGCTAGAAAGCAATCACAGA
3497 SEQ ID NO: 338 -15.4 -21.2 62.5 -3.2 -2.6 -6.9
ACATTCCAAAATCTGAAAAT
3591 SEQ ID NO: 339 -15.4 -15.8 50.2 0 0 -3.2
ATGCAAACATTCCAAAATCT
3597 SEQ ID NO: 340 -15.4 -18.4 55.3 -2.5 -0.2 -5.6
TGTCAACGGCTTGCCCCAGA
50 SEQ ID NO: 341 -15.3 -29.7 78.3 -13.5 -0.8 -7.1
AGGAACGGAGTTGCTCATCC
251 SEQ ID NO: 342 -15.3 -25.4 72.1 -8.3 -1.8 -6.8
GTCCTGATTCACCAGAGAGT
1100 SEQ ID NO: 343 -15.3 -25.6 74.9 -9.8 -0.2 -3.8
1112 AAAACTCGGCTTGTCCTGAT -15.3 -23.3 65.9 -7.4 -0.3 -3.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligc oligo
SEQ ID NO -.344
TCCTTCCACAGGTTGTACCA
1519 SEQ ID NO: 345 -15.3 -27.7 78 -10.7 -1.7 -5.8 GGGTTGCGGGGTTGAGACAG
1552 SEQ ID NO: 346 -15.3 -27.3 77 -11.3 -0.5 -3.8 GGAAGCTCCACAGTGGGACT
1732 SEQ ID NO: 347 -15.3 -27.1 76.4 -10.7 -0.9 -9.3 CGTCAGGCAGAGTACAGGCT
2082 SEQ ID NO: 348 -15.3 -27.1 77.8 -11.1 -0.4 -5.5 GCCATCCTGACATGAGTCAG
2192 SEQ ID NO: 349 -15.3 -26.2 74.7 -7.3 -3.6 -9.2 TTTTCCAAGAAGTTCAACAA
2887 SEQ ID NO: 350 -15.3 -18.5 56.7 -3.2 0 -6.8 CCCCCATTGGGGTAGATGTC
970 SEQ ID NO: 351 -15.2 -29.5 80.3 -11.3 -3 -12.8 ATTTTCTTGGCATTGTAGCC
1210 SEQ ID NO: 352 -15.2 -24.2 71.7 -7.4 -1.5 -5.8 TAGGTACATTTTGCTGTTCC
1241 SEQ ID NO: 353 -15.2 -23.4 70.4 -8.2 0 -5.2 GGTTTCCCCAGACTTCACCC
1601 SEQ ID NO: 354 -15.2 -30.8 82.9 -15.6 0 -3.8 GGGTCTTCTGTACAAAATGT
1633 SEQ ID NO -.355 -15.2 -21.2 64 -6 0 -6.2 AGTATGGTCAGTGCAACCCA
2254 SEQ ID NO:356 -15.2 -26.3 74.8 -10.5 -0.3 -6.7 AGACATTTGCTCAATTAAAA
2357 SEQ ID NO-.357 -15.2 -16.5 52.5 -1.2 0 -3.6 GTATATGCAAACATTCCAAA
3601 SEQ ID NO: 358 -15.2 -18.4 55.7 -2.5 -0.5 -5.1 GTCTTCTAAGGGCTGGCTGT
461 SEQ ID NO -.359 -15.1 -27.1 79.9 -12 0 -6.3 GAAACTGCAGTCTTCTAAGG
470 SEQ ID NO:360 -15.1 -20.9 63.1 -3.9 0 -12 ATCCTGGCAATGCTGTGTCC
676 SEQ ID NO: 361 -15.1 -27.8 78.1 -12 -0.4 -7.7 GAAGGAACGCGTGTAGGTGT
911 SEQ ID NO: 362 -15.1 -24.3 68.8 -8.3 0 -9.7 GGAAGTCACCCCCATTGGGG
978 SEQ ID NO: 363 -15.1 -30 79.3 -11.3 -3.6 -12.4 GCTCAATTTCTCCCATGTTC
1329 SEQ ID NO: 364 -15.1 -25.4 73.9 -10.3 0 -4.3 CTCCCGTCCGGGGTTGCGGG
1562 SEQ ID NO: 365 -15.1 -34.4 86.3 -16.2 -3 -13.4 CAAGAGCTATAGCAGCGCAG
1929 SEQ ID NO:366 -15.1 -24.3 69.4 -7.6 -1.5 -10.2 CCGAGCAAGATACCAGGCCT
2212 SEQ ID NO: 367 -15.1 -28.3 74.7 -12.7 0 -7.9 TAAGTGTCTCAGATATTGTG
2942 SEQ ID NO: 368 -15.1 -19.4 61.6 -4.3 0 -2.8 TCTGAGTCCTCTCCCTGGCT
3100 SEQ ID NO: 369 -15.1 -30.9 87.3 -14.5 -1.2 -6.6 GCATATTGGTGGGAACTGGC
3168 SEQ ID NO: 370 -15.1 -25.1 71.8 -8.7 -1.2 -6.1 TTTAGCTGTCATGTTGAAAC
485 SEQ ID NO: 371 -15 -19.6 60.7 -3.9 -0.1 -8.6 AGGTTTTAGCTGTCATGTTG
489 SEQ ID NO: 372 -15 -22.7 70.1 -7.7 0 -4.8 AGGCAAAACTCGGCTTGTCC
1116 SEQ ID NO: 373 -15 -25.5 70.7 -9.8 -0.5 -4.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CAGACTTCACCCGGATGCGC 1593 SEQ ID NO:374 -15 -28.8 75.8 -13.1 -0.5 -7
AACCAGAGCTCCCGGCCTGG 1672 SEQ ID NO: 375 -15 -31.8 81.6 -12.8 -4 -9.5
CATTGGGTGGGTCCTCAGCA 1827 SEQ ID NO: 376 -15 -28.9 82.1 -13.3 -0.3 -4.4
GCTTCAGAGAGTGAGCTGGG 2303 SEQ ID NO:377 -15 -26 77.1 -9.8 -1.1 -5.8
ATGTGTGCTTCAGAGAGTGA 2309 SEQ ID NO: 378 -15 -23.3 71.2 -8.3 0 -3.6
AATTGGTGGCTTTTCCAAGA 2897 SEQ ID NO:379 -15 -23 66.9 -6.3 -1.7 -6.1
GGGAGGCAAGGACTCGCTGC 2 SEQ ID NO: 380 -14.9 -28.6 78.7 -13.7 0.3 -5.7
TTTTAGCTGTCATGTTGAAA 486 SEQ ID NO:381 -14.9 -19.5 60.5 -3.9 -0.1 -8.6
ATCGTCCATCCGTGAATGAT 514 SEQ ID NO: 382 -14.9 -24.4 67.8 -9.5 0 -3
TGCAGCCAGTCGAGCATCCT
691 SEQ ID NO: 383 -14.9 -29.8 81.7 -14 -0.7 -6.1 CTGCAGCCAGTCGAGCATCC
692 SEQ ID NO-.384 -14.9 -29.8 81.7 -14 -0.7 -7.2 TTTTCTTGGCATTGTAGCCA
1209 SEQ ID NO:385 -14.9 -24.9 72.9 -7.4 -2.6 -8
GGTGACGTAAAAGGTGGGCT 1346 SEQ ID NO -.386 -14.9 -24.3 68.6 -9.4 0 -5.3
CCAGTGGCAGAGTCTGGGAA 1386 SEQ ID NO:387 -14.9 -27 76.9 -10.5 -1.6 -9.6
AGCAGCGCAGTCCCCTCCCG 1919 SEQ ID NO-.388 -14.9 -35.3 88.8 -19.5 -0.7 -8.5
AAGAGCTATAGCAGCGCAGT 1928 SEQ ID NO: 389 -14.9 -24.8 71.5 -7.6 -2.3 -11
AGAAACCAATCCAGTGTGCA 2049 SEQ ID NO: 390 -14.9 -23.4 66.3 -8.5 0 -5.2
GCAAGATACCAGGCCTGCCA 2208 SEQ ID NO: 391 -14.9 -29.4 78.3 -12.7 -0.3 -11.7
AATAGACATTTGCTCAATTA 2360 SEQ ID NO:392 -14.9 -17.6 55.5 -2.7 0 -3.6
AACTCCACTGGGTTCCAAAT 2433 SEQ ID NO: 393 -14.9 -24 67.4 -8.5 -0.3 -5.9
CCCCAGGCCCCAGGTGCCTT 2507 SEQ ID NO: 394 -14.9 -37.6 93.4 -20.5 -2.2 -10
AGCCTCAGGGTCCCTAATGC 2544 SEQ ID NO: 395 -14.9 -29.5 81.5 -14 -0.3 -7
GGCTGCACCACTAACTAGTA 3084 SEQ ID NO:396 -14.9 -25.1 71.7 -9.5 -0.4 -7.1
TTTGTCTCACGTCTGGGGCA 3185 SEQ ID NO: 397 -14.9 -27.4 78.8 -11.6 -0.8 -4.7
TTAGGATTTTATGGATGGCT
3228 SEQ ID NO:398 -14.9 -21.3 64.4 -6.4 0 -3.7 CTTAGGATTTTATGGATGGC
3229 SEQ ID NO:399 -14.9 -21.3 64.4 -6.4 0 -2.8 GCTTAGGATTTTATGGATGG
3230 SEQ ID NO:400 -14.9 -21.3 64.4 -6.4 0 -2.8 ATTCTTCCTCTCCTGCTTGG
3332 SEQ ID NO: 401 -14.9 -27.4 79.3 -12.5 0 -3.8
CATTCCAAAATCTGAAAATA 3590 SEQ ID NO: 402 -14.9 -15.3 49.2 0 0 -3.2
324 GCCGTCCCTCTGGACCAAAA -14.8 -29 74.9 -11.5 -2.7 -8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligc SEQ ID NO -.403
TTCCAGCCGTCCCTCTGGAC
329 SEQ ID NO: 404 -14.8 -31.6 84.4 -13.9 -2.9 -8.4 TGTTCCTCATTTTCTTGGCA
1218 SEQ ID NO: 05 -14.8 -25.1 74.3 -10.3 0 -4 AGTTGTTCCCAGTGCTCCAG
1871 SEQ ID NO: 406 -14.8 -28.7 82.4 -13.9 0 -3.7 GAGAAACCAATCCAGTGTGC
2050 SEQ ID NO: 407 -14.8 -23.3 66.5 -8.5 0 -3.7 TAGCCTCCCCCAGGCCCCAG
2514 SEQ ID NO: 408 -14.8 -37.2 92.1 -19.2 -3.2 -7.5 GCTTGCTATTCTGCTAGTGA
2649 SEQ ID NO :409 -14.8 -24.8 74.2 -10 3.8 -4.3 GGCTTTTCCAAGAAGTTCAA
2890 SEQ ID NO: 410 -14.8 -22.2 65.4 -6.8 -0.3 -7 TGGCTAGAAAGCAATCACAG
3498 SEQ ID NO: 411 -14.8 -20.6 61.2 -3.2 -2.6 -6.8 TTATCTTCCAGCCGTCCCTC
334 SEQ ID NO: 412 -14.7 -29.8 81.8 -15.1 0 -3.2 AAAGATACCGCTCATCGTCC
527 SEQ ID NO: 13 -14.7 -24.5 67.7 -9.2 -0.3 -3.5 CTACATTGGCGTCTTTCTCT
588 SEQ ID NO -.414 -14.7 -24.7 72.7 -10 0 -4.6 CCACAGGCATCTGAATACCA
942 SEQ ID NO: 415 -14.7 -25.1 69.7 -8.8 -1.5 -4.6 TTGTCCTGATTCACCAGAGA
1102 SEQ ID NO-.416 -14.7 -24.5 71.3 -9.8 0 -3.8 TCAAGAGGTCTCCCAAGTCC
1464 SEQ ID NO: 417 -14.7 -26.7 76.1 -11 -0.9 -4.8 GGTGAGCTGGATCTTCAAGA
1478 SEQ ID NO: 18 -14.7 -23.9 71 -9.2 0 -5.2 GAAGAATCCTTCCATTGGGT
1839 SEQ ID NO: 419 -14.7 -24 68.6 -7.9 -1.3 -6.5 GGCCCCAGGTGCCTTTCCCC
2502 SEQ ID NO: 420 -14.7 -37.4 94.5 -21.3 -1.3 -8.3 TGGCTGCACCACTAACTAGT
3085 SEQ ID NO: 421 -14.7 -25.4 72.1 -9.5 -1.1 -8.3 CTGAGTCCTCTCCCTGGCTG
3099 SEQ ID NO: 422 -14.7 -30.5 85 -14.5 -1.2 -6.6 GTCTTCATGGAGTTTCAGAG
3141 SEQ ID NO: 423 -14.7 -22.6 70.3 -7.9 0 -6.5 AGTCTTCATGGAGTTTCAGA
3142 SEQ ID NO: 424 -14.7 -22.6 70.3 -7.9 0 -6.5 AACATTCCAAAATCTGAAAA
3592 SEQ ID NO: 425 -14.7 -15.1 48.7 0 0 -3.2 AAACATTCCAAAATCTGAAA
3593 SEQ ID NO: 426 -14.7 -15.1 48.7 0 0 -3.2 CGGTAAGACCCTTCTCTCGG
152 SEQ ID NO: 427 -14.6 -27 73.7 -11.5 -0.7 -4 GGAACGGAGTTGCTCATCCT
250 SEQ ID NO: 428 -14.6 -26.3 73.7 -9.9 -1.8 -6.8 TCAATGTGGCCCACAGGCAT
952 SEQ ID NO: 429 -14.6 -27.9 76.1 -10 -3.3 -9.4 GATCTTCAAGAGGTCTCCCA
1469 SEQ ID NO: 430 -14.6 -25.8 74.9 -10.2 -0.9 -5 CTTCTGTACAAAATGTCAGT
1629 SEQ ID NO: 431 -14.6 -19.5 60.3 -3.3 -1.6 -6.5 CCAGCCATCCCGACACTTGC
1694 SEQ ID NO: 432 -14.6 -30.9 79.9 -16.3 0 -3.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
ACCAGTTGTTCCCAGTGCTC 1874 SEQ ID NO:433 -14.6 -28.9 82.6 -14.3 0 -3.7
CTGCCATCCTGACATGAGTC 2194 SEQ ID NO: 434 -14.6 -26.4 75.1 -10.7 -1 -5.2
GCCCCAGGTGCCTTTCCCCA 2501 SEQ ID NO: 435 -14.6 -36.9 92.9 -22.3 0 -6.4
CCCAGGCCCCAGGTGCCTTT 2506 SEQ ID NO: 436 -14.6 -35.7 90.7 -18.9 -2.2 -10
TCTTCATGGAGTTTCAGAGA 3140 SEQ ID NO: 437 -14.6 -22 68.2 -7.4 0 -6.5
TTGTCTCACGTCTGGGGCAT 3184 SEQ ID NO: 438 -14.6 -27.3 78.3 -11.6 -1 -4.9
AGTCTTCTAAGGGCTGGCTG 462 SEQ ID NO: 439 -14.5 -25.9 76.4 -11.4 0 -6.3
CCCCATTGGGGTAGATGTCA 969 SEQ ID NO: 440 -14.5 -28.2 77.9 -11.3 -2.3 -12
CTTGTCCTGATTCACCAGAG 1103 SEQ ID NO: 441 -14.5 -24.8 71.9 -9.8 -0.2 -3.8
GCAAAACTCGGCTTGTCCTG 1114 SEQ ID NO: 442 -14.5 -25.2 69.7 -10.1 -0.3 -4.2
TTTTGCTGTTCCTCTTGTTC 1233 SEQ ID NO -.443 -14.5 -24.7 75.2 -10.2 0 -3.6
AGGGTGACGTAAAAGGTGGG 1348 SEQ ID NO: 444 -14.5 -22.8 65.4 -8.3 0 -5.3
GACATTTGCTCAATTAAAAA 2356 SEQ ID NO -.445 -14.5 -15.8 50.7 -1.2 0 -3.6
AGCCTCCCCCAGGCCCCAGG 2513 SEQ ID NO: 446 -14.5 -38.7 95 -21 -3.2 -9.2
TCATGGAGTTTCAGAGATAG 3137 SEQ ID NO: 447 -14.5 -20.3 63.6 -5.8 0 -4.7
GGCATATTGGTGGGAACTGG 3169 SEQ ID NO: 448 -14.5 -24.5 70.2 -8.7 -1.2 -5.7
TCATTCTTCCTCTCCTGCTT 3334 SEQ ID NO: 449 -14.5 -27.3 79.8 -12.8 0 -3.6
GAGCGAGTGTCAACGGCTTG 57 SEQ ID NO: 450 -14.4 -25.6 71.7 -9.6 -1.6 -5.6
CGCTCATCGTCCATCCGTGA 519 SEQ ID NO: 51 -14.4 -29.1 77.3 -14.2 -0.1 -3.6
GTCCGGAGAGAGCCTCTTGT 866 SEQ ID NO: 452 -14.4 -28.7 81.1 -12.8 -1.3 -10
GCCCACAGGCATCTGAATAC 944 SEQ ID NO: 453 -14.4 -26.2 72.7 -9.3 -2.5 -8.7
GAAGTCACCCCCATTGGGGT 977 SEQ ID NO: 454 -14.4 -30 80.2 -11.3 -4.3 -12.8
TTGGGTGGGTCCTCAGCAGT 1825 SEQ ID NO: 455 -14.4 -29.4 85.3 -14.1 -0.8 -4.9
CAGCAAGAGCTATAGCAGCG 1932 SEQ ID NO: 456 -14.4 -24.3 69.4 -7.6 -2.3 -11
GTCAGGCAGAGTACAGGCTC 2081 SEQ ID NO:457 -14.4 -26.7 80.2 -11.1 -1.1 -5.3
CAGTATGGTCAGTGCAACCC 2255 SEQ ID NO: 458 -14.4 -26.3 74.8 -11.1 -0.6 -7.4
GCTGCACCACTAACTAGTAT 3083 SEQ ID NO: 459 -14.4 -23.9 69.1 -9.5 0 -6.3
TGTCTCACGTCTGGGGCATA 3183 SEQ ID NO: 460 -14.4 -26.9 77.3 -11.6 -0.8 -4.7
GTCAACGGCTTGCCCCAGAA 49 SEQ ID NO: 461 -14.3 -29 76.1 -13.8 -0.8 -7.1
246 CGGAGTTGCTCATCCTGCCC -14.3 -30.8 82.7 -15.3 -1.1 -5.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 462
CCACCCTGGTATTATTGACC 654 SEQ ID NO: 463 -14.3 -26.6 72.9 -11.8 -0.2 -4.5
TACAAAATGTCAGTTTCCGC 1623 SEQ ID NO: 464 -14.3 -21.2 62.1 -6.9 0 -3.6
CTGTACAAAATGTCAGTTTC 1626 SEQ ID NO: 465 -14.3 -18.7 58.6 -3.3 -1 -6.1
GGCCCGAGCAAGATACCAGG
2215 SEQ ID NO:466 -14.3 -28.6 75.3 -12.7 -1.5 -5.6 GGGCCCGAGCAAGATACCAG
2216 SEQ ID NO: 467 -14.3 -28.6 75.3 -12.7 -1.5 -10.6 GCCATCATTCTGGCCCCAGC
2683 SEQ ID NO:468 -14.3 -32.5 86.4 -16.2 -2 -7.8
GCTAGAAAGCAATCACAGAA 3496 SEQ ID NO:469 -14.3 -19.3 58.1 -3.2 -1.8 -6.5
GCTGGAAGTCACCCCCATTG 981 SEQ ID NO: 470 -14.2 -29.1 77.8 -14.4 -0.1 -4.9
CCTCATTTTCTTGGCATTGT 1214 SEQ ID NO: 471 -14.2 -24.7 72.5 -10.5 0 -4
CTCAATTTCTCCCATGTTCT 1328 SEQ ID NO:472 -14.2 -24.5 71.4 -10.3 0 -4.3
GAGGTCTCCCAAGTCCTCCT
1460 SEQ ID NO: 473 -14.2 -30.5 85 -14.9 -1.3 -6.1 AGAGGTCTCCCAAGTCCTCC
1461 SEQ ID NO: 474 -14.2 -29.6 83.4 -13.3 -2.1 -6.4 AAGAGGTCTCCCAAGTCCTC
1462 SEQ ID NO: 475 -14.2 -26.9 77 -11 -1.7 -6.5 CCTTCCACAGGTTGTACCAA
1518 SEQ ID NO: 476 -14.2 -26.6 73.9 -10.7 -1.7 -5.3
GTTGCGGGGTTGAGACAGGT
1550 SEQ ID NO: 477 -14.2 -27.3 77.9 -12.4 -0.5 -4.5 GGTTGCGGGGTTGAGACAGG
1551 SEQ ID NO: 478 -14.2 -27.3 77 -12.4 -0.5 -4.5 CAGGGTCTTCTGTACAAAAT
1635 SEQ ID NO: 479 -14.2 -20.7 62.4 -6 -0.1 -6.2 TCAGGGTCTTCTGTACAAAA
1636 SEQ ID NO: 480 -14.2 -21.1 63.9 -6 -0.7 -6.2 AGAGCTATAGCAGCGCAGTC
1927 SEQ ID NO: 481 -14.2 -25.9 75.8 -9.4 -2.3 -11
AGCAAGATACCAGGCCTGCC 2209 SEQ ID NO: 482 -14.2 -28.7 77.6 -12.7 -0.6 -11.7
CCGGCCATCATTCTGGCCCC 2686 SEQ ID NO:483 -14.2 -34 85.8 -15.5 -4.3 -11.3
ATCTGAGTCCTCTCCCTGGC 3101 SEQ ID NO: 484 -14.2 -30 85.2 -14.5 -1.2 -6.6
CATATTGGTGGGAACTGGCT 3167 SEQ ID NO: 485 -14.2 -24.2 69.5 -8.7 -1.2 -7.4
TATCTTCCAGCCGTCCCTCT 333 SEQ ID NO: 486 -14.1 -30.6 83.3 -16.5 0 -3.2
AAAATCTGCATCGTCCGGAG 878 SEQ ID NO: 487 -14.1 -23.1 64.5 0 -8.5
GTGGACGGCTCGCTCATGCT 1070 SEQ ID NO: 488 -14.1 -29.6 80.7 -14.4 -1 -6.1
TGTCCTGATTCACCAGAGAG 1101 SEQ ID NO:489 -14.1 -24.4 71.2 -9.8 -0.2 -3.6
TCATTTTCTTGGCATTGTAG 1212 SEQ ID NO: 490 -14.1 -21.5 66.2 -7.4 0 -4
GTTCCTCTTGTTCCTCATTT 1226 SEQ ID NO:491 -14.1 -25.9 77.3 -11.8 0 -1.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraInte - total formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
TGAAAGGCATGCCTGCCCGG 1266 SEQ ID NO: 492 -14.1 -29.4 75.5 -11.9 -2.8 -14.8
GGATCTTCAAGAGGTCTCCC 1470 SEQ ID NO: 493 -14.1 -26.3 76.5 -11 -1.1 -5
AGGTGAGCTGGATCTTCAAG 1479 SEQ ID NO: 494 -14.1 -23.3 69.8 -9.2 0 -5.2
TTCCGCTGGGTTTCCCCAGA 1609 SEQ ID NO: 495 -14.1 -31.5 83.4 -13.4 -4 -11.5
GAGCCAGCGTTCCTCGTCAG 2096 SEQ ID NO:496 -14.1 -29.8 81.8 -14.9 -0.6 -4.6
AGGGCCCGAGCAAGATACCA 2217 SEQ ID NO: 497 -14.1 -28.6 75.3 -12.7 -1.5 -11.3
GGAGCGAGTGTCAACGGCTT 58 SEQ ID NO: 498 -14 -26.8 74.3 -11.2 -1.6 -5.6
TCCTGGCAATGCTGTGTCCC 675 SEQ ID NO: 499 -14 -29.8 81.7 -15.8 0 -6.9
GTTCCTCATTTTCTTGGCAT 1217 SEQ ID NO: 500 -14 -25.1 74.4 -11.1 0 -4
CCGCTGGGTTTCCCCAGACT 1607 SEQ ID NO: 501 -14 -32.1 83.7 -13.4 -4.7 -11.5
ACAAAATGTCAGTTTCCGCT 1622 SEQ ID NO -.502 -14 -22.4 64.5 -8.4 0 -3.6
AGGGTCTTCTGTACAAAATG 1634 SEQ ID NO: 503 -14 -20 61.1 -6 0 -6.2
ATTGGGTGGGTCCTCAGCAG 1826 SEQ ID NO: 504 -14 -28.2 81.4 -13.3 -0.8 -4.9
CATCCTGACATGAGTCAGCT 2190 SEQ ID NO:505 -14 -25.1 73 -7.3 -3.8 -9.6
GCCTCAGGGTCCCTAATGCT 2543 SEQ ID NO: 506 -14 -30.4 83.1 -15.8 -0.3 -6.8
GTAAGTGTCTCAGATATTGT 2943 SEQ ID NO: 507 -14 -20.6 65.1 -6.6 0 -2.8
TATGCAAACATTCCAAAATC 3598 SEQ ID NO: 508 -14 -17.2 53.1 -2.5 -0.5 -5.6
ACCCTCAGGCTATGTGGATA 3689 SEQ ID NO: 509 -14 -26.5 75.1 -11.4 -1 -4.3
AATTACCCTCAGGCTATGTG 3693 SEQ ID NO: 510 -14 -24.1 69.2 -10.1 0.5 -3.7
GAGGAACGGAGTTGCTCATC 252 SEQ ID NO: 511 -13.9 -24 69.7 -8.3 -1.8 -10
CTGTCATGTTGAAACTGCAG 480 SEQ ID NO: 512 -13.9 -21.3 63.7 -6.7 -0.1 -8.7
CCAAACCTGTGATTCGGCCC 810 SEQ ID NO: 513 -13.9 -28.5 74 -14.6 0 -6.2
ATGCCTGCCCGGGTTTTTAG 1258 SEQ ID NO: 514 -13.9 -29 78.1 -13.8 -0.7 -10.3
AGTCTTGCTGCCTTGCTGGC 1775 SEQ ID NO: 515 -13.9 -29.8 85.1 -13.8 -2.1 -8
GCAGCAAGAGCTATAGCAGC 1933 SEQ ID NO: 516 -13.9 -25.3 73.7 -9.4 -1.9 -11
CCTGCCATCCTGACATGAGT 2195 SEQ ID NO: 517 -13.9 -28 76.9 -14.1 0 -5.2
CTATAGCCTCCCCCAGGCCC 2517 SEQ ID NO: 518 -13.9 -35.1 89 -18.8 -2.4 -9.3
AAGCCTCAGGGTCCCTAATG 2545 SEQ ID NO -.519 -13.9 -27 74.7 -12.5 -0.3 -7
TGAGTCCTCTCCCTGGCTGC 3098 SEQ ID NO: 520 -13.9 -31.4 87.7 -16.2 -1.2 -7.2
308 AAAAGGTACGGGGCTCCCCG -13.8 -28.5 73 -11.2 -3.3 -14.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 521
TCTTCTAAGGGCTGGCTGTG 460 SEQ ID NO:522 -13.8 -25.9 75.9 -12.1 0 -6.3
GATCCAAACCTGTGATTCGG 813 SEQ ID NO:523 -13.8 -23.7 66.2 -9.3 -0.3 -6.4
GTAGATGTCAATGTGGCCCA 959 SEQ ID NO:524 -13.8 -26 73.9 -12.2 0 -6.8
CGGGTTTTTAGGTACATTTT 1249 SEQ ID NO:525 -13.8 -21.8 65.4 -8 0 -5.2
TCTGTACAAAATGTCAGTTT
1627 SEQ ID NO:526 -13.8 -18.7 58.6 -3.3 -1.6 -6.5 TTCTGTACAAAATGTCAGTT
1628 SEQ ID NO:527 -13.8 -18.7 58.6 -3.3 -1.6 -6.5 CTCCAGCCATCCCGACACTT
1696 SEQ ID NO:528 -13.8 -30.4 79.5 -16.6 0 -2.8
TTGTTCCCAGTGCTCCAGGG 1869 SEQ ID NO:529 -13.8 -29.9 83.6 -15.5 -0.3 -5.1
GGAGACCAGTTGTTCCCAGT 1878 SEQ ID NO:530 -13.8 -28.2 80.2 -13.9 -0.2 -4.1
ATGGATGGCTCTATATAAAA 3218 SEQ ID NO:531 -13.8 -18 55.8 -4.2 0 -4
AATCATTCTTCCTCTCCTGC 3336 SEQ ID NO:532 -13.8 -25.6 74.6 -11.8 0 -2.6
CTGAGAAACCAATCCAGTGT 2052 SEQ ID NO:533 -13.7 -22.4 64.3 -8.7 0 -3.7
ATCCTGACATGAGTCAGCTC 2189 SEQ ID NO:534 -13.7 -24.8 73.6 -7.3 -3.8 -9.4
TTAAAGCCTCAGGGTCCCTA 2548 SEQ ID NO:535 -13.7 -26.8 74.7 -12.5 -0.3 -7
CAGGCTATGTGGATAAGGTG 3684 SEQ ID NO:536 -13.7 -22.7 67.3 -9 0 -4.1
TCAACGGCTTGCCCCAGAAC 48 SEQ ID NO:537 -13.6 -28 73.6 -13.8 -0.3 -6.6
TTGAAACTGCAGTCTTCTAA 472 SEQ ID NO:538 -13.6 -19.8 60.6 -3.9 0 -12.8
GTTTTCAAAGATACCGCTCA 533 SEQ ID NO:539 -13.6 -22.3 64.7 -8.7 0 -3.1
GGACATTCCCGAGAGAAAAA 723 SEQ ID NO:540 -13.6 -21 59.6 -6.9 -0.1 -3.6
CTGCATACCCGGCCACGTGC 768 SEQ ID NO:541 -13.6 -31.8 80.7 -16.6 -1.5 -8.4
GCTCATGCTCACATTTTACC 1059 SEQ ID NO:542 -13.6 -24.7 71.9 -10.4 -0.5 -4.4
TTCAAGAGGTCTCCCAAGTC 1465 SEQ ID NO:543 -13.6 -24.8 72.8 -10.2 -0.9 -4
CAGCTCCCGTCCGGGGTTGC 1565 SEQ ID NO:544 -13.6 -33.7 87.7 -17.4 -2.7 -10.5
CGACACTTGCGAAACCAGAG 1684 SEQ ID NO: 545 -13.6 -22.8 62.9 -9.2 0 -4.1
CGGAGCCAGCGTTCCTCGTC
2098 SEQ ID NO:546 -13.6 -31.1 82.5 -16 -1.4 -5.8 TCGGAGCCAGCGTTCCTCGT
2099 SEQ ID NO:547 -13.6 -31.1 82.5 -16 -1.4 -5.9 GCCCGAGCAAGATACCAGGC
2214 SEQ ID NO:548 -13.6 -29.2 76.9 -14.7 -0.7 -5.2
TCCACTGGGTTCCAAATGGA 2430 SEQ ID NO:549 -13.6 -25.4 70.8 -9.4 -2.4 -8.3
CACTTAAAGCCTCAGGGTCC 2551 SEQ ID NO:550 -13.6 -26 73.4 -11.8 -0.3 -4.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo CCACTTAAAGCCTCAGGGTC
2552 SEQ ID NO: 551 -13 .6 -26 73.4 -11.8 -0.3 -3.6 CCAAGAAGTTCAACAAGAAA
2883 SEQ ID NO: 552 -13. .6 -17 52.6 -2.7 -0.5 -6.8 CTAGAAAGCAATCACAGAAA
3495 SEQ ID NO: 553 -13 .6 -16.8 52.6 -3.2 0 -4.1 ATATGCAAACATTCCAAAAT
3599 SEQ ID NO: 554 -13 .6 -16.8 52 -2.5 -0.5 -5.6 GCGAGTGTCAACGGCTTGCC
55 SEQ ID NO: 555 -13 .5 -28.8 77.7 -14.2 -1 -7.3 ATCCTGCCCCGCCACACCCC
235 SEQ ID NO: 556 -13 .5 -37.5 89.2 -24 0 -2.8 GACCAAAAGGTACGGGGCTC
312 SEQ ID NO: 557 -13 .5 -25.2 69.3 -11.2 -0.1 -5.2 TGAAACTGCAGTCTTCTAAG
471 SEQ ID NO: 558 -13 .5 -19.7 60.5 -3.9 0 -12.8 TGTCATGTTGAAACTGCAGT
479 SEQ ID NO: 559 -13 .5 -21.6 64.9 -6.7 -0.1 -10.7 GATGTCAATGTGGCCCACAG
956 SEQ ID NO: 560 -13 .5 -26 72.8 -10.8 -1.7 -9.2 TCTGAAAGGCATGCCTGCCC
1268 SEQ ID NO: 561 -13 .5 -28.7 76.7 -11.5 -3.6 -14.8 TCCGCTGGGTTTCCCCAGAC
1608 SEQ ID NO: 562 -13 .5 -31.6 83.6 -13.4 -4.7 -11.5 GGTGTTCTCAGGGTCTTCTG
1643 SEQ ID NO: 563 -13 .5 -26.4 81 -12.2 -0.4 -3.7 GAAGCTCCACAGTGGGACTG
1731 SEQ ID NO: 564 -13 .5 -25.9 73.6 -10.7 -1.7 -9.3 GTCTTGCTGCCTTGCTGGCA
1774 SEQ ID NO: 565 -13 .5 -30.5 85.7 -13.8 -3.2 -10.1 GCAACTGAGAAACCAATCCA
2056 SEQ ID NO: 566 -13. .5 -22 62 -8.5 0 -3.4 ATTCCAAAATCTGAAAATAA
3589 SEQ ID NO: 567 -13. .5 -13.9 46.6 0 0 -3.2 GTCGAGCATCCTGGCAATGC
683 SEQ ID NO: 568 -13 .4 -27.6 76.3 -13.2 -0.9 -8.2 TCCTCATTTTCTTGGCATTG
1215 SEQ ID NO: 569 -13, .4 -23.9 70.7 -10.5 0 -4 CTCCTTCCACAGGTTGTACC
1520 SEQ ID NO: 570 -13. .4 -27.9 79 -13.6 -0.8 -5.8 CCCGGATGCGCCTGATATTC
1584 SEQ ID NO: 571 -13. .4 -28.7 74.9 -14.6 -0.5 -7.4 GCAGAGTACAGGCTCGCCCA
2076 SEQ ID NO: 572 -13, .4 -30.5 82.8 -14.9 -2.2 -7.3 GGAGCCAGCGTTCCTCGTCA
2097 SEQ ID NO:573 -13. .4 -31 84 -16.6 -0.9 -5.6 ATAGCCTCCCCCAGGCCCCA
2515 SEQ ID NO: 574 -13, .4 -37.2 91.6 -20.6 -3.2 -7.5 ACCACTTAAAGCCTCAGGGT
2553 SEQ ID NO: 575 -13, .4 -25.8 72.3 -11.8 -0.3 -4.4 TCTAGAATTGGTGGCTTTTC
2902 SEQ ID NO: 576 -13. .4 -22 67.2 -8.6 0 -5.2 CCTCGTCCTGAGCCGCCGGG
19 SEQ ID NO: 577 -13, .3 -34.8 86 -20.6 -0.8 -8.4 GCCGGTAAGACCCTTCTCTC
154 SEQ ID NO: 578 -13. .3 -28.8 79 -14.4 -0.7 -9.8 AAGGTTTTAGCTGTCATGTT
490 SEQ ID NO: 579 -13. .3 -22 67.8 -8.7 0 -4.8
912 CGAAGGAACGCGTGTAGGTG -13. .3 -23.9 65.9 -9.7 0 -9.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 580
TTAGGTACATTTTGCTGTTC
1242 SEQ ID NO: 581 -13.3 -21.5 66.8 -8.2 0 -5.2 TTTCCGCTGGGTTTCCCCAG
1610 SEQ ID NO: 582 -13.3 -31 82.5 -13.4 -4.3 -10.2 GTTTCCGCTGGGTTTCCCCA
1611 SEQ ID NO: 583 -13.3 -32.2 85.7 -16.3 -2.6 -7.7 CTGGTTTCGTTTTTCATCCT
1714 SEQ ID NO: 584 -13.3 -24.7 72.6 -11.4 0 -3.2 CTGCTAGTGATCAAACACGT
2639 SEQ ID NO: 585 -13.3 -21.9 63.9 -7 -1.6 -6.7 GATACTCTGCTTGCTATTCT
2657 SEQ ID NO: 586 -13.3 -23.3 70.3 -10 0 -4.5 CTGGCTGCACCACTAACTAG
3086 SEQ ID NO: 587 -13.3 -25.1 70.8 -10.5 -1.2 -8.4 TCTTCCTCTCCTGCTTGGTG
3330 SEQ ID NO: 588 -13.3 -28.5 82.5 -14.7 -0.1 -4.1 AGAAAATCATTCTTCCTCTC
3340 SEQ ID NO: 589 -13.3 -20.1 61.6 -5.6 -1.1 -3.8 TATATGCAAACATTCCAAAA
3600 SEQ ID NO: 590 -13.3 -16.5 51.5 -2.5 -0.5 -5.6 GGAGGCAAGGACTCGCTGCT
1 SEQ ID NO: 591 -13.2 -28.3 78.1 -13.7 -1.3 -6.8 GGGGCTCCCCGCAGCAAAGC
299 SEQ ID NO: 592 -13.2 -32.9 84 -17.6 -2.1 -9.9 ACGAGTTTGTGCAGCCAGTT
550 SEQ ID NO -.593 -13.2 -26.5 75.8 -13.3 0 -5.6 ATGTCAATGTGGCCCACAGG
955 SEQ ID NO: 594 -13.2 -26.6 74 -11.7 -1.7 -9.2 CTGGAAGTCACCCCCATTGG
980 SEQ ID NO: 595 -13.2 -28.5 76.1 -14.8 -0.1 -5.2 TTTCTTGGCATTGTAGCCAA
1208 SEQ ID NO: 596 -13.2 -24.1 70.1 -7.4 -3.5 -9.8 CCTGCCCGGGTTTTTAGGTA
1255 SEQ ID NO: 597 -13.2 -29.3 79.5 -14.6 0 -11 CAGTTTCCGCTGGGTTTCCC
1613 SEQ ID NO: 598 -13.2 -30.2 82.7 -16 -0.9 -5.5 TCCAGCCATCCCGACACTTG
1695 SEQ ID NO: 599 -13.2 -29.5 77.5 -16.3 0 -3.2 CCCAGTGCTCCAGGGTCAAG
1864 SEQ ID NO: 600 -13.2 -29.7 81.7 -15.7 -0.6 -5.1 ACATTTGCTCAATTAAAAAA
2355 SEQ ID NO: 601 -13.2 -14.5 48 -1.2 0 -3.6 AAAGCCTCAGGGTCCCTAAT
2546 SEQ ID NO: 602 -13.2 -26.3 72.5 -12.5 -0.3 -7 TTGCTCCAAAGCAGTTATAT
2713 SEQ ID NO: 603 -13.2 -21.7 64.4 -5.9 -2.6 -7.2 GAAAATCATTCTTCCTCTCC
3339 SEQ ID NO: 604 -13.2 -22.1 65.1 -8.3 -0.3 -2.8 GGTAAGACCCTTCTCTCGGC
151 SEQ ID NO: 605 -13.1 -28 78.1 -14.4 -0.2 -4.7 GTTTTTAGGTACATTTTGCT
1246 SEQ ID NO: 606 -13.1 -21.3 66 -8.2 0 -5.2 TTCAGCTCCCGTCCGGGGTT
1567 SEQ ID NO: 607 -13.1 -32.4 85.8 -17.4 -1.9 -10.7 GCTGGTGTTCTCAGGGTCTT
1646 SEQ ID NO: 608 -13.1 -27.8 84 -14 -0.5 -5.2 ACCAGAGCTCCCGGCCTGGG
1671 SEQ ID NO: 609 -13.1 -33.7 86.5 -16.2 -4.4 -11.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular
■sition oligo binding ation Duplex ture oligo oligo
CAAGATACCAGGCCTGCCAT
2207 SEQ ID NO: 610 -13.1 -27.6 74.2 -12.7 -0.3 -11.7
TAGGGCCCGAGCAAGATACC
2218 SEQ ID NO: 611 -13.1 -27.6 73.8 -12.7 -1.5 -11.3
CTCCACTGGGTTCCAAATGG
2431 SEQ ID NO: 612 -13.1 -25.7 71.4 -10.9 -1.7 -6.9
CCTATAGCCTCCCCCAGGCC
2518 SEQ ID NO: 613 -13.1 -35.1 89 -18.8 -3.2 -9.3
CTATTCTGCTAGTGATCAAA
2644 SEQ ID NO: 614 -13.1 -19.9 61.2 -6.8 0 -6.7
TAGTATATAAGTCTAGGCAT
3069 SEQ ID NO: 615 -13.1 -19.2 60.8 -6.1 0 -6.1
GAGTCCTCTCCCTGGCTGCA
3097 SEQ ID NO: 616 -13.1 -32.1 88.9 -18.3 -0.5 -7.4
CATGGAGTTTCAGAGATAGA
3136 SEQ ID NO: 617 -13.1 -20.5 63.5 -7.4 0 -3.7
TGGATGGCTCTATATAAAAA
3217 SEQ ID NO: 618 -13.1 -17.3 54 -4.2 0 -4
TTATGGATGGCTCTATATAA
3220 SEQ ID NO: 619 -13.1 -19.2 59.3 -5.6 -0.1 -4
AGCGAGTGTCAACGGCTTGC
56 SEQ ID NO: 620 -13 -26.8 74.6 -12.3 -1.4 -6.6
GGGAGCGAGTGTCAACGGCT
59 SEQ ID NO: 621 -13 -27.9 76.5 -13.4 -1.4 -5.5
TACGGGGCTCCCCGCAGCAA
302 SEQ ID NO -.622 -13 -32.5 81.6 -15.9 -3.5 -14.6
TTTAGGTACATTTTGCTGTT
1243 SEQ ID NO: 623 -13 -21.2 65.5 -8.2 0 -4.4
TTTTAGGTACATTTTGCTGT
1244 SEQ ID NO: 624 -13 -21.2 65.5 -8.2 0 -5.2
GGGTTTTTAGGTACATTTTG
1248 SEQ ID NO: 625 -13 -21 65 -8 0 -5.2
TCAGCTCCCGTCCGGGGTTG
1566 SEQ ID NO: 626 -13 -32.3 85.2 -17.4 -1.9 -10.8
ATTCAGCTCCCGTCCGGGGT
1568 SEQ ID NO: 627 -13 -32.3 85.4 -17.4 -1.9 -10.7
TGCTGGTGTTCTCAGGGTCT
1647 SEQ ID NO: 628 -13 -27.7 83.3 -14 -0.5 -5.2
AAATCTGGACTTGGTGCTCT
1996 SEQ ID NO: 629 -13 -23.3 68.6 -10.3 0 -3.6
TAAAGCCTCAGGGTCCCTAA
2547 SEQ ID NO: 630 -13 -26 72 -12.5 -0.2 -7
TCTGCTAGTGATCAAACACG
2640 SEQ ID NO: 631 -13 -21.1 62.3 -6.5 -1.6 -6.7
GGCTTAGGATTTTATGGATG
3231 SEQ ID NO: 632 -13 -21.3 64.4 -8.3 0 -3.7
CAACCGTTGGCACAGATGTT
3275 SEQ ID NO: 633 -13 -24.8 69.2 -11 -0.6 -8.4
TGTACAAGCTTCGCTTTGGC
3514 SEQ ID NO: 634 -13 -25 71.8 -10.6 -1.3 -7.6
AGGGAGCGAGTGTCAACGGC
60 SEQ ID NO: 635 -12.9 -27 74.9 -13.4 -0.5 -4.4
GTACGGGGCTCCCCGCAGCA
303 SEQ ID NO: 636 -12.9 -34.4 87.4 -17.9 -3.5 -14.6
GCTGTCATGTTGAAACTGCA
481 SEQ ID NO: 637 -12.9 -23.1 67.6 -9 -1.1 -6.7
AGTTTTCAAAGATACCGCTC
534 SEQ ID NO: 638 -12.9 -21.6 63.7 -8.7 0 -3.1
551 CACGAGTTTGTGCAGCCAGT -12.9 -27.1 76.6 -13.3 -0.8 -5.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 639
GACATTCCCGAGAGAAAAAT
722 SEQ ID NO: 640 -12.9 -19.8 57.3 -6.9 0 -3.2 TTCTTGGCATTGTAGCCAAT
1207 SEQ ID NO: 641 -12.9 -24 69.7 -7.4 -3.7 -10.1 CCGGATGCGCCTGATATTCA
1583 SEQ ID NO: 642 -12.9 -27.4 72.7 -13.8 -0.5 -7.4 ACAGGAGACCAGTTGTTCCC
1881 SEQ ID NO: 643 -12.9 -27.2 77.2 -13.2 -1 -4.9 CTAGTATATAAGTCTAGGCA
3070 SEQ ID NO: 644 -12.9 -20.1 62.9 -6.7 -0.2 -6.1 AAGTCTTCATGGAGTTTCAG
3143 SEQ ID NO: 645 -12.9 -21.3 66.3 -8.4 0 -6.5 TTTATGGATGGCTCTATATA
3221 SEQ ID NO: 646 -12.9 -20 61.8 -6.6 -0.1 -4.6 GTTTAACAGTGATACAACTT
3407 SEQ ID NO: 647 -12.9 -18.2 57.1 -5.3 0 -4.4 TAGAAAGCAATCACAGAAAC
3494 SEQ ID NO: 648 -12.9 -16.1 51.3 -3.2 0 -4.1 TTCAAAGATACCGCTCATCG
530 SEQ ID NO: 649 -12.8 -22.1 62.8 -8.7 -0.3 -3.5 GCAGGGCTGACACGAGTTTG
561 SEQ ID NO -.650 -12.8 -26.1 73.8 -13.3 0 -5.4 TAGATGTCAATGTGGCCCAC
958 SEQ ID NO: 651 -12.8 -25 71.2 -11.7 -0.2 -6.9 CTTGGCATTGTAGCCAATGC
1205 SEQ ID NO: 652 -12.8 -25.3 71.9 -7.4 -5.1 -12.4 TCTTGGCATTGTAGCCAATG
1206 SEQ ID NO: 653 -12.8 -23.9 69.2 -7.4 -3.7 -10.1 TTCATCCTCCAGCCATCCCG
1702 SEQ ID NO: 654 -12.8 -31.3 81.9 -18.5 0 -3.2 AAGTCTTGCTGCCTTGCTGG
1776 SEQ ID NO: 655 -12.8 -27.3 77.7 -13.8 -0.4 -5.4 CAAATCTGGACTTGGTGCTC
1997 SEQ ID NO: 656 -12.8 -23.1 67.8 -10.3 0 -4.1 AGCAACTGAGAAACCAATCC
2057 SEQ ID NO: 657 -12.8 -21.3 61.1 -8.5 0 -4.1 TCCTGACATGAGTCAGCTCC
2188 SEQ ID NO: 658 -12.8 -26.8 77.4 -10.2 -3.8 -9.1 GAGCAAGATACCAGGCCTGC
2210 SEQ ID NO: 659 -12.8 -27.3 75.5 -12.7 -0.2 -11.7 CAATAGACATTTGCTCAATT
2361 SEQ ID NO: 660 -12.8 -18.6 57.3 -5.8 0 -4 CCTCCCCCAGGCCCCAGGTG
2511 SEQ ID NO: 661 -12.8 -38.1 93.7 -25.3 0 -6.8 GCTTTTCCAAGAAGTTCAAC
2889 SEQ ID NO: 662 -12.8 -21.2 63.4 -7.8 -0.3 -6.8 AATCAAGATCTAGAATTGGT
2910 SEQ ID NO: 663 -12.8 -17.7 55.9 -4.4 0 -8 AGTTTAACAGTGATACAACT
3408 SEQ ID NO: 664 -12.8 -18.1 57 -5.3 0 -5.2 TTGGCTAGAAAGCAATCACA
3499 SEQ ID NO: 665 -12.8 -20.7 61.3 -5.3 -2.6 -6.9 TACCCTCAGGCTATGTGGAT
3690 SEQ ID NO: 666 -12.8 -26.5 75.1 -12.6 -1 -4.3 ACGGGGCTCCCCGCAGCAAA
301 SEQ ID NO -.667 -12.7 -32.1 79.8 -15.8 -3.5 -14.6 CCTTCATGCTCTGGGTCCTT
421 SEQ ID NO: 668 -12.7 -29.1 82.4 -16.4 0 -4.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular sition oligo binding ation Duplex ture oligo oligo
TTTCAAAGATACCGCTCATC
531 SEQ ID NO: 669 -12.7 -21.4 62.7 -8.7 0 -3.1
ACATTCCCGAGAGAAAAATC
721 SEQ ID NO: 670 -12.7 -19.6 57.3 -6.9 0 -3.2
CGTGTAGGTGTGGAGGACAT
902 SEQ ID NO: 671 -12.7 -25 72.7 -11.6 -0.5 -3.7
CCCATTGGGGTAGATGTCAA
968 SEQ ID NO: 672 -12.7 -25.5 72 -11.3 -1.4 -8.6
TGGGTGGGTCCTCAGCAGTA
1824 SEQ ID NO: 673 -12.7 -29 84.3 -15.4 -0.8 -4.9
GAGACCAGTTGTTCCCAGTG
1877 SEQ ID NO: 674 -12.7 -27 77.3 -14.3 0 -3.3
GCTATAGCAGCGCAGTCCCC
1924 SEQ ID NO: 675 -12.7 -31.3 84.4 -17 -1.5 -10.7
GCCAGCGTTCCTCGTCAGGC
2094 SEQ ID NO: 676 -12.7 -32.2 87.2 -17.2 -2.3 -8.2
CTCCCCCAGGCCCCAGGTGC
2510 SEQ ID NO: 677 -12.7 -37.9 94.9 -25.2 0 -6.8
TATCCTATAGCCTCCCCCAG
2521 SEQ ID NO: 678 -12.7 -30.2 80.4 -17.5 0 -5
ACTTAAAGCCTCAGGGTCCC
2550 SEQ ID NO: 679 -12.7 -27.3 75.8 -14 -0.3 -6.1
ACAGAAGAGATTTGCTCCAA
2724 SEQ ID NO: 680 -12.7 -21.3 63 -7.4 -1.1 -5.7
AACAGAAGAGATTTGCTCCA
2725 SEQ ID NO: 681 -12.7 -21.3 63 -7.4 -1.1 -5.7
TCAAATCAAGATCTAGAATT
2913 SEQ ID NO: 682 -12.7 -15.7 51.3 -3 0 -6.2
AATTCAAATCAAGATCTAGA
2916 SEQ ID NO: 683 -12.7 -15.7 51.3 -3 0 -6.4
ACGTCTGGGGCATATTGGTG
3177 SEQ ID NO: 684 -12.7 -25.8 73.6 -13.1 0 -4.4
AAATTACCCTCAGGCTATGT
3694 SEQ ID NO: 685 -12.7 -23.4 67.1 -10.1 -0.3 -4.9
GGACCAAAAGGTACGGGGCT
313 SEQ ID NO: 686 -12.6 -26 70.2 -12.9 -0.1 -5.2
CATTCCCGAGAGAAAAATCG
720 SEQ ID NO: 687 -12.6 -20.2 57.5 -6.9 -0.4 -3.7
CAAACCTGTGATTCGGCCCA
809 SEQ ID NO: 688 -12.6 -27.2 71.8 -14.6 0 -6.2
CAATGTGGCCCACAGGCATC
951 SEQ ID NO: 689 -12.6 -27.9 76.1 -12 -3.3 -9.4
TGCCCGGGTTTTTAGGTACA
1253 SEQ ID NO: 690 -12.6 -27.3 75.8 -13.5 0 -10.3
GGGCTCAATTTCTCCCATGT
1331 SEQ ID NO: 691 -12.6 -27.3 77 -13.6 -1 -5.5
AAGGGTGACGTAAAAGGTGG
1349 SEQ ID NO: 692 -12.6 -20.9 61 -8.3 0 -5.3
ACTGGTTTCGTTTTTCATCC
1715 SEQ ID NO: 693 -12.6 -24 71.1 -11.4 0 -3
CTTGCTGCCTTGCTGGCAAG
1772 SEQ ID NO: 694 -12.6 -28.2 77.9 -12.5 -3.1 -12.1
ACAAATCTGGACTTGGTGCT
1998 SEQ ID NO: 695 -12.6 -22.9 66.8 -10.3 0 -5.6
ATTCTGCTAGTGATCAAACA
2642 SEQ ID NO: 696 -12.6 -20.2 61.6 -7.6 0 -6.7
CCATCATTCTGGCCCCAGCA
2682 SEQ ID NO: 697 -12.6 -31.4 83 -17.2 -1.5 -7.8
3166 ATATTGGTGGGAACTGGCTG -12.6 -23.5 68.3 -9.6 -1.2 -7.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligc oligo SEQ ID NO: 698
GCTTTGGCTAGAAAGCAATC
3502 SEQ ID NO: 699 -12.6 -21.9 64.7 -6.5 -2.8 -10.8 CATCCTGCCCCGCCACACCC
236 SEQ ID NO: 700 -12.5 -36.2 87.1 -23.7 ■ 0 -3 TCATCGTCCATCCGTGAATG
516 SEQ ID NO: 701 -12.5 -24.9 69.1 -11.9 -0.1 -3.6 ACTACATTGGCGTCTTTCTC
589 SEQ ID NO: 702 -12.5 -24 71.2 -11.5 0 -4.6 GTGTAGGTGTGGAGGACATC
901 SEQ ID NO: 703 -12.5 -24.6 74.7 -11.4 -0.5 -3.7 GCTCCCGTCCGGGGTTGCGG
1563 SEQ ID NO: 704 -12.5 -35 88 -19.5 -3 -11.1 TCTTCTGTACAAAATGTCAG
1630 SEQ ID NO: 705 -12.5 -18.7 58.6 -4.8 -1.3 -5.9 CAGCGCAGTCCCCTCCCGCG
1917 SEQ ID NO: 706 -12.5 -36.1 87.7 -21 -2.6 -8.5 AAGATACCAGGCCTGCCATC
2206 SEQ ID NO-.707 -12.5 -27.3 74.8 -12.7 -0.3 -12.4 TATGGTCAGTGCAACCCATG
2252 SEQ ID NO: 708 -12.5 -25.1 71 -11.3 -1.2 -7.4 AGAAGTTCAACAAGAAAAGG
2880 SEQ ID NO -.709 -12.5 -15.5 50.2 -3 0 -6.8 TGGAGTTTCAGAGATAGACT
3134 SEQ ID NO: 710 -12.5 -20.9 64.9 -8.4 0 -3.5 CTTTGGCTAGAAAGCAATCA
3501 SEQ ID NO-.711 -12.5 -20.8 61.8 -6.5 -1.8 -6.2 TCCAAAACTTTTTGAGCACC
3797 SEQ ID NO: 712 -12.5 -21.8 62.8 -8.2 -1 -7.3 CTTATCTTCCAGCCGTCCCT
335 SEQ ID NO: 713 -12.4 -30.3 81.9 -17.9 0 -3.2 TTTTCAAAGATACCGCTCAT
532 SEQ ID NO: 714 -12.4 -21.1 61.7 -8.7 0 -3.1 GGCTGGAAGTCACCCCCATT
982 SEQ ID NO: 715 -12.4 -30.3 80.4 -17.2 -0.5 -5.3 CATCCTCCAGCCATCCCGAC
1700 SEQ ID NO: 716 -12.4 -31.6 81.6 -19.2 0 -3.2 CACAAATCTGGACTTGGTGC
1999 SEQ ID NO: 717 -12.4 -22.7 66.1 -10.3 0 -5.6 AGCAGTATGGTCAGTGCAAC
2257 SEQ ID NO: 718 -12.4 -24.1 72.1 -10.1 -1.6 -5.7 AGCAGTTATATCTGGCAACC
2704 SEQ ID NO: 719 -12.4 -23.7 69.4 -10.4 -0.7 -2.8 GTGTATTAATTCAAATCAAG
2923 SEQ ID NO: 720 -12.4 -15.4 50.9 -3 0 -4.2 TGTGTATTAATTCAAATCAA
2924 SEQ ID NO: 721 -12.4 -15.4 50.7 -3 0 -3.9 GTCCTCTCCCTGGCTGCACC
3095 SEQ ID NO: 722 -12.4 -33.7 91.2 -21.3 0 -6.4 CACGTCTGGGGCATATTGGT
3178 SEQ ID NO: 723 -12.4 -26.5 74.8 -14.1 0 -4.6 GGATGGCTCTATATAAAAAA
3216 SEQ ID NO: 724 -12.4 -16.6 52.3 -4.2 0 -4.6 CATTCTTCCTCTCCTGCTTG
3333 SEQ ID NO: 725 -12.4 -26.9 77.7 -14.5 0 -3.6 CAAACATTCCAAAATCTGAA
3594 SEQ ID NO -.726 -12.4 -16.5 51.3 -4.1 0 -3.2 GACACATCAATGAATTTTGT
3659 SEQ ID NO: 727 -12.4 -18.2 56.5 -5.8 0 -4.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GGGCTGGCTGTGGCCGACGG 452 SEQ ID NO: 728 -12.3 -32.8 84.8 -17.7 -2.8 -11
GTGCAGGGCTGACACGAGTT 563 SEQ ID NO: 729 -12.3 -27.2 76.8 -13.3 -1.4 -10.1
TGGACATTCCCGAGAGAAAA 724 SEQ ID NO:730 -12.3 -21.7 61.3 -8.5 -0.8 -4.1
TCCAAACCTGTGATTCGGCC 811 SEQ ID NO: 731 -12.3 -26.9 72.3 -14.6 0 -5.8
CAAAATCTGCATCGTCCGGA 879 SEQ ID NO: 732 -12.3 -23.8 65.4 -10.9 0 -8.4
GCGTGTAGGTGTGGAGGACA 903 SEQ ID NO: 733 -12.3 -26.8 77.3 -13.9 -0.3 -4
GTCACCCCCATTGGGGTAGA 974 SEQ ID NO: 734 -12.3 -30.4 82.2 -13.6 -4.5 -12.4
GTTTCCCCAGACTTCACCCG 1600 SEQ ID NO:735 -12.3 -30.4 80 -18.1 0 -3
CTGGTGTTCTCAGGGTCTTC 1645 SEQ ID NO:736 -12.3 -26.4 81 -14.1 0 -4.5
GGGAAGCTCCACAGTGGGAC 1733 SEQ ID NO: 737 -12.3 -27.4 77.1 -13.5 -1.6 -9.5
GGGGAGCAGGACGGAATGGC 2286 SEQ ID NO:738 -12.3 -27.6 75.3 -15.3 0 -3.9
TTTGCTCCAAAGCAGTTATA 2714 SEQ ID NO: 739 -12.3 -21.8 64.7 -6.9 -2.6 -7.2
AAATCAAGATCTAGAATTGG
2911 SEQ ID NO: 740 -12.3 -15.8 51.3 -3 0 -8 CAAATCAAGATCTAGAATTG
2912 SEQ ID NO: 741 -12.3 -15.3 50.2 -3 0 -7.2 CTGCACCACTAACTAGTATA
3082 SEQ ID NO:742 -12.3 -21.8 64.4 -9.5 0 -6.3
AGTCCTCTCCCTGGCTGCAC 3096 SEQ ID NO: 743 -12.3 -31.7 88.2 -19.4 0 -6.4
AATCTGAGTCCTCTCCCTGG 3102 SEQ ID NO: 744 -12.3 -27.5 77.9 -14.5 -0.5 -6.6
TACAAGCTTCGCTTTGGCTA 3512 SEQ ID NO: 745 -12.3 -24.4 70 -10.5 -1.5 -9.5
CCCTCGTCCTGAGCCGCCGG 20 SEQ ID NO: 746 -12.2 -35.6 86.7 -22.5 -0.8 -7.7
TCCTGCCCCGCCACACCCCC 234 SEQ ID NO: 747 -12.2 -39.5 92 -27.3 0 -3
GTCCCTCTGGACCAAAAGGT 321 SEQ ID NO:748 -12.2 -26.8 73.6 -12.4 -2.2 -6.9
CAGGGCTGACACGAGTTTGT 560 SEQ ID NO: 749 -12.2 -25.5 72.8 -13.3 0 -4.7
TGCAGGGCTGACACGAGTTT 562 SEQ ID NO: 750 -12.2 -26.1 73.8 -13.3 -0.3 -5.6
ATTCCCGAGAGAAAAATCGT 719 SEQ ID NO: 751 -12.2 -20.7 59 -8 -0.2 -4.6
CCATTGGGGTAGATGTCAAT 967 SEQ ID NO: 752 -12.2 -23.5 68.3 -11.3 0 -5
TCTGCTCGATCCGCTCCACT 1410 SEQ ID NO: 753 -12.2 -29.9 80.3 -17.2 -0.1 -5.6
CTTCCACAGGTTGTACCAAG 1517 SEQ ID NO: 754 -12.2 -24.6 70.6 -10.7 -1.7 -5.3
AGTTTCCGCTGGGTTTCCCC 1612 SEQ ID NO: 755 -12.2 -31.5 85.1 -17.7 -1.5 -5.9
CCGACACTTGCGAAACCAGA 1685 SEQ ID NO:756 -12.2 -24.8 65.9 -12.6 0 -4.3
1777 GAAGTCTTGCTGCCTTGCTG -12.2 -26.7 76.4 -13.8 -0.4 -5.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 757
GAGCTATAGCAGCGCAGTCC
1926 SEQ ID NO: 758 -12.2 -27.9 79.2 -13.4 -2.3 -11 CTAGGGCCCGAGCAAGATAC
2219 SEQ ID NO: 759 -12.2 -26.5 72.3 -12.7 -0.7 -11.3 GATGTGTGCTTCAGAGAGTG
2310 SEQ ID NO:760 -12.2 -23.3 71.2 -11.1 0 -3.6 GTGTTCAATAGACATTTGCT
2366 SEQ ID NO: 761 -12.2 -21 64.2 -8.8 0 -4.4 CAGAAGAGATTTGCTCCAAA
2723 SEQ ID NO: 762 -12.2 -20.4 60.4 -7.4 -0.6 -5.7 ATTAATTCAAATCAAGATCT
2919 SEQ ID NO: 763 -12.2 -15.2 50.2 -3 0 -6.1 AGTATATAAGTCTAGGCATG
3068 SEQ ID NO: 764 -12.2 -19.5 61.3 -7.3 0 -6.1 GAGTGTCAACGGCTTGCCCC
53 SEQ ID NO: 765 -12.1 -30.2 80.6 -17.2 -0.8 -7.4 CGAGTTTGTGCAGCCAGTTT
549 SEQ ID NO: 766 -12.1 -26.4 75.6 -14.3 0 -5.6 CCGAAGGAACGCGTGTAGGT
913 SEQ ID NO: 767 -12.1 -25.9 69.4 -11.4 -2.1 -12.5 GATCCGCTCCACTATTTCCA
1403 SEQ ID NO:768 -12.1 -27.7 75.7 -15.6 0 -3.3 TGGATCTTCAAGAGGTCTCC
1471 SEQ ID NO: 769 -12.1 -24.3 72.5 -11 -1.1 -5 CGCTGGGTTTCCCCAGACTT
1606 SEQ ID NO: 770 -12.1 -30.2 80.8 -13.4 -4.7 -10.7 TTTCATCCTCCAGCCATCCC
1703 SEQ ID NO: 771 -12.1 -30.6 82.8 -18.5 0 -3.2 AGCTATAGCAGCGCAGTCCC
1925 SEQ ID NO: 772 -12.1 -29.3 81.4 -14.9 -2.3 -11 ACTGAGAAACCAATCCAGTG
2053 SEQ ID NO: 773 -12.1 -21.4 61.9 -8.1 -1.1 -5 GGCAGAGTACAGGCTCGCCC
2077 SEQ ID NO: 774 -12.1 -31 84.4 -14.9 -4 -9.6 GATACCAGGCCTGCCATCCT
• 2204 SEQ ID NO: 775 -12.1 -30.9 82.1 -17.1 -0.3 -11.6 AGATACCAGGCCTGCCATCC
2205 SEQ ID NO: 776 -12.1 -30 80.6 -15.6 -0.3 -12.8 AACCACTTAAAGCCTCAGGG
2554 SEQ ID NO: 777 -12.1 -23.9 67 -11.8 0 -3.7 TTCTGCTAGTGATCAAACAC
2641 SEQ ID NO: 778 -12.1 -20.4 62.2 -7.6 -0.5 -6.7 ATGGAGTTTCAGAGATAGAC
3135 SEQ ID NO:779 -12.1 -20 62.8 -7.9 0 -2.7 GTCCAACCGTTGGCACAGAT
3278 SEQ ID NO:780 -12.1 -27.1 74 -13.1 -1.8 -10.8 TCAGAAGTGACCAGGATGTA
3879 SEQ ID NO: 781 -12.1 -22.4 66.5 -10.3 0 -4.2 CACAGGCATCTGAATACCAA
941 SEQ ID NO:782 -12 -22.4 64.1 -8.8 -1.5 -4.9 TTGGCATTGTAGCCAATGCT
1204 SEQ ID NO: 783 -12 -25.3 71.9 -7.4 -5.9 -13.3 TTCCTCATTTTCTTGGCATT
1216 SEQ ID NO: 784 -12 -24 71.2 -12 0 -4 CCGGGTTTTTAGGTACATTT
1250 SEQ ID NO:785 -12 -23.7 68.8 -11.7 0 -5.6 CCAGACTTCACCCGGATGCG
1594 SEQ ID NO:786 -12 -29 75.1 -16.4 -0.3 -6.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo nding ation Duplex ture oligo oligo
AGGAGACCAGTTGTTCCCAG
1879 SEQ ID NO: 787 -12 -27 76.9 -13.9 -1 -4.9
CGAGCAAGATACCAGGCCTG
2211 SEQ ID NO:788 -12 -26.3 71.3 -12.7 0 -11.4
AAAATCATTCTTCCTCTCCT
3338 SEQ ID NO: 789 -12 -22.4 65.7 -10.4 0 -1.8
GCAAACATTCCAAAATCTGA
3595 SEQ ID NO: 790 -12 -19 56.5 -7 0 -3.4
AACCCCTCACATAAGTTACC
3757 SEQ ID NO: 791 -12 -24.6 68.2 -12.6 0 -3.8
TTGGTGTTTCCAGCAATCCC
175 SEQ ID NO: 792 -11.9 -27.2 76.4 -15.3 3.6 -0.6
ATGCTGTGTCCCACCACCCT
667 SEQ ID NO: 793 -11.9 -32.2 84.7 -20.3 0.1 -4.2
TTTTTAGGTACATTTTGCTG
1245 SEQ ID NO: 794 -11.9 -20.1 62.5 -8.2 0 -5.2
GAGCTGGATCTTCAAGAGGT
1475 SEQ ID NO: 795 -11.9 -23.9 71.4 -12 0 -5.1
TTCCACAGGTTGTACCAAGA
1516 SEQ ID NO: 796 -11.9 -24.3 70 -10.7 -1.7 -5.3
TGGTGTTCTCAGGGTCTTCT
1644 SEQ ID NO: 797 -11.9 -26.4 81 -14.5 0 -3.1
GAGCTCCCGGCCTGGGGATA 3
1667 SEQ ID NO: 798 -11.9 -32.3 84.5 -18.2 -2 -11.8
AGAAGAATCCTTCCATTGGG
1840 SEQ ID NO: 799 -11.9 -22.8 65.8 -8.8 -2.1 -6.3
CACAGGAGACCAGTTGTTCC
1882 SEQ ID NO: 800 -11.9 -25.9 74.6 -13.2 -0.6 -4.5
AAACCAATCCAGTGTGCACG
2047 SEQ ID NO: 801 -11.9 -23.8 65.6 -11 0 -9.8
CCTGACATGAGTCAGCTCCT
2187 SEQ ID NO: 802 -11.9 -27.3 77.6 -11.6 -3.8 -9.1
CAGAGAGTGAGCTGGGGAGC
2299 SEQ ID NO: 803 -11.9 -26.4 77.3 -13.8 -0.5 -5
GGCCATCATTCTGGCCCCAG
2684 SEQ ID NO: 804 -11.9 -31.9 84.6 -16.2 -3.8 -10.7
CAGGTGCCGGTTTCTGTGTA
2786 SEQ ID NO: 805 -11.9 -27.7 79.2 -15.8 0 -7
TTAATTCAAATCAAGATCTA
2918 SEQ ID NO: 806 -11.9 -14.9 49.7 -3 0 -6.4
CCTGGCTGCACCACTAACTA
3087 SEQ ID NO: 807 -11.9 -27.1 74 -13.9 -1.2 -8.4
CCAACCGTTGGCACAGATGT
3276 SEQ ID NO: 808 -11.9 -26.7 72.3 -13.4 -1.1 -10.1
TTCCAAAATCTGAAAATAAT
3588 SEQ ID NO: 809 -11.9 -13.9 46.6 -2 0 -3.2
CTCGTCCTGAGCCGCCGGGA
18 SEQ ID NO :810 -11.8 -33.4 84.2 -20.6 -0.9 -8.6
GCTTATCTTCCAGCCGTCCC
336 SEQ ID NO: 811 -11.8 -31.2 84.3 -19.4 0 -4
GTCAGTTTCCGCTGGGTTTC
1615 SEQ ID NO: 812 -11.8 -27.8 81.1 -14.7 -1.2 -5.2
CCAGAGCTCCCGGCCTGGGG
1670 SEQ ID NO: 813 -11.8 -34.7 88.3 -19.4 -3.5 -12.4
GCTGCCTTGCTGGCAAGACT
1769 SEQ ID NO: 814 -11.8 -28.9 79.6 -13.8 -3.3 -12.2
AACCAATCCAGTGTGCACGA
2046 SEQ ID NO: 815 -11.8 -25.1 68.9 -12.4 0 -9.8
2516 TATAGCCTCCCCCAGGCCCC -11.8 -36.2 90.3 -21.2 -3.2 -9.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 816
TAATTCAAATCAAGATCTAG 2917 SEQ ID NO:817 -11.8 -14.8 49.5 -3 0 -6.4 GTATTAATTCAAATCAAGAT
2921 SEQ ID NO:818 -11.8 -14.8 49.4 -3 0 -4.2 TGTATTAATTCAAATCAAGA
2922 SEQ ID NO:819 -11.8 -14.8 49.4 -3 0 -4 .2 TATGGATGGCTCTATATAAA
3219 SEQ ID NO:820 -11.8 -18.4 57.1 -6.6 0 -4
AGAAAGCAATCACAGAAACA 3493 SEQ ID NO:821 -11.8 -17.1 53.1 -5.3 0 -4
AGGCTATGTGGATAAGGTGT 3683 SEQ ID NO:822 -11.8 -23.2 69.5 -11.4 0 -4 . 1
TACCACAAACCATGCTTCAT 3741 SEQ ID NO:823 -11.8 -22.9 64.6 -11.1 0 -4.2
GACACGAGTTTGTGCAGCCA 553 SEQ ID NO: 824 -11.7 -26.7 74.7 -13.3 -1.7 -7 .3
TGTGCAGGGCTGACACGAGT
564 SEQ ID NO:825 -11.7 -27.1 76.3 -13.3 -2 .1 -10 .7 GTGTGCAGGGCTGACACGAG
565 SEQ ID NO:826 -11.7 -27.1 76.3 -13.3 -2 .1 -11.3 AGTCACCCCCATTGGGGTAG
975 SEQ ID NO:827 -11.7 -29.8 81.2 -13.6 -4.5 -12 .8
TCCTGATTCACCAGAGAGTC 1099 SEQ ID NO:828 -11.7 -24.8 73.1 -12.6 -0.2 -3 . 8
TGGGCTCAATTTCTCCCATG 1332 SEQ ID NO:829 -11.7 -26.1 73.4 -12.7 -1.7 -6 .8
TTGCGGGGTTGAGACAGGTA 1549 SEQ ID NO:830 -11.7 -25.8 73.8 -13.4 -0.5 -4.5
TATTCAGCTCCCGTCCGGGG 1569 SEQ ID NO-.831 -11.7 -30.8 81.4 -17.4 -1.6 -10.7
CGGATGCGCCTGATATTCAG 1582 SEQ ID NO:832 -11.7 -25.4 69.6 -12.1 -1.2 -10. 6
GCTGGGTTTCCCCAGACTTC 1605 SEQ ID NO: 833 -11.7 -29.8 83.2 -13.4 -4.7 -10.7
GTCTTCTGTACAAAATGTCA 1631 SEQ ID NO:834 -11.7 -19.9 61.5 -8.2 0 -6.1
TGGTTTCGTTTTTCATCCTC 1713 SEQ ID NO:835 -11.7 -24.2 72.2 -12.5 0 -3 .2
AGCTCCACAGTGGGACTGGT 1729 SEQ ID NO:836 -11.7 -28.4 81.1 -14.6 -2 .1 -9 .3
AGAGGTTTGGAGTTAGAGCT 1964 SEQ ID NO:837 -11.7 -23.3 71.6 -11.6 0 -5
CTTCAGAGAGTGAGCTGGGG 2302 SEQ ID NO:838 -11.7 -25.4 75.2 -13 -0.4 -5.5
AATCCCAACTCCACTGGGTT 2439 SEQ ID NO:839 -11.7 -26.7 73.1 -12.9 -2.1 -6. 8
CTCAGATATTGTGTGTATTA 2935 SEQ ID NO:840 -11.7 -19.5 61.8 -7.8 0 -2.5
CCCCGCCACACCCCCTCCCA 229 SEQ ID NO:841 -11.6 -40.4 92 -28.8 0 -2 .6
GGGCTGACACGAGTTTGTGC 558 SEQ ID NO:842 -11.6 -26.6 75.6 -13.3 -1.7 -7
TGTCCCACCACCCTGGTATT 661 SEQ ID NO:843 -11.6 -30.5 81.2 -17.2 -1.7 -5.7
CCCACAGGCATCTGAATACC 943 SEQ ID NO:844 -11.6 -26.4 72 -13.2 -1.5 -4.8
AGATGTCAATGTGGCCCACA 957 SEQ ID NO:845 -11.6 -26 72.8 -12.8 -1.5 -8.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo >inding ation Duplex ture oligo oligo
GGCATTGTAGCCAATGCTAT
1202 SEQ ID NO: 846 -11.6 -24.9 71 -7.4 -5.9 -15.3
TGGCATTGTAGCCAATGCTA
1203 SEQ ID NO: 847 -11.6 -24.9 70.9 -7.4 -5.9 -13.3
GATATTCAGCTCCCGTCCGG
1571 SEQ ID NO: 848 -11.6 -29 77.7 -17.4 0 -6.3
GCCATCCCGACACTTGCGAA
1691 SEQ ID NO: 849 -11.6 -28.9 74.2 -17.3 0 -4.3
CCTCCAGCCATCCCGACACT
1697 SEQ ID NO: 850 -11.6 -32.3 82.3 -20.7 0 -3.2
CATTTGCTCAATTAAAAAAT
2354 SEQ ID NO: 851 -11.6 -14.3 47.6 -2.7 0 -3.2
CAACTCCACTGGGTTCCAAA
2434 SEQ ID NO: 852 -11.6 -24.7 68.6 -12.5 -0.3 -6.1
CCAAAGCAGTTATATCTGGC
2708 SEQ ID NO: 853 -11.6 -22.8 66.6 -10.4 -0.6 -2.7
GGAGTTTCAGAGATAGACTT
3133 SEQ ID NO: 854 -11.6 -21 65.4 -9.4 0 -3.7
CGGGGCTCCCCGCAGCAAAG
300 SEQ ID NO: 855 -11.5 -31.9 79.6 -17.6 -2.6 -12.9
TCCTTCATGCTCTGGGTCCT
422 SEQ ID NO: 856 -11.5 -29.4 84 -17.9 0 -3.8
CCTGGCAATGCTGTGTCCCA 0
674 SEQ ID NO: 857 -11.5 -30.1 80.9 -17.9 -0.4 -8.2
GCATACCCGGCCACGTGCGC
766 SEQ ID NO: 858 -11.5 -33.5 82.6 -20.1 -1.9 -10.8
ATCCGCTCCACTATTTCCAG
1402 SEQ ID NO: 859 -11.5 -27.1 74.8 -15.6 0 -3.1
CTGCTCGATCCGCTCCACTA
1409 SEQ ID NO: 860 -11.5 -29.2 78 -17.2 -0.1 -5.6
GTTGGTGGCATTCTGCTCGA
1421 SEQ ID NO: 861 -11.5 -27.3 78.2 -13.9 -1.9 -7.8
TGTTGGTGGCATTCTGCTCG
1422 SEQ ID NO: 862 -11.5 -26.7 76.6 -13.3 -1.9 -8.6
GTCCTCCTCGGTGTAGACCA
1448 SEQ ID NO: 863 -11.5 -29.8 82.8 -16.5 -1.8 -3.1
ACCCTCAGGGAAGCTCCACA
1740 SEQ ID NO: 864 -11.5 -29.2 79 -16.1 -1.6 -8.2
GGTGCCGGTTTCTGTGTACA
2784 SEQ ID NO: 865 -11.5 -27.9 79.4 -15.8 -0.3 -6.8
GTGTGTATTAATTCAAATCA
2925 SEQ ID NO: 866 -11.5 -17.3 55.3 -5.8 0 -4.2
AACCGTTGGCACAGATGTTC
3274 SEQ ID NO: 867 -11.5 -24.5 69.6 -12.2 -0.6 -6.1
TGTCCTTAGAAAACCTAAGT
3364 SEQ ID NO: 868 -11.5 -20.1 60 -6.4 -2.2 -5.7
GTACAAGCTTCGCTTTGGCT
3513 SEQ ID NO: 869 -11.5 -25.9 73.9 -12.8 -1.5 -9.5
TCCAAAATCTGAAAATAATC
3587 SEQ ID NO: 870 -11.5 -14.2 47.3 -2.7 0 -3.2
GTCAGAAGTGACCAGGATGT
3880 SEQ ID NO: 871 -11.5 -23.9 70.5 -10.3 -2.1 -5.8
AAAAACAGAAGTCAGAAGTG
3890 SEQ ID NO: 872 -11.5 -15.4 50.2 -3.9 0 -2.9
GGGCTCCCCGCAGCAAAGCA
298 SEQ ID NO: 873 -11.4 -32.4 82.5 -19 -2 -7.6
GTCCCACCACCCTGGTATTA
660 SEQ ID NO: 874 -11.4 -30.2 80.8 -17.2 -1.5 -5.5
1247 GGTTTTTAGGTACATTTTGC -11.4 -21.6 66.7 -10.2 0 -5.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular sition oligo binding ation Duplex ture oligo oligo
SEQ ID NO :875
TTCTGCTCGATCCGCTCCAC
1411 SEQ ID NO: 876 -11.4 -29.1 78.8 -17.2 -0.1 -5.6 TGTCAGTTTCCGCTGGGTTT
1616 SEQ ID NO: 877 -11.4 -27.4 79 -14.7 -1.2 -5.2 GAGGTTTGGAGTTAGAGCTA
1963 SEQ ID NO.-878 -11.4 -23 70.6 -11.6 0 -5.1 GAAACCAATCCAGTGTGCAC
2048 SEQ ID NO: 879 -11.4 -23.6 66.6 -11.6 0 -8.4 AGCCAATGATGTGTGCTTCA
2317 SEQ ID NO: 880 -11.4 -24.7 71.3 -12.6 -0.5 -3.9 TGTTCAATAGACATTTGCTC
2365 SEQ ID NO: 881 -11.4 -20.2 62.4 -8.8 0 -4 CGGTTTCTGTGTACACAGAT
2779 SEQ ID NO: 882 -11.4 -23.2 68.6 -7.4 -2.3 -17 AGGTGCCGGTTTCTGTGTAC
2785 SEQ ID NO: 883 -11.4 -27.2 78.7 -15.8 0 -6.6 TGCACCACTAACTAGTATAT
3081 SEQ ID NO: 884 -11.4 -20.9 62.5 -9.5 0 -6.3 AAGAAAATCATTCTTCCTCT
3341 SEQ ID NO: 885 -11.4 -19 58.2 -5.6 -2 -5.7 TTTGGCTAGAAAGCAATCAC
3500 SEQ ID NO: 886 . -11.4 -20.1 60.5 -6.1 -2.6 -6.6 TTACCCTCAGGCTATGTGGA
3691 SEQ ID NO: 887 -11.4 -26.6 75.6 -14.1 -1 -3.9 ATCCAAAACTTTTTGAGCAC
3798 SEQ ID NO: 888 -11.4 -19.8 59.3 -7.3 -1 -7.3 AGAGGAACGGAGTTGCTCAT
253 SEQ ID NO: 889 -11.3 -23.6 68.4 -9.9 -2.4 -10.7 CGTCCCTCTGGACCAAAAGG
322 SEQ ID NO: 890 -11.3 -26.4 70.5 -12.4 -2.7 -7.2 CTTCTAAGGGCTGGCTGTGG
459 SEQ ID NO: 891 -11.3 -26.7 76.8 -15.4 0 -6 CTGTGTCCCACCACCCTGGT
664 SEQ ID NO: 892 -11.3 -32.8 86.5 -19.9 -1.5 -5.3 GTGGACATTCCCGAGAGAAA
725 SEQ ID NO: 893 -11.3 -23.6 66 -11.4 -0.8 -4.1 ACAGGCATCTGAATACCAAT
940 SEQ ID NO: 894 -11.3 -21.7 62.9 -8.8 -1.5 -4.9 GCATTGTAGCCAATGCTATT
1201 SEQ ID NO: 895 -11.3 -23.8 68.8 -7.4 -5.1 -12.4 ATGTCAGTTTCCGCTGGGTT
1617 SEQ ID NO: 896 -11.3 -27.3 78.5 -14.7 -1.2 -5.2 ATGCTGGTGTTCTCAGGGTC
1648 SEQ ID NO: 897 -11.3 -26.8 81 -14.8 -0.5 -5.2 CTATAGCAGCGCAGTCCCCT
1923 SEQ ID NO: 898 -11.3 -30.4 82 -18.6 0.1 -8.5 GTTTGGAGTTAGAGCTATTC
1960 SEQ ID NO: 899 -11.3 -21.7 68.1 -10.4 0 -5.1 AATCTGGACTTGGTGCTCTG
1995 SEQ ID NO: 900 -11.3 -24 70.8 -12.7 0 -3.6 ACCAGGCCTGCCATCCTGAC
2201 SEQ ID NO: 901 -11.3 -31.4 83.1 -17.9 -2 -11.9 GGGAGCAGGACGGAATGGCT
2285 SEQ ID NO: 902 -11.3 -27.3 74.7 -15.3 -0.5 -5 AGTGTTCAATAGACATTTGC
2367 SEQ ID NO: 903 -11.3 -20.1 62.4 -8.8 0 -4.6 CTTAAAGCCTCAGGGTCCCT
2549 SEQ ID NO: 904 -11.3 -28 77.1 -16.1 -0.3 -6.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo άnding ation Duplex ture oligo oligo
CGGCCATCATTCTGGCCCCA 2685 SEQ ID NO: 905 -11.3 -32.7 83.6 -17.1 -4.3 -11.3
GAAGAGATTTGCTCCAAAGC 2721 SEQ ID NO: 906 -11.3 -21.5 63.2 -7.4 -2.8 -7.3
AAACAGAAGAGATTTGCTCC 2726 SEQ ID NO: 907 -11.3 -19.9 59.8 -7.4 -1.1 -5.7
AAGAAGTTCAACAAGAAAAG 2881 SEQ ID NO:908 -11.3 -13.6 46.4 -1.5 -0.5 -6.8
TTTCCAAGAAGTTCAACAAG 2886 SEQ ID NO: 909 -11.3 -18.4 56.6 -7.1 0 -6.8
GTATATAAGTCTAGGCATG 3067 SEQ ID NO: 910 -11.3 -20.7 64.4 -9.4 0 -6.1
CCAAAACTTTTTGAGCACCA 3796 SEQ ID NO:911 -11.3 -22.1 62.6 -9.7 -1 -7.3
CAGAAGTCAGAAGTGACCAG 3885 SEQ ID NO:912 -11.3 -21.5 64.1 -8.6 -1.6 -5.2
AAAGGTTTTAGCTGTCATGT 491 SEQ ID NO: 913 -11.2 -21.2 65 -10 0 -4.8
TCGTCCATCCGTGAATGATG 513 SEQ ID NO: 914 -11.2 -24.4 67.7 -12.7 -0.2 -4.4
TGTGTGCAGGGCTGACACGA 566 SEQ ID NO: 915 -11.2 -27.1 75.8 -13.3 -2.6 -11.7
TCTCTTGTGTGCAGGGCTGA 571 SEQ ID NO: 916 -11.2 -27.3 80.5 -15.5 -0.3 -5.4
CTCGATCCGCTCCACTATTT 1406 SEQ ID NO: 917 -11.2 -26.7 73 -15.5 0 -4.5
TCATCCTCCAGCCATCCCGA 1701 SEQ ID NO: 918 -11.2 -31.8 82.7 -20.6 0 -3.2
TCTTGCTGCCTTGCTGGCAA 1773 SEQ ID NO: 919 -11.2 -28.6 79.3 -14.1 -3.3 -10.3
TCAATAGACATTTGCTCAAT 2362 SEQ ID NO: 920 -11.2 -18.9 58.3 -7.7 0 -4
CCTCAGGGTCCCTAATGCTT 2542 SEQ ID NO:921 -11.2 -28.7 79.1 -17 -0.1 -6.4
CTATCTCTCTAAACAGAAGA 2736 SEQ ID NO: 922 -11.2 -18.2 57.2 -7 0 -3.2
TTCCAAGAAGTTCAACAAGA 2885 SEQ ID NO: 923 -11.2 -18.9 57.5 -7.7 0 -6.8
ACCGTTGGCACAGATGTTCT 3273 SEQ ID NO:924 -11.2 -26.1 73.9 -14.3 -0.3 -4.6
GTCCTTAGAAAACCTAAGTA 3363 SEQ ID NO: 925 -11.2 -19.8 59.5 -6.4 -2.2 -5.7
AATGTCCTTAGAAAACCTAA
3366 SEQ ID NO: 926 -11.2 -18.2 55.2 -6.4 -0.3 -3 CAATGTCCTTAGAAAACCTA
3367 SEQ ID NO: 927 -11.2 -19.6 58.1 -8.4 0 -2.1 AAGTTTAACAGTGATACAAC
3409 SEQ ID NO: 928 -11.2 -16.5 53.2 -5.3 0 -4.4
CAAGCTTCGCTTTGGCTAGA
3510 SEQ ID NO: 929 -11.2 -25.1 71.6 -12.3 -1.5 -9.5
TAAAAACAGAAGTCAGAAGT
3891 SEQ ID NO: 930 -11.2 -15.1 49.7 -3.9 0 -2.8 GTAAAAACAGAAGTCAGAAG
3892 SEQ ID NO: 931 -11.2 -15.1 49.7 -3.9 0 -2.8 GAGTTGCTCATCCTGCCCCG
244 SEQ ID NO: 932 -11.1 -31.6 83.5 -19.9 -0.3 -4.5
ACACGAGTTTGTGCAGCCAG 552 SEQ ID NO: 933 -11.1 -26.1 73.7 -13.3 -1.7 -6.5
557 GGCTGACACGAGTTTGTGCA -11.1 -26.1 74.1 -13.3 -1.7 -7.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 934
AGTGGACATTCCCGAGAGAA
726 SEQ ID NO: 935 -11.1 -24.3 68.4 -12.3 -0.8 -4.1 CCTGCATACCCGGCCACGTG
769 SEQ ID NO: 936 -11.1 -32 79.9 -20.1 -0.6 -8.4 TCACCCCCATTGGGGTAGAT
973 SEQ ID NO: 937 -11.1 -29.2 78.7 -13.6 -4.5 -12.8 ATTTCTCCCATGTTCTTGTA
1324 SEQ ID NO: 938 -11.1 -24.2 72.1 -13.1 0 -4.3 AGCTCCCGGCCTGGGGATAT
1666 SEQ ID NO: 939 -11.1 -31.7 83.2 -18.2 -2.1 -12.4 CAGGAGACCAGTTGTTCCCA
1880 SEQ ID NO: 940 -11.1 -27.7 77.6 -15.5 -1 -4.9 TCACAGGAGACCAGTTGTTC
1883 SEQ ID NO: 941 -11.1 -24.3 72.6 -13.2 0.5 -3.3 GCCTGCCATCCTGACATGAG
2196 SEQ ID NO: 942 -11.1 -28.6 77.7 -17.5 0 -5.2 CCAGGCCCCAGGTGCCTTTC
2505 SEQ ID NO: 943 -11.1 -34.1 89.5 -20.8 -2.2 -10 AGAAGAGATTTGCTCCAAAG
2722 SEQ ID NO: 944 -11.1 -19.7 59.4 -7.4 -1.1 -5.7 GTCATAACTTCTATCTCTCT
2746' SEQ ID NO: 945 -11.1 -21.4 67 -10.3 0 -1.9 GCACCACTAACTAGTATATA
3080 SEQ ID NO: 946 -11.1 -20.6 62 -9.5 0 -6.3 ACATATCTTGAAATAAGACT
3448 SEQ ID NO: 947 -11.1 -15.9 51.6 -3.9 -0.8 -3.9 GAAGTCAGAAGTGACCAGGA
3883 SEQ ID NO: 948 -11.1 -22.6 66.6 -9.1 -2.4 -6.3 CAGGGAGCGAGTGTCAACGG
61 SEQ ID NO: 949 -11 -25.9 71.8 -14.2 -0.5 -4.6 GTTGCTCATCCTGCCCCGCC
242 SEQ ID NO -.950 -11 -34.8 89.3 -23.8 0 -3.6 AACGGAGTTGCTCATCCTGC
248 SEQ ID NO: 951 -11 -26.3 73.9 -14 -1.2 -6.4 ATCCTTCATGCTCTGGGTCC
423 SEQ ID NO: 952 -11 -28.5 81.9 -17.5 0 -4.4 GTCATGTTGAAACTGCAGTC
478 SEQ ID NO: 953 -11 -22 66.6 -9 -0.1 -12.1 TGACACGAGTTTGTGCAGCC
554 SEQ ID NO: 954 -11 -26 73.5 -13.3 -1.7 -6.8 CTCTTGTGTGCAGGGCTGAC
570 SEQ ID NO: 955 -11 -27.1 79.2 -15.5 -0.3 -5.4 CTCTCTTGTGTGCAGGGCTG
572 SEQ ID NO: 956 -11 -27.6 81.2 -16 -0.3 -5.3 TTTCTCTCTTGTGTGCAGGG
575 SEQ ID NO: 957 -11 -25.5 77.2 -14.5 0 -5.3 TCGAGCATCCTGGCAATGCT
682 SEQ ID NO: 958 -11 -27.3 74.9 -13.5 -2.8 -11.2 GCAGCCAGTCGAGCATCCTG
690 SEQ ID NO: 959 -11 -29.8 81.7 -17.9 -0.7 -6.1 CCCGAGAGAAAAATCGTCCT
716 SEQ ID NO: 960 -11 -23.5 63.6 -11.6 -0.7 -3.9 TCCGGAGAGAGCCTCTTGTG
865 SEQ ID NO: 961 -11 -27.5 77.3 -15 -1.4 -9.9 GGTAGATGTCAATGTGGCCC
960 SEQ ID NO: 962 -11 -26.5 75.4 -15.5 0 -6.6 TGGCTGGAAGTCACCCCCAT
983 SEQ ID NO: 963 -11 -30.2 79.8 -17.9 -1.2 -5.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular sition oligo binding ation Duplex ture oligo oligo
GGTGGACGGCTCGCTCATGC
1071 SEQ ID NO: 964 -11 -29.9 81.3 -18.2 -0.5 -6.1
GGTGTAGACCAGGAAGGTGT
1439 SEQ ID NO: 965 -11 -25.5 74.6 -12.9 -1.5 -2.9
CTGGATCTTCAAGAGGTCTC
1472 SEQ ID NO: 966 -11 -23.2 70.7 -11 -1.1 -5
ATATTCAGCTCCCGTCCGGG
1570 SEQ ID NO: 967 -11 -29.6 78.9 -17.4 -0.8 -10.1
AATGTCAGTTTCCGCTGGGT
1618 SEQ ID NO: 968 -11 -26.5 75.5 -14.7 -0.6 -5.2
GGTTTGGAGTTAGAGCTATT
1961 SEQ ID NO: 969 -11 -22.5 69.2 -11.5 0 -5.1
TTCGGAGCCAGCGTTCCTCG
2100 SEQ ID NO: 970 -11 -30 79.5 -17.5 -1.4 -5.2
TCTATCTCTCTAAACAGAAG
2737 SEQ ID NO: 971 -11 -18 57.2 -7 0 -2.7
TATTAATTCAAATCAAGATC
2920 SEQ ID NO: 972 -11 -14 47.8 -3 0 -4.2
GATATTGTGTGTATTAATTC
2931 SEQ ID NO: 973 -11 -17.3 56.3 -6.3 0 -4.2
GAAAAGTGTAAGTGTCTCAG
2950 SEQ ID NO: 974 -11 -18.7 58.9 -7.7 0 -2.1
TGAAAAGTGTAAGTGTCTCA
2951 SEQ ID NO: 975 -11 -18.7 58.6 -7.7 0 -2.4
AAATCATTCTTCCTCTCCTG
3337 SEQ ID NO: 976 -11 -23.1 67.8 -12.1 0 -1.8
ATGTCCTTAGAAAACCTAAG
3365 SEQ ID NO: 977 -11 -18.9 57.1 -6.4 -1.4 -4.8
TTTAACAGTGATACAACTTT
3406 SEQ ID NO: 978 -11 -17.1 54.5 -6.1 0 -3.7
CCAAAATCTGAAAATAATCT
3586 SEQ ID NO: 979 -11 -14.7 48 -3.7 0 -3.2
ACCACAAACCATGCTTCATG
3740 SEQ ID NO: 980 -11 -23.2 65 -11.1 -1 -5.3
AGAAGTCAGAAGTGACCAGG
3884 SEQ ID NO: 981 -11 -22 65.5 -8.6 -2.4 -6.3
GGCCGGTAAGACCCTTCTCT
155 SEQ ID NO: 982 -10.9 -29.6 79.8 -17.6 -0.7 -9.8
TCACAGATGGTTTGACCTCA
381 SEQ ID NO: 983 -10.9 -24 70.3 -12.3 -0.6 -4.4
CTCATGCTCACATTTTACCA
1058 SEQ ID NO: 984 -10.9 -23.6 68.8 -12 -0.4 -4.4
AGCCATCCCGACACTTGCGA
1692 SEQ ID NO: 985 -10.9 -29.6 76.7 -18.2 -0.1 -4.3
TGCTGCCTTGCTGGCAAGAC
1770 SEQ ID NO: 986 -10.9 -28 77.5 -13.8 -3.3 -12.7
CCAACTCCACTGGGTTCCAA
2435 SEQ ID NO: 987 -10.9 -27.4 74.1 -15.9 -0.3 -6.1
CAACAAGAAAAGGCACTGGT
2873 SEQ ID NO: 988 -10.9 -19.9 58.4 -8.2 -0.6 -4.4
CCCTGGCTGCACCACTAACT
3088 SEQ ID NO: 989 -10.9 -29.4 77.8 -17.2 -1.2 -8.4
ACAAGCTTCGCTTTGGCTAG
3511 SEQ ID NO: 990 -10.9 -24.7 70.9 -12.2 -1.5 -9.5
CTGTACAAGCTTCGCTTTGG
3515 SEQ ID NO: 991 -10.9 -24.1 69.5 -11.6 -1.5 -7.8
GTCTGTGTAGCTTTGGGTTT
361 SEQ ID NO: 992 -10.8 -25.3 77.5 -14.5 0 -4.6
693 CCTGCAGCCAGTCGAGCATC -10.8 -29.8 81.7 -18.1 -0.8 -8.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligc oligo SEQ ID NO: 993
TCAAGTGGACATTCCCGAGA
729 SEQ ID NO: 994 -10.8 -24.8 69.5 -13.1 -0.8 -4.1 CTTTCACGAAGTTGCCTGCA
783 SEQ ID NO: 995 -10.8 -25.6 71.6 -14.3 -0.2 -6.8 ACCCCCATTGGGGTAGATGT
971 SEQ ID NO: 996 -10.8 -29.3 79.2 -14.2 -4.3 -12.8 CCTGATTCACCAGAGAGTCA
1098 SEQ ID NO: 997 -10.8 -25.1 72.5 -13.6 -0.4 -5.4 AGTCCTCCTCGGTGTAGACC
1449 SEQ ID NO: 998 -10.8 -29.1 82.2 -17.4 -0.7 -1.7 AAGCTCCACAGTGGGACTGG
1730 SEQ ID NO: 999 -10.8 -26.5 74.9 -13.6 -2.1 -8.9 AGCCAGCGTTCCTCGTCAGG
2095 SEQ ID NO: 1000 -10.8 -30.4 83.1 -18.7 -0.8 -8.2 ATGGTCAGTGCAACCCATGA
2251 SEQ ID NO: 1001 -10.8 -26 72.8 -14.2 -0.9 -7.4 CCACTGGGTTCCAAATGGAG
2429 SEQ ID NO: 1002 -10.8 -25 69.5 -12.6 -1.5 -9.1 TGCTCCAAAGCAGTTATATC
2712 SEQ ID NO: 1003 -10.8 -22 65.5 -8.8 -2.4 -7.1 TATTGGTGGGAACTGGCTGC
3165 SEQ ID NO: 1004 -10.8 -25.3 72.5 -13.6 -0.4 -9.4 GAAGTTTAACAGTGATACAA
3410 SEQ ID NO: 1005 -10.8 -16.9 53.9 -6.1 0 -4.6 TCGTCCTGAGCCGCCGGGAG
17 SEQ ID NO: 1006 -10.7 -32.5 82.7 -20.6 -1.1 -8.7 GTAAGACCCTTCTCTCGGCC
150 SEQ ID NO: 1007 -10.7 -28.8 79 -17.6 -0.2 -6 TTGTGTGCAGGGCTGACACG
567 SEQ ID NO: 1008 -10.7 -26.6 74.8 -13.3 -2.6 -11.7 TTTCACGAAGTTGCCTGCAT
782 SEQ ID NO: 1009 -10.7 -24.7 69.7 -13.3 -0.4 -6.8 GGCCCACAGGCATCTGAATA
945 SEQ ID NO: 1010 -10.7 -27.2 74.6 -13.2 -3.3 -8.9 CACCCCCATTGGGGTAGATG
972 SEQ ID NO: 1011 -10.7 -28.8 76.9 -13.6 -4.5 -12.8 AATTTCTCCCATGTTCTTGT
1325 SEQ ID NO: 1012 -10.7 -23.8 70.3 -13.1 0 -4.3 AAAGGGTGACGTAAAAGGTG
1350 SEQ ID NO: 1013 -10.7 -19 56.8 -8.3 0 -5.3 TCGATCCGCTCCACTATTTC
1405 SEQ ID NO: 1014 -10.7 -26.2 72.7 -15.5 0 -4.2 GGGTCCTCAGCAGTAACTTT
1819 SEQ ID NO: 1015 -10.7 -26 76.1 -15.3 0 -4.1 TGATGTGTGCTTCAGAGAGT
2311 SEQ ID NO: 1016 -10.7 -23.3 71.2 -12.6 0 -3.6 TTCAATAGACATTTGCTCAA
2363 SEQ ID NO: 1017 -10.7 -19 58.6 -8.3 0 CTAAACAGAAGAGATTTGCT
2728 SEQ ID NO: 1018 -10.7 -18.1 56.1 -7.4 0 -5.7 TGTAAGTGTCTCAGATATTG
2944 SEQ ID NO: 1019 -10.7 -19.4 61.6 -8.7 0 -2.8 AAGGGCTTAGGATTTTATGG
3234 SEQ ID NO: 1020 -10.7 -21.2 63.9 -10.5 0 -3.7 TGAGAACATATCTTGAAATA
3453 SEQ ID NO: 1021 -10.7 -15.4 50.5 -3.9 -0.6 -3.9 AGATGGTTTGACCTCAGTCT
377 SEQ ID NO: 1022 -10.6 -24.5 73.2 -12.3 -1.6 -5.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
AGGGCTGGCTGTGGCCGACG
453 SEQ ID NO: 1023 -10.6 -31.6 82.8 -17.7 -3.3 -11
CATACCCGGCCACGTGCGCT
765 SEQ ID NO: 1024 -10.6 -32.6 80.5 -20.1 -1.3 -11.7
ACAAAATCTGCATCGTCCGG
880 SEQ ID NO: 1025 -10.6 -23.4 64.7 -12.8 0 -6
AAGTCACCCCCATTGGGGTA
976 SEQ ID NO: 1026 -10.6 -29.1 78.4 -14.2 -4.3 -12.8
GATTCACCAGAGAGTCAACA
1095 SEQ ID NO: 1027 -10.6 -22.4 66.4 -11.8 0 -4.8
AAGGCAAAACTCGGCTTGTC
1117 SEQ ID NO: 1028 -10.6 -22.8 65.1 -11.5 -0.5 -4.1
GGGGATATGCTGGTGTTCTC
1654 SEQ ID NO: 1029 -10.6 -26 77.2 -15.4 0 -3.6
AGGGAAGCTCCACAGTGGGA
1734 SEQ ID NO: 1030 -10.6 -27.2 76.8 -15 -1.6 -9.5
GGAAGTCTTGCTGCCTTGCT
1778 SEQ ID NO: 1031 -10.6 -27.9 79.3 -16.6 -0.4 -5.4
TGGGTCCTCAGCAGTAACTT
1820 SEQ ID NO: 1022 -10.6 -25.9 75.5 -15.3 0 -4.1
CCCCAGGTGCCTTTCCCCAT
2500 SEQ ID NO: 1033 -10.6 -35.1 88.6 -24.5 0 -6.6
CTCAGGGTCCCTAATGCTTA
2541 SEQ ID NO: 1034 -10.6 -26.4 75 -15.3 -0.1 -6.4
CAGATATTGTGTGTATTAAT
2933 SEQ ID NO: 1035 -10.6 -17.5 56.2 -6.9 0 -4
ACTAGTATATAAGTCTAGGC
3071 SEQ ID NO: 1036 -10.6 -19.6 62.2 -7.8 -1.1 -6.3
AAGCAATCACAGAAACAAGA
3490 SEQ ID NO: 1037 -10.6 -17.1 53.1 -6.5 0 -4.1
TGGTGTTTCCAGCAATCCCG
174 SEQ ID NO: 1038 -10.5 -27.9 75.7 -16.3 -1 -6.1
GAACGGAGTTGCTCATCCTG
249 SEQ ID NO: 1039 -10.5 -25.1 71 -12.8 -1.8 -6.8
CAGATGGTTTGACCTCAGTC
378 SEQ ID NO: 1040 -10.5 -24.3 72.3 -12.3 -1.4 -5.3
CTCACAGATGGTTTGACCTC
382 SEQ ID NO: 1041 -10.5 -24.2 71.2 -12.3 -1.3 -5.1
GGCTGGCTGTGGCCGACGGA
451 SEQ ID NO: 1042 -10.5 -32.2 83.7 -18.4 -3.3 -11
TCCCGAGAGAAAAATCGTCC
717 SEQ ID NO: 1043 -10.5 -23 63.2 -11.6 -0.7 -3.9
TGCATACCCGGCCACGTGCG
767 SEQ ID NO: 1044 -10.5 -31.7 78.6 -18.6 -2.6 -8.9
CTATTTCCAGTGGCAGAGTC
1392 SEQ ID NO: 1045 -10.5 -25 74.8 -14.5 0 -7.4
GTGTTGGTGGCATTCTGCTC
1423 SEQ ID NO: 1046 -10.5 -27.1 80.8 -14.7 -1.9 -5.6
CCCCAGACTTCACCCGGATG
1596 SEQ ID NO: 1047 -10.5 -30.4 77.8 -19.9 0 -6.4
TTGCTGCCTTGCTGGCAAGA
1771 SEQ ID NO: 1048 -10.5 -27.9 77.3 -14.1 -3.3 -12.7
GTGGGTCCTCAGCAGTAACT
1821 SEQ ID NO: 1049 -10.5 -27 78.8 -16.5 0 -4.1
GGGTGGGTCCTCAGCAGTAA
1823 SEQ ID NO: 1050 -10.5 -28.3 81.6 -16.9 -0.8 -4.9
ACACACAAATCTGGACTTGG
2002 SEQ ID NO: 1051 -10.5 -20.8 61.4 -10.3 0 -4.7
2054 AACTGAGAAACCAATCCAGT -10.5 -20.7 60.1 -8.7 -1.4 -5.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1052
TCAGAGAGTGAGCTGGGGAG
2300 SEQ ID NO: 1053 -10.5 -25 74.4 -13.8 -0.4 -5 TGCTAGTGATCAAACACGTC
2638 SEQ ID NO: 1054 -10.5 -21.4 63.4 -10 -0.8 -6.7 CCGGTTTCTGTGTACACAGA
2780 SEQ ID NO: 1055 -10.5 -25.2 72.4 -10.3 -2.4 -17 GATGGCTCTATATAAAAAAA
3215 SEQ ID NO: 1056 -10.5 -14.7 48.5 -4.2 0 -3.7 CGTTGGCACAGATGTTCTCC
3271 SEQ ID NO: 1057 -10.5 -26.3 75 -15 -0.6 -6.1 CCGTTGGCACAGATGTTCTC
3272 SEQ ID NO: 1058 -10.5 -26.3 75 -15 -0.6 -6.1 TAAGTTACCACAAACCATGC
3746 SEQ ID NO: 1059 -10.5 -21.1 61 -10.1 -0.2 -4.4 TGGACCAAAAGGTACGGGGC
314 SEQ ID NO:1060 -10.4 -25.1 68.3 -14.2 -0.1 -5.2 AGTCGAGCATCCTGGCAATG
684 SEQ ID NO: 1061 -10.4 -25.8 72.4 -14.5 -0.8 -5.6 CTGGCTGGAAGTCACCCCCA
984 SEQ ID NO: 1062 -10.4 -31.1 81.7 -19.3 -1.3 -5.2 TTTCTCCCATGTTCTTGTAA
1323 SEQ ID NO: 1063 -10.4 -23.5 69.7 -13.1 0 -4.3 TAAAGGGTGACGTAAAAGGT
1351 SEQ ID NO: 1064 -10.4 -18.7 56.4 -8.3 0 -5.3 ACTATTTCCAGTGGCAGAGT
1393 SEQ ID NO: 1065 -10.4 -24.8 73.6 -14.4 0 -7.4 TGATATTCAGCTCCCGTCCG
1572 SEQ ID NO: 1066 -10.4 -27.8 75.1 -17.4 0 -4.4 GCTAGGGCCCGAGCAAGATA
2220 SEQ ID NO -.1067 -10.4 -28.1 75.7 -15.6 -1.5 -12.1 TGGGGAGCAGGACGGAATGG
2287 SEQ ID NO: 1068 -10.4 -25.8 71.1 -15.4 0 -4.1 CAAGAAGTTCAACAAGAAAA
2882 SEQ ID NO: 1069 -10.4 -14.3 47.5 -3.2 -0.5 -6.8 TTGAAAAGTGTAAGTGTCTC
2952 SEQ ID NO: 1070 -10.4 -18.1 57.7 -7.7 0 -2.3 GAAATCTGAGTCCTCTCCCT
3104 SEQ ID NO: 1071 -10.4 -26.2 74.3 -14.5 -1.2 -4.9 TATCTTGAAATAAGACTCAA
3445 SEQ ID NO: 1072 -10.4 -15.4 50.5 -3.6 -1.3 -6 GCTTCGCTTTGGCTAGAAAG
3507 SEQ ID NO: 1073 -10.4 -23.7 68.2 -12.3 -0.9 -5.7 TCCCTCTGGACCAAAAGGTA
320 SEQ ID NO: 1074 -10.3 -25.3 69.9 -14.2 -0.6 -6 ACAGATGGTTTGACCTCAGT
379 SEQ ID NO: 1075 -10.3 -24.1 71.2 -12.3 -1.4 -5.2 AAACCTCACAGATGGTTTGA
386 SEQ ID NO: 1076 -10.3 -21.5 63.2 -9.1 -2.1 -7.3 TCTAAGGGCTGGCTGTGGCC
457 SEQ ID NO: 1077 -10.3 -29.5 82.5 -17 -2.2 -11 CAAAGATACCGCTCATCGTC
528 SEQ ID NO: 1078 -10.3 -23.2 65.3 -12.3 -0.3 -3.5 TCTTGTGTGCAGGGCTGACA
569 SEQ ID NO:1079 -10.3 -26.9 78.3 -15.9 -0.4 -6.6 TTCCCGAGAGAAAAATCGTC
718 SEQ ID NO: 1080 -10.3 -21.1 60.2 -9.9 -0.7 -4.1 TTCACGAAGTTGCCTGCATA
781 SEQ ID NO: 1081 -10.3 -24.3 68.8 -13.3 -0.4 -6.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CTGAAAGGCATGCCTGCCCG 1267 SEQ ID NO: 1082 -10.3 -29.1 74.9 -15.2 -3.6 -14.3
CGCTCCACTATTTCCAGTGG 1399 SEQ ID NO:1083 -10.3 -27.1 75.3 -14 -2.8 -8.6
CCCAGACTTCACCCGGATGC 1595 SEQ ID NO: 1084 -10.3 -30.2 78.5 -19.9 0 -6.4
CAGAGCTCCCGGCCTGGGGA 1669 SEQ ID NO:1085 -10.3 -33.3 86.4 -20.6 -2.1 -12.4
TCAGGCAGAGTACAGGCTCG 2080 SEQ ID NO: 1086 -10.3 -26.3 76 -13.8 -2.2 -7.4
CACTGGGTTCCAAATGGAGA 2428 SEQ ID NO: 1087 -10.3 -23.6 67.3 -12.7 -0.3 -7.5
GCTCCAAAGCAGTTATATCT 2711 SEQ ID NO: 1088 -10.3 -22.9 67.6 -10.9 -1.7 -5.8
AGATATTGTGTGTATTAATT 2932 SEQ ID NO:1089 -10.3 -16.9 55.2 -6.6 0 -4.2
GGGCTTAGGATTTTATGGAT 3232 SEQ ID NO:1090 -10.3 -22.5 67.2 -12.2 0 -3.7
AAAGGGCTTAGGATTTTATG 3235 SEQ ID NO:1091 -10.3 -19.3 59.2 -9 0 -3.8
GAAAGCAATCACAGAAACAA 3492 SEQ ID NO: 1092 -10.3 -16.4 51.3 -6.1 0 -4.1
GGCTATGTGGATAAGGTGTA 3682 SEQ ID NO: 1093 -10.3 -22.9 68.6 -12.6 0 -4.1
AAACTTTTTGAGCACCAACA 3793 SEQ ID NO: 1094 -10.3 -20.3 59.7 -9.5 -0.2 -4.6
AGTAAAAACAGAAGTCAGAA 3893 SEQ ID NO: 1095 -10.3 -15.1 49.7 -4.8 0 -2.9
CTCTTGGTGTTTCCAGCAAT 178 SEQ ID NO: 1096 -10.2 -25 73 -14.8 3.4 -0.9
TTCTCTCTTGTGTGCAGGGC 574 SEQ ID NO: 1097 -10.2 -27.2 81.7 -17 0 -5.3
ATCAAGTGGACATTCCCGAG
730 SEQ ID NO: 1098 -10.2 -24.2 68.2 -13.1 -0.8 -4.3 GATCAAGTGGACATTCCCGA
731 SEQ ID NO:1099 -10.2 -24.8 69.2 -13.7 -0.8 -5.9 TGAGCTGGATCTTCAAGAGG
1476 SEQ ID NO: 1100 -10.2 -22.7 67.8 -12.5 0 -5.1
GGATGCGCCTGATATTCAGC 1581 SEQ ID NO: 1101 -10.2 -26.4 73.7 -14.6 -1.4 -10.6
AGCGCAGTCCCCTCCCGCGA 1916 SEQ ID NO: 1102 -10.2 -36 88 -23.2 -2.6 -8.5
ATCCTATAGCCTCCCCCAGG 2520 SEQ ID NO:1103 -10.2 -31.7 83.4 -20.8 -0.5 -5.2
ATATCCTATAGCCTCCCCCA 2522 SEQ ID NO: 1104 -10.2 -30.2 80.1 -20 0 -4.5
AAACCACTTAAAGCCTCAGG 2555 SEQ ID NO: 1105 -10.2 -22 62.6 -11.8 0 -3.6
GGCAACCGGCCATCATTCTG 2691 SEQ ID NO: 1106 -10.2 -28.2 75.3 -15.5 -2.5 -7.2
CAAAGCAGTTATATCTGGCA 2707 SEQ ID NO: 1107 -10.2 -21.5 64 -10.4 -0.7 -2.8
TCCAAAGCAGTTATATCTGG 2709 SEQ ID NO: 1108 -10.2 -21.4 63.9 -10.4 -0.6 -2.7
TGTCATAACTTCTATCTCTC 2747 SEQ ID NO:1109 -10.2 -20.5 64.7 -10.3 0 -2.4
GAAGTTCAACAAGAAAAGGC 2879 SEQ ID NO:1110 -10.2 -17.3 53.8 -6.4 -0.5 -6.1
3144 AAAGTCTTCATGGAGTTTC -10.2 -20.6 63.7 -9.4 -0.9 -6.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: llll
TCCTTAGAAAACCTAAGTAC
3362 SEQ ID NO: 1112 -10.2 -18.8 57.2 -6.4 -2.2 -5.7 GTGATACAACTTTGGCACGA
3399 SEQ ID NO: 1113 -10.2 -22.3 64.4 -11.4 -0.4 -5.5 ATTACCCTCAGGCTATGTGG
3692 SEQ ID NO: 1114 -10.2 -26 74.2 -15.2 -0.3 -3.6 CCTGCCCCGCCACACCCCCT
233 SEQ ID NO: 1115 -10.1 -40 91.9 -29.9 0 -3 AGTTGCTCATCCTGCCCCGC
243 SEQ ID NO: 1116 -10.1 -32.8 86.5 -22.7 0 -3.6 ACGGAGTTGCTCATCCTGCC
247 SEQ ID NO: 1117 -10.1 -29 79.9 -17.7 -1.1 -5.1 CGTCCATCCGTGAATGATGA
512 SEQ ID NO: 1118 -10.1 -24.6 67.5 -13.3 -1.1 -4.6 AACTACATTGGCGTCTTTCT
590 SEQ ID NO: 1119 -10.1 -22.9 67.3 -12.8 0 -4.6 TCCCACCACCCTGGTATTAT
659 SEQ ID NO: 1120 -10.1 -29 77.5 -17.2 -1.7 -5.7 CCGCTCCACTATTTCCAGTG
1400 SEQ ID NO: 1121 -10.1 -27.9 76.3 -16.8 -0.9 -4.9 CGATCCGCTCCACTATTTCC
1404 SEQ ID NO: 1122 -10.1 -27.8 74.5 -17.7 0 -3.9 GGTGGCATTCTGCTCGATCC
1418 SEQ ID NO: 1123 -10.1 -28.4 79.8 -16.4 -1.9 -7.8 GCTGGATCTTCAAGAGGTCT
1473 SEQ ID NO: 1124 -10.1 -24.6 73.5 -13.3 -1.1 -5 GGGATATGCTGGTGTTCTCA
1653 SEQ ID NO: 1125 -10.1 -25.5 75.6 -15.4 0 -3.6 CCATCCCGACACTTGCGAAA
1690 SEQ ID NO: 1126 -10.1 -26.4 68.5 -16.3 0 -4.3 ATCACAGGAGACCAGTTGTT
1884 SEQ ID NO: 1127 -10.1 -23.9 70.8 -13.2 -0.3 -3.7 AAGCAGTATGGTCAGTGCAA
2258 SEQ ID NO: 1128 -10.1 -23.2 69 -11.5 -1.6 -5.7 TCAACAAGAAAAGGCACTGG
2874 SEQ ID NO: 1129 -10.1 -19.1 56.9 -8.2 -0.6 -4 ATCAAGATCTAGAATTGGTG
2909 SEQ ID NO: 1130 -10.1 -18.4 57.8 -7.8 0 -8 AAAACAGAAGTCAGAAGTGA
3889 SEQ ID NO: 1131 -10.1 -16.7 53.1 -6 -0.3 -3.2 GCCCTCGTCCTGAGCCGCCG
21 SEQ ID NO: 1132 -10 -36.2 88.3 -25.3 -0.8 -5.4 CTTGGTGTTTCCAGCAATCC
176 SEQ ID NO: 1133 -10 -26.1 74.7 -16.1 3.4 -0.9 GCCCCGCCACACCCCCTCCC
230 SEQ ID NO: 1134 -10 -41.5 95 -31.5 0 -2.5 AGCTTATCTTCCAGCCGTCC
337 SEQ ID NO: 1135 -10 -29.2 81.3 -18.3 -0.8 -4.3 GCGCCTGATATTCAGCTCCC
1577 SEQ ID NO: 1136 -10 -29.9 80.6 -18.3 -1.4 -10.6 TTTGGAGTTAGAGCTATTCA
1959 SEQ ID NO: 1137 -10 -21.2 65.8 -10.7 -0.2 -5.1 TCTGGACTTGGTGCTCTGGA
1993 SEQ ID NO: 1138 -10 -26.5 77.5 -16.5 0 -3.6 GAGTACAGGCTCGCCCAGCA
2073 SEQ ID NO: 1139 -10 -30.5 82.8 -18.4 -2.1 -8.5 TTCAGAGAGTGAGCTGGGGA
2301 SEQ ID NO: 1140 -10 -25.1 74.5 -14.4 -0.4 -5.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo TGATACTCTGCTTGCTATTC 2658 SEQ ID NO: 1141 -10 -22.4 68.1 -12.4 0 -4.5
TCCAACCGTTGGCACAGATG 3277 SEQ ID NO: 1142 -10 -25.9 70.7 -14.1 -1.7 -10.6
GAAATAAGACTCAACTGGTT
3439 SEQ ID NO: 1143 -10 -17.9 55.6 -7.9 0 -4.3 GAGAACATATCTTGAAATAA
3452 SEQ ID NO: 1144 -10 -14.7 48.9 -3.9 -0.6 -3.9
TGCAAACATTCCAAAATCTG 3596 SEQ ID NO: 1145 -10 -18.4 55.2 -8.4 0 -4.7
AACTTTTTGAGCACCAACAA 3792 SEQ ID NO: 1146 -10 -20.3 59.7 -9.8 -0.2 -4.6
AGGGCTGACACGAGTTTGTG 559 SEQ ID NO: 1147 -9.9 -24.8 71.6 -13.3 -1.5 -6.7
TAGACCAGGAAGGTGTTGGT
1435 SEQ ID NO: 1148 -9.9 -24.4 71.5 -12.9 -1.5 -6.9 GTAGACCAGGAAGGTGTTGG
1436 SEQ ID NO: 1149 -9.9 -24.4 71.5 -12.9 -1.5 -5.8 GTGTAGACCAGGAAGGTGTT
1438 SEQ ID NO: 1150 -9.9 -24.4 72.3 -12.9 -1.5 -4.5
ATCTGGACTTGGTGCTCTGG 1994 SEQ ID NO: 1151 -9.9 -25.9 76 -16 0 -3.6
TGAGAAACCAATCCAGTGTG 2051 SEQ ID NO: 1152 -9.9 -21.5 62.4 -11.6 0 -3.7
CATGAGTCAGCTCCTGTCGG 2182 SEQ ID NO: 1153 -9.9 -27.2 77.7 -16 -1.2 -6.2
AAGAGATTTGCTCCAAAGCA 2720 SEQ ID NO: 1154 -9.9 -21.6 63.1 -9.3 -2.4 -10.2
ATATTGTGTGTATTAATTCA 2930 SEQ ID NO: 1155 -9.9 -17.4 56.3 -7.5 0 -4.2
GTTGGCACAGATGTTCTCCT 3270 SEQ ID NO: 1156 -9.9 -26.4 77.3 -15.7 -0.6 -6.1
CCTTAGAAAACCTAAGTACA 3361 SEQ ID NO: 1157 -9.9 -19.1 57.1 -7 -2.2 -6.2
TGAAATAAGACTCAACTGGT
3440 SEQ ID NO: 1158 -9.9 -17.8 55.2 -7.9 0 -2.9 AGCTTCGCTTTGGCTAGAAA
3508 SEQ ID NO: 1159 -9.9 -23.7 68.2 -12.3 -1.4 -6.4 AAGCTTCGCTTTGGCTAGAA
3509 SEQ ID NO: 1160 -9.9 -23.7 68.2 -12.3 -1.4 -9.2 CATAAGTTACCACAAACCAT
3748 SEQ ID NO: 1161 -9.9 -20 58.5 -10.1 0.6 -3.8
ACTTTTTGAGCACCAACAAG 3791 SEQ ID NO: 1162 -9.9 -21 61.8 -11.1 2.1 -3.6
CGAGTGTCAACGGCTTGCCC 54 SEQ ID NO: 1163 -9.8 -29 76.9 -18.3 -0.8 -7.4
TCTTGGTGTTTCCAGCAATC 177 SEQ ID NO: 1164 -9.8 -24.5 72.7 -14.7 3.4 -0.9
CACAGATGGTTTGACCTCAG 380 SEQ ID NO: 1165 -9.8 -23.6 69 -12.3 -1.4 -5.2
CAGTTTTCAAAGATACCGCT 535 SEQ ID NO: 1166 -9.8 -21.9 63.5 -12.1 0 -3.1
CCCACCACCCTGGTATTATT 658 SEQ ID NO: 1167 -9.8 -28.7 76.2 -17.2 -1.7 -5.7
CATTGTAGCCAATGCTATTA 1200 SEQ ID NO: 1168 -9.8 -21.7 64.1 -9.6 -2.3 -6.8
CTCATTTTCTTGGCATTGTA 1213 SEQ ID NO: 1169 -9.8 -22.4 68 -12.6 0 -4
1385 CAGTGGCAGAGTCTGGGAAT -9.8 -25 73.1 -14.2 -0.5 -9.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO : 1170
CAGGTGAGCTGGATCTTCAA 1480 SEQ ID NO:1171 -9.8 -24 70.8 -13.3 -0.7 -6.7
GTTTTTCATCCTCCAGCCAT 1706 SEQ ID NO: 1172 -9.8 -27.6 78.3 -17.8 0 -3.2
GGTTTCGTTTTTCATCCTCC 1712 SEQ ID NO: 1173 -9.8 -26.2 76.2 -16.4 0 -2.5
ATGAGTCAGCTCCTGTCGGA 2181 SEQ ID NO: 1174 -9.8 -27.1 77.9 -16 -1.2 -7.2
GCCGGTTTCTGTGTACACAG
2781 SEQ ID NO:1175 -9.8 -26.4 75.4 -13.2 -1.4 -15 TGCCGGTTTCTGTGTACACA
2782 SEQ ID NO: 1176 -26.4 74.9 -14.8 0 -11.7 TGTGTGTATTAATTCAAATC
2926 SEQ ID NO: 1177 -9.8 -16.6 54 -6.8 0 -4.2
AAATCTGAGTCCTCTCCCTG 3103 SEQ ID NO: 1178 -9.8 -25.6 72.8 -14.5 -1.2 -4.9
GAGTTTCAGAGATAGACTTT 3132 SEQ ID NO: 1179 -9.8 -19.9 62.9 -10.1 0 -3.7
CGCTTTGGCTAGAAAGCAAT 3503 SEQ ID NO: 1180 -9.8 -22.3 63.6 -9.2 -3.3 -11
CTGTGTAGCTTTGGGTTTGT
359 SEQ ID NO: 1181 -9.7 -24.9 75.4 -15.2 0 -4.6 AACCTCACAGATGGTTTGAC
385 SEQ ID NO:1182 -9.7 -22.4 65.9 -11.5 -1.1 -5.3
TAAACCTCACAGATGGTTTG 387 SEQ ID NO -.1183 -9.7 -20.6 61.4 -8.5 -2.4 -7.9
GAGTTTGTGCAGCCAGTTTT 548 SEQ ID NO: 1184 -9.7 -25.7 76.3 -16 0 -5.3
CAATTTCTCCCATGTTCTTG 1326 SEQ ID NO -.1185 -9.7 -23.3 68.1 -13.6 0 -4.3
CTGGGTTTCCCCAGACTTCA 1604 SEQ ID NO: 1186 -9.7 -28.7 79.7 -15 -4 -9.6
TAGGAAAGCCAATGATGTGT 2323 SEQ ID NO-.1187 -9.7 -20.9 61.6 -10 -1.1 -3.5
GTTCAATAGACATTTGCTCA 2364 SEQ ID NO: 1188 -9.7 -20.9 63.8 -11.2 0 -4
AAATCCCAACTCCACTGGGT 2440 SEQ ID NO: 1189 -9.7 -25.9 70.5 -14.1 -2.1 -6.
TCAGGGTCCCTAATGCTTAT 2540 SEQ ID NO: 1190 -9.7 -25.5 73 -15.3 -0.1 -6
AAGCAGTTATATCTGGCAAC 2705 SEQ ID NO: 1191 -9.7 -21 63.4 -10.4 -0.7 -2
TCACGTCTGGGGCATATTGG 3179 SEQ ID NO: 1192 -9.7 -25.7 73.1 -16 0 -4
ATATCTTGAAATAAGACTCA 3446 SEQ ID NO: 1193 -9.7 -16.1 52.3 -5 -1.3 -5
AGAACATATCTTGAAATAAG 3451 SEQ ID NO:1194 -9.7 -14.1 47.8 -3.9 -0.1 -3
CATGCTTCATGTACACAACT 3731 SEQ ID NO: 1195 -9.7 -21.7 64.3 -11.1 -0.8 -6
GCAGAGGAACGGAGTTGCTC 255 SEQ ID NO: 1196 -9.6 -25.4 72.7 -14 -1.8 -8
TCTGTGTAGCTTTGGGTTTG
360 SEQ ID NO: 1197 -9.6 -24.1 73.5 -14.5 0 -4 CTCAGTCTGTGTAGCTTTGG
365 SEQ ID NO:1198 -9.6 -24.7 75.5 -15.1 0 _4
AAGTGGACATTCCCGAGAGA 727 SEQ ID NO: 1199 -9.6 -24.3 68.4 -13.8 -0.8 -4.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CCCGGGTTTTTAGGTACATT
1251 SEQ ID NO: 1200 -9.6 -25.6 72 -15.3 0 -9
AGTGGCAGAGTCTGGGAATC
1384 SEQ ID NO: 1201 -9.6 -24.7 73.7 -14.4 0.2 -8.9
CAAAATGTCAGTTTCCGCTG
1621 SEQ ID NO: 1202 -9.6 -22.2 63.9 -11.7 -0.8 -4.2
GTGGGACTGGTTTCGTTTTT
1720 SEQ ID NO: 1203 -9.6 -24.7 72.9 -15.1 0 -3.2
CCACAGTGGGACTGGTTTCG
1725 SEQ ID NO: 1204 -9.6 -26.7 74.8 -15 -2.1 -8.3
CTGGACTTGGTGCTCTGGAG
1992 SEQ ID NO: 1205 -9.6 -26.1 76 -16.5 0 -5.7
ATCCCAACTCCACTGGGTTC
2438 SEQ ID NO: 1206 -9.6 -27.8 77.1 -16.1 -2.1 -6.8
TCATAACTTCTATCTCTCTA
2745 SEQ ID NO: 1207 -9.6 -19.9 62.9 -10.3 0 -1.2
TCAGATATTGTGTGTATTAA
2934 SEQ ID NO: 1208 -9.6 -17.9 57.5 -8.3 0 -2.8
TCTCACGTCTGGGGCATATT
3181 SEQ ID NO: 1209 -9.6 -25.8 74.3 -16.2 0 -4.7
AAAAGGGCTTAGGATTTTAT
3236 SEQ ID NO: 1210 -9.6 -18.6 57.4 -9 0 -3.8
GAACATATCTTGAAATAAGA
3450 SEQ ID NO: 1211 -9.6 -14.7 48.9 -3.9 -1.1 -3.7
GTGGATAAGGTGTAACTGAC
3676 SEQ ID NO: 1212 -9.6 -20.5 62.5 -10.1 -0.6 -2.6
GCTTCATGTACACAACTATT
3728 SEQ ID NO: 1213 -9.6 -20.8 62.9 -11.2 0 -6.7
AAGTTACCACAAACCATGCT
3745 SEQ ID NO: 1214 -9.6 -22.3 63.3 -12.2 -0.2 -4.4
ACATAAGTTACCACAAACCA
3749 SEQ ID NO: 1215 -9.6 -20.2 59 -10.1 -0.2 -3.8
AGACCCTTCTCTCGGCCAGG
147 SEQ ID NO: 1216 -9.5 -30.5 82.6 -21 0 -7.2
CCCGCCACACCCCCTCCCAA
228 SEQ ID NO: 1217 -9.5 -37.7 86.9 -28.2 0 -2.6
CAGTCTGTGTAGCTTTGGGT
363 SEQ ID NO: 1218 -9.5 -25.8 78.2 -16.3 0 -4.6
ACCACCCTGGTATTATTGAC
655 SEQ ID NO: 1219 -9.5 -24.8 70 -13.7 -1.5 -5.3
CAGCCAGTCGAGCATCCTGG
689 SEQ ID NO: 1220 -9.5 -29.2 79.9 -17.8 -1.9 -8.4
CACTATTTCCAGTGGCAGAG
1394 SEQ ID NO: 1221 -9.5 -24.3 71.2 -13.9 -0.8 -7.4
CTGATATTCAGCTCCCGTCC
1573 SEQ ID NO: 1222 -9.5 -27.9 77.2 -17.4 -0.9 -4.7
TATGCTGGTGTTCTCAGGGT
1649 SEQ ID NO: 1223 -9.5 -26.1 78.3 -15.9 -0.5 -5.2
CATCCCGACACTTGCGAAAC
1689 SEQ ID NO: 1224 -9.5 -24.6 65.9 -15.1 0 -4.1
AGTGGGACTGGTTTCGTTTT
1721 SEQ ID NO: 1225 -9.5 -24.6 72.8 -15.1 0 -3.3
TAGCAGCGCAGTCCCCTCCC
1920 SEQ ID NO: 1226 -9.5 -34.2 89.2 -23.8 -0.7 -7.7
TAAGCAGTATGGTCAGTGCA
2259 SEQ ID NO: 1227 -9.5 -23.6 70.8 -12.5 -1.6 -5.5
AGAGAGTGAGCTGGGGAGCA
2298 SEQ ID NO: 1228 -9.5 -26.4 77.3 -15.3 -1.6 -5.5
2436 CCCAACTCCACTGGGTTCCA -9.5 -30.1 79.8 -19 -1.5 -6.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO : 1229
CATCATTCTGGCCCCAGCAT 2681 SEQ ID NO: 1230 -29.4 79.7 -18.3 -1.5 -7.8
TGGTGGGAACTGGCTGCAAA 3162 SEQ ID NO: 1231 -9 -24.8 69.3 -13.9 -1.2 -9.6
AAAATTACCCTCAGGCTATG 3695 SEQ ID NO: 1232 -9 -21.5 62.1 -11.4 -0.3 -4.9
TGCTTCATGTACACAACTAT 3729 SEQ ID NO: 1233 -9 -20.7 62.5 -11.2 0 -6.7
AAGTCAGAAGTGACCAGGAT 3882 SEQ ID NO: 1234 -9 -22 65.3 -10.1 -2.4 -6.3
GGGTTTGTGGAGCTTATCTT
347 SEQ ID NO: 1235 -9 -24.7 74.4 -15.3 0 -5.2 TTAAACCTCACAGATGGTTT
388 SEQ ID NO: 1236 -9 -20.7 61.8 -9.1 -2.2 -7.5
TTCTAAGGGCTGGCTGTGGC 458 SEQ ID NO: 1237 -27.6 79.3 -17.5 -0.5 -6
GTGTCCCACCACCCTGGTAT 662 SEQ ID NO: 1238 -31.6 84.3 -20.5 -1.7 -5.7
TGATCCCAAGACATCGTTGA 1013 SEQ ID NO: 1239 -23.6 66.6 -14.2 0 -4.7
CCACTATTTCCAGTGGCAGA 1395 SEQ ID NO: 1240 -26.3 74.6 -14.5 -2.4 -7.6
GCTCCACTATTTCCAGTGGC 1398 SEQ ID NO: 1241 -28.1 80.1 -15.7 -3 -9.6
TCCTATAGCCTCCCCCAGGC 2519 SEQ ID NO: 1242 -33.5 87.7 -21.3 -2.8 -8.9
TATCTCTCTAAACAGAAGAG 2735 SEQ ID NO: 1243 -17.3 55.4 -7 -0.7 -4.2
TTACATATGTCATAACTTCT 2754 SEQ ID NO: 1244 -18.2 57.8 -8.3 0 -8.2
ACAATGTCCTTAGAAAACCT 3368 SEQ ID NO: 1245 -20.1 59.2 -10.7 0 -4
TGTGGATAAGGTGTAACTGA 3677 SEQ ID NO: 1246 -20.3 61.8 -10.1 -0.6 -2.6
TAGTAAAAACAGAAGTCAGA 3894 SEQ ID NO: 1247 -15.5 50.8 -6.1 0 -2.9
CGGCCGGTAAGACCCTTCTC 156 SEQ ID NO: 1248 -29.5 77.6 -19.1 -0.2 -10.2
TGGGTTTGTGGAGCTTATCT
348 SEQ ID NO: 1249 -24.6 73.8 -15.3 0 -5.2 AGTCTGTGTAGCTTTGGGTT
362 SEQ ID NO: 1250 -25.2 77.5 -15.9 0 -4.6
TCTCTCTTGTGTGCAGGGCT
573 SEQ ID NO: 1251 -28 83.5 -18.1 -0.3 -5.3
CAGTCGAGCATCCTGGCAAT
685 SEQ ID NO: 1252 -26.5 73.6 -16.3 -0.8 -5.6 CCAGTCGAGCATCCTGGCAA
686 SEQ ID NO: 1253 -28.5 77.1 -17.7 -1.4 -7.4 ATTCACCAGAGAGTCAACAA
1094 SEQ ID NO: 1254 -21.1 62.9 -11.8 0 -4.8
CTGATTCACCAGAGAGTCAA 1097 SEQ ID NO: 1255 -22.4 66.4 -12.4 -0.5 -5.3
TGTAGACCAGGAAGGTGTTG 1437 SEQ ID NO: 1256 -23.2 68.6 -12.9 -0.9 -4.5
CCAGTGCTCCAGGGTCAAGG 1863 SEQ ID NO: 1257 -28.9 80.8 -19.6 0 -3.6
GCGCAGTCCCCTCCCGCGAG 1915 SEQ ID NO: 1258 -36 88 -24.9 -1.8 -8.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
ACCAATCCAGTGTGCACGAG 2045 SEQ ID NO: 1259 -9.3 -25.8 71.3 -15.6 0 -9.8
TGGTCAGTGCAACCCATGAG 2250 SEQ ID NO: 1260 -9.3 -26 73.1 -15.9 -0.6 -7.4
AGGCCCCAGGTGCCTTTCCC 2503 SEQ ID NO: 1261 -9.3 -35.4 91.8 -24 -2.1 -9.8
ATGCTTATATCCTATAGCCT 2528 SEQ ID NO: 1262 -9.3 -23.6 69.1 -13.6 -0.5 -5
TAAACAGAAGAGATTTGCTC 2727 SEQ ID NO: 1263 -9.3 -17.6 55.5 -7.4 -0.7 -5.7
ATCTCTCTAAACAGAAGAGA 2734 SEQ ID NO: 1264 -9.3 -18.2 57.3 -7 -1.9 -6.4
TTTGCCTCCAGGAAATCTGA 3115 SEQ ID NO: 1265 -9.3 -24.3 68.8 -13.9 -1 -5
AGTCCAACCGTTGGCACAGA 3279 SEQ ID NO: 1266 -9.3 -27.1 74.3 -15.2 -2.6 -11.5
CTCCTGCTTGGTGTCACACT 3323 SEQ ID NO: 1267 -9.3 -27.7 79.7 -17.2 -1.1 -6.7
AAAGAAAATCATTCTTCCTC 3342 SEQ ID NO:1268 -9.3 -17.4 54.5 -5.6 -2.5 -6.5
AAAGCAATCACAGAAACAAG 3491 SEQ ID NO: 1269 -9.3 -15.8 50.3 -6.5 0 -4.1
ATGAATTTTGTGTTTAGGCT 3650 SEQ ID NO: 1270 -9.3 -20.4 62.9 -11.1 0 -3.7
GGCTCCCCGCAGCAAAGCAA 297 SEQ ID NO: 1271 -9.2 -30.5 77.9 -19.4 -1.9 -6.2
GCCTGCATACCCGGCCACGT 770 SEQ ID NO: 1272 -9.2 -33.8 84 -23.7 -0.7 -7.2
TGTAGGTGTGGAGGACATCC 900 SEQ ID NO: 1273 -9.2 -25.4 74.8 -15.2 -0.9 -4.7
ATTGGGGTAGATGTCAATGT 965 SEQ ID NO: 1274 -9.2 -22 66.5 -12.8 0 -3.8
TTCTCCCATGTTCTTGTAAC 1322 SEQ ID NO: 1275 -9.2 -23.6 69.9 -13.9 -0.1 -4.3
TCCACAGGTTGTACCAAGAC 1515 SEQ ID NO: 1276 -9.2 -24.4 70.2 -13.5 -1.7 -5.3
AGAAATCCCAACTCCACTGG 2442 SEQ ID NO: 1277 -9.2 -24.1 66.6 -14.9 0 -4.1
TATTCTGCTAGTGATCAAAC 2643 SEQ ID NO: 1278 -9.2 -19.2 59.8 -10 0 -6.7
TCTCTCTAAACAGAAGAGAT 2733 SEQ ID NO: 1279 -9.2 -18.2 57.3 -7 -2 -6.5
ATTGGTGGGAACTGGCTGCA 3164 SEQ ID NO: 1280 -9.2 -26.3 74.2 -15.7 -1.2 -9.6
CTCACGTCTGGGGCATATTG 3180 SEQ ID NO: 1281 -9.2 -25.4 72.5 -16.2 0 -4.7
TGTTTGTCTCACGTCTGGGG 3187 SEQ ID NO: 1282 -9.2 -26.1 76.5 -16.9 0 -4.6
ATGGCTCTATATAAAAAAAA 3214 SEQ ID NO: 1283 -9.2 -13.4 45.9 -4.2 0 -3.7
TTAACAGTGATACAACTTTG 3405 SEQ ID NO: 1284 -9.2 -17 54.2 -7.8 0 -4.6
TCTTGAAATAAGACTCAACT
3443 SEQ ID NO: 1285 -9.2 -16.8 53.4 -6.7 -0.8 -6 ATCTTGAAATAAGACTCAAC
3444 SEQ ID NO: 1286 -9.2 -15.9 51.6 -5.3 -1.3 -6 CCCTCACATAAGTTACCACA
3754 SEQ ID NO: 1287 -9.2 -24.7 69.1 -15 -0.2 -3.8
254 CAGAGGAACGGAGTTGCTCA -9.1 -24.3 69.6 -12.8 -2.4 -10.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular isition oligo binding ation Duplex ture oligo oligo SEQ ID NO -.1288
AAGGGCTGGCTGTGGCCGAC
454 SEQ ID NO: 1289 -9.1 -30.1 80.8 -17.7 -3.3 -11 TGATTCACCAGAGAGTCAAC
1096 SEQ ID NO: 1290 -9.1 -21.7 65 -11.9 -0.4 -4.8 TCCTCCTCGGTGTAGACCAG
1447 SEQ ID NO: 1291 -9.1 -28.6 79.6 -17.7 -1.8 -3.1 CGAAACTCCTTCCACAGGTT
1525 SEQ ID NO: 1292 -9.1 -25 69.2 -15 -0.8 -5.2 CACACAAATCTGGACTTGGT
2001 SEQ ID NO: 1293 -9.1 -21.8 63.8 -12.7 0 -5.6 TGAGTCAGCTCCTGTCGGAA
2180 SEQ ID NO: 1294 -9.1 -26.4 75.4 -16 -1.2 -6.7 TATAAGTCTAGGCATGTGGC
3064 SEQ ID NO: 1295 -9.1 -22.8 68.8 -13 -0.4 -5.3 GGAAATCTGAGTCCTCTCCC
3105 SEQ ID NO: 1296 -9.1 -26.5 74.9 -16.1 -1.2 -6.9 GTCTCACGTCTGGGGCATAT
3182 SEQ ID NO: 1297 -9.1 -26.9 77.5 -17.3 -0.1 -4.7 CCTCTCCTGCTTGGTGTCAC
3326 SEQ ID NO: 1298 -9.1 -29.2 83.6 -20.1 0.5 -4.1 TTCCTCTCCTGCTTGGTGTC
3328 SEQ ID NO-.1299 -9.1 -28.8 84.3 -19.2 -0.1 -4.1 TGGATAAGGTGTAACTGACA
3675 SEQ ID NO: 1300 -9.1 -20 60.6 -10.1 -0.6 -3.8 GACCCTTCTCTCGGCCAGGG
146 SEQ ID NO: 1301 -9 -31.7 84.7 -21 -1.7 -10 TTGCTCATCCTGCCCCGCCA
241 SEQ ID NO: 1302 -9 -34.3 86.8 -25.3 0 -3.6 GCTCCCCGCAGCAAAGCAAT
296 SEQ ID NO: 1303 -9 -29.3 75.6 -19.4 -0.7 -5.6 ACCTCACAGATGGTTTGACC
384 SEQ ID NO: 1304 -9 -25.1 71.8 -15.4 -0.5 -4.5 CAACTACATTGGCGTCTTTC
591 SEQ ID NO: 1305 -9 -22.7 66.5 -13.7 0 -4.6 TCCTGCAGCCAGTCGAGCAT
694 SEQ ID NO: 1306 -9 -29.8 81.7 -19.9 -0.8 -8.1 TCACGAAGTTGCCTGCATAC
780 SEQ ID NO: 1307 -9 -24.4 69 -14.7 -0.4 -6.8 CTGCCCGGGTTTTTAGGTAC
1254 SEQ ID NO: 1308 -9 -27.5 76.6 -17.3 0 -10.3 TCCGCTCCACTATTTCCAGT
1401 SEQ ID NO: 1309 -9 -28.3 78.2 -19.3 0 -3.1 AACTCCTTCCACAGGTTGTA
1522 SEQ ID NO: 1310 -9 -25.2 72.8 -15.3 -0.8 -4.9 TTTCCCCAGACTTCACCCGG
1599 SEQ ID NO: 1311 -9 -30.4 79.1 -21.4 0 -5.8 AGCAGTAACTTTCCTCCATG
1811 SEQ ID NO: 1312 -9 -24.4 70.8 -15.4 0 -4.1 TACACACAAATCTGGACTTG
2003 SEQ ID NO: 1313 -9 -19.3 58.4 -10.3 0 -5.1 GGCCTGCCATCCTGACATGA
2197 SEQ ID NO: 1314 -9 -29.8 79.9 -20.3 0 -7.5 ATGGCTAAGACGTAAGCAGT
2271 SEQ ID NO: 1315 -9 -22.4 65.4 -11.6 -1.8 -8.2 CAGGGTCCCTAATGCTTATA
2539 SEQ ID NO: 1316 -9 -24.8 70.8 -15.3 -0.1 -6.4 TACATATGTCATAACTTCTA
2753 SEQ ID NO: 1317 -9 -17.8 56.8 -8.3 0 -8.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo inding ation Duplex ture oligo oligo
AGAAGTTTAACAGTGATACA 3411 SEQ ID NO: 1318 -9 -17.6 56 -8.6 0 -4.6
AACATATCTTGAAATAAGAC 3449 SEQ ID NO: 1319 -9 -14.3 48.1 -3.9 -1.3 -4
TGTGTTTAGGCTCGGGTCCT 3642 SEQ ID NO: 1320 -9 -28.3 81.2 -18.8 -0.2 -7
CCCCTCACATAAGTTACCAC 3755 SEQ ID NO -.1321 -9 -26 71.4 -17 0 -3.8
GAAGTGACCAGGATGTACAG 3876 SEQ ID NO: 1322 -9 -22.2 65.6 -13.2 0 -6.7
TGCAAAGCTTCCATTAGTAA 3908 SEQ ID NO: 1323 -9 -21 62.3 -11.4 -0.3 -7
GGTGTTTCCAGCAATCCCGG 173 SEQ ID NO: 1324 -8.9 -29.1 78.4 -19.6 -0.3 -6.4
CGCCACACCCCCTCCCAAGA 226 SEQ ID NO: 1325 -8.9 -34.3 82.7 -25.4 0 -2.6
GTTTGTGGAGCTTATCTTCC 345 SEQ ID NO: 1326 -8.9 -24.7 74.5 -15.3 -0.1 -5.2
GTTTGTGCAGCCAGTTTTCA 546 SEQ ID NO: 1327 -8.9 -26.2 77.5 -17.3 0 -4.8
TCCGTGTAAAGCTGGTGGGC 631 SEQ ID NO: 1328 -8.9 -27.2 75.7 -17.6 -0.4 -5.1
AAACCTGTGATTCGGCCCAC 808 SEQ ID NO: 1329 -8.9 -26.7 71.3 -17.3 -0.1 -6.6
GGCCCCTTCAAACATGGGCC 839 SEQ ID NO: 1330 -8.9 -30.8 79.6 -18 -3.9 -10.4
CTCTGAAAGGCATGCCTGCC 1269 SEQ ID NO: 1331 -8.9 -27.6 75.2 -15.2 -3.2 -14.8
GCTCGATCCGCTCCACTATT 1407 SEQ ID NO: 1332 -8.9 -28.4 76.7 -19.5 0 -4.8
CCACAGGTTGTACCAAGACT 1514 SEQ ID NO: 1333 -8.9 -24.9 70.5 -15 -0.9 -4.2
AAACTCCTTCCACAGGTTGT 1523 SEQ ID NO: 1334 -8.9 -24.8 71 -15.2 -0.5 -5.4
GCGAAACTCCTTCCACAGGT 1526 SEQ ID NO: 1335 -8.9 -26.7 72.9 -16.9 -0.8 -5
AGCTCCCGTCCGGGGTTGCG 1564 SEQ ID NO: 1336 -8.9 -33.8 86 -21.1 -3.8 -11.8
GGACTGGTTTCGTTTTTCAT 1717 SEQ ID NO: 1337 -8.9 -23.4 69.7 -14.5 0 -3.3
AGGAAGTCTTGCTGCCTTGC 1779 SEQ ID NO: 1338 -8.9 -27 77.6 -18.1 0 -5.4
TGGACTTGGTGCTCTGGAGG 1991 SEQ ID NO: 1339 -8.9 -26.4 76.7 -17.5 0 -6.4
AGCTAGGGCCCGAGCAAGAT 2221 SEQ ID NO: 1340 -8.9 -28.4 76.6 -17.1 -1.7 -12.8
ATGATGTGTGCTTCAGAGAG 2312 SEQ ID NO: 1341 -8.9 -22.1 67.6 -13.2 0 -3.7
CTCTCTAAACAGAAGAGATT 2732 SEQ ID NO: 1342 -8.9 -17.9 56.3 -7 -2 -6.5
GCAGGTGCCGGTTTCTGTGT 2787 SEQ ID NO: 1343 -8.9 -29.8 84.4 -20.3 -0.2 -8.3
ATAAGTCTAGGCATGTGGCT 3063 SEQ ID NO: 1344 -8.9 -24 71.4 -13.8 -1.2 -6.1
GGTGGGAACTGGCTGCAAAA 3161 SEQ ID NO: 1345 -8.9 -24.1 67.3 -13.9 -1.2 -7.6
CCTCACATAAGTTACCACAA 3753 SEQ ID NO: 1346 -8.9 -22 63.5 -12.6 -0.2 -3.8
3874 AGTGACCAGGATGTACAGCC -8.9 -26.1 74.6 -17.2 0 -5.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1347
GCAAAGCTTCCATTAGTAAA
3907 SEQ ID NO: 1348 -8.9 -20.3 60.4 -11.4 0 -7 GTTAAACCTCACAGATGGTT
389 SEQ ID NO: 1349 -8.8 -21.8 64.6 -11.5 -1.4 -5.9 GCCAGTCGAGCATCCTGGCA
687 SEQ ID NO: 1350 -8.8 -31 83.9 -17.7 -4.5 -13.6 CAAGTGGACATTCCCGAGAG
728 SEQ ID NO: 1351 -8.8 -24.4 68.2 -15.1 -0.1 -4.2 CATTGGGGTAGATGTCAATG
966 SEQ ID NO: 1352 -8.8 -21.5 64.4 -11.3 -1.3 -5.2 AGCTGGATCTTCAAGAGGTC
1474 SEQ ID NO: 1353 -8.8 -23.7 71.7 -14.9 0.1 -4.6 TGCGGGGTTGAGACAGGTAG
1548 SEQ ID NO: 1354 -8.8 -25.7 73.7 -16.2 -0.5 -4.5 GGTCTTCTGTACAAAATGTC
1632 SEQ ID NO: 1355 -8.8 -20.4 62.9 -11.6 0 -6.1 CACAGTGGGACTGGTTTCGT
1724 SEQ ID NO: 1356 -8.8 -25.9 74.6 -15 -2.1 -6.9 CAGCAGTAACTTTCCTCCAT
1812 SEQ ID NO: 1357 -8.8 -25.1 72 -16.3 0 -4.1 AGTCCCCTCCCGCGAGGAGT
1911 SEQ ID NO: 1358 -8.8 -33.9 87.1 -22.2 -2.5 -13.6 TGAGCTGGGGAGCAGGACGG
2292 SEQ ID NO: 1359 -8.8 -28 77.3 -17.6 -1.6 -6.4 GTGAGCTGGGGAGCAGGACG
2293 SEQ ID NO: 1360 -8.8 -28 78.2 -17.6 -1.6 -5.9 AGGAAAGCCAATGATGTGTG
2322 SEQ ID NO: 1361 -8.8 -21.2 62 -11.2 -1.1 -3.5 AAGTGTTCAATAGACATTTG
2368 SEQ ID NO: 1362 -8.8 -17.6 56.1 -8.8 0 -4.4 AGGGTCCCTAATGCTTATAT
2538 SEQ ID NO: 1363 -8.8 -24.1 69.6 -15.3 0 -6.1 CAGTTATATCTGGCAACCGG
2702 SEQ ID NO: 1364 -8.8 -23.9 67.6 -14.6 -0.2 -6.6 AAAGCAGTTATATCTGGCAA
2706 SEQ ID NO: 1365 -8.8 -20.1 60.7 -10.4 -0.7 -2.8 TTCTATCTCTCTAAACAGAA
2738 SEQ ID NO: 1366 -8.8 -18.1 57.4 -9.3 0 -3 TATTGTGTGTATTAATTCAA
2929 SEQ ID NO: 1367 -8.8 -16.7 54.3 -7.9 0 -4.2 ATGTGGATAAGGTGTAACTG
3678 SEQ ID NO: 1368 -8.8 -19.7 60.5 -10.1 -0.6 -2.6 TCACATAAGTTACCACAAAC
3751 SEQ ID NO: 1369 -8.8 -18.6 56.7 -9.3 -0.2 -3.3 TAAGACCCTTCTCTCGGCCA
149 SEQ ID NO: 1370 -8.7 -28.3 76.7 -19.1 -0.2 -7.4 CCGTCCCTCTGGACCAAAAG
323 SEQ ID NO: 1371 -8.7 -27.2 71.4 -15.8 -2.7 -6.6 ATACCCGGCCACGTGCGCTC
764 SEQ ID NO: 1372 -8.7 -32.3 81.2 -21.7 -1.3 -11.7 AACCTGTGATTCGGCCCACC
807 SEQ ID NO: 1373 -8.7 -29.4 76.8 -20.7 0.1 -6.3 TCAATTTCTCCCATGTTCTT
1327 SEQ ID NO: 1374 -8.7 -23.7 69.8 -15 0 -4.3 TTGGTGGCATTCTGCTCGAT
1420 SEQ ID NO: 1375 -8.7 -26.1 74.6 -15.5 -1.9 -7.8 CCAGGTGAGCTGGATCTTCA
1481 SEQ ID NO: 1376 -8.7 -26.7 77 -15.5 -2.5 -7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CGCCTGATATTCAGCTCCCG 1576 SEQ ID NO: 1377 -8.7 -28.9 76.2 -18.7 -1.4 -6.2
TCCTCCAGCCATCCCGACAC 1698 SEQ ID NO: 1378 -8.7 -31.8 82.2 -23.1 0 -3.2
CTGCCTTGCTGGCAAGACTT 1768 SEQ ID NO: 1379 -8.7 -27.2 75.7 -15.2 -3.3 -12.7
GGTCCTCAGCAGTAACTTTC 1818 SEQ ID NO: 1380 -8.7 -25.2 75.1 -16.5 0 -4.1
GGTGGGTCCTCAGCAGTAAC 1822 SEQ ID NO: 1381 -8.7 -27.3 79.5 -18.6 5 -4.1
GGCTAAGACGTAAGCAGTAT
2269 SEQ ID NO: 1382 -8.7 -22.1 65 -11.6 -1.8 -8.2 TGGCTAAGACGTAAGCAGTA
2270 SEQ ID NO: 1383 -8.7 -22.1 64.9 -11.6 -1.8 -8.2 CTGGCAACCGGCCATCATTC
2693 SEQ ID NO:1384 -8.7 -28.2 75.3 -16.2 -3.3 -8 TCTGGCAACCGGCCATCATT
2694 SEQ ID NO: 1385 -8.7 -28.2 75.3 -16.2 -3.3 -8 TTGTGTTTAGGCTCGGGTCC
3643 SEQ ID NO: 1386 -8.7 -27.5 79.6 -18.8 0 -5.4
ACACATCAATGAATTTTGTG 3658 SEQ ID NO: 1387 -8.7 -17.6 55.2 -7.6 -1.2 -8.6
AGTTACCACAAACCATGCTT 3744 SEQ ID NO: 1388 -8.7 -23.1 65.6 -13.9 -0.2 -4.4
ATAAGTTACCACAAACCATG 3747 SEQ ID NO: 1389 -8.7 -19.3 57.3 -10.1 -0.2 -4.2
ACCCCTCACATAAGTTACCA 3756 SEQ ID NO: 1390 -8.7 -26 71.4 -17.3 0 -3.8
TTTTGAGCACCAACAAGACA 3788 SEQ ID NO:1391 -8.7 -21.3 62 -12.1 -0.2 -4.6
AAGTGACCAGGATGTACAGC 3875 SEQ ID NO: 1392 -8.7 -23.4 68.5 -14.7 0 -1.8
GGTTTGTGGAGCTTATCTTC 346 SEQ ID NO: 1393 -8.6 -23.9 73.4 -15.3 0 -5.2
CTCTGGGTCCTTGGAGGTGC
413 SEQ ID NO: 1394 -8.6 -29.2 84.2 -19.8 -0.6 -5 GCTCTGGGTCCTTGGAGGTG
414 SEQ ID NO: 1395 -8.6 -29.2 84.2 -19.8 -0.6 -5.2 TGCTCTGGGTCCTTGGAGGT
415 SEQ ID NO: 1396 -8.6 -29.2 84.2 -19.8 -0.6 -5.2 CTTGTGTGCAGGGCTGACAC
568 SEQ ID NO: 1397 -8.6 -26.7 77.1 -16.5 -1.5 -10.3
GGCATCTGAATACCAATGCT 937 SEQ ID NO:1398 -8.6 -23.5 66.7 -11.9 -3 -7.4
GCCCGGGTTTTTAGGTACAT 1252 SEQ ID NO: 1399 -8.6 -27.3 75.9 -17.5 0 -10.3
GAGTCTGGGAATCTGCATTA 1377 SEQ ID NO: 1400 -8.6 -23 68.7 -14.4 0 -4.9
GTGGCAGAGTCTGGGAATCT 1383 SEQ ID NO: 1401 -8.6 -25.6 75.5 -16 -0.6 -9.6
TCCACTATTTCCAGTGGCAG 1396 SEQ ID NO: 1402 -8.6 -26.1 75 -14.5 -3 -8.7
TCAGTTTCCGCTGGGTTTCC 1614 SEQ ID NO: 1403 -8.6 -28.6 81 -18.7 -1.2 -5.2
AAATGTCAGTTTCCGCTGGG 1619 SEQ ID NO: 1404 -8.6 -24.6 69.8 -14.7 -1.2 -5.2
AGAGCTCCCGGCCTGGGGAT 1668 SEQ ID NO: 1405 -8.6 -32.6 85.4 -21.6 -2.1 -12.4
1934 GGCAGCAAGAGCTATAGCAG -8.6 -24.7 71.9 -13.4 -2.7 -11 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1406
TTGGAGTTAGAGCTATTCAA
1958 SEQ ID NO: 1407 -8.6 -20.4 63.1 -11.3 -0.2 -5.1 CAGCAACTGAGAAACCAATC
2058 SEQ ID NO: 1408 -8.6 -20 58.7 -11.4 0 -4.1 TCTTTTGAAAAGTGTAAGTG
2956 SEQ ID NO: 1409 -8.6 -16.7 54 -7.2 -0.8 -5.9 ATCTTTTGAAAAGTGTAAGT
2957 SEQ ID NO: 1410 -8.6 -16.7 54.1 -7.2 -0.8 -5.9 CACCACTAACTAGTATATAA
3079 SEQ ID NO: 1411 -8.6 -18.1 56.1 -9.5 0 -6.3 TCCTCTCCTGCTTGGTGTCA
3327 SEQ ID NO: 1412 -8.6 -29.4 84.9 -20.3 -0.1 -4.1 AGCAATCACAGAAACAAGAG
3489 SEQ ID NO: 1413 -8.6 -17.8 54.9 -9.2 0 -4.1 TCAGTCTGTGTAGCTTTGGG
364 SEQ ID NO: 1414 -8.5 -25 76.3 -16.5 0 -4.6 TCAAAGATACCGCTCATCGT
529 SEQ ID NO: 1415 -8.5 -23.2 65.3 -14.2 -0.2 -3.1 CGCATCCGTGTAAAGCTGGT
635 SEQ ID NO: 1416 -8.5 -26.3 71.8 -17.8 0 -5.1 CCCGGCCACGTGCGCTCCGA
761 SEQ ID NO: 1417 -8.5 -35.8 84.7 -25.4 -1.3 -11.7 ACCCGGCCACGTGCGCTCCG
762 SEQ ID NO: 1418 -8.5 -35.4 84.1 -25.4 -0.7 -10.9 GCCGAAGGAACGCGTGTAGG
914 SEQ ID NO: 1419 -8.5 -26.5 70.2 -15.3 -2.1 -13.2 AGGCATCTGAATACCAATGC
938 SEQ ID NO: 1420 -8.5 -22.6 65.1 -11.9 -2.2 -6.5 CTGAGGCTCAAAGCAGGCTG
2150 SEQ ID NO: 1421 -8.5 -25.5 72.6 -15.7 -1.2 -4.9 ATTTTAAGTGTTCAATAGAC
2373 SEQ ID NO: 1422 -8.5 -16.7 54.6 -8.2 0 -2.6 ATGATACTCTGCTTGCTATT
2659 SEQ ID NO: 1423 -8.5 -22 66.5 -13.5 0 -4.5 GCAGTTATATCTGGCAACCG
2703 SEQ ID NO: 1424 -8.5 -24.5 69.2 -15.2 -0.6 -2.7 CATAACTTCTATCTCTCTAA
2744 SEQ ID NO: 1425 -8.5 -18.8 59.3 -10.3 0 -1.2 AGGGCTTAGGATTTTATGGA
3233 SEQ ID NO: 1426 -8.5 -22.5 67.5 -14 0 -3.7 TTGAGAACATATCTTGAAAT
3454 SEQ ID NO: 1427 -8.5 -15.8 51.3 -6.5 -0.6 -3.9 TCATTATGTATATGCAAACA
3608 SEQ ID NO: 1428 -8.5 -17.5 55 -9 0 -6.2 TATGTGGATAAGGTGTAACT
3679 SEQ ID NO: 1429 -8.5 -19.4 60 -10.1 -0.6 -2.6 CCTCTTGGTGTTTCCAGCAA
179 SEQ ID NO: 1430 -8.4 -27 76.8 -18.6 3.6 -0.6 TCATCCTGCCCCGCCACACC
237 SEQ ID NO: 1431 -8.4 -34.6 85.9 -26.2 0 -3 CAGCAAAGCAATAGCAGAGG
288 SEQ ID NO: 1432 -8.4 -21.6 63.1 -11.5 -1.7 -6.6 AGCCAGTCGAGCATCCTGGC
688 SEQ ID NO: 1433 -8.4 -30.3 83.3 -17.7 -4.2 -13 AAATCGTCCTTCTCCTGCAG
706 SEQ ID NO: 1434 -8.4 -25.5 71.8 -16.6 0 -7.8 GGATCCAAACCTGTGATTCG
814 SEQ ID NO: 1435 -8.4 -23.7 66.2 -14.6 -0.3 -8.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Intertotal form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
CAGGCATCTGAATACCAATG 939 SEQ ID NO:1436 -8.4 -21.5 62.3 -12.3 -0.6 -4.7
AGTCTGGGAATCTGCATTAG 1376 SEQ ID NO:1437 -8.4 -22.4 67.5 -14 0 -4.9
GTGAGCTGGATCTTCAAGAG 1477 SEQ ID NO: 1438 -8.4 -22.7 68.5 -14.3 0 -5.2
CCTGGGGATATGCTGGTGTT 1657 SEQ ID NO:1439 -8.4 -27.2 77.1 -18.8 0 -3.6
CTCCACAGTGGGACTGGTTT 1727 SEQ ID NO: 1440 -8.4 -26.8 77 -17.1 -1.2 -9.3
GAGAAGAATCCTTCCATTGG 1841 SEQ ID NO: 1441 -8.4 -22.2 64.6 -11.7 -2.1 -6
GAATGGCTAAGACGTAAGCA 2273 SEQ ID NO: 1442 -8.4 -21.1 61.4 -11.6 -1 -7.4
TCCAAGAAGTTCAACAAGAA 2884 SEQ ID NO: 1443 -8.4 -18.1 55.4 -9.1 -0.3 -6
CTTTTGAAAAGTGTAAGTGT 2955 SEQ ID NO: 1444 -8.4 -17.5 55.7 -8.6 -0.2 -5.1
CTTCCTCCCGAATCTCAGCC 3305 SEQ ID NO:1445 -8.4 -29.6 79.1 -21.2 0 -3.2
TCGCTTTGGCTAGAAAGCAA
3504 SEQ ID NO: 1446 -8.4 -22.7 65 -11 -3.3 -11 TTCGCTTTGGCTAGAAAGCA
3505 SEQ ID NO: 1447 -8.4 -23.5 67.4 -11.8 -3.3 -11 CCCCGCAGCAAAGCAATAGC
293 SEQ ID NO: 1448 -8.3 -27.7 72.1 -18.5 -0.7 -6.1
CCCTCTGGACCAAAAGGTAC 319 SEQ ID NO: 1449 -8.3 -25.1 69 -16.3 -0.1 -6
CTCCTGCAGCCAGTCGAGCA 695 SEQ ID NO: 1450 -8.3 -30.7 83.7 -21.5 -0.8 -8.1
AGGTGGACGGCTCGCTCATG 1072 SEQ ID NO: 1451 -8.3 -28.1 77.3 -19.8 0.3 -5.3
CAGCCATCCCGACACTTGCG 1693 SEQ ID NO: 1452 -8.3 -29.7 76.4 -20.9 -0.1 -4
TTACACACAAATCTGGACTT 2004 SEQ ID NO:1453 -8.3 -19.4 58.8 -11.1 0 -3
CCAATCCAGTGTGCACGAGA 2044 SEQ ID NO: 1454 -8.3 -26.2 72 -17 0 -9.8
CTGGGGAGCAGGACGGAATG 2288 SEQ ID NO:1455 -8.3 -25.5 70.5 -16.3 -0.7 -4.9
GAAAGCCAATGATGTGTGCT 2320 SEQ ID NO: 1456 -8.3 -22.7 65.2 -13.5 -0.7 -4.2
CAGGCCCCAGGTGCCTTTCC 2504 SEQ ID NO: 1457 -8.3 -34.1 89.5 -23.6 -2.2 -10
TATATCCTATAGCCTCCCCC 2523 SEQ ID NO:1458 -8.3 -29.2 78.5 -20.9 0 -5
TCTCTAAACAGAAGAGATTT 2731 SEQ ID NO: 1459 -8.3 -17.1 54.7 -7 -1.8 -6.2
TATATAAGTCTAGGCATGTG 3066 SEQ ID NO: 1460 -8.3 -19.5 61 -11.2 0 -6.1
AAATAAGACTCAACTGGTTA 3438 SEQ ID NO: 1461 -8.3 -17 53.8 -8.7 0 -4.7
TGACACATCAATGAATTTTG 3660 SEQ ID NO: 1462 -8.3 -17 53.6 -8.1 -0.3 -4.8
TCCCGGCCGGTAAGACCCTT 159 SEQ ID NO: 1463 -8.2 -32.2 80.5 -21 -0.7 -14.2
AAAATCGTCCTTCTCCTGCA 707 SEQ ID NO: 1464 -8.2 -24.8 69.3 -16.6 0 -4.7
784 CCTTTCACGAAGTTGCCTGC -8.2 -26.9 74 -18 -0.4 -3.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO : 1465
CCTGGCTGGAAGTCACCCCC 985 SEQ ID NO: 1466 .2 -32.4 84 -22.8 -1.3 -5.2
GTCCACAGCCTGGCTGGAAG 993 SEQ ID NO: 1467 .2 -28.9 79.6 -17.6 -2 -14.2
AGACCAGGAAGGTGTTGGTG 1434 SEQ ID NO: 1468 .2 -24.7 71.9 -14.8 -1.7 -6.7
ACAGTGGGACTGGTTTCGTT 1723 SEQ ID NO: 1469 .2 -25.3 73.8 -15 -2.1 -6.9
GCTCCACAGTGGGACTGGTT 1728 SEQ ID NO .-1470 .2 -28.5 81.1 -18.2 -2.1 -9.3
CATCACAGGAGACCAGTTGT 1885 SEQ ID NO: 1471 .2 -24.5 71.6 -15.7 -0.3 -3.7
CGAGGAGTCCCAGCCATCAC 1899 SEQ ID NO: 1472 .2 -29.3 79.3 -20 -1 -7.5
AGGTTTGGAGTTAGAGCTAT 1962 SEQ ID NO: 1473 .2 -22.4 69.1 -14.2 0 -5.1
CCAGCAACTGAGAAACCAAT 2059 SEQ ID NO: 1474 .2 -21.6 60.9 -12.8 -0.3 -4.3
CAGAGTACAGGCTCGCCCAG 2075 SEQ ID NO: 1475 .2 -28.7 78.8 -18.3 -2.2 -7.3
GAGTCAGCTCCTGTCGGAAG 2179 SEQ ID NO: 1496 .2 -26.4 75.9 -17.3 -0.7 -5.4
GCTAAGACGTAAGCAGTATG 2268 SEQ ID NO: 1477 .2 -20.9 62.3 -11.6 -1 -7.6
AAAGTGTAAGTGTCTCAGAT 2948 SEQ ID NO: 1478 .2 -19.4 61 -11.2 0 -3.3
TCTAGGCATGTGGCTGAACC 3058 SEQ ID NO: 1479 .2 -25.9 73.8 -17 -0.4 -8.3
TTGTTTGTCTCACGTCTGGG 3188 SEQ ID NO: 1480 .2 -25 74.2 -16.8 0 -4.6
TTAATAAAAGGGCTTAGGAT 3241 SEQ ID NO: 1481 .2 -17.4 54.4 -9.2 0 -3.8
TTCCTCCCGAATCTCAGCCA 3304 SEQ ID NO: 1482 .2 -29.4 78.3 -21.2 0 -3.2
ATCCCGGCCGGTAAGACCCT 160 SEQ ID NO: 1483 .1 -32.1 80.2 -21 -0.7 -14.2
GCTCAAGCCGAAGGAACGCG 920 SEQ ID NO: 1484 .1 -26.3 68.6 -16.6 -1.5 -10.1
ATCCCAAGACATCGTTGAGT 1011 SEQ ID NO: 1485 .1 -24.2 68.8 -16.1 0 -3.8
GATTTTCATCTGATAATGGT 1292 SEQ ID NO: 1486 .1 -19.3 60.1 -11.2 0 '-4.4
CGGTGTAGACCAGGAAGGTG 1440 SEQ ID NO .-1487 .1 -25.1 71.1 -15.2 -1.8 -6.3
CCCAGGTGAGCTGGATCTTC 1482 SEQ ID NO: 1488 .1 -28 79.6 -16.9 -3 -7.3
CACCCTCAGGGAAGCTCCAC 1741 SEQ ID NO: 1489 .1 -29.2 79 -19.5 -1.6 -8.2
GAGGAGTCCCAGCCATCACA 1898 SEQ ID NO: 1490 .1 -29.2 80.7 -20 -1 -7.5
ATACCAGGCCTGCCATCCTG 2203 SEQ ID NO: 1491 .1 -30.3 80.7 -20.2 -1.6 -11.7
AGTGAGCTGGGGAGCAGGAC 2294 SEQ ID NO: 1492 .1 -27.2 78.9 -17.6 -1.4 -5.6
GCTAGTGATCAAACACGTCA 2637 SEQ ID NO: 1493 .1 -22.1 64.7 -12.4 -1.6 -6.2
AAGTTCAACAAGAAAAGGCA 2878 SEQ ID NO: 1494 .1 -17.4 53.8 -8.6 -0.5 -4.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
TTGTGTGTATTAATTCAAAT 2927 SEQ ID NO: 1495 -8.1 -16.3 53.1 -8.2 0 -4.2
GTGTCACACTTCCTCCCGAA 3313 SEQ ID NO: 1496 -8.1 -28 76.5 -19.3 -0.3 -5.8
CAAAATCTGAAAATAATCTA 3585 SEQ ID NO: 1497 -8.1 -12.4 44 -4.3 0 -2.7
ATGCTTCATGTACACAACTA 3730 SEQ ID NO:1498 -8.1 -20.7 62.5 -12.6 0 -6.7
GGATGTACAGCCAATAATAT 3866 SEQ ID NO: 1499 -8.1 -20.1 59.9 -12 0 -6.4
AGAAGTGACCAGGATGTACA 3877 SEQ ID NO: 1500 -8.1 -22.2 65.6 -14.1 0 -6.4
CGTCCTGAGCCGCCGGGAGG 16 SEQ ID NO: 1501 -8 -33.3 83.4 -24.1 -1.1 -8.7
GGCTTGCCCCAGAACGAGAT 43 SEQ ID NO: 1502 -8 -28.6 75.4 -20 -0.3 -6.5
CTGGACCAAAAGGTACGGGG 315 SEQ ID NO:1503 -8 -24.2 66.3 -15.7 -0.1 -5.2
TGATGAAAAAGGTTTTAGCT 498 SEQ ID NO: 1504 -8 -17.5 54.8 -9.5 0.2 -6.8
AGAAAAATCGTCCTTCTCCT 710 SEQ ID NO: 1505 -8 -22.2 63.8 -14.2 0 -3.2
CGATCAAGTGGACATTCCCG 732 SEQ ID NO: 1506 -8 -25 68.1 -16.1 -0.8 -6.1
AAACATGGGCCCGGCAGGAT 830 SEQ ID NO: 1507 -8 -28 73.1 -18.4 -0.7 -11.2
GTGGCATTCTGCTCGATCCG 1417 SEQ ID NO: 1508 -8 -28 76.9 -18.1 -1.9 -8.7
ACTCCTTCCACAGGTTGTAC 1521 SEQ ID NO: 1509 -8 -26.1 75.9 -17.2 -0.8 -5.4
GCGGGGTTGAGACAGGTAGC 1547 SEQ ID NO: 1510 -8 -27.5 78.4 -19.5 0.3 -3.9
GCCTGGGGATATGCTGGTGT 1658 SEQ ID NO: 1511 -8 -28.9 81.2 -20.9 0 -4.9
CAGTCCCCTCCCGCGAGGAG 1912 SEQ ID NO: 1512 -8 -33.4 84.6 -22.7 -2.4 -13.2
CTTCGGAGCCAGCGTTCCTC 2101 SEQ ID NO: 1513 -8 -30.1 81.8 -20.6 -1.4 -5.2
CCAACAGCTAGGGCCCGAGC 2226 SEQ ID NO: 1514 -8 -30.7 79.9 -21 -0.9 -11.5
AGTTATATCTGGCAACCGGC 2701 SEQ ID NO: 1515 -8 -25 70.6 -16.3 -0.4 -6.9
CTCCAAAGCAGTTATATCTG 2710 SEQ ID NO: 1516 -8 -21.1 63.3 -12.6 -0.2 -2
ATTAATAAAAGGGCTTAGGA 3242 SEQ ID NO: 1517 -8 -17.4 54.4 -9.4 0 -3.8
CATTATGTATATGCAAACAT 3607 SEQ ID NO: 1518 -8 -17.1 53.8 -8.4 -0.5 -7.2
ACTGACACATCAATGAATTT 3662 SEQ ID NO: 1519 -8 -18 55.7 -9.3 -0.4 -4.8
GGATAAGGTGTAACTGACAC 3674 SEQ ID NO: 1520 -8 -20.2 61.2 -10.1 -2.1 -5.7
CTCACATAAGTTACCACAAA 3752 SEQ ID NO:1521 -8 -19.3 58 -10.8 -0.2 -3.8
AAAACTTTTTGAGCACCAAC 3794 SEQ ID NO: 1522 -8 -18.9 56.7 -10.4 -0.2 -4.6
GCGGTGGCAGGGAGCGAGTG 68 SEQ ID NO: 1523 -7.9 -30.1 81.7 -20.6 -1.6 -6.6
613 GCCAGGGGGAGCCAGTCAAC -7.9 -30.2 82.7 -21 -1.2 -5.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular sition oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1524
CACAAAATCTGCATCGTCCG
881 SEQ ID NO: 1525 -7.9 -22.9 63.5 -15 0 -4.9 CGTTGAGTCCACAGCCTGGC
999 SEQ ID NO: 1526 -7.9 -29.6 81.1 -20.8 -0.8 -8.8 TTCACCAGAGAGTCAACAAA
1093 SEQ ID NO: 1527 -7.9 -20.4 60.9 -12.5 0 -4.8 ATGCGCCTGATATTCAGCTC
1579 SEQ ID NO: 1528 -7.9 -25.9 73.4 -16.4 -1.4 -10.6 TGGGGATATGCTGGTGTTCT
1655 SEQ ID NO: 1529 -7.9 -25.6 75.2 -17.7 0 -3.6 GGGACTGGTTTCGTTTTTCA
1718 SEQ ID NO: 1530 -7.9 -24.6 72.5 -16.7 0 -3.3 CAGTGGGACTGGTTTCGTTT
1722 SEQ ID NO: 1531 -7.9 -25.2 73.6 -16 -1.2 -5.4 TTTCCTCCATGGGCTTGGAT
1802 SEQ ID NO: 1532 -7.9 -27.6 77.4 -18.6 -1 -8.4 GTAACTTTCCTCCATGGGCT
1807 SEQ ID NO: 1533 -7.9 -27 76.2 -18.5 -0.2 -8.3 ATAGCAGCGCAGTCCCCTCC
1921 SEQ ID NO: 1534 -7.9 -32.2 85.8 -23.4 -0.7 -8.5 ACACAAATCTGGACTTGGTG
2000 SEQ ID NO: 1535 -7.9 -21.1 62.6 -12.7 -0.1 -5.6 CAACTGAGAAACCAATCCAG
2055 SEQ ID NO: 1536 -7.9 -20.2 58.5 -11.6 -0.4 -3.6 CAGGCAGAGTACAGGCTCGC
2079 SEQ ID NO -.1537 -7.9 -27.7 78.7 -17.2 -2.6 -7.4 TAGAAACCACTTAAAGCCTC
2558 SEQ ID NO: 1538 -7.9 -20.4 59.9 -12.5 0 -3.2 TGGCAACCGGCCATCATTCT
2692 SEQ ID NO: 1539 -7.9 -28.2 75.3 -17.1 -3.2 -7.8 CTTCCTCTCCTGCTTGGTGT
3329 SEQ ID NO: 1540 -7.9 -29.3 84.4 -20.9 -0.1 -4.1 AATAAGACTCAACTGGTTAT
3437 SEQ ID NO: 1541 -7.9 -17.7 55.6 -9.8 0 -4.7 CACATCAATGAATTTTGTGT
3657 SEQ ID NO: 1542 -7.9 -18.6 57.5 -9.9 -0.6 -7.4 CTTCATGTACACAACTATTT
3727 SEQ ID NO: 1543 -7.9 -19.1 59.1 -11.2 0 -6.2 TTTGAGCACCAACAAGACAA
3787 SEQ ID NO: 1544 -7.9 -20.5 59.8 -12.1 -0.2 -4.4 AGTCAGAAGTGACCAGGATG
3881 SEQ ID NO: 1545 -7.9 -22.7 67.4 -12.4 -2.4 -6.6 AAACAGAAGTCAGAAGTGAC
3888 SEQ ID NO: 1546 -7.9 -17.6 55.4 -7.7 -2 -5.6 CCCGGCCGGTAAGACCCTTC
158 SEQ ID NO: 1547 -7.8 -32.2 80.5 -21 -0.7 -14.9 CATCCTTCATGCTCTGGGTC
424 SEQ ID NO: 1548 -7.8 -27.2 79.3 -19.4 0 -4.4 CTAAGGGCTGGCTGTGGCCG
456 SEQ ID NO: 1549 -7.8 -29.9 80.2 -18.8 -3.3 -11 ATCCGTGTAAAGCTGGTGGG
632 SEQ ID NO: 1550 -7.8 -25.4 71.4 -17.6 0 -5.1 GAGAAAAATCGTCCTTCTCC
711 SEQ ID NO: 1551 -7.8 -21.9 63.2 -12.7 -1.3 - -5.4 TCATGCTCACATTTTACCAC
1057 SEQ ID NO: 1552 -7.8 -22.9 67.4 -14.4 -0.4 -4.4 ATAAAGGGTGACGTAAAAGG
1352 SEQ ID NO: 1553 -7.8 -17.5 53.7 -9.7 0 -5.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Intertotal form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
TCAGCAGTAACTTTCCTCCA 1813 SEQ ID NO: 1554 -7.8 -25.5 73.8 -17.7 0 -4.1
GGTCAGTGCAACCCATGAGA 2249 SEQ ID NO: 1555 -7.8 -26.6 74.6 -18.3 -0.1 -6.4
ATTTGCTCAATTAAAAAATG 2353 SEQ ID NO: 1556 -7.8 -13.6 46.4 -5.8 0 -3.6
ATCTGGCAACCGGCCATCAT 2695 SEQ ID NO: 1557 -7.8 -28.1 75 -17 -3.3 -8
GTGCCGGTTTCTGTGTACAC 2783 SEQ ID NO: 1558 -7.8 -26.9 77.4 -18.2 0 -9.6
AGTTCAACAAGAAAAGGCAC 2877 SEQ ID NO: 1559 -7.8 -18.3 56 -9.8 -0.5 -4.8
TTTTGAAAAGTGTAAGTGTC 2954 SEQ ID NO: 1560 -7.8 -17 55 -9.2 0 -3.7
CTTTGCCTCCAGGAAATCTG 3116 SEQ ID NO: 1561 -7.8 -24.6 69.4 -16 -0.6 -5
TGTCACACTTCCTCCCGAAT 3312 SEQ ID NO: 1562 -7.8 -26.8 73.2 -19 0 -2.8
TGATACAACTTTGGCACGAT 3398 SEQ ID NO: 1563 -7.8 -21.1 61.4 -12.6 -0.4 -4
CCTGTACAAGCTTCGCTTTG 3516 SEQ ID NO: 1564 -7.8 -24.9 70.6 -15.5 -1.5 -7.8
ATGTATATGCAAACATTCCA
3603 SEQ ID NO: 1565 -7.8 -19.8 59.3 -11.3 -0.5 -7 TATGTATATGCAAACATTCC
3604 SEQ ID NO: 1566 -7.8 -18.8 57.6 -10.1 -0.7 -7.4 CTGACACATCAATGAATTTT
3661 SEQ ID NO: 1567 -7.8 -17.9 55.5 -9.4 -0.4 -4.8
CTTTTTGAGCACCAACAAGA
3790 SEQ ID NO: 1568 -7.8 -21.4 62.5 -13.6 2.6 -2.6
GCGGAGGTTAAACCTCACAG
395 SEQ ID NO: 1569 -7.7 -24.3 68.3 -12.3 -4.3 -11.9 TGCGGAGGTTAAACCTCACA
396 SEQ ID NO: 1570 -7.7 -24.3 67.9 -12.3 -4.3 -13.2 GCATCCGTGTAAAGCTGGTG
634 SEQ ID NO: 1571 -7.7 -25.5 71.7 -17.8 0 -5.1
CACCACCCTGGTATTATTGA 656 SEQ ID NO: 1572 -7.7 -25.3 70.5 -15.9 -1.7 -5.7
TGTGTCCCACCACCCTGGTA 663 SEQ ID NO: 1573 -7.7 -31.6 84.1 -22.2 -1.7 -6.3
TGCTGTGTCCCACCACCCTG 666 SEQ ID NO: 1574 -7.7 -32.2 84.6 -23.7 -0.6 -4.3
CGAAGTTGCCTGCATACCCG 777 SEQ ID NO: 1575 -7.7 -27.9 72.7 -20.2 0 -5.8
TGGAAGGCAAAACTCGGCTT 1120 SEQ ID NO: 1576 -7.7 -23 64.4 -14.6 -0.5 -4
TGGTGGCATTCTGCTCGATC 1419 SEQ ID NO: 1577 -7.7 -26.4 76 -17.5 -1.1 -7.8
CGTTTTTCATCCTCCAGCCA 1707 SEQ ID NO: 1578 -7.7 -28.4 78 -20.7 0 -3.2
GACTGGTTTCGTTTTTCATC 1716 SEQ ID NO: 1579 -7.7 -22.6 68.7 -14.9 0 -3.3
CCCTCAGGGAAGCTCCACAG 1739 SEQ ID NO: 1580 -7.7 -29 78.8 -19.7 -1.6 -7.7
TGGTGTCACACTTCCTCCCG 3315 SEQ ID NO: 1581 -7.7 -29.3 80 -20.4 -1.1 -6.7
GTGTTTAGGCTCGGGTCCTA 3641 SEQ ID NO: 1582 -7.7 -28 80.8 -19.6 -0.5 -7.9
3651 AATGAATTTTGTGTTTAGGC -7.7 -18.8 58.8 -11.1 0 -3.3 kcal/ kcal/ kcal/ mol mol ,deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO : 1583
TAAAATTACCCTCAGGCTAT 3696 SEQ ID NO: 1584 -7.7 -21.2 61.7 -12.9 -0.3 -4.9
GTACACAACTATTTAAAATA 3721 SEQ ID NO: 1585 -7.7 -14.3 48.1 -6.6 0 -5
GGCGGTGGCAGGGAGCGAGT 69 SEQ ID NO: 1586 -7.6 -31.3 84.5 -22.1 -1.6 -7.2
GAGCAGAGGAACGGAGTTGC 257 SEQ ID NO: 1587 -7.6 -24.7 70.8 -15.3 -1.8 -7.3
CTTCATGCTCTGGGTCCTTG 420 SEQ ID NO: 1588 -7.6 -27.1 78.6 -19.5 0 -4.4
ATGATGAAAAAGGTTTTAGC 499 SEQ ID NO: 1589 -7.6 -16.6 53 -8.3 -0.4 -4.4
AATCGTCCTTCTCCTGCAGC 705 SEQ ID NO: 1590 -7.6 -28 78.5 -19.9 0 -8.1
GTCGGCCCCTTCAAACATGG 842 SEQ ID NO: 1591 -7.6 -28.2 74.6 -20.6 0 -6.2
CCGGAGAGAGCCTCTTGTGG 864 SEQ ID NO: 1592 -7.6 -28.3 78.1 -19.2 -1.4 -8.2
GGGGTAGATGTCAATGTGGC 962 SEQ ID NO: 1593 -7.6 -24.9 73.4 -17.3 0 -3.8
TTTTTCATCCTCCAGCCATC 1705 SEQ ID NO: 1594 -7.6 -26.8 76.6 -19.2 0 -3.2
CAGGGAAGCTCCACAGTGGG 1735 SEQ ID NO: 1595 -7.6 -27.3 76.5 -18.1 -1.6 -9.5
AATTTTAAGTGTTCAATAGA 2374 SEQ ID NO: 1596 -7.6 -15.8 52.2 -8.2 0 -2.6
CAAATCTTTTGAAAAGTGTA 2960 SEQ ID NO: 1597 -7.6 -15.5 50.7 -7.2 -0.5 -5.3
AAAAGTCTTCATGGAGTTTC 3145 SEQ ID NO: 1598 -7.6 -19.2 60.3 -10.1 -1.4 -6.7
TTGAGCACCAACAAGACAAA 3786 SEQ ID NO: 1599 -7.6 -19.7 57.7 -12.1 0 -4.5
CGTGAATGATGAAAAAGGTT 504 SEQ ID NO: 1600 -7.5 -16.8 52.1 -9.3 0 -1.8
CCAGTTTTCAAAGATACCGC 536 SEQ ID NO: 1601 -7.5 -23 65.2 -15.5 0 -2.6
AGGATCCAAACCTGTGATTC 815 SEQ ID NO: 1602 -7.5 -22.9 66.2 -14.6 -0.3 -9
CTTACACACAAATCTGGACT 2005 SEQ ID NO: 1603 -7.5 -20.2 60.3 -12.7 0 -3
TGACATGAGTCAGCTCCTGT 2185 SEQ ID NO: 1604 -7.5 -25.6 75.3 -15.9 -2.2 -8.6
CCCCAACAGCTAGGGCCCGA 2228 SEQ ID NO: 1605 -7.5 -32.9 81.9 -23.7 -1.1 -11.3
GTAAGCAGTATGGTCAGTGC 2260 SEQ ID NO: 1606 -7.5 -24.1 73.3 -15.9 -0.5 -4.1
TCCCAACTCCACTGGGTTCC 2437 SEQ ID NO: 1607 -7.5 -29.8 80.5 -20.2 -2.1 -6.8
GAAATCCCAACTCCACTGGG 2441 SEQ ID NO: 1608 -7.5 -25.3 68.7 -16.5 -1.2 -5.6
ATAGAAACCACTTAAAGCCT 2559 SEQ ID NO: 1609 -7.5 -20 58.6 -12.5 0 -3.2
TGATCAAACACGTCACTCAT 2632 SEQ ID NO: 1610 -7.5 -20.7 61.1 -13.2 0 -6
AATGATACTCTGCTTGCTAT 2660 SEQ ID NO: 1611 -7.5 -21.2 63.9 -13.7 0 -4.5
GGTTTCTGTGTACACAGATG 2778 SEQ ID NO: 1612 -7.5 -22.4 68.4 -10.3 -2.6 -17.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo AAAAGTGTAAGTGTCTCAGA
2949 SEQ ID NO: 1613 -7 .5 -18.7 58 .9 -11.2 0 -2.5 TTGGTGGGAACTGGCTGCAA
3163 SEQ ID NO: 1614 -7 .5 -25.6 71 .9 -16.7 -1.2 -9.6 ACAAAGAAAATCATTCTTCC
3344 SEQ ID NO: 1615 -7 .5 -17 53 .3 -7 -2.5 -6.5 AAACAATGTCCTTAGAAAAC
3370 SEQ ID NO: 1616 -7 .5 -15.8 50 .5 -8.3 0 -4.8 ACTATTTAAAATATCGTATA
3714 SEQ ID NO: 1617 -7 .5 -14.1 47 .8 -6.6 0 -5 CAGAAGTGACCAGGATGTAC
3878 SEQ ID NO: 1618 -7. .5 -22.2 65. .6 -14.7 0 -4 GCTTGCCCCAGAACGAGATC
42 SEQ ID NO: 1619 -7. .4 -27.8 74. .6 -20.4 0 -4.1 GCAGGGAGCGAGTGTCAACG
62 SEQ ID NO: 1620 -7. .4 -26.5 73. .4 -17.7 -1.3 -4.7 GCCACACCCCCTCCCAAGAA
225 SEQ ID NO: 1621 -7. .4 -32.8 80. .9 -25.4 0 -2 CCGCCACACCCCCTCCCAAG
227 SEQ ID NO: 1622 -7. .4 -35.7 84. .5 -28.3 0 -2.6 CCTCACAGATGGTTTGACCT
383 SEQ ID NO: 1623 -7. .4 -25.8 73. .2 -17 -1.3 -5.1 GTGAATGATGAAAAAGGTTT
503 SEQ ID NO: 1624 -7. .4 -16.1 51. .5 -8.7 0 -2.3 ATCGTCCTTCTCCTGCAGCC
704 SEQ ID NO: 1625 -7. .4 -30.7 84. .7 -22.8 0 -8.1 TACCCGGCCACGTGCGCTCC
763 SEQ ID NO: 1626 -7. .4 -34.3 84. .2 -25 -1.3 -11.7 TGCCTGCATACCCGGCCACG
771 SEQ ID NO: 1627 -7. .4 -32.6 80. .6 -23.7 -1.4 -8 GAAGGCAAAACTCGGCTTGT
1118 SEQ ID NO: 1628 -7. .4 -23 64. .9 -14.9 -0.5 -4 GGCATTCTGCTCGATCCGCT
1415 SEQ ID NO: 1629 -7. .4 -29.5 79. .8 -19.6 -2.5 -8.7 CTCAGCAGTAACTTTCCTCC
1814 SEQ ID NO: 1630 -7. .4 -25.7 74. .6 -18.3 0 -4.1 GGACTTGGTGCTCTGGAGGT
1990 SEQ ID NO: 1631 -7. .4 -27.6 80. .6 -20.2 0 -6.4 GCCCAGCAACTGAGAAACCA
2061 SEQ ID NO: 1632 -7. .4 -26.1 69. .9 -18.1 -0.3 -4.3 CGCCCAGCAACTGAGAAACC
2062 SEQ ID NO: 1633 -7. .4 -26.2 68. .9 -18.1 -0.4 -4.3 CTGACATGAGTCAGCTCCTG
2186 SEQ ID NO: 1634 -7. .4 -25.3 73. .7 -14.6 -3.3 -8.2 AGGCCTGCCATCCTGACATG
2198 SEQ ID NO: 1635 -7, .4 -29.2 78. .9 -21.1 -0.3 -8.2 CCCAGGTGCCTTTCCCCATG
2499 SEQ ID NO: 1636 -7, .4 -33.1 85. .3 -25.7 0 -6.6 GAAACCACTTAAAGCCTCAG
2556 SEQ ID NO: 1637 -7, .4 -21.4 61. .5 -14 0 -3.2 CTTCTATCTCTCTAAACAGA
2739 SEQ ID NO: 1638 -7. .4 -19.7 61. .4 -12.3 0 -2.5 ATTACATATGTCATAACTTC
2755 SEQ ID NO: 1639 -7, .4 -17.3 55. .7 -9.4 0 -8.2 TTCAACAAGAAAAGGCACTG
2875 SEQ ID NO: 1640 -7, .4 -18 54. ,9 -8.2 -2.4 -5.4 AGTGATACAACTTTGGCACG
3400 SEQ ID NO: 1641 -7. .4 -21.7 63. 3 -13.2 -1 -6.2
3488 GCAATCACAGAAACAAGAGA -7. .4 -18.4 56 -11 0 -3.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1642
TGTTTAGGCTCGGGTCCTAT
3640 SEQ ID NO: 1643 -7.4 -26.8 77.1 -18.3 -1 -8.5 AAAACCCCTCACATAAGTTA
3759 SEQ ID NO: 1644 -7.4 -21 60.4 -13.6 0 -3.5 GCCCCAGAACGAGATCTGCC
38 SEQ ID NO: 1645 -7.3 -29.7 77.5 -21 -1.3 -6.3 ACCCTTCTCTCGGCCAGGGG
145 SEQ ID NO: 1646 -7.3 -32.3 85.9 -22.9 -2.1 -10.5 GATGAAAAAGGTTTTAGCTG
497 SEQ ID NO: 1647 -7.3 -17.5 54.8 -9.5 -0.4 -8.1 CCGCATCCGTGTAAAGCTGG
636 SEQ ID NO: 1648 -7.3 -27.1 72 -19.3 -0.2 -5.3 CCGAGAGAAAAATCGTCCTT
715 SEQ ID NO: 1649 -7.3 -21.6 60.7 -13.4 -0.7 -3.9 TGCTCAAGCCGAAGGAACGC
921 SEQ ID NO: 1650 -7.3 -25.5 68.4 -16.6 -1.5 -6.3 CCCAAGACATCGTTGAGTCC
1009 SEQ ID NO: 1651 -7.3 -26.2 72.4 -18.9 0.1 -4.4 GATGCGCCTGATATTCAGCT
1580 SEQ ID NO: 1652 -7.3 -26.1 73.1 -17.2 -1.4 -10.6 CTGGGGATATGCTGGTGTTC
1656 SEQ ID NO: 1653 -7.3 -25.6 75.2 -18.3 0 -3.6 TATAGCAGCGCAGTCCCCTC
1922 SEQ ID NO: 1654 -7.3 -29.9 81.9 -21.7 -0.7 -8.5 CAGGCCTGCCATCCTGACAT
2199 SEQ ID NO: 1655 -7.3 -29.9 80.1 -20.7 -1.5 -11.5 TCAGTGCAACCCATGAGAAC
2247 SEQ ID NO: 1656 -7.3 -23.7 67.2 -15.9 -0.2 -5.4 ATAGGAAAGCCAATGATGTG
2324 SEQ ID NO: 1657 -7.3 -19.7 58.7 -11.2 -1.1 -3.5 CCCAGCATGAATGATACTCT
2669 SEQ ID NO: 1658 -7.3 -23.8 67.4 -16.5 0 -4.6 AACTAGTATATAAGTCTAGG
3072 SEQ ID NO: 1659 -7.3 -17.1 55.7 -8.6 -1.1 -6.3 TTCAGAGATAGACTTTGCCT
3128 SEQ ID NO: 1660 -7.3 -22.7 67.9 -14.9 -0.1 -3.8 CTCTCCTGCTTGGTGTCACA
3325 SEQ ID NO: 1661 -7.3 -27.9 81 -20.1 -0.1 -5 CAAAGAAAATCATTCTTCCT
3343 SEQ ID NO: 1662 -7.3 -17.7 54.6 -7.9 -2.5 -6.5 CAAAACTTTTTGAGCACCAA
3795 SEQ ID NO: 1663 -7.3 -19.4 57.4 -11.4 -0.5 -6.5 CGGCTTGCCCCAGAACGAGA
44 SEQ ID NO: 1664 -7.2 -29.4 75.2 -21.3 -0.8 -7.1 TTTGGGTTTGTGGAGCTTAT
350 SEQ ID NO: 1665 -7.2 -23.5 70.7 -16.3 0 -5.2 GCTGGCTGTGGCCGACGGAG
450 SEQ ID NO: 1666 -7.2 -31 81.6 -20.5 -3.3 -8.4 CCGTGAATGATGAAAAAGGT
505 SEQ ID NO: 1667 -7.2 -18.7 55.2 -11.5 0 -3 GGCCAGGGGGAGCCAGTCAA
614 SEQ ID NO: 1668 -7.2 -31.2 84.6 -22.3 -1.7 -8.6 AAGCTGGTGGGCCAGGGGGA
623 SEQ ID NO: 1669 -7.2 -30.7 83.6 -20.3 -3.2 -9.4 CACGAAGTTGCCTGCATACC
779 SEQ ID NO: 1670 -7.2 -26 71 -18.1 -0.4 -6.8 GATCCCAAGACATCGTTGAG
1012 SEQ ID NO: 1671 -7.2 -23.6 67 -16.4 0 -3.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GGATTTTCATCTGATAATGG
1293 SEQ ID NO: 1672 -7.2 -19.3 59.6 -11.2 -0.7 -4.5
GGTGTTGGTGGCATTCTGCT
1424 SEQ ID NO: 1673 -7.2 -27.9 81.7 -18.8 -1.9 -5.6
TGCGCCTGATATTCAGCTCC
1578 SEQ ID NO: 1674 -7.2 -27.9 77 -19.1 -1.3 -10.6
GTTTCGTTTTTCATCCTCCA
1711 SEQ ID NO: 1675 -7.2 -25.7 74.6 -18.5 0 -3
CCTTGCTGGCAAGACTTGCC
1765 SEQ ID NO: 1676 -7.2 -28.3 77.3 -17.3 -3.8 -12.9
GTCCTCAGCAGTAACTTTCC
1817 SEQ ID NO: 1677 -7.2 -26 76.2 -18.8 0 -4.1
GGCTCGCCCAGCAACTGAGA
2066 SEQ ID NO: 1678 -7.2 -29.7 79 -20.4 -2.1 -6.9
GGAAAGCCAATGATGTGTGC
2321 SEQ ID NO: 1679 -7.2 -23 65.8 -15.2 -0.3 -3.4
GATCAAACACGTCACTCATA
2631 SEQ ID NO: 1680 -7.2 -20.4 60.6 -13.2 0 -4.7
AAGTGTAAGTGTCTCAGATA
2947 SEQ ID NO: 1681 -7.2 -19.8 62.6 -12.6 0 -3.3
CTAGGCATGTGGCTGAACCT
3057 SEQ ID NO: 1682 -7.2 -26.4 74.1 -17.9 -1.2 -8.3
TAATAAAAGGGCTTAGGATT
3240 SEQ ID NO: 1683 -7.2 -17.4 54.4 -10.2 0 -3.8
GGCACAGATGTTCTCCTGGT
3267 SEQ ID NO: 1684 -7.2 -27.5 79.6 -19.5 -0.6 -5
CAGAAGTTTAACAGTGATAC
3412 SEQ ID NO: 1685 -7.2 -17.6 56 -10.4 0 -4.6
AATCTGAAAATAATCTAAAA
3582 SEQ ID NO: 1686 -7.2 -11 41.5 -3.8 0 -3.2
AAATCTGAAAATAATCTAAA
3583 SEQ ID NO: 1687 -7.2 -11 41.5 -3.8 0 -3.2
TGCCCTCGTCCTGAGCCGCC
22 SEQ ID NO.-1688 -7.1 -35.4 88.9 -26.8 -1.4 -5.4
AACGGCTTGCCCCAGAACGA
46 SEQ ID NO: 1689 -7.1 -28.3 72.3 -20.3 -0.8 -7.1
TGTGTAGCTTTGGGTTTGTG
358 SEQ ID NO: 1690 -7.1 -24 73 -16.9 0 -4.3
GCATCCTTCATGCTCTGGGT
425 SEQ ID NO: 1691 -7.1 -28.6 82 -19.4 -2.1 -5.7
ATTGTAGCCAATGCTATTAC
1199 SEQ ID NO: 1692 -7.1 -21.2 63.5 -12 -2.1 -8.5
TGGGTTTCCCCAGACTTCAC
1603 SEQ ID NO: 1693 -7.1 -28 78.4 -18.3 -2.6 -7.6
AGGCAGCAAGAGCTATAGCA
1935 SEQ ID NO: 1694 -7.1 -24.7 71.9 -14.9 -2.7 -11
AATGGCTAAGACGTAAGCAG
2272 SEQ ID NO: 1695 -7.1 -20.5 60.4 -11.6 -1.8 -8.2
AGCTGGGGAGCAGGACGGAA
2290 SEQ ID NO: 1696 -7.1 -27.3 75 -18.6 -1.6 -6.4
AATGATGTGTGCTTCAGAGA
2313 SEQ ID NO: 1697 -7.1 -21.4 65 -14.3 0 -3.7
TAAGTGTTCAATAGACATTT
2369 SEQ ID NO: 1698 -7.1 -17.3 55.6 -10.2 0 -3.3
GGTCCCTAATGCTTATATCC
2536 SEQ ID NO: 1699 -7.1 -25.3 72 -18.2 0 -3.6
GTTCAACAAGAAAAGGCACT
2876 SEQ ID NO: 1700 -7.1 -19.2 57.7 -11.1 -0.9 -4.8
3311 GTCACACTTCCTCCCGAATC -7.1 -27.2 74.9 -20.1 0 -2.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1701
GATGTACAGCCAATAATATG
3865 SEQ ID NO: 1702 -7.1 -18.9 57.4 -11.8 0 -6.7 ACGGCTTGCCCCAGAACGAG
45 SEQ ID NO: 1703 -7 -29 74.6 -21.1 -0.8 -7.1 CAACGGCTTGCCCCAGAACG
47 SEQ ID NO: 1704 -7 -28.4 72.1 -20.5 -0.8 -7.1 TTTGTGCAGCCAGTTTTCAA
545 SEQ ID NO: 1705 -7 -24.3 71.3 -17.3 0 -5.3 CGGCCCCTTCAAACATGGGC
840 SEQ ID NO: 1706 -7 -29.6 76.2 r-19.7 -2.9 -9 TCCACAGCCTGGCTGGAAGT
992 SEQ ID NO: 1707 -7 -28.9 79.6 -18.3 -2.9 -15.1 CTGGAAGGCAAAACTCGGCT
1121 SEQ ID NO: 1708 -7 -23.8 65.8 -16.1 -0.5 -4 ACTCTGAAAGGCATGCCTGC
1270 SEQ ID NO: 1709 -7 -25.8 72.3 -15.5 -1.4 -14.8 TCTCCCATGTTCTTGTAACT
1321 SEQ ID NO: 1710 -7 -24.4 71.6 -16.4 -0.9 -3.8 AGGAAGGTGTTGGTGGCATT
1429 SEQ ID NO: 1711 -7 -25 73.3 -18 0 -4 GGGGTTGAGACAGGTAGCTG
1545 SEQ ID NO: 1712 -7 -25.8 76 -17.4 -1.3 -3.2 TTCCCCAGACTTCACCCGGA
1598 SEQ ID NO: 1713 -7 -30.9 79.9 -23.9 0 -6.4 CATGGGCTTGGATAGCAGGA
1795 SEQ ID NO: 1714 -7 -25.7 73.5 -17.2 -1.4 -7.3 AGTAACTTTCCTCCATGGGC
1808 SEQ ID NO: 1715 -7 -26.1 74.6 -18.5 -0.2 -8.3 AAAGCCAATGATGTGTGCTT
2319 SEQ ID NO: 1716 -7 -22.2 64.2 -13.5 -1.7 -6.2 TGGCTCTATATAAAAAAAAA
3213 SEQ ID NO: 1717 -7 -12.7 44.5 -5.7 0 -3.7 AAGTCCAACCGTTGGCACAG
3280 SEQ ID NO: 1718 -7 -25.8 70.8 -16.2 -2.6 -11.5 TCCTCCCGAATCTCAGCCAT
3303 SEQ ID NO: 1719 -7 -29.3 77.9 -22.3 0 -3.2 CTGCTTGGTGTCACACTTCC
3320 SEQ ID NO: 1720 -7 -26.9 78.1 -18.7 -1.1 -6.7 CGGTGGCAGGGAGCGAGTGT
67 SEQ ID NO: 1721 -6.9 -29.5 80.9 -21.7 -0.8 -4.3 CTCCCCGCAGCAAAGCAATA
295 SEQ ID NO: 1722 -6.9 -27.2 71.3 -19.4 -0.7 -4.9 ACCTCAGTCTGTGTAGCTTT
367 SEQ ID NO: 1723 -6.9 -25.7 77.5 -18.8 0 -4.6 TTCCTTTCACGAAGTTGCCT
786 SEQ ID NO: 1724 -6.9 -25.6 72 -18 -0.4 -3.8 CAGGATCCAAACCTGTGATT
816 SEQ ID NO: 1725 -6.9 -23.2 65.9 -14.6 -1.7 -9 GTCTGGGAATCTGCATTAGT
1375 SEQ ID NO: 1726 -6.9 -23.6 70.7 -16.7 0 -4.9 ATCCTCCAGCCATCCCGACA
1699 SEQ ID NO: 1727 -6.9 -31.6 81.6 -24.7 0 -3.2 TTCCTCCATGGGCTTGGATA
1801 SEQ ID NO: 1728 -6.9 -27.2 76.4 -19 -1.2 -8.4 GTCCCCTCCCGCGAGGAGTC
1910 SEQ ID NO: 1729 -6.9 -34.3 88.6 -24.7 -2.4 -13.1 TCTACACAGGGCCTCTTCGG
2115 SEQ ID NO: 1730 -6.9 -27.7 77.6 -20.8 0 -7.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
ACTGAGGCTCAAAGCAGGCT 2151 SEQ ID NO: 1731 -6.9 -25.7 73.3 -16.8 -2 -6.9
TACCAGGCCTGCCATCCTGA 2202 SEQ ID NO: 1732 -6.9 -30.9 82 -21.8 -2 -11.9
CATGAATGATACTCTGCTTG 2664 SEQ ID NO:1733 -6.9 -20.1 60.8 -13.2 0 -3.7
TTGGCACAGATGTTCTCCTG 3269 SEQ ID NO:1734 -6.9 -25.2 73.5 -17.5 -0.6 -6.1
TCTCCTGCTTGGTGTCACAC 3324 SEQ ID NO: 1735 -6.9 -27.2 79.5 -19.7 -0.3 -6.6
TAACAGTGATACAACTTTGG 3404 SEQ ID NO: 1736 -6.9 -18.1 56.3 -11.2 0 -4.6
CTTCGCTTTGGCTAGAAAGC 3506 SEQ ID NO:1737 -6.9 -23.7 68.2 -14.6 -2.2 -9.6
TATCTCATTATGTATATGCA 3612 SEQ ID NO: 1738 -6.9 -19 59.9 -12.1 0 -5.8
ATCAATGAATTTTGTGTTTA 3654 SEQ ID NO: 1739 -6.9 -16.9 54.5 -10 0 -4.8
GCTATGTGGATAAGGTGTAA 3681 SEQ ID NO: 1740 -6.9 -21 63.6 -14.1 0 -2.8
ACAACTATTTAAAATATCGT 3717 SEQ ID NO: 1741 -6.9 -14.9 49 -8 0 -5
TGTACACAACTATTTAAAAT 3722 SEQ ID NO: 1742 -6.9 -14.6 48.6 -7.7 0 -5.9
GTGACCAGGATGTACAGCCA 3873 SEQ ID NO: 1743 -6.9 -26.8 75.4 -19.3 -0.3 -7.1
CCATTAGTAAAAACAGAAGT 3898 SEQ ID NO: 1744 -6.9 -16.6 52.3 -9.7 0 -3.9
GAACGAGATCTGCCCTCGTC 32 SEQ ID NO: 1745 -6.8 -26.9 73.5 -16.7 -3.4 -9.2
CTCATCCTGCCCCGCCACAC 238 SEQ ID NO: 1746 -6.8 -33.5 84.6 -26.7 0 -3
TCTGGACCAAAAGGTACGGG 316 SEQ ID NO: 1747 -6.8 -23.4 65.3 -16.6 0.4 -5.2
ATGCTCTGGGTCCTTGGAGG 416 SEQ ID NO: 1748 -6.8 -28 80.4 -20.6 -0.3 -5.2
AAAAATCGTCCTTCTCCTGC 708 SEQ ID NO: 1749 -6.8 -23.4 66.1 -16.6 0 -3
TCCTTTCACGAAGTTGCCTG 785 SEQ ID NO: 1750 -6.8 -25.5 71.5 -18 -0.4 -3.8
GGGTAGATGTCAATGTGGCC 961 SEQ ID NO: 1751 -6.8 -25.7 74.4 -18.9 0 -6.2
GCCTGATATTCAGCTCCCGT 1575 SEQ ID NO: 1752 -6.8 -29.3 79.8 -21 -1.4 -6.2
CTTGCTGGCAAGACTTGCCC 1764 SEQ ID NO: 1753 -6.8 -28.3 77.3 -17.3 -4.2 -13.3
TAACTTTCCTCCATGGGCTT 1806 SEQ ID NO:1754 -6.8 -25.9 73.2 -18.5 -0.2 -8.3
CCGCGAGGAGTCCCAGCCAT 1902 SEQ ID NO: 1755 -6.8 -32.6 82.9 -24.7 -1 -8.5
CCAATGATGTGTGCTTCAGA 2315 SEQ ID NO: 1756 -6.8 -23.5 68.4 -16.7 0 -3.7
TTAATTTTAAGTGTTCAATA 2376 SEQ ID NO: 1757 -6.8 -15 50.5 -8.2 0 -2.7
ACTGGGTTCCAAATGGAGAG 2427 SEQ ID NO:1758 -6.8 -22.9 66.4 -15.5 -0.3 -7.5
AGTGTAAGTGTCTCAGATAT 2946 SEQ ID NO: 1759 -6.8 -20.5 65 -13.7 0 -3.3
2953 TTTGAAAAGTGTAAGTGTCT -6.8 -17.8 56.6 -11 0 -2.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1760
GTCTAGGCATGTGGCTGAAC
3059 SEQ ID NO: 1761 -6.8 -25.1 73.6 -17 -1.2 -5.6 CTCCAGGAAATCTGAGTCCT
3110 SEQ ID NO: 1762 -6.8 -24.8 71.1 -16.9 -1 -7.2 TTTGTGTTTAGGCTCGGGTC
3644 SEQ ID NO: 1763 -6.8 -25.6 76.2 -18.8 0 -4.3 GAAAACCCCTCACATAAGTT
3760 SEQ ID NO: 1764 -6.8 -21.9 62 -15.1 0 -3.1 TGAGCACCAACAAGACAAAA
3785 SEQ ID NO: 1765 -6.8 -18.9 55.7 -12.1 0 -4.1 AAGACCCTTCTCTCGGCCAG
148 SEQ ID NO: 1766 -6.7 -28.6 77.5 -21.4 -0.2 -7.4 CTGACACGAGTTTGTGCAGC
555 SEQ ID NO: 1767 -6.7 -24.9 71.8 -15.3 -2.9 -7.4 TCGTCCTTCTCCTGCAGCCA
703 SEQ ID NO: 1768 -6.7 -31.4 85.7 -24.2 0 -8.1 TTGCCTGCATACCCGGCCAC
772 SEQ ID NO: 1769 -6.7 -31.9 81.4 -23.7 -1.4 -8 ACATGGGCCCGGCAGGATCC
828 SEQ ID NO: 1770 -6.7 -31.8 82.6 -23.5 -0.7 -11.2 CTCGGTGTAGACCAGGAAGG
1442 SEQ ID NO: 1771 -6.7 -25.2 71.5 -16.7 -1.8 -3.1 TCCCAGGTGAGCTGGATCTT
1483 SEQ ID NO: 1772 -6.7 -28 79.6 -18.3 -3 -7.3 GGCCCCCTCCCAGGTGAGCT
1490 SEQ ID NO: 1773 -6.7 -36.7 94.1 -28.8 -1.1 -8.1 TGGGACTGGTTTCGTTTTTC
1719 SEQ ID NO: 1774 -6.7 -23.9 71.1 -17.2 0 -3.3 CCCAGCAACTGAGAAACCAA
2060 SEQ ID NO: 1775 -6.7 -23.6 64.2 -16.3 -0.3 -4.3 TGAGGCTCAAAGCAGGCTGA
2149 SEQ ID NO: 1776 -6.7 -25.2 71.9 -16.5 -2 -7 CAGCTAGGGCCCGAGCAAGA
2222 SEQ ID NO: 1777 -6.7 -29.1 77.6 -20 -1.7 -12.8 CAATGATGTGTGCTTCAGAG
2314 SEQ ID NO: 1778 -6.7 -21.5 64.9 -14.8 0 -3.7 TAATTTTAAGTGTTCAATAG
2375 SEQ ID NO: 1779 -6.7 -14.9 50.3 -8.2 0 -2.7 AATCTTTTGAAAAGTGTAAG
2958 SEQ ID NO: 1780 -6.7 -14.8 49.5 -7.2 -0.8 -5.9 TAAGTCTAGGCATGTGGCTG
3062 SEQ ID NO: 1781 -6.7 -24 71.3 -16 -1.2 -6.1 ATAAAAGGGCTTAGGATTTT
3238 SEQ ID NO: 1782 -6.7 -18.6 57.4 -11.9 0 -3.8 TCCTGCTTGGTGTCACACTT
3322 SEQ ID NO: 1783 -6.7 -26.9 78.1 -19 -1.1 -6.7 CATATCTTGAAATAAGACTC
3447 SEQ ID NO: 1784 -6.7 -16.1 52.3 -8 -1.3 -4 ATAAAATTACCCTCAGGCTA
3697 SEQ ID NO: 1785 -6.7 -21.2 61.7 -13.9 -0.3 -4.9 TTCATGTACACAACTATTTA
3726 SEQ ID NO: 1786 -6.7 -17.9 56.6 -11.2 0 -6.7 GTTACCACAAACCATGCTTC
3743 SEQ ID NO: 1787 -6.7 -23.5 66.8 -16.8 0 -4.2 AAACCCCTCACATAAGTTAC
3758 SEQ ID NO: 1788 -6.7 -21.9 62.7 -15.2 0 -3.8 CTTTGGGTTTGTGGAGCTTA
351 SEQ ID NO: 1789 -6.6 -24.4 72.8 -17.8 0 -5.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
GATGGTTTGACCTCAGTCTG 376 SEQ ID NO: 1790 -6.6 -24.5 72.7 -16.3 -1.6 -5.5
AGTTTGTGCAGCCAGTTTTC 547 SEQ ID NO: 1791 -6.6 -25.5 76.7 -18.9 0 -5.3
ACGAAGTTGCCTGCATACCC 778 SEQ ID NO: 1792 -6.6 -27.3 73.3 -20.2 -0.2 -6.8
AAGACATCGTTGAGTCCACA 1006 SEQ ID NO: 1793 -6.6 -23.1 66.9 -15.6 -0.7 -4.4
TCCCAAGACATCGTTGAGTC 1010 SEQ ID NO: 1794 -6.6 -24.6 70.4 -17.4 -0.3 -4.4
TTGTAGCCAATGCTATTACA 1198 SEQ ID NO: 1795 -6.6 -21.9 64.7 -13.2 -2.1 -8.5
CAGGTGCCTTTCCCCATGCA 2497 SEQ ID NO: 1796 -6.6 -31.6 84 -24.3 -0.5 -6.6
CCTAATGCTTATATCCTATA 2532 SEQ ID NO: 1797 -6.6 -20.8 61.9 -14.2 0 -3.6
ATCATTCTGGCCCCAGCATG 2680 SEQ ID NO: 1798 -6.6 -28.7 78.4 -20.5 -1.5 -7.8
ACTTTGCCTCCAGGAAATCT 3117 SEQ ID NO: 1799 -6.6 -24.8 70.1 -18.2 0 -5
GATAGACTTTGCCTCCAGGA 3122 SEQ ID NO: 1800 -6.6 -25.8 73.6 -19.2 0 -4.7
CACACTTCCTCCCGAATCTC 3309 SEQ ID NO: 1801 -6.6 -26.9 73.5 -20.3 0 -2.8
AACAATGTCCTTAGAAAACC 3369 SEQ ID NO:1802 -6.6 -18.5 55.6 -11.9 0 -4.8
AAAACAATGTCCTTAGAAAA 3371 SEQ ID NO:1803 -6.6 -14.9 48.5 -8.3 0 -4.8
CAGTGATACAACTTTGGCAC 3401 SEQ ID NO: 1804 -6.6 -21.6 64.1 -15 0 -4.9
CTCATTATGTATATGCAAAC 3609 SEQ ID NO: 1805 -6.6 -17.7 55.7 -11.1 0 -6.2
ACATCAATGAATTTTGTGTT 3656 SEQ ID NO:1806 -6.6 -18 56.6 -10.8 -0.3 -5.5
ATAAGGTGTAACTGACACAT 3672 SEQ ID NO: 1807 -6.6 -19.1 58.6 -10.1 -2.4 -6.4
CTATTTAAAATATCGTATAA 3713 SEQ ID NO: 1808 -6.6 -13.2 45.8 -6.6 0 -5
CCGGCCGGTAAGACCCTTCT 157 SEQ ID NO: 1809 -6.5 -31.1 79.2 -21.4 -0.7 -14.6
AATCCCGGCCGGTAAGACCC 161 SEQ ID NO: 1810 -6.5 -30.5 76.3 -21 -0.7 -14.2
CCTCAGTCTGTGTAGCTTTG 366 SEQ ID NO: 1811 -6.5 -25.5 76.6 -19 0 -4.6
CGGAGGTTAAACCTCACAGA 394 SEQ ID NO: 1812 -6.5 -23.1 65.5 -12.3 -4.3 -11.9
GTAGGTGTGGAGGACATCCA 899 SEQ ID NO: 1813 -6.5 -26.1 76.2 -17.4 -2.2 -6.9
AGACATCGTTGAGTCCACAG 1005 SEQ ID NO: 1814 -6.5 -23.8 69.5 -16.4 -0.7 -4.4
TGGCATTCTGCTCGATCCGC 1416 SEQ ID NO: 1815 -6.5 -28.6 77.7 -19.6 -2.5 -8.7
GCTCCCGGCCTGGGGATATG 1665 SEQ ID NO: 1816 -6.5 -31.7 82.6 -22.8 -2.1 -12.4
TCCACAGTGGGACTGGTTTC 1726 SEQ ID NO: 1817 -6.5 -26.3 76.8 -17.7 -2.1 -9.3
GTGCTCTGGAGGTGTGGACA 1983 SEQ ID NO:1818 -6.5 -27.3 80 -20.2 -0.3 -6.4
2352 TTTGCTCAATTAAAAAATGA -6.5 -14.2 47.5 -7.7 0 -3.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1819
TGGGTTCCAAATGGAGAGGC 2425 SEQ ID NO: 1820 -6.5 -24.8 70.6 -17.8 -0.2 -7.2
TATGTCATAACTTCTATCTC 2749 SEQ ID NO: 1821 -6.5 -18.9 60.4 -12.4 0 -3.1
TTCAAATCAAGATCTAGAAT
2914 SEQ ID NO: 1822 -6.5 -15.7 51.3 -9.2 0 -6.6 ATTCAAATCAAGATCTAGAA
2915 SEQ ID NO: 1823 -6.5 -15.7 51.3 -9.2 0 -6.6 TTTCAGAGATAGACTTTGCC
3129 SEQ ID NO: 1824 -6.5 -21.9 66.3 -14.9 -0.1 -3.8
AAAAGTCCTTGTTTGTCTCA 3196 SEQ ID NO: 1825 -6.5 -21.5 65.1 -15 0 -3.2
TAAAACAATGTCCTTAGAAA 3372 SEQ ID NO:1826 -6.5 -15.3 49.5 -8.8 0 -4.8
GATACAACTTTGGCACGATA 3397 SEQ ID NO: 1827 -6.5 -20.8 61 -13.6 -0.4 -4
ACTTCTGGTTCCAAGCATTT 3554 SEQ ID NO:1828 -6.5 -24.1 70.7 -17.6 0 -4.8
TACACAACTATTTAAAATAT 3720 SEQ ID NO: 1829 -6.5 -13.1 45.6 -6.6 0 -5
GACCTCAGTCTGTGTAGCTT 368 SEQ ID NO: 1830 -6.4 -26.2 78.6 -18.8 -0.9 -6.4
CCGTGTAAAGCTGGTGGGCC 630 SEQ ID NO: 1831 -6.4 -28.8 77.4 -21.5 -0.8 -6.4
CCTTCTCCTGCAGCCAGTCG 699 SEQ ID NO: 1832 -6.4 -31 84.2 -23.7 -0.8 -8.1
ACGTGCGCTCCGAGGCTGTA 754 SEQ ID NO: 1833 -6.4 -30.1 79.7 -22.8 -0.6 -9.3
AGTCCACAGCCTGGCTGGAA 994 SEQ ID NO: 1834 -6.4 -28.9 79.6 -18.9 -2.9 -15.1
ATGCAATTGATCCCAAGACA 1020 SEQ ID NO: 1835 -6.4 -22.4 63.7 -15.3 -0.5 -7.6
CAGGAAGGTGTTGGTGGCAT 1430 SEQ ID NO: 1836 -6.4 -25.6 74.1 -19.2 0 -4
GGGTTTCCCCAGACTTCACC 1602 SEQ ID NO: 1837 -6.4 -30 82.1 -21.7 -1.9 -6.4
CCCGCGAGGAGTCCCAGCCA 1903 SEQ ID NO-.1838 -6.4 -34.6 86 -26.8 -1.3 -8.9
AGAGTACAGGCTCGCCCAGC 2074 SEQ ID NO: 1839 -6.4 -29.8 82.1 -21.2 -2.2 -7.3
TTCTACACAGGGCCTCTTCG 2116 SEQ ID NO: 1840 -6.4 -26.6 75.4 -20.2 0 -7.3
GACATGAGTCAGCTCCTGTC 2184 SEQ ID NO: 1841 -6.4 -26 77.3 -16.7 -2.9 -8.6
GCAGGACGGAATGGCTAAGA 2281 SEQ ID NO: 1842 -6.4 -23.9 67 -17.5 0 -3.9
ATTAATTTTAAGTGTTCAAT 2377 SEQ ID NO: 1843 -6.4 -15.3 51 -8.9 0 -3.8
TGCTTATATCCTATAGCCTC 2527 SEQ ID NO: 1844 -6.4 -24 70.7 -16.9 -0.5 -5
CCCTAATGCTTATATCCTAT 2533 SEQ ID NO: 1845 -6.4 -23.1 66.1 -16.7 0 -3.6
ATCAAACACGTCACTCATAG 2630 SEQ ID NO: 1846 -6.4 -19.8 59.6 -13.4 0 -4.6
TATCTGGCAACCGGCCATCA 2696 SEQ ID NO: 1847 -6.4 -27.8 74.5 -18.1 -3.3 -8.8
AGTTTCAGAGATAGACTTTG 3131 SEQ ID NO: 1848 -6.4 -19.3 61.4 -12.9 0 -4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
AAAAAAGTCCTTGTTTGTCT 3198 SEQ ID NO: 1849 -6.4 -19 58.3 -12.6 0 -3.9
ATAAGACTCAACTGGTTATG 3436 SEQ ID NO: 1850 -6.4 -18.4 57.4 -12 0 -4.7
CTTCTGGTTCCAAGCATTTT 3553 SEQ ID NO: 1851 -6.4 -24 70.5 -17.6 0 -5
GATAAGGTGTAACTGACACA 3673 SEQ ID NO: 1852 -6.4 -19.7 59.9 -10.1 -3.2 -6.9
CACATAAGTTACCACAAACC 3750 SEQ ID NO: 1853 -6.4 -20.2 59 -13.3 -0.2 -3.8
CAAAGCTTCCATTAGTAAAA 3906 SEQ ID NO: 1854 -6.4 -17.8 54.7 -11.4 0 -7
, GGTGGCAGGGAGCGAGTGTC
66 SEQ ID NO: 1855 -6.3 -29.1 83.4 -21.2 -1.6 -4.5
ACAACTACATTGGCGTCTTT 592 SEQ ID NO: 1856 -6.3 -22.5 65.6 -15.2 -0.9 -5.2
AACATGGGCCCGGCAGGATC 829 SEQ ID NO: 1857 -6.3 -29.1 76.9 -21.4 -0.7 -10.5
CAAGACATCGTTGAGTCCAC 1007 SEQ ID NO: 1858 -6.3 -23.1 66.9 -15.9 -0.7 -4.4
AAAATGTCAGTTTCCGCTGG 1620 SEQ ID NO: 1859 -6.3 -22.7 65.2 -15.1 -1.2 -5.8
CAGGGTCAAGGCTGAGAAGA 1854 SEQ ID NO: 1860 -6.3 -23.7 69.1 -16.6 -0.6 -4.5
TGGAGTTAGAGCTATTCAAG 1957 SEQ ID NO -.1861 -6.3 -20.3 63 -13.5 -0.2 -5.1
CGTAAGCAGTATGGTCAGTG 2261 SEQ ID NO: 1862 -6.3 -23.1 68.7 -16.3 -0.2 -3.8
TAGAAATCCCAACTCCACTG 2443 SEQ ID NO: 1863 -6.3 -22.6 63.8 -16.3 0 -2.2
TCCCTAATGCTTATATCCTA 2534 SEQ ID NO: 1864 -6.3 -23.5 67.6 -17.2 0 -3.6
ATGAATGATACTCTGCTTGC 2663 SEQ ID NO: 1865 -6.3 -21.2 63.7 -14.9 0 -3.6
ATACACAAATCTTTTGAAAA 2965 SEQ ID NO: 1866 -6.3 -14.2 47.6 -7.2 -0.5 -4.3
CTTGTTTGTCTCACGTCTGG 3189 SEQ ID NO: 1867 -6.3 -24.7 73.5 -18.4 0 -4.6
CATTAATAAAAGGGCTTAGG 3243 SEQ ID NO: 1868 -6.3 -17.5 54.4 -11.2 0 -4.2
TTAAAACAATGTCCTTAGAA 3373 SEQ ID NO: 1869 -6.3 -16.1 51.4 -9.8 0 -4.3
ATTATGTATATGCAAACATT 3606 SEQ ID NO: 1870 -6.3 -16.5 52.9 -9.3 -0.7 -7.4
AACTGACACATCAATGAATT 3663 SEQ ID NO: 1871 -6.3 -17.2 53.6 -10.2 -0.4 -4.8
CCATGCTTCATGTACACAAC 3732 SEQ ID NO: 1872 -6.3 -22.8 66 -15.1 -1.3 -6.7
AACAGAAGTCAGAAGTGACC 3887 SEQ ID NO: 1873 -6.3 -20.3 61.1 -11.6 -2.4 -6
CCCTTCTCTCGGCCAGGGGC 144 SEQ ID NO: 1874 -6.2 -33.9 89.7 -26.2 -1.4 -9
TGCTCATCCTGCCCCGCCAC 240 SEQ ID NO: 1875 -6.2 -34.4 87 -28.2 0 -3.6
GGAGAGGTAGCATCCTTCAT 434 SEQ ID NO: 1876 -6.2 -25.5 75.1 -18.1 -1.1 -6.9
GCTGACACGAGTTTGTGCAG 556 SEQ ID NO: 1877 -6.2 -24.9 71.8 -15.3 -3.4 -8.4
935 CATCTGAATACCAATGCTCA -6.2 -21.6 62.9 -15.4 0 -3.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligc
SEQ ID NO: 1878
TGCTCGATCCGCTCCACTAT
1408 SEQ ID NO: 1879 -6.2 -28.3 76.2 -21.6 -0.1 -5.6 CAGGCTCGCCCAGCAACTGA
2068 SEQ ID NO: 1880 -6.2 -29.8 78.7 -21.5 -2.1 -7.7 GAGAGTGAGCTGGGGAGCAG
2297 SEQ ID NO: 1881 -6.2 -26.4 77.3 -18.6 -1.6 -5.5 GCTTATATCCTATAGCCTCC
2526 SEQ ID NO:1882 -6.2 -26 74.6 -19.8 0 -5 CATATGTCATAACTTCTATC
2751 SEQ ID NO: 1883 -6.2 -18.3 58.2 -12.1 0 -5 TGCAAAAGTCTTCATGGAGT
3148 SEQ ID NO: 1884 -6.2 -21.1 63.5 -14.9 0 -6.5 GTGGGAACTGGCTGCAAAAG
3160 SEQ ID NO: 1885 -6.2 -22.9 65.1 -16 -0.4 -7.8 ACACTTCCTCCCGAATCTCA
3308 SEQ ID NO: 1886 -6.2 -26.9 73.5 -20.7 0 -2.8 ATCTGAAAATAATCTAAAAT
3581 SEQ ID NO: 1887 -6.2 -11.7 42.8 -5.5 0 -3.2 ATATCTCATTATGTATATGC
3613 SEQ ID NO: 1888 -6.2 -18.3 58.6 -12.1 0 -3.2 GTAACTGACACATCAATGAA
3665 SEQ ID NO: 1889 -6.2 -18 55.5 -11.3 -0.2 -4.8 TAAGGTGTAACTGACACATC
3671 SEQ ID NO: 1890 -6.2 -19.5 60 -10.1 -3.2 -6.9 CACAACTACATTGGCGTCTT
593 SEQ ID NO: 1891 -6.1 -23.1 66.4 -16 -0.9 -5.2 AATGCTGTGTCCCACCACCC
668 SEQ ID NO: 1892 -6.1 -30.6 80.4 -23.7 -0.6 -4.3 GACATCGTTGAGTCCACAGC
1004 SEQ ID NO: 1893 -6.1 -25.6 73.5 -19.5 0 -4 TTTTCATCCTCCAGCCATCC
1704 SEQ ID NO: 1894 -6.1 -28.7 79.8 -22.6 0 -3.2 GGGTCAAGGCTGAGAAGAAT
1852 SEQ ID NO: 1895 -6.1 -22.3 65.4 -15.4 -0.6 -4.5 AGGGTCAAGGCTGAGAAGAA
1853 SEQ ID NO: 1896 -6.1 -22.3 65.7 -15.4 -0.6 -4.5 GCAGTCCCCTCCCGCGAGGA
1913 SEQ ID NO: 1897 -6.1 -35.2 88.3 -26.7 -2.4 -10 GGTGCTCTGGAGGTGTGGAC
1984 SEQ ID NO: 1898 -6.1 -27.8 81.7 -21.7 0 -6.4 AGCAGGACGGAATGGCTAAG
2282 SEQ ID NO: 1899 -6.1 -23.3 66 -16.7 -0.2 -4.6 TTAAGTGTTCAATAGACATT
2370 SEQ ID NO: 1900 -6.1 -17.3 55.6 -11.2 0 -3.2 ACGTCACTCATAGGGGAGGT
2623 SEQ ID NO: 1901 -6.1 -25.8 74.7 -18.9 -0.6 -5.3 ACTTCTATCTCTCTAAACAG
2740 SEQ ID NO: 1902 -6.1 -19.3 60.6 -13.2 0 -1.6 AAGTCTAGGCATGTGGCTGA
3061 SEQ ID NO: 1903 -6.1 -24.9 73.3 -17.5 -1.2 -6.1 AAAAAGTCCTTGTTTGTCTC
3197 SEQ ID NO: 1904 -6.1 -20.1 61.7 -14 0 -3.2 AAAAAAAGTCCTTGTTTGTC
3199 SEQ ID NO: 1905 -6.1 -17.4 54.6 -11.3 0 -4.4 GCACAGATGTTCTCCTGGTT
3266 SEQ ID NO: 1906 -6.1 -26.4 77.3 -19.5 -0.6 -4.6 TGGCACAGATGTTCTCCTGG
3268 SEQ ID NO: 1907 -6.1 -26.3 75.8 -19.5 -0.4 -5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GGTGTCACACTTCCTCCCGA
3314 SEQ ID NO: 1908 -6.1 -29.9 81.5 -22.6 -1.1 -7.5
CTTAGAAAACCTAAGTACAA
3360 SEQ ID NO: 1909 -6.1 -16.4 51.9 -8.6 -1.7 -6.2
GTTTAGGCTCGGGTCCTATT
3639 SEQ ID NO: 1910 -6.1 -26.9 77.7 -19.7 -1 -8.5
CATCAATGAATTTTGTGTTT
3655 SEQ ID NO: 1911 -6.1 -17.9 56.4 -11.8 0 -4.8
GAGCACCAACAAGACAAAAA
3784 SEQ ID NO: 1912 -6.1 -18.2 54.1 -12.1 0 -4.1
AAAACCACCTCTTGGTGTTT
186 SEQ ID NO: 1913 -6 -23.1 66.1 -13.9 -3.2 -8.9
CAAAAACCACCTCTTGGTGT
188 SEQ ID NO: 1914 -6 -22.9 64.5 -13.9 -3 -7.4
GCAGCAAAGCAATAGCAGAG
289 SEQ ID NO: 1915 -6 -22.2 64.6 -14.5 -1.7 -7.2
CTGGGTCCTTGGAGGTGCGG
411 SEQ ID NO: 1916 -6 -29.9 82.3 -23.1 -0.6 1-5.9
TCCTTCTCCTGCAGCCAGTC
700 SEQ ID NO: 1917 -6 -30.6 86.9 -23.7 -0.8 -8.1
GAGAGAAAAATCGTCCTTCT
713 SEQ ID NO: 1918 -6 -20.1 59.7 -13.6 -0.2 -3.7
ATTTTCATCTGATAATGGTA
1291 SEQ ID NO: 1919 -6 -18.4 58.2 -12.4 0 -4.4
AGAGTCTGGGAATCTGCATT
1378 SEQ ID NO: 1920 -6 -23.3 69.5 -16.5 -0.6 -5.4
GACCAGGAAGGTGTTGGTGG
1433 SEQ ID NO: 1921 -6 -25.9 74.2 -18.2 -1.7 -6.7
TCGGTGTAGACCAGGAAGGT
1441 SEQ ID NO: 1922 -6 -25.5 72.9 -17.7 -1.8 -6.5
TCGTTTTTCATCCTCCAGCC
1708 SEQ ID NO: 1923 -6 -28.1 78.7 -22.1 0 -3.2
TTGCTGGCAAGACTTGCCCG
1763 SEQ ID NO: 1924 -6 -28.2 75.2 -18.7 -3.5 -12.6
GAGGCAGCAAGAGCTATAGC
1936 SEQ ID NO: 1925 -6 -24.6 72.2 -17 -1.6 -9.7
GCTCGCCCAGCAACTGAGAA
2065 SEQ ID NO: 1926 -6 -27.8 74.2 -20.4 -1.3 -5.8
ACGTAAGCAGTATGGTCAGT
2262 SEQ ID NO: 1927 -6 -23.3 69.4 -16.8 -0.2 -4.7
GAGCAGGACGGAATGGCTAA
2283 SEQ ID NO: 1928 -6 -23.9 67 -17 -0.7 -4.9
GAGCTGGGGAGCAGGACGGA
2291 SEQ ID NO: 1929 -6 -28.6 78.8 -21 -1.6 -6.4
GGGTTCCAAATGGAGAGGCT
2424 SEQ ID NO: 1930 -6 -25.7 72.7 -19.2 -0.2 -7.5
ATATGTCATAACTTCTATCT
2750 SEQ ID NO: 1931 -6 -18.5 58.9 -12.5 0 -3.6
GTTTCTGTGTACACAGATGT
2777 SEQ ID NO: 1932 -6 -22.4 69.1 -11.8 -2.6 -17.3
GTGTAAGTGTCTCAGATATT
2945 SEQ ID NO: 1933 -6 -20.6 65.1 -14.6 0 -3.3
AAATCTTTTGAAAAGTGTAA
2959 SEQ ID NO: 1934 -6 -14.1 47.8 -7.2 -0.8 -5.9
ATATAAGTCTAGGCATGTGG
3065 SEQ ID NO: 1935 -6 -21 64.3 -15 0 -6.1
AGATAGACTTTGCCTCCAGG
3123 SEQ ID NO: 1936 -6 -25.2 72.6 -19.2 0 -4.1
3150 GCTGCAAAAGTCTTCATGGA -6 -22.6 66.2 -16.6 0 -5.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Intertotal form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1937
CTTGAGAACATATCTTGAAA
3455 SEQ ID NO: 1938 -6 -16.7 53.1 -9.9 -0.6 -3.9 CCACAAACCATGCTTCATGT
3739 SEQ ID NO: 1939 -6 -24.2 67.5 -16.8 -1.3 -5.7 ATGTACAGCCAATAATATG
3864 SEQ ID NO: 1940 -6 -19.5 58.6 -12.8 -0.5 -7.6 TGCCCCGCCACACCCCCTCC
231 SEQ ID NO: 1941 -5.9 -39.5 92 -33.6 0 -3 GGTTAAACCTCACAGATGGT
390 SEQ ID NO: 1942 -5.9 -22.9 66.8 -15.4 -1.6 -6.5 GGGTCCTTGGAGGTGCGGAG
409 SEQ ID NO: 1943 -5.9 -29.6 82.3 -22.9 -0.6 -5.9 AAAGCTGGTGGGCCAGGGGG
624 SEQ ID NO: 1944 -5.9 -29.4 79.7 -20.3 -3.2 -9.4 GCTGTGTCCCACCACCCTGG
665 SEQ ID NO: 1945 -5.9 -33.4 87.3 -26.6 -0.8 -5 CCTGTGATTCGGCCCACCGT
805 SEQ ID NO: 1946 -5.9 -31.9 81.3 -23.5 -2.5 -9.2 GGCCCGGCAGGATCCAAACC
823 SEQ ID NO: 1947 -5.9 -31.2 78.8 -24.2 -0.7 -9.7 TTGGGGTAGATGTCAATGTG
964 SEQ ID NO: 1948 -5.9 -22 66.4 -16.1 0 -3.8 ACATGGATTTTCATCTGATA
1297 SEQ ID NO: 1949 -5.9 -19.7 60.9 -13.8 0.1 -5.5 GGAAGGTGTTGGTGGCATTC
1428 SEQ ID NO: 1950 -5.9 -25.4 74.8 -19.5 0 -4 GCGAGGAGTCCCAGCCATCA
1900 SEQ ID NO: 1951 -5.9 -30.9 82.9 -23.9 -1 -7.8 TACAGGCTCGCCCAGCAACT
2070 SEQ ID NO: 1952 -5.9 -29.1 77.7 -21.8 -1.3 -7.3 AGGCAGAGTACAGGCTCGCC
2078 SEQ ID NO: 1953 -5.9 -29 81.2 -18.7 -4.4 -10.4 CTTATATCCTATAGCCTCCC
2525 SEQ ID NO: 1954 -5.9 -26.2 73.9 -20.3 0 -5 AATAGAAACCACTTAAAGCC
2560 SEQ ID NO: 1955 -5.9 -18.4 55.1 -12.5 0 -3.2 GTATTAAAGTAAAATATTTC
2855 SEQ ID NO: 1956 -5.9 -12.4 44.7 -6.5 0 -6.6 AGGCACTGGTATTAAAGTAA
2863 SEQ ID NO: 1957 -5.9 -19.5 59.6 -13.1 -0.2 -4 ACTCTAATTAGGCAATGCAT
2983 SEQ ID NO: 1958 -5.9 -20.7 62 -13.9 -0.7 -8 ACTAACTAGTATATAAGTCT
3075 SEQ ID NO: 1959 -5.9 -17 55.4 -11.1 0 -6.3 TCAGAGATAGACTTTGCCTC
3127 SEQ ID NO: 1960 -5.9 -23 69.2 -16.6 -0.1 -4.5 CTGCAAAAGTCTTCATGGAG
3149 SEQ ID NO: 1961 -5.9 -20.8 62.3 -14.9 0 -5.9 AAAAAAAAGTCCTTGTTTGT
3200 SEQ ID NO: 1962 -5.9 -16.3 51.7 -10.4 0 -4.4 GCTTGAGAACATATCTTGAA
3456 SEQ ID NO: 1963 -5.9 -19.2 58.9 -13.3 0 -3.9 TGCCCCAGAACGAGATCTGC
39 SEQ ID NO: 1964 -5.8 -27.7 74.1 -21 -0.8 -6.3 AAACCACCTCTTGGTGTTTC
185 SEQ ID NO: 1965 -5.8 -24.2 69.8 -15.4 -3 -8.8 AGAGCAGAGGAACGGAGTTG
258 SEQ ID NO: 1966 -5.8 -22.9 66.8 -15.3 -1.8 -7.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo AGCATCCTTCATGCTCTGGG 426 SEQ ID NO: 1967 -5.8 -27.4 78.6 -18.7 -2.9 -7.5
AATGATGAAAAAGGTTTTAG 500 SEQ ID NO: 1968 -5.8 -14.1 47.6 -7.6 -0.4 -4.4
TGAATGATGAAAAAGGTTTT 502 SEQ ID NO: 1969 -5.8 -15 49.2 -8.7 -0.2 -4.1
GTCCATCCGTGAATGATGAA 511 SEQ ID NO: 1970 -5.8 -23.1 65.2 -16.1 -1.1 -4.6
CCGATCAAGTGGACATTCCC 733 SEQ ID NO: 1971 -5.8 -26.2 71.4 -19.5 -0.8 -6.1
GCATCTGAATACCAATGCTC 936 SEQ ID NO: 1972 -5.8 -22.7 65.7 -14.7 -2.2 -6.5
GAGTCCACAGCCTGGCTGGA 995 SEQ ID NO: 1973 -5.8 -30.2 83.6 -20.8 -2.9 -15.1
GCCAATGCTATTACAACGGT 1193 SEQ ID NO: 1974 -5.8 -23.6 66 -17.2 -0.3 -4.1
TGAGAAGAATCCTTCCATTG 1842 SEQ ID NO: 1975 -5.8 -21 62 -13.1 -2.1 -7
CGCGAGGAGTCCCAGCCATC 1901 SEQ ID NO: 1976 -5.8 -31 81.4 -24.1 -1 -8.3
ACAGGCTCGCCCAGCAACTG 2069 SEQ ID NO: 1977 -5.8 -29.4 78 -21.5 -2.1 -7.8
CCAGGCCTGCCATCCTGACA 2200 SEQ ID NO: 1978 -5.8 -31.9 83.5 -23.9 -2 -11.9
AAGCCAATGATGTGTGCTTC 2318 SEQ ID NO: 1979 -5.8 -23.3 67.9 -16 -1.4 -5.6
CATTCTAATTAATTTTAAGT 2384 SEQ ID NO: 1980 -5.8 -14.7 49.6 -8.9 0 -6.2
CCAGGTGCCTTTCCCCATGC 2498 SEQ ID NO: 1981 -5.8 -32.9 86.3 -27.1 0 -6.6
ACATAATAACTAAGAAGAAA 2578 SEQ ID NO: 1982 -5.8 -12.1 43.5 -6.3 0 -2.2
CCCCAGCATGAATGATACTC 2670 SEQ ID NO: 1983 -5.8 -24.9 69.1 -19.1 0 -4.8
ATAGTTGCCCTTCTCCCCCT 3003 SEQ ID NO: 1984 -5.8 -32.4 86.2 -26.6 0 -3
GCAAAAGTCTTCATGGAGTT 3147 SEQ ID NO: 1985 -5.8 -21.2 64 -14.9 -0.2 -6.5
TCCATTAGTAAAAACAGAAG 3899 SEQ ID NO: 1986 -5.8 -15.8 50.8 -10 0 -3.9
ACCTCTTGGTGTTTCCAGCA 180 SEQ ID NO: 1987 -5.7 -27.9 80 -20.9 -1.2 -6.2
ATGGTTTGACCTCAGTCTGT 375 SEQ ID NO: 1988 -5.7 -25.1 75 -17.8 -1.6 -6.2
GGAGGTTAAACCTCACAGAT 393 SEQ ID NO: 1989 -5.7 -22.3 65.3 -12.3 -4.3 -11.9
CCACCACCCTGGTATTATTG 657 SEQ ID NO: 1990 -5.7 -26.7 72.7 -19.3 -1.7 -5.7
TCCCCTCCCGCGAGGAGTCC 1909 SEQ ID NO: 1991 -5.7 -35.1 88.2 -26.5 -2.5 -13.6
CACTGAGGCTCAAAGCAGGC 2152 SEQ ID NO: 1992 -5.7 -25.5 72.5 -17.8 -2 -6.1
AGACGTAAGCAGTATGGTCA 2264 SEQ ID NO: 1993 -5.7 -22.7 67.4 -16 -0.9 -5.6
GGAGCAGGACGGAATGGCTA 2284 SEQ ID NO:1994 -5.7 -25.8 71.7 -19.2 -0.7 -4.9
AATAGGAAAGCCAATGATGT 2325 SEQ ID NO: 1995 -5.7 -19 56.9 -12.1 -1.1 -3.9
2496 AGGTGCCTTTCCCCATGCAT -5.7 -30.9 83 -24.3 -0.7 -6.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 1996
AATGCTTATATCCTATAGCC 2529 SEQ ID NO:1997 -5.7 -22 64.9 -15.6 -0.5 -5
CGTCACTCATAGGGGAGGTG 2622 SEQ ID NO:1998 -5.7 -25.6 73.9 -19.9 0.1 -4.6
GGCACTGGTATTAAAGTAAA 2862 SEQ ID NO:1999 -5.7 -18.8 57.5 -13.1 0 -4
GGCAATGCATACACAAATCT 2973 SEQ ID NO:2000 -5.7 -20.9 61 -14.3 -0.7 -8
CTCTCCCTGGCTGCACCACT 3092 SEQ ID NO:2001 -5.7 -31.9 85.7 -24.9 -1.2 -8.4
GTTTCAGAGATAGACTTTGC 3130 SEQ ID NO:2002 -5.7 -21.1 65.7 -14.9 -0.1 -3.4
TAAAAGGGCTTAGGATTTTA 3237 SEQ ID NO: 2003 -5.7 -18.3 56.8 -12.6 0 -3.8
CCTCCCGAATCTCAGCCATA 3302 SEQ ID NO:2004 -5.7 -28.6 75.8 -22.9 0 -3.2
CTTGAAATAAGACTCAACTG 3442 SEQ ID NO:2005 -5.7 -16.4 52.2 -10.1 -0.3 -3.5
ACCTGTACAAGCTTCGCTTT 3517 SEQ ID NO:2006 -5.7 -25.1 71.3 -17.8 -1.5 -7.8
TCAATGAATTTTGTGTTTAG 3653 SEQ ID NO:2007 -5.7 -16.9 54.7 -11.2 0 -4.1
CACAAACCATGCTTCATGTA 3738 SEQ ID NO:2008 -5.7 -21.9 63.4 -14.8 -1.3 -5.7
GACCAGGATGTACAGCCAAT 3871 SEQ ID NO:2009 -5.7 -24.9 69.9 -19.2 0.1 -6.3
CCACAACTACATTGGCGTCT 594 SEQ ID NO:2010 -5.6 -25 69.6 -18.4 -0.9 -5.2
CATGGGCCCGGCAGGATCCA 827 SEQ ID NO:2011 -5.6 -32.3 82.9 -24.9 -1-.5 -11.2
CAAACATGGGCCCGGCAGGA 831 SEQ ID NO:2012 -5.6 -28.7 74.1 -21.5 -0.7 -11.2
CATGCTCACATTTTACCACC 1056 SEQ ID NO:2013 -5.6 -24.5 69.5 -18.2 -0.4 -3.6
CCCTCCCAGGTGAGCTGGAT 1486 SEQ ID NO:2014 -5.6 -31.5 84.3 -23.4 -2.5 -7.6
GCCCCCTCCCAGGTGAGCTG 1489 SEQ ID NO:2015 -5.6 -35.5 91.4 -29 -0.8 -5.8
GAAACTCCTTCCACAGGTTG 1524 SEQ ID NO:2016 -5.6 -24.2 69 -17.7 -0.8 -5.4
CTGGAGGTGTGGACAGAGGT 1978 SEQ ID NO:2017 -5.6 -26 76.5 -19.8 -0.3 -4
GCTGGGGAGCAGGACGGAAT 2289 SEQ ID NO:2018 -5.6 -27.3 74.7 -20.2 -1.4 -6.2
GTCCCTAATGCTTATATCCT 2535 SEQ ID NO:2019 -5.6 -25 71.4 -19.4 0 -3.6
CTAACTAGTATATAAGTCTA 3074 SEQ ID NO:2020 -5.6 -16.5 54.3 -10.9 0 -6.3
TCCTTGTTTGTCTCACGTCT 3191 SEQ ID NO:2021 -5.6 -25.9 76.6 -20.3 0 -4.6
AAAGTCCTTGTTTGTCTCAC 3195 SEQ ID NO:2022 -5.6 -22.4 68 -16.8 0 -3.2
GGCTCTATATAAAAAAAAAA 3212 SEQ ID NO:2023 -5.6 -12 43.1 -6.4 0 -3.7
TTATGTATATGCAAACATTC 3605 SEQ ID NO-.2024 -5.6 -16.9 54.1 -10.4 -0.7 -7.4
GGCTCGGGTCCTATTCCCAA 3634 SEQ ID NO:2025 -5.6 -30.2 80.9 -23.1 -1.4 -6.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
ATCGTATAAAATTACCCTCA 3702 SEQ ID NO:2026 -5.6 -19.7 58.2 -14.1 0 -3.2
AAATCCAAAACTTTTTGAGC 3800 SEQ ID NO:2027 -5.6 -17.5 54 -11.2 -0.5 -6.8
ACAGAAGTCAGAAGTGACCA 3886 SEQ ID NO:2028 -5.6 -21.7 64.5 -13.7 -2.4 -6
CCCCTCCCAAGAAACAGAAG 218 SEQ ID NO:2029 -5.5 -25.3 67.1 -19.8 0 -1.8
AACCACAACTACATTGGCGT 596 SEQ ID NO: 2030 -5.5 -23.2 64.8 -17 -0.4 -4.7
CCAGGGGGAGCCAGTCAACC 612 SEQ ID NO: 2031 -5.5 -30.4 81.7 -23.5 -1.3 -4.4
AGAGAAAAATCGTCCTTCTC 712 SEQ ID NO: 2032 -5.5 -19.9 59.8 -12.7 -1.7 -6.2
GTTCCTTTCACGAAGTTGCC 787 SEQ ID NO: 2033 -5.5 -25.9 73.4 -19.7 -0.4 -3.8
CATCGTTGAGTCCACAGCCT
1002 SEQ ID NO: 2034 -5.5 -27.7 77.2 -22.2 0 -0.7 ACATCGTTGAGTCCACAGCC
1003 SEQ ID NO: 2035 -5.5 -27 75.8 -21.5 0 -3.8 ATTGATCCCAAGACATCGTT
1015 SEQ ID NO:2036 -5.5 -23.1 65.8 -16.9 -0.5 -4.3
TGTGATTGTTCCATATGCAA 1034 SEQ ID NO:2037 -5.5 -21.8 64.7 -16.3 0 -5.8
TTGAAGCGATTGGAGTCAGT 1144 SEQ ID NO: 2038 -5.5 -22.6 66.8 -17.1 0 -5
AAACTCTGAAAGGCATGCCT 1272 SEQ ID NO:2039 -5.5 -22.6 64.2 -13.9 -0.2 -14.5
TCCCGACACTTGCGAAACCA 1687 SEQ ID NO:2040 -5.5 -26.6 69 -21.1 0 -4.3
CCATGGGCTTGGATAGCAGG 1796 SEQ ID NO:2041 -5.5 -27.1 75.7 -19.4 -2.2 -10.8
GGACAGAGGTTTGGAGTTAG 1968 SEQ ID NO:2042 -5.5 -22.7 69.2 -17.2 0 -3.8
AGTCAGCTCCTGTCGGAAGG 2178 SEQ ID NO: 2043 -5.5 -27 77.2 -20.6 -0.7 -5.5
ATGTCATAACTTCTATCTCT 2748 SEQ ID NO: 2044 -5.5 -20.1 63.1 -14.6 0 -2.5
TACACAAATCTTTTGAAAAG 2964 SEQ ID NO:2045 -5.5 -14.2 47.7 -7.2 -1.4 -5.7
GCAATGCATACACAAATCTT 2972 SEQ ID NO: 2046 -5.5 -19.8 58.9 -14.3 0 -7.4
AATAAAAGGGCTTAGGATTT 3239 SEQ ID NO:2047 -5.5 -17.8 55.2 -12.3 0 -3.7
TTGGTGTCACACTTCCTCCC 3316 SEQ ID NO:2048 -5.5 -28.6 80.8 -21.9 -1.1 -6.7
GCTTGGTGTCACACTTCCTC 3318 SEQ ID NO:2049 -5.5 -27.3 80.2 -21.2 -0.3 -5.9
CAAAATCCAAAACTTTTTGA 3802 SEQ ID NO:2050 -5.5 -15.7 49.9 -9.1 -1 -7.3
AACGAGATCTGCCCTCGTCC 31 SEQ ID NO:2051 -5.4 -28.3 75.6 -19.5 -3.4 -9.2
AAAAACCACCTCTTGGTGTT 187 SEQ ID NO: 2052 -5.4 -22.3 63.7 -13.9 -3 -7.9
GCTCATCCTGCCCCGCCACA 239 SEQ ID NO: 2053 -5.4 -35.1 88.1 -29.7 0 -3.1
GTAGCCGATCAAGTGGACAT 737 SEQ ID NO: 2054 -5.4 -24.4 69.4 -19 0 -4.9
1021 TATGCAATTGATCCCAAGAC -5.4 -21.4 62.1 -15.3 -0.5 -7.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligc oligo SEQ ID NO: 2055
ATGGATTTTCATCTGATAAT
1295 SEQ ID NO: 2056 -5.4 -18.1 57 -11.8 -0.7 -4.5 CATGGATTTTCATCTGATAA
1296 SEQ ID NO: 2057 -5.4 -18.8 58.3 -12.5 -0.7 -4.5 GGTTGTACCAAGACTGAGAG
1509 SEQ ID NO: 2058 -5.4 -22.5 66.7 -16.1 -0.9 -4.7 TCCCCAGACTTCACCCGGAT
1597 SEQ ID NO: 2059 -5.4 -30.8 79.6 -25.4 0 -6.4 TCAGGGAAGCTCCACAGTGG
1736 SEQ ID NO: 2060 -5.4 -26.5 75.6 -19.5 -1.6 -9.5 TCCTCAGCAGTAACTTTCCT
1816 SEQ ID NO: 2061 -5.4 -25.7 74.6 -20.3 0 -4.1 CCCCTCCCGCGAGGAGTCCC
1908 SEQ ID NO: 2062 -5.4 -36.7 89.4 -28.4 -2.5 -13.6 TGGAGGTGTGGACAGAGGTT
1977 SEQ ID NO: 2063 -5.4 -25.2 74.8 -19.8 0.3 -4 GTACAGGCTCGCCCAGCAAC
2071 SEQ ID NO: 2064 -5.4 -29.4 79.2 -21.9 -2.1 -7.8 CCCAACAGCTAGGGCCCGAG
2227 SEQ ID NO: 2065 -5.4 -30.9 79.1 -23.6 -0.9 -11.8 GCTCAATTAAAAAATGAACA
2349 SEQ ID NO: 2066 -5.4 -14.2 47.1 -8.8 0 -3 CTGGGTTCCAAATGGAGAGG
2426 SEQ ID NO: 2067 -5.4 -23.9 68.3 -17.9 -0.3 -7.5 CTAGTGATCAAACACGTCAC
2636 SEQ ID NO: 2068 -5.4 -20.5 61.2 -13.5 -1.6 -6.7 ACATATGTCATAACTTCTAT
2752 SEQ ID NO: 2069 -5.4 -18.1 57.4 -12.2 0 -7.6 CTGTATTAAATCTTAGAACC
2818 SEQ ID NO: 2070 -5.4 -17.4 54.9 -12 0 -2.8 TATTAAAGTAAAATATTTCA
2854 SEQ ID NO: 2071 -5.4 -11.9 43.5 -6.5 0 -6.6 TACTCTAATTAGGCAATGCA
2984 SEQ ID NO: 2072 -5.4 -20.4 61.4 -14.1 -0.7 AATAATAGTTGCCCTTCTCC
3007 SEQ ID NO: 2073 -5.4 -23.8 68.4 -18.4 0 -3 CTCCCTGGCTGCACCACTAA
3090 SEQ ID NO: 2074 -5.4 -29.6 78.9 -23.1 -1 -8.2 GAGATAGACTTTGCCTCCAG
3124 SEQ ID NO: 2075 -5.4 -24.6 71.3 -19.2 0 -3 ATTAAAACAATGTCCTTAGA
3374 SEQ ID NO: 2076 -5.4 -16.8 53.1 -11.4 0 -4 ATCACAGAAACAAGAGAAGC
3485 SEQ ID NO: 2077 -5.4 -17.7 54.9 -12.3 0 -2 TCTGAAAATAATCTAAAATT
3580 SEQ ID NO: 2078 -5.4 -11.8 43.1 -6.4 0 -2 AAAATCTGAAAATAATCTAA
3584 SEQ ID NO: 2079 -5.4 -11 41.5 -5.6 0 -3 ATGTACACAACTATTTAAAA
3723 SEQ ID NO: 2080 -5.4 -14.6 48.6 -9.2 0 -6 AATCCAAAACTTTTTGAGCA
3799 SEQ ID NO: 2081 -5.4 -18.9 56.9 -12.4 -1 -7 CCAAAATCCAAAACTTTTTG
3803 SEQ ID NO: 2082 -5.4 -17.1 52.2 -10.5 -1.1 -6 TCCAAAATCCAAAACTTTTT
3804 SEQ ID NO: 2083 -5.4 -17.5 53.3 -12.1 0 -3 CCCCCTCCCAAGAAACAGAA
219 SEQ ID NO: 2084 -5.3 -27.3 70 -22 0 -1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GAGCTTATCTTCCAGCCGTC
338 SEQ ID NO: 2085 -5.3 -27.8 79 -21.6 -0.8 -5.2
GAGGTTAAACCTCACAGATG
392 SEQ ID NO: 2086 -5.3 -21.1 62.6 -12.3 -3.5 -11.3
TTCATGCTCTGGGTCCTTGG
419 SEQ ID NO: 2087 -5.3 -27.4 79.3 -22.1 0 -4.4
GAGAGGTAGCATCCTTCATG
433 SEQ ID NO: 2088 -5.3 -24.3 72.1 -18.1 -0.6 -8.6
AAAAAGGTTTTAGCTGTCAT
493 SEQ ID NO: 2089 -5.3 -18.6 57.7 -13.3 0 -6.8
GAAAAAGGTTTTAGCTGTCA
494 SEQ ID NO: 2090 -5.3 -19.2 59 -13.2 -0.4 -8.1
TCGGCCCCTTCAAACATGGG
841 SEQ ID NO: 2091 -5.3 -28.2 73.8 -22.1 -0.6 -7.8
TGTCGGCCCCTTCAAACATG
843 SEQ ID NO: 2092 -5.3 -27 72.1 -21.7 0 -6.2
AGCCGAAGGAACGCGTGTAG
915 SEQ ID NO: 2093 -5.3 -25.3 68.1 -17.3 -2.1 -13.2
GTGATTGTTCCATATGCAAT
1033 SEQ ID NO: 2094 -5.3 -21.8 64.7 -15.7 -0.6 -7.4
GGAAGGCAAAACTCGGCTTG
1119 SEQ ID NO: 2095 -5.3 -23 64.4 -17.7 0.3 -4
TAAACTCTGAAAGGCATGCC
1273 SEQ ID NO: 2096 -5.3 -21.4 61.8 -13.9 0 -12.5
ACTTGGTGCTCTGGAGGTGT
1988 SEQ ID NO: 2097 -5.3 -27 80 -21.7 0 -6.4
AGTACAGGCTCGCCCAGCAA
2072 SEQ ID NO: 2098 -5.3 -29.2 78.9 -21.8 -2.1 -8.5
TCTAATTAATTTTAAGTGTT
2381 SEQ ID NO: 2099 -5.3 -15.2 51.1 -9.9 0 -6.2
GTCCATTACCACATTCTAAT
2395 SEQ ID NO: 2100 -5.3 -22.3 65.3 -17 0 -2.1
TGTCCATTACCACATTCTAA
2396 SEQ ID NO: 2101 -5.3 -22.3 65.2 -17 0 -2.8
AGAAACCACTTAAAGCCTCA
2557 SEQ ID NO: 2102 -5.3 -21.4 61.5 -16.1 0 -3.2
TATTAAATCTTAGAACCAGC
2815 SEQ ID NO: 2103 -5.3 -17.8 55.5 -12.5 0 -3
CAAAAGTCTTCATGGAGTTT
3146 SEQ ID NO: 2104 -5.3 -19.5 60.1 -12.9 -1.2 -6.5
TAAGACTCAACTGGTTATGT
3435 SEQ ID NO: 2105 -5.3 -19.6 60.5 -14.3 0 -4.7
AAAATCCAAAACTTTTTGAG
3801 SEQ ID NO: 2106 -5.3 -15 48.9 -8.6 -1 -7.3
AGAACGAGATCTGCCCTCGT
33 SEQ ID NO: 2107 -5.2 -26.5 72.2 -18.1 -3.2 -9
TGGGTCCTTGGAGGTGCGGA
410 SEQ ID NO:2108 -5.2 -29.6 81.7 -23.9 -0.1 -5.9
TCTCCTGCAGCCAGTCGAGC
696 SEQ ID NO: 2109 -5.2 -30.4 84.6 -24 -1.1 -8.1
ACCTGTGATTCGGCCCACCG
806 SEQ ID NO: 2110 -5.2 -30.9 78.7 -23.5 -2.2 -9.2
GCAGGATCCAAACCTGTGAT
817 SEQ ID NO: 2111 -5.2 -24.9 69.6 -17.3 -2.4 -9
GCCTGGCTGGAAGTCACCCC
986 SEQ ID NO: 2112 -5.2 -32.2 85 -25.6 -1.3 -9.4
GAGGTGGACGGCTCGCTCAT
1073 SEQ ID NO: 2113 -5.2 -28.7 78.8 -22.8 -0.5 -6.1
1688 ATCCCGACACTTGCGAAACC -5.2 -25.9 68 -20.7 0 -4.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligc SEQ ID NO: 2114
CTCTTCGGAGCCAGCGTTCC
2103 SEQ ID NO: 2115 -5.2 -30.1 81.8 -24 -0.7 -5.1 GCCAATGATGTGTGCTTCAG
2316 SEQ ID NO: 2116 -5.2 -24.7 71.3 -19.5 0 -3.8 GGGTCCCTAATGCTTATATC
2537 SEQ ID NO: 2117 -5.2 -24.5 71 -19.3 0 -5.3 GTATTAAATCTTAGAACCAG
2816 SEQ ID NO: 2118 -5.2 -17.2 54.5 -12 0 -3 TGTATTAAATCTTAGAACCA
2817 SEQ ID NO: 2119 -5.2 -17.2 54.3 -12 0 -3 CCACTAACTAGTATATAAGT
3077 SEQ ID NO: 2120 -5.2 -18.4 57.4 -13.2 0 -6.3 CCTCCAGGAAATCTGAGTCC
3111 SEQ ID NO: 2121 -5.2 -25.9 72.7 -19.6 • -1 -5.8 GCCTCCAGGAAATCTGAGTC
3112 SEQ ID NO: 2122 -5.2 -25.7 73.4 -19.7 -0.6 -5 CCTTGTTTGTCTCACGTCTG
3190 SEQ ID NO: 2123 -5.2 -25.5 74.6 -20.3 0 -4.6 CCTGGTTATACATTAATAAA
3253 SEQ ID NO: 2124 -5.2 -17.1 53.6 -11.9 0 -4.2 TACAAAGAAAATCATTCTTC
3345 SEQ ID NO:2125 -5.2 -14.7 49.1 -7 -2.5 -6.5 ACACTTCTGGTTCCAAGCAT
3556 SEQ ID NO: 2126 -5.2 -24.8 71.7 -19.6 0 -5 TTTTTGAGCACCAACAAGAC
3789 SEQ ID NO: 2127 -5.2 -20.7 61.2 -15 -0.2 -4.6 CTCCAAAATCCAAAACTTTT
3805 SEQ ID NO: 2128 -5.2 -18.3 54.7 -13.1 0 -2.7 TTCCATTAGTAAAAACAGAA
3900 SEQ ID NO: 2129 -5.2 -15.9 51 -10.7 0 -3.4 CCTCTGGACCAAAAGGTACG
318 SEQ ID NO: 2130 -5.1 -23.9 65.8 -18.3 -0.1 -5.2 GTGGAGCTTATCTTCCAGCC
341 SEQ ID NO: 2131 -5.1 -27.8 80.1 -21.1 -1.6 -6.1 GTGGGCCAGGGGGAGCCAGT
617 SEQ ID NO: 2132 -5.1 -33.2 90.7 -25.6 -2.5 -9.1 TAAAGCTGGTGGGCCAGGGG
625 SEQ ID NO: 2133 -5.1 -27.9 76.6 -20.3 -2.5 -8.7 GCCCCTTCAAACATGGGCCC
838 SEQ ID NO: 2134 -5.1 -31.6 80.4 -24 -2.5 -9.8 CCAAGACATCGTTGAGTCCA
1008 SEQ ID NO: 2135 -5.1 -24.9 70 -18.9 -0.7 -4.4 AGAGGTGGACGGCTCGCTCA
1074 SEQ ID NO:2136 -5.1 -28.7 79.2 -22.2 -1.3 -6.1 ACTGGAAGGCAAAACTCGGC
1122 SEQ ID NO: 2137 -5.1 -23.1 64.6 -17.5 -0.2 -4.1 TCCTCCATGGGCTTGGATAG
1800 SEQ ID NO:2138 -5.1 -27.1 76.4 -20.7 -1.2 -9.5 GGTCAAGGCTGAGAAGAATC
1851 SEQ ID NO: 2139 -5.1 -21.5 64.3 -15.6 -0.6 -4.3 CCATCACAGGAGACCAGTTG
1886 SEQ ID NO: 2140 -5.1 -25.3 71.9 -19.6 -0.3 -3.7 GAGGCTCAAAGCAGGCTGAG
2148 SEQ ID NO: 2141 -5.1 -25.2 72.4 -18.1 -2 -7.6 TTGCTCAATTAAAAAATGAA
2351 SEQ ID NO: 2142 -5.1 -13.4 45.8 -8.3 0 -3.6 TTCTAATTAATTTTAAGTGT
2382 SEQ ID NO: 2143 -5.1 -15.2 51.1 -10.1 0 -6.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
ATTCTAATTAATTTTAAGTG
2383 SEQ ID NO: 2144 -5.1 -14 48.3 -8.9 0 -5.9
CTAGAAATCCCAACTCCACT
2444 SEQ ID NO: 2145 -5.1 -23.5 65.7 -18.4 0 -3
TTTCCCCATGCATATACACA
2489 SEQ ID NO: 2146 -5.1 -25 69.7 -19.9 0 -6.8
GAATGATACTCTGCTTGCTA
2661 SEQ ID NO: 2147 -5.1 -21.8 65.2 -16.7 0 -4.5
TCTCCCTGGCTGCACCACTA
3091 SEQ ID NO: 2148 -5.1 -30.7 83.2 -24.3 -1.2 -8.4
AAAGTCCAACCGTTGGCACA
3281 SEQ ID NO: 2149 -5.1 -25.1 68.4 -17.4 -2.6 -11.5
AACAGTGATACAACTTTGGC
3403 SEQ ID NO: 2150 -5.1 -20.2 60.9 -15.1 0 -4.6
TATAAAATTACCCTCAGGCT
3698 SEQ ID NO: 2151 -5.1 -21.2 61.7 -15.5 -0.3 -4.9
CCCAGAACGAGATCTGCCCT
36 SEQ ID NO: 2152 -5 -28.8 75.3 -22.4 -1.3 -6.3
AGCAGAGGAACGGAGTTGCT
256 SEQ ID NO: 2153 -5 -25 71.4 -17.7 -2.3 -7.7
TGGAGCTTATCTTCCAGCCG
340 SEQ ID NO: 2154 -5 -27.4 76.2 -21.1 -1.2 -5.8
TTGGGTTTGTGGAGCTTATC
349 SEQ ID NO: 2155 -5 -23.8 72.1 -18.8 0 -5.2
TCATGCTCTGGGTCCTTGGA
418 SEQ ID NO: 2156 -5 -27.9 80.3 -22.9 0 -5
GGGCCAGGGGGAGCCAGTCA
615 SEQ ID NO: 2157 -5 -33.1 90.1 -25.6 -2.5 -9.2
CCCCTTCAAACATGGGCCCG
837 SEQ ID NO: 2158 -5 -30.6 76.3 -24 -0.9 -11.2
TTTGAAGCGATTGGAGTCAG
1145 SEQ ID NO: 2159 -5 -21.5 63.9 -16.5 0 -5
GGTGTGGACAGAGGTTTGGA
1973 SEQ ID NO: 2160 -5 -25.3 74.8 -19.7 -0.3 -4
CTACACAGGGCCTCTTCGGA
2114 SEQ ID NO: 2161 -5 -27.9 77.2 -22.4 0 -7.7
TTCCCCATGCATATACACAT
2488 SEQ ID NO: 2162 -5 -24.9 69.3 -19.9 0 -6.8
ATTAAAGTAAAATATTTCAA
2853 SEQ ID NO: 2163 -5 -11.5 42.6 -6.5 0 -6.6
CTCCCCCTACTCTAATTAGG
2991 SEQ ID NO: 2164 -5 -26.3 72.9 -21.3 0.2 -7.5
AGACTTTGCCTCCAGGAAAT
3119 SEQ ID NO: 2165 -5 -24.1 68.3 -19.1 0 -5
TTAGAAAACCTAAGTACAAA
3359 SEQ ID NO: 2166 -5 -14.8 48.6 -9.2 -0.3 -6.2
TCAGAAGTTTAACAGTGATA
3413 SEQ ID NO: 2167 -5 -17.8 56.8 -12.8 0 -4.6
AGGCTCGGGTCCTATTCCCA
3635 SEQ ID NO: 2168 -5 -30.9 83.8 -24 -1.9 -6.9
CAACTATTTAAAATATCGTA
3716 SEQ ID NO: 2169 -5 -14.4 48 -9.4 0 -5
CACAACTATTTAAAATATCG
3718 SEQ ID NO: 2170 -5 -14.4 47.7 -9.4 0 -5
ACAAACCATGCTTCATGTAC
3737 SEQ ID NO: 2171 -5 -21.4 62.8 -15 -1.3 -5.7
CTTCCATTAGTAAAAACAGA
3901 SEQ ID NO: 2172 -5 -17.5 54.5 -12.5 0 -3.9
369 TGACCTCAGTCTGTGTAGCT -4.9 -26.1 77.9 -19.6 -1.6 -7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2173
TGTAGCCGATCAAGTGGACA
738 SEQ ID NO: 2174 -4.9 -24.4 69.3 -19.5 0 -4.9 GCCCGGCAGGATCCAAACCT
822 SEQ ID NO :2175 -4.9 -30.9 78.3 -25.2 -0.3 -9 CCACAAAATCTGCATCGTCC
882 SEQ ID NO: 2176 -4.9 -24.1 66.6 -19.2 0 -4.9 AATTGATCCCAAGACATCGT
1016 SEQ ID NO: 2177 -4.9 -22.3 63.5 -16.7 -0.5 -4.3 CAATTGATCCCAAGACATCG
1017 SEQ ID NO: 2178 -4.9 -21.8 61.7 -16.2 -0.5 -6.7 GCAATTGATCCCAAGACATC
1018 SEQ ID NO: 2179 -4.9 -22.8 65.2 -17.2 -0.5 -7.1 CTGTGATTGTTCCATATGCA
1035 SEQ ID NO: 2180 -4.9 -23.4 68.9 -18.5 0 -5.7 TGCGAAACTCCTTCCACAGG
1527 SEQ ID NO: 2181 -4.9 -25.5 69.7 -19.9 -0.5 -5 GGGTTGAGACAGGTAGCTGC
1544 SEQ ID NO: 2182 -4.9 -26.4 77.9 -19.9 -1.5 -3.5 ATGGGCTTGGATAGCAGGAA
1794 SEQ ID NO: 2183 -4.9 -24.3 70 -17.2 -2.2 -6 GTCCCAGCCATCACAGGAGA
1893 SEQ ID NO: 2184 -4.9 -29.2 80.7 -23.8 -0.1 -3.7 GACAGAGGTTTGGAGTTAGA
1967 SEQ ID NO: 2185 -4.9 -22.1 67.8 -17.2 0 -3.8 GGAGGTGTGGACAGAGGTTT
1976 SEQ ID NO: 2186 -4.9 -25.3 75.4 -19.8 -0.3 -3.5 ACAGCTAGGGCCCGAGCAAG
2223 SEQ ID NO: 2187 -4.9 -28.7 76.9 -21.4 -1.7 -12.8 CAGGACGGAATGGCTAAGAC
2280 SEQ ID NO: 2188 -4.9 -22.3 63.7 -17.4 0 -3.7 AATTAATTTTAAGTGTTCAA
2378 SEQ ID NO: 2189 -4.9 -14.6 49.3 -9.7 0 -5.8 GGCAGGTGCCGGTTTCTGTG
2788 SEQ ID NO: 2190 -4.9 -29.8 83.3 -23.2 -1.7 -10.3 AAGGCACTGGTATTAAAGTA
2864 SEQ ID NO: 2191 -4.9 -19.5 59.6 -13.8 -0.6 -4.1 TAGTTGCCCTTCTCCCCCTA
3002 SEQ ID NO: 2192 -4.9 -32.1 85.6 -27.2 0 -2.3 TAACTAGTATATAAGTCTAG
3073 SEQ ID NO: 2193 -4.9 -15.6 52.4 -9.8 -0.7 -6.3 ATTGGCTTGAGAACATATCT
3460 SEQ ID NO: 2194 -4.9 -20.5 62.2 -14.9 -0.4 -6.2 CAAACCATGCTTCATGTACA
3736 SEQ ID NO: 2195 -4.9 -21.9 63.4 -16.1 -0.8 -6.4 CCAGAACGAGATCTGCCCTC
35 SEQ ID NO: 2196 -4.8 -27.2 73.6 -21 -1.3 -6.3 GGGCTGGGGGACTGGAGGCA
128 SEQ ID NO: 2197 -4.8 -31.1 85.4 -25.4 -0.8 -5.2 TTGTGCAGCCAGTTTTCAAA
544 SEQ ID NO: 2198 -4.8 -23.5 68.6 -18.7 0 -5.3 ACCACAACTACATTGGCGTC
595 SEQ ID NO: 2199 -4.8 -24.3 68.3 -18.5 -0.9 -5.5 GTGATTCGGCCCACCGTTCC
802 SEQ ID NO: 2200 -4.8 -31.5 81.8 -24.2 -2.5 -9.2 TCTGATAATGGTAAACTCTG
1284 SEQ ID NO: 2201 -4.8 -18 56.4 -13.2 0 -2.6 GACATGGATTTTCATCTGAT
1298 SEQ ID NO:2202 -4.8 -20.6 62.8 -14.9 -0.7 -5.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GAAGGTGTTGGTGGCATTCT
1427 SEQ ID NO: 2203 -4.8 -25.1 74.1 -20.3 0 -4
CGGGGTTGAGACAGGTAGCT
1546 SEQ ID NO:2204 -4.8 -26.6 75.9 -21.1 -0.5 -4.9
ACCCCAACAGCTAGGGCCCG
2229 SEQ ID NO: 2205 -4.8 -32.5 81.2 -26 -1.2 -11.3
TAGTGATCAAACACGTCACT
2635 SEQ ID NO: 2206 -4.8 -20.5 61.2 -13.7 -2 -7.3
CCAGCATGAATGATACTCTG
2668 SEQ ID NO: 2207 -4.8 -21.8 63.8 -17 0 -4.8
ATATCTGGCAACCGGCCATC
2697 SEQ ID NO: 2208 -4.8 -27.1 73.4 -19.2 -3.1 -10
TATTACATATGTCATAACTT
2756 SEQ ID NO:2209 -4.8 -16.6 53.9 -11.3 0 -8.2
CACAAATCTTTTGAAAAGTG
2962 SEQ ID NO: 2210 -4.8 -15.5 50.3 -9.2 -1.4 -6
AGGCAATGCATACACAAATC
2974 SEQ ID NO: 2211 -4.8 -20 59.4 -14.3 -0.7 -8
CTACTCTAATTAGGCAATGC
2985 SEQ ID NO: 2212 -4.8 -20.6 62.1 -15.8 0 -6.9
CACTAACTAGTATATAAGTC
3076 SEQ ID NO: 2213 -4.8 -16.8 54.7 -12 0 -5.8
CTCCCGAATCTCAGCCATAA
3301 SEQ ID NO: 2214 -4.8 -25.9 70.3 -21.1 0 -3.2
CCTGCTTGGTGTCACACTTC
3321 SEQ ID NO: 2215 -4.8 -26.9 78.1 -20.9 -1.1 -6.7
TGGTTCCAAGCATTTTGGAT
3549 SEQ ID NO: 2216 -4.8 -23.5 68.4 -15.6 -3.1 -8.3
CACTTCTGGTTCCAAGCATT
3555 SEQ ID NO: 2217 -4.8 -24.7 71.5 -19.9 0 -5
AACACTTCTGGTTCCAAGCA
3557 SEQ ID NO: 2218 -4.8 -24.1 69.4 -19.3 0 -5
TGTAACTGACACATCAATGA
3666 SEQ ID NO: 2219 -4.8 -18.7 57.3 -13.2 -0.4 -4.7
AGCACCAACAAGACAAAAAA
3783 SEQ ID NO: 2220 -4.8 -16.9 51.5 -12.1 0 -4.1
GCTCCAAAATCCAAAACTTT
3806 SEQ ID NO: 2221 -4.8 -20 57.9 -15.2 0 -2.8
CGGGCGGTGGCAGGGAGCGA
71 SEQ ID NO: 2222 -4.7 -32.1 82.6 -25.8 -1.6 -7.2
CCCTCCCAAGAAACAGAAGT
217 SEQ ID NO: 2223 -4.7 -24.5 66.7 -19.8 0 -2.8
AGAGGTAGCATCCTTCATGC
432 SEQ ID NO: 2224 -4.7 -25.5 75.3 -18.7 -2.1 -8.6
CGGAGAGGTAGCATCCTTCA
435 SEQ ID NO: 2225 -4.7 -26.3 74.9 -20.4 -1.1 -6.9
CAAGCCGAAGGAACGCGTGT
917 SEQ ID NO: 2226 -4.7 -25.6 67.5 -18.3 -1.5 -13.2
CACAGCCTGGCTGGAAGTCA
990 SEQ ID NO: 2227 -4.7 -27.6 77.1 -19.3 -2.9 -15.1
TTTACCACCTCTGTGATTGT
1045 SEQ ID NO: 2228 -4.7 -24.3 70.8 -18.8 -0.6 -3.7
CCAATGCTATTACAACGGTT
1192 SEQ ID NO: 2229 -4.7 -21.9 62.5 -17.2 0 -4.5
TGGATTTTCATCTGATAATG
1294 SEQ ID NO: 2230 -4.7 -18.1 57 -12.5 -0.7 -4.5
CTCCACTATTTCCAGTGGCA
1397 SEQ ID NO: 2231 -4.7 -27 76.7 -19.3 -3 -8.7
1412 ATTCTGCTCGATCCGCTCCA -4.7 -28.9 78.2 -24.2 0.4 -4.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 2232
CCTCCTCGGTGTAGACCAGG
1446 SEQ ID NO: 2233 -4.7 -29.4 80.4 -22.2 -2.5 -5.3 CGCAGTCCCCTCCCGCGAGG
1914 SEQ ID NO: 2234 -4.7 -35.4 86.4 -28.7 -2 -8.2 TGAGAACCCCAACAGCTAGG
2234 SEQ ID NO: 2235 -4.7 -25.2 69.1 -20.5 0 -4.6 TCTAGAAATCCCAACTCCAC
2445 SEQ ID NO: 2236 -4.7 -23 65.2 -18.3 0 -5.2 ATTTGCTCCAAAGCAGTTAT
2715 SEQ ID NO: 2237 -4.7 -22.1 65.3 -14.8 -2.6 -7.2 AGTCTAGGCATGTGGCTGAA
3060 SEQ ID NO: 2238 -4.7 -24.9 73.3 -18.9 -1.2 -6.1 TAGACTTTGCCTCCAGGAAA
3120 SEQ ID NO: 2239 -4.7 -23.8 67.8 -19.1 0 -5 CTTGGTGTCACACTTCCTCC
3317 SEQ ID NO: 2240 -4.7 -27.5 79.2 -21.6 -1.1 -6.7 TCACAGAAACAAGAGAAGCA
3484 SEQ ID NO: 2241 -4.7 -18.4 56.1 -13.7 0 -4.1 AACCACCTCTTGGTGTTTCC
184 SEQ ID NO: 2242 -4.6 -26.9 75.8 -19.3 -3 -8.1 AGCAAAGCAATAGCAGAGGC
287 SEQ ID NO: 2243 -4.6 -22.7 65.9 -16.4 -1.7 -7.3 GCTTTGGGTTTGTGGAGCTT
■ 352 SEQ ID NO: 2244 -4.6 -26.5 78.1 -21.3 -0.3 -5.2 GTGCGGAGGTTAAACCTCAC
397 SEQ ID NO: 2245 -4.6 -24.8 69.9 -16.7 -3.5 -13.2 TAAGGGCTGGCTGTGGCCGA
455 SEQ ID NO: 2246 -4.6 -29.6 79.6 -21.7 -3.3 -11 AAAAGGTTTTAGCTGTCATG
492 SEQ ID NO: 2247 -4.6 -19.3 59.6 -14.7 0 -4.8 GCCAGTTTTCAAAGATACCG
537 SEQ ID NO: 2248 -4.6 -23 65.2 -18.4 0 -2.6 GAAAAATCGTCCTTCTCCTG
709 SEQ ID NO: 2249 -4.6 -22.2 63.4 -17.6 0 -3 GCTGTAGCCGATCAAGTGGA
740 SEQ ID NO: 2250 -4.6 -26.2 73.8 -21.6 0 -4.9 GATTCGGCCCACCGTTCCTT
800 SEQ ID NO: 2251 -4.6 -31.3 80.9 -24.2 -2.5 -9.2 TGATTCGGCCCACCGTTCCT
801 SEQ ID NO: 2252 -4.6 -31.2 80.3 -24.2 -2.4 -9.2 GGGCCCGGCAGGATCCAAAC
824 SEQ ID NO: 2253 -4.6 -30.4 78 -24.2 -1.5 -10.6 TGCAATTGATCCCAAGACAT
1019 SEQ ID NO: 2254 -4.6 -22.4 63.7 -17.8 0 -7.1 CATTCTGCTCGATCCGCTCC
1413 SEQ ID NO: 2255 -4.6 -28.9 78.2 -23.8 -0.1 -5.6 TCTTCGGAGCCAGCGTTCCT
2102 SEQ ID NO: 2256 -4.6 -30.1 81.8 -24.5 -0.9 -4.7 TCATTCTGGCCCCAGCATGA
2679 SEQ ID NO: 2257 -4.6 -29.3 79.8 -23.1 -1.5 -7.6 GTTGCCCTTCTCCCCCTACT
3000 SEQ ID NO: 2258 -4.6 -33.5 88.3 -28.9 0 -3 TCGGGTCCTATTCCCAAAAT
3631 SEQ ID NO: 2259 -4.6 -24.9 68.1 -18.4 -1.9 -5.6 GCTCGGGTCCTATTCCCAAA
3633 SEQ ID NO: 2260 -4.6 -28.3 76 -21.8 -1.9 -5.8 GGAAAACCCCTCACATAAGT
3761 SEQ ID NO: 2261 -4.6 -23 64 -18.4 0 2.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CCGGGCGGTGGCAGGGAGCG
72 SEQ ID NO: 2262 -4.5 -33.5 84.5 -27.4 -1.6 -8.7
ATCGTTGAGTCCACAGCCTG
1001 SEQ ID NO: 2263 -4.5 -27 75.9 -22.5 0 -3.7
ATATGCAATTGATCCCAAGA
1022 SEQ ID NO: 2264 -4.5 -21.2 61.5 -16 -0.5 -7.6
CTCCCATGTTCTTGTAACTG
1320 SEQ ID NO: 2265 -4.5 -24 69.8 -18.5 -0.9 -4.3
CCAGGAAGGTGTTGGTGGCA
1431 SEQ ID NO:2266 -4.5 -27.6 77.8 -23.1 0 -4
TCCTCGGTGTAGACCAGGAA
1444 SEQ ID NO:2267 -4.5 -26.4 73.8 -18.5 -3.4 -7.1
CCTCAGGGAAGCTCCACAGT
1738 SEQ ID NO: 2268 -4.5 -28.2 78.8 -22.1 -1.6 -7
GGAGTTAGAGCTATTCAAGA
1956 SEQ ID NO: 2269 -4.5 -20.9 64.5 -15.9 -0.2 -5.1
GACTTGGTGCTCTGGAGGTG
1989 SEQ ID NO: 2270 -4.5 -26.4 77.6 -21.9 0 -6.4
AATGAACAGAAAAATAGGAA
2337 SEQ ID NO: 2271 -4.5 -12.7 44.3 -8.2 0" -2.4
AAATGAACAGAAAAATAGGA
2338 SEQ ID NO: 2272 -4.5 -12.7 44.3 -8.2 0 -2.4
TCTAAACAGAAGAGATTTGC
2729 SEQ ID NO: 2273 -4.5 -17.6 55.5 -13.1 0 -5.7
CTCTAAACAGAAGAGATTTG
2730 SEQ ID NO:2274 -4.5 -16.7 53.5 -11.3 -0.7 -4
TTGCCTCCAGGAAATCTGAG
3114 SEQ ID NO: 2275 -4.5 -24.2 68.8 -18.6 -1 -4.9
ATAGACTTTGCCTCCAGGAA
3121 SEQ ID NO: 2276 -4.5 -24.5 70 -20 0 -5
TCCCGAATCTCAGCCATAAA
3300 SEQ ID NO: 2277 -4.5 -24.3 66.5 -19.8 0 -3.2
GTACAAAGAAAATCATTCTT
3346 SEQ ID NO: 2278 -4.5 -15.5 50.6 -9.2 -1.8 -7.7
GGTTCCAAGCATTTTGGATA
3548 SEQ ID NO: 2279 -4.5 -23.2 67.9 -15.6 -3.1 -8.3
TAACTGACACATCAATGAAT
3664 SEQ ID NO: 2280 -4.5 -16.8 52.8 -11.6 -0.4 -4.8
GTGTAACTGACACATCAATG
3667 SEQ ID NO:2281 -4.5 -19.3 59 -12.4 -2.4 -6.8
GTGGCAGGGAGCGAGTGTCA
65 SEQ ID NO: 2282 -4.4 -28.6 81.7 -22.6 -1.6 -5.3
GTGTAGCTTTGGGTTTGTGG
357 SEQ ID NO: 2283 -4.4 -25.2 76.1 -20.8 0 -4.6
GTAAAGCTGGTGGGCCAGGG
626 SEQ ID NO: 2284 -4.4 -27.9 77.5 -20.3 -3.2 -9.4
TCAAACATGGGCCCGGCAGG
832 SEQ ID NO: 2285 -4.4 -28.5 74.5 -22.5 -0.7 -11.2
CTCAAGCCGAAGGAACGCGT
919 SEQ ID NO:2286 -4.4 -25.7 67.8 -19.3 -1.5 -12
ATGCTCACATTTTACCACCT
1055 SEQ ID NO: 2287 -4.4 -24.7 70.3 -19.8 -0.2 -3.6
TTTTGAAGCGATTGGAGTCA
1146 SEQ ID NO:2288 -4.4 -21.6 64.1 -17.2 0 -5
AGGCCCCCTCCCAGGTGAGC
1491 SEQ ID NO:2289 -4.4 -35.8 92.7 -30.6 -0.5 -8.5
TGCCTTGCTGGCAAGACTTG
1767 SEQ ID NO:2290 -4.4 -26.3 73.6 -18.7 -3.2 -12.7
1780 CAGGAAGTCTTGCTGCCTTG -4.4 -25.9 74.3 -21.5 0 -5.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligc SEQ ID NO: 2291
AGTCCCAGCCATCACAGGAG
1894 SEQ ID NO: 2292 -4.4 -28.6 79.7 -23.7 -0.1 -3.7 TCTGGAGGTGTGGACAGAGG
1979 SEQ ID NO: 2293 -4.4 -25.2 74.6 -19.8 -0.9 -4.9 GCTTACACACAAATCTGGAC
2006 SEQ ID NO: 2294 -4.4 -21.1 62.4 -16.7 0 -3 GTCAGTGCAACCCATGAGAA
2248 SEQ ID NO: 2295 -4.4 -24.7 69.7 -19.8 -0.2 -4.9 GGTGCCTTTCCCCATGCATA
2495 SEQ ID NO: 2296 -4.4 -30.6 82 -25.3 -0.7 -6.8 TAATAGTTGCCCTTCTCCCC
3005 SEQ ID NO: 2297 -4.4 -28.5 77.8 -24.1 0 -3 TCCAGGAAATCTGAGTCCTC
3109 SEQ ID NO: 2298 -4.4 -24.3 70.7 -18.7 -1.1 -7.4 GCTCTATATAAAAAAAAAAG
3211 SEQ ID NO: 2299 -4.4 -10.8 41.1 -6.4 0 -3.3 ATACATTAATAAAAGGGCTT
3246 SEQ ID NO: 2300 -4.4 -16.5 52.3 -12.1 0 -4.2 TATTTAAAATATCGTATAAA
3712 SEQ ID NO: 2301 -4.4 -11.6 42.6 -7.2 0 -5 GTCCTGAGCCGCCGGGAGGC
15 SEQ ID NO: 2302 -4.3 -34.3 88.2 -26.9 -3.1 -12 GGGCGGTGGCAGGGAGCGAG
70 SEQ ID NO: 2303 -4.3 -31.3 83.5 -25.4 -1.6 -7.2 AAACTTGGCGGCACGGAGCC
91 SEQ ID NO: 2304 -4.3 -27.9 73 -21.6 -2 -9.3 CGCAGCAAAGCAATAGCAGA
290 SEQ ID NO: 2305 -4.3 -23 64.7 -17 -1.7 -7.4 GAAGTTGCCTGCATACCCGG
776 SEQ ID NO: 2306 -4.3 -28.3 75.1 -24 0 -5.8 TTTTCATCTGATAATGGTAA
1290 SEQ ID NO: 2307 -4.3 -17.7 56.2 -13.4 0 -4.2 ACCAGGAAGGTGTTGGTGGC
1432 SEQ ID NO: 2308 -4.3 -27.1 77.3 -21.6 -l.-l -6.5 GCACCCTCAGGGAAGCTCCA
1742 SEQ ID NO: 2309 -4.3 -30.8 82.7 -24.3 -2.2 -8.9 TCGCCCAGCAACTGAGAAAC
2063 SEQ ID NO: 2310 -4.3 -24.6 67 -19.6 -0.4 -4.1 ACATGAGTCAGCTCCTGTCG
2183 SEQ ID NO: 2311 -4.3 -26.2 75.6 -20.1 -1.8 -7 CCCATGAGAACCCCAACAGC
2238 SEQ ID NO: 2312 -4.3 -28.1 72.8 -23.8 0 -4.5 CCTCTCCCTGGCTGCACCAC
3093 SEQ ID NO: 2313 -4.3 -33 87.1 -27.4 -1.2 -8.4 TGCCTCCAGGAAATCTGAGT
3113 SEQ ID NO: 2314 -4.3 -25.3 71.6 -19.9 -1 -5 AATTGGCTTGAGAACATATC
3461 SEQ ID NO: 2315 -4.3 -18.9 58.2 -14.6 0 -4.5 AACCTGTACAAGCTTCGCTT
3518 SEQ ID NO: 2316 -4.3 -24.3 68.7 -18.6 -1.3 -7.8 TCTCATTATGTATATGCAAA
3610 SEQ ID NO: 2317 -4.3 -17.9 56.4 -13.6 0 -6.2 CAGAACGAGATCTGCCCTCG
34 SEQ ID NO: 2318 -4.2 -26 70.2 -20.4 -1.3 -6.4 GTGTTTCCAGCAATCCCGGC
172 SEQ ID NO: 2319 -4.2 -29.7 80.1 -25.5 0 -6.1 GTGCGCTCCGAGGCTGTAGC
752 SEQ ID NO: 2320 -4.2 -30.9 84.3 -25.9 -0.6 -8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CCCTTCAAACATGGGCCCGG
836 SEQ ID NO: 2321 -4.2 -29.8 75.5 -24 -0.4 -11.2
ATCCCCTTTTTGAAGCGATT
1153 SEQ ID NO: 2322 -4.2 -24.9 68.9 -20.1 -0.3 -5.4
TGGCAGAGTCTGGGAATCTG
1382 SEQ ID NO: 2323 -4.2 -24.4 71.7 -17.7 -2.5 -9.6
CTCCTCGGTGTAGACCAGGA
1445 SEQ ID NO: 2324 -4.2 -28 78.2 -20.4 -3.4 -7.1
AACTTTCCTCCATGGGCTTG
1805 SEQ ID NO: 2325 -4.2 -26.2 73.6 -21.4 -0.2 -8.3
GGTTCCAAATGGAGAGGCTC
2423 SEQ ID NO: 2326 -4.2 -24.9 71.7 -20.2 -0.2 -7.5
AGGTGGCACATAATAACTAA
2607 SEQ ID NO: 2327 -4.2 -19.1 57.9 -14 -0.8 -4.8
GTATTACATATGTCATAACT
2757 SEQ ID NO: 2328 -4.2 -17.7 56.5 -13 0 -7.9
ATAATAGTTGCCCTTCTCCC
3006 SEQ ID NO: 2329 -4.2 -26.5 74.3 -22.3 0 -3
TGGGAACTGGCTGCAAAAGT
3159 SEQ ID NO:2330 -4.2 -22.9 65.1 -18.2 -0.2 -7.6
AAGTCCTTGTTTGTCTCACG
3194 SEQ ID NO: 2331 -4.2 -23.9 70.5 -19.7 0 -3
ATAAAAAAAAAAGTCCTTGT
3204 SEQ ID NO: 2332 -4.2 -13.2 45.3 -9 0 -3.2
CTCGGGTCCTATTCCCAAAA
3632 SEQ ID NO: 2333 -4.2 -25.8 69.9 -19.7 -1.9 -5.6
CTATGTGGATAAGGTGTAAC
3680 SEQ ID NO: 2334 -4.2 -19.4 60 -15.2 0 -1.9
ACCAGGATGTACAGCCAATA
3870 SEQ ID NO: 2335 -4.2 -24 68.1 -19.2 -0.3 -7.1
AACTTGGCGGCACGGAGCCC
90 SEQ ID NO:2336 -4.1 -30.6 78.4 -24.1 -2.4 -9.3
ACAAAAACCACCTCTTGGTG
189 SEQ ID NO: 2337 -4.1 -21.9 62.2 -15.1 -2.7 -7
GAATGATGAAAAAGGTTTTA
501 SEQ ID NO: 2338 -4.1 -14.7 48.7 -9.9 -0.4 -4.4
TCCATCCGTGAATGATGAAA
510 SEQ ID NO: 2339 -4.1 -21.2 60.5 -15.9 -1.1 -4.6
CCCACCGTTCCTTTCACGAA
793 SEQ ID NO: 2340 -4.1 -28.5 73.9 -23.9 -0.1 -3.7
ATTCGGCCCACCGTTCCTTT
799 SEQ ID NO: 2341 -4.1 -30.8 80 -24.2 -2.5 -6.6
CCCGGCAGGATCCAAACCTG
821 SEQ ID NO: 2342 -4.1 -29.1 74.3 -23.5 -1.4 -9
ATGTCGGCCCCTTCAAACAT
844 SEQ ID NO: 343 -4.1 -27 72.2 -22.9 0 -5.7
CGGAGAGAGCCTCTTGTGGA
863 SEQ ID NO: 2344 -4.1 -26.9 75.9 -21.3 -1.4 -8.2
AGGTGTGGACAGAGGTTTGG
1974 SEQ ID NO: 2345 -4.1 -24.7 73.7 -20 -0.3 -4
CCTCACTAAGCCTCAGTTTT
3040 SEQ ID NO: 2346 -4.1 -25.4 73.3 -21.3 0 -3.2
CAGAGATAGACTTTGCCTCC
3126 SEQ ID NO: 2347 -4.1 -24.6 71.3 -20.5 0 -3.8
TACATTAATAAAAGGGCTTA
3245 SEQ ID NO: 2348 -4.1 -16.2 51.8 -12.1 0 -4.2
CACTTCCTCCCGAATCTCAG
3307 SEQ ID NO: 2349 -4.1 -26.7 73.3 -22.6 0 -2.8
3351 CCTAAGTACAAAGAAAATCA -4.1 -15.9 50.6 -11.8 0 -4.5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO:2350
CAATCACAGAAACAAGAGAA
3487 SEQ ID NO:2351 -4.1 -15.9 50.6 -11.8 0 -2.9 TGACCAGGATGTACAGCCAA
3872 SEQ ID NO: 2352 -4.1 -24.9 69.8 -20.2 -0.3 -7.1 CTTGCCCCAGAACGAGATCT
41 SEQ ID NO: 2353 -4 -26.9 72.4 -22.9 0 -6.3 TTTGTGGAGCTTATCTTCCA
344 SEQ ID NO:2354 -4 -24.2 .72 -18.7 -1.4 -5.9 TCTGGGTCCTTGGAGGTGCG
412 SEQ ID NO: 2355 -4 -29.1 81.6 -24.3 -0.6 -5.9 TCCGTGAATGATGAAAAAGG
506 SEQ ID NO: 2356 -4 -17.9 53.8 -13.9 0 -3.3 CACGTGCGCTCCGAGGCTGT
755 SEQ ID NO: 2357 -4 -31.1 81.2 -26.2 -0.6 -9.3 CTGTGATTCGGCCCACCGTT
804 SEQ ID NO: 2358 -4 -30 78.5 -23.5 -2.5 -9.2 CCTTCAAACATGGGCCCGGC
835 SEQ ID NO: 2359 -4 -29.6 76.2 -24 0 -11.2 TCAAGCCGAAGGAACGCGTG
918 SEQ ID NO: 2360 -4 -24.8 66 -18.3 -0.8 -13.2 TTGATCCCAAGACATCGTTG
1014 SEQ ID NO:2361 -4 -23.1 65.7 -19.1 0 -4.3 TGTAGCCAATGCTATTACAA
1197 SEQ ID NO: 2362 -4 -21.1 62.3 -15 -2.1 -8.5 TCCCATGTTCTTGTAACTGA
1319 SEQ ID NO: 2363 -4 -23.7 69.2 -18.7 -0.9 -4.3 CTGCGAAACTCCTTCCACAG
1528 SEQ ID NO:2364 -4 -25.2 69.1 -20.7 -0.1 -4.3 CCCGACACTTGCGAAACCAG
1686 SEQ ID NO: 2365 -4 -26.2 67.9 -22.2 0 -4.3 TTCGTTTTTCATCCTCCAGC
1709 SEQ ID NO:2366 -4 -26.2 75.5 -22.2 0 -3 AGCAGGAAGTCTTGCTGCCT
1782 SEQ ID NO: 2367 -4 -27.6 78.9 -20.7 -2.9 -9.4 GACGTAAGCAGTATGGTCAG
2263 SEQ ID NO:2368 -4 -22.7 67.4 -18.2 -0.2 -5.6 TAATTAATTTTAAGTGTTCA
2379 SEQ ID NO: 2369 -4 -15 50.5 -11 0 -6.2 TTATATCCTATAGCCTCCCC
2524 SEQ ID NO: 2370 -4 -27.3 75.5 -23.3 0 -5 AACTTCTATCTCTCTAAACA
2741 SEQ ID NO: 2371 -4 -18.6 58.4 -14.6 0 -0.9 CCCCCTACTCTAATTAGGCA
2989 SEQ ID NO: 2372 -4 -27.5 74.6 -22.8 -0.5 -7.5 TCCTGGTTATACATTAATAA
3254 SEQ ID NO: 2373 -4 -18.2 56.6 -14.2 0 -4.6 CACAGATGTTCTCCTGGTTA
3265 SEQ ID NO: 2374 -4 -24.3 72.1 -19.5 -0.6 -4.6 GAATTTTGTGTTTAGGCTCG
3648 SEQ ID NO: 2375 -4 -21.6 64.9 -17.6 0 -3.7 GCACCAACAAGACAAAAAAT
3782 SEQ ID NO: 2376 -4 -16.9 51.4 -12.9 0 -3.4 ACCACCTCTTGGTGTTTCCA
183 SEQ ID NO: 2377 -3.9 -28.3 79.4 -21.4 -3 -7.4 AAGTTGCCTGCATACCCGGC
775 SEQ ID NO: 2378 -3.9 -29.5 77.9 -25 -0.3 -6.9 AAGCCGAAGGAACGCGTGTA
916 SEQ ID NO: 2379 -3.9 -24.6 66 -18 -2.1 -13.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
TCGTTGAGTCCACAGCCTGG
1000 SEQ ID NO:2380 -3.9 -28.2 78.5 -23.5 -0.6 -4.8
ATTGGAGTCAGTGCACTGGA
1136 SEQ ID NO:2381 -3.9 -24.8 73.5 -17.8 -0.4 -14.4
GCGATTGGAGTCAGTGCACT
1139 SEQ ID NO:2382 -3.9 -26.2 75.3 -21.2 -0.1 -10.1
TCCCCTTTTTGAAGCGATTG
1152 SEQ ID NO: 2383 -3.9 -24.9 68.8 -20.2 -0.6 -5.3
CATAAAGGGTGACGTAAAAG
1353 SEQ ID NO: 2384 -3.9 -17 52.6 -13.1 0 -5.3
AGTGCCATAAAGGGTGACGT
1358 SEQ ID NO: 2385 -3.9 -24.4 68.9 -19.8 -0.4 -8.2
GGATATGCTGGTGTTCTCAG
1652 SEQ ID NO: 2386 -3.9 -24.3 73.1 -19.9 -0.1 -4.8
CCAGGGTCAAGGCTGAGAAG
1855 SEQ ID NO: 2387 -3.9 -25.1 71.4 -20.5 -0.5 -4.1
TAAGACGTAAGCAGTATGGT
2266 SEQ ID NO: 2388 -3.9 -20.6 61.9 -15.8 -0.8 -6.2
GGTATTAAAGTAAAATATTT
2856 SEQ ID NO: 2389 -3.9 -13.2 46.1 -9.3 0 -6.4
CTCCTGGTTATACATTAATA
3255 SEQ ID NO: 2390 -3.9 -19.8 60.5 -15.9 0 -4.6
TTCAGAAGTTTAACAGTGAT
3414 SEQ ID NO: 2391 -3.9 -18.2 57.7 -14.3 0 -4.6
ATGGGAAAACCCCTCACATA
3764 SEQ ID NO: 2392 -3.9 -23.7 65.1 -17.5 -2.3 -5.8
CTGCCCCGCCACACCCCCTC
232 SEQ ID NO: 2393 -3.8 -38.4 90.9 -34.6 0 -3
ACAGAGCAGAGGAACGGAGT
260 SEQ ID NO: 2394 -3.8 -23.7 68.3 -19.2 -0.5 -4.3
GCTCACATTTTACCACCTCT
1053 SEQ ID NO: 2395 -3.8 -26 74 -22.2 0 -2.8
CTTTTTGAAGCGATTGGAGT
1148 SEQ ID NO:2396 -3.8 -21.5 63.7 -17.2 -0.1 -5.3
AAGGTGTTGGTGGCATTCTG
1426 SEQ ID NO: 2397 -3.8 -24.5 72.5 -20.7 0 -4
AGGTTGTACCAAGACTGAGA
1510 SEQ ID NO: 2398 -3.8 -22.5 66.7 -17 -1.7 -5
GGCTGAGAAGAATCCTTCCA
1845 SEQ ID NO: 2399 -3.8 -24.8 70.2 -18.9 -2.1 -8.1
CCCTCCCGCGAGGAGTCCCA
1907 SEQ ID NO: 2400 -3.8 -35.4 87.3 -28.7 -2.5 -13.6
ATGAGAACCCCAACAGCTAG
2235 SEQ ID NO: 2401 -3.8 -24 66.7 -20.2 0 -4.6
CTGTGTACACAGATGTGTAT
2773 SEQ ID NO: 2402 -3.8 -21.5 65.9 -14.5 -1.7 -14.6
GCTCTGTCTGGCAGGTGCCG
2797 SEQ ID NO: 2403 -3.8 -31.2 86.6 -25 -2.4 -10.9
ACTGTATTAAATCTTAGAAC
2819 SEQ ID NO: 2404 -3.8 -15.6 51.5 -11.8 0 -3
GCACTGGTATTAAAGTAAAA
2861 SEQ ID NO: 2405 -3.8 -16.9 53.3 -13.1 0 -3.4
CAATGCATACACAAATCTTT
2971 SEQ ID NO: 2406 -3.8 -18.1 55.5 -14.3 0 -7.3
CCTTCTCCCCCTACTCTAAT
2995 SEQ ID NO: 2407 -3.8 -28.7 77.6 -24.9 0 -0.9
GACTTTGCCTCCAGGAAATC
3118 SEQ ID NO: 2408 -3.8 -24.5 69.5 -20.7 0 -5
3210 CTCTATATAAAAAAAAAAGT -3.8 -10.2 40 -6.4 0 -3.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular sition oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2409
TCATGTACACAACTATTTAA
3725 SEQ ID NO: 2410 -3.8 -17.1 54.4 -13.3 0 -6.7 TTACCACAAACCATGCTTCA
3742 SEQ ID NO: 2411 -3.8 -23 64.9 -19.2 0 -4.2 CAGAGCAGAGGAACGGAGTT
259 SEQ ID NO: 2412 -3.7 -23.6 68.1 -18.3 -1.6 -7.3 CCCGCAGCAAAGCAATAGCA
292 SEQ ID NO: 2413 -3.7 -26.4 69.9 -21 -1.7 -7.4 CATCCGTGTAAAGCTGGTGG
633 SEQ ID NO: 2414 -3.7 -24.9 70 -21.2 0 -5.1 CGTGCGCTCCGAGGCTGTAG
753 SEQ ID NO: 2415 -3.7 -29.9 79.4 -25.5 -0.5 -8.2 TGGGGTAGATGTCAATGTGG
963 SEQ ID NO: 2416 -3.7 -23.1 68.7 -19.4 0 -3.8 ACAGCCTGGCTGGAAGTCAC
989 SEQ ID NO: 2417 -3.7 -27.1 76.7 -19.8 -2.9 -15.1 CCACAGCCTGGCTGGAAGTC
991 SEQ ID NO: 2418 -3.7 -28.9 79.6 -21.6 -2.9 -15.1 AAGAGGTGGACGGCTCGCTC
1075 SEQ ID NO: 2419 -3.7 -27.3 75.6 -22.2 -1.3 -5.5 CAGAGTCTGGGAATCTGCAT
1379 SEQ ID NO: 2420 -3.7 -23.9 70.3 -18.2 -2 -8.3 CCTCCCAGGTGAGCTGGATC
1485 SEQ ID NO: 2421 -3.7 -29.9 82.8 -23.2 -3 -7.3 CCCCTCCCAGGTGAGCTGGA
1487 SEQ ID NO: 2422 -3.7' -33.5 87.6 -26.8 -3 -7.6 GTAGCTGCGAAACTCCTTCC
1532 SEQ ID NO: 2423 -3.7 -26.3 73 -22.6 0 -7.2 GGCCTGGGGATATGCTGGTG
1659 SEQ ID NO: 2424 -3.7 -28.9 80.2 -24.7 -0.1 -6.4 CTCCCGGCCTGGGGATATGC
1664 SEQ ID NO: 2425 -3.7 -31.7 82.6 -25.6 -2.1 -12.4 CAGTAACTTTCCTCCATGGG
1809 SEQ ID NO: 2426 -3.7 -25 71.4 -20.7 -0.2 -8.3 AGCTCTGTCTGGCAGGTGCC
2798 SEQ ID NO: 2427 -3.7 -30.4 87.9 -25 -1.7 -9.5 ATTAAATCTTAGAACCAGCT
2814 SEQ ID NO: 2428 -3.7 -19 57.9 -15.3 0 -4.3 CAAGAAAAGGCACTGGTATT
2870 SEQ ID NO: 2429 -3.7 -19.5 58.4 -15 -0.6 -4 TCCCCCTACTCTAATTAGGC
2990 SEQ ID NO:2430 -3.7 -27.2 75.2 -22.8 -0.5 -7.5 AGTTGCCCTTCTCCCCCTAC
3001 SEQ ID NO: 2431 -3.7 -32.6 86.8 -28.9 0 -3 CAATTGGCTTGAGAACATAT
3462 SEQ ID NO: 2432 -3.7 -19.2 58.1 -15.5 0 -5.7 AATTTTGTGTTTAGGCTCGG
3647 SEQ ID NO: 2433 -3.7 -22.2 66.2 -18.5 0 -3.7 CATGTACACAACTATTTAAA
3724 SEQ ID NO:2434 -3.7 -16 51.5 -12.3 0 -6.7 GGAGCTTATCTTCCAGCCGT
339 SEQ ID NO: 2435 -3.6 -28.6 79.9 -24.1 -0.8 -5.2 TGGGCCAGGGGGAGCCAGTC
616 SEQ ID NO:2436 -3.6 -32.4 88.9 -26.3 -2.5 -9.2 CTGGTGGGCCAGGGGGAGCC
620 SEQ ID NO: 2437 -3.6 -33.4 89.8 -26.5 -3.3 -8.9 GTGTAAAGCTGGTGGGCCAG
628 SEQ ID NO: 2438 -3.6 -26.7 75.6 -20.3 -2.8 -8.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
TGAAGCGATTGGAGTCAGTG 1143 SEQ ID NO: 2439 -3.6 -22.5 66.3 -18.9 0 -5
AACTCTGAAAGGCATGCCTG 1271 SEQ ID NO: 2440 -3.6 -23.3 66.1 -16.4 -0.4 -14.8
GTGCCATAAAGGGTGACGTA 1357 SEQ ID NO: 2441 -3.6 -24.1 68.1 -19.8 -0.4 -8.2
CCTCAGCAGTAACTTTCCTC 1815 SEQ ID NO: 2442 -3.6 -25.7 74.6 -22.1 0 -3.3
CCTCTTCGGAGCCAGCGTTC 2104 SEQ ID NO: 2443 -3.6 -30.1 81.8 -25.2 -1.2 -5.6
AAGACGTAAGCAGTATGGTC 2265 SEQ ID NO: 2444 -3.6 -21.3 63.9 -17.2 -0.2 -5.6
CTAAGACGTAAGCAGTATGG 2267 SEQ ID NO: 2445 -3.6 -20.3 60.8 -16.2 -0.2 -5
AGAGTGAGCTGGGGAGCAGG 2296 SEQ ID NO: 2446 -3.6 -27 78.6 -21.8 -1.6 -5.5
CTCAATTAAAAAATGAACAG 2348 SEQ ID NO: 2447 -3.6 -12.4 43.9 -8.8 0 -2.9
ACCACATTCTAATTAATTTT 2388 SEQ ID NO: 2448 -3.6 -17.6 55.1 -14 0 -6.2
CTTTCCCCATGCATATACAC 2490 SEQ ID NO: 2449 -3.6 -25.2 70.4 -21.6 0 -6.8
TGGCAGGTGCCGGTTTCTGT 2789 SEQ ID NO:2450 -3.6 -29.8 83.3 -23.8 -2.4 -10.9
AGAACCAGCTCTGTCTGGCA 2804 SEQ ID NO:2451 -3.6 -27 77.2 -21.2 -2.2 -7.1
CACTGTATTAAATCTTAGAA 2820 SEQ ID NO: 2452 -3.6 -16.1 52.3 -12.5 0 -3
ACAAGAAAAGGCACTGGTAT 2871 SEQ ID NO: 2453 -3.6 -19.6 58.5 -15.2 -0.6 -4.1
CAGTTTTGTAAAATAGGGAT 3027 SEQ ID NO:2454 -3.6 -17.7 55.7 -13.6 -0.1 -4.2
TCACACTTCCTCCCGAATCT 3310 SEQ ID NO: 2455 -3.6 -26.9 73.5 -23.3 0 -2.8
ACCTAAGTACAAAGAAAATC 3352 SEQ ID NO: 2456 -3.6 -15.4 49.8 -11.8 0 -5.3
TTCTGGTTCCAAGCATTTTG 3552 SEQ ID NO: 2457 -3.6 -23.1 68.4 -19.5 0 -5
CTGAAAATAATCTAAAATTT 3579 SEQ ID NO:2458 -3.6 -11.5 42.4 -7.9 0 -4.9
ATCTCATTATGTATATGCAA 3611 SEQ ID NO: 2459 -3.6 -18.6 58.4 -15 0 -6.2
CAATCCCGGCCGGTAAGACC 162 SEQ ID NO: 2460 -3.5 -29.2 74.2 -22.9 -0.3 -13.7
GTTTCCAGCAATCCCGGCCG 170 SEQ ID NO: 2461 -3.5 -31.3 79.8 -26.7 -0.1 -10.2
CACCTCTTGGTGTTTCCAGC 181 SEQ ID NO: 2462 -3.5 -27.9 80 -21.9 -2.5 -7.8
GGTTTGACCTCAGTCTGTGT 373 SEQ ID NO: 2463 -3.5 -26.3 78.8 -21.8 -0.9 -5.8
CTGGCTGTGGCCGACGGAGA 449 SEQ ID NO: 2464 -3.5 -29.8 78.7 -23 -3.3 -8.4
GGTGGGCCAGGGGGAGCCAG
618 SEQ ID NO: 2465 -3.5 -33.2 89.5 -27.2 -2.5 -9.2 TGGTGGGCCAGGGGGAGCCA
619 SEQ ID NO: 2466 -3.5 -33.2 88.8 -26.5 -3.2 -8.4 GGCTGTAGCCGATCAAGTGG
741 SEQ ID NO: 2467 -3.5 -26.8 75 -21.6 -1.7 -9.8
773 GTTGCCTGCATACCCGGCCA -3.5 -32.9 84.1 -27.9 -1.4 -8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2468
TCGGCCCACCGTTCCTTTCA
797 SEQ ID NO: 2469 -3.5 -31.8 82.3 -25.8 -2.5 -6.6 AGACATGGATTTTCATCTGA
1299 SEQ ID NO: 2470 -3.5 -20.6 63.1 -16.2 -0.7 -5.5 CCGGGCACCCTCAGGGAAGC
1746 SEQ ID NO: 2471 -3.5 -32 82.5 -26.3 -2.2 -11.2 GCCTTGCTGGCAAGACTTGC
1766 SEQ ID NO: 2472 -3.5 -28.1 78.1 -22 -2.5 -12.7 GTCAAGGCTGAGAAGAATCC
1850 SEQ ID NO: 2473 -3.5 -22.3 65.5 -18 -0.6 -3.9 CAGTGCTCCAGGGTCAAGGC
1862 SEQ ID NO: 2474 -3.5 -28.7 81.8 -25.2 0 -3.9 GCCATCACAGGAGACCAGTT
1887 SEQ ID NO: 2475 -3.5 -27.1 76.4 -23 -0.3 -3.8 TCCCGCGAGGAGTCCCAGCC
1904 SEQ ID NO: 2476 -3.5 -34.3 86.9 -29.3 -1.3 -10 AACAGCTAGGGCCCGAGCAA
2224 SEQ ID NO: 2477 -3.5 -28 74.3 -22.1 -1.7 -12.8 AAATAGGAAAGCCAATGATG
2326 SEQ ID NO: 2478 -3.5 -17.1 52.6 -13 -0.3 -3.2 CATAATAACTAAGAAGAAAT
2577 SEQ ID NO: 2479 -3.5 -11.9 43.1 -8.4 0 -2.2 GATTTGCTCCAAAGCAGTTA
2716 SEQ ID NO: 2480 -3.5 -22.7 66.6 -16.6 -2.6 -10.2 AGATTTGCTCCAAAGCAGTT
2717 SEQ ID NO: 2481 -3.5 -23 67.4 -17.2 -2.3 -10.2 ATTGTGTGTATTAATTCAAA
2928 SEQ ID NO: 2482 -3.5 -16.3 53.1 -12.8 0 -4.2 ACTTCCTCCCGAATCTCAGC
3306 SEQ ID NO: 2483 -3.5 -27.8 76.4 -24.3 0 -2.8 ATACAACTTTGGCACGATAC
3396 SEQ ID NO: 2484 -3.5 -20.4 60.2 -16.2 -0.4 -4 AATGGGAAAACCCCTCACAT
3765 SEQ ID NO: 2485 -3.5 -23.3 63.7 -17.5 -2.3 -5.8 ATGAAAAAGGTTTTAGCTGT
496 SEQ ID NO: 2486 -3.4 -18.1 56.4 -14 -0.4 -8.1 GCCGATCAAGTGGACATTCC
734 SEQ ID NO: 2487 -3.4 -26 72 -21.9 -0.4 -5.9 CGGCCCACCGTTCCTTTCAC
796 SEQ ID NO:2488 -3.4 -31.6 81.2 -26.3 -1.9 -6.2 ATCTGAATACCAATGCTCAA
934 SEQ ID NO: 2489 -3.4 -20.2 59.8 -16.8 0 -3.6 GCTATTACAACGGTTCTTGC
1187 SEQ ID NO: 2490 -3.4 -23.1 67.4 -19.7 0 -4.7 GATATGCTGGTGTTCTCAGG
1651 SEQ ID NO: 2491 -3.4 -24.3 73.1 -20.2 -0.5 -5.2 CGGGCACCCTCAGGGAAGCT
1745 SEQ ID NO: 2492 -3.4 -30.9 81.1 -24.5 -3 -9.8 TGGACAGAGGTTTGGAGTTA
1969 SEQ ID NO: 2493 -3.4 -22.7 68.7 -19.3 0 -3.8 AGGCTCGCCCAGCAACTGAG
2067 SEQ ID NO: 2494 -3.4 -29.1 78 -23.6 -2.1 -7.7 GGAATGGCTAAGACGTAAGC
2274 SEQ ID NO: 2495 -3.4 -21.6 62.7 -17.3 -0.7 -7 ATGAACAGAAAAATAGGAAA
2336 SEQ ID NO: 2496 -3.4 -12.7 44.3 -9.3 0 -2.4 TTTAAGTGTTCAATAGACAT
2371 SEQ ID NO: 2497 -3.4 -17.3 55.6 -13.9 0 -6.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo CACGTCACTCATAGGGGAGG 2624 SEQ ID NO:2498 -3.4 -25.3 72.4 -21.1 -0.6 -5.5
TAGAACCAGCTCTGTCTGGC 2805 SEQ ID NO:2499 -3.4 -26 75.4 -21.2 -1.3 -6.2
CATACACAAATCTTTTGAAA 2966 SEQ ID NO:2500 -3.4 -15.6 50.4 -10.7 -1.4 -5.2
CTTCTCCCCCTACTCTAATT 2994 SEQ ID NO: 2501 -3.4 -26.8 74.6 -23.4 0 -2.5
TTATACATTAATAAAAGGGC 3248 SEQ ID NO:2502 -3.4 -15.3 50 -11.9 0 -4.2
AAAAGTCCAACCGTTGGCAC 3282 SEQ ID NO:2503 -3.4 -23.7 65.4 -18.2 -2.1 -10.9
TAGAAAACCTAAGTACAAAG 3358 SEQ ID NO:2504 -3.4 -14.7 48.4 -11.3 0 -5.6
GATTAAAACAATGTCCTTAG 3375 SEQ ID NO:2505 -3.4 -16.8 53.1 -13.4 0 -4.8
GTCCTTGGAGGTGCGGAGGT 407 SEQ ID NO:2506 -3.3 -29.6 83.3 -25.5 -0.6 -5.9
CGTGTAAAGCTGGTGGGCCA 629 SEQ ID NO: 2507 -3.3 -27.5 75.1 -23 -1.1 -7.6
CTGGCAATGCTGTGTCCCAC 673 SEQ ID NO: 2508 -3.3 -28.3 78.1 -23.5 -0.4 -11
CGAGAGAAAAATCGTCCTTC 714 SEQ ID NO: 2509 -3.3 -20 58.5 -16.2 -0.2 -3.5
GCCCACCGTTCCTTTCACGA 794 SEQ ID NO: 2510 -3.3 -31 80 -26.9 -0.6 -3.8
ATGGGCCCGGCAGGATCCAA 826 SEQ ID NO: 2511 -3.3 -30.9 79.6 -25.8 -1.5 -11.2
GAGAGCCTCTTGTGGATGTC 859 SEQ ID NO: 2512 -3.3 -25.9 76.9 -22.6 0 -5.8
GATCCCCTTTTTGAAGCGAT 1154 SEQ ID NO: 2513 -3.3 -25.4 69.8 -21.2 -0.7 -4.9
GGGAATCTGCATTAGTGCCA 1371 SEQ ID NO: 2514 -3.3 -25.6 72.9 -20.4 -1.9 -8.8
GGCACCCTCAGGGAAGCTCC 1743 SEQ ID NO: 2515 -3.3 -31.3 84.3 -25 -3 -9.8
CTCCAGGGTCAAGGCTGAGA 1857 SEQ ID NO: 2516 -3.3 -27.1 77.3 -23.1 -0.5 -7.9
AGAAAAATAGGAAAGCCAAT
2330 SEQ ID NO:2517 -3.3 -15.7 49.7 -11.2 -1.1 -3.8 CAGAAAAATAGGAAAGCCAA
2331 SEQ ID NO:2518 -3.3 -16.4 50.8 -11.9 -1.1 -3.5 TCAATTAAAAAATGAACAGA
2347 SEQ ID NO: 2519 -3.3 -12.1 43.3 -8.8 0 -3
TTTTAAGTGTTCAATAGACA 2372 SEQ ID NO: 2520 -3.3 -17.4 55.9 -14.1 0 -6.2
ACATTCTAATTAATTTTAAG 2385 SEQ ID NO:2521 -3.3 -13.7 47.4 -10.4 0 -6.2
TCAAACACGTCACTCATAGG 2629 SEQ ID NO:2522 -3.3 -21 62.1 -17.7 0 -4.6
AAAGGCACTGGTATTAAAGT 2865 SEQ ID NO:2523 -3.3 -19.1 58.2 -15 -0.6 -4.1
AGAAAAGGCACTGGTATTAA 2868 SEQ ID NO:2524 -3.3 -18.5 56.6 -14.7 -0.1 -4
TCTCCCCCTACTCTAATTAG 2992 SEQ ID NO:2525 -3.3 -25.5 72 -22.2 0 -6.9
CTGGTTATACATTAATAAAA 3252 SEQ ID NO:2526 -3.3 -14.4 48.3 -11.1 0 -4.2
3699 GTATAAAATTACCCTCAGGC -3.3 -21.5 62.8 -17.6 -0.3 -4.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 2527
GCTTCCATTAGTAAAAACAG
3902 SEQ ID NO: 2528 -3.3 -18.7 57 -15.4 0 -3.9 TGTAAAGCTGGTGGGCCAGG
627 SEQ ID NO: 2529 -3.2 -26.7 74.8 -20.3 -3.2 -9.4 GCGCTCCGAGGCTGTAGCCG
750 SEQ ID NO: 2530 -3.2 -32.5 83.7 -26.8 -2.5 -11.3 TTTTACCACCTCTGTGATTG
1046 SEQ ID NO: 2531 -3.2 -23.2 67.9 -18.8 -1.1 -3.7 TTGGAGTCAGTGCACTGGAA
1135 SEQ ID NO: 2532 -3.2 -24.1 71 -17.8 -0.4 -14.4 CCTTTTTGAAGCGATTGGAG
1149 SEQ ID NO: 2533 -3.2 -22.3 64.3 -18.3 -0.6 -5.3 GTAGCCAATGCTATTACAAC
1196 SEQ ID NO: 2534 -3.2 -21.3 62.9 -16 -2.1 -8.5 ACTTTCCTCCATGGGCTTGG
1804 SEQ ID NO: 2535 -3.2 -28.1 78.7 -24.3 -0.1 -8.3 CTGAGAAGAATCCTTCCATT
1843 SEQ ID NO: 2536 -3.2 -21.9 63.9 -16.6 -2.1 -6.3 TCAAGAGAGGCAGCAAGAGC
1942 SEQ ID NO: 2537 -3.2 -23.5 69 -19.5 -0.6 -5.3 CCATGAGAACCCCAACAGCT
2237 SEQ ID NO:2538 -3.2 -27 71.4 -23.8 0 -4.5 AAAATGAACAGAAAAATAGG
2339 SEQ ID NO:2539 -3.2 -11.4 41.9 -8.2 0 -2.4 AAATAGAAACCACTTAAAGC
2561 SEQ ID NO: 2540 -3.2 -15.7 50.1 -12.5 0 -3 CTCTGTCTGGCAGGTGCCGG
2796 SEQ ID NO: 2541 -3.2 -30.6 84.7 -25 -2.4 -11.3 AACAAGAAAAGGCACTGGTA
2872 SEQ ID NO: 2542 -3.2 -18.9 56.7 -14.9 -0.6 -4.5 TTGCCCTTCTCCCCCTACTC
2999 SEQ ID NO: 2543 -3.2 -32.7 86.6 -29.5 0 -3 ACTGGCTGCAAAAGTCTTCA
3154 SEQ ID NO: 2544 -3.2 -23.1 67.4 -19.2 -0.4 -6.4 GGAACTGGCTGCAAAAGTCT
3157 SEQ ID NO: 2545 -3.2 -23 66.1 -19.1 -0.4 -6.4 TGCTTGGTGTCACACTTCCT
3319 SEQ ID NO: 2546 -3.2 -26.9 78.1 -22.5 -1.1 -6.7 CTTCAGAAGTTTAACAGTGA
3415 SEQ ID NO: 2547 -3.2 -19.1 59.7 -15.9 0 -5.9 AAATATCTCATTATGTATAT
3615 SEQ ID NO: 2548 -3.2 -15.1 50.6 -11.9 0 -3 ATTTTGTGTTTAGGCTCGGG
3646 SEQ ID NO: 2549 -3.2 -24.1 71.2 -20.9 0 -3.7 TGGGAAAACCCCTCACATAA
3763 SEQ ID NO: 2550 -3.2 -23 63.3 -17.5 -2.3 -5.8 AACAAAAACCACCTCTTGGT
190 SEQ ID NO: 2551 -3.1 -21.2 60.4 -16.1 -2 -5.5 GCAAAGCAATAGCAGAGGCT
286 SEQ ID NO: 2552 -3.1 -23.6 67.6 -19.1 -1.3 -7.1 TTGACCTCAGTCTGTGTAGC
370 SEQ ID NO: 2553 -3.1 -25.3 76.2 -20.6 -1.6 -5.4 AGGTTAAACCTCACAGATGG
391 SEQ ID NO: 2554 -3.1 -21.7 63.9 -17 -1.6 -7.2 GGTCCTTGGAGGTGCGGAGG
408 SEQ ID NO: 2555 -3.1 -29.6 82.3 -25.7 -0.6 -5.9 GTTGAGTCCACAGCCTGGCT
998 SEQ ID NO: 2556 -3.1 -29.7 83.7 -25.1 -1.2 -10.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CCCTTTTTGAAGCGATTGGA
1150 SEQ ID NO: 2557 -3.1 -24.3 67.5 -20.4 -0.6 -5.3
ACAGATCCCCTTTTTGAAGC
1157 SEQ ID NO: 2558 -3.1 -24.9 70.4 -21 -0.6 -5.6
AGGCTGAGAAGAATCCTTCC
1846 SEQ ID NO: 2559 -3.1 -24.1 69.3 -18.9 -2.1 -7.5
AGTGCAACCCATGAGAACCC
2245 SEQ ID NO: 2560 -3.1 -26.6 71.5 -23 -0.2 -5.4
TGGTATTAAAGTAAAATATT
2857 SEQ ID NO: 2561 -3.1 -13.1 45.8 -10 0 -4.4
GCATACACAAATCTTTTGAA
2967 SEQ ID NO: 2562 -3.1 -18.1 55.8 -13.5 -1.4 -5.9
AAGACTCAACTGGTTATGTC
3434 SEQ ID NO: 2563 -3.1 -20.3 62.5 -16.7 0 -7.5
TTGAAATAAGACTCAACTGG
3441 SEQ ID NO: 2564 -3.1 -16.7 52.8 -13.1 -0.1 -3.4
CAATGAATTTTGTGTTTAGG
3652 SEQ ID NO: 2565 -3.1 -17.7 56 -14.6 0 -3
GGCTGGGGGACTGGAGGCAG
127 SEQ ID NO: 2566 -3 -29.9 83.2 -25.5 -1.3 -6.3
GTCAACCACAACTACATTGG
599 SEQ ID NO: 2567 -3 -21.7 63.1 -17.7 -0.9 -3.9
GGCAGGATCCAAACCTGTGA
818 SEQ ID NO: 2568 -3 -26.1 72 -20.7 -2.4 -9
CAGCCTGGCTGGAAGTCACC
988 SEQ ID NO: 2569 -3 -28.9 79.6 -23.1 -2 -13.6
TCACATTTTACCACCTCTGT
1051 SEQ ID NO: 2570 -3 -24.5 71 -21.5 0 -2.5
TCACCAGAGAGTCAACAAAG
1092 SEQ ID NO: 2571 -3 -20.3 60.7 -17.3 0 -4.8
GTTGTACCAAGACTGAGAGG
1508 SEQ ID NO: 2572 -3 -22.5 66.7 -19.5 0 -4.2
CGGCCTGGGGATATGCTGGT
1660 SEQ ID NO: 2573 -3 -29.7 80 -26.2 -0.1 -6.7
GGGCACCCTCAGGGAAGCTC
1744 SEQ ID NO: 2574 -3 -30.5 83.4 -24.5 -3 -10
CAAGAGAGGCAGCAAGAGCT
1941 SEQ ID NO: 2575 -3 -24 69.4 -19.5 -1.4 -5.3
GTCAGCTCCTGTCGGAAGGA
2177 SEQ ID NO:2576 -3 -27.6 78.2 -23.5 -1 -7.3
CCATTACCACATTCTAATTA
2393 SEQ ID NO: 2577 -3 -20.5 60.7 -17.5 0 -3.5
TCCCCATGCATATACACATA
2487 SEQ ID NO: 2578 -3 -24.5 68.4 -21.5 0 -6.6
CACATAATAACTAAGAAGAA
2579 SEQ ID NO:2579 -3 -13.5 46.1 -10.5 0 -2.2
GGCACATAATAACTAAGAAG
2581 SEQ ID NO: 2580 -3 -16.6 52.4 -13.6 0 -4
GGTGGCACATAATAACTAAG
2606 SEQ ID NO: 2581 -3 -19.1 57.9 -15.2 -0.8 -4.8
CTGTCTGGCAGGTGCCGGTT
2794 SEQ ID NO: 2582 -3 -30.6 84.9 -25.2 -2.4 -11.6
AGTTTTGTAAAATAGGGATA
3026 SEQ ID NO: 2583 -3 -16.7 53.8 -13.2 -0.2 -4.9
AAAAAAAAAGTCCTTGTTTG
3201 SEQ ID NO -.2584 -3 -14.4 47.7 -11.4 0 -4.4
TTTAGGCTCGGGTCCTATTC
3638 SEQ ID NO: 2585 -3 -26.1 75.9 -22 -1 -8.5
3645 TTTTGTGTTTAGGCTCGGGT -3 -25.3 74.8 -22.3 0 -3.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2586
CAACCACAACTACATTGGCG
597 SEQ ID NO: 2587 -2.9 -22.7 63.1 -18.8 -0.9 -5.2 CCCCTTTTTGAAGCGATTGG
1151 SEQ ID NO: 2588 -2.9 -25.7 69.7 -22 -0.6 -5.3 GCATTCTGCTCGATCCGCTC
1414 SEQ ID NO:2589 -2.9 -28.7 79 -23.9 -1.9 -6.6 CCTGATATTCAGCTCCCGTC
1574 SEQ ID NO: 2590 -2.9 -27.9 77.2 -23.5 -1.4 -5.6 CTTTCCTCCATGGGCTTGGA
1803 SEQ ID NO: 2591 -2.9 -28.5 79.4 -24.5 -1 -8.3 CAATCCAGTGTGCACGAGAG
2043 SEQ ID NO: 2592 -2.9 -24.2 68.8 -20.4 0 -9.8 CTAATTAATTTTAAGTGTTC
2380 SEQ ID NO: 2593 -2.9 -15.2 51.1 -12.3 0 -6.2 GCCCCAGCATGAATGATACT
2671 SEQ ID NO: 2594 -2.9 -26.3 71.6 -22.5 -0.7 -4.8 ACAAATCTTTTGAAAAGTGT
2961 SEQ ID NO: 2595 -2.9 -16 51.7 -11.6 -1.4 -6 TCCTCTCCCTGGCTGCACCA
3094 SEQ ID NO:2596 -2.9 -33.2 88.4 -29.1 -1.1 -8.3 AAGGTGTAACTGACACATCA
3670 SEQ ID NO: 2597 -2.9 -20.5 61.8 -14.4 -3.2 -7 ACACAACTATTTAAAATATC
3719 SEQ ID NO: 2598 -2.9 -13.8 47.1 -10.9 0 -5 GTGGAAAATGAAAACTTGGC
102 SEQ ID NO: 2599 -2.8 -17.6 53.8 -14.8 0 -2.8 CCTTCTCTCGGCCAGGGGCT
143 SEQ ID NO: 2600 -2.8 -32.8 88.3 -27.8 -2.2 -7.4 TGGTTTGACCTCAGTCTGTG
374 SEQ ID NO: 2601 -2.8 -25.1 74.8 -20.7 -1.6 -6.2 TGAAAAAGGTTTTAGCTGTC
495 SEQ ID NO: 2602 -2.8 -18.5 57.7 -15 -0.4 -8.1 CTGTAGCCGATCAAGTGGAC
739 SEQ ID NO: 2603 -2.8 -24.6 70.1 -21.8 0 -4.9 AGTTGCCTGCATACCCGGCC
774 SEQ ID NO: 2604 -2.8 -32.2 83.6 -27.9 -1.4 -8 GGCCCACCGTTCCTTTCACG
795 SEQ ID NO: 2605 -2.8 -31.6 81.2 -28.1 -0.5 -6 GATGTCGGCCCCTTCAAACA
845 SEQ ID NO: 2606 -2.8 -27.6 73.4 -24.8 0 -6.2 TGAGTCCACAGCCTGGCTGG
996 SEQ ID NO: 2607 -2.8 -29.6 82 -23.2 -2.9 -15.1 CATATGCAATTGATCCCAAG
1023 SEQ ID NO: 2608 -2.8 -21.3 61.5 -17.8 -0.5 -7.6 TAGCCAATGCTATTACAACG
1195 SEQ ID NO: 2609 -2.8 -20.9 60.4 -16.5 -1.6 -6.2 ATATGCTGGTGTTCTCAGGG
1650 SEQ ID NO: 2610 -2.8 -24.9 74.5 -22.1 0.2 -4.5 TCACTGAGGCTCAAAGCAGG
2153 SEQ ID NO: 2611 -2.8 -24.1 69.8 -19.3 -2 -6.1 CATGAGAACCCCAACAGCTA
2236 SEQ ID NO: 2612 -2.8 -24.7 67.6 -21.9 0 -4.6 GTGCAACCCATGAGAACCCC
2244 SEQ ID NO: 2613 -2.8 -28.6 74.5 -25.8 0 -5.4 ACAGAAAAATAGGAAAGCCA
2332 SEQ ID NO: 2614 -2.8 -17.3 52.8 -13.3 -1.1 -3.5 AACAGAAAAATAGGAAAGCC
2333 SEQ ID NO: 2615 -2.8 -15.9 50.1 -13.1 0 -3.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo TGTGTACACAGATGTGTATT
2772 SEQ ID NO: 2616 -2. .8 -20.7 64.2 -15.6 -2.2 -11.7 TTAAATCTTAGAACCAGCTC
2813 SEQ ID NO:2617 -2, .8 -19.4 59.2 -16.6 0 -4.4 CCAGGAAATCTGAGTCCTCT
3108 SEQ ID NO: 2618 -2. .8 -24.8 71.1 -20.8 -1.1 -7.4 ACATTAATAAAAGGGCTTAG
3244 SEQ ID NO:2619 -2, .8 -16.5 52.5 -13.7 0 -4.2 GTTATACATTAATAAAAGGG
3249 SEQ ID NO: 2620 -2. .8 -14.7 49 -11.9 0 -4.2 CAGAAACAAGAGAAGCACAC
3481 SEQ ID NO: 2621 -2. .8 -18.2 55.4 -15.4 0 -4.1 TGAATTTTGTGTTTAGGCTC
3649 SEQ ID NO: 2622 -2, .8 -20.8 64.4 -18 0 -3.7 GGTGTAACTGACACATCAAT
3668 SEQ ID NO:2623 -2. .8 -20.5 61.6 -14.5 -3.2 -7.1 AACTATTTAAAATATCGTAT
3715 SEQ ID NO: 2624 -2. .8 -13.7 46.8 -10.9 0 -4.5 AAATGGGAAAACCCCTCACA
3766 SEQ ID NO: 2625 -2. .8 -22.6 61.9 -17.5 -2.3 -5.8 TTCCAGCAATCCCGGCCGGT
168 SEQ ID NO:2626 -2 .7 -32.4 81.8 -26.7 -0.1 -14.2 CTTCAAACATGGGCCCGGCA
834 SEQ ID NO.-2627 -2 .7 -28.3 74 -24 -0.7 -11.2 GGAGAGAGCCTCTTGTGGAT
862 SEQ ID NO: 2628 -2 .7 -26.1 76.1 -21.9 -1.4 -8.2 AATGCTCAAGCCGAAGGAAC
923 SEQ ID NO.-2629 -2. .7 -22.2 62.5 -17.9 -1.5 -6.3 TGATTGTTCCATATGCAATT
1032 SEQ ID NO: 2630 -2. .7 -20.7 62 -17.1 -0.8 -7.6 CAACAAAGAGGTGGACGGCT
1080 SEQ ID NO.-2631 -2 .7 -23.2 65 -20.5 0 -3.7 GTAAACTCTGAAAGGCATGC
1274 SEQ ID NO:2632 -2. .7 -20.6 61.2 -17.2 0 -8.9 AGGTGTTGGTGGCATTCTGC
1425 SEQ ID NO.-2633 -2. .7 -27 79.9 -23.1 -1.1 -4.7 ACAGGTTGTACCAAGACTGA
1512 SEQ ID NO: 2634 -2. .7 -22.8 66.9 -18.4 -1.7 -6.5 TGCTGGCAAGACTTGCCCGG
1762 SEQ ID NO: 2635 -2. .7 -29.3 77.2 -22.4 -4.2 -13.3 GAGTCCCAGCCATCACAGGA
1895 SEQ ID NO:2636 -2. .7 -29.2 80.7 -26.5 0 -3.8 ATTCAAGAGAGGCAGCAAGA
1944 SEQ ID NO: 2637 -2. .7 -21.8 64.8 -19.1 0 -6.3 ACCCATGAGAACCCCAACAG
2239 SEQ ID NO: 2638 -2 .7 -26.5 69.6 -23.8 0 -4.5 GAGTGAGCTGGGGAGCAGGA
2295 SEQ ID NO: 2639 -2, .7 -27.6 79.7 -23.3 -1.6 -5.5 CATTCTGGCCCCAGCATGAA
2678 SEQ ID NO: 2640 -2 .7 -28.2 75.7 -23.9 -1.5 -7.8 ATGTGTATTACATATGTCAT
2761 SEQ ID NO: 2641 -2, .7 -18.8 59.6 -15 -1 -8.2 TTCTCCCCCTACTCTAATTA
2993 SEQ ID NO: 2642 -2. .7 -25.6 72.1 -22.9 0 -3.5 TGCCCTTCTCCCCCTACTCT
2998 SEQ ID NO: 2643 -2. .7 -33.5 88.1 -30.8 0 -3 GGCTGCAAAAGTCTTCATGG
3151 SEQ ID NO: 2644 -2, .7 -23.2 67.4 -20.5 0 -6.4
3205 TATAAAAAAAAAAGTCCTTG -2, .7 -11.7 42.6 -9 0 -3.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 2645
ATATAAAAAAAAAAGTCCTT
3206 SEQ ID NO: 2646 -2.7 -11.7 42.6 -9 0 -2.9 ACAGTGATACAACTTTGGCA
3402 SEQ ID NO: 2647 -2.7 -21.6 64.1 -18.9 0 -4.6 CCCCAGAACGAGATCTGCCC
37 SEQ ID NO: 2648 -2.6 -29.9 76.8 -25.9 -1.3 -6.3 TGAAAACTTGGCGGCACGGA
94 SEQ ID NO: 2649 -2.6 -24 64.9 -19.5 -1.9 -6.5 TCCCCGCAGCAAAGCAATAG
294 SEQ ID NO:2650 -2.6 -26.3 69.8 -22.8 -0.7 -4.4 TGGCAATGCTGTGTCCCACC
672 SEQ ID NO: 2651 -2.6 -29.4 79.6 -25.2 -0.6 -11 TAGTGCCATAAAGGGTGACG
1359 SEQ ID NO: 2652 -2.6 -22.9 65.3 -19.8 -0.1 -4.4 AGAGGCAGCAAGAGCTATAG
1937 SEQ ID NO: 2653 -2.6 -22.8 68 -18.6 -1.5 -6.6 AGGACGGAATGGCTAAGACG
2279 SEQ ID NO: 2654 -2.6 -22.4 62.9 -19.8 0 -3.7 AAGAAAAGGCACTGGTATTA
2869 SEQ ID NO: 2655 -2.6 -18.5 56.6 -15.1 -0.6 -4 ACACAAATCTTTTGAAAAGT
2963 SEQ ID NO:2656 -2.6 -15.7 50.8 -11.6 -1.4 -6 ACCACTAACTAGTATATAAG
3078 SEQ ID NO: 2657 -2.6 -17.4 55 -14.8 0 -6.3 AGTACAAAGAAAATCATTCT
3347 SEQ ID NO:2658 -2.6 -15.4 50.4 -11.4 -1.3 -7.9 TGCTCCAAAATCCAAAACTT
3807 SEQ ID NO: 2659 -2.6 -19.9 57.6 -17.3 0 -3.6 ATTAGTAAAAACAGAAGTCA
3896 SEQ ID NO:2660 -2.6 -15 49.7 -12.4 0 -3.9 ATGAAAACTTGGCGGCACGG
95 SEQ ID NO: 2661 -2.5 -23.4 63.8 -19 -1.9 -6.5 AAACAGAGCAGAGGAACGGA
262 SEQ ID NO: 2662 -2.5 -21.1 60.9 -18.6 0 -4.1 GAAACAGAGCAGAGGAACGG
263 SEQ ID NO: 2663 -2.5 -21.1 60.9 -18.6 0 -4.1 TAGCATCCTTCATGCTCTGG
427 SEQ ID NO: 2664 -2.5 -25.9 75.3 -20.3 -3.1 -7.7 CAGCCAGTTTTCAAAGATAC
539 SEQ ID NO:2665 -2.5 -20.9 62.6 -18.4 0 -3.2 GTACCAAGACTGAGAGGCCC
1505 SEQ ID NO: 2666 -2.5 -27 74.7 -24.5 0 -6.8 AGCTGCGAAACTCCTTCCAC
1530 SEQ ID NO: 2667 -2.5 -26.3 72 -23.8 0 -5.8 CGGAATGGCTAAGACGTAAG
2275 SEQ ID NO:2668 -2.5 -20.6 59.4 -18.1 0 -5.3 TATATCTGGCAACCGGCCAT
2698 SEQ ID NO: 2669 -2.5 -26.4 71.4 -20.6 -3.3 -10.3 TCTTAGAACCAGCTCTGTCT
2808 SEQ ID NO:2670 -2.5 -24.4 72.6 -21.9 0 -4.4 TAAATCTTAGAACCAGCTCT
2812 SEQ ID NO: 2671 -2.5 -20.2 60.8 -17.7 0 -4.4 ATTAGGCAATGCATACACAA
2977 SEQ ID NO: 2672 -2.5 -20.1 59.8 -17.6 0.1 -7.3 ACAGATGTTCTCCTGGTTAT
3264 SEQ ID NO: 2673 -2.5 -23.6 70.8 -20.3 -0.6 -4.6 AACCTAAGTACAAAGAAAAT
3353 SEQ ID NO: 2674 -2.5 -14.3 47.3 -11.8 0 -5.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
AAACACTTCTGGTTCCAAGC
3558 SEQ ID NO: 2675 -2.5 -22.7 66 -20.2 0 -5
CGGGTCCTATTCCCAAAATA
3630 SEQ ID NO: 2676 -2.5 -24.2 66.2 -19.8 -1.9 -5.6
TTAGGCTCGGGTCCTATTCC
3637 SEQ ID NO: 2677 -2.5 -28 79.1 -24.4 -1 -8.5
ATTTAAAATATCGTATAAAA
3711 SEQ ID NO:2678 -2.5 -11.2 41.8 -8.7 0 -5
CCTTGGAGGTGCGGAGGTTA
405 SEQ ID NO: 2679 -2.4 -27.8 77.7 -25.4 0 -5.2
CCGGCAGGATCCAAACCTGT
820 SEQ ID NO:2680 -2.4 -28.3 74.2 -23.5 -2.4 -9
ATGCTCAAGCCGAAGGAACG
922 SEQ ID NO:2681 -2.4 -23.7 64.7 -19.7 -1.5 -6.3
TTTCATCTGATAATGGTAAA
1289 SEQ ID NO: 2682 -2.4 -16.9 54 -14.5 0 -4.4
ACGAGAGGCCCCAGGCACCC
2030 SEQ ID NO:2683 -2.4 -33.8 85.1 -28.9 -2.5 -7.5
TGTGTATTACATATGTCATA
2760 SEQ ID NO: 2684 -2.4 -18.5 59 -15.5 -0.2 -8.2
AATCTTAGAACCAGCTCTGT
2810 SEQ ID NO: 2685 -2.4 -22.4 66.5 -20 0 -4.4
CTGGTATTAAAGTAAAATAT
2858 SEQ ID NO: 2686 -2.4 -13.9 47.3 -11.5 0 -3
ACGAGATCTGCCCTCGTCCT
30 SEQ ID NO: 2687 -2.3 -29.9 79.8 -24.7 -2.9 -8.4
ACTTGGCGGCACGGAGCCCG
89 SEQ ID NO: 2688 -2.3 -32.1 80.3 -27.4 -2.4 -9.3
TGTTTCCAGCAATCCCGGCC
171 SEQ ID NO: 2689 -2.3 -30.5 80.1 -27.7 -0.1 -6.1
CCACACCCCCTCCCAAGAAA
224 SEQ ID NO: 2690 -2.3 -30.3 75.1 -28 0 -1.8
TTCTCCTGCAGCCAGTCGAG
697 SEQ ID NO: 2691 -2.3 -28.7 80.5 -25.4 -0.9 -7.6
TAGGTGTGGAGGACATCCAC
898 SEQ ID NO: 2692 -2.3 -25.1 73.2 -19.7 -3.1 -9
TGCTCACATTTTACCACCTC
1054 SEQ ID NO: 2693 -2.3 -25.1 71.9 -22.8 0 -3.6
GCTGCGAAACTCCTTCCACA
1529 SEQ ID NO: 2694 -2.3 -27 72.7 -24.7 0 0
TTTCGTTTTTCATCCTCCAG
1710 SEQ ID NO: 2695 -2.3 -24.5 71.5 -22.2 0 -3
TCCATGGGCTTGGATAGCAG
1797 SEQ ID NO: 2696 -2.3 -26.3 74.9 -21.8 -2.2 -11.4
CCTCCATGGGCTTGGATAGC
1799 SEQ ID NO: 2697 -2.3 -28.5 79 -24.6 -1.2 -10.7
AGTGCTCCAGGGTCAAGGCT
1861 SEQ ID NO: 2698 -2.3 -28.9 82.8 -26.6 0 -4.7
AACCCCAACAGCTAGGGCCC
2230 SEQ ID NO: 2699 -2.3 -31 79.3 -27.3 -1.2 -10
TGCTCAATTAAAAAATGAAC
2350 SEQ ID NO: 2700 -2.3 -13.5 46 -11.2 0 -3.6
CACATTCTAATTAATTTTAA
2386 SEQ ID NO: 2701 -2.3 -14.4 48.6 -12.1 0 -6.2
TCCATTACCACATTCTAATT
2394 SEQ ID NO: 2702 -2.3 -21.2 62.6 -18.9 0 -2.5
TGGCACATAATAACTAAGAA
2582 SEQ ID NO: 2703 -2.3 -16.6 52.3 -13.6 -0.4 -4
2809 ATCTTAGAACCAGCTCTGTC -2.3 -23.5 70.5 -21.2 0 -4.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2704
TGCATACACAAATCTTTTGA
2968 SEQ ID NO: 2705 -2.3 -18.8 57.6 -15 -1.4 -7.2 TAATAATAGTTGCCCTTCTC
3008 SEQ ID NO: 2706 -2.3 -21.5 64.2 -19.2 0 -3 GTTTTGTAAAATAGGGATAA
3025 SEQ ID NO :2707 -2.3 -16 51.9 -13.2 -0.2 -4.9 CTGGCTGCAAAAGTCTTCAT
3153 SEQ ID NO: 2708 -2.3 -22.9 66.8 -19.9 -0.4 -6.4 TCTCTCGGCCAGGGGCTGGG
140 SEQ ID NO: 2709 -2.2 -32.2 87.6 -27.7 -2.3 -10.4 TCCTTGGAGGTGCGGAGGTT
406 SEQ ID NO: 2710 -2.2 -28.5 80.1 -25.5 -0.6 -5.9 CAATGCTCAAGCCGAAGGAA
924 SEQ ID NO: 2711 -2.2 -22.7 63.1 -18.9 -1.5 -6.3 TCAACAAAGAGGTGGACGGC
1081 SEQ ID NO: 2712 -2.2 -22.7 64.6 -20.5 0 -3.5 CACCAGAGAGTCAACAAAGA
1091 SEQ ID NO: 2713 -2.2 -20.5 60.6 -18.3 0 -4.8 AGGTAGCTGCGAAACTCCTT
1534 SEQ ID NO: 2714 -2.2 -25.1 70.7 -22.9 0 -7 TCCCGGCCTGGGGATATGCT
1663 SEQ ID NO: 2715 -2.2 -31.7 82.6 -27.1 -2.1 -12.4 GTGTGGACAGAGGTTTGGAG
1972 SEQ ID NO: 2716 -2.2 -24.1 72.4 -21.9 0 -4 TCTCACTGAGGCTCAAAGCA
2155 SEQ ID NO: 2717 -2.2 -24.2 70.5- -20 -2 -9 CAGTGCAACCCATGAGAACC
2246 SEQ ID NO: 2718 -2.2 -25.3 69.2 -22.6 -0.2 -5.4 GAAAAATAGGAAAGCCAATG
2329 SEQ ID NO: 2719 -2.2 -15.7 49.6 -12.3 -1.1 -3.9 ATGCATATACACATACACCA
2482 SEQ ID NO:2720 -2.2 -21.2 62.1 -19 0 -6.4 GAGGTGGCACATAATAACTA
2608 SEQ ID NO: 2721 -2.2 -20.4 61.1 -17.3 -0.8 -4.8 TCTGGCCCCAGCATGAATGA
2675 SEQ ID NO: 2722 -2.2 -28 75.4 -24.2 -1.5 -7.8 GAGATTTGCTCCAAAGCAGT
2718 SEQ ID NO: 2723 -2.2 -23.5 68.4 -18.7 -2.6 -10.2 GCACTGTATTAAATCTTAGA
2821 SEQ ID NO: 2724 -2.2 -18.6 58.2 -16.4 0 -3.4 TCTCCTGGTTATACATTAAT
3256 SEQ ID NO: 2725 -2.2 -20.5 62.5 -18.3 0 -4.6 TAGGCTCGGGTCCTATTCCC
36361 SEQ ID NO: 2726 -2.2 -29.9 82.3 -26.8 -0.8 -8 AGGTGTAACTGACACATCAA
3669 SEQ ID NO: 2727 -2.2 -20.5 61.8 -15.1 -3.2 -7 CCTCCCAAGAAACAGAAGTT
216 SEQ ID NO: 2728 -2.1 -22.6 63.7 -19.8 -0.5 -3.8 TGTGGAGCTTATCTTCCAGC
342 SEQ ID NO: 2729 -2.1 -25.8 76.2 -22.1 -1.6 -6.1 CCATCCGTGAATGATGAAAA
509 SEQ ID NO: 2730 -2.1 -20.1 57.6 -16.8 -1.1 -4.6 AGTCAACCACAACTACATTG
600 SEQ ID NO: 2731 -2.1 -20.5 60.8 -17.7 -0.5 -3.3 GGGAGCCAGTCAACCACAAC
607 SEQ ID NO: 2732 -2.1 -26.4 72.8 -23.7 -0.3 -4.3 CAGGGGGAGCCAGTCAACCA
611 SEQ ID NO: 2733 -2.1 -29.1 79.3 -25.6 -1.3 -4.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
AGCCGATCAAGTGGACATTC 735 SEQ ID NO:2734 -2.1 -24 68.7 -21.9 0 -4.9
GTTCCATATGCAATTGATCC 1027 SEQ ID NO: 2735 -2.1 -23 66.9 -20.9 0 -6.8
TTACCACCTCTGTGATTGTT 1044 SEQ ID NO:2736 -2.1 -24.3 70.8 -21 -1.1 -3.8
CAAAGAGGTGGACGGCTCGC 1077 SEQ ID NO: 2737 -2.1 -26 71 -22.5 -1.3 -5.5
CGATTGGAGTCAGTGCACTG 1138 SEQ ID NO: 2738 -2.1 -24.4 70.7 -19.5 0 -13.8
GGAATCTGCATTAGTGCCAT 1370 SEQ ID NO: 2739 -2.1 -24.4 70.3 -20.4 -1.9 -8.8
TTGGTGCTCTGGAGGTGTGG 1986 SEQ ID NO: 2740 -2.1 -27.1 79.8 -25 0 -6.4
GCACATAATAACTAAGAAGA 2580 SEQ ID NO:2741 -2.1 -16 51.3 -13.9 0 -3.4
CACAGATGTGTATTACATAT 2766 SEQ ID NO: 2742 -2.1 -18.7 58.5 -15.5 -1 -7.1
TAGGCAATGCATACACAAAT 2975 SEQ ID NO: 2743 -2.1 -19.3 57.6 -16.3 -0.7 -8
GGGAACTGGCTGCAAAAGTC 3158 SEQ ID NO: 2744 -2.1 -23.3 66.7 -20.7 -0.2 -6.6
ATGTTCTCCTGGTTATACAT 3260 SEQ ID NO:2745 -2.1 -22.7 68.5 -20.6 0 -4.6
CTAAGTACAAAGAAAATCAT 3350 SEQ ID NO:2746 -2.1 -13.9 47 -11.8 0 -5.3
TACAACTTTGGCACGATACA 3395 SEQ ID NO: 2747 -2.1 -21.1 61.4 -18.3 -0.4 -4
AGACTCAACTGGTTATGTCT 3433 SEQ ID NO: 2748 -2.1 -21.9 66.8 -18.9 -0.6 -8.8
TTGGCTTGAGAACATATCTT 3459 SEQ ID NO: 2749 -2.1 -20.6 62.5 -17.7 -0.6 -5.9
ACAGAAACAAGAGAAGCACA 3482 SEQ ID NO: 2750 -2.1 -18.2 55.4 -16.1 0 -4.1
AAAATGGGAAAACCCCTCAC 3767 SEQ ID NO: 2751 -2.1 -21.2 59.2 -17.5 -1.6 -5.1
CCGGGAGGCAAGGACTCGCT 4 SEQ ID NO: 2752 -2 -29.6 77.7 -26.2 -1.3 -7.3
GGCAATGCTGTGTCCCACCA 671 SEQ ID NO: 2753 -2 -30.1 80.8 -26.5 -0.6 -11
CGCTCCGAGGCTGTAGCCGA 749 SEQ ID NO: 2754 -2 -31.3 80.8 -26.8 -2.5 -10.5
CACATTTTACCACCTCTGTG 1050 SEQ ID NO:2755 -2 -24.1 69.2 -21.2 -0.7 -4.5
AAAGAGGTGGACGGCTCGCT 1076 SEQ ID NO: 2756 -2 -26.2 71.7 -22.8 -1.3 -5.5
AGCGATTGGAGTCAGTGCAC 1140 SEQ ID NO: 2757 -2 -25.3 73.6 -22.3 -0.9 -8.6
GCTGAGAAGAATCCTTCCAT 1844 SEQ ID NO:2758 -2 -23.6 67.6 -19.9 -1.7 -6.1
TGCTTACACACAAATCTGGA 2007 SEQ ID NO: 2759 -2 -20.9 61.8 -18.9 0 -3.6
GGTCTAGAAATCCCAACTCC 2447 SEQ ID NO: 2760 -2 -24.5 69.1 -22.5 0 -6
GTGCCTTTCCCCATGCATAT 2494 SEQ ID NO: 2761 -2 -29.4 79.5 -26.5 -0.7 -6.8
GAAATAGAAACCACTTAAAG
2562 SEQ ID NO: 2762 -2 -14.5 47.8 -12.5 0 -2.9
2563 AGAAATAGAAACCACTTAAA -2 -14.5 47.8 -12.5 0 -2.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 2763
AAGAAATAGAAACCACTTAA
2564 SEQ ID NO: 2764 -2 -14.5 47.8 -12.5 0 -2.8 GTCACTCATAGGGGAGGTGG
2621 SEQ ID NO: 2765 -2 -26 76.9 -23.2 -0.6 -4.8 GTCTGGCAGGTGCCGGTTTC
2792 SEQ ID NO: 2766 -2 -30.2 85.5 -25.8 -2.4 -11.6 TTAGGCAATGCATACACAAA
2976 SEQ ID NO: 2767 -2 -19.4 57.9 -16.5 -0.7 -8 GTCCTTGTTTGTCTCACGTC
3192 SEQ ID NO: 2768 -2 -26.2 78.2 -24.2 0 -4.6 TATACATTAATAAAAGGGCT
3247 SEQ ID NO: 2769 -2 -16.1 51.5 -14.1 0 -4 CCCGAATCTCAGCCATAAAA
3299 SEQ ID NO:2770 -2 -23.2 63.3 -21.2 0 -3.2 CAAAATATCTCATTATGTAT
3617 SEQ ID NO: 2771 -2 -15.4 50.7 -13.4 0 -2.8 AGCTTCCATTAGTAAAAACA
3903 SEQ ID NO: 2772 -2 -18.7 57 -16.7 0 -4.3 GGTGCGGAGGTTAAACCTCA
398 SEQ ID NO: 2773 -1.9 -25.8 71.8 -19.6 -4.3 -13.2 GGAGCCAGTCAACCACAACT
606 SEQ ID NO: 2774 -1.9 -26.1 72.2 -23.7 -0.1 -3.7 TTGAGTCCACAGCCTGGCTG
997 SEQ ID NO: 2775 -1.9 -28.5 79.8 -23.3 -2.5 -14.6 CCACCTCTGTGATTGTTCCA
1041 SEQ ID NO: 2776 -1.9 -27.4 76.9 -24.3 -1.1 -3.7 CTTGTAACTGAAGACATGGA
1310 SEQ ID NO: 2777 -1.9 -19.5 59.2 -17.6 0 -5.2 CCCATGTTCTTGTAACTGAA
1318 SEQ ID NO: 2778 -1.9 -22.6 65.4 -20.2 -0.2 -4.3 CCTCGGTGTAGACCAGGAAG
1443 SEQ ID NO: 2779 -1.9 -26 72.5 -21.8 -2.3 -4.9 GGTAGCTGCGAAACTCCTTC
1533 SEQ ID NO: 2780 -1.9 -25.5 72 -23.1 0 -8 TCCAGGGTCAAGGCTGAGAA
1856 SEQ ID NO:2781 -1.9 -25.5 72.8 -22.9 -0.5 -7.9 AGCCATCACAGGAGACCAGT
1888 SEQ ID NO: 2782 -1.9 -27 76.3 -24.5 -0.3 -3.8 GGAGTCCCAGCCATCACAGG
1896 SEQ ID NO: 2783 -1.9 -29.8 82 -27.4 -0.2 -6.3 CAGTGTGCACGAGAGGCCCC
2038 SEQ ID NO:2784 -1.9 -30.8 82.1 -28 0 -9.8 TACACAGGGCCTCTTCGGAG
2113 SEQ ID NO: 2785 -1.9 -27 75.6 -24 -1 -8.6 CAACAGCTAGGGCCCGAGCA
2225 SEQ ID NO: 2786 -1.9 -29.4 77.6 -25.5 -1.5 -12 GTGGCACATAATAACTAAGA
2605 SEQ ID NO: 2787 -1.9 -18.5 56.7 -15.7 -0.8 -4.2 GCATGAATGATACTCTGCTT
2665 SEQ ID NO: 2788 -1.9 -21.9 65 -19.4 -0.3 -4.8 TAACTTCTATCTCTCTAAAC
2742 SEQ ID NO: 2789 -1.9 -17.6 56.5 -15.7 0 -0.9 AAATCTTAGAACCAGCTCTG
2811 SEQ ID NO:2790 -1.9 -20.5 61.3 -18.6 0 -4.4 ACCTCACTAAGCCTCAGTTT
3041 SEQ ID NO: 2791 -1.9 -25.5 73.5 -23.6 0 -3.2 GAACTGGCTGCAAAAGTCTT
3156 SEQ ID NO: 2792 -1.9 -21.9 63.9 -20 0.3 -6.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal form- Tm of struc- molecular molecular position oligo linding ation Duplex ture oligo oligo
AGTCCTTGTTTGTCTCACGT 3193 SEQ ID NO: 2793 -1.9 -25.8 76.7 -23.9 0 -4.4
ACAATTGGCTTGAGAACATA 3463 SEQ ID NO: 2794 -1.9 -19.4 58.6 -16.7 -0.6 -7.2
CACACAATTGGCTTGAGAAC 3466 SEQ ID NO:2795 -1.9 -20.6 60.9 -17.9 -0.6 -7.2
TTTCCAGCAATCCCGGCCGG 169 SEQ ID NO:2796 -1.8 -31.3 19 -26.7 -0.1 -13.8
TGTGATTCGGCCCACCGTTC 803 SEQ ID NO: 2797 -1.8 -29.5 78.4 -25.2 -2.5 -9.2
TGCCCGGGCACCCTCAGGGA 1749 SEQ ID NO: 2798 -1.8 -34.7 87.6 -27.7 -2.4 -18.6
TGCTCCAGGGTCAAGGCTGA 1859 SEQ ID NO:2799 -1.8 -28.3 79.9 -26 -0.2 -5.9
CCTCCCGCGAGGAGTCCCAG 1906 SEQ ID NO:2800 -1.8 -33.4 84.6 -28.7 -2.5 -13.6
TGCTCTGGAGGTGTGGACAG 1982 SEQ ID NO: 2801 -1.8 -26.1 76.6 -23.7 -0.3 -6.4
CTTGGTGCTCTGGAGGTGTG 1987 SEQ ID NO:2802 -1.8 -26.8 79.1 -25 0 -6.4
GAGCAGCTGACAGCCTTCTA 2131 SEQ ID NO:2803 -1.8 -27.1 77.9 -24.5 -0.5 -8.7
TTCTCACTGAGGCTCAAAGC 2156 SEQ ID NO:2804 -1.8 -23.6 69.7 -20 -1.8 -8.3
TGAACAGAAAAATAGGAAAG 2335 SEQ ID NO: 2805 -1.8 -12.7 44.4 -10.9 0 -2
TAATGCTTATATCCTATAGC 2530 SEQ ID NO:2806 -1.8 -19.7 60.5 -17.4 -0.1 -5
GAAGAAATAGAAACCACTTA 2565 SEQ ID NO:2807 -1.8 -15.8 50.4 -14 0 -3.1
CTGGCCCCAGCATGAATGAT 2674 SEQ ID NO:2808 -1.8 -27.6 73.8 -24.2 -1.5 -7.6
TTATATCTGGCAACCGGCCA 2699 SEQ ID NO:2809 -1.8 -26.5 71.7 -21.5 -3.2 -8.5
ACACAGATGTGTATTACATA 2767 SEQ ID NO: 2810 -1.8 -18.9 59.1 -15.5 -1.6 -9.1
TTTCTGTGTACACAGATGTG 2776 SEQ ID NO:2811 -1.8 -21.2 65.5 -14.8 -2.6 -17.3
AACTGGCTGCAAAAGTCTTC 3155 SEQ ID NO: 2812 -1.8 -21.7 64.1 -19.2 -0.4 -5.6
AAACCTAAGTACAAAGAAAA 3354 , SEQ ID NO: 2813 -1.8 -13.6 45.9 -11.8 0 -5.3
AGAAAACCTAAGTACAAAGA 3357 SEQ ID NO:2814 -1.8 -15.6 50.1 -13.8 0 -5.3
ATGTCTTCAGAAGTTTAACA 3419 SEQ ID NO:2815 -1.8 -18.9 59.5 -17.1 0 -7.1
AAAATATCTCATTATGTATA 3616 SEQ ID NO: 2816 -1.8 -14.4 48.9 -12.6 0 -2.8
TCCTGAGCCGCCGGGAGGCA 14 SEQ ID NO: 2817 -1.7 -33.8 85.6 -27.9 -4.2 -13.3
AAAACTTGGCGGCACGGAGC 92 SEQ ID NO:2818 -1.7 -25.2 67.7 -21.6 -1.9 -6.9
AGCTTTGGGTTTGTGGAGCT 353 SEQ ID NO:2819 -1.7 -26.4 78.1 -23.5 -1.1 -5
CATGCTCTGGGTCCTTGGAG 417 SEQ ID NO:2820 -1.7 -27.5 78.7 -25.3 -0.1 -5
ATCCGTGAATGATGAAAAAG 507 SEQ ID NO: 2821 -1.7 -16.7 51.6 -15 0 -3
751 TGCGCTCCGAGGCTGTAGCC -1.7 -31.7 84.1 -28.4 -1.4 -10.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 2822
AGCCTGGCTGGAAGTCACCC
987 SEQ ID NO: 2823 -1.7 -30.2 82 -27 -1.3 -10.3 AGAGTCAACAAAGAGGTGGA
1085 SEQ ID NO: 2824 -1.7 -20.5 61.9 -18.8 0 -4.8 GAGAGTCAACAAAGAGGTGG
1086 SEQ ID NO: 2825 -1.7 -20.5 61.9 -18.8 0 -4.8 AGATCCCCTTTTTGAAGCGA
1155 SEQ ID NO:2826 -1.7 -25.4 70 -22.9 -0.6 -5.6 AGCCAATGCTATTACAACGG
1194 SEQ ID NO: 2827 -1.7 -22.4 63.3 -19.5 -1.1 -5.6 CCATAAAGGGTGACGTAAAA
1354 SEQ ID NO:2828 -1.7 -19 55.9 -17.3 0 -5.3 CAGGTTGTACCAAGACTGAG
1511 SEQ ID NO: 2829 -1.7 -22.6 66.6 -19.2 -1.7 -5.5 TAGCTGCGAAACTCCTTCCA
1531 SEQ ID NO: 2830 -1.7 -25.8 70.9 -24.1 0 -5.8 TTGCCCGGGCACCCTCAGGG
1750 SEQ ID NO: 2831 -1.7 -34.2 86.7 -27.7 -2 -17.8 TATTCAAGAGAGGCAGCAAG
1945 SEQ ID NO: 2832 -1.7 -20.9 62.9 -19.2 0 -6.3 ACAGAGGTTTGGAGTTAGAG
1966 SEQ ID NO: 2833 -1.7 -21.5 66.6 -19.8 0 -2.5 GCTCTGGAGGTGTGGACAGA
1981 SEQ ID NO:2834 -1.7 -26.7 78.2 -24 -0.9 -6.4 TAGGGGAGGTGGCACATAAT
2613 SEQ ID NO:2835 -1.7 -23.9 69.3 -21.3 -0.8 -4.8 TACACAGATGTGTATTACAT
2768 SEQ ID NO:2836 -1.7 -18.9 59.1 -15.5 -1.7 -10.3 AAAAAGTCCAACCGTTGGCA
3283 SEQ ID NO:2837 -1.7 -22.8 63 -19 6 -1.3 -10.1 GACTCAACTGGTTATGTCTT
3432 SEQ ID NO: 2838 -1.7 -22 66.9 -19.8 0 -7.5 AACAGAGCAGAGGAACGGAG
261 SEQ ID NO: 2839 -1.6 -21.8 63.1 -20.2 0 -4.1 TGTGCAGCCAGTTTTCAAAG
543 SEQ ID NO: 2840 -1.6 -23.4 68.5 -21.8 0 -5.3 CTTCTCCTGCAGCCAGTCGA
698 SEQ ID NO: 2841 -1.6 -29.6 82.1 -27.1 -0.8 -8.1 CGTCCTTCTCCTGCAGCCAG
702 SEQ ID NO: 2842 -1.6 -31 84.2 -28.7 -0.5 -8.1 ACATTTTACCACCTCTGTGA
1049 SEQ ID NO: 2843 -1.6 -24 69.4 -21.2 -1.1 -3.7 ACTGAAGACATGGATTTTCA
1304 SEQ ID NO: 2844 -1.6 -19.7 60.1 -17.6 -0.2 -5.2 TACCAAGACTGAGAGGCCCC
1504 SEQ ID NO: 2845 -1.6 -27.8 74.9 -26.2 0 -6.8 TAGCAGGAAGTCTTGCTGCC
1783 SEQ ID NO: 2846 -1.6 -26.4 76.2 -21.9 -2.9 -9.9 CAGAGGTTTGGAGTTAGAGC
1965 SEQ ID NO: 2847 -1.6 -23.1 70.7 -21.5 0 -2.8 CTCGCCCAGCAACTGAGAAA
2064 SEQ ID NO: 2848 -1.6 -25.3 68.3 -23 -0.4 -4.5 GAGAACCCCAACAGCTAGGG
2233 SEQ ID NO: 2849 -1.6 -26.4 71.6 -23.8 -0.9 -7 ATTACCACATTCTAATTAAT
2391 SEQ ID NO: 2850 -1.6 -17.1 54 -15.5 0 -4.4 AGGGGAGGTGGCACATAATA
2612 SEQ ID NO:2851 -1.6 -23.9 69.3 -21.4 -0.8 -4.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo CTCACTAAGCCTCAGTTTTG
3039 SEQ ID NO: 2852 -1. .6 -23.4 69.4 -21.8 0 -3.2 CAGGAAATCTGAGTCCTCTC
3107 SEQ ID NO: 2853 -1, .6 -23.2 69 -20.4 -1.1 -7.4 CACAATTGGCTTGAGAACAT
3464 SEQ ID NO: 2854 -1. .6 -20.4 60.4 -18 -0.6 -7.2 TTTAAAATATCGTATAAAAT
3710 SEQ ID NO:2855 -1. .6 -11.2 41.8 -9.6 0 -4 GGAGGTGCGGAGGTTAAACC
401 SEQ ID NO:2856 -1, .5 -25.6 71.3 -23.3 -0.6 -5.5 AGCCAGTTTTCAAAGATACC
538 SEQ ID NO: 2857 -1. .5 -22.2 65.1 -20.7 0 -3.2 GCAGCCAGTTTTCAAAGATA
540 SEQ ID NO -.2858 -1 .5 -22.5 66.2 -21 ' 0 -3.5 CAGTCAACCACAACTACATT
601 SEQ ID NO: 2859 -1. .5 -21.2 62.1 -19.7 0 -2.8 GTCCTTCTCCTGCAGCCAGT
701 SEQ ID NO:2860 -1, .5 -31.4 88.8 -29 -0.8 -8.1 AGGCTGTAGCCGATCAAGTG
742 SEQ ID NO:2861 -1. .5 -25.6 72.7 -21.6 -2.5 -10.5 CCCCCTCCCAGGTGAGCTGG
1488 SEQ ID NO: 2862 -1, .5 -34.9 89.5 -30.8 -2.6 -6.7 GCAGTAACTTTCCTCCATGG
1810 SEQ ID NO:2863 -1, .5 -25.6 73.1 -23.6 0 -7.7 CAAGGCTGAGAAGAATCCTT
1848 SEQ ID NO:2864 -1, .5 -21.7 63.2 -18.8 -1.3 -4.3 GTGGACAGAGGTTTGGAGTT
1970 SEQ ID NO: 2865 -1. .5 -24.2 73 -22.7 0 -2.9 GAGGTGTGGACAGAGGTTTG
1975 SEQ ID NO:2866 -1, .5 -24.1 72.4 -22 -0.3 -4 CCCAGGCACCCAGCTGCTTA
2021 SEQ ID NO:2867 -1. .5 -32.5 85.1 -30.3 -0.5 -8.1 CACAGGGCCTCTTCGGAGCC
2111 SEQ ID NO:2868 -1, .5 -30.9 83.3 -27.8 -1.6 -7.5 TGAGCAGCTGACAGCCTTCT
2132 SEQ ID NO:2869 -1, .5 -27.4 78.3 -24.5 -1.3 -8.7 CTCCTGTCGGAAGGACTTCT
2172 SEQ ID NO:2870 -1. .5 -26 73.9 -23.2 -1.2 -7.6 TTACCACATTCTAATTAATT
2390 SEQ ID NO: 2871 -1. .5 -17.2 54.3 -15.7 0 -6 ATGTCCATTACCACATTCTA
2397 SEQ ID NO: 2872 -1. .5 -23 67.4 -21.5 0 -3.7 TATGTCCATTACCACATTCT
2398 SEQ ID NO: 2873 -1. .5 -23 67.4 -20.9 -0.3 -3.8 GTTCCAAATGGAGAGGCTCA
2422 SEQ ID NO: 2874 -1. .5 -24.4 70.3 -21.7 -1.1 -7.5 GATGTGTATTACATATGTCA
2762 SEQ ID NO:2875 -1. .5 -19.4 61 -16.3 -1.6 -9.3 TTCTGTGTACACAGATGTGT
2775 SEQ ID NO:2876 -1. .5 -22.3 68.6 -16.2 -2.6 -17.3 TGTCTGGCAGGTGCCGGTTT
2793 SEQ ID NO:2877 -1. .5 -29.8 83.3 -26 -2.3 -11.5 CAGCTCTGTCTGGCAGGTGC
2799 SEQ ID NO:2878 -1. .5 -29.1 85.3 -26.2 -1.3 -8 ATGCATACACAAATCTTTTG
2969 SEQ ID NO: 2879 -1. .5 -18.2 56.3 -15.6 -1 -8.4 AAAAAAAAAAGTCCTTGTTT
3202 SEQ ID NO:2880 -1. .5 -13.7 46.3 -12.2 0 -4.1
3391 ACTTTGGCACGATACAGATT -1. .5 -21.9 64 -20.4 0.3 -4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mc duplex target IntraInter- total formTm of strucmolecular olecul position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2881
GCACACAATTGGCTTGAGAA
3467 SEQ ID NO: 2882 -1.5 -22.2 64.3 -20.1 -0.3 -6.4
ACGGAGCCCGGGCGGTGGCA
79 SEQ ID NO: 2883 -1.4 -34.5 85.4 -29.4 -3.5 -14.9
AAACAAAAACCACCTCTTGG
191 SEQ ID NO: 2884 -1.4 -19.3 56.1 -16.8 -1 -4.1
TAGCAGAGGCTCCAGAAACA
277 SEQ ID NO: 2885 -1.4 -23.9 68.6 -20.9 -1.5 -5
TAGCCGATCAAGTGGACATT
736 SEQ ID NO: 2886 -1.4 -23.3 66.6 -21.9 0 -4.4
GCCACGTGCGCTCCGAGGCT
757 SEQ ID NO: 2887 -1.4 -33.7 85.3 -29.4 -2.8 -13
TTCGGCCCACCGTTCCTTTC
798 SEQ ID NO: 2888 -1.4 -31.2 81.7 -27.3 -2.5 -6.6
GTGCACTGGAAGGCAAAACT
1126 SEQ ID NO: 2889 -1.4 -22.6 64.5 -19 -2.2 -8.6
GGTTGAGACAGGTAGCTGCG
1543 SEQ ID NO: 2890 -1.4 -26 74.8 -23 -1.5 -3.5
TTCAAGAGAGGCAGCAAGAG
1943 SEQ ID NO: 2891 -1.4 -21.8 65.1 -20.4 0 -6.3
GCCTCTTCGGAGCCAGCGTT
2105 SEQ ID NO: 2892 -1.4 -31.5 84.3 -28.7 -1.3 -6.4
CTTCTCACTGAGGCTCAAAG
2157 SEQ ID NO -.2893 -1.4 -22.7 67.4 -20.8 -0.2 -6.7
TCTGGCAGGTGCCGGTTTCT
2791 SEQ ID NO: 2894 -1.4 -29.9 83.8 -26.1 -2.4 -11.6
TCTATATAAAAAAAAAAGTC
3209 SEQ ID NO: 2895 -1.4 -9.7 39.2 -8.3 0 -3.3
GATGTTCTCCTGGTTATACA
3261 SEQ ID NO:2896 -1.4 -23.3 69.9 -21.9 0 -4.6
GATACAGATTAAAACAATGT
3381 SEQ ID NO: 2897 -1.4 -14.9 49.1 -13.5 0 -4.6
CACAGAAACAAGAGAAGCAC
3483 SEQ ID NO: 2898 -1.4 -18.2 55.4 -16.8 0 -4.1
AATCCAAAAATCCAAAATCC
3831 SEQ ID NO: 2899 -1.4 -17 51.5 -15.6 0 -1.1
ATCTGCCCTCGTCCTGAGCC
25 SEQ ID NO: 2900 -1.3 -32.1 85.9 -29.9 -0.8 -5.4
TCCAGCAATCCCGGCCGGTA
167 SEQ ID NO: 2901 -1.3 -32 80.9 -27.7 -0.1 -14.2
NO : 29OCAATGCTGTGTCCCA
669 SEQ ID NO:2902CCACC -1.3 -29.3 78.1 -27.2 -0.6 -4.3
CCACGTGCGCTCCGAGGCTG
756 SEQ ID NO:2903 -1.3 -31.9 81.1 -29.7 -0.6 -9.4
TTTTTGAAGCGATTGGAGTC
1147 SEQ ID NO: 2904 -1.3 -21 63.2 -19.7 0 -4.1
CTCAGGGAAGCTCCACAGTG
1737 SEQ ID NO: 2905 -1.3 -26.2 75 -24 -0.8 -6.3
AGGAGTCCCAGCCATCACAG
1897 SEQ ID NO: 2906 -1.3 -28.6 79.7 -26.2 -1 -7.5
CTGAGCAGCTGACAGCCTTC
2133 SEQ ID NO:2907 -1.3 -27.4 78.3 -24.5 -1.3 -10.8
AAAAATGAACAGAAAAATAG
2340 SEQ ID NO: 2908 -1.3 -9.5 38.6 -8.2 0 -1.9
ATAATAATAGTTGCCCTTCT
3009 SEQ ID NO: 2909 -1.3 -21.1 62.7 -19.8 0 -3
GAAACAAGAGAAGCACACAA
3479 SEQ ID NO: 2910 -1.3 -17.5 53.6 -16.2 0 -4.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Intertotal form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
CGAGATCTGCCCTCGTCCTG
29 SEQ ID NO: 2911 -1.2 -29.7 79.1 -26.9 -1.6 -6.3 TTGTGGAGCTTATCTTCCAG
343 SEQ ID NO: 2912 -1.2 -24.1 71.9 -21.3 -1.6 -6.1 GCCAGTCAACCACAACTACA
603 SEQ ID NO: 2913 -1.2 -24.9 69.3 -23.7 0 -2.8 TCCACAAAATCTGCATCGTC
883 SEQ ID NO:2914 -1.2 -22.5 64.5 -21.3 0 -4.9 ATACCAATGCTCAAGCCGAA
928 SEQ ID NO: 2915 -1.2 -23.5 64.6 -22.3 0 -5.7 AATACCAATGCTCAAGCCGA
929 SEQ ID NO:2916 -1.2 -23.5 64.6 -22.3 0 -5.7 TTCCATATGCAATTGATCCC
1026 SEQ ID NO:2917 -1.2 -23.8 67.4 -22.6 0 -6.8 GCAGGAAGTCTTGCTGCCTT
1781 SEQ ID NO: 2918 -1.2 -27.7 78.9 -24.4 -2.1 -7.9 TCAAGGCTGAGAAGAATCCT
1849 SEQ ID NO: 2919 -1.2 -22 64.3 -20 -0.6 -4.3 CATTACCACATTCTAATTAA
2392 SEQ ID NO:2920 -1.2 -17.8 55.2 -16.6 0 -3.8 AGAGGGTCTAGAAATCCCAA
2451 SEQ ID NO:2921 -1.2 -22.8 65.9 -19.5 -2.1 -9.9 AAGAGGGTCTAGAAATCCCA
2452 SEQ ID NO: 2922 -1.2 -22.8 65.9 -19.5 -2.1 -9.9 ACTGGTATTAAAGTAAAATA
2859 SEQ ID NO:2923 -1.2 -14.1 47.8 -12.9 0 -3 CCCCTACTCTAATTAGGCAA
2988 SEQ ID NO:2924 -1.2 -24.8 69 -22.9 -0.5 -7.5 AGGAAATCTGAGTCCTCTCC
3106 SEQ ID NO: 2925 -1.2 -24.5 71.6 -22 -1.2 -7.3 ATACAGATTAAAACAATGTC
3380 SEQ ID NO: 2926 -1.2 -14.7 49 -13.5 0 -4.8 ATGCTCCAAAATCCAAAACT
3808 SEQ ID NO: 2927 -1.2 -19.8 57.3 -18.6 0 -3.6 TGGAAAATGAAAACTTGGCG
101 SEQ ID NO:2928 -1.1 -17.2 52.1 -16.1 0 -4 CACACCCCCTCCCAAGAAAC
223 SEQ ID NO: 2929 -1.1 -28.5 72.6 -27.4 0 -1.8 TGGGCCCGGCAGGATCCAAA
825 SEQ ID NO: 2930 -1.1 -30.2 77.3 -27.3 -1.5 -11.2 CCTCTTGTGGATGTCGGCCC
854 SEQ ID NO: 2931 -1.1 -30.7 82.9 -29.6 0 -6.2 CCATATGCAATTGATCCCAA
1024 SEQ ID NO: 2932 -1.1 -23.3 64.7 -21.6 -0.3 -6.8 GTAACTGAAGACATGGATTT
1307 SEQ ID NO:2933 -1.1 -18.7 57.7 -17.6 0 -5.2 GGCAGAGTCTGGGAATCTGC
1381 SEQ ID NO: 2934 -1.1 -26.2 76.4 -20.3 -4.8 -13.5 GAGTTAGAGCTATTCAAGAG
1955 SEQ ID NO: 2935 -1.1 -19.7 62 -18.1 -0.2 -5.1 AGGCTCAAAGCAGGCTGAGC
2147 SEQ ID NO:2936 -1.1 -26.4 75.4 -22.1 -3.2 -11.7 CCACATTCTAATTAATTTTA
2387 SEQ ID NO: 2937 -1.1 -17.1 54.1 -16 0 -6.2 TAATAACTAAGAAGGTGGCA
2597 SEQ ID NO: 2938 -1.1 -18.1 55.8 -17 0 -5 TGTTCTCCTGGTTATACATT
3259 SEQ ID NO: 2939 -1.1 -22.8 68.9 -21.7 0 -4.6
3285 ATAAAAAGTCCAACCGTTGG -1.1 -20 57.8 -17.3 -1.5 -10.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2940
CAACCTGTACAAGCTTCGCT
3519 SEQ ID NO: 2941 -1.1 -24.9 69.4 -23 -0.6 -7.8 TCAACCTGTACAAGCTTCGC
3520 SEQ ID NO: 2942 -1.1 -24.4 69.1 -23.3 0 -6.4 CGTATAAAATTACCCTCAGG
3700 SEQ ID NO: 2943 -1.1 -20.5 59.4 -18.9 -0.1 -3.3 AGGGGCTGGGGGACTGGAGG
130 SEQ ID NO: 2944 -1 -29.8 82.9 -28.3 -0.2 -5.1 TTCTCTCGGCCAGGGGCTGG
141 SEQ ID NO: 2945 -1 -31.1 85.3 -27.7 -2.4 -10.4 TGGCTGTGGCCGACGGAGAG
448 SEQ ID NO: 2946 -1 -28.9 77.2 -24.6 -3.3 -8.4 GTGCAGCCAGTTTTCAAAGA
542 SEQ ID NO: 2947 -1 -24 70 -23 0 -5.3 GGAGGACATCCACAAAATCT
891 SEQ ID NO: 2948 -1 -21.7 62.7 -19.3 -1.3 -6 CCAATGCTCAAGCCGAAGGA
925 SEQ ID NO: 2949 -1 -25.4 68.3 -22.8 -1.5 -5.6 GAGTCAACAAAGAGGTGGAC
1084 SEQ ID NO:2950 -1 -20.7 62.3 -18.8 -0.8 -4.1 TGCACTGGAAGGCAAAACTC
1125 SEQ ID NO: 2951 -1 -21.8 62.9 -19 -1.8 -5 TGTAACTGAAGACATGGATT
1308 SEQ ID NO: 2952 -1 -18.6 57.3 -17.6 0 -5.2 TTGTAACTGAAGACATGGAT
1309 SEQ ID NO -.2953 -1 -18.6 57.3 -17.6 0 -5.2 GCCATAAAGGGTGACGTAAA
1355 SEQ ID NO: 2954 -1 -21.5 61.2 -19.8 -0.4 -6 TTAGTGCCATAAAGGGTGAC
1360 SEQ ID NO -.2955 -1 -22.2 65.3 -20.5 -0.4 -3.8 CCGGCCTGGGGATATGCTGG
1661 SEQ ID NO: 2956 -1 -30.5 79.9 -28.3 -1.1 -7.8 AGGACTTCTCACTGAGGCTC
2161 SEQ ID NO: 2957 -1 -25.4 75.9 -23.9 -0.2 -6.3 GCTCCTGTCGGAAGGACTTC
2173 SEQ ID NO:2958 -1 -26.9 76.3 -24.3 -1.6 -7.5 GACGGAATGGCTAAGACGTA
2277 SEQ ID NO: 2959 -1 -22.1 62.7 -20.2 -0.8 -5.3 GTCTAGAAATCCCAACTCCA
2446 SEQ ID NO: 2960 -1 -24 67.7 -23 0 -6 TGAATGATACTCTGCTTGCT
2662 SEQ ID NO: 2961 -1 -22.1 65.7 -21.1 0 -4.5 TCCCTGGCTGCACCACTAAC
3089 SEQ ID NO: 2962 -1 -28.9 77.6 -26.6 -1.2 -8.4 CATAAAAAGTCCAACCGTTG
3286 SEQ ID NO: 2963 -1 -19.5 56.7 -18.5 0 -6.4 CTGGTTATGTCTTCAGAAGT
3425 SEQ ID NO: 2964 -1 -21.9 67.6 -20.9 0.2 -7.1 ACACAATTGGCTTGAGAACA
3465 SEQ ID NO: 2965 -1 -20.6 60.9 -18.8 -0.6 -7.2 CTCTGGACCAAAAGGTACGG
317 SEQ ID NO: 2966 -0.9 -23.1 64.7 -21.7 -0.1 -5.2 GAGCCAGTCAACCACAACTA
605 SEQ ID NO: 2967 -0.9 -24.6 69.1 -23.7 0 -3.5 TCCGAGGCTGTAGCCGATCA
746 SEQ ID NO: 2968 -0.9 -28.9 77.9 -26.3 -1.7 -9.7 CACCGTTCCTTTCACGAAGT
791 SEQ ID NO: 2969 -0.9 -25.7 70.7 -24 -0.6 -4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
CACAGGTTGTACCAAGACTG 1513 SEQ ID NO:2970 -0.9 -22.9 66.8 -20.3 -1.7 -6
TGCAACCCATGAGAACCCCA 2243 SEQ ID NO: 2971 -0.9 -28.1 72.5 -27.2 0 -4.7
GTGATCAAACACGTCACTCA 2633 SEQ ID NO:2972 -θ'.9 -21.9 64.1 -19.7 -1.2 -6.7
ATTCTGGCCCCAGCATGAAT 2677 SEQ ID NO:2973 -0.9 -27.5 74.6 -25 -1.5 -7.8
AAGTACAAAGAAAATCATTC 3348 SEQ ID NO:2974 -0.9 -13.8 47 -12.3 -0.3 -5.9
GGCTTGAGAACATATCTTGA 3457 SEQ ID NO:2975 -0.9 -21.1 63.5 -19.4 -0.6 -5.9
AACCATGCTTCATGTACACA 3734 SEQ ID NO:2976 -0.9 -22.8 66 -20.5 -1.3 -6.7
TTAGTAAAAACAGAAGTCAG 3895 SEQ ID NO:2977 -0.9 -15 49.8 -14.1 0 -2.9
TTGTTCCATATGCAATTGAT 1029 SEQ ID NO:2978 -0.8 -20.7 62 -19.9 0 -6.8
GATTGTTCCATATGCAATTG 1031 SEQ ID NO:2979 -0.8 -20.7 62 -19 -0.8 -7.6
GTCAACAAAGAGGTGGACGG 1082 SEQ ID NO:2980 -0.8 -22.1 63.7 -20.1 -1.1 -4.3
CCCCAGGCACCCAGCTGCTT 2022 SEQ ID NO:2981 -0.8 -34.8 88.8 -32.6 -1.3 -8.1
AGCAGCTGACAGCCTTCTAC 2130 SEQ ID NO:2982 -0.8 -26.7 77.2 -24.5 -1.3 -8.7
CAATTAAAAAATGAACAGAA 2346 SEQ ID NO:2983 -0.8 -11 41.2 -10.2 0 -3
GTGTACACAGATGTGTATTA 2771 SEQ ID NO: 2984 -0.8 -20.4 63.7 -17.4 -2.2 -11.1
TTCTCCTGGTTATACATTAA 3257 SEQ ID NO:2985 -0.8 -20.6 62.8 -19.8 0 -4.6
CCTATTCCCAAAATATCTCA 3625 SEQ ID NO:2986 -0.8 -21.8 62.5 -21 0 -2.6
GAGATCTGCCCTCGTCCTGA 28 SEQ ID NO:2987 -0.7 -29.5 80.8 -28.3 -0.2 -6.3
GGGGCTGGGGGACTGGAGGC 129 SEQ ID NO:2988 -0.7 -31.6 87.1 -30.4 -0.2 -5.1
CTCTTGTGGATGTCGGCCCC 853 SEQ ID NO:2989 -0.7 -30.7 82.9 -30 0 -6.2
AACTGAAGACATGGATTTTC 1305 SEQ ID NO:2990 -0.7 -18.3 56.9 -17.6 0 -5.2
GAGGCCCCCTCCCAGGTGAG 1492 SEQ ID NO:2991 -0.7 -34.6 89.6 -32.4 -1.4 -8.5
TGGTGCTCTGGAGGTGTGGA 1985 SEQ ID NO:2992 -0.7 -27.6 80.8 -26.9 0 -5.7
CTGCTTACACACAAATCTGG 2008 SEQ ID NO:2993 -0.7 -21.2 62.4 -20.5 0 -3.6
AGCAGGCTGAGCAGCTGACA 2139 SEQ ID NO:2994 -0.7 -27.7 79.1 -25.5 -1.4 -9.8
GTGGCACATAATAACTAAGA 2583 SEQ ID NO:2995 -0.7 -18.5 56.7 -16.9 -0.8 -4.2
AGAAGGTGGCACATAATAAC 2588 SEQ ID NO:2996 -0.7 -19.1 58 -17.5 -0.8 -4
ATAGGGGAGGTGGCACATAA 2614 SEQ ID NO:2997 -0.7 -23.9 69.3 -22.3 -0.8 -4.8
CAAACACGTCACTCATAGGG 2628 SEQ ID NO:2998 -0.7 -21.8 63.1 -21.1 0 -4.4
2759 GTGTATTACATATGTCATAA -0.7 -17.8 57 -16.5 -0.2 -8.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 2999
CTGGCAGGTGCCGGTTTCTG
2790 SEQ ID NO: 3000 -0.7 -29.5 81.6 -26.4 -2.4 -11.3 TCTGTCTGGCAGGTGCCGGT
2795 SEQ ID NO: 3001 -0.7 -30.9 86.5 -27.8 -2.4 -11.6 TAAAAAAAAAAGTCCTTGTT
3203 SEQ ID NO: 3002 -0.7 -13.3 45.5 -12.6 0 -3.2 TGGTTATACATTAATAAAAG
3251 SEQ ID NO: 3003 -0.7 -13.5 46.6 -12.8 0 -4.2 TGGCTTGAGAACATATCTTG
3458 SEQ ID NO: 3004 -0.7 -20.5 62.1 -19 -0.6 -5.9 CCAAAATATCTCATTATGTA
3618 SEQ ID NO: 3005 -0.7 -17.4 54.5 -16.7 0 -2.8 TTCCCAAAATATCTCATTAT
3621 SEQ ID NO:3006 -0.7 -19 57.5 -18.3 0 -2.6 ATTCCCAAAATATCTCATTA
3622 SEQ ID NO: 3007 -0.7 -19 57.5 -18.3 0 -2.6 CATTAGTAAAAACAGAAGTC
3897 SEQ ID NO: 3008 -0.7 -15 49.7 -14.3 0 -3.9 AGGTGCGGAGGTTAAACCTC
399 SEQ ID NO: 3009 -0.6 -25.1 71 -21.3 -3.2 -12.8 GCAATGCTGTGTCCCACCAC
670 SEQ ID NO: 3010 -0.6 -29.1 78.9 -27.7 -0.6 -8.3 CTCTGTGATTGTTCCATATG
1037 SEQ ID NO .-3011 -0.6 -22.2 66.9 -21.6 0 -5.4 CACTGGAAGGCAAAACTCGG
1123 SEQ ID NO: 3012 -0.6 -22 62 -20.9 -0.2 -4 ATTACAACGGTTCTTGCGGC
1184 SEQ ID NO .-3013 -0.6 -24.5 68.7 -23.3 -0.3 -5.1 TCTTGTAACTGAAGACATGG
1311 SEQ ID NO: 3014 -0.6 -19.3 59.2 -18.7 0 -5.7 GAATCTGCATTAGTGCCATA
1369 SEQ ID NO: 3015 -0.6 -22.9 67.1 -20.4 -1.9 -7.2 AAAAAATGAACAGAAAAATA
2341 SEQ ID NO:3016 -0.6 -8.8 37.5 -8.2 0 -2.4 TAAAAAATGAACAGAAAAAT
2342 SEQ ID NO: 3017 -0.6 -8.8 37.5 -8.2 0 -2.4 TACCACATTCTAATTAATTT
2389 SEQ ID NO: 3018 -0.6 -17.2 54.3 -16.6 0 -6.2 AAAGAGGGTCTAGAAATCCC
2453 SEQ ID NO: 3019 -0.6 -21.4 62.6 -20.3 -0.2 -7.8 GGAGGTGGCACATAATAACT
2609 SEQ ID NO:3020 -0.6 -21.9 64.2 -20.7 -0.3 -4.8 TGGCCCCAGCATGAATGATA
2673 SEQ ID NO:3021 -0.6 -26.4 71.5 -24.2 -1.5 -7.6 AGAGATTTGCTCCAAAGCAG
2719 SEQ ID NO: 3022 -0.6 -22.3 65.4 -19.1 -2.6 -10.2 ATAACTTCTATCTCTCTAAA
2743 SEQ ID NO: 3023 -0.6 -17.4 56 -16.8 0 -1.1 AATTAGGCAATGCATACACA
2978 SEQ ID NO: 3024 -0.6 -20.1 59.8 -18.6 -0.7 -8 AGAGATAGACTTTGCCTCCA
3125 SEQ ID NO: 3025 -0.6 -24.6 71.3 -24 0 -3.8 AAACAAGAGAAGCACACAAT
3478 SEQ ID Nθ:3026 -0.6 -16.9 52.4 -16.3 0 -4.1 AATCACAGAAACAAGAGAAG
3486 SEQ ID NO: 3027 -0.6 -15.2 49.5 -14.6 0 -2.9 CAGAGGCTCCAGAAACAGAG
274 SEQ ID NO:3028 -0.5 -23 66.5 -22.5 0 -3.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
CCGCAGCAAAGCAATAGCAG 291 SEQ ID NO:3029 -0.5 -24.4 66.9 -22.2 -1.7 -7.4
AGCCAGTCAACCACAACTAC 604 SEQ ID NO:3030 -0.5 -24.2 68.4 -23.7 0 -3.5
CCTCTGTGATTGTTCCATAT 1038 SEQ ID NO:3031 -0.5 -24.2 70.9 -23.7 0 -2.1
CAGAGAGTCAACAAAGAGGT 1088 SEQ ID NO:3032 -0.5 -20 60.9 -19.5 0 -4.8
TTCATCTGATAATGGTAAAC 1288 SEQ ID NO:3033 -0.5 -17 54.2 -16.5 0 -4.4
GCTGGCAAGACTTGCCCGGG 1761 SEQ ID NO:3034 -0.5 -30.5 79.8 -25.8 -4.2 -13.3
AGCTGACAGCCTTCTACACA 2127 SEQ ID NO:3035 -0.5 -25.8 74.1 -23.9 -1.3 -7.5
AATAACTAAGAAGGTGGCAC \
2596 SEQ ID NO:3036 -0.5 -18.6 56.8 -18.1 0 -5
AAAGCACTGTATTAAATCTT 2824 SEQ ID NO:3037 -0.5 -16.9 53.7 -16.4 0 -4.1
AGCACACAATTGGCTTGAGA 3468 SEQ ID NO:3038 -0.5 -22.9 66.7 -21.2 -1.1 -7.4
AATATCTCATTATGTATATG 3614 SEQ ID NO:3039 -0.5 -15.8 52.4 -15.3 0 -3.1
GGGTCCTATTCCCAAAATAT 3629 SEQ ID NO:3040 -0.5 -23.4 66 -21.4 -1.4 -5.4
TCTGCCCTCGTCCTGAGCCG 24 SEQ ID NO:3041 -0.4 -32.9 85.2 -31.6 -0.8 -5.4
GGCGGCACGGAGCCCGGGCG 85 SEQ ID NO:3042 -0.4 -35.9 85.7 -29.7 -5.2 -19.4
TCTCGGCCAGGGGCTGGGGG 138 SEQ ID NO:3043 -0.4 -33.3 88.8 -30.3 -2.6 -10.4
CCACCTCTTGGTGTTTCCAG 182 SEQ ID NO:3044 -0.4 -28.1 79.1 -24.7 -3 -7.4
CTTGGAGGTGCGGAGGTTAA 404 SEQ ID NO:3045 -0.4 -25.1 71.6 -24.7 0 -4
CGGCAGGATCCAAACCTGTG 819 SEQ ID NO:3046 -0.4 -26.3 70.8 -23.5 -2.4 -9.6
TACCACCTCTGTGATTGTTC 1043 SEQ ID NO:3047 -0.4 -24.6 72.1 -23 -1.1 -3.8
CATGCATATACACATACACC 2483 SEQ ID NO: 3048 -0.4 -21.2 62.1 -20.8 0 -6.8
CTAATGCTTATATCCTATAG 2531 SEQ ID NO:3049 -0.4 -18.8 58.4 -18.4 0 -4.7
ATAATAACTAAGAAGGTGGC 2598 SEQ ID NO:3050 -0.4 -17.4 54.6 -17 0 -5
GGGGAGGTGGCACATAATAA 2611 SEQ ID NO:3051 -0.4 -23.2 66.8 -21.9 -0.8 -4.8
AAGCACTGTATTAAATCTTA 2823 SEQ ID NO:3052 -0.4 -17.3 55 -16.9 0 -4.1
GAAAAGGCACTGGTATTAAA 2867 SEQ ID NO:3053 -0.4 -17.8 54.7 -16.6 -0.6 -4.1
AATGCATACACAAATCTTTT 2970 SEQ ID NO:3054 -0.4 -17.5 54.6 -17.1 0 -7.3
AGAAACAAGAGAAGCACACA 3480 SEQ ID NO:3055 -0.4 -18.2 55.4 -17.8 0 -4.1
ACCATGCTTCATGTACACAA 3733 SEQ ID NO:3056 -0.4 -22.8 66 -21 -1.3 -6.7
GCGGCACGGAGCCCGGGCGG 84 SEQ ID NO:3057 -0.3 -35.9 85.7 -29.8 -5.2 -19.4
93 GAAAACTTGGCGGCACGGAG -0.3 -24 65.2 -21.8 -1.9 -6.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO:3058
AGCTGGTGGGCCAGGGGGAG
622 SEQ ID NO:3059 -0.3 -31.4 86.8 -27.9 -3.2 -9.4 ACCGTTCCTTTCACGAAGTT
790 SEQ ID NO:3060 -0.3 -25.1 69.9 -24 -0.6 -4.1 AGAGCCTCTTGTGGATGTCG
858 SEQ ID NO:3061 -0.3 -26.1 75.2 -25.8 0 -3.7 ATTGTTCCATATGCAATTGA
1030 SEQ ID NO:3062 -0.3 -20.7 62 -19.9 -0.2 -6.8 CGAGAGGCCCCAGGCACCCA
2029 SEQ ID NO: 3063 -0.3 -34.3 85.4 -31.5 -2.5 -7.5 CACGAGAGGCCCCAGGCACC
2031 SEQ ID NO: 3064 -0.3 -32.5 82.9 -29.7 -2.5 -7.5 GTGTGCACGAGAGGCCCCAG
2036 SEQ ID NO:3065 -0.3 -30.8 82.1 -29.6 0 -9.8 GGACTTCTCACTGAGGCTCA
2160 SEQ ID NO:3066 -0.3 -26.1 76.8 -25.3 -0.2 -6.3 CTGTCGGAAGGACTTCTCAC
2169 SEQ ID NO:3067 -0.3 -24 70 -22.1 -1.6 -7.6 AAAAATAGGAAAGCCAATGA
2328 SEQ ID NO:3068 -0.3 -15.7 49.6 -14.2 -1.1 -3.9 AGAAGAAATAGAAACCACTT
2566 SEQ ID NO: 3069 -0.3 -16.1 51.1 -15.8 0 -3.2 ACACGTCACTCATAGGGGAG
2625 SEQ ID NO:3070 -0.3 -24.3 70.4 -23.5 -0.2 -5 TCTGTGTACACAGATGTGTA
2774 SEQ ID NO: 3071 -0.3 -21.9 67.6 -17.3 -2.3 -16.8 CTTTGGCACGATACAGATTA
3390 SEQ ID NO:3072 -0.3 -21.4 62.9 -20.4 -0.4 -3.5 TCTGGTTCCAAGCATTTTGG
3551 SEQ ID NO: 3073 -0.3 -24.2 70.6 -22 -1.9 -6 AAAATATCGTATAAAATTAC
3707 SEQ ID NO:3074 -0.3 -11.3 42 -11 0 -3.2 ATCCAAAATCCGAAATGCTC
3822 SEQ ID NO: 3075 -0.3 -20.5 58.6 -20.2 0 -3.6 CGGGAGGCAAGGACTCGCTG
3 SEQ ID NO: 3076 -0.2 -27.6 74.3 -26 -1.3 -4.5 AGTCAACAAAGAGGTGGACG
1083 SEQ ID NO: 3077 -0.2 -20.9 61.4 -18.8 -1.9 -5.1 GATAATGGTAAACTCTGAAA
1281 SEQ ID NO: 3078 -0.2 -15.9 51.1 -15.7 0 -2.6 TGTGGACAGAGGTTTGGAGT
1971 SEQ ID NO:3079 -0.2 -24.1 72.4 -23.9 0 -3.8 AATATGTCCATTACCACATT
2400 SEQ ID NO: 3080 -0.2 -21 61.9 -20.2 -0.3 -3.8 GAGGGTCTAGAAATCCCAAC
2450 SEQ ID NO: 3081 -0.2 -23 66.2 -20.7 -2.1 -9.9 TAAGAAGGTGGCACATAATA
2590 SEQ ID NO: 3082 -0.2 -18.6 57 -17.5 -0.8 -4.8 TTTTGTAAAATAGGGATAAT
3024 SEQ ID NO:3083 -0.2 -14.8 49.2 -14.1 -0.2 -3.5 GCATGTGGCTGAACCTCACT
3053 SEQ ID NO:3084 -0.2 -26.8 75.2 -25.6 -0.9 -8.3 ACAACTTTGGCACGATACAG
3394 SEQ ID NO:3085 -0.2 -21.4 62.1 -20.5 -0.4 -4 TTAAAATATCGTATAAAATT
3709 SEQ ID NO:3086 -0.2 -11.2 41.8 -11 0 -3 TTGCCCCAGAACGAGATCTG
40 SEQ ID NO: 3087 -0.1 -26 70.5 -24.7 -1.1 -6.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
ATAGCAGAGGCTCCAGAAAC 278 SEQ ID NO:3088 -0.1 -23.2 67.4 -21.5 -1.5 -5
CCAGTCAACCACAACTACAT 602 SEQ ID NO:3089 -0.1 -23.1 65.3 -23 0 -2.8
ACCTCTGTGATTGTTCCATA 1039 SEQ ID NO:3090 -0.1 -24.4 71.5 -24.3 0 -2.1
ATTTTACCACCTCTGTGATT 1047 SEQ ID NO:3091 -0.1 -23.2 68 -21.9 -1.1 -3.7
AGAGAGTCAACAAAGAGGTG 1087 SEQ ID NO: 3092 -0.1 -19.3 59.6 -19.2 0 --4.8
GATTGGAGTCAGTGCACTGG 1137 SEQ ID NO:3093 -0.1 -24.8 73.5 -21.6 -0.4 -14.4
CTATTACAACGGTTCTTGCG 1186 SEQ ID NO:3094 -0.1 -22.1 63.7 -22 0 -4.7
ACCAAGACTGAGAGGCCCCC 1503 SEQ ID NO:3095 -0.1 -30.1 78.7 -30 0 -6.8
CTCCCGCGAGGAGTCCCAGC 1905 SEQ ID NO:3096 -0.1 -33.2 85.6 -30.6 -2 -12.8
GAGAGGCAGCAAGAGCTATA 1938 SEQ ID NO:3097 -0.1 -23.4 69.1 -21.7 -1.5 -5.8
CTATTCAAGAGAGGCAGCAA 1946 SEQ ID NO:3098 -0.1 -21.8 64.7 -21.7 0 -6.3
AGTTAGAGCTATTCAAGAGA 1954 SEQ ID NO:3099 -0.1 -19.7 62 -19.6 0.5 -5.1
ACGGAATGGCTAAGACGTA 2276 SEQ ID NO:3100 -0.1 -20.8 59.7 -20.2 -0.2 -5.3
TCCAAACAGAAAGAGGGTCT 2462 SEQ ID NO: 3101 -0.1 -21.3 62.4 -21.2 0 -3.7
TGAACCTCACTAAGCCTCAG 3044 SEQ ID NO:3102 -0.1 -24 68.3 -23.9 0 -3.2
AACAAGAGAAGCACACAATT 3477 SEQ ID NO:3103 -0.1 -17.7 54.4 -17.6 0 -4.1
GGGAAAACCCCTCACATAAG 3762 SEQ ID NO:3104 -0.1 -23 63.5 -21.3 -1.6 -4.8
CTTGGCGGCACGGAGCCCGG 88 SEQ ID NO:3105 0 -33.1 82 -30.7 -2.4 -10.1
CCGACGGAGAGGTAGCATCC 439 SEQ ID NO:3106 0 -27.8 75.1 -27.8 0 -4.7
TACCAATGCTCAAGCCGAAG 927 SEQ ID NO:3107 0 -23.5 64.8 -23.5 0 -5.7
GAATACCAATGCTCAAGCCG 930 SEQ ID NO:3108 0 -23.5 64.6 -23.5 0 -5.7
CAGATCCCCTTTTTGAAGCG 1156 SEQ ID NO:3109 0 -25.5 69.9 -24.7 -0.6 -5.6
TATTACAACGGTTCTTGCGG 1185 SEQ ID NO:3110 0 -22.4 64.2 -21.8 -0.3 -4.7
CAATGCTATTACAACGGTTC 1191 SEQ ID NO:3111 0 -20.3 60.2 -20.3 0 -4.7
CTGAAGACATGGATTTTCAT 1303 SEQ ID NO:3112 0 -19.5 59.6 -18.9 -0.3 -5.3
TAACTGAAGACATGGATTTT 1306 SEQ ID NO: 3113 0 -17.6 55.1 -17.6 0 -5.2
TGCCATAAAGGGTGACGTAA 1356 SEQ ID NO:3114 0 -22.2 63 -21.5 -0.4 -8.2
TGTACCAAGACTGAGAGGCC 1506 SEQ ID NO:3115 0 -25 71 -25 0 -6.4
CCCGGGCACCCTCAGGGAAG 1747 SEQ ID NO:3116 0 -32.2 81.6 -30.3 -1.7 -11.5
1858 GCTCCAGGGTCAAGGCTGAG 0 -28.3 80.4 -27.6 -0.5 -7.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 3117
TCCCAGCCATCACAGGAGAC
1892 SEQ ID NO: 3118 0 -28.2 77.8 -28.2 0 -3.5 AATCCAGTGTGCACGAGAGG
2042 SEQ ID NO: 3119 0 -24.7 70.2 -23.8 0 -9.8 ACACAGGGCCTCTTCGGAGC
2112 SEQ ID NO: 3120 0 -29.1 80.5 -27.8 -1.2 -8.6 GCAGGCTGAGCAGCTGACAG
2138 SEQ ID NO: 3121 0 -27.7 79.1 -25.9 -1.7 -11.1 ATAACTAAGAAGGTGGCACA
2595 SEQ ID NO: 3122 0 -20 59.9 -19.2 -0.6 -5 AGCATGAATGATACTCTGCT
2666 SEQ ID NO: 3123 0 -21.8 64.9 -20.6 -1.1 -4.8 CCCTACTCTAATTAGGCAAT
2987 SEQ ID NO: 3124 0 -22.8 65.5 -22.1 -0.5 -7.5 GAAAACCTAAGTACAAAGAA
3356 SEQ ID NO: 3125 0 -14.9 48.4 -14.9 0 -5.3 TCTTCAGAAGTTTAACAGTG
3416 SEQ ID NO:3126 0 -18.9 59.8 -18.9 0 -7.1 GCCGGGAGGCAAGGACTCGC
5 SEQ ID NO: 3127 0.1 -30.5 80 -26.9 -3.7 -10.2 GGACTGGAGGCAGAGAAGGT
120 SEQ ID NO: 3128 0.1 -25.3 73.3 -23.7 -1.7 -4.7 GGGACTGGAGGCAGAGAAGG
121 SEQ ID NO: 3129 0.1 -25.3 72.5 -23.7 -1.7 -4.7 CACCCCCTCCCAAGAAACAG
221 SEQ ID NO:3130 0.1 -28.3 72.3 -28.4 0 -1.8 AGAAACAGAGCAGAGGAACG
264 SEQ ID NO:3131 0.1 -19.9 58.8 -20 0 -4.1 GGACATCCACAAAATCTGCA
888 SEQ ID NO: 3132 0.1 -22.4 63.8 -22.5 0 -5.3 TCTGAATACCAATGCTCAAG
933 SEQ ID NO: 3133 0.1 -20.2 60 -20.3 0 -3.6 CACCTCTGTGATTGTTCCAT
1040 SEQ ID NO:3134 0.1 -25.4 73.2 -24.7 -0.6 -3.4 ACCAGAGAGTCAACAAAGAG
1090 SEQ ID NO: 3135 0.1 -19.8 59.6 -19.9 0 -4.8 TTACAACGGTTCTTGCGGCA
1183 SEQ ID NO: 3136 0.1 -25.2 69.8 -24.7 -0.3 -7.3 AATCTGCATTAGTGCCATAA
1368 SEQ ID NO: 3137 0.1 -21.6 63.7 -20.4 -1.2 -6.5 GTTGAGACAGGTAGCTGCGA
1542 SEQ ID NO:3138 0.1 -25.4 73.5 -23.9 -1.5 -3.5 AGTGTGCACGAGAGGCCCCA
2037 SEQ ID NO:3139 0.1 -30.8 82.1 -30 0 -9.8 AAGGACTTCTCACTGAGGCT
2162 SEQ ID NO: 3140 0.1 -24.3 71.6 -23.9 -0.2 -6.3 GAACCCCAACAGCTAGGGCC
2231 SEQ ID NO: 3141 0.1 -29.6 77.4 -28.4 -1.2 -7.3 CTCTAATTAGGCAATGCATA
2982 SEQ ID NO: 3142 0.1 -20.2 60.9 -19.4 -0.7 -8 GATAATAATAGTTGCCCTTC
3010 SEQ ID NO: 3143 0.1 -20.8 62.1 -20.9 0 -3 GTTCTCCTGGTTATACATTA
3258 SEQ ID NO: 3144 0.1 -22.5 68.4 -22.6 0 -4 CGATACAGATTAAAACAATG
3382 SEQ ID NO-.3145 0.1 -14.5 47.6 -14.6 0 -3 AAACCATGCTTCATGTACAC
3735 SEQ ID NO: 3146 0.1 -21.4 62.8 -20.1 -1.3 -6.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo AAGCTTCCATTAGTAAAAAC 3904 SEQ ID NO: 3147 0.1 -17.3 54 -17.4 0 -6.2 GCAATCCCGGCCGGTAAGAC
163 SEQ ID NO: 3148 0.2 -29 74.8 -26.2 0 -14.2 CTTGCCCGGGCACCCTCAGG 1751 SEQ ID NO: 3149 0.2 -33.9 86.1 -29.8 -1.3 -16.7 AAGGCTGAGAAGAATCCTTC 1847 SEQ ID NO:3150 0.2 -21.4 63.5 -19.9 -1.7 -7.1 CTCTGGAGGTGTGGACAGAG 1980 SEQ ID NO:3151 0.2 -24.9 73.9 -23.1 -2 -6.6 CCAGGCACCCAGCTGCTTAC 2020 SEQ ID NO: 3152 0.2 -30.7 82.4 -29.5 -1.3 -8.1 ACTTCTCACTGAGGCTCAAA 2158 SEQ ID NO: 3153 0.2 -22.9 67.7 -22.6 -0.2 -6.3 GAACAGAAAAATAGGAAAGC 2334 SEQ ID NO: 3154 0.2 -14.5 47.8 -14.7 0 -2.8 AAGAAGGTGGCACATAATAA 2589 SEQ ID NO: 3155 0.2 -18.2 55.7 -17.5 -0.8 -4.8 CATAGGGGAGGTGGCACATA 2615 SEQ ID NO: 3156 0.2 -25.3 72.8 -24.6 -0.8 -4.8 AGATGTGTATTACATATGTC 2763 SEQ ID NO: 3157 0.2 -18.7 59.9 -17.3 -1.6 -9.3 GATACTCAACCTGTACAAGC 3525 SEQ ID NO: 3158 0.2 -21.8 64.2 -22 0 -6.1 GGATACTCAACCTGTACAAG 3526 SEQ ID NO: 3159 0.2 -21.2 62.7 -21.4 0 -6.1 CCCAAAATATCTCATTATGT 3619 SEQ ID NO:3160 0.2 -19.7 58.7 -19.9 0 -2.8 TCTGTGATTGTTCCATATGC 1036 SEQ ID NO: 3161 0.3 -23.1 69.3 -23.4 0 -5.7 TGATAATGGTAAACTCTGAA 1282 SEQ ID NO: 3162 0.3 -16.6 52.8 -16.9 0 -2.6 CAGGTAGCTGCGAAACTCCT 1535 SEQ ID NO: 3163 0.3 -25.7 71.4 -25.2 -0.6 -7 CAGCCATCACAGGAGACCAG 1889 SEQ ID NO:3164 0.3 -26.5 74 -26.2 -0.3 -3.8 GCTATTCAAGAGAGGCAGCA 1947 SEQ ID NO: 3165 0.3 -24.3 71.3 -23.7 -0.7 -6.3 TCGGAAGGACTTCTCACTGA 2166 SEQ ID NO: 3166 0.3 -23.4 68 -23 -0.5 -7.6 AGCTCCTGTCGGAAGGACTT 2174 SEQ ID NO: 3167 0.3 -26.5 74.9 -25.2 -1.6 -7.5 GGACGGAATGGCTAAGACGT 2278 SEQ ID NO: 3168 0.3 -23.6 65.6 -23.1 -0.6 -5.2 GGGTCTAGAAATCCCAACTC 2448' SEQ ID NO: 3169 0.3 -23.7 68 -22.6 -1.3 -9.2 ACAGATGTGTATTACATATG 2765 SEQ ID NO:3170 0.3 -18 57.2 -15.5 -2.8 -6.6 AGGCATGTGGCTGAACCTCA 3055 SEQ ID NO:3171 0.3 -26.9 75.5 -25.9 -1.2 -8.3 CAGATGTTCTCCTGGTTATA 3263 SEQ ID NO: 3172 0.3 -23.1 69.6 -23.4 0 -4.6 GCCGCCGGGAGGCAAGGACT 8 SEQ ID NO: 3173 0.4 -32.1 81.5 -28.3 -4.2 -12.6 CAGGGGCTGGGGGACTGGAG
131 SEQ ID NO: 3174 0.4 -29.3 81.3 -29.2 -0.2 -4.3 TAGCTTTGGGTTTGTGGAGC
354 SEQ ID NO: 3175 0.4 -25.2 75.3 -25 -0.3 -4.6 598 TCAACCACAACTACATTGGC 0.4 -22.3 64 -21.7 -0.9 -3.9 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 3176
GAGGCTGTAGCCGATCAAGT
743 SEQ ID NO: 3177 0.4 -26.2 74.2 -24.1 -2.5 -10.5 GCTCCGAGGCTGTAGCCGAT
748 SEQ ID NO: 3178 0.4 -30.5 81.3 -28.4 -2.5 -10.5 TCCATATGCAATTGATCCCA
1025 SEQ ID NO:3179 0.4 -24.4 68.1 -24.8 0 -6.8 CTCACATTTTACCACCTCTG
1052 SEQ ID NO:3180 0.4 -24.2 69.6 -24.6 0 -1.8 ATTAGTGCCATAAAGGGTGA
1361 SEQ ID NO: 3181 0.4 -22 64.7 -21.7 -0.4 -3.8 AGAGCTATTCAAGAGAGGCA
1950 SEQ ID NO:3182 0.4 -22.4 67.3 -21.7 -1 -5.2 AGAACCCCAACAGCTAGGGC
2232 SEQ ID NO: 3183 0.4 -27.6 74.4 -26.7 -1.2 -6.8 AGGGTCTAGAAATCCCAACT
2449 SEQ ID NO: 3184 0.4 -23.3 66.8 -21.6 -2.1 -9.9 TTAGAACCAGCTCTGTCTGG
2806 SEQ ID NO:3185 0.4 -24.3 71.4 -22.7 -2 -6.8 AGCACTGTATTAAATCTTAG
2822 SEQ ID NO:3186 0.4 -18 57.1 -18.4 0 -4.1 AATAGTTGCCCTTCTCCCCC
3004 SEQ ID NO:3187 0.4 -30.8 81.7 -31.2 0 -3 TCACTAAGCCTCAGTTTTGT
3038 SEQ ID NO: 3188 0.4 -23.7 70.8 -24.1 0 -3.2 AACCTCACTAAGCCTCAGTT
3042 SEQ ID NO: 3189 0.4 -24.7 70.8 -25.1 0 -3.2 TAGGCATGTGGCTGAACCTC
3056 SEQ ID NO: 3190 0.4 -25.9 73.8 -25 -1.2 -8.3 CCATAAAAAGTCCAACCGTT
3287 SEQ ID NO: 3191 0.4 -21.5 60.1 -21.9 0 -2.8 ACTCAACTGGTTATGTCTTC
3431 SEQ ID NO: 3192 0.4 -21.8 67.1 -22.2 0 -4.7 CTGGTTCCAAGCATTTTGGA
3550 SEQ ID NO: 3193 0.4 -24.4 70.3 -22.2 -2.6 -7.7 GGCAGGGAGCGAGTGTCAAC
63 SEQ ID NO: 3194 0.5 -26.9 76.2 -25.8 -1.6 -4.5 TTGGCGGCACGGAGCCCGGG
87 SEQ ID NO: 3195 0.5 -33.4 82.6 -31.2 -1.9 -13.5 ACCCCCTCCCAAGAAACAGA
220 SEQ ID NO: 3196 0.5 -28.2 72.5 -28.7 0 -1.8 ACACCCCCTCCCAAGAAACA
222 SEQ ID NO: 3197 0.5 -28.5 72.6 -29 0 -1.8 CAAAGCAATAGCAGAGGCTC
285 SEQ ID NO: 3198 0.5 -22.2 65 -21 -1.7 -8.1 GGATGTCGGCCCCTTCAAAC
846 SEQ ID NO: 3199 0.5 -28.1 74.8 -28.6 0 -6.2 TGGAGGACATCCACAAAATC
892 SEQ ID NO:3200 0.5 -20.8 60.8 -19.3 -2 -6 GTGCTCCAGGGTCAAGGCTG
1860 SEQ ID NO: 3201 0.5 -28.9 82.2 -28.9 -0.1 -4.7 CGGAAGGACTTCTCACTGAG
2165 SEQ ID NO: 3202 0.5 -23 66.8 -22.8 -0.5 -7.6 AAAATAGGAAAGCCAATGAT
2327 SEQ ID NO: 3203 0.5 -16.4 51.1 -15.7 -1.1 -3.9 ATATGTCCATTACCACATTC
2399 SEQ ID NO:3204 0.5 -22.1 65.5 -22 -0.3 -3.8 CAGCATGAATGATACTCTGC
2667 SEQ ID NO: 3205 0.5 -21.6 64.1 -21.5 -0.3 -4.8 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
CTGAACCTCACTAAGCCTCA 3045 SEQ ID NO:3206 0.5 -24.9 70 -25.4 0 -3.2
GTCTTCAGAAGTTTAACAGT 3417 SEQ ID NO:3207 0.5 -20.1 63.1 -20.6 0 -7.1
TCCAAAATCCGAAATGCTCC 3821 SEQ ID NO:3208 0.5 -22.5 61.9 -23 0 -3.6
CTGCCCTCGTCCTGAGCCGC 23 SEQ ID NO:3209 0.6 -34.3 87.6 -33.8 -1 -5.4
GCTGGTGGGCCAGGGGGAGC 621 SEQ ID NO: 3210 0.6 -33.2 91.1 -30.6 -3.2 -9.4
ACCACCTCTGTGATTGTTCC 1042 SEQ ID NO: 3211 0.6 -26.9 76.4 -26.3 -1.1 -3.7
TCTGGGAATCTGCATTAGTG 1374 SEQ ID NO:3212 0.6 -22.4 67.1 -23 0 -4.9
CTCACTGAGGCTCAAAGCAG 2154 SEQ ID NO: 3213 0.6 -23.8 69.2 -22.4 -2 -8.4
TCCTGTCGGAAGGACTTCTC 2171 SEQ ID NO: 3214 0.6 -25.5 73.6 -24.5 -1.6 -7.6
GAGGCTCAGTAATATGTCCA 2410 SEQ ID NO:3215 0.6 -23.8 70.5 -23.9 -0.1 -4.1
GAAGGTGGCACATAATAACT 2587 SEQ ID NO:3216 0.6 -20 59.7 -20 -0.3 -4.8
TTCTGGCCCCAGCATGAATG 2676 SEQ ID NO:3217 0.6 -27.5 74.5 -27.2 -0.8 -7.8
GGTTATACATTAATAAAAGG 3250 SEQ ID NO:3218 0.6 -14.7 49 -15.3 0 -4.2
TAAAAAGTCCAACCGTTGGC 3284 SEQ ID NO: 3219 0.6 -21.8 61.4 -20.7 -1.7 -10.5
TAAGTACAAAGAAAATCATT 3349 SEQ ID NO:3220 0.6 -13.1 45.5 -13.7 0 -5.3
CTCGGCCAGGGGCTGGGGGA 137 SEQ ID NO:3221 0.7 -33.5 88.2 -31.8 -2.4 -10.41
TGTTCCATATGCAATTGATC 1028 SEQ ID NO: 3222 0.7 -21 63.1 -21.7 0 -6.8
GCAGAGTCTGGGAATCTGCA 1380 SEQ ID NO: 3223 0.7 -25.7 74.8 -21.3 -5.1 -14.1
GTGCACGAGAGGCCCCAGGC 2034 SEQ ID NO:3224 0.7 -32.6 85.6 -31.3 -1.4 -12
GCTGACAGCCTTCTACACAG 2126 SEQ ID NO:3225 0.7 -25.8 74.1 -25.8 -0.5 -6.3
AACACGTCACTCATAGGGGA 2626 SEQ ID NO:3226 0.7 -23.6 67.8 -24.3 0 -4.6
AGTGATCAAACACGTCACTC 2634 SEQ ID NO:3227 0.7 -21.2 63.2 -19.9 -2 -7.2
ACCAGCTCTGTCTGGCAGGT 2801 SEQ ID NO:3228 0.7 -29.5 85 -28 -2.2 -7.6
TCGTATAAAATTACCCTCAG 3701 SEQ ID NO:3229 0.7 -19.7 58.3 -20.4 0 -3.2
GAAAATGAAAACTTGGCGGC 99 SEQ ID NO:3230 0.8 -19 55.5 -19.8 0 -5.3
GCTGGGGGACTGGAGGCAGA 126 SEQ ID NO:3231 0.8 -29.3 81.9 -28.4 -1.7 -5.9
AGCAGAGGCTCCAGAAACAG 276 SEQ ID NO:3232 0.8 -24.2 69.4 -23.6 -1.3 -5
GTAGCATCCTTCATGCTCTG 428 SEQ ID NO-.3233 0.8 -25.9 76.2 -23.6 -3.1 -8.4
AGGTGTGGAGGACATCCACA 897 SEQ ID NO: 3234 0.8 -26.1 75 -21.8 -5.1 -11.7
1142 GAAGCGATTGGAGTCAGTGC 0.8 -24.3 70.7 -25.1 0 -5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular sition oligo 1 Dinding • ation Duplex ture oligo oligo SEQ ID NO:3235
TCATCTGATAATGGTAAACT
1287 SEQ ID NO: 3236 0.8 -17.8 55.8 -18.6 0 -4.4 GCATTAGTGCCATAAAGGGT
1363 SEQ ID NO: 3237 0.8 -23.9 68.9 -23.4 -1.2 -6.2 TGTGCACGAGAGGCCCCAGG
2035 SEQ ID NO: 3238 0.8 -30.8 81.1 -30.7 0 -9.8 CCTTTCCCCATGCATATACA
2491 SEQ ID NO: 3239 0.8 -27 73.3 -27.8 0 -6.8 TGGCTGCAAAAGTCTTCATG
3152 SEQ ID NO: 3240 0.8 -22 64.8 -22.1 -0.4 -6.4 CAGATTAAAACAATGTCCTT
3377 SEQ ID NO: 3241 0.8 -17.8 54.8 -18.6 0 -4.8 CTATTCCCAAAATATCTCAT
3624 SEQ ID NO: 3242 0.8 -19.8 59 -20.6 0 -2.6 CCTGAGCCGCCGGGAGGCAA
13 SEQ ID NO: 3243 0.9 -32.7 81.5 -29.4 -4.2 -12.5 CTCTCGGCCAGGGGCTGGGG
139 SEQ ID NO: 3244 0.9 -33 88.2 -31.3 -2.6 -10.4 GGCTGTGGCCGACGGAGAGG
447 SEQ ID NO: 3245 0.9 -30.1 79.8 -28.4 -2.6 -8.7 TTCAAACATGGGCCCGGCAG
833 SEQ ID NO: 3246 0.9 -27.4 72.5 -26.7 -0.7 -11.2 GGTAAACTCTGAAAGGCATG
1275 SEQ ID NO: 3247 0.9 -20 59.7 -20.4 0 -7.5 CCATGTTCTTGTAACTGAAG
1317 SEQ ID NO: 3248 0.9 -20.6 62 -20.5 -0.9 -4.3 CCCGGCCTGGGGATATGCTG
1662 SEQ ID NO: 3249 0.9 -31.3 80.7 -30.4 -1.5 -11.4 GAGCTATTCAAGAGAGGCAG
1949 SEQ ID NO: 3250 0.9 -22.4 67.3 -22.2 -1 -5.1 ATCCAGTGTGCACGAGAGGC
2041 SEQ ID NO: 3251 0.9 -27.2 76.9 -27.2 0 -9.8 GAAGGACTTCTCACTGAGGC
2163 SEQ ID NO: 3252 0.9 -24 70.9 -24.4 -0.2 -6.7 CAGATGTGTATTACATATGT
2764 SEQ ID NO: 3253 0.9 -19 59.8 -17.7 -2.2 -9.3 CTCAACCTGTACAAGCTTCG
3521 SEQ ID NO: 3254 0.9 -23.5 66.9 -24.4 0 -6.4 GCAGAGGCTCCAGAAACAGA
275 SEQ ID NO: 3255 1 -24.8 70.4 -25.1 -0.5 -3.9 GTTTGACCTCAGTCTGTGTA
372 SEQ ID NO: 3256 1 -24.8 75.3 -24.2 -1.6 -4.2 GAGAGAGCCTCTTGTGGATG
861 SEQ ID NO: 3257 1 -24.9 73.2 -24.5 -1.3 -8.2 AGTGCACTGGAAGGCAAAAC
1127 SEQ ID NO: 3258 1 -21.7 62.9 -20.5 -2.2 -10.1 GCCTTCTACACAGGGCCTCT
2119 SEQ ID NO: 3259 1 -30 83.6 -29.9 -1 -7.3 CAGCTCCTGTCGGAAGGACT
2175 SEQ ID NO: 3260 1 -27.1 75.6 -26.5 -1.6 -7.5 GAAAGAGGGTCTAGAAATCC
2454 SEQ ID NO:3261 1 -20 60.2 -21 0 -6 GCCTTTCCCCATGCATATAC
2492 SEQ ID NO:3262 1 -28.1 76.4 -29.1 0 -6.8 GCCCTTCTCCCCCTACTCTA
2997 SEQ ID NO: 3263 1 -33.2 87.8 -34.2 0 -2 ACAAGAGAAGCACACAATTG
3476 SEQ ID NO:3264 1 -18.4 56.1 -19.4 0 -6.7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
TGGCAGGGAGCGAGTGTCAA 64 SEQ ID NO:3265 1.1 -26.7 75.4 -26.2 -1.6 -5
GGAAAATGAAAACTTGGCGG 100 SEQ ID NO:3266 1.1 -18.4 54.3 -19.5 0 -4
GGTGGAAAATGAAAACTTGG 103 SEQ ID NO:3267 1.1 -17 52.6 -18.1 0 -2.6
GAGGTGCGGAGGTTAAACCT 400 SEQ ID NO:3268 1.1 -25.3 70.7 -24.7 -1.7 -7.7
TTGGAGGTGCGGAGGTTAAA 403 SEQ ID NO-.3269 1.1 -23.5 67.5 -24.6 0 -4
GAGCCTCTTGTGGATGTCGG 857 SEQ ID NO:3270 ' 1.1 -27.3 77.6 -28.4 0 -3.7
GAGGACATCCACAAAATCTG 890 SEQ ID NO:3271 1.1 -20.5 60.2 -21 -0.3 -6
CATTTTACCACCTCTGTGAT 1048 SEQ ID NO:3272 1.1 -23.8 68.8 -23.7 -1.1 -3.7
CTGACAGCCTTCTACACAGG 2125 SEQ ID NO:3273 1.1 -25.2 72.4 -26.3 0 -3.5.
GTTATATCTGGCAACCGGCC 2700 SEQ ID NO:3274 1.1 -27 73.8 -26 -2.1 -6.9
AGATGTTCTCCTGGTTATAC 3262 SEQ ID NO-.3275 1.1 -22.6 69 ' -23.7 0 -4.6
TCCTATTCCCAAAATATCTC 3626 SEQ ID NO:3276 1.1 -21.5 62.8 -22.6 0 -2.6
GAAATGCTCCAAAATCCAAA 3811 SEQ ID NO:3277 1.1 -18.6 54.7 -19.7 0 -2.9
GAGCCCGGGCGGTGGCAGGG 76 SEQ ID NO:3278 1.2 -34.7 88.3 -32.1 -2.7 -15.7
CCAGCAATCCCGGCCGGTAA 166 SEQ ID NO:3279 1.2 -30.9 77.1 -29.1 -0.1 -14.2
GCTGTGGCCGACGGAGAGGT 446 SEQ ID NO:3280 1.2 -30.1 80.7 -30.7 -0.2 -8.3
GCCTCTTGTGGATGTCGGCC 855 SEQ ID NO:3281 1.2 -30.5 83.9 -31 -0.4 -5.8
AACAAAGAGGTGGACGGCTC 1079 SEQ ID NO:3282 1.2 -22.9 65.3 -23.6 -0.2 -3.7
TTGTACCAAGACTGAGAGGC 1507 SEQ ID NO:3283 1.2 -23.1 67.7 -24.3 0 -4.2
AAAAGCACTGTATTAAATCT 2825 SEQ ID NO:3284 1.2 -16.1 51.7 -17.3 0 -4.1
AATGCTCCAAAATCCAAAAC 3809 SEQ ID NO:3285 1.2 -18.2 54 -19.4 0 -3.6
CCAAAATCCGAAATGCTCCA 3820 SEQ ID NO:3286 1.2 -22.8 61.7 -24 0 -3.6
AGCCCGGGCGGTGGCAGGGA 75 SEQ ID NO:3287 1.3 -34.7 88.3 -32.1 -3.1 -15.7
CGGCACGGAGCCCGGGCGGT 83 SEQ ID NO:3288 1.3 -35.3 85 -31.2 -5.2 -18.1
GACTGGAGGCAGAGAAGGTG 119 SEQ ID NO:3289 1.3 -24.1 70.5 -23.7 -1.7 -4.7
ATGCTATTACAACGGTTCTT 1189 SEQ ID NO:3290 1.3 -21.3 63.3 -22.6 0 -4.7
AGAGAGGCAGCAAGAGCTAT 1939 SEQ ID NO:3291 1.3 -23.7 70 -23.4 -1.5 -6.6
ACAGCCTTCTACACAGGGCC 2122 SEQ ID NO:3292 1.3 -28.7 79.8 -28.2 -1.8 -6.4
CCTGTCGGAAGGACTTCTCA 2170 SEQ ID NO:3293 1.3 -25.8 73 -25.5 -1.6 -7.6
2176 TCAGCTCCTGTCGGAAGGAC 1.3 -26.6 75.3 -26.8 -1 -7.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO:3294
TGGCACATAATAACTAAGAA
2604 SEQ ID NO:3295 1.3 -16.6 52.3 -17.2 -0.4 -4 CACTGGTATTAAAGTAAAAT
2860 SEQ ID NO: 3296 1.3 -15.1 49.6 -16.4 0 -3 CTAATTAGGCAATGCATACA
2980 SEQ ID NO: 3297 1.3 -19.8 59.4 -20.2 -0.7 -8 GAACCTCACTAAGCCTCAGT
3043 SEQ ID NO:3298 1.3 -25.2 71.7 -26.5 0 -3.2 ATACTCAACCTGTACAAGCT
3524 SEQ ID NO:3299 1.3 -22.1 64.8 -23.4 0 -6.1 ATATCGTATAAAATTACCCT
3704 SEQ ID NO:3300 1.3 -18.3 55.3 -19.6 0 -3.2 ATCCAAAAATCCAAAATCCG
3830 SEQ ID NO:3301 1.3 -18.5 53.7 -19.8 0 -2.2 CCGCCGGGAGGCAAGGACTC
7 SEQ ID NO: 3302 1.4 -30.7 79.2 -27.9 -4.2 -10.4 CTTCTCTCGGCCAGGGGCTG
142 SEQ ID NO:3303 1.4 -30.8 84.7 -30 -2.2 -7.9 TCTTGTGGATGTCGGCCCCT
852 SEQ ID NO:3304 1.4 -30.7 82.9 -32.1 0 -6.2 AGGACATCCACAAAATCTGC
889 SEQ ID NO:3305 1.4 -21.7 62.9 -22.5 -0.3 -6 GCCCCAGGCACCCAGCTGCT
2023 SEQ ID NO: 3306 1.4 -36.5 92.7 -36 -1.7 -11.5 TGACAGCCTTCTACACAGGG
2124 SEQ ID NO: 3307 1.4 -25.5 73 -26.3 -0.3 -3.5 GCTGAGCAGCTGACAGCCTT
2134 SEQ ID NO:3308 1.4 -28.8 81 -26.5 -2.1 -15.6 GGCTCAAAGCAGGCTGAGCA
2146 SEQ ID NO:3309 1.4 -27.1 76.2 -24.2 -4.3 -12.9 ATAACTAAGAAGAAATAGAA
2573 SEQ ID NO:3310 1.4 -11.8 43 -13.2 0 -2.9 TCACTCATAGGGGAGGTGGC
2620 SEQ ID NO:3311 1.4 -26.6 77.9 -27.2 -0.6 -4.5 GGCCCCAGCATGAATGATAC
2672 SEQ ID NO: 3312 1.4 -26.6 72.2 -26.4 -1.5 -7.3 TCTAATTAGGCAATGCATAC
2981 SEQ ID NO: 3313 1.4 -19.5 59.5 -20 -0.7 -8 GCTGAACCTCACTAAGCCTC
3046 SEQ ID NO: 3314 1.4 -26 73 -27.4 0 -3.6 AGATTAAAACAATGTCCTTA
3376 SEQ ID NO:3315 1.4 -16.8 53.1 -18.2 0 -4.8 AAATATCGTATAAAATTACC
3706 SEQ ID NO: 3316 1.4 -14 46.9 -15.4 0 -3.2 ACAGAAGTTTTAAAAAACAA
205 SEQ ID NO: 3317 1.5 -12.7 44.6 -12.3 -1.9 -8.8 AACAGAAGTTTTAAAAAACA
206 SEQ ID NO:'3318 1.5 -12.7 44.6 -12.3 -1.9 -8.8 TGGAGGTGCGGAGGTTAAAC
402 SEQ ID NO: 3319 1.5 -23.6 67.7 -25.1 0 -4 CTGAATACCAATGCTCAAGC
932 SEQ ID NO:3320 1.5 -21.6 62.5 -23.1 0 -5.3 CAGCCTTCTACACAGGGCCT
2121 SEQ ID NO: 3321 1.5 -29.4 81.1 -29.1 -1.8 -7.3 CAGCTGACAGCCTTCTACAC
2128 SEQ ID NO: 3322 1.5 -25.8 74.1 -25.9 -1.3 -7.6 ATAATAACTAAGAAGAAATA
2576 SEQ ID NO: 3323 1.5 -10.9 41.3 -12.4 0 -2.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
GGATAATAATAGTTGCCCTT 3011 SEQ ID NO:3324 1.5 -21.6 63.2 -23.1 0 -3
TTTGTAAAATAGGGATAATA 3023 SEQ ID NO:3325 1.5 -14.4 48.4 -15.4 -0.2 -2
GTTATGTCTTCAGAAGTTTA 3422 SEQ ID NO:3326 1.5 -19.7 62.9 -21.2 0.2 -7.1
ACTGGTTATGTCTTCAGAAG 3426 SEQ ID NO: 3327 1.5 -20.9 64.8 -21.7 -0.5 -6.5
GTTCCAAGCATTTTGGATAA 3547 SEQ ID NO: 3328 1.5 -21.3 63.2 -19.7 -3.1 -8.3
ACGGAGAGGTAGCATCCTTC 436 SEQ ID NO:3329 1.6 -25.8 74.4 -26.5 -0.7 -6.4
GCCGACGGAGAGGTAGCATC 440 SEQ ID NO:3330 1.6 -27.6 75.8 -29.2 0 -5.8
CATCCGTGAATGATGAAAAA 508 SEQ ID NO: 3331 1.6 -17.4 52.6 -18.2 -0.6 -4.2
TGGTAAACTCTGAAAGGCAT 1276 SEQ ID NO:3332 1.6 -20 59.7 -21.6 0 -4
AATTAAAAAATGAACAGAAA 2345 SEQ ID NO:3333 1.6 -9.6 38.8 -11.2 0 -3
TAATATGTCCATTACCACAT 2401 SEQ ID NO: 3334 1.6 -20.6 61 -21.7 -0.1 -3.8
CTAAGAAGAAATAGAAACCA 2569 SEQ ID NO:3335 1.6 -14.8 48.3 -16.4 0 -2
GGTGGCACATAATAACTAAG 2584 SEQ ID NO:3336 1.6 -19.1 57.9 -19.8 -0.8 -4.8
GGCATGTGGCTGAACCTCAC 3054 SEQ ID NO:3337 1.6 -27.1 75.8 -27.4 -1.2 -8.3
AATATCGTATAAAATTACCC 3705 SEQ ID NO:3338 1.6 -16.7 51.9 -18.3 0 -3.2
AATCCAAAATCCGAAATGCT 3823 SEQ ID NO:3339 1.6 -19.4 55.8 -21 0 -3.6
CAGAAGTTTTAAAAAACAAA 204 SEQ ID NO: 3340 1.7 -11.8 42.8 -12.3 -1.1 -8
CCACCGTTCCTTTCACGAAG 792 SEQ ID NO:3341 1.7 -26.5 • 71 -27.4 -0.6 -3.8
AGAGAGCCTCTTGTGGATGT 860 SEQ ID NO: 3342 1.7 -25.5 75.4 -26.3 -0.8 -7.3
CATTAGTGCCATAAAGGGTG 1362 SEQ ID NO:3343 1.7 -22.1 64.6 -23.1 -0.4 -3.8
ATAGCAGGAAGTCTTGCTGC 1784 SEQ ID NO:3344 1.7 -24.4 72.4 -23.6 -2.5 -9.9
GGATAGCAGGAAGTCTTGCT 1786 SEQ ID NO:3345 1.7 -24.4 72.2 -24.5 -1.6 -9.5
TGCACGAGAGGCCCCAGGCA 2033 SEQ ID NO:3346 1.7 -32.1 83.1 -31.3 -2.5 -8.7
ACAGGGCCTCTTCGGAGCCA 2110 SEQ ID NO:3347 1.7 -30.9 83.3 -29.1 -3.5 -8.6
GCAACCCATGAGAACCCCAA 2242 SEQ ID NO:3348 1.7 -27.4 70.6 -29.1 0 -4.5
AGAAAGAGGGTCTAGAAATC
2455 SEQ ID NO: 3349 1.7 -18 56.6 -19.7 0 -6 CAGAAAGAGGGTCTAGAAAT
2456 SEQ ID NO:3350 1.7 -18.3 56.6 -20 0 -6 AAGAAGAAATAGAAACCACT
2567 SEQ ID NO:3351 1.7 -15.3 49.2 -17 0 -2.1
TCTCAGCCATAAAAAGTCCA 3293 SEQ ID NO: 3352 1.7 -22.1 63.8 -23.8 0 -2.4
3355 AAAACCTAAGTACAAAGAAA 1.7 -13.6 45.9 -15.3 0 -5.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular sition oligo binding ation Duplex ture oligo oligo
SEQ ID NO:3353
TAAAATATCGTATAAAATTA
3708 SEQ ID NO: 3354 1.7 -10.8 41.1 -12.5 0 -3.2 GCAATAGCAGAGGCTCCAGA
281 SEQ ID NO: 3355 1.8 -26.2 74.6 -26.7 -1.2 -6.4 TAATTAGGCAATGCATACAC
2979 SEQ ID NO: 3356 1.8 -19.1 58 -20 -0.7 -8 CCCTTCTCCCCCTACTCTAA
2996 SEQ ID NO:3357 1.8 -30.7 81 -32.5 0 -0.7 CAACTTTGGCACGATACAGA
3393 SEQ ID NO:3358 1.8 -21.8 62.9 -22.9 -0.4 -4 AAAAATGGGAAAACCCCTCA
3768 SEQ ID NO: 3359 1.8 -20.3 57.1 -19.8 -2.3 -5.8 AAAAAATGGGAAAACCCCTC
3769 SEQ ID NO: 3360 1.8 -18.9 54.5 -18.4 -2.3 -5.8 AGATCTGCCCTCGTCCTGAG
27 SEQ ID NO: 3361 1.9 -28.9 79.8 -30 -0.6 -6.8 AAATGAAAACTTGGCGGCAC
97 SEQ ID NO:3362 1.9 -20 57.6 -21.9 0 -6.5 GTTTTAAAAAACAAAAACCA
199 SEQ ID NO:3363 1.9 -12.7 44.1 -13.3 -1.2 -8.1 GTGGAGGACATCCACAAAAT
893 SEQ ID NO: 3364 1.9 -21.6 62.4 -19.3 -4.2 -9.9 GCACTGGAAGGCAAAACTCG
1124 SEQ ID NO: 3365 1.9 -22.6 63.4 -23.3 -1.1 -4.6 CATGTTCTTGTAACTGAAGA
1316 SEQ ID NO: 3366 1.9 -19.2 59.5 -20.1 -0.9 -4.6 TGGATAGCAGGAAGTCTTGC
1787 SEQ ID NO:3367 1.9 -23.5 70 -24.5 -0.8 -7.9 ATGGAGAGGCTCAGTAATAT
2415 SEQ ID NO: 3368 1.9 -21.3 64.7 -22 -1.1 -5 CCCCATGCATATACACATAC
2486 SEQ ID NO:3369 1.9 -24.3 67.5 -26.2 0 -6.8 TAACTAAGAAGAAATAGAAA
2572 SEQ ID NO:3370 1.9 -11.1 41.7 -13 0 -2.9 CTAAGAAGGTGGCACATAAT
2591 SEQ ID NO: 3371 1.9 -19.8 59.4 -20.8 -0.8 -4.8 CTCATAGGGGAGGTGGCACA
2617 SEQ ID NO: 3372 1.9 -26.9 77.1 -28 -0.6 -4.9 CCTACTCTAATTAGGCAATG
2986 SEQ ID NO:3373 1.9 -20.8 61.8 -22.2 0 -7.5 CAAGCATTTTGGATAAGGGA
3543 SEQ ID NO: 3374 1.9 -20.6 61.3 -22.5 0 -4.1 TCCCAAAATATCTCATTATG
3620 SEQ ID NO: 3375 1.9 -18.9 57.1 -20.8 0 -2.6 CAGGATGTACAGCCAATAAT
3868 SEQ ID NO: 3376 1.9 -21.1 61.8 -22.4 -0.3 -7.1 AATGAAAACTTGGCGGCACG
96 SEQ ID NO: 3377 2 -21.5 59.8 -21.9 -1.5 -6.5 AGCAATCCCGGCCGGTAAGA
164 SEQ ID NO: 3378 2 -28.8 74.5 -27.8 -0.1 -14.2 CATCTGATAATGGTAAACTC
1286 SEQ ID NO: 3379 2 -17.8 55.8 -19.8 0 -4.4 CAGGCACCCAGCTGCTTACA
2019 SEQ ID NO:3380 2 -29.4 80 -30 -1.3 -8.1 CCCATGCATATACACATACA
2485 SEQ ID NO: 3381 2 -23 65.1 -25 0 -6.8 TCATAGGGGAGGTGGCACAT
2616 SEQ ID NO: 3382 2 -26 75.1 -27.1 -0.8 -5.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo TTAAAGTAAAATATTTCAAA 2852 SEQ ID NO:3383 2 -10.8 41.2 -12.8 0 -6.6 GGGATAATAATAGTTGCCCT
3012 SEQ ID NO:3384 2 -22.7 65.3 -24 -0.5 -4.5 AGGGATAATAATAGTTGCCC
3013 SEQ ID NO:3385 2 -21.8 63.7 -23.1 -0.5 -4.5 GCCTCAGTTTTGTAAAATAG
3031 SEQ ID NO:3386 2 -19.8 60.4 -21.3 -0.2 -4.2
ACGATACAGATTAAAACAAT 3383 SEQ ID NO:3387 2 -14.7 48.1 -16.7 0 -3.5
TATCGTATAAAATTACCCTC 3703 SEQ ID NO:3388 2 -18.7 56.5 -20.7 0 -3.2
TCCGAAATGCTCCAAAATCC 3814 SEQ ID NO:3389 2 -22.5 61.9 -24.5 ' 0 -3.6
TGGCGGCACGGAGCCCGGGC 86 SEQ ID NO:3390 2.1 -35.1 86.1 -32.2 -3.3 -18.1
TTTGACCTCAGTCTGTGTAG 371 SEQ ID NO-.3391 2.1 -23.6 71.9 -24.1 -1.6 -4.2
GACATCCACAAAATCTGCAT 887 SEQ ID NO:3392 2.1 -21.2 61.4 -23.3 0 -4.9
AATGCTATTACAACGGTTCT 1190 SEQ ID NO-.3393 2.1 -20.5 60.9 -22.6 0 -4.7
ATAATGGTAAACTCTGAAAG 1280 SEQ ID NO:3394 2.1 -15.3 50 -17.4 0 -3.8
TTCTTGTAACTGAAGACATG 1312 SEQ ID NO: 3395 2.1 -18.2 57 -19.7 -0.3 -5.3
CTTGGATAGCAGGAAGTCTT 1789 SEQ ID NO:3396 2.1 -22.7 68.1 -24.8 0 -4.1
TAGAGCTATTCAAGAGAGGC 1951 SEQ ID NO:3397 2.1 -21.4 65.5 -23 -0.2 -5.1
GGCCTCTTCGGAGCCAGCGT 2106 SEQ ID NO:3398 2.1 -32.6 86.5 -32 -2.7 -9.7
AAGCAGGCTGAGCAGCTGAC 2140 SEQ ID NO:3399 2.1 -26.3 75.4 -26.6 -1.8 -10.4
CTCAAAGCAGGCTGAGCAGC 2144 SEQ ID NO:3400 2.1 -25.9 73.9 -26.9 -0.9 -9.5
GGAAGGACTTCTCACTGAGG 2164 SEQ ID NO:3401 2.1 -23.4 69.2 -24.8 -0.5 -7.6
ACAGAAAGAGGGTCTAGAAA 2457 SEQ ID NO:3402 2.1 -18.5 57.1 -20.6 0 -6
CCAAACAGAAAGAGGGTCTA 2461 SEQ ID NO:3403 2.1 -20.6 60.6 -22.7 0 -3.1
ACTAAGAAGAAATAGAAACC 2570 SEQ ID NO:3404 2.1 -14.3 47.5 -16.4 0 -2.9
TAACTAAGAAGGTGGCACAT 2594 SEQ ID NO:3405 2.1 -20 59.9 -20.6 -1.4 -5
GCCATAAAAAGTCCAACCGT 3288 SEQ ID NO:3406 2.1 -23.2 63.3 -25.3 0 -2.6
TTTGGCACGATACAGATTAA 3389 SEQ ID NO:3407 2.1 -19.8 59.1 -21.2 -0.4 -4
CTCAACTGGTTATGTCTTCA 3430 SEQ ID NO:3408 2.1 -22.3 67.8 -24.4 0 -4.7
CCAGGATGTACAGCCAATAA 3869 SEQ ID NO:3409 2.1 -23.1 65.4 -24.6 -0.3 -7.1
GATCTGCCCTCGTCCTGAGC 26 SEQ ID NO-.3410 2.2 -30.7 83.9 -32 -0.8 -5.6
TCGGCCAGGGGCTGGGGGAC 136 SEQ ID NO:3411 2.2 -32.8 86.9 -32.6 -2.4 -10.4
429 GGTAGCATCCTTCATGCTCT 2.2 -27.1 79.2 -26.2 -3.1 -8.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo 1bineling ■ ation Duplex ture oligo oligo SEQ ID NO: 3412
CTCCGAGGCTGTAGCCGATC
747 SEQ ID NO: 3413 2. .2 -29.1 78.8 -28.8 -2.5 -10.5 CCGGCCACGTGCGCTCCGAG
760 SEQ ID NO: 3414 2, .2 -33.8 82.2 -34.1 -1.3 -11.7 TGGCAAGACTTGCCCGGGCA p
1759 SEQ ID NO: 3415 2, .2 -30.3 79 -27.9 -4.2 -17 TCCAGTGTGCACGAGAGGCC
2040 SEQ ID NO: 3416 2, .2 -29.2 80.5 -30.5 0 -9.8 CCTTCTACACAGGGCCTCTT
2118 SEQ ID NO: 3417 2. .2 -28.3 79.5 -30.5 0 -7.3 GTCGGAAGGACTTCTCACTG
2167 SEQ ID NO: 3418 2 .2. -24 70 -25.2 -0.9 -7.6 CCATGCATATACACATACAC
2484 SEQ ID NO: 3419 2 .2 -21.2 62.1 -23.4 0 -6.8 TGCCTTTCCCCATGCATATA
2493 SEQ ID NO: 3420 ,2 .2 -27.9 75.6 -29.5 -0.3 -6.8 TACTCAACCTGTACAAGCTT
3523 SEQ ID NO: 3421 2 .2 -22.2 65.2 -24.4 0 -6.2 CGGAGCCCGGGCGGTGGCAG
78 SEQ ID NO:3422 2 .3 -34.3 85.2 -32.7 -3.3 -15.7 GTAGCTTTGGGTTTGTGGAG
355 SEQ ID NO: 3423 2. .3 -24.6 74.3 -26.9 0 -4.6 CGACGGAGAGGTAGCATCCT
438 SEQ ID NO: 3424 2 .3 -26.7 73.5 -28.1 -0.7 -6.2 GGGGGAGCCAGTCAACCACA
609 SEQ ID NO: 3425 2 .3 -29.3 79.6 -30.2 -1.3 -4.8 GGCTTGGATAGCAGGAAGTC
1791 SEQ ID NO: 3426 2 .3 -24.7 72.9 -24.8 -2.2 -5.7 CAAATGGAGAGGCTCAGTAA
2418 SEQ ID NO: 3427 2 .3 -20.9 62.2 -22 -1.1 -5 ACAGATTAAAACAATGTCCT
3378 SEQ ID NO: 3428 2. .3 -17.9 55 -20.2 0 -4.8 CCGAAATGCTCCAAAATCCA
3813 SEQ ID NO: 3429 2 .3 -22.8 61.7 -25.1 0 -3.6 CGCCGGGAGGCAAGGACTCG
6 SEQ ID NO: 3430 2 .4 -29.5 75.7 -27.7 -4.2 -10 AGTTTTAAAAAACAAAAACC
200 SEQ ID NO: 3431 2 .4 -12 43 -12.4 -2 -8.8 ATGGTAAACTCTGAAAGGCA
1277 SEQ ID NO:3432 2 .4 -20 59.7 -22.4 0 -4 GGGCTTGGATAGCAGGAAGT
1792 SEQ ID NO: 3433 2 .4 -25:5 73.8 -25.7 -2.2 -6 CCAGCCATCACAGGAGACCA
1890 SEQ ID NO: 3434 2 .4 -28.5 77.2 -30.3 -0.3 -3.8 AAGAGAGGCAGCAAGAGCTA
1940 SEQ ID NO: 3435 2. .4 -23 67.6 -23.8 -1.5 -6.6 GACAGCCTTCTACACAGGGC
2123 SEQ ID NO:3436 2 .4 -27.3 77.6 -28.2 -1.4 -5.4 AAATGGAGAGGCTCAGTAAT
2417 SEQ ID NO: 3437 2 .4 -20.2 61 -22 -0.3 -4.9 GTAAAATAGGGATAATAATA
3020 SEQ ID NO -.3438 2 .4 -13.2 45.8 -15.6 0 -1.4 ATCTCAGCCATAAAAAGTCC
3294 SEQ ID NO: 3439 2 .4 -21.4 62.6 -23.8 0 -3.2 TACAGATTAAAACAATGTCC
3379 SEQ ID NO: 3440 2 .4 -16.7 52.7 -19.1 0 -4.8 CAAGAAACAGAAGTTTTAAA
211 SEQ ID NO: 3441 2 .5 -13.8 46.8 -14.5 -1.8 -5.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo inding ation Duplex ture oligo oligo
TCCCAAGAAACAGAAGTTTT 214 SEQ ID NO: 3442 2.5 -19.9 59 -20.6 -1.8 -5
GACGGAGAGGTAGCATCCTT 437 SEQ ID NO: 3443 2.5 -26 74 -27.6 -0.7 -6.4
CCGAGGCTGTAGCCGATCAA 745 SEQ ID NO: 3444 2.5 -27.8 74 -27.8 -2.5 -10.5
AAGCGATTGGAGTCAGTGCA 1141 SEQ ID NO: 3445 2.5 -24.4 70.5 -25.9 -0.9 -8
CTGATAATGGTAAACTCTGA 1283 SEQ ID NO:3446 2.5 -18.2 56.4 -20.7 0 -2.6
AGACAGGTAGCTGCGAAACT 1538 SEQ ID NO: 3447 2.5 -23.2 66.6 -24.1 -1.5 -3.5
GCTTGGATAGCAGGAAGTCT 1790 SEQ ID NO: 3448 2.5 -24.4 72.2 -25.4 -1.4 -5.2
CACATAATAACTAAGAAGGT 2601 SEQ ID NO: 3449 2.5 -16 51.4 -18.5 0 -2.5
CCTCAGTTTTGTAAAATAGG 3030 SEQ ID NO:3450 2.5 -19.2 58.9 -21.2 -0.2 -4.4
AGGATGTACAGCCAATAATA 3867 SEQ ID NO:3451 2.5 -20.1 60.1 -22 -0.3 -7.1
AAAGCTTCCATTAGTAAAAA 3905 SEQ ID NO:3452 2.5 -16.4 51.9 -18.9 0 -7
CTGAGCCGCCGGGAGGCAAG 12 SEQ ID NO: 3453 2.6 -30.7 78.7 -29.1 -4.2 -13.3
GGCCACGTGCGCTCCGAGGC 758 SEQ ID NO: 3454 2.6 -34 85.9 -33.7 -2.8 -13
TGTGGAGGACATCCACAAAA 894 SEQ ID NO: 3455 2.6 -21.6 62.3 -19.3 -4.9 -11.2
CTGGGAATCTGCATTAGTGC 1373 SEQ ID NO:3456 2.6 -23.8 69.9 -24.8 -1.5 -8.8
AATGGAGAGGCTCAGTAATA 2416 SEQ ID NO: 3457 2.6 -20.6 62.5 -22 -1.1 -5
TCCAAATGGAGAGGCTCAGT
2420 SEQ ID NO:3458 2.6 -24.3 70.2 -25.7 -1.1 -6.9 TTCCAAATGGAGAGGCTCAG
2421 SEQ ID NO:3459 2.6 -23.2 67.3 -24.6 -1.1 -7.5 TATATAAAAAAAAAAGTCCT
3207 SEQ ID NO:3460 2.6 -11.3 41.9 -13.9 0 -3
TTATGTCTTCAGAAGTTTAA 3421 SEQ ID NO:3461 2.6 -17.8 57.4 -20.4 0 -7.1
AAGCACACAATTGGCTTGAG 3469 SEQ ID NO:3462 2.6 -21.6 63.3 -22.2 -2 -9.3
TACAGCCAATAATATGGGTT 3861 SEQ ID NO:3463 2.6 -20.8 61.4 -22.9 -0.2 -4.1
CAATAGCAGAGGCTCCAGAA 280 SEQ ID NO:3464 2.7 -23.7 68 -24.8 -1.5 -5
GAGGTAGCATCCTTCATGCT 431 SEQ ID NO:3465 2.7 -26.4 77 -26.5 -2.6 -8.6
GACTGAGAGGCCCCCTCCCA 1498 SEQ ID NO: 3466 2.7 -33.9 87 -34.4 -2.2 -8.6
CCAAGACTGAGAGGCCCCCT 1502 SEQ ID NO: 3467 2.7 -30.8 79.9 -32.9 -0.3 -6.8
GCTGCTTACACACAAATCTG 2009 SEQ ID NO:3468 2.7 -21.8 63.9 -24.5 0 -5.2
AGGGCCTCTTCGGAGCCAGC 2108 SEQ ID NO: 3469 2.7 -31.8 86.5 -31 -3.5 -8.7
GCAGCTGACAGCCTTCTACA 2129 SEQ ID NO:3470 2.7 -27.4 77.9 -28.7 -1.3 -8.7
2458 AACAGAAAGAGGGTCTAGAA 2.7 -18.5 57.1 -21.2 0 -6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO : 3471
AATAACTAAGAAGAAATAGA 2574 SEQ ID NO: 3472 -11.8 43 -14.5 0 -2.6
AACTAAGAAGGTGGCACATA 2593 SEQ ID NO: 3473 -20 59.9 -21.2 -1.4 -4.8
GGGAGGTGGCACATAATAAC 2610 SEQ ID NO:3474 -22.2 64.8 -24 -0.8 -4
GGTTATGTCTTCAGAAGTTT 3423 SEQ ID NO: 3475 -21.2 66.4 -23.9 0.2 -7.1
TTCCAAGCATTTTGGATAAG 3546 SEQ ID NO:3476 -20.1 60.4 -19.7 -3.1 -8.3
TATTCCCAAAATATCTCATT 3623 SEQ ID NO:3477 -19 57.5 -21.7 0 -2.6
AAAATGAAAACTTGGCGGCA 98 SEQ ID NO:3478 -19.1 55.5 -21.9 0 -6.5
CCAGGGGCTGGGGGACTGGA 132 SEQ ID NO: 3479 -31.3 84.4 -32.5 -1.6 -7.1
GGGGAGCCAGTCAACCACAA 608 SEQ ID NO:3480 -27.4 74.7 -29.5 -0.5 -4.3
AGGGGGAGCCAGTCAACCAC 610 SEQ ID NO:3481 -28.6 78.9 -30 -1.3 -4.7
GGTGTGGAGGACATCCACAA 896 SEQ ID NO: 3482 -25.4 72.2 -22.9 -5.3 -11.9
CAGTGCACTGGAAGGCAAAA 1128 SEQ ID NO: 3483 -22.2 63.5 -22.2 -2.2 -13.4
ACTGAGAGGCCCCCTCCCAG 1497 SEQ ID NO -.3484 -33.3 86.1 -35.6 0.3 -8.6
GAGACAGGTAGCTGCGAAAC 1539 SEQ ID NO:3485 -22.9 66 -24.1 -1.5 -3.5
GCCCGGGCACCCTCAGGGAA 1748 SEQ ID NO: 3486 -34 85.3 -31.6 -2.4 -18.5
GCACGAGAGGCCCCAGGCAC 2032 SEQ ID NO:3487 -32.3 83.9 -32.6 -2.5 -7.5
CTTCTACACAGGGCCTCTTC 2117 SEQ ID NO: 3488 -26.7 77.7 -29.5 0 -7.3
ACTAAGAAGGTGGCACATAA 2592 SEQ ID NO: 3489 -20 59.9 -21.3 -1.4 -4.8
AAAGTAAAATATTTCAAAGA 2850 SEQ ID NO:3490 -11.6 42.7 -14.4 0 -6.6
TTGTAAAATAGGGATAATAA 3022 SEQ ID NO:3491 -13.6 46.6 -16.4 0 -1.5
AAATCCAAAATCCGAAATGC 3824 SEQ ID NO:3492 -17.8 52.7 -20.6 0 -2.8
CCCGGGCGGTGGCAGGGAGC 73 SEQ ID NO: 3493 -34.7 88.3 -35.2 -2.4 -9.8
CACGGAGCCCGGGCGGTGGC 80 SEQ ID NO: 3494 -34.5 85.4 -33.5 -2.4 -16
TGCAGCCAGTTTTCAAAGAT 541 SEQ ID NO: 3495 -22.8 66.7 -25.7 0 -4.7
TGGATGTCGGCCCCTTCAAA 847 SEQ ID NO: 3496 -27.9 74.1 -30.8 0 -6.2
AGTCAGTGCACTGGAAGGCA 1131 SEQ ID NO: 3497 -25.9 75.3 -25.6 -2 -14.4
ATGTTCTTGTAACTGAAGAC 1315 SEQ ID NO: 3498 -18.7 58.8 -20.6 -0.9 -4.6
CTCCATGGGCTTGGATAGCA 1798 SEQ ID NO: 3499 -27.2 76.5 -27.9 -2.2 -11.4
CACCCAGCTGCTTACACACA 2015 SEQ ID NO:3500 -27.5 75.2 -29.9 0 -8.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
AACCAGCTCTGTCTGGCAGG 2802 SEQ ID NO:3501 2.9 -27.6 78.4 -28.3 -2.2 -7.6
TAAAATATTTCAAAGAGGAA 2846 SEQ ID NO:3502 2.9 -12.9 45.1 -15.8 0 -6.6
AGCCTCAGTTTTGTAAAATA 3032 SEQ ID NO:3503 2.9 -19.8 60.4 -22.2 -0.2 -4.2
AGGGATACTCAACCTGTACA 3528 SEQ ID NO: 3504 2.9 -23.1 67.3 -25.1 -0.7 -6.9
CAAAAAATGGGAAAACCCCT 3770 SEQ ID NO:3505 2.9 -19.2 54.5 -19.8 -2.3 -5.8
AGCCGCCGGGAGGCAAGGAC 9 SEQ ID NO: 3506 3 -31.2 80.1 -30 -4.2 -13.3
ACAAAGAGGTGGACGGCTCG 1078 SEQ ID NO:3507 3 -24.4 67.6 -26.7 -0.5 -5.2
CCAGAGAGTCAACAAAGAGG 1089 , SEQ ID NO:3508 3 -20.8 61.6 -23.8 0 -4
AGACAGATCCCCTTTTTGAA 1159 SEQ ID NO:3509 3 -23.7 67.6 -26.7 0 -3.7
TAATGGTAAACTCTGAAAGG 1279 SEQ ID NO: 3510 3 -16.5 52.4 -19.5 0 -3.3
ATCTGATAATGGTAAACTCT 1285 SEQ ID NO: 3511 3 -18 56.4 -21 0 -4
AAGACATGGATTTTCATCTG
1300 SEQ ID NO:3512 3 -19.3 59.6 -21.4 -0.7 -5.5 TTGAGACAGGTAGCTGCGAA
1541 SEQ ID NO: 3513 3 -23.5 67.8 -24.9 -1.5 -3.5
TTGGATAGCAGGAAGTCTTG 1788 SEQ ID NO:3514 3 -21.8 66 -24.8 0 -4.1
AGGCACCCAGCTGCTTACAC 2018 SEQ ID NO:3515 3 -28.9 79.6 -30.5 -1.3 -8.1
CAACCCATGAGAACCCCAAC 2241 SEQ ID NO: 3516 3 -25.8 67.5 -28.8 0 -4
CACGATACAGATTAAAACAA 3384 SEQ ID NO:3517 3 -15.4 49.3 -18.4 0 -3.5
AACTGGTTATGTCTTCAGAA 3427 SEQ ID NO: 3518 3 -20.2 62.3 -22.5 -0.5 -1.4
GAAACACTTCTGGTTCCAAG 3559 SEQ ID NO:3519 3 -21.5 63.3 -23 -1.4 -5.2
CCAAGAAACAGAAGTTTTAA
212 SEQ ID NO: 3520 3.1 -16.5 52 -18.3 -1.2 -5.1 CCCAAGAAACAGAAGTTTTA
213 SEQ ID NO:3521 3.1 -19.2 57.3 -20.5 -1.8 -5.1 CGGCCACGTGCGCTCCGAGG
759 SEQ ID NO:3522 3.1 -33 81.4 -34.2 -1.3 -11.7
ACCAATGCTCAAGCCGAAGG
926 SEQ ID NO: 3523 3.1 -25 67.6 -26.9 -1.1 -5.8
GAAGACATGGATTTTCATCT
1301 SEQ ID NO:3524 3.1 -19.9 61 -22.1 -0.7 -4.3 GTTCTTGTAACTGAAGACAT
1313 SEQ ID NO: 3525 3.1 -19.4 60.1 -21.9 -0.3 -3.9
TGAGAGGCCCCCTCCCAGGT 1495 SEQ ID NO: 3526 3.1 -34.6 89.6 -35.5 -2.2 -8.9
AAAGCAGGCTGAGCAGCTGA 2141 SEQ ID NO: 3527 3.1 -25.4 72.3 -26.7 -1.8 -10.4
TCAAAGCAGGCTGAGCAGCT 2143 SEQ ID NO: 3528 3.1 -25.9 73.9 -27.3 -1.7 -10.4
ACATAATAACTAAGAAGGTG 2600 SEQ ID NO:3529 3.1 -15.3 50.1 -18.4 0 -2.6
2770 TGTACACAGATGTGTATTAC 3.1 -19.4 60.9 -20.3 -2.2 -11.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Intertotal form- Tm of struc- molecular molecular position oligo bliinnddiinngg aattiioonn D Duupplleexx ttuurree oolliiggoc oligo SEQ ID NO -.3530
ACCCTAATCCAAAAATCCAA
3836 SEQ ID NO: 3531 3.1 -20.8 58.3 -23.9 0 -1.1 AGCAATAGCAGAGGCTCCAG
282 SEQ ID NO: 3532 3.2 -25.6 73.5 -27.1 -1.7 -7 .8 GTGGATGTCGGCCCCTTCAA
848 SEQ ID NO: 3533 3.2 -29.8 79.6 -33 0 -6.2 ATCCACAAAATCTGCATCGT
884 SEQ ID NO:3534 3.2 -22.1 63.1 -25.3 0 -4.9 TGAAGACATGGATTTTCATC
1302 SEQ ID NO: 3535 3.2 -19 59 -21.7 -0.2 -5.2 AGAGGCCCCCTCCCAGGTGA
1493 SEQ ID NO: 3536 3.2 -34.6 89.6 -35.6 -2.2 -8.5 GAGAGGCCCCCTCCCAGGTG
1494 SEQ ID NO: 3537 3.2 -34.6 89.6 -35.6 -2.2 -8.6 GTAAAATATTTCAAAGAGGA
2847 SEQ ID NO: 3538 3.2 -14.8 49.2 -18 0 -6.6 TAAAGTAAAATATTTCAAAG
2851 SEQ ID NO: 3539 3.2 -10.7 41 -13.9 0 -6.6 GTACAGCCAATAATATGGGT
3862 SEQ ID NO: 3540 3.2 -21.9 64.1 -23.8 -1.2 -6.8 AGAGGCTCCAGAAACAGAGC
273 SEQ ID NO: 3541 3.3 -24.1 69.6 -25.2 -2.2 -6.8 TGTAGCTTTGGGTTTGTGGA
356 SEQ ID NO: 3542 3.3 -24.6 73.8 -27.9 0 -4.6 CAGACAGATCCCCTTTTTGA
1160 SEQ ID NO: 3543 3.3 -25.1 70.9 -28.4 0 -4.5 TGGGAATCTGCATTAGTGCC
1372 SEQ ID NO: 3544 3.3 -24.9 71.6 -26.3 -1.9 CTGGCAAGACTTGCCCGGGC
1760 SEQ ID NO: 3545 3.3 -30.5 79.8 -29.6 -4.2 -14.2 GCACCCAGCTGCTTACACAC
2016 SEQ ID NO: 3546 3.3 -28.6 78.4 -31.2 -0.5 -7 .6 CCAGCTCTGTCTGGCAGGTG
2800 SEQ ID NO: 3547 3.3 -29.3 84.1 -31.2 -1.3 -7.6 CATGTGGCTGAACCTCACTA
3052 SEQ ID NO: 3548 3.3 -24.7 70.4 -27 -0.9 -5.5 TTGGCACGATACAGATTAAA
3388 SEQ ID NO: 3549 3.3 -19 57 -21.6 -0.4 -4 CAAGAGAAGCACACAATTGG
3475 SEQ ID NO: 3550 3.3 -19.4 58 -22.7 0 -7.2 GAGGCAGAGAAGGTGGAAAA
114 SEQ ID NO: 3551 3.4 -20.9 61.6 -24.3 0 -4 AGGTAGCATCCTTCATGCTC
430 SEQ ID NO: 3552 3.4 -26.2 77.5 -26.5 -3.1 -8.4 CGTTCCTTTCACGAAGTTGC
788 SEQ ID NO:3553 3.4 -24.7 69.8 -27.4 -0.4 -3 .8 AGACTGAGAGGCCCCCTCCC
1499 SEQ ID NO: 3554 3.4 -33.2 86.4 -34.4 -2.2 -7.9 ACTTGCCCGGGCACCCTCAG
1752 SEQ ID NO: 3555 3.4 -32.9 84.3 -32.1 -1.3 -16.6 AAACAGAAAGAGGGTCTAGA
2459 SEQ ID NO: 3556 3.4 -18.5 57.1 -21.9 0 -5.8 GCATATACACATACACCATC
2480 SEQ ID NO: 3557 3.4 -21.6 63.6 -25 0 -3.4 ACTCATAGGGGAGGTGGCAC
2618 SEQ ID NO: 3558 3.4 -26.4 76.7 -29 -0.6 -4.9 GAACCAGCTCTGTCTGGCAG
2803 SEQ ID NO: 3559 3.4 -27 77.2 -28.2 -2.2 -7.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
AGAAGTTTTAAAAAACAAAA
203 SEQ ID NO: 3560 3.5 -10.4 40.3 -12 -1.9
CAGAAACAGAGCAGAGGAAC
265 SEQ ID NO: 3561 3.5 -19.8 59.4 -23.3 0 -4.1
GGCAAGACTTGCCCGGGCAC
1758 SEQ ID NO: 3562 3.5 -30.5 79.7 -29.4 -3.5 -17.2
TGGGCTTGGATAGCAGGAAG
1793 SEQ ID NO: 3563 3.5 -24.3 70.3 -25.6 -2.2 -6
CAGGGCCTCTTCGGAGCCAG
2109 SEQ ID NO: 3564 3.5 -30.7 83.1 -30.7 -3.5
GTACACAGATGTGTATTACA
2769 SEQ ID NO: 3565 3.5 -20.1 62.3 -21.4 -2.2 -11.1
AAAAGGCACTGGTATTAAAG
2866 SEQ ID NO: 3566 3.5 -17.2 53.6 -19.9 -0.6 -4.1
TAGGGATAATAATAGTTGCC
3014 SEQ ID NO: 3567 3.5 -19.5 59.4 -23 0 -3
AACCCTAATCCAAAAATCCA
3837 SEQ ID NO: 3568 3.5 -20.8 58.3 -24.3 0 -1.1
TGAATACCAATGCTCAAGCC
931 SEQ ID NO: 3569 3.6 -22.7 64.2 -26.3 0 -5.7
TACAACGGTTCTTGCGGCAG
1182 SEQ ID NO: 3570 3.6 -25.1 69.8 -28.7 0.4 -7.7
AGCTATTCAAGAGAGGCAGC
1948 SEQ ID NO: 3571 3.6 -23.6 70.4 -26.1 -1 -6
GGCTCAGTAATATGTCCATT
2408 SEQ ID NO: 3572 3.6 -23.3 69.1 -26.9 0 -4.1
AAGGTGGCACATAATAACTA
2586 SEQ ID NO: 3573 3.6 -19.1 57.9 -21.8 -0.8 -4.8
CCAAGCATTTTGGATAAGGG
3544 SEQ ID NO: 3574 3.6 -22 63.6 -23.9 -1.7 -5.6
GTCCTATTCCCAAAATATCT
3627 SEQ ID NO: 3575 3.6 -22.3 64.3 -25.9 0 -2.6
AAATGCTCCAAAATCCAAAA
3810 SEQ ID NO: 3576 3.6 -17.3 52.1 -20.9 0 -3.6
CCCAGCCATCACAGGAGACC
1891 SEQ ID NO: 3577 3.7 -29.8 79.5 -33.5 0 -3.5
ATCCAAACAGAAAGAGGGTC
2463 SEQ ID NO: 3578 3.7 -20.4 60.6 -24.1 0 -3.6
AACTTTGGCACGATACAGAT
3392 SEQ ID NO: 3579 3.7 -21.1 61.7 -24.1 -0.4 -4
GGGATACTCAACCTGTACAA
3527 SEQ ID NO: 3580 3.7 -22.4 65 -25.2 -0.7 -7
CTCCCAAGAAACAGAAGTTT
215 SEQ ID NO: 3581 3.8 -20.7 60.5 -22.9 -1.6 -4.9
CTTAGAACCAGCTCTGTCTG
2807 SEQ ID NO: 3582 3.8 -24 70.7 -27.8 0 -4.5
AAAATATTTCAAAGAGGAAA
2845 SEQ ID NO: 3583 3.8 -12.5 44.2 -15.6 -0.5 -6.6
AGTAAAATATTTCAAAGAGG
2848 SEQ ID NO: 3584 3.8 -14.2 48 -18 0 -6.6
CTCAGTTTTGTAAAATAGGG
3029 SEQ ID NO:3585 3.8 -18.4 57.6 -21.7 -0.2 -3.7
GGCACATAATAACTAAGAAG
2603 SEQ ID NO: 3586 3.9 -16.6 52.4 -20.5 0 -4
TGTCTTCAGAAGTTTAACAG
3418 SEQ ID NO: 3587 3.9 -18.9 59.8 -22.8 0 -7.1
CAACTGGTTATGTCTTCAGA
3428 SEQ ID NO: 3588 3.9 -21.6 65.8 -24.8 -0.5 -6
3815 ATCCGAAATGCTCCAAAATC 3.9 -20.5 58.6 -24.4 0 -3.6 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 3589
AAAAACAAAAACCACCTCTT
193 SEQ ID NO:3590 4 -16.7 51 -20.7 0 -0.9 AAACAGAAGTTTTAAAAAAC
207 SEQ ID NO: 3591 4 -11.3 42 -14 -1.2 -7.5 ACAGGTAGCTGCGAAACTCC
1536 SEQ ID NO: 3592 4 -25 70.1 -27.4 -1.5 -3.5 GCTCAAAGCAGGCTGAGCAG
2145 SEQ ID NO: 3593 4 -25.9 73.9 -26.4 -3.5 -12.3 CATATACACATACACCATCC
2479 SEQ ID NO:3594 4 -21.8 63.2 -25.8 0 -2.4 TGTAAAATAGGGATAATAAT
3021 SEQ ID NO: 3595 4 -13.5 46.3 -17.5 0 -1.4 GCACGATACAGATTAAAACA
3385 SEQ ID NO:3596 4 -17.9 54.3 -21.9 0 -3.5 TATGTCTTCAGAAGTTTAAC
3420 SEQ ID NO: 3597 4 -17.9 57.6 -21.9 0 -6.5 GAAAATAATCTAAAATTTGA
3577 SEQ ID NO: 3598 4 -11.2 41.9 -15.2 0 -5.2 GGTCCTATTCCCAAAATATC
3628 SEQ ID NO:3599 4 -22.6 64.9 -26.6 0 -2.7 ACAGCCAATAATATGGGTTG
3860 SEQ ID NO: 3600 4 -21.1 61.9 -24.1 -0.9 -5.5 AAAACAAAAACCACCTCTTG
192 SEQ ID NO:3601 4.1 -17.4 52.4 -21.5 0 -2.8 CTCCCAGGTGAGCTGGATCT
1484 SEQ ID NO: 3602 4.1 -28.8 81.2 -29.9 -3 -7.3 ACCCAGCTGCTTACACACAA
2014 SEQ ID NO:3603 4.1 -26.1 71.8 -29.7 0 -8.1 AACCCATGAGAACCCCAACA
2240 SEQ ID NO: 3604 4.1 -25.8 67.5 -29.9 0 -4.5 GCTCAGTAATATGTCCATTA
2407 SEQ ID NO: 3605 4.1 -21.8 65.9 -25.9 0 -2.9 CATAATAACTAAGAAGGTGG
2599 SEQ ID NO: 3606 4.1 -16.3 52 -20.4 0 -2.6 AAGTAAAATATTTCAAAGAG
2849 SEQ ID NO:3607 4.1 -12.3 44.1 -16.4 0 -6.1 GAAGCACACAATTGGCTTGA
3470 SEQ ID NO: 3608 4.1 -22.2 64.3 -23.7 -2.6 -10.1 ACTCAACCTGTACAAGCTTC
3522 SEQ ID NO:3609 4.1 -22.9 67.3 -27 0 -6.4 TCCAAAAATCCAAAATCCGA
3829 SEQ ID NO: 3610 4.1 -19.1 54.7 -23.2 0 -2.8 TGTACAGCCAATAATATGGG
3863 SEQ ID NO: 3611 4.1 -20.7 61 -23.7 -0.9 -9.4 GGGGACTGGAGGCAGAGAAG
122 SEQ ID NO: 3612 4.2 -25.3 72.5 -28.6 -0.8 -4.2 CGGCCAGGGGCTGGGGGACT
135 SEQ ID NO: 3613 4.2 -33.3 86.9 -35.1 -2.4 -9.5 TCAGTGCACTGGAAGGCAAA
1129 SEQ ID NO: 3614 4.2 -23.3 67 -24.3 -2.2 -14.4 GCAAGACTTGCCCGGGCACC
1757 SEQ ID NO: 3615 4.2 -31.3 80.5 -31.3 -2.6 -16.6 AGGTGGCACATAATAACTAA
2585 SEQ ID NO: 3616 4.2 -19.1 57.9 -22.4 -0.8 -4.8 GGCAGAGAAGGTGGAAAATG
112 SEQ ID NO:3617 4.3 -20.3 60 -24.6 0 -4 GGCCGACGGAGAGGTAGCAT
441 SEQ ID NO:3618 4.3 -28.4 76.6 -32 -0.4 -7 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
AGCCTCTTGTGGATGTCGGC 856 SEQ ID NO: 3619 4.3 -28.5 80.7 -31.9 -0.8 -5.1
GAGTCAGTGCACTGGAAGGC 1132 SEQ ID NO:3620 4.3 -25.8 75.6 -27 -0.7 -14.4
AAGACTGAGAGGCCCCCTCC
1500 SEQ ID NO:3621 4.3 -30.5 80.6 -32.6 -2.2 -8.6 ATTAAAAAATGAACAGAAAA
2344 SEQ ID NO:3622 4.3 -9.6 38.8 -13.9 0 -3
AATAGGGATAATAATAGTTG
3016 SEQ ID NO:3623 4.3 -15 49.9 -19.3 0 -1.4 AAATAGGGATAATAATAGTT
3017 SEQ ID NO: 3624 4.3 -14.3 48.2 -18.6 0 -1.4 CCGAATCTCAGCCATAAAAA
3298 SEQ ID NO:3625 4.3 -20.5 58.3 -24.8 0 -3.2
AAGGGATACTCAACCTGTAC
3529 SEQ ID NO:3626 4.3 -21.7 64 -25.1 -0.7 -5.8
GGAGGCAGAGAAGGTGGAAA
115 SEQ ID NO: 3627 4.4 -22.8 66.1 -27.2 0 -4 TGGAGGCAGAGAAGGTGGAA
116 SEQ ID NO: 3628 4.4 -23.5 68.2 -27.9 0 -3.2 TCAGACAGATCCCCTTTTTG
1161 SEQ ID NO:3629 4.4 -24.9 71.2 -29.3 0 -4.5
GCTCAGACAGATCCCCTTTT 1163 SEQ ID NO: 3630 4.4 -27.5 77.2 -31.9 0 -4.5
TGTTCTTGTAACTGAAGACA 1314 SEQ ID NO:3631 4.4 -19.4 60 -22.8 -0.9 -4.6
ATCTGCATTAGTGCCATAAA 1367 SEQ ID NO:3632 4.4 -21.6 63.7 -24.1 -1.9 -7.2
CAAGACTGAGAGGCCCCCTC
1501 SEQ ID NO:3633 4.4 -29.2 78.3 -31.8 -1.8 -8.2 CCAGTGTGCACGAGAGGCCC
2039 SEQ ID NO: 3634 4.4 -30.8 82.1 -34.5 0 -9.1
AGAGGCTCAGTAATATGTCC
2411 SEQ ID NO:3635 4.4 -23.1 69.5 -27.5 0 -4.5
AAAAAAAGCACTGTATTAAA
2828 SEQ ID NO:3636 4.4 -12.7 44.4 -17.1 0 -4.1 GAAAAAAAGCACTGTATTAA
2829 SEQ ID NO:3637 4.4 -14 47 -18.4 0 -4.1 AAGCATTTTGGATAAGGGAT
3542 SEQ ID NO: 3638 4.4 -19.9 60 -24.3 0 -4.1
AGGTGGAAAATGAAAACTTG 104 SEQ ID NO: 3639 4.5 -15.8 50.4 -20.3 0 -2.6
AAGAAACAGAAGTTTTAAAA 210 SEQ ID NO:3640 4.5 -12.4 44.1 -15.1 -1.8 -6.6
CCGTTCCTTTCACGAAGTTG 789 SEQ ID NO: 3641 4.5 -24.9 69.2 -28.6 -0.6 -4.1
ACAACGGTTCTTGCGGCAGC 1181 SEQ ID NO:3642 4.5 -27.2 74.4 -31 -0.5 -7.7
TGAGACAGGTAGCTGCGAAA 1540 SEQ ID NO:3643 4.5 -22.7 65.3 -26.4 -0.6 -2.6
CCAGCTGCTTACACACAAAT 2012 SEQ ID NO:3644 4.5 -23.2 65.7 -27.2 0 -8.1
ACAAAAAATGGGAAAACCCC 3771 SEQ ID NO:3645 4.5 -18.5 53.4 -21.4 -1.5 -5.8
AAAAATCCAAAATCCGAAAT 3826 SEQ ID NO:3646 4.5 -14.6 46.8 -19.1 0 -2.8
CTAATCCAAAAATCCAAAAT 3833 SEQ ID NO:3647 4.5 -15.2 48.4 -19.7 0 -1.1
74 GCCCGGGCGGTGGCAGGGAG 4.6 -34.7 88.3 -35.7 -3.1 -15 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 3648
AAGCAATAGCAGAGGCTCCA
283 SEQ ID NO: 3649 4.6 -24.9 70.8 -27.8 -1.7 -8.1 TGTGGATGTCGGCCCCTTCA
849 SEQ ID NO:3650 4.6 -30.5 82 -35.1 0 -6.2 AGCCTTCTACACAGGGCCTC
2120 SEQ ID NO:3651 4.6 -29.1 82 -31.9 -1.8 -7.3 CAAAGCAGGCTGAGCAGCTG
2142 SEQ ID NO: 3652 4.6 -25.5 72.1 -28.3 -1.8 -10.4 CCAAATGGAGAGGCTCAGTA
2419 SEQ ID NO: 3653 4.6 -23.6 68 -27 -1.1 -5.3 CATCCAAACAGAAAGAGGGT
2464 SEQ ID NO: 3654 4.6 -20.7 60.4 -25.3 0 -3.6 TGCATATACACATACACCAT
2481 SEQ ID NO: 3655 4.6 -21.2 62.1 -25.8 0 -4.7 AAATATTTCAAAGAGGAAAA
2844 SEQ ID NO: 3656 4.6 -12.5 44.2 -16.6 -0.2 -5.8 AAGCCTCAGTTTTGTAAAAT
3033 SEQ ID NO: 3657 4.6 -19.4 59 -23.5 -0.2 -4.2 CAGCCATAAAAAGTCCAACC
3290 SEQ ID NO: 3658 4.6 -21.9 61.5 -26.5 0 -3.2 TGAAACACTTCTGGTTCCAA
3560 SEQ ID NO: 3659 4.6 -21.5 63 -24 -2.1 -5.8 CTCAGACAGATCCCCTTTTT
1162 SEQ ID NO: 3660 4.7 -25.8 73.3 -30.5 0 -4.5 TGCATTAGTGCCATAAAGGG
1364 SEQ ID NO: 3661 4.7 -22.7 65.6 -25.5 -1.9 -7.2 AGCTGCTTACACACAAATCT
2010 SEQ ID NO: 3662 4.7 -21.8 64.2 -26.5 0 -6.7 AACTAAGAAGAAATAGAAAC
2571 SEQ ID NO: 3663 4.7 -11.6 42.6 -16.3 0 -2.9 CTCAGCCATAAAAAGTCCAA
3292 SEQ ID NO:3664 4.7 -21 60.6 -25.7 0 -3.2 AGAAGCACACAATTGGCTTG
3471 SEQ ID NO: 3665 4.7 -21.6 63.3 -23.7 -2.6 -10.1 CCAAAAATCCAAAATCCGAA
3828 SEQ ID NO: 3666 4.7 -18 52.3 -22.7 0 -2.8 ACACCATCCAAACAGAAAGA
2468 SEQ ID NO: 3667 4.8 -20.2 58.5 -25 0 -2.2 TAATAACTAAGAAGAAATAG
2575 SEQ ID NO: 3668 4.8 -10.9 41.4 -15.7 0 -2.5 CTATATAAAAAAAAAAGTCC
3208 SEQ ID NO: 3669 4.8 -11.3 41.9 -16.1 0 -3.3 GAGCCGCCGGGAGGCAAGGA
10 SEQ ID NO: 3670 4.9 -31.6 80.7 -32.8 -3.7 -13.3 GCAGAGAAGGTGGAAAATGA
111 SEQ ID NO: 3671 4.9 -19.7 58.9 -24.6 0 -3.4 CTGGGGGACTGGAGGCAGAG
125 SEQ ID NO: 3672 4.9 -27.5 77.8 -30.7 -1.7 -5.2 TTTTAAAAAACAAAAACCAC
198 SEQ ID NO: 3673 4.9 -11.7 42.4 -16.6 0 -6 CATCCACAAAATCTGCATCG
885 SEQ ID NO: 3674 4.9 -21.6 61.4 -26.5 0 -4.9 ATAGGGATAATAATAGTTGC
3015 SEQ ID NO: 3675 4.9 -17.5 55.6 -22.4 0 -2.6 TCAGTTTTGTAAAATAGGGA
3028 SEQ ID NO:3676 4.9 -18.1 57 -22.5 -0.2 -4.2 TGGTTATGTCTTCAGAAGTT
3424 SEQ ID NO: 3677 4.9 -21.1 65.9 -26 0.2 -7.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
GAGAAGCACACAATTGGCTT 3472 SEQ ID NO:3678 4.9 -22.2 64.6 -24.7 -2.4 -10.1
TCTAAAATTTGAAACACTTC 3569 SEQ ID NO:3679 4.9 -14.8 49.2 -19.7 0 -5.3
CCCTAATCCAAAAATCCAAA 3835 SEQ ID NO: 3680 4.9 -19.9 56.3 -24.8 0 -1.1
GAGAAGGTGGAAAATGAAAA
108 SEQ ID NO:3681 5 -15.1 48.9 -20.1 0 -1.2 AGGCAGAGAAGGTGGAAAAT
113 SEQ ID NO:3682 5 -20.3 60.3 -25.3 0 -4
GTCAGTGCACTGGAAGGCAA 1130 SEQ ID NO:3683 5 -25.2 72.5 -27.1 -1.7 -14.4
TGCTATTACAACGGTTCTTG 1188 SEQ ID NO: 3684 5 -21.3 63.2 -26.3 0 -4.7
TGTCGGAAGGACTTCTCACT 2168 SEQ ID NO:3685 5 -24 70 -27.4 -1.6 -6.8
CCATCCAAACAGAAAGAGGG 2465 SEQ ID NO: 3686 5 -21.5 61.1 -26.5 0 -3.5
AAATAATCTAAAATTTGAAA
3575 SEQ ID NO:3687 5 -9.9 39.5 -14.9 0 -5.2 AAAATAATCTAAAATTTGAA
3576 SEQ ID NO:3688 5 -9.9 39.5 -14.9 0 -5.2 TAATCCAAAAATCCAAAATC
3832 SEQ ID NO:3689 5 -14.7 47.7 -19.7 0 -1.1
GTGTGGAGGACATCCACAAA 895 SEQ ID NO:3690 5.1 -23.5 67.4 -23.3 -5.3 -11.9
TGGAGTCAGTGCACTGGAAG 1134 SEQ ID NO: 3691 5.1 -24 70.9 -26 -0.4 -14.4
AAAAAAGCACTGTATTAAAT 2827 SEQ ID NO:3692 5.1 -13.4 45.8 -18.5 0 -4.1
ATAATCTAAAATTTGAAACA
3573 SEQ ID NO:3693 5.1 -12.2 43.7 -17.3 0 -5.2 GGAGCCCGGGCGGTGGCAGG
77 SEQ ID NO: 3694 5.2 -34.7 88.3 -36.1 -2.4 -15.7
AGAGAAGGTGGAAAATGAAA
109 SEQ ID NO: 3695 5.2 -15.8 50.5 -21 0 -1.2 GTTAGAGCTATTCAAGAGAG
1953 SEQ ID NO: 3696 5.2 -19.7 62 -24.4 -0.2 -4.5
TTAAAAAATGAACAGAAAAA 2343 SEQ ID NO: 3697 5.2 -8.9 37.7 -14.1 0 -2.4
CAGTAATATGTCCATTACCA 2404 SEQ ID NO: 3698 5.2 -21.6 63.8 -25.4 -1.3 -5
ATATACACATACACCATCCA 2478 SEQ ID NO: 3699 5.2 -21.8 63.2 -27 0 -2.4
TAAGAAGAAATAGAAACCAC 2568 SEQ ID NO:3700 5.2 -14.1 47.1 -19.3 0 -1.2
TGTATTACATATGTCATAAC 2758 SEQ ID NO:3701 5.2 -16.8 54.5 -21.5 0 -8.2
AAAATAGGGATAATAATAGT 3018 SEQ ID NO: 3702 5.2 -13.5 46.4 -18.7 0 -1.4
AATAATCTAAAATTTGAAAC
3574 SEQ ID NO: 3703 5.2 -10.8 41.2 -16 0 -5.2 GAAGTTTTAAAAAACAAAAA
202 SEQ ID NO:3704 5.3 -9.7 39.1 -13.1 -1.9 -8.8
TGGCCGACGGAGAGGTAGCA
442 SEQ ID NO: 3705 5.3 -28.4 76.5 -33 -0.4 -8.2
AGCTCAGACAGATCCCCTTT 1164 SEQ ID NO:3706 5.3 -27.4 77.2 -32.7 0 -4.5
1952 TTAGAGCTATTCAAGAGAGG 5.3 -19.7 61.4 -24.5 -0.2 -5.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo
SEQ ID NO: 3707
GGCACCCAGCTGCTTACACA
2017 SEQ ID NO: 3708 5.3 -29.6 80.3 -33.5 -1.3 -8.1 GCACATAATAACTAAGAAGG
2602 SEQ ID NO: 3709 5.3 -16.6 52.4 -21.9 0 -3.4 CAACCCTAATCCAAAAATCC
3838 SEQ ID NO: 3710 5.3 -20.8 58.3 -26.1 0 -1.1 TCAGTAATATGTCCATTACC
2405 SEQ ID NO: 3711 5.4 -21.3 64 -25.3 -1.3 -5 TAAGGGATACTCAACCTGTA
3530 SEQ ID NO: 3712 5.4 -21.2 62.9 -25.7 -0.7 -4.7 GCATTTTGGATAAGGGATAC
3540 SEQ ID NO:3713 5.4 -20.5 61.9 -25.9 0 -3.4 TGAAAATAATCTAAAATTTG
3578 SEQ ID NO: 3714 5.4 -10.6 40.8 -16 0 -5.2 CTCCAGAAACAGAGCAGAGG
268 SEQ ID NO: 3715 5.5 -23 66.5 -28.5 0 -4.1 GGCTCCAGAAACAGAGCAGA
270 SEQ ID NO: 3716 5.5 -24.8 70.4 -27 -3.3 -8 TATACACATACACCATCCAA
2477 SEQ ID NO: 3717 5.5 -21.1 61.3 -26.6 0 -1.5 AAACACGTCACTCATAGGGG
2627 SEQ ID NO: 3718 5.5 -22.3 64.4 -27.8 0 -4.6 TGGCACGATACAGATTAAAA
3387 SEQ ID NO: 3719 5.5 -18.2 54.9 -23 -0.4 -4 AATAATATGGGTTGAGCAAC
3854 SEQ ID NO: 3720 5.5 -18.3 56.4 -23.8 0 -7.3 CAGAGAAGGTGGAAAATGAA
110 SEQ ID NO: 3721 5.6 -17.2 53.3 -22.8 0 -1.6 AAAAAGCACTGTATTAAATC
2826 SEQ ID NO: 3722 5.6 -14.5 48.3 -20.1 0 -3.3 AATATTTCAAAGAGGAAAAA
2843 SEQ ID NO: 3723 5.6 -12.5 44.2 -17.2 -0.7 -4.9 AGAGAAGCACACAATTGGCT
3473 SEQ ID NO: 3724 5.6 -22.1 64.5 -26.8 -0.8 -7.4 CAACAAGACAAAAAATGGGA
3778 SEQ ID NO: 3725 5.6 -15.2 48.5 -20.8 0 -2.5 ACCAACAAGACAAAAAATGG
3780 SEQ ID NO: 3726 5.6 -15.6 49.1 -20.7 -0.2 -3.9 AAAATCCAAAATCCGAAATG
3825 SEQ ID NO: 3727 5.6 -15.3 48.1 -20.9 0 -2.8 GCCAGGGGCTGGGGGACTGG
133 SEQ ID NO:3728 5.7 -32.5 87.5 -35.9 -2.3 -8.4 AAGTTTTAAAAAACAAAAAC
201 SEQ ID NO: 3729 5.7 -9.3 38.4 -13.1 -1.9 -8.8 AATAGCAGAGGCTCCAGAAA
279 SEQ ID NO:3730 5.7 -22.3 64.7 -26.4 -1.5 -5 GACAGATCCCCTTTTTGAAG
1158 SEQ ID NO: 3731 5.7 -23.7 67.6 -28.7 -0.4 -5.3 CTGAGAGGCCCCCTCCCAGG
1496 SEQ ID NO: 3732 5.7 -34.3 87.9 -39.5 0.8 -8.6 CAGGCTGAGCAGCTGACAGC
2137 SEQ ID NO: 3733 5.7 -27.7 79.1 -29.3 -2.5 -16.4 TACACCATCCAAACAGAAAG
2469 SEQ ID NO: 3734 5.7 -19.3 56.8 -25 0 -2.2 ATACACCATCCAAACAGAAA
2470 SEQ ID NO: 3735 5.7 -19.3 56.6 -25 0 -2.2 CACTAAGCCTCAGTTTTGTA
3037 SEQ ID NO:3736 5.7 -23 68.6 -28.7 0 -3.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CACCAACAAGACAAAAAATG 3781 SEQ ID NO: 3737 5.7 -15.1 48.1 -20.8 0 -2.1
CAAAAATCCAAAATCCGAAA 3827 SEQ ID NO: 3738 5.7 -15.3 47.9 -21 0 -2.8
TCTGCATTAGTGCCATAAAG 1366 SEQ ID NO: 3739 5.8 -21.6 63.9 -25.5 -1.9 -7.2
GACTTCTCACTGAGGCTCAA 2159 SEQ ID NO:3740 5.8 -24.2 71.4 -30 0.2 -6
GAATCTCAGCCATAAAAAGT
3296 SEQ ID NO:3741 5.8 -18.9 57.1 -24.7 0 -3.2 AGCATTTTGGATAAGGGATA
3541 SEQ ID NO: 3742 5.8 -20.3 61.5 -26.1 0 -4.1
AATCTAAAATTTGAAACACT 3571 SEQ ID NO:3743 5.8 -13.6 46.4 -19.4 0 -5.2
CCAACAAGACAAAAAATGGG 3779 SEQ ID NO:3744 5.8 -16.6 50.8 -22.4 0 -3.4
AATCCGAAATGCTCCAAAAT 3816 SEQ ID NO:3745 5.8 -19.4 55.8 -25.2 0 -3.6
CCTAATCCAAAAATCCAAAA 3834 SEQ ID NO:3746 5.8 -17.2 51.6 -23 0 -1.1
TGAGCCGCCGGGAGGCAAGG 11 SEQ ID NO: 3747 5.9 -31 79.3 -32.7 -4.2 -13.3
CTGGAGGCAGAGAAGGTGGA 117 SEQ ID NO: 3748 5.9 -25.1 72.5 -30.1 -0.8 -4
TTTAAAAAACAAAAACCACC 197 SEQ ID NO: 3749 5.9 -13.6 45.4 -19.5 0 -4
CCAGAAACAGAGCAGAGGAA 266 SEQ ID NO: 3750 5.9 -21.6 62.5 -27.5 0 -4.1
GCTCCAGAAACAGAGCAGAG 269 SEQ ID NO:3751 5.9 -23.6 68.1 -27 -2.5 -7.4
CTGCATTAGTGCCATAAAGG 1365 SEQ ID NO:3752 5.9 -22.4 65 -26.4 -1.9 -7.2
CCCAGCTGCTTACACACAAA 2013 SEQ ID NO:3753 5.9 -25.2 69.1 -30.6 0 -8.1
GTAATATGTCCATTACCACA 2402 SEQ ID NO: 3754 5.9 -21.8 64.1 -27 -0.5 -4.8
TGGAGAGGCTCAGTAATATG 2414 SEQ ID NO:3755 5.9 -21.3 64.6 -26 -1.1 -5
CGAATCTCAGCCATAAAAAG
3297 SEQ ID NO:3756 5.9 -18.5 55.1 -24.4 0 -3.2 GGGGGACTGGAGGCAGAGAA
123 SEQ ID NO: 3757 6 -26.5 74.8 -30.8 -1.7 -4.7 TGGGGGACTGGAGGCAGAGA
124 SEQ ID NO:3758 6 -27.2 77.1 -31.5 -1.7 -4.7 GATAGCAGGAAGTCTTGCTG
1785 SEQ ID NO:3759 6 -23.2 69.3 -27.4 -1.8 -9.9
AGGCTCAGTAATATGTCCAT 2409 SEQ ID NO:3760 6 -23.2 69 -28.7 -0.1 -4.1
ATAAGGGATACTCAACCTGT 3531 SEQ ID NO:3761 6 -21.5 63.4 -26.8 -0.5 -3.9
CAATAATATGGGTTGAGCAA 3855 SEQ ID NO: 3762 6 -18.8 57.1 -24.8 0 -4.1
AAAAAACAAAAACCACCTCT 194 SEQ ID NO: 3763 6.1 -15.9 49.3 -22 0 0
GACTTGCCCGGGCACCCTCA 1753 SEQ ID NO:3764 6.1 -33.5 85.2 -35.4- -1.3 -16.6
CAAGACTTGCCCGGGCACCC 1756 SEQ ID NO:3765 6.1 -31.5 79.7 -33.4 -1.3 -16.6
2413 GGAGAGGCTCAGTAATATGT 6.1 -22.5 68.1 -27.4 -1.1 -5 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 3766
ATGTGGCTGAACCTCACTAA
3051 SEQ ID NO: 3767 6.1 -23.3 67 -28.4 -0.9 -5.2 CAGCCAATAATATGGGTTGA
3859 SEQ ID NO: 3768 6.1 -21.5 62.6 -26.6 -0.9 -5 ATATTTCAAAGAGGAAAAAA
2842 SEQ ID NO: 3769 6.2 -12.5 44.2 -17.8 -0.7 -4.9 TCAGCCATAAAAAGTCCAAC
3291 SEQ ID NO: 3770 6.2 -20.3 59.3 -26.5 0 -3.2 AAGAGAAGCACACAATTGGC
3474 SEQ ID NO: 3771 6.2 -20.5 60.6 -26.1 -0.3 -7.2 TAATCTAAAATTTGAAACAC
3572 SEQ ID NO: 3772 6.2 -12.4 44.2 -18.6 0 -5.2 AAGACTTGCCCGGGCACCCT
1755 SEQ ID NO: 3773 6.3 -31.7 80.5 -33.8 -1.3 -16.6 GGGCCTCTTCGGAGCCAGCG
2107 SEQ ID NO: 3774 6.3 -32.6 85.4 -35.4 -3.5 -10.2 GGCTGAGCAGCTGACAGCCT
2135 SEQ ID NO: 3775 6.3 -29.9 83.3 -30.3 -4.3 -20 CACTCATAGGGGAGGTGGCA
2619 SEQ ID NO: 3776 6.3 -26.9 77.1 -32.4 -0.6 -4.9 GGAAAAAAAGCACTGTATTA
2830 SEQ ID NO: 3777 6.4 -15.9 50.7 -22.3 0 -4.1 TCAACTGGTTATGTCTTCAG
3429 SEQ ID NO:3778 6.4 -21.4 66 -27.3 -0.1 -6 ATCTAAAATTTGAAACACTT
3570 SEQ ID NO: 3779 6.5 -14.4 48.1 -20.9 0 -4.7 ATAATATGGGTTGAGCAACC
3853 SEQ ID NO: 3780 6.5 -21 62 -25.8 -1.6 -10.9 ACTAAGCCTCAGTTTTGTAA
3036 SEQ ID NO: 3781 6.6 -21.6 65.1 -28.2 0 -2.4 TTTGAAACACTTCTGGTTCC
3562 SEQ ID NO: 3782 6.6 -21.7 64.6 -26.2 -2.1 -4.8 TCCAGAAACAGAGCAGAGGA
267 SEQ ID NO: 3783 6.7 -22.7 65.9 -29.4 0 -4.1 AGACTTGCCCGGGCACCCTC
1754 SEQ ID NO: 3784 6.7 -32.8 84.7 -35.4 -1.3 -16.3 CTCAGTAATATGTCCATTAC
2406 SEQ ID NO: 3785 6.7 -20.2 62.1 -25.9 -0.9 -4.6 GTGGCCGACGGAGAGGTAGC
443 SEQ ID NO:3786 6.8 -28.9 78.8 -35.2 0 -8.2 CTTGTGGATGTCGGCCCCTT
851 SEQ ID NO:3787 6.8 -30.4 81.5 -37.2 0 -6.2 CTAAGCCTCAGTTTTGTAAA
3035 SEQ ID NO:3788 6.8 -20.7 62.3 -27.5 0 -3.2 AGCCATAAAAAGTCCAACCG
3289 SEQ ID NO:3789 6.8 -22 60.8 -28.8 0 -3.2 GGCACGATACAGATTAAAAC
3386 SEQ ID NO: 3790 6.8 -18.4 55.5 -25.2 0 -4 GGCACGGAGCCCGGGCGGTG
82 SEQ ID NO:3791 6.9 -34.5 85.4 -36.2 -5.2 -16.3 TTAAAAAACAAAAACCACCT
196 SEQ ID NO: 3792 6.9 ( -14.4 46.7 -21.3 0 -2 AAGGTGGAAAATGAAAACTT
105 SEQ ID NO: 3793 7 -15.1 48.9 -22.1 0 -2.6 GAGAGGCTCAGTAATATGTC
2412 SEQ ID NO: 3794 7 -21.7 67 -28.1 -0.3 -5.1 GACAAAAAATGGGAAAACCC
3772 SEQ ID NO: 3795 7 -17.1 51.3 -23.4 -0.4 -5.4 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
CAGCTGCTTACACACAAATC
2011 SEQ ID NO: 3796 7.2 -21.6 63.5 -28.8 0 -7.2
AGTAATATGTCCATTACCAC
2403 SEQ ID NO: 3797 7.2 -21.1 63.1 -26.9 -1.3 -5
AATCTCAGCCATAAAAAGTC
3295 SEQ ID NO: 3798 7.2 -18.7 57.1 -25.9 0 -3.2
AATTTGAAACACTTCTGGTT
3564 SEQ ID NO: 3799 7.2 -18.6 57.4 -25.2 -0.3 -3.8
CCAATAATATGGGTTGAGCA
3856 SEQ ID NO: 3800 7.2 -21.5 62.6 -28.2 -0.2 -4.5
GCACGGAGCCCGGGCGGTGG
81 SEQ ID NO: 3801 7.3 -34.5 85.4 -37.2 -4.4 -16.7
CGAGGCTGTAGCCGATCAAG
744 SEQ ID NO: 3802 7.3 -25.8 70.9 -30.6 -2.5 -10.5
ACATCCACAAAATCTGCATC
886 SEQ ID NO: 3803 7.3 -21 61.5 -28.3 0 -4.9
GGTTCTTGCGGCAGCTCAGA
1176 SEQ ID NO: 3804 7.3 -28.6 81.4 -34.5 -1.3 -8
TCCAAGCATTTTGGATAAGG
3545 SEQ ID NO: 3805 7.3 -21.2 62.5 -25.7 -2.8 -7.8
AATATGGGTTGAGCAACCCT
3851 SEQ ID NO:3806 7.3 -24.2 68 -27.9 -3.4 -14.6
ATATGGGTTGAGCAACCCTA
3850 SEQ ID NO:3807 7.4 -24.6 69.6 -27.9 -4.1 -15.3
ACCATCCAAACAGAAAGAGG
2466 SEQ ID NO:3808 7.5 -20.5 59.3 -28 0 -3.6
AAATTTGAAACACTTCTGGT
3565 SEQ ID NO: 3809 7.5 -17.8 55.3 -24.4 -0.7 -5.8
AAATCCGAAATGCTCCAAAA
3817 SEQ ID NO: 3810 7.5 -18.7 54.3 -26.2 0 -3.6
AAAATCCGAAATGCTCCAAA
3818 SEQ ID NO: 3811 7.5 -18.7 54.3 -26.2 0 -3.6
AGCAACCCTAATCCAAAAAT
3840 SEQ ID NO: 3812 7.5 -20.2 57.5 -27.7 0 -4.1
GAAGGTGGAAAATGAAAACT
106 SEQ ID NO: 3813 7.6 -15.6 49.8 -23.2 0 -2.6
TAAGCCTCAGTTTTGTAAAA
3034 SEQ ID NO: 3814 7.6 -19.1 58.4 -26.7 0 -4
CGAAATGCTCCAAAATCCAA
3812 SEQ ID NO: 3815 7.7 -20.1 56.9 -27.8 0 -3.6
GGCCAGGGGCTGGGGGACTG
134 SEQ ID NO:3816 7.8 -32.5 87.5 -37.9 -2.4 -9.1
ATACACATACACCATCCAAA
2476 SEQ ID NO -.3817 7.8 -20.7 59.9 -28.5 0 -0.9
TTGAAACACTTCTGGTTCCA
3561 SEQ ID NO: 3818 7.8 -22.3 65.4 -28 -2.1 -5.8
GGAGTCAGTGCACTGGAAGG
1133 SEQ ID NO: 3819 7.9 -25.2 73.8 -30.3 -0.2 -13.8
GACAGGTAGCTGCGAAACTC
1537 SEQ ID NO:3820 7.9 -23.6 67.8 -29.9 -1.5 -3.5
AACAAGACAAAAAATGGGAA
3777 SEQ ID NO: 3821 7.9 -13.8 46 -21.7 0 -2.5
CAAAATCCGAAATGCTCCAA
3819 SEQ ID NO: 3822 7.9 -20.1 56.9 -28 0 -3.6
CAAAGAGGAAAAAAAGCACT
2836 SEQ ID NO: 3823 8 -15.1 48.5 -23.1 0 -4.1
CAGCTCAGACAGATCCCCTT
1165 SEQ ID NO:3824 8.1 -28 77.8 -36.1 0 -4.5
2471 CATACACCATCCAAACAGAA 8.1 -20.7 59.5 -28.8 0 -2.2 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligc oligo
SEQ ID NO: 3825
AAGAGGAAAAAAAGCACTGT
2834 SEQ ID NO:3826 8.2 -16.3 51.3 -24.5 0 -4.1 ATTTGAAACACTTCTGGTTC
3563 SEQ ID NO: 3827 8.2 -19.7 60.8 -26.2 -1.7 -5.5 ACAAGACAAAAAATGGGAAA
3776 SEQ ID NO:3828 8.2 -13.8 46 -22 0 -2.5 GGCAGCTCAGACAGATCCCC
1167 SEQ ID NO: 3829 8.3 -30 82.5 -38.3 0 -5 TATTTCAAAGAGGAAAAAAA
2841 SEQ ID NO: 3830 8.3 -11.8 42.8 -19.2 -0.7 -4.9 TAAAATAGGGATAATAATAG
3019 SEQ ID NO: 3831 8.3 -12 43.4 -20.3 0 -1.4 GCAACCCTAATCCAAAAATC
3839 SEQ ID NO:3832 8.4 -20.6 58.5 -29 0 -3.4 AGAAGGTGGAAAATGAAAAC
107 SEQ ID NO: 3833 8.5 -14.7 48.2 -23.2 0 -1.9 CGGTTCTTGCGGCAGCTCAG
1177 SEQ ID NO: 3834 8.5 -28.8 79.5 -35.9 -1.3 -7.8 TCAAAGAGGAAAAAAAGCAC
2837 SEQ ID NO: 3835 8.5 -14.6 47.8 -23.1 0 -4.1 TGGGTTGAGCAACCCTAATC
3847 SEQ ID NO: 3836 8.5 -24.6 69.5 -29 -4.1 -15.3 AGAAACAGAAGTTTTAAAAA
209 SEQ ID NO:3837 8.6 -12.4 44.1 -19.2 -1.8 -6.8 TTCAAAGAGGAAAAAAAGCA
2838 SEQ ID NO: 3838 8.6 -14.5 47.7 -23.1 0 -4.1 GTTCTTGCGGCAGCTCAGAC
1175 SEQ ID NO: 3839 8.7 -27.6 79.3 -34.9 -1.3 -8 AAAGAGGAAAAAAAGCACTG
2835 SEQ ID NO: 3840 8.7 -14.4 47.4 -23.1 0 -4.1 GATAAGGGATACTCAACCTG
3532 SEQ ID NO: 3841 8.8 -20.9 61.7 -28.8 -0.7 -4.7 AGAGGAAAAAAAGCACTGTA
2833 SEQ ID NO: 3842 8.9 -16.7 52.4 -25.6 0 -4.1 AGCCAATAATATGGGTTGAG
3858 SEQ ID NO: 3843 8.9 -20.8 61.7 -28.7 -0.9 -4.5 AAAGCAATAGCAGAGGCTCC
284 SEQ ID NO: 3844 9 -23.5 67.5 -30.8 -1.7 -8.1 CATTTTGGATAAGGGATACT
3539 SEQ ID NO: 3845 9 -19.6 59.7 -27.7 -0.7 -3.3 TAATATGGGTTGAGCAACCC
3852 SEQ ID NO: 3846 9 -23 65.6 -28.5 -3.3 -14.3 ATGGGTTGAGCAACCCTAAT
3848 SEQ ID NO: 3847 9.1 -24.2 68 -29.2 -4.1 -15.3 AATGGTAAACTCTGAAAGGC
1278 SEQ ID NO: 3848 9.2 -18.6 56.7 -27.8 0 -3.8 AGAGGCCCCAGGCACCCAGC
2027 SEQ ID NO: 3849 9.2 -34.7 89.5 -41.4 -2.5 -7.8 GAGAGGCCCCAGGCACCCAG
2028 SEQ ID NO: 3850 9.2 -33.5 86.5 -41 -1.7 -7.1 CAAACAGAAAGAGGGTCTAG
2460 SEQ ID NO: 3851 9.2 -18.6 57.1 -27.8 0 -3.4 ACTGGAGGCAGAGAAGGTGG
118 SEQ ID NO:3852 9.3 -24.7 71.8 -32.3 -1.7 -4.7 TTGTGGATGTCGGCCCCTTC
850 SEQ ID NO: 3853 9.3 -29.9 81.4 -39.2 0 -6.2 TATGGGTTGAGCAACCCTAA
3849 SEQ ID NO: 3854 9.3 -23.9 67.5 -29.1 -4.1 -15.3 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target IntraIntertotal formTm of strucmolecular molecular position oligo binding ation Duplex ture oligo oligo
TAAAAAACAAAAACCACCTC
195 SEQ ID NO: 3855 9.4 -14.7 47.3 -24.1 0 0
GAGGCTCCAGAAACAGAGCA
272 SEQ ID NO: 3856 9.4 -24.8 70.4 -30.9 -3.3 -8
AAAATTTGAAACACTTCTGG
3566 SEQ ID NO: 3857 9.5 -15.9 50.9 -24.5 -0.7 -5.8
GGGTTGAGCAACCCTAATCC
3846 SEQ ID NO: 3858 9.6 -26.6 73.1 -32.6 -3.4 -14.5
AGGCTCCAGAAACAGAGCAG
271 SEQ ID NO:3859 9.7 -24.2 69.4 -30.6 -3.3 -8
CAAGACAAAAAATGGGAAAA
3775 SEQ ID NO:3860 9.7 -12.9 44.3 -22.6 0 -2.2
GAGCAACCCTAATCCAAAAA
3841 SEQ ID NO:3861 9.7 -20.8 58.6 -30.5 0 -4.1
CTAAAATTTGAAACACTTCT
3568 SEQ ID NO:3862 10 -15.3 49.9 -24.4 -0.7 -5.8
TGAGCAACCCTAATCCAAAA
3842 SEQ ID NO: 3863 10 -21.5 60.3 -31.5 0 -4.1
GAAACAGAAGTTTTAAAAAA
208 SEQ ID NO: 3864 10.1 -11.7 42.7 -20 -1.8 -6.8
CTGTGGCCGACGGAGAGGTA
445 SEQ ID NO: 3865 10.1 -28 76 -37.5 -0.1 -8.2
GGTTGAGCAACCCTAATCCA
3845 SEQ ID NO: 3866 10.1 -26.1 71.7 -34.8 -1.2 -10.1
CAGCAATCCCGGCCGGTAAG
165 SEQ ID NO:3867 10.4 -28.9 74.3 -36.3 -0.1 -14.2
TTCTTGCGGCAGCTCAGACA
1174 SEQ ID NO: 3868 10.8 -27.1 76.8 -36.7 -1.1 -7.8
GCCAATAATATGGGTTGAGC
3857 SEQ ID NO: 3869 11.1 -22.6 65.5 -32.7 -0.9 -4.5
GGATAAGGGATACTCAACCT
3533 SEQ ID NO:3870 11.4 -22.1 64.3 -32.6 -0.7 -4.6
AGGCTGAGCAGCTGACAGCC
2136 SEQ ID NO: 3871 11.5 -29 81.6 -34.6 -4.3 -20
CACCATCCAAACAGAAAGAG
2467 SEQ ID NO: 3872 11.5 -20 58.1 -31.5 0 -2.2
ATTTCAAAGAGGAAAAAAAG
2840 SEQ ID NO: 3873 11.5 -12.1 43.4 -22.7 -0.7 -4.9
GAGGCCCCAGGCACCCAGCT
2026 SEQ ID NO: 3874 11.7 -35.6 90.9 -44.8 -2.5 -8.7
CACATACACCATCCAAACAG
2473 SEQ ID NO: 3875 11.8 -21.7 61.8 -33.5 0 -0.9
TACACATACACCATCCAAAC
2475 SEQ ID NO: 3876 11.9 -20.9 60.4 -32.8 0 -0.9
AGGAAAAAAAGCACTGTATT
2831 SEQ ID NO: 3877 12.1 -16.2 51.4 -28.3 0 -4.1
TGTGGCTGAACCTCACTAAG
3050 SEQ ID NO: 3878 12.1 -23.3 67.3 -34.4 -0.9 -5.2
ATTTTGGATAAGGGATACTC
3538 SEQ ID NO: 3879 12.1 -19.3 59.8 -30.5 -0.7 -3.3
GGCCCCAGGCACCCAGCTGC
2024 SEQ ID NO:3880 12.2 -36.8 93.3 -46.5 -2.5 -12.1
ACATACACCATCCAAACAGA
2472 SEQ ID NO: 3881 12.2 -21.6 61.8 -33.8 0 -2
ACACATACACCATCCAAACA
2474 SEQ ID NO:3882 12.2 -21.9 62.1 -34.1 0 -0.7
TTTCAAAGAGGAAAAAAAGC
2839 SEQ ID NO: 3883 12.2 -13.9 46.7 -25.6 -0.2 -4.4
3047 GGCTGAACCTCACTAAGCCT 12.2 -26.8 73.9 -36.8 -2.2 -7.1 kcal/ kcal/ kcal/ mol mol deg C mol kcal/mol kcal/mol duplex target Intra- Inter- total form- Tm of struc- molecular molecular position oligo binding ation Duplex ture oligo oligo SEQ ID NO: 3884
GTGGCTGAACCTCACTAAGC
3049 SEQ ID NO: 3885 12.4 -25.1 71.6 -36.6 -0.8 -5.1 TTTTGGATAAGGGATACTCA
3537 SEQ ID NO:3886 12.4 -20 61.1 -31.5 -0.7 -4 TGTGGCCGACGGAGAGGTAG
444 SEQ ID NO: 3887 12.6 -27.1 74.4 -39.1 -0.1 -8.2 TCTTGCGGCAGCTCAGACAG
1173 SEQ ID NO:3888 12.7 -27 76.7 -38.3 -1.3 -8.7 TGGCTGAACCTCACTAAGCC
3048 SEQ ID NO: 3889 12.8 -25.9 71.9 -36.6 -2.1 -6.9 AGGCCCCAGGCACCCAGCTG
2025 SEQ ID NO:3890 12.9 -35 89.4 -45.4 -2.5 -11.8 TAAAATTTGAAACACTTCTG
3567 SEQ ID NO: 3891 12.9 -14.4 48.1 -26.4 -0.7 -5.8 CGGCAGCTCAGACAGATCCC
1168 SEQ ID NO: 3892 13 -28.8 78.6 -41.8 0 -5 ACGGTTCTTGCGGCAGCTCA
1178 SEQ ID NO: 3893 13.1 -29 79.8 -40.7 -1.3 -7.8 GAGGAAAAAAAGCACTGTAT
2832 SEQ ID NO:3894 13.1 -16.7 52.3 -29.8 0 -4.1 TTGAGCAACCCTAATCCAAA
3843 SEQ ID NO:3895 13.1 -22.3 62.4 -35.4 0 -4.1 GCAGCTCAGACAGATCCCCT
1166 SEQ ID NO:3896 13.4 -29.7 81.8 -43.1 0 -4.5 AAGACAAAAAATGGGAAAAC
3774 SEQ ID NO: 3897 13.5 -12.4 43.6 -25.9 0 -2.5 GTTGAGCAACCCTAATCCAA
3844 SEQ ID NO:3898 13.6 -24.2 67.2 -37.8 0 -6.5 CTTGCGGCAGCTCAGACAGA
1172 SEQ ID NO: 3899 13.7 -27.2 76.3 -39.5 -1.3 -8.7 AGACAAAAAATGGGAAAACC
3773 SEQ ID NO:3900 14.2 -15.1 48.2 -29.3 0 -2.9 AACGGTTCTTGCGGCAGCTC
1179 SEQ ID NO: 3901 14.5 -27.6 76.2 -40.7 -1.3 -7.8 TGGATAAGGGATACTCAACC
3534 SEQ ID NO:3902 14.5 -21.2 62.3 -34.8 -0.7 -4.2 CAACGGTTCTTGCGGCAGCT
1180 SEQ ID NO: 3903 14.6 -27.9 75.6 -41.1 -1.3 -7.8 GCGGCAGCTCAGACAGATCC
1169 SEQ ID NO: 3904 15 -28.6 79.4 -42.8 -0.6 -7 TTGCGGCAGCTCAGACAGAT
1171 SEQ ID NO: 3905 16.6 -26.3 74.3 -41.5 -1.3 -8.7 TTTGGATAAGGGATACTCAA
3536 SEQ ID NO: 3906 17.1 -19.2 58.8 -35.4 -0.7 -5 TGCGGCAGCTCAGACAGATC
1170 SEQ ID NO:3907 17.7 -26.6 75.7 -42.9 -1.3 -7.8 TTGGATAAGGGATACTCAAC
3535 SEQ ID NO: 3908 19.4 -19.3 59 -37.8 -0.7 -4.9
Example 15
Western blot analysis of EL protein levels [00178] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 5 N, and transferred to membrane for western blotting. Appropriate primary antibody directed to EL is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHOP MAGER™ (Molecular Dynamics, Sunnyvale CA).

Claims

WHAT IS CLAIMED IS:
1. An antisense compound 8 to 30 nucleobases in length targeted to a nucleic acid molecule encoding EL, wherein said antisense compound specifically hybridizes with and inhibits the expression of EL.
2. The antisense compound of claim 1 which is an antisense oligonucleotide.
3. The antisense oligonucleotide of claim 2 comprising a nucleic acid sequence selected from the group consisting of at least eight contiguous bases of SEQ ID NO: 1 - SEQ ID NO:3908.
4. The antisense oligonucleotide of claim 2 comprising a nucleic acid sequence selected from the group consisting SEQ ID NO: 1 - SEQ ID NO:3908.
5. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.
6. The antisense compound of claim 5 wherein the modified internucleoside linkage is a phosphorothioate linkage.
7. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide comprises at least one modified sugar moiety.
8. The antisense compound of claim 7 wherein the modified sugar moiety is a 2'-O-methoxyethyl sugar moiety.
9. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide comprises at least one modified nucleobase.
10. The antisense compound of claim 9 wherein the modified nucleobase is a 5-methylcytosine.
11. The antisense compound of claim 2, 3, or 4 wherein the antisense oligonucleotide is a chimeric oligonucleotide.
12. A composition comprising the antisense compound of claim 1 and a pharmaceutically acceptable carrier or diluent.
13. The composition of claim 12 further comprising a colloidal dispersion system.
14. The composition of claim 13 wherein the antisense compound is an antisense oligonucleotide.
15. A method of inhibiting the expression of EL in cells or tissues comprising contacting said cells or tissues with the antisense compound of claim 1 so that expression of EL is inhibited.
16. A method of treating a human having a disease or condition associated with EL comprising administering to said animal a therapeutically or prophylactically effective amount of the antisense compound of claim 1 so that expression of EL is inhibited.
17. The method of claim 16 wherein the disease or condition is dyslipidemia.
18. The method of claim 16 wherein the disease or condition is low HDL.
19. The method of claim 16 wherein the disease or condition is a cardiovascular disorder.
20. The method of claim 16 wherein the disease or condition is a metabolic syndrome X.
PCT/US2003/022410 2002-07-19 2003-07-18 Antisense modulation of endothelial lipase expression WO2004009541A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2004523535A JP2005533505A (en) 2002-07-19 2003-07-18 Antisense regulation of endothelial lipase expression
EP03765691A EP1539689A2 (en) 2002-07-19 2003-07-18 Antisense modulation of endothelial lipase expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US39710602P 2002-07-19 2002-07-19
US60/397,106 2002-07-19

Publications (2)

Publication Number Publication Date
WO2004009541A2 true WO2004009541A2 (en) 2004-01-29
WO2004009541A3 WO2004009541A3 (en) 2004-05-21

Family

ID=30770996

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/022410 WO2004009541A2 (en) 2002-07-19 2003-07-18 Antisense modulation of endothelial lipase expression

Country Status (3)

Country Link
EP (1) EP1539689A2 (en)
JP (1) JP2005533505A (en)
WO (1) WO2004009541A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7507808B2 (en) * 2002-12-12 2009-03-24 Isis Pharmaceuticals, Inc. Modulation of endothelial lipase expression
US20170166899A1 (en) * 2014-05-01 2017-06-15 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032611A1 (en) * 1997-12-19 1999-07-01 Progenitor, Inc. A lipase expressed in endothelial cells and methods for its use
US6114517A (en) * 1998-12-10 2000-09-05 Isis Pharmaceuticals Inc. Methods of modulating tumor necrosis factor α-induced expression of cell adhesion molecules

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032611A1 (en) * 1997-12-19 1999-07-01 Progenitor, Inc. A lipase expressed in endothelial cells and methods for its use
US6114517A (en) * 1998-12-10 2000-09-05 Isis Pharmaceuticals Inc. Methods of modulating tumor necrosis factor α-induced expression of cell adhesion molecules

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7507808B2 (en) * 2002-12-12 2009-03-24 Isis Pharmaceuticals, Inc. Modulation of endothelial lipase expression
US20170166899A1 (en) * 2014-05-01 2017-06-15 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US9994855B2 (en) * 2014-05-01 2018-06-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10793862B2 (en) 2014-05-01 2020-10-06 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US11312964B2 (en) 2014-05-01 2022-04-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression

Also Published As

Publication number Publication date
EP1539689A2 (en) 2005-06-15
JP2005533505A (en) 2005-11-10
WO2004009541A3 (en) 2004-05-21

Similar Documents

Publication Publication Date Title
US7335764B2 (en) Antisense modulation of acyl CoA cholesterol acyltransferase-2 expression
US20030049662A1 (en) Antisense modulation of smad7expression
EP1549387A1 (en) Antisense modulation of farnesoid x receptor expression
WO2002028878A1 (en) Antisense modulation of smad6 expression
AU2382200A (en) Antisense modulation of ship-2 expression
WO2004016224A2 (en) Antisense modulation of vegf co-regulated chemokine-1 expression
EP2272985A1 (en) Antisense modulation of apolipoprotein (A) expression
AU2118901A (en) Antisense modulation of integrin-linked kinase expression
WO2004028458A2 (en) Antisense modulation of microsomal prostaglandin e2 synthase expression
EP1534728A2 (en) Antisense modulation of glucocorticoid receptor expression
EP1218395B1 (en) Antisense modulation of x-linked inhibitor of apoptosis expression
US6395544B1 (en) Antisense modulation of BCAS1 expression
EP1543159A2 (en) Antisense modulation of endothelial specific molecule 1 expression
AU2001232814B2 (en) Antisense modulation of glycogen synthase kinase 3 alpha expression
EP1572713A2 (en) Antisense modulation of acyl-coa synthetase 1 expression
WO2002027033A1 (en) Antisense modulation of mekk4 expression
WO2004003201A2 (en) Antisense modulation of lrh1 expression
US20050065104A1 (en) Antisense modulation of acyl coenzyme a cholesterol acyltransferase-1 expression
WO2004035763A2 (en) Antisense modulation of gfat expression
WO2004009541A2 (en) Antisense modulation of endothelial lipase expression
US20050182015A1 (en) Antisense modulation of EIF2C1 expression
WO2002048314A2 (en) Antisense modulation of raidd expression
WO2003038050A2 (en) Antisense modulation of phospholipase a2 group v expression
US20040009599A1 (en) Antisense modulation of cellular inhibitor of apoptosis-1 expression
WO2003040321A2 (en) Antisense modulation of eif2c1 expression

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2004523535

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2003765691

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2003765691

Country of ref document: EP