WO2003093509A1

WO2003093509A1 - Methods and compositions for improving specificity of pcr amplication

Info

Publication number: WO2003093509A1
Application number: PCT/KR2002/000816
Authority: WO
Inventors: Jong Yoon Chun
Original assignee: Seegene, Inc.
Priority date: 2002-05-01
Filing date: 2002-05-01
Publication date: 2003-11-13
Also published as: AU2002307654A1

Abstract

The present invention is directed to novel methods and compositions for improving the specificity of PCR amplification. Specifically it relates to a novel annealing control primer system named ACP system which allows primer annealing to be controlled in association with annealing temperature, such that the specificity of PCR amplification can be significantly improved during PCR. The principle of the ACP system is based on the composition of an oligonucleotide primer having 3' - and 5' -end distinct portions separated by at least one deoxyinosine group and the effect of the deoxyinosine group on the annealing of the 3' -and 5' -end portion each, in connection with the alteration of annealing temperature, which are unique features of this invention. The presence of deoxyinosine group positioned between the 3' - and 5' - end portions plays as a switch in controlling primer annealing to a template nucleic acid in associated with annealing temperature during polymerase chain reaction (PCR) due to the property of deoxyinosine as universal base. The present invention provides an improved method for selectively amplifying a target nucleic acid fragment from a nucleic acid or a mixture using ACP system. The present invention also provides an improved method for detecting differentially expressed mRNAs in two or more nucleic acid samples using the ACP system. The present invention also provides an improved method for rapidly amplifying cDNA ends, so called RACE technologies related to both of 3' - and 5' -end, full-length cDNAs, and 5' -enriched cDNAs using the ACP system. Kits containing ACP are included within the scope of the present invention. Furthermore, the ACP system in this present invention can be also adapted to almost unlimited application in all fields of PCR-based technology.

Description

METHODS AND COMPOSITIONS FOR IMPROVING SPECIFICITY OF PCR

AMPLIFICATION

Technical Field

This present invention relates to novel methods and compositions for improving specificity of PCR amplification. More in detail, it relates to a novel annealing control primer system named ACP system which allows primer annealing to be controlled in association with annealing temperature, such that the specificity of PCR amplification can be significantly improved during PCR. In addition, the ACP system described in the present invention can be adapted to almost unlimited application in all fields of PCR-based technology.

Background Art

The method known as polymerase chain reaction (PCR), is based on repeated cycles of dena uration of double-stranded DNA, followed by oligonucleotide primer annealing to the DNA template, and primer extension by a DNA polymerase (Mullis et al. U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saild et al. 1985). The oligonucleotide primers used in PCR are designed to anneal to opposite strands of the DNA, and are positioned so that the DNA polymerase catalyzed extension product of one primer can serve as the template strand for the other primer. The PCR amplification process results in the exponential increase of discrete DNA fragments whose length is defined by the 5' ends of the oligonucleotide primers.

The success of a PCR amplification relies on the specificity with which a primer anneals only to its target (and not non-target) sequences so it is important to optimize this molecule interaction. Whether a primer can anneal only to its perfect complement or also to sequences that have one or more mismatches to the primer, depends critically upon the annealing temperature. In general the higher the annealing temperature the more specific annealing of he primer to its perfect matched template and so the greater the likelihood of only target sequence amplification. The lower the temperature, the more mismatches between template and primer can be tolerated, leading to increased amplification of non- target sequences. Adjusting the annealing temperature step can alter the specificity of pairing between template and primer. For examples, if there is no product, the temperature may be too high and can be reduced. If there are products in control lanes where only one primer is present, this indicates that the single primer is annealing to more than one region of the template and generating products. In this case, the annealing temperature should be increased. Considering this effect of annealing temperature on primer annealing specificity as above, there remains a strong need for an annealing control primer syetm which is capable of controlling primer annealing in accordance with annealing temperature to enhance primer annealing specificity regardless of primer design.

In addition to annealing temperature, several "primer search parameters" such as primer length, GC content, and PCR product length as well as annealing temperature (Dieffenbach et al., 1995) should be considered in primer annealing specificity. If a primer, which satisfies all such parameter, were employed, primer annealing would be specified, resulting in the significant enhancement of primer annealing specificity during target DNA amplification and the freedom from the problems such as backgrounds and non-specific products arising from primers used in the experiments. It is usual that well-designed primers can help avoid non-specific annealing and backgrounds as well as distinguish between cDNA or genomic templates in RNA-PCR. Many approaches have been developed to improve primer annealing specificity and therefore of amplification ofthe desired product. Examples are touchdown PCR (Don et al., 1991), hot start PCR (D'Aquila et al., 1991), nested PCR (Mullis and Faloona, 1987), and booster PCR (Ruano et al., 1989). Another alternative approaches have been also reported that various 'enhancer' compounds can improve the specificity of PCR. The enliancer compounds include chemicals that increase the effective annealing temperature of the reaction, DNA binding proteins and commercially available reagents. However, there is no 'magic' additive that will ensure success in every PCR and it may be necessary to test different additives under different conditions, such as annealing temperature. Although these approaches have contributed to the improvement of primer annealing specificity in some cases, they did not fundamentally access a solution for the problems arising from primers used in the PCR amplification, such as non-specific products and high backgrounds. In many cases the primer sequence does not need to be a perfect complement to the template sequence. The region of the primer that should be perfectly matched to the template is the 3 '-end because this is the end of the primer that is extended by the DNA polymerase and is therefore most important for ensuring the specificity of annealing to the correct target sequence. The 5' -end ofthe primer is less important in determining specificity of annealing to the target sequence and can be modified to carry additional sequence, such as restriction sites or promoter sequences that are not complementary to the template (McPherson and Moller 2000). This notion is adapted to the design of annealing control primers described in this invention. It has been widely known that nucleotides at some ambiguous positions of degenerate primers have been substituted by universal base or a non-discriminatory analogue such as deoxyinosine (Ohtsuka et al, 1985; Sakanari et al., 1989), l-(2'-deoxy- beta-D-ribofuranosyl)-3-nitropyrrole (Nichols et al., 1994), or 5-Nitroindole (Loakes and Brown, 1994) for solving the design problems associated with the degenerate primers because such universal bases are capable of non-specifically base pairing with all four conventional bases. Nevertheless, there has not been any report that this universal base or a non-discriminatory analogue such as deoxyinosine, l-(2'-deoxy-beta-D-ribofuranosyl)-3- nitropyrrole, or 5-Nitroindole is used to increase the specificity of primer annealing during PCR. The presence of universal base such as deoxyinosine, l-(2'-deoxy-beta-D- ribofuranosyl)-3-nitropyrrole, or 5-Nitroindole in a primer generates low annealing temperatures due to its weaker hydrogen bonding interactions in base pairing. As an extension of this theory, it would be induced that contiguous universal bases present between the 3 '-end and 5 '-end of a primer could generate a region, which has lower melting temperature, forms a boundary to each of 3 ' -and 5 ' -end portions of the primer, and affect the annealing of each portion, respectively. This simple theory provides us with the basis of annealing control primers described in this invention.

The present invention provides a novel annealing control primer system, named ACP system, which allows enhancing the specificity of PCR amplification. The present ACP system can be adapted to almost unlimited application in all fields of PCR-based technology. PCR based techniques have been widely used not only for amplification of a target DNA sequence but also for scientific applications or methods in the fields of biological and medical research such as Reverse transcriptase PCR (RT-PCR), Differential Display PCR (DD-PCR), Cloning of known or unknown genes by PCR, Rapid amplification of cDNA ends (RACE) and PCR-based genomic analysis (McPherson and Moller, 2000). The followings are only representatives of PCR applications.

Techniques designed to identify genes that are differentially regulated by cells under various physiological or experimental conditions (for example, differentiation, carcinogenesis, pharmacologic treatment) have become pivotal to modern biology. One such method for screening differences in gene expression between various cell types or between different stages of cell development with the availability of PCR is known as Differential Display PCR (DD-PCR), described by Liang and Pardee in 1992. This method uses combinations of 10-mer arbitrary primers with anchored cDNA primers and generates fragments that originate mostly from the poly(A) tail and extend about 50-600 nucleotide upstream. By combining 3 ' anchored Oligo(dT) primers and short 5 ' arbitrary primers, subsets ofthe transcriptome are amplified, the resulting cDNA fragments are separated on denaturing polyacrylamide gel and visualized autoradiographically.

Although this method is simple and rapid and only requires small amounts of total RNA, there are a number of disadvantages to the previous DD-PCR methods. The differential banding patterns are often only poorly reproducible due to the use of short arbitrary primer so that many laboratories have had difficulty obtaining reproducible results with these methods. It has been shown that at least 40% ofthe differentially displayed bands are not reproducible between experiments even in well-trained hands (Bauer el al., 1994). Furthermore, the pattern of differential expression often cannot be reproducible on Northern blots and percent of these false positives can arise up to 90% (Sompayrac et al., 1995). As a modification used for an alternative, the use of longer random primers of, e.g., 20 bases in length does not satisfactorily solve the problem of reproducibility (Ito et al., 1994). There are another factors leading to the relatively low reproducibility of DD-PCR such as an insufficient amount of starting material and very low concentration of dNTP (2-5 μM) used to prepare the different banding patterns (Matz and Lukyanov, 1998). It is also difficult to detect rare transcripts with these methods (Matz and Lukyanov, 1998). In addition, because the cDNA fragments obtained from DD-PCR are short (typically 100-500 bp) and correspond to the 3 ' -end ofthe gene that represent mainly the 3 ' untranslated region, they usually do not contain a large portion ofthe coding region. Therefore, labor-intensive full- length cDNA screening is needed unless significant sequence homology, informative for gene classification and prediction of function, is obtained (Matz and Lukyanov, 1998).

Differential Display methods use radioactive detection techniques using denaturing polyacrylamide gels. The radioactive detection ofthe reaction products restricts the use of this technique to laboratories with the appropriate equipment. Relatively long exposure times and problems with the isolation of interesting bands from the polyacrylamide gels are additional drawbacks of Differential Display technique. Although modified non-radioactive

Differential Display methods have recently been described, which include silver staining (Gottschlich et al. 1997; Kociok et al., 1998), fluorescent-labeled oligonucleotides (Bauer et al. 1993; Ito et al. 1994; Luehrsen et al., 1997; Smith et al., 1997), the use of biotinylated primers (Korn et al., 1992; Tagle et al., 1993; Rosok et al., 1996), and ethidium bromide- stained agarose gels (Rompf and Kahl, 1997; Jefferies et al., 1998; Gromova et al., 1999), these methods have met with only limited success. If the reaction products could be simply detected on ethidium bromide-stained agarose gel and the results were reproducible and reliable, it would greatly increase the speed and avoid the use of radioactivity.

The application to the identification of differentially expressed genes in this present invention provides an improved method to overcome the problems and limitations associated with the previous Differential Display methods described above in detecting differentially expressed mRNAs.

Another PCR-based approach called targeted differential display uses an oligonucleotide primer that directs the amplification of multigene family members with conserved protein domains. Gene families are groups of genes which are often functionally characterized by a particular type of function which the gene products in a cell undertake and which structurally have one or several conserved regions (domains) in common. Examples of gene families are the MADS-box and the homeogene family as well as further transcription factor families. The cyclin, cytokine and globin gene families are for example of medical interest. The Prosite database provides a list of proteins that have common domains and sequence motifs. The oligonucleotide used in the PCR can either be a specific primer that is used at a low annealing temperature or, as is more often the case, a degenerate primer mixture for use at higher stringencies (Stone and Wharton, 1994). However, amplifications using degenerate primers can sometimes be problematic and may require optimization. It is important to keep the annealing temperature as high as possible to avoid extensive nonspecific amplification and a good rule of thumb is to use 55 °C. as a starting temperature. In general, it is difficult to keep this rule because degenerate primers should be designed based on amino acid sequences or conserved domain sequences as a precondition. In order to generate a satisfied relationship between degenerate primer and annealing temperature in this approach, it is required to use an annealing control primer which can tolerate the alternation of annealing temperature, particularly high temperature such as 68

°C. regardless of primer design.

Another method for RNA fingerprinting is arbitrary primed PCR (AP-PCR). One great strength of AP-PCR methods is their simplicity (Welsh and McClelland, 1991; Williams et al., 1990). AP-PCR uses a single primer or a pair of primers, wherein the primers are 10-mers or 18-mers as longer primer. This method has previously been used to provide DNA fingerprints of hybrid cell lines (Ledbetter et al., 1990) and particular genomic regions (Welsh and McClelland, 1990; Williams et al., 1990). It provides a very useful tool for genome analysis in bacterial, fungal and plant identification and population studies, where individual isolates can be compared rapidly. For example, they can be used as a tool to identify pathogens or the occurrence of particular strains or pathotypes. Commonly, AP-

PCR uses a single primer to initiate DNA synthesis from regions of a template where the primer matches imperfectly. In order for this to work, the initial cycles have to be performed at low stringency (37-50 °C), normally for the first five cycles, which allows primer annealing to imperfect sites throughout the genome. The stringency is then increased (55 °C.) as for standard PCR amplification and the reaction allowed proceeding for an additional 30-35 cycles. AP-PCR is not recommended for use in such applications as paternity testing where unequivocal results are demanded, because nonparental products are occasionally produced. Although alternative AP-PCR approaches including nested AP-PCR have been developed (McClelland et al., 1993; Ralph et al., 1993), the issue of reproducibility is still of main concern. One concern is that the patterns may vary from day to day or from lab to lab (see, e.g., Meunier and Grimont, 1993). However, this present invention provides an improved method using the ACP system of the present invention to overcome the reproducible problems associated with the previous AP-PCR methods described above.

Another PCR-based application is RACE technology. RACE is a procedure for amplification of cDNA regions corresponding to the 5'- or 3 '-end of mRNA (Frohman et al., 1988) and it has been used to isolate rare transcripts successfully. The gene-specific primer may be derived from sequence data from a partial cDNA, genomic exon, or peptide.

In 3' RACE the polyA tail of mRNA molecules is exploited as a priming site for

PCR amplification. mRNAs are converted into cDNAs using reverse transcriptase and an Oligo-dT primer as described in the standard art. The generated cDNAs can then be directly

PCR amplified using a gene-specific primer and a primer that anneals to the polyA region.

The same principle as the above 3' RACE applies for 5' RACE but there is no polyA tail. Thus, 5' RACE is made by tagging the 5 '-end of a cDNA by means of different methods (Fromont-Racine et al., 1993; Schaefer, 1995; Franz et al., 1999). Most approaches for the 5' RACE, such as homopolymeric tailing or ligation anchored tailing require a set of enzymatic reactions after completion of first strand cDNA synthesis (Schaefer, 1995). Each enzymatic step has the potential to introduce failures and to destroy the integrity of the cDNA. Recently, an alternative was introduced, the so called CapFinder approach (Chenchik et al., 1998; Chenchik et al. U.S. Pat. Nos. 5,962,271 and 5,962,272). The technique relies on dual functions of the reverse transcriptases; one is the terminal transferase activity to add non-templated nucleotides to the 3 '-end of a cDNA and the other is the template switching activity to switch a template to a second template. This property is utilized during the retroviral life cycle (Clark, 1988; Kulpa et al., 1997). Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT) often adds three to four non-template- derived cytosine residues to the 3 '-end of newly synthesized cDNAs in the presence of manganese or high magnesium (Schmidt and Mueller, 1999). This approach allows the amplification of full-length cDNAs because the M-MLV RT adds C residues preferentially to the cDNA if complete (capped) mRNA serves as template.

However the CapFinder approach for 5'-RACE experiments could not be free from background problems such as DNA smear arising from the contamination of the CapFinder and Oligo-dT primers, which were used in cDNA synthesis (Chenchik et al., 1998). Even residual amounts of these primers result in a high background because both ideally fit to all cDNAs present in the reaction mixture. Also, 3 '-RACE and full-length cDNA amplification have the same background problems due to the contamination of primers used for cDNA synthesis in which they generate non-specific products in PCR reaction (Chenchik et al., 1998). New approaches to overcome the problems above have been recently introduced.

One approach is step-out PCR to suppress unwanted PCR products (Matz et al., 1999) but it has been pointed out that this approach still remains a smear of DNA rather than a single DNA (Schramm et al., 2000). Another approach which is introduced more recently is to use solid-phase cDNA synthesis and procedures to remove all contaminants used in cDNA synthesis (Schramm et al., 2000), but the major drawback of this technique is costly and time consuming by requiring solid-phase cDNA synthesis and following procedures. Therefore, more effective, simple, rapid and inexpensive strategies are required to completely eliminate problems arising from contamination of the primers such as Oligo-dT or CapFinder primer used for cDNA synthesis. In addition to RACE technologies mentioned above, utilizing current technologies for cDNA library construction, the 5 '-ends of genes tend to be under-represented in cDNA populations, especially if a poly(dT) primer is used during first cDNA strand synthesis and if the starting material is limited. Although a number of different approaches have been developed to overcome this problem, most suffer from common limitations producing full- length cDNAs or 5 '-enriched cDNAs with a number of inherent problems. These approaches are complex or costly and time consuming by requiring multiple enzymatic steps and/or are not pronounced sensitive (Carninci et al., 1997; Suzuki et al., 1997; Guegler et al. U.S. Pat. Nos. 6,083,727 and 6,326,175; Hayashizaki. U.S. Pat. No. 6,143,528). Therefore, there is continued interest in the development of improved methods for generating full- length or 5 '-enriched cDNAs, particularly with the limited starting material.

As described above, all these PCR techniques and method could not be completely free from the limitations and problems resulting from the non-specificity of primers used in each method, such as false positives, poor reproducibility, high backgrounds and etc., although improved approaches to each method has been continuously introduced, so that they are in needs of a universal primer system which could improve the specificity of PCR amplification by controlling primer annealing in association with annealing temperature. It is very interesting to see how ACP system described in this invention affects each PCR application, especially primer annealing specificity.

Disclosure ofthe Invention

The present invention is directed to novel methods and compositions for improving the specificity of PCR amplification. Particularly it relates to a novel annealing control primer system named ACP system which allows primer annealing to be controlled in association with annealing temperature, such that the specificity of PCR amplification can be significantly improved during PCR. The principle of the ACP system is based on the composition of an oligonucleotide primer having 3'- and 5 '-end distinct portions separated by at least one deoxyinosine group and the effect of the deoxyinosine group on the annealing of the 3 '-and 5'- end portion each, in connection with the alteration of annealing temperature. This invention has discovered that the presence of deoxyinosine group positioned between the 3'- and 5'- end portions plays as a switch in controlling primer annealing to a template nucleic acid in associated with annealing temperature during polymerase chain reaction due to the property of deoxyinosine as universal base, such that the presence of deoxyinosine group positioned between the 3'- and 5'- end portions interrupts the annealing of the 5 '-end portion as well as limits primer annealing to the 3'- end portion at a first annealing temperature, and also, the 5 '-end portion comprises a universal primer sequence and serves as a universal priming site at a second annealing temperature, which is relatively higher than the first annealing temperature, for subsequent amplification of reaction product generated from the annealing and extension of the 3 '-end portion sequence to the template nucleic acid with the annealing of the 3 '-end portion bothered or interrupted at the same stringency conditions. Thus, an oligonucleotide primer containing a universal base group such as a deoxyinosine residue group or groups between the 3 '-end and 5 '-end portions thereof can be involved in two different occasions of primer annealmg depending on alternation of annealing temperature. In the view of these features, the ACP is fundamentally different from the conventional primer in terms ofthe function for improving primer annealing specificity under a particular stringency conditions during PCR amplification. The present invention provides an improved method for selectively amplifying a target nucleic acid fragment from a nucleic acid or a mixture using ACP system.

The present invention also provides an improved method for detecting and cloning differentially expressed mRNAs in two or more nucleic acid samples using ACP system. The present invention also provides an improved method for rapid amplification of

3 '-end and 5 '-end cDNAs using ACP system.

The present invention also provides an improved method for amplifying full- length cDNAs using ACP system.

The present invention also provides an improved method for amplifying 5 ' enriched cDNAs using ACP system.

In addition, the ACP system of the present invention can be used for detecting polymorphisms in genomic fingerprinting.

The ACP system of the present invention can be also used for the identification of conserved homology segments in multigene families. The ACP system of the present invention may further be useful in general PCR procedures associated with parameters of primer design, comprising primer length, annealing temperature, GC content, and PCR product length.

The ACP system of the invention may further be also useful for analyzing specific nucleic acid sequences associated with medical diagnostic applications such as infectious diseases, genetic disorders or cellular disorders such as cancer, as well as amplifying a particular nucleic acid sequence.

Kits containing ACP are included within the scope ofthe present invention.

The ACP system of the present invention can be also adapted to almost unlimited application in all fields of PCR-based technology.

Brief Description ofthe Drawings

FIG. 1A shows a schematic representation for selectively amplifying a target nucleic acid of double-stranded DNA using novel ACP system.

FIG. IB shows a schematic representation for selectively amplifying a target nucleic acid of mRNA using novel ACP system. FIG. 2 shows a schematic representation for identifying differentially expressed genes using novel ACP system.

FIG. 3 shows a schematic representation for amplifying a target cDNA fragment comprising 3 ' -end region corresponding to the 3 ' -end of mRNA using novel ACP system. FIG. 4A shows a schematic representation for amplifying a target cDNA fragment comprising 5' -end region corresponding to the 5' -end of mRNA using novel ACP system. The Oligo dT is used as a first-strand cDNA synthesis primer.

FIG. 4B shows a schematic representation for amplifying a target cDNA fragment comprising 5' -end region corresponding to the 5' -end of mRNA using novel ACP system. The random primer is used as a first-strand cDNA synthesis primer.

FIG. 5 shows a schematic representation for amplifying full-length cDNA molecules complementary to the mRNA molecules using novel ACP system.

FIG. 6 shows a schematic representation for amplifying 5' enriched cDNA molecules complementary to the mRNA molecules comprising the 5 ' -end information using novel ACP system.

FIG. 7 is an agarose gel photograph to show the effect of a deoxyinosine group positioned between the 3' - and 5' -end portions of ACP. The cDNA was amplified using total RNA isolated from conceptus tissues at E4.5 (lanes 1 and 4), El 1.5 (lanes 2 and 5), and E18.5 (lanes 3 and 6), with a set ofthe dT₁₀-JYC2 (SEG ID NO. 29) and ACP10 (lanes 1-3) (SEG ID NO. 13), and a set ofthe dT₁₀-ACPl (SEG ID NO. 30) and ACPIO (lanes 4-6), respectively.

FIG. 8 is an agarose gel photograph to show the effect of deoxyinosine residues positioned between the 3 ' - and 5 ' -end portions of ACP in association with the alteration of number of deoxyinosine during PCR. The lanes 0, 2, 4, 6, and 8 represent the number of deoxyinosine residues, respectively.

FIG. 9A is an agarose gel photograph to show the results of two stage PCR amplifications for Esxl using a set of EsxN7 and EsxC6 primers (lane 1) and a set of EsxN7-ACP and EsxC6-ACP primers (lane 2).

FIG. 9B is an agarose gel photograph to show the results of two-stage PCR amplifications for Esxl using EsxNl (lane 1), EsxC2 (lane 2), a set of EsxNl-ACP and

EsxC2 (lane 3), and a set of EsxNl-ACP and EsxC2-ACP (lane 4). FIG. 9C is an agarose gel photograph to show the results of two-stage PCR amplifications for Esxl using a set of EsxN3 and EsxC5 (lanes 1 and 2) and a set of EsxN3- ACP and EsxC5-ACP (lane 3).

FIG. 10A is photographs of agarose gels to show examples ofthe ACP system used for detecting differentially expressed mRNAs during embryonic development using different stages of mouse conceptus tissues. The cDNAs were amplified using total RNA isolated from conceptus tissues at E4.5 (lane 1), El 1.5 (lane 2), and E18.5 (lane 3), with a set of ACP3 (SEG ID NO. 3) and dT₁₀-ACPl. The bands indicated by arrows represent the cDNA fragments amplified from differentially expressed mRNAs. The numbers ofthe arrows indicate the cD A fragments used as probes in the Northern blot analysis of FIG.

11.

FIG. 10B is photographs of agarose gels to show examples ofthe ACP system used for detecting differentially expressed mRNAs during embryonic development using different stages of mouse conceptus tissues. The cDNAs were amplified using total RNA isolated from conceptus tissues at E4.5 (lanes 1-2 and 7-8), El 1.5 (lanes 3-4 and 9-10), and

E18.5 (lanes 5-6 and 11-12), with a set of ACP5 (SEG ID NO. 5) and dT₁₀-ACPl (the lanes 1-6), and a set of ACP8 (SEG ID NO. 8) and dT₁₀-ACPl (lanes 7-12), respectively. The bands indicated by arrows represent the cDNA fragments amplified from differentially expressed mRNAs. The numbers ofthe arrows indicate the cDNA fragments used as probes in the Northern blot analysis of FIG. 11.

FIG. 10C is an agarose gel photograph to show the amplified cDNA products obtained from different stages of mouse conceptus samples (E4.5: lanes 1 and 2; El 1.5: lanes 3 and 4; E18.5: lanes 5 and 6) using a set of ACP10 and dTι₀-ACP primers.

FIG. 10D is an agarose gel photograph to show the amplified cDNA products obtained from different stages of mouse conceptus samples (E4.5: lanes 1 and 2; El 1.5: lanes 3 and 4; E18.5: lanes 5 and 6) using a set of ACP14 and T[₀-ACP1 primers.

FIG. 11 is an agarose gel photograph to show the amplified cDNA products obtained from different stages of mouse conceptus samples (E4.5: lane 1; El 1.5: lane 2; E18.5: lane 3) using a set of ACP10 and JYC5-T₁₅-ACP primers. FIG. 12 shows Northern blot analysis of six cDNA fragments amplified from differentially expressed mRNAs during embryonic development. The six ³²P-labeled fragments indicated by arrows in FIG. 10 were used as probes for Northern blot analysis.

The arrows 1, 2, 3, 4, 5, and 6 are DEGl (FIG. 12A), DEG3 (FIG. 12B), DEG2 (FIG. 12C),

DEG8 (FIG. 12D), DEG5 (FIG. 12E), and DEG7 (FIG. 12F), respectively, wherein the results ofthe DEG sequence analysis are shown in Table 1. DEG2 (SEG ID NO. 31) and DEG5 (SEG ID NO. 32) are turned out as novel genes (Table 2). The control panels (the lower part of each panel) show each gel before blotting, stained with ethidium bromide and photographed under UV light, demonstrating similar levels of 18S and 28S rRNA as a loading control.

FIG. 13 shows the expression patterns of a novel gene, DEG5, in a full stage of mouse conceptus. Northern blot analysis was performed using the radio-labeled DEG5 cDNA fragment as a probe. Total RNA (20 μg/lane) was prepared from mouse conceptuses at the gestation times as indicated. The control panel at the lower part shows a gel before blotting, stained with ethidium bromide and photographed under UV light, demonstrating similar levels of 18S and 28S rRNA as a loading control. FIG. 14 is an agarose gel photograph to show the difference between the conventional 3 ' -RACE (lane 1) and the ACP-based 3 ' -RACE (lane 2) with regard to Esxl

3 ' -RACE.

FIG. 15 is an agarose gel photograph to show the difference between CapFinder methods and ACP-based methods for mouse JunB (lanes 1 and 2) and beta-actin 5' -RACE (lanes 3 and 4) using the conventional primer (lanes 1 and 3) and ACP (lanes 2 and 4), respectively

FIG. 16 is an agarose gel to show the difference between CapFinder methods and

ACP-based methods for mouse PLP-C alpha 5 ' -RACE using the conventional primer (lane

1) and ACP (lanes 2, 3, and 4), respectively. FIG. 17 shows the results of virtual Northern analysis by the CapFinder methods or ACP-based methods for the amplification of mouse full-length GAPDH cDNA.

Best Mode for Carrying Out the Invention

The present invention is directed to novel methods and compositions for improving the specificity of PCR amplification. Particularly it relates to a novel annealing control primer system named ACP system which allows primer annealing to be controlled in association with annealing temperature, such that the specificity of PCR amplification can be significantly improved during PCR. The principle ofthe ACP system is based on the composition of an oligonucleotide primer having 3 ' - and 5 ' -end distinct portions separated by at least one deoxyinosine group. This invention has discovered that the presence of deoxyinosine group positioned between the 3' - and 5' - end portions plays as a switch in controlling primer annealing to a template nucleic acid in associated with annealing temperature during PCR due to the property of deoxyinosine as universal base, such that the presence of deoxyinosine group positioned between the 3 ' - and 5 ' - end portions interrupts the annealing of the 5 ' -end portion as well as limits primer annealing to the 3 ' - end portion at a first annealing temperature, and also, the 5 ' -end portion comprises a universal primer sequence and serves as a universal priming site for subsequent amplification of reaction product generated from annealing and extension ofthe 3' -end portion sequence to the template nucleic acid with the annealing ofthe 3 ' -end portion bothered or interrupted at a second annealing temperature. Thus, an oligonucleotide primer containing a universal base group such as a deoxyinosine residue group or groups between the 3 ' -end and 5' -end portions thereof can be involved in two different occasions of primer annealing depending on alternation of annealing temperature. For this reason, the ACP is fundamentally different from the conventional primer in terms of the function for improving primer annealing specificity under a particular stringency conditions during PCR amplification.

A deoxyinosine group positioned between the 3 ' - and 5 ' -end portions of ACP described herein is designed to define each portion.

The term "template" refers to nucleic acid. The term "portion" refers to a nucleotide sequence flanked by at least one deoxyinosine residue group, universal base or non-discriminatory base analog. The term "3 ' -end portion" or "5 ' -end portion" refers to a nucleotide sequence at the 3 ' end or 5 ' end of a primer, respectively, which is flanked by at least one deoxyinosine residue group, universal base or non-discriminatory base analog.

The term "primer" as used herein refers to an oligonucleotide, whether occurring naturally or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand (template) is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer can also include ribonucleotides. The primer must be sufficiently long to prime the synthesis of extension products in the presence ofthe agent for polymerization. The exact lengths ofthe primers will depend on many factors, including temperature, application and source of primer.

The term " annealing" or "priming" as used herein refers to the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, whereby said apposition enables the polymerase to polymerize nucleotides into a nucleic acid molecule which is complementary to the template nucleic acid or a portion thereof.

The term "substantially complementary" is used herein to mean that the ACP and a target sequence share sufficient nucleotide similarities to enable annealing ofthe ACP to the target sequence under the designated annealing conditions, such that the annealed primer can be extended by polymerase to form a complementary copy of the template.

The term "normal cell" is used to mean any cell that is not in a diseased or pathologic state.

The ACP system in this invention is significantly effective and widely accessible to PCR based applications. Also, various problems related to primer annealing specificity remaining for the previous PCR techniques can be fundamentally solved by the ACP system. The main benefits to be obtained from the use ofthe ACP system during PCR are as follows:

(a) primer annealing specificity is improved by the effect ofthe deoxyinosine residue group on the annealing of 3 ' - and 5 ' -end portions of ACP in accordance with the alteration of annealing temperature, which requires two stage PCR amplifications.

(b) amplification of non-specific PCR products is interrupted by two-stage PCR amplifications which are performed at low and high stringent conditions.

(c) mispriming which is a major cause of false product amplification during PCR can be significantly minimized. (d) the efficiency of PCR amplification is increased, which makes it easier to detect rare mRNAs. (e) the reproducibility of PCR products is increased, which saves a great amount of time and cost.

(f) agarose gel electrophoresis followed by ethidium bromide staining can be used for detecting differentially displayed RT-PCR products. (g) the background problems arising from contamination ofthe primer(s) used for cDNA synthesis for 5 ' - or 3 ' -RACE (rapid amplification of cDNA ends) can be eliminated.

Principle of ACP system

The principle of ACP system is based on the composition of an oligonucleotide primer having 3 ' - and 5 ' -end distinct portions separated by at least one deoxyinosine group and the effect ofthe deoxyinosine group to the 3 ' - and 5 ' -end portions in the oligonucleotide primer. The presence of at least one deoxyinosine residue group between the 3 ' - and 5 ' -end portions of ACP acts as a main factor which is responsible for the improvement of primer annealing specificity in accordance with the following assumptions: (1) the presence of at least one deoxyinosine residue group between the 3 ' - and

5' -end portions of ACP interrupts the annealing ofthe 5' -end portion to the template at first annealing temperature.

(2) the 5 ' -end portion not involved in the annealing under the first aimealing temperature keeps bothering the annealing ofthe 3' -end portion to the template. (3) however, the frequency with which specific annealing events ofthe 3 ' -end portion sequence occurs is relatively higher than the frequency with which non-specific annealing events occur, under the first annealing temperature.

(4) with the annealing ofthe 3 ' -end portion bothered or interrupted at a second annealing temperature which is high stringency conditions and also should be higher than the first annealing temperature, the 5 ' -end portion comprises a universal primer sequence and serves as a universal priming site for subsequent amplification of reaction product generated from annealing and extension ofthe 3 ' -end portion sequence.

(5) consequently, only the reaction product generated from annealing and extension ofthe 3' -end portion sequence is amplified close to the theoretical optimum of a twofold increase of product for each PCR cycle using universal sequences each corresponding to both ends ofthe reaction products under the second annealing temperature.

Therefore, the 3' -end portion of ACP acts only as annealing site to the template during PCR and the 5 ' -end portion of ACP is used as a universal priming site for the subsequent amplification ofthe product generated by contacting and extending the 3 ' -end portion of ACP to the template.

The invention particularly concerns the embodiments ofthe general ACP system, wherein ACP is represented by the following formula (1): 5 ' -dNi -dN₂ -...dN_x-dIι -dl₂ - ...dI_y-dNi -dN₂ -...dN_z- 3' wherein dN is one ofthe four deoxyribonucleotides, A, C, G, or T; dl is a deoxyinosine and the deoxyinosine group is responsible for the main function of ACP in associated with alteration of annealing temperature during PCR; x, y, and z represent an integer, respectively; dN_x represents the 5' -end portion and contains a pre-selected arbitrary nucleotide sequence; dl_y represents a deoxyinosine region and contains at least 2 deoxyinosines; dN_z represents the 3 ' -end portion.

In a preferred embodiment, each ACP contains at least 2 deoxyinosine residues between the 3 ' - and 5 ' -end portion sequences of ACP. Preferably, the deoxyinosine residues between the 3 ' - and 5 ' -end portion sequences can be up to 15 deoxyinosine residues in length. Most preferably, the deoxyinosine residues between the 3 ' - and 5 ' -end portion sequences are 5 deoxyinosine residues in length. The use of deoxyinosine residues between the 3 ' - and 5 ' -end portion sequences is considered as a key feature in the present invention because it provides each portion (3 ' - and 5 ' -) with a distinct annealing specificity in association with an annealing temperature during PCR.

In one aspect ofthe invention, the minimum number of linked deoxyinosine residues between the 3 ' - and 5 ' -end portions of ACP is preferred in order to interrupt the annealing ofthe 5 ' -end portion to the template during PCR at a first annealing temperature. The length of linked deoxyinosine in the sequence (8-10 bases) does not make a significant difference on the effect of deoxyinosine residues in ACP.

In another preferred embodiment, the deoxyinosine residue group responsible for the main function of ACP in association with the alteration of annealing temperature during PCR described herein can be replaced with a non-discriminatory base analogue or universal base group such as a group of l-(2' -deoxy-beta-D-ribofuranosyl)-3-nitropyrrole or 5-

Nitroindole (Nichols et al., 1994; Loakes and Brown, 1994). The "preferred length" of an oligonucleotide primer, as used herein, is determined from desired specificity of annealing and the number of oligonucleotides having the desired specificity that are required to hybridize to the template. For example, an oligonucleotide primer of 20 nucleotides is more specific than an oligonucleotide primer of 10 nucleotides because the addition of each nucleotide to an oligonucleotide increases the annealing temperature ofthe primer to the template.

The lengths of the 3 ' - and 5 ' -end portion sequences of the ACP described herein will depend on the objective of each experiment.

In a preferred embodiment, the 3 ' -end portion of ACP is at least 6 nucleotides in length, which is a minimal requirement of length for primer annealing. Preferably, the 3 ' - end portion sequence is from 10 to 25 nucleotides and can be up to 50 nucleotides in length. In another embodiment, the 3 ' -end portion of ACP can include ribonucleotides as well as deoxyribonucleotides.

In another preferred embodiment, the 5' -end portion of ACP contains at least 15 nucleotides in length, which is a minimal requirement of length for annealing under high stringent conditions. Preferably, the 5' -end portion sequence can be up to 60 nucleotides in length. More preferably, the 5 ' -end portion sequence is from 20 to 25 nucleotides in length. The entire ACP is preferably from 35 to 50 nucleotides in length, and can be up to 100 nucleotides in length. The 5 ' -end portion of ACP has a pre-selected arbitrary nucleotide sequence and this nucleotide sequence is used as a universal primer sequence for subsequent amplification. Using a longer arbitrary sequence (about 25 to 60 bases) at the 5' -end portion of ACP reduces the efficiency of ACP, but shorter sequences (about 15 to 17 bases) reduce the efficiency of annealmg at high stringent conditions of ACP. It is also a key feature ofthe present invention to use a pre-selected arbitrary nucleotide sequence at the 5 ' - end portion of ACP as a universal primer sequence for subsequent amplification.

Some modifications in the 5 ' -end portion of ACP such as replacement of 1-10 nucleotides for nucleotides containing different hapten groups (biotin, digoxigenin, fluorescein, etc.), nucleotide analogs, ribonucleotides, non-natural nucleotides, incorporation of restriction sites, bacteriophage RNA polymerase promoter region but still retain the main function of ACP, i.e., improving primer annealing specificity, are within the scope of present invention. A variety of DNA polymerase can be used during PCR with the subject invention. Preferably, the polymerase is a thermostable DNA polymerase such as may be obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Many of these polymerases may be isolated from bacterium itself or obtained commercially. Polymerase to be used with the subject invention can also be obtained from cells which express high levels ofthe cloned genes encoding the polymerase. The subject invention further concerns kits which contain in separate packaging or compartments, the reagents such as annealing control primers and universal primers required for practicing the ACP system for improving primer annealing specificity ofthe subject invention. Such kits may optionally include the reagents required for performing PCR reactions such as DNA polymerase, DNA polymerase cofactors, and deoxyribonucleotide-5 ' -triphosphates. Optionally, the kits may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. The ldts may also include reagents necessary for performing positive and negative control reactions. Optimal amounts of reagents to be used in a given reaction can be readily determined by the skilled artisan having the benefit ofthe current disclosure.

The ACP system ofthe subject invention can be applied to a variety of PCR-based technologies. Representative examples are:

I. Application to amplifying a target nucleic acid sequence

II. Application to the identification of differentially expressed genes

III. Application to rapid amplification of cDNA ends (RACE)

IV. Application to genomic fingerprinting V. Application to the identification of conserved homology segments in multigene families

VI. Other applications

I. Application to amplifying a target nucleic acid sequence

This application using ACP system of the subject invention can provide an improved method for selectively amplifying a target nucleic acid fragment from a nucleic acid or a mixture by performing two-stage PCR amplifications to. Since the effect of ACP system provides to the conventional primers with primer annealing specificity regardless of "primer search parameters" such as primer design, comprising primer length, annealing temperature, GC content, and PCR product length, it is particularly recommended to use the ACP system when the conventional primers used to amplify a target nucleic acid fragment from a nucleic acid or a mixture are too sensitive to such parameters to generate specific PCR products.

The process for selectively amplifying a target nucleic acid fragment from a nucleic acid or a mixture using ACP system comprises the following steps: (1) amplifying a target nucleic acid fragment present in a nucleic acid or a mixture by a first-stage PCR using a pair of ACPs as 5 ' and 3 ' primers under conditions such that the 3' -end portion of each ACP anneals to a site ofthe template at a first annealing temperature and wherein the first-stage PCR amplification is carried out by at least two cycles ofthe denaturing, annealing and primer extension steps of PCR to obtain amplification products; and

(2) re-amplifying the first-stage PCR product generated from step (1) at a second annealing temperature which is high stringent conditions by a second-stage PCR amplification comprising at least one cycle of annealing, primer extending and denaturing, using the universal sequences ofthe 5' -end portions ofthe ACPs as primers. The first-stage PCR products generated from step (1) contain ACP sequences at their 5 ' ends and thus, the

5' -end portion sequences of ACPs are used as universal primer sequences in step (2).

It would be understood that the 5 ' -end portions of a set of ACPs used in step (1) could comprise identical or different sequences; if they are identical, one universal primer corresponding to the sequence of 5 ' -end portion will be used in step (2) whereas if they are different, two universal primers each corresponding to the sequence of each 5 ' -end portion of ACPs will be used in step (2). In a preferred embodiment, the 5 ' -end portions of ACPs used as 5 ' and 3 ' primers comprise different sequences at their 5 ' -ends so that two universal primers each corresponding to the sequence of each 5' -end portion of ACPs are used in step (2). A schematic representation for selectively amplifying a target nucleic acid of double-standed DNA using novel ACP system as described above is illustrated in FIG. 1 A. FIG. IB. illustrates a schematic representation for selectively amplifying a target nucleic acid of mRNA using novel ACP system.

The scope ofthe present invention also includes an alternative process for selectively amplifying a target nucleic acid fragment from a nucleic acid or a mixture using ACP system, wherein a set of primers comprising an ACP and a conventional primer can be used in the step (1), instead of a set of ACP. In this case, the conventional primer is added only step (1) with the ACP and only one universal primer corresponding to the 5 ' -end portion sequence ofthe ACP is added in the step (2). In preferred embodiment, the alternative process can be used when each 3 ' -portion of a pair of ACP to be used in step (1) has different melting temperature.

"T_m" refers to the temperature at which half the primers are annealed to the target region.

Steps (1) and (2) ofthe process are separated only in time. Step 1 should be followed by step 2. However, it would be understood that the first-stage PCR reaction mixture from step (1) could include the universal primers which will be used to anneal to the sequences ofthe 5' -end portions ofthe ACPs in step (2), which means that the universal primers can be added to the reaction mixture at the time of or after first-stage PCR reaction.

In a preferred embodiment, the first annealing temperature ranges from 40 °C. to 65 °C. for the first-stage PCR amplification in step (1). The second annealing temperature ranges from 50 °C. to 72 °C. for the second-stage PCR amplification in step (2). The length or melting temperature (T_m) ofthe V end portion sequence of ACP will determine the annealing temperature for the first-stage PCR amplification in step (1). For example, in case that ACP comprises 10 arbitrary nucleotides at the 3' -end portion, preferably, annealing temperature will be about between 50 °C. and 55 °C. for the first-stage PCR amplification in step (l).

In another embodiment, the first-stage PCR amplification under low stringent conditions used in step (1) is carried out for at least 2 cycles of PCR to improve the specificity of primer annealmg during the first stage PCR amplification, and through the subsequent cycles, the second-stage amplification is processed more effectively under high stringent conditions used in step (2). The first-stage amplification can be carried out up to 30 cycles of PCR. In a preferred embodiment, the first-stage amplification is carried out for 2 cycles of PCR. In another embodiment, the second-stage PCR amplification under high stringent conditions used step (2) is carried out for at least one cycle and up to 45 cycles of PCR to amplify the first-stage PCR product. In a preferred embodiment, the second-stage amplification is carried out for 25-35 cycles of PCR. High and low stringency conditions are standard in the art.

"Cycle" refers to the process which results in the production of a copy of target nucleic acid. A cycle includes a denaturing step, an annealing step, and an extending step.

II. Application to the identification of differentially expressed genes

This application using ACP system of the subject invention can provide an improved method particularly for detecting and cloning cDNAs complementary to differentially expressed mRNAs in two or more nucleic acid samples. A schematic representation for identifying differentially expressed genes using novel ACP system is illustrated in FIG. 2. The method comprises the following steps of:

(a) providing a first sample of nucleic acids representing a first population of mRNA transcripts and a second sample of nucleic acids representing a second population of mRNA transcripts;

(b) separately contacting each of the first nucleic acid sample and the second nucleic acid sample with a first ACP, wherein the first ACP has a hybridizing sequence sufficiently complementary to a region of the first and second population of mRNA transcripts to hybridize therewith;

(c) reverse transcribing the mRNA to which the first ACP hybridizes to produce the first and second populations of DNA strands that are complementary to the mRNAs in the first and second nucleic acid samples, respectively;

(d) purifying and quantifying the complementary DNA strands produced as a result of the reverse transcription step (c);

(e) synthesizing a second DNA strand complementary to each of the first and second populations of DNA strands using a second ACP under low stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein the second ACP has a hybridizing sequence sufficiently complementary to the first and second populations of DNA strands; (f) amplifying each second DNA strand obtained from step (e) under high stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension to generate the first and second populations of amplification products using two universal primers each comprising a sequence corresponding to each 5 '-end portion of the first and second ACPs; and

(g) comparing the presence or level of individual amplification products in the first and second populations of amplification products.

Steps (e) and (f) of the subject application are occurred in a single tube using the same reaction mixture except for primers, which means that steps (e) and (f) are separated only in time. It would be understood that universal primers can be added to the reaction mixture at the time or after second DNA strand synthesis. In a preferred embodiment, universal primers are added to the reaction mixture right after step (e) is completed, followed by subsequent PCR amplification of second DNA strands.

It would be also understood that the 5 '-end portion sequences of the first and second ACPs used in steps (b) and (e), respectively, could be identical or different sequences; if they are identical, one universal primer corresponding to the sequence of 5'- end portion will be used in step (f), whereas if they are different, two universal primers each corresponding to the sequence of each 5 '-end portion of ACPs will be used in step (f). In a preferred embodiment, the 5 '-end portion sequences of the first and second ACPs used in steps (b) and (e) are different and thus, two universal primers each corresponding to the sequence of each 5 '-end portion of ACPs are used in step (f).

The method of the subject application for detecting differences in gene expression uses only a single cDNA synthesis primer (the first ACP) to react with mRNA, unlike Differential Display PCR which requires multiple cDNA synthesis anchor primers. In the original differential display method outlined by Liang and Pardee in 1992, twelve anchor primers were introduced. The anchor primers for example, having a sequence of T_{i2 MN}, where M is A, C, or G and N is A, C, G or T, produced twelve separate cDNA populations. Recently, modified anchor primers have been proposed by altering the number of nucleotides such as one or three instead of two at the 3 '-end which can hybridize to a sequence that is immediately 5' to the poly A tail of mRNAs or by extending additional nucleotides at the 5'-end while retaining the Oligo (dT)₉-ι_{2 MN} tail resulting in at least 21 nucleotides in length (Villeponteau et al., 1996, Combates et al., 2000).

The subject invention particularly concerns the embodiments of the ACP system used in this method for the identification of differentially expressed genes, wherein the first ACP used in step (b) is represented by the following general formula (2): 5'-dNι -dN₂ -... dN_x-dIι - dl₂ -...dI_y-dT_! -dT₂ -...dT_z- 3' wherein dN is one ofthe four deoxyribonucleotides,

A, C, G, or T; dl is a deoxyinosine and the deoxyinosine group is responsible for the main function ofthe ACP associated with alteration of annealing temperature during PCR; dT is a T deoxyribonucleotide; x, y, and z represent an integer, respectively; dN_x represents the 5'- end portion and contains a pre-selected arbitrary nucleotide sequence; dl_y represents a deoxyinosine region and contains at least 2 deoxyinosines; dT_z represents the 3 '-end portion; the nucleotide sequence of the 3 '-end portion should have lower T_m than that of the 5 '-end portion.

The above formula (2) basically follows the rule of formula (1) except the composition ofthe 3'-end portion of ACP, comparing to the formula (1). The 3'-end portion of formula (2) consists of sequences capable of annealing to the poly A tail of mRNA and serves as a cDNA synthesis primer for reverse transcription of mRNA.

In a preferred embodiment, the 3 '-end portion of the first ACP used in step (b) contains at least 6 T nucleotides in length, which is a minimal requirement of length for primer annealing. Preferably, the 3 '-end portion sequence is from 10 to 20 T nucleotides and can be up to 30 T nucleotides in length. Most preferably, the 3 '-end portion sequence is about 15 T nucleotides in length. This primer is named dT₁₅ annealing control primer (dT₁₅- ACP). In some embodiments, the 3'-end portion of the first ACP used in step (b) may contain at least one additional nucleotide at the 3' end that can hybridize to an mRNA sequence which is immediately upstream of the polyA tail. The additional nucleotides at the 3' end of the first ACP may be up to 3 in length. The additional polyA-non-complementary nucleotides are of the sequence M, MN, or MNN, where M can be G (guanine), A (adenine), or C (cytosine) and N can be G, A, C, or T (thymidine). Most preferably, the 3'- end portion sequence ofthe first ACP used in step (b) contains dT[₅ only.

In preferred, the first entire ACP is about 40-45 nucleotides in length and comprises dT_[5 at the 3'-end portion, dN₂o-₂₅ at the 5'-end portion and dl₅ between the 3'- and 5 '-end portions. The first entire ACP can be up to 100 nucleotides in length. The first ACP described herein is hybridized to the poly A tail of the mRNA, which is present on all mRNAs, except for a small minority of mRNA. The use ofthe first ACP used in this invention results in only one reaction and produces only one cDNA population, in contrast to at least 3 to 64 separate cDNA populations generated by anchor primers of Differential Display technique. This greatly increases the efficiency of the method by generating a substantially standard pool of single-stranded cDNA from each experimental mRNA population.

In the step (d), the standard pools of cDNAs synthesized by the first ACP should be purified and then quantitated by spectrophotometry, in accordance with techniques well- known to those of ordinary skill in the art. This step is necessary to precisely control their inputs into the PCR amplification step and then compare the final PCR products between two or more samples. Preferably, the amount of cDNA produced at this point in the method is measured. Preferably, this determination is made using ultraviolet spectroscopy, although any standard procedure known for quantifying cDNA known to those of ordinary skill in the art is acceptable for use for this purpose. When using the UV spectroscopy procedure, an absorbance of about 260 nm of UV light preferably is used. By the measurement of cDNA quantity at this step, therefore, the cDNA quantity can be standardized between or among samples in the following PCR reaction.

After synthesis of the first cDNA strands using the first ACP, second cDNA strands are synthesized using the second ACP primer under low stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein the resultant first cDNA strands are used as templates

The second ACP basically follows the rule of formula (1), except that the 3 '-end portion ofthe second ACP comprises a short arbitrary sequence and the nucleotide sequence of the 3 '-end portion should have lower T_m than that of the 5 '-end portion. This primer is named an arbitrary annealing control primer (AR-ACP).

In a preferred embodiment, the 3 '-end portion ofthe second ACP can have from 8 to 15 nucleotides in length. Most preferably, the 3 '-end portion ofthe second ACP contains about 10 nucleotides in length. In a preferred embodiment, the second entire ACP is about 40-45 nucleotides in length and comprises dNio at the 3 '-end portion, dN₂₀-25 at the 5 '-end portion and dl₅ between the 3'- and 5'-end portions. The second entire ACP can be up to 100 nucleotides in length.

The second ACP described herein is different from a so-called long arbitrary primer, as used in the known modified Differential Display technique. For example, the conventional long arbitrary primers as described by Villeponteau et al. (1996) and

Diachenko et al. (1996), having at least 21 or 25 nucleotides in length, comprise of only arbitrary nucleotides in the entire sequences. Thus, these conventional long arbitrary primers under the low annealing temperature (about 40 °C.) required in the early PCR cycle to achieve arbitrary priming will hybridize in a non-predictable way, making it impossible to design a representative set of primers rationally. Furthermore, many of the bands represent the same mRNA due to the "Stickiness" of long primers when used under such a low stringency.

One of significant embodiments of the method for detecting differentially expressed genes in this present invention is the use of the second ACP. Since the second ACP is designed to limit the annealing of the second ACP to its 3 '-end portion sequence, not to its 5 '-end portion sequence in association with annealing temperature, the resultant annealing will come out in a predictable way, making a rational design of a representative set of primers possible. In addition, the second ACP system allows avoiding false positive problems caused by the "Stickiness" of the conventional long primers under low stringent conditions as used in the previous Differential Display technique.

In a preferred embodiment, the annealing temperature used for the synthesis of second DNA strands under low stringency conditions used in step (e) is preferably about between 45 °C. and 55 °C. Most preferably, the annealing temperature used for the synthesis of second DNA strands under low stringency conditions is about 50 °C. However, unlike Differential Display, which uses annealing temperatures between 35 °C. and 45 °C, the annealing temperature of low stringency conditions used in the subject application is relatively higher than those used in the known classical or enhanced Differential Display techniques with arbitrary primers.

Another unique and significant embodiments of the subject application for detecting differentially expressed genes in this present invention is that only initially synthesized second DNA strands are amplified by ACP-based PCR, wherein the 3'- and 5'- ends of the second DNA strands which were initially synthesized using the second ACP comprise the sequences of the first and second ACPs, respectively and thus, its 5 '-end portion sequences of the first and second ACPs are used as universal primer sequences in step (f) for the amplification of the second DNA strands. Since the ACP system in the subject application allows the amplification of specific products, it can be possible to fundamentally eliminates the cause of major bottleneck problems, such as false products and poor reproducibility, caused by non-specific annealing of the arbitrary and dT primers to first and second DNA strands as well as amplified products during PCR in the known Differential Display methods. In a preferred embodiment, the synthesis of second DNA strands in step (e) is carried out by at least 1 cycle of PCR under low stringent conditions to achieve arbitrary priming, and through the subsequent cycles, the amplification is processed more effectively for the amplification of the resultant second DNA strands under high stringent conditions used in step (f). The synthesis of second DNA strands in step (e) can be repeated up to 10 cycles of PCR. The cycle of second DNA strand synthesis can be various by the types of samples. Most preferably, the synthesis of second DNA strands in step (e) is carried out by one cycle of PCR under low stringent conditions.

In a preferred embodiment, the PCR amplification of the resultant second DNA strands synthesized by the step (e) is carried out under high stringent conditions using two universal primers each comprising a sequence corresponding to each 5 '-end portion of the first and second ACPs. In contrast, since the known Differential Display methods use the same primers for high stringent conditions as well as for low stringency conditions, the drawbacks and limitations, namely the high false positive rate, poor reproducibility and possible under-representation of minor mRNA fractions in the analysis, are occurred. In a preferred embodiment, the annealing temperature of the PCR amplification for high stringent conditions used in step (f) is preferably about between 55 °C. and 72 °C. Most preferably, the annealing temperature used for the high stringent conditions is about 65-68 °C.

In a preferred embodiment, the PCR amplification under high stringent conditions used step (f) is carried out by at least 10 cycles and up to 50 cycles of PCR to amplify the resultant second DNA strands synthesized by step (e) during PCR. Most preferably, the PCR amplification is carried out by 40-45 cycles of PCR.

In a preferred embodiment, the second-strand cDNA is synthesized by hot start

PCR method in which the procedure is to set up the complete reactions without the DNA polymerase and incubate the tubes in the thermal cycler to complete the initial denaturation step at >90 °C. Then, while holding the tubes at a temperature above 70 °C, the appropriate amount of DNA polymerase can be pipetted into the reaction.

In a preferred embodiment, the addition of the universal primers into the reaction mixture after the complete reaction of the second-strand cDNA synthesis is also carried out under denaturation temperature such as >90 °C. Then, while holding the tubes at a temperature about 90 °C, the appropriate amount of the universal primers can be pipetted into the reaction.

An example of the second DNA strand synthesis and the subsequent PCR amplification of the resultant second DNA strands in a single tube is conducted under the following conditions: the second DNA strands are synthesized under low stringent conditions by one cycle of the first-stage PCR comprising annealing, extending and denaturing reaction; the reaction mixture in a final volume of 49.5 μl containing 50 ng ofthe first-strand cDNA, 5 μl of lOx PCR reaction buffer (Roche), 5 μl of dNTP (2 mM each dATP, dCTP, dGTP, dTTP), and 1 μl of 10 μM second ACP is pre-heated at 94 °C, while holding the tube containing the reaction mixture at the 94 °C, 0.5 μl of Taq polymerase (5units/μl; Roche) is added into the reaction mixture; the PCR reactions are as follows: one cycle of 94 °C. for 1 min, 50 °C. for 3 min, and 72 °C. for 1 min; followed by denaturing the amplification product at 94 °C; after the complete reaction of the second DNA strand synthesis in step (e), 2 μl of 5' universal primer (10 μM) and 2 μl of 3'universal primer (10 μM) are added to the reaction mixture and then the second stage PCR amplification is conducted as follows: 40 cycles of 94 °C. for 40 sec, 68 °C. for 40 sec, and 72 °C. for 40 sec; followed by a 5 min final extension at 72 °C.

It should be noted that a proper concentration of arbitrary ACP (second ACP) is used to synthesize the second-strand cDNAs by one cycle of the first-stage PCR amplification. If the amount of the second ACP used in the step (e) is too low, the resultant amplified PCR products are not reproducible. In contrast, the excess amount of the second

ACP used in the step (e) generates backgrounds such as DNA smear during PCR. In a preferred embodiment, the concentration of the second ACP used in the step (e) is about between 0.1 μl and 1 μM. Most preferably, the concentration of the second ACP used in the step (e) is about 0.2 μl.

In a preferred embodiment, the concentration of universal primers used in the step (f) is about between 0.1 μl and 1 μM. Most preferably, the concentration of the universal primers used in the step (f) is about 0.4 μl.

Another significant embodiment of the subject application to the identification of differences in gene expression is the use of high annealing temperature in a method. High annealing temperature used in step (f) increases the specificity of primer annealing during PCR, which results in eliminating false positive products completely and increasing reproducibility. Freedom from false positives which is one major bottleneck remaining for the previous Differential Display technique is especially important in the screening step for the verification ofthe cDNA fragments identified by Differential Display.

In a preferred embodiment, the resultant PCR cDNA fragments produced by step (f) are separated by electrophoresis to identify differentially expressed mRNAs. Preferably, the resultant PCR cDNA fragments are detected on an ethidium bromide-stained agarose gel. In some embodiment, the resulting PCR cDNA fragments are detected on a denaturing polyacrylamide gel.

Another significant feature of this subject application is the use of ethidium bromide-stained agarose gel to identify differentially expressed mRNAs. In general, the known Differential Display methods use radioactive detection techniques using denaturing polyacrylamide gels. The significant amount of the amplified cDNA fragments obtained through two stage PCR amplifications described herein allows to use an ethidium bromide- stained agarose gel to detect the amplified cDNAs, which results in increasing the speed and avoiding the use of radioactivity.

In conclusion, the subject application for detecting and cloning differentially expressed genes in this invention differs from the previous Differential Display techniques in several ways as described above.

Primarily, the 3 '-end portion of ACP anneals to the template nucleic acid under low annealing temperature but under high annealing temperature, the 3 '-end portion is not annealed to the template nucleic acid, such that the ACP is not involved as a primer in subsequent amplification of reaction product generated from annealing and extension ofthe 3 '-end portion sequence to the template nucleic acid. Thus, an oligonucleotide primer containing a universal base group such as a deoxyinosine residue group or groups between the 3 '-end and 5 '-end portions thereof can be involved in two different occasions of primer annealing depending on alternation of annealing temperature. As a result, the ACP system applied for detecting and cloning differentially expressed mRNAs completely eliminates false positives and produces only authentic PCR products. For this reason, the ACP-based Differential Display of this invention is fundamentally different from the previous Differential Display methods in terms of the function for improving primer annealing specificity under a particular stringency conditions during PCR amplification, wherein the previous Differential Display methods use the same primers for high stringent conditions as well as for low stringency conditions, the drawbacks and limitations, namely the high false positive rate, poor reproducibility and possible under-representation of minor mRNA fractions in the analysis, are occurred. Furthermore, the use ofthe ACP system in this method makes it possible to allow the amplification of only second DNA strands and the use of the sufficient amount of starting materials as well as the high concentration of dNTP, resulting in the following benefits: a) increasing primer annealing specificity, b) eliminating the problem of false positives which requires the subsequent labor-intensive work to verify true positives, c) improving reliability and reproducibility, d) detecting rare mRNAs, e) generating longdistance PCR products ranging in size from 150 bp to 1.2 kb, f) allowing the use of ethidium bromide-stained agarose gel to detect products, g) increasing the speed, h) particularly, not requiring well-trained hands to conduct this method, i) allowing the rational design of a representative set of primers.

III. Application to rapid amplification of cDNA ends (RACE)

This application using the ACP system of the subject invention can provide an improved method for rapidly amplifying cDNA ends, so called RACE technologies. To be specific, the ACP system of the subject application is adapted to the RACE technologies related to both of 3'- and 5 '-end, full-length cDNAs, and 5 '-enriched cDNAs and eliminates the background problems resulting from the primers used in the conventional RACE technologies.

An improved method using ACP system for amplifying a target cDNA fragment containing 3 '-end region corresponding to the 3 '-end of mRNA, it is called as 3 '-RACE, comprises the following step of: (1) synthesizing first cDNA strands complementary to mRNAs with a first ACP under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein the first ACP comprises a hybridizing sequence at 3 '-end portion sufficiently complementary to the poly A tail ofthe mRNAs to hybridize therewith;

This method comprising the embodiment of step (1) follows by either alternative step (2A) or step (2B), described below:

(2 A) amplifying a target cDNA sequence containing 3 '-end region using the first cDNA strands as templates, wherein the universal sequence corresponding to 5 '-end portion of the first ACP used in the step (1) and a gene-specific primer are used as 3' and 5' primers, respectively. (2B) synthesizing the second-strand cDNA using a second ACP comprising a gene-specific sequence at the 3 '-end portion, by at least one cycle of PCR comprising denaturing, annealing and primer extension.

The method comprising the embodiment of step (2B) further comprises the following steps: (3) amplifying the second-strand cDNA using two universal primers each corresponding to the 5 '-end portion sequence of the first and second ACPs under high stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein the second-strand cDNA comprises the first and second ACP sequences at both 3'- and 5 '-ends. Steps (2B) and (3) ofthe subject application are occurred in a single tube using the same reaction mixture except for primers, which means that steps (2B) and (3) are separated only in time. It would be understood that universal primers can be added to the reaction mixture at the time or after second DNA strand synthesis. In a preferred embodiment, universal primers are added to the reaction mixture right after step (2B) is completed, followed by subsequent PCR amplification of second DNA strands.

One of significant embodiments of the present invention for 3 '-RACE is that the first ACP comprising Oligo(dT) at the 3 '-end portion is used as a cDNA synthesis primer and then the resultant cDNAs are directly used as templates for subsequent PCR amplification without any additional purification steps to remove the cDNA synthesis primer. The annealing of the first ACP to the templates will be interrupted during subsequent PCR by the effect of the deoxyinosine residue group to the 3'- and 5 '-end portions of the ACP under relatively high stringent conditions as described in the principle of ACP system above. As a result, the subject application to 3 '-RACE simplifies the conventional RACE methods by reducing the step of purification and also, the ACP used in the subject application does not involve the background problems because the annealing of the 3 '-end portion is specified by the presence of the deoxyinosine residue group positioned between the 3 '-and 5 '-end portions in the ACPs, whereas conventional cDNA synthesis primers such as Oligo-dT primers used in the current 3 '-RACE methods generate backgrounds during PCR, which is non-specific products. The formula of the first ACP for the cDNA synthesis is identical to the formula (2). When a gene-specific primer is used as 5' primer, the amplification of a target cDNA fragment containing a 3 '-end sequence in step (2 A) is carried out under high stringent conditions in accordance with conventional PCR methods as described in the standard art.

In a preferred embodiment, a target cDNA fragment containing a 3 '-end sequence in step (2B) is amplified using a second ACP comprising a gene-specific sequence at the 3'- end portion, by two stage PCR amplifications which is used in the application of the present invention for amplifying a target nucleic acid sequence above. Since the ACP system described in this invention can generate stable T_ra in a primer and also tolerate "primer search parameters" such as primer design, comprising primer length, annealing temperature, GC content, and PCR product length, it is particularly useful when the gene-specific primer sequences have low T_m or are very sensitive to such parameters to generate specific products. The formula ofthe second ACP is identical to the formula (1) except at the 3 '-end portion, wherein the 3 '-end portion contains a gene-specific sequence.

A schematic representation for amplifying a target cDNA fragment comprising 3 ' -end region corresponding to the 3 ' -end of mRNA using novel ACP system, it is called as ACP-based 3' RACE, is illustrated in FIG. 3. In another embodiment, an application using ACP system of the subject invention can also provide an improved method for amplifying a target cDNA fragment comprising 5 '-end region corresponding to the 5 '-end of mRNA, it is called as 5' RACE, the method comprises the following steps of: (1) contacting the mRNA molecules with a conventional Oligo dT primer or random primer under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein the cDNA synthesis primer comprises a hybridizing sequence at 3 '-end portion sufficiently complementary to a region of the mRNAs to hybridize therewith; (2) reverse transcribing the mRNAs to which the cDNA synthesis primer hybridizes to produce first strand cDNA sequences that are complementary to the mRNAs to which the cDNA synthesis primer hybridizes, resulting in forming mRNA-cDNA intermediates;

(3) permitting cytosine residues to be tailed at the 3 '-end ofthe first strand cDNAs by the terminal transferase reaction of reverse transcriptase in the presence of manganese under the form of said mRNA-cDNA intermediates;

(4) contacting a first ACP to the cytosine tails at the 3 '-end of the first cDNA strand in the form of the mRNA-cDNA intermediate, wherein the first ACP comprises at least three guanine residues at its 3 '-end to hybridize the cytosine tails of the 3 '-end of the first cDNA strand;

(5) extending the tailed 3 '-end of the first strand cDNA sequences to generate additional sequences complementary to the first ACP using reverse transcriptase, wherein the first ACP is used as a template in the extension reaction.

This method comprises the embodiment of steps (1) - (5) and follows by either alternative step (6A) or step (6B), described below:

(6 A) amplifying a target cDNA sequence comprising its 5 '-end region using the resultant full-length of first cDNA strands as templates, wherein the universal sequence corresponding to 5 '-end portion ofthe first ACP which was used as an extension primer for the 3 '-end extension ofthe first cDNA strand used in steps (4) and (5) is used as a 5' primer and a gene-specific primer is used as 3 ' primer.

(6B) synthesizing the second-strand cDNA of the extended first-strand cDNA using a universal primer by at least one cycle of PCR comprising denaturing, annealing and primer extension, wherein said universal primer has a sequence complementary to the 5'- end extended sequence ofthe first-strand cDNA;

The method comprising the embodiment of step (6B) further comprises the following steps:

(7) synthesizing a target cDNA strand using a second ACP at a first annealing temperature by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein the second ACP comprises a gene-specific sequence at the 3 '-end portion; (8) amplifying the target cDNA strand using two universal primers at a second annealing temperature, which is high stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein the universal primers have sequences complementary to both 3'- and 5 '-ends of the target cDNA strand, which comprises the sequences ofthe first and second ACPs at both 3'- and 5 '-ends. Steps (6), (7) and (8) of the subject application are occurred in a single tube using the same reaction mixture except for primers, which means that steps (6)-(8) are separated only in time. It would be understood that the primer(s) used in each step (6), (7) and (8) can be added to the reaction mixture at the time or after each step. In a preferred embodiment, the primer(s) is(are) added to the reaction mixture right after each step is completed, followed by subsequent PCR amplification of second DNA strands.

When a gene-specific primer is used as 5' primer, the amplification of a target cDNA fragment containing a 5 '-end sequence in step (6 A) is carried out under high stringent conditions in accordance with conventional PCR methods as described in the standard art. In a preferred embodiment, a target cDNA fragment containing a 5 '-end sequence in step (6B) is amplified using a second ACP comprising a gene-specific sequence at the 3'- end portion, by two stage PCR amplifications which is used in the application ofthe present invention for amplifying a target nucleic acid sequence above. Since the ACP system described in this invention can generate stable T_m in a primer and also tolerate "primer search parameters" such as primer design, comprising primer length, annealing temperature,

GC content, and PCR product length, it is particularly useful when the gene-specific primer sequences have low T_m or are very sensitive to such parameters to generate specific products. The formula ofthe second ACP is identical to the formula (1) except at the 3'-end portion, wherein the 3 '-end portion contains a gene-specific sequence.

In a preferred embodiment, when the size of a target mRNA is so large that the reverse transcriptase falls off before reaching the 5' complete sequences, the random primer is used as cDNA synthesis primer.

The first ACP is similar to CapFinder primer (Chenchik et al., 1998; Chenchik et al. U.S. Pat. Nos. 5,962,271 and 5,962,272) because both of them comprise three guanine residues at its 3 '-end and use them as a template switching primer for the 3 '-end extension of the first cDNA strand by reverse transcriptase, whereas they are fundamentally different from each other in term of the function of a switch of primer annealing temperature. CapFinder primer does not comprise a deoxyinosine group which has a function of regulating primer annealing temperature so that the CapFinder PCR method for 5 '-RACE (Chenchik et al., 1998) can not be free from a high background such as DNA spear arising from contamination of the primers such as the CapFinder and Oligo-dT primers used in cDNA synthesis during PCR. On the other hand, the deoxyinosine group of the first ACP has a function of regulating primer annealing temperature so that the subject method does not provide any cause for the background problems during subsequent PCR amplification; this is a key feature ofthe ACP system applied to 5 '-RACE. Furthermore, when the ACP system of the present invention is used in 5 '-RACE technology, it is unnecessary to conduct the process of physical separation such as a solid- phase cDNA synthesis and procedures which has been introduced as an alternative method to remove all contaminants used in cDNA synthesis (Schramm et al., 2000).

This invention particularly concerns the embodiments of the first ACP applied for the above 5 '-RACE, wherein the first ACP used in steps (4) and (5) is represented by the following general formula (3): 5'-dN_x-dI_y-dN_z-G₃-3', wherein dN_x represents the 5'-end portion and contains a pre-selected arbitrary deoxynucleotide sequence; dN_z represents the 3 '-end portion and contains a pre-selected arbitrary deoxynucleotide sequence; dl represents at least two deoxyinosine residues; G₃ represents three guanines; x, y, and z represent an integer, respectively and z should be less than x, wherein x is the number of nucleotides in the 5 '-end portion, y is the number of deoxyinosine residues separating the 5 '-end portion and 3 '-end portion, and z is the number of nucleotides in the 3 '-end portion; the nucleotide sequence ofthe 3 '-end portion should have lower T_m than that ofthe 5 '-end portion.

The above formula (3) follows the same rule of the formula (1) except the composition ofthe 3 '-end portion. The 3 '-end portion of formula (3) contains three guanines to hybridize the cytosine tails ofthe 3 '-end ofthe first-strand cDNA sequence.

In a preferred embodiment, the 3 '-end portion (dN_z) ofthe first ACP used in steps (4) and (5) for 5 '-RACE comprises at least one deoxyribonucleotide immediately 5' to three guanines at the 3 '-end. Preferably, the 3 '-end portion sequence (dN_z) is from 2 to 15 nucleotides in length. Most preferably, the 3 '-end portion sequence is about 2-3 nucleotides in length. Further, in some embodiments, the 5 '-end portion (dN_x) of the first ACP used in steps (4) and (5) can include a sequence that is recognized by a restriction endonuclease.

Three guanine residues at the 3 '-end of the first ACP can be replaced by riboguanines, deoxyriboguanines or a combination of riboguanines and deoxyriboguanines. In a preferred embodiment, the 3 '-end ofthe first ACP comprises two riboguanines and one deoxyriboguanine at the 3 '-end (r(G)₂-d(G)-3'). Most preferably, three guanine residues at the 3 '-end ofthe second ACP comprise riboguanines.

When a gene-specific primer in step (6A) is used as 3' primer for 5 '-RACE, a target cDNA fragment containing a 5 '-end sequence is amplified under high stringency conditions by conventional PCR methods as described in the standard art. In a preferred embodiment, a target cDNA fragment containing a 5 '-end sequence is amplified using a second ACP which consists of a gene-specific sequence at the 3 '-end portion, by two stage PCR amplifications which is conducted in the application for amplifying a target nucleic acid sequence in the present invention. Since the ACP system described in this invention can generate stable T_m in a primer and also tolerate "primer search parameters" such as primer design, comprising primer length, annealing temperature,

GC content, and PCR product length, it is particularly useful when the gene-specific primer sequences have low T_m or are very sensitive to such parameters to generate specific products. The formula ofthe second ACP is identical to the formula (1) except at the 3'-end portion, wherein the 3 '-end portion contains a gene-specific sequence. A schematic representation for amplifying a target cDNA fragment comprising

5' -end region corresponding to the 5' -end of mRNA using novel ACP system, it is called as ACP-based 5' RACE, is illustrated in FIG. 4.

In another embodiment, an application using ACP system of the subject invention can also provide an improved method for amplifying full-length cDNAs, the method comprises the following steps of: (1) contacting the mRNA molecules with a first ACP under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein the first ACP comprises a hybridizing sequence at 3 '-end portion sufficiently complementary to the poly A tail ofthe mRNAs to hybridize therewith;

(2) reverse transcribing the mRNAs to which the first ACP hybridizes to produce first strand cDNA sequences that are complementary to the mRNAs to which the first ACP hybridizes therewith, resulting in forming mRNA-cDNA intermediates;

(3) permitting cytosine residues to be tailed at the 3 '-end of the first strand cDNA by the terminal transferase reaction of reverse transcriptase in the presence of manganese under the form ofthe mRNA-cDNA intermediate; (4) contacting a second ACP with the cytosine tails at the 3 '-end of the first cDNA strand in the form of the mRNA-cDNA intermediate, wherein the second ACP comprises at least three guanine residues at its 3 '-end to hybridize the cytosine tails of the 3 '-end of the first cDNA strand;

(5) extending the tailed 3 '-end of the first strand cDNA sequences to generate additional sequences complementary to the second ACP using reverse transcriptase, wherein the second ACP is used as a template in the extension reaction;

(6) amplifying the extended first strand cDNAs using two universal primers to obtain amplification products of full-length cDNAs complementary to the mRNAs, by at least one cycle of PCR comprising denaturing, annealing and primer extension, wherein the universal primers have sequences complementary to both 3'- and 5 '-ends of the extended first strand cDNAs, which comprises the sequences ofthe first and second ACPs at both 3'- and 5 '-ends.

The first ACP used in the step (1) is the same as the first ACP used in the above ACP-based 3 '-RACE and the second ACP used in the steps (4) and (5) for generating full- length cDNA is the same as the first ACP used in the steps (4) and (5) of the above ACP- based 5 '-RACE. One of significant embodiments ofthe present invention for amplifying full-length cDNA is that when the full-length cDNAs are amplified by two universal primers used in the step (6) during PCR, the first and second ACPs remained in the reaction mixture of the step (6) can not be annealed to the template under such high annealing temperature because the presence of a deoxyinosine group between the 3 '-end and 5 '-end portions of each ACP limits the annealing of both ACPs to the 3 '-end portion and thus, the 3 '-end portion sequence which comprises low T_m can not be annealed to the temperate under such high annealing temperature during PCR. Thus, the ACP system of the present invention applied to the amplification of full-length cDNAs eliminates the background problems arising from the primers used in conventional RACE methods.

The use of ACP system in RACE technology significantly simplifies and improves the conventional RACE technologies with regard to the amplification of cDNA ends or full- length cDNAs, as described above. The vital feature ofthe subject method is to be free from the background problems arising from the primers used in conventional RACE methods. Consequently this method described herein can be more effective, easier, less labor- intensive, and more reproducible than conventional RACE methods.

A schematic representation for amplifying full-length cDNA molecules complementary to the mRNA molecules using novel ACP system, is illustrated in FIG. 5.

In another embodiment, an application using ACP system of the subject invention can also provide an improved method for amplifying 5' enriched cDNAs, the method comprises the following steps of:

(1) contacting the mRNA molecules with a first ACP under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein the first ACP comprises a random nucleotide sequence at 3 '-end portion; (2) reverse transcribing the mRNAs to which the first ACP hybridizes to produce first strand cDNA sequences that are complementary to the mRNAs to which the first ACP hybridizes, resulting in forming mRNA-cDNA intermediates;

(3) permitting cytosine residues to be tailed at the 3 '-end ofthe first strand cDNAs by the terminal transferase reaction of reverse transcriptase in the presence of manganese under the form of the mRNA-cDNA intermediates;

(4) contacting a second ACP with the cytosine tails at the 3 '-end ofthe first cDNA strand in the form ofthe mRNA-cDNA intermediate, wherein the second ACP comprises at least three guanine residues at its 3 '-end to hybridize the cytosine tails ofthe 3 '-end of the first cDNA strand;

(5) extending the tailed 3 '-end of the first strand cDNA sequences to generate additional sequences complementary to the second ACP using reverse transcriptase in the presence of manganese, wherein the second ACP is used as a template in the extension reaction;

(6) amplifying the extended first strand cDNAs using two universal primers to obtain amplification products of 5' enriched cDNA molecules complementary to the mRNAs, by at least one cycle of PCR comprising denaturing, annealing and primer extension, wherein the universal primers have sequences complementary to both 3'- and 5'- ends of the extended first strand cDNAs, which comprises the sequences of the first and second ACPs at both 3'- and 5 '-ends.

"5' enriched cDNAs" refers to a significant portion of the cDNA constituents which contain the nucleotide sequence information ofthe 5 '-end ofthe mRNAs from which the cDNAs are derived.

The formula of the first ACP is identical to the formula (1) except the 3 '-end portion, wherein the 3 '-end portion comprises a random nucleotide sequence. In a preferred embodiment, the 3 '-end portion of the first ACP used in step (1) for 5' enriched cDNAs contains at least six random deoxyribonucleotides. In some embodiments, the 5 '-end portion of the first ACP used in step (1) can includes a sequence that is recognized by a restriction endonuclease.

The second ACP used in the steps (4) and (5) for amplifying 5' enriched cDNAs is the same as the first ACP used in the steps (4) and (5) ofthe above ACP-based 5 '-RACE. The conventional methods require more steps to amplify 5 'enriched cDNA molecules complementary to the mRNA molecules than the subject method because the conventional methods use the conventional primers which do not have the function of controlling annealing temperature. To contrast, this subject method is considerably a simple and effective approach due to the function of regulating annealing temperature generated by the effect of a deoxyinosine group in ACP.

A schematic representation for amplifying 5' enriched cDNA molecules complementary to the mRNA molecules comprising the 5 ' -end information using novel ACP system, is illustrated in FIG. 6.

IV. Application to genomic fingerprinting

This application using ACP system of the subject invention can provide an improved method for detecting polymoφhisms in genomic fingerprinting. The formula of

ACP for genomic fingerprinting is identical to the formula (1) except at the 3 '-end portion, wherein the 3 '-end portion comprises an arbitrary nucleotide sequence. The process is also identical to that for amplifying a target nucleic acid sequence except template nucleic acid, wherein the template nucleic acid is genomic DNA. The term " Genomic DNA" as used herein refers to a population of DNA that comprises the complete genetic component of a species. Thus genomic DNA comprises the complete set of genes present in a pre-selected species. The complete set of genes in a species is also referred to as genome.

In the previous arbitrarily primed PCR fingerprints, called AP-PCR, short or long arbitrary primers are used under non-stringent conditions for early 2-5 cycles of PCR amplification because a low annealing temperature is required to achieve arbitrary priming. Although effective amplification proceeds in the following cycles under high stringency condition, false positives still comprise a significant portion of isolated fragments because the same arbitrary primers are used in the following high stringency conditions. In contrast to AP-PCR, the ACP-based PCR for genomic fingeφrinting uses ACP at low stringent conditions and then the universal sequences of ACPs are used as primers at high stringent conditions, resulting in eliminating false positives generated by the previous AP-PCR. For example, the ACP contains an arbitrary sequence at the 3 '-end portion with at least 6 nucleotides in length. Preferably, the 3 '-end portion contains about 10 nucleotides in length. A single ACP or a pair of ACPs can be used for detecting polymoφhisms in genomic fingeφrinting. Preferably, a pair of ACPs is used for genomic fingeφrinting because a pair of ACPs produces more products than a single arbitrary ACP does.

In another embodiment, the above ACP-based PCR can be also used for RNA fingeφrinting to detect differentially expressed genes. The process is also identical to that for amplifying a target nucleic acid sequence except template nucleic acid, wherein the template nucleic acid is mRNA.

V. Application to the identification of conserved homology segments in multigene families

This application using ACP system of the subject invention can also provide an improved method for the identification of conserved homology segments in multigene families. The formula of ACP for the isolation of conserved homology segments in multigene families is identical to the formula (1) except the sequence of the 3 '-end portion, wherein the 3 '-end portion of ACP refers to a sequence substantially complementary to a consensus sequence found in a gene family, or a degenerate sequence comprising a plurality of combinations of nucleotides encoding a predetermined amino acid sequence. The process is also identical to that used for amplifying a target nucleic acid sequence using genomic

DNA or mRNA as a start material. Alternatively, the process can be also combined with that used for detecting differentially expressed mRNAs.

There are two principle approaches to the design of degenerate primers: (a) using peptide sequence data obtained from a purified protein; and (b) using consensus protein sequence data from alignments of gene families. If orthologs of the gene of interest have been cloned from other organisms, or if the gene is a member of a gene family, it will be possible to generate protein sequence alignments. These may reveal appropriate regions for the design of degenerate primers, for example, from consensus sequence of highly conserved regions. Amplifications using degenerate primers can sometimes be problematic and may require optimization. The first parameter is annealing temperature. It is important to keep the annealing temperature as high as possible to avoid extensive nonspecific amplification and a good rule of thumb is to use 55 °C. as a starting temperature. In general, it is difficult to keep this rule because degenerate primers should be designed based on amino acid sequences as a precondition. However, the ACP system does not have to satisfy this requirement because the ACP system allows a high annealing temperature such as 65

°C. at the second stage of PCR amplification regardless of primer design.

VI. Other applications

The ACP of the subject invention can be also useful in general PCR procedures associated with primer search parameters such as primer design, comprising primer length, annealing temperature, GC content, and PCR product length. Considering the effect of these parameters issued above on general PCR procedures, the ACP described herein is relatively less sensitive to such parameters because the ACP system tolerates these "primer search parameters". The subject invention can be also used for analyzing specific nucleic acid sequences associated with medical diagnostic applications, such as infectious diseases, genetic disorders or cellular disorders such as cancer, as well as amplifying a particular nucleic acid sequence.

In a further aspect, the invention comprises a ldt for performing the above methods. Such a kit may be prepared from readily available materials and reagents.

Conclusion: as much as the PCR technology has influenced the biotechnological field, the use of ACP system fundamentally alter the principles of the current existing PCR based methods, as mentioned above, by showing unlimited applicability, and have them significantly upgraded at one time. In consequence, the ACP systems and its various applications described in this present invention provide a turning point to open a new biotechnological era since the introduction of PCR technology.

The following examples demonstrate the mechanism and utility of this invention. They do not serve to limit the scope of the invention, but merely to illustrate the ways in which the method and compositions of this invention may be performed.

EXAMPLES

In the experimental disclosure which follows, the following abbreviations apply:

M (molar), mM (millimolar), μM (micromolar), g (gram), μg (micrograms), ng

(nanograms), 1 (liters), ml (milliliters), μl (microliters), °C. (degree Centigrade); Promega

(Promega Co., Madison, USA); Clontech (CLONTECH Laboratories, Palo Alto, USA); Roche (Roche Diagnostics, Mannheim, Germany).

The primers used in the subject invention are shown in Table 1.

Example 1 — Evaluation of deoxyinosine effect in ACP system

The effect of deoxyinosine residues positioned between the 3'- and 5'-end portions of ACP was evaluated by RT-PCR using mouse conceptus tissues. Total RNA was isolated from the entire conceptuses of mouse strain ICR at day of 4.5, 11.5, and 18.5 during gestation period using either Tri-reagent (Sigma), or the LiCl/Urea method (Hogan et al., 1994) as previously described (Chun et al., 1999; Hwang et al., 2000). Two individual experiments of cDNA amplifications using ACP were performed to examine the effect of deoxyinosine residues positioned between the 3'- and 5 '-end portions of ACP as follows:

A. The effect of deoxyinosine residues positioned between the 3'- and 5'-end portions of ACP in comparison with the primer not containing a dexoyinosine group. B. The effect of deoxyinosine residues positioned between the 3'- and 5 '-end portions of ACP in association with the alteration of number of dexoyinosine.

These experiments were conducted based on the following assumptions:

(i) deoxyinosine residues would generate a region which has lower annealing temperature in ACP due to their weaker hydrogen bonding interactions in base pairing. (ii) annealing of the 3 '-end portion of ACP could be separated from the 5 '-end portion since the deoxyinosine group separates the 3 '-end and 5 '-end portions in their annealing under high stringent conditions due to the property of deoxyinosine such as its weaker hydrogen bonding interaction in base pairing.

(iii) only the 3 '-end portion of ACP acts only as annealing site to the template during PCR.

(iv) T_m of dTio having 10 T nucleotides is too low for the 10 T nucleotides to bind the template.

(v) consequently, the dTι₀ would not produce any PCR products under high annealing temperature.

A. The effect of deoxyinosine residues positioned between the 3'- and 5'-end portions of

ACP in comparison with the primer not containing a dexoyinosine group

(A) First-strand cDNA synthesis dT₁₀-JYC2 5'- GCTTGACTACGATACTGTGCGATTTTTTTTTT -3' (SEQ ID NO. 29) or dT₁₀-ACPl 5'- GCTTGACTACGATACTGTGCGAIIIIITTTTTTTTTT -3' (SEQ ID NO. 30) was used as a cDNA synthesis primer.

Three micrograms of total RNA and 2 μl of 10 μM dT₁₀-JYC2 or 10 μM dTι₀-

ACP1 were combined in a 20 μl final volume. The solution was heated at 65 °C. for 10 minutes, quenched on ice, and microcentrifuged to collect solvent at the bottom. The following components were added sequentially to the annealed primer/template on ice: 0.5 μl (40 units/μl) of RNasin ribonuclease inhibitor (Promega), 4 μl of 5x reaction buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl₂, 50 mM DTT; Promega), 5 μl of 2 mM each deoxynucleotide mix (dATP, dCTP, dGTP, dTTP), and 1 μl of Moloney-murine leukemia virus (M-MLV) reverse transcriptase (200 units/μl; Promega). The 20 μl of reaction mixture was incubated at 37 °C. for 90 min, microcentrifuged, and placed on ice for

2 min. The reaction was stopped by incubation at 94 °C. for 2 min.

(B cDNA amplification using ACPs

The dTio-ACPl was used to examine the effect of a deoxyinosine group positioned between the 3'- and 5'-end portions during PCR. The dTι₀-JYC2 not containing a deoxyinosine group was used as a control.

The ACP10 5'- GTCTACCAGGCATTCGCTTCATIIIIIGCCATCGACC -3' (SEQ ID NO. 13) was used as 5' primer for this experiment.

The PCR amplification was conducted in a 50 μl volume containing 50 ng of the first-strand cDNA, 5 μl of 10 x PCR buffer, 1 μl of 10 μM 5 'primer (ACP10), lμl of 10 μM 3 'primer (dT_I0-JYC2 or dT₁₀-ACPl), 3 μl of 25 mM MgCl₂, 5 μl of 2 mM dNTP, 0.5 μl of

Taq polymerase (5 units/μl). The PCR reactions were conducted under the following conditions: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 1 min, 54 °C. for 1 min, and

72 °C. for 1 min; followed by a 5 min final extension at 72 °C. Amplified products were analyzed by electrophoresis in a 2% agarose gel followed by ethidium bromide staining. As a result, FIG. 7 shows that the dTι₀-ACPl containing a deoxyinosine group produced almost no products (lanes 4-6), whereas the dTιo-JYC2 not containing a deoxyinosine group produced a plurality of amplified cDNA products (lanes 1-3).

Consistent with our assumption, the results clearly indicate that the deoxyinosine group positioned between the 3 '-and 5 '-end portions affects the annealing of the 3'- and 5 '-end portions of the dTι₀-ACP to the template cDNA under such high annealing temperature, resulting in no product. B. The effect of deoxyinosine residues positioned between the 3'- and 5'-end portions of ACP in association with the alteration of number of dexoyinosine

( A) First-strand cDNA synthesis

The first-strand cDNA was synthesized from total RNA of mouse concentues using dT₁₀-JYC2 as a cDNA synthesis primer as the above.

(B cDNA amplification using ACPs

This experiment used four ACPs each comprising different number of deoxyinosine residues as follows, to examine the effect of deoxyinosine residues positioned between the 3'- and 5 '-end portions in association with the alteration of number of deoxyinosine, under a particular stringency conditions.

ACP16 5'- GTCTACCAGGCATTCGCTTCATIIGCCATCGACC -3 ' (SEQ ID NO. 13) ACP17 5'- GTCTACCAGGCATTCGCTTCATiπiGCCATCGACC-3' (SEQ ID NO. 13) ACP 18 5'- -3' (SEQ ID NO. 13) ACP19 5'- -3' (SEQ ID NO.

13)

CRP2I0 5'- GTCTACCAGGCATTCGCTTCATGCCATCGACC -3' (SEQ ID NO. 13) not containing a deoxyinosine group was used as a control.

The resultant first-strand cDNA generated from step (A), which comprises the universal sequence of the dTι₀-ACP at its 5 '-end, was used as a template and the universal primer JYC2 5'- GCTTGACTACGATACTGTGCGA -3' (SEQ ID NO. 10) corresponding to the 5 '-end portion ofthe dT₁₀-ACP was used as 3' primer.

The PCR amplification was conducted in a 50 μl volume containing 50 ng of the first-strand cDNA, 5 μl of 10 x PCR buffer, 1 μl of 10 μM 5'primer (ACP16, 17, 18, 19, or CRP2I0), lμl of 10 μM 3'primer (JYC2), 3 μl of 25 mM MgCl₂, 5 μl of 2 mM dNTP, 0.5 μl of Taq polymerase (5 units/μl). The PCR reactions were comprised of: 5 min at 94 °C, followed by 30 cycles of 94 °C. for 1 min, 57 °C. for 1 min, and 72 °C. for 1 min; followed by a 5 min final extension at 72 °C. Amplified products were analyzed by electrophoresis in a 2% agarose gel followed by ethidium bromide staining. As a result, FIG. 8 shows that the CRP2I0 not containing any deoxyinosine residues produced a plurality of amplified cDNA products, whereas the ACPs containing at least two deoxyinosine residues generated the significant reduction of amplified cDNA products, and even more, the ACP containing eight deoxyinosine residues produced almost no products. Consistent with our assumption, the results clearly indicates that the annealing of the 3 '-end portion of ACP to the template could be separated from the 5 '-portion since a group of contiguous deoxyinosine residues separates the 3 '-end and 5 '-end portions in their annealing under high stringent conditions due to the property of deoxyinosine such as its weaker hydrogen bonding interaction in base pairing.

Example 2.— Method for amplifying a target nucleic acid sequence using ACP system

The ACP system of the subject invention was applied to amplify target nucleotide sequences of mouse placenta-specific homeobox gene Esxl cDNA. The process arid results for the amplification of the target nucleotide sequences of Esxl cDNA using ACPs are described herein. Total RNA (3 μg) obtained from mouse 18.5-day-old placenta was used as a starting material. First-strand cDNAs were prepared under the same conditions as used in the cDNA synthesis of Example 1, except that Oligo-dT ₁₅ was used as the first-strand cDNA synthesis primer. Oligo-dT₁₅ 5'-TTTTITITITTTT T-3' (_SEQ ID NO. 54)

The resultant first-strand cDNAs were used as templates to amplify target cDNA fragments of Esxl using ACPs. This experiments conducted two stage PCR amplifications, which is a unique feature ofthe present invention.

The conventional primers of Esxl used in the subject invention are: EsxN7 5' primer 5'-GCCGGTTGCAGAAGCACC-3' (SEQ ID NO. 44) EsxC6 3 ' primer 5 '-GAACCATGTTTCTGAATGCC-3 ' (SEQ ID NO. 45) EsxNl 5' primer 5'-GAATCTGAAACAACTTTCTA-3' (SEQ ID NO. 48)

EsxC2 3 ' primer 5 '-GATGCATGGGACGAGGCACC-3 ' (SEQ ID NO. 49) EsxN3 5' primer 5'-CGCCGCAACCCCTGCCCGCA-3' (SEQ ID NO. 51) EsxC5 3' primer 5'-GATGCATGGGACGAGGCA-3' (SEQ ID NO. 52)

Three primer sets; EsxN7 and EsxC6, EsxNl and EsxC2, and EsxN3 and EsxC5, were used in the subject invention because they are known as the primer sets which generate high backgrounds as well as non-specific products by conventional PCR methods as described in the standard art.

According to single-target PCR systems, primers with similar melting temperatures (T_M) should be chosen. However, the primer set of EsxNl (T_M 50.7 °C.) and EsxC2 (T_M 71.9 °C.) has about 20 °C. of different melting temperatures between them, and the primer set of EsxN3 (T_M 86.9 °C.) and EsxC5 (T_M 66.2 °C.) both have high melting temperatures, whereas the primer set of EsxN7 (T_M 68.2 °C.) and EsxC6 (T_M 61.2 °C.) has relatively similar melting temperature.

The ACP system of the subject invention were applied to these three conventional primer sets to demonstrate if the ACP system can overcome such background problems and non-specific products, which are main concerns with these conventional primer sets.

The following ACPs comprise the sequences of the above conventional primers at their 3 '-end portions and were used as Esxl gene-specific primers for the first-stage PCR amplification; EsxN7-ACP 5' primer 5'-GTCTACCAGGCATTCGCTTCATIIIIIGCCGGTTGCAGAA

GCACC-3' (SEQ ID NO. 46)

EsxC6-ACP 3' primer 5'- GCTTGACTACGATACTGTGCGAIIIIIGAACCATGTTTCT

GAATGCC-3' (SEQ ID NO. 47)

EsxNl-ACP 5' primer 5'-GTCTACCAGGCATTCGCTTCATIIIIIGAATCTGAAACAA CTTTCTA-3 ' (SEQ ID NO. 50)

EsxC2-ACP 3' primer 5'-GCTTGACTACGATACTGTGCGAIIIIIGATGCATGGGACG

AGGCACC-3' (SEQ ID NO. 55)

EsxN3-ACP 5' primer 5'-GTCTACCAGGCATTCGCTTCATIIIIICGCCGCAACCCCTG

CCCGCA-3' (SEQ ID NO. 53) EsxC5-ACP 3' primer 5'-GCTTGACTACGATACTGTGCGAIIIIIGATGCATGGGACG

AGGCA-3' (SEQ ID NO. 56)

The 5 '-end portion sequences of the ACPs were served as universal primer sequences only for the second-stage PCR amplification; JYC2 and JYC4 5'-

TCTACCAGGCATTCGCTTCAT -3' (SEQ ID NO. 12). During the first-stage PCR amplification, the primer set of EsxN7-ACP and

EsxC6-ACP was used as 5' and 3' primers, respectively, to generate the 520-bp fragment of the Esxl cDNA, the primer set of EsxNl-ACP and EsxC2-ACP was used as 5' and 3' primers, respectively, to generate the 811-bp fragment ofthe Esxl cDNA, and the primer set of EsxN3-ACP and EsxC5-ACP was used as 5' and 3' primers, respectively, to generate the 483-bp fragment ofthe Esxl cDNA. . During the second-stage PCR amplification, JYC4 and JYC2 were used as universal 5' and 3' primers, respectively.

A. First-Stage PCR Amplification using ACPs

The first-stage PCR amplification was performed by hot start PCR method in which the procedure is to set up the complete reactions without the DNA polymerase and incubate the tubes in the thermal cycler to complete the initial denaturation step at >90 °C.

Then, while holding the tubes at a temperature above 70 °C, the appropriate amount of DNA polymerase can be pipetted into the reaction.

The first-stage PCR amplification was conducted by at least two cycles of PCR comprising of annealing, extending and denaturing reaction; the reaction mixture in a final volume of 49.5 μl containing 50 ng of the first-strand cDNA, 5 μl of 10 x PCR reaction buffer (Promega), 5 μl of 25 mM MgCl₂, 5 μl of dNTP (2 mM each dATP, dCTP, dGTP, dTTP), 1.35 μl of 5' ACP (1 μM) and 1.35 μl of 3' ACP (1 μM) is pre-heated at 94 °C, while holding the tube containing the reaction mixture at the 94 °C, 0.5 μl of Taq polymerase (5units/μl; Promega) is added into the reaction mixture; the PCR reactions are as follows: two cycles of 94 °C. for 40 sec, 60 °C. for 40 sec, and 72 °C. for 40 sec; followed by denaturing the amplification product at 94 °C.

B. Second-Stage PCR Amplification Using Universal Primers Corresponding to the 5 '-end Portion Sequences of ACPs

The resultant cDNA product generated by the first-stage PCR amplification using Esxl gene-specific ACPs was then amplified by the following second-stage PCR amplification under higher annealing temperature. After the completion of the first-stage

PCR amplification, each 1 μl of 10 μM universal primers, JYC4 and JYC2, was added into the reaction mixture obtained from the first-stage PCR amplification, under denaturing temperature such as at 94 °C. The second stage-PCR reaction was as follows: 35 cycles of 94 °C. for 40 sec, 68 °C. for 40 sec, and 72 °C. for 40 sec; followed by a 5 min final extension at 72 °C. The amplified products were analyzed by electrophoresis in a 2% agarose gel and detected by staining with ethidium bromide.

As shown in FIG. 9A-C, the two-stage PCR amplifications for Esxl using each primer set of EsxN7-ACP and EsxC6-ACP, EsxNl-ACP and EsxC2-ACP, and EsxN3-ACP and EsxC5-ACP generated a single band which corresponds to the expected size, 520-bp (FIG. 9A, lane 2), 811-bp (FIG. 9B, lane 4), and 483-bp (FIG. 9C, lane 3) of Esxl cDNA fragments, respectively. Subsequent cloning and sequence analysis of the clones confirm that the band is Esxl cDNA fragments. In contrast, the corresponding conventional primer sets, which contains only the sequence ofthe 3 '-end portion each corresponding to the ACP sets, produced non-specific products as well as high backgrounds such as DNA smear (FIG. 9A, lane 1; FIG. 9B, lane 3; FIG. 9C, lane 1 and 2). Since the PCR products using a ACP set comprise the universal primer sequences at their 5'- and 3 '-ends, additional 54-bp sequences corresponding to the universal primer sequences and deoxyinosine residues was found

These examples illustrate that ACP system permits the products to be free from the background problems as well as non-specificity arising from the conventional primers used in PCR methods as described in the standard art. Thus, the ACP system allows the generation of the specific products even though gene-specific primers are not properly designed.

FIG. 9A shows the amplified cDNA products generated by the following sets of primers; a set of EsxN7 and EsxC6 (lane 1), and a set of EsxN7-ACP and EsxC6-ACP (lane 2). PCR reactions using the conventional primer set EsxN7 and EsxC6 were as follows: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 40 sec, 60 °C. for 40 sec, and 72 °C. for 40 sec; followed by a 5 min final extension at 72 °C.

FIG. 9B shows the amplified cDNA products generated by the following single primer or a primer pair; the primers EsxNl and EsxC2 were used in lane 1 and 2, respectively; a combination of EsxNl-ACP and conventional primer EsxC2 was used in lane 3; two ACPs EsxNl-ACP and EsxC2-ACP were used in lane 4. When a conventional primer set, EsxNl and EsxC2, was used under high annealing temperature of 60 °C, no specific-target product was produced. However, when a primer set comprising one ACP EsxNl-ACP and a conventional primer of EsxC2 was used, a target-specific product as well as non-specific products was also amplified by the conventional primer EsxC2 (lane 3). In contrast, when a ACP set was used, only a single target-specific product was amplified (lane

4), which indicats that the ACP system of the subject invention permits the primers to tolerate the primer design parameter such as requirement of similar melting temperatures of primers for single-target PCR systems.

FIG. 9C shows the amplified cDNA products generated by using the following primer sets; a set of EsxN3 and EsxC5 was used in lane 1 and 2, and a set of EsxN3-ACP and EsxC5-ACP was used in lane 3. PCR reactions using the conventional primer set of EsxN3 and EsxC5 were as follows: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 40 sec, 58 °C. for 40 sec, and 72 °C. for 40 sec; followed by a 5 min final extension at 72 °C. (lane 1). The conventional primer set was also compared with the ACP set by conducting the same two stage PCR amplifications as used in the ACP system, such that its annealing temperature is increased from 60 °C. to 68 °C, except that the conventional primers were added at time of the first stage-PCR amplification and during second-stage PCR amplification (lane 2). These results also indicate that the ACP system of the subject invention can help to overcome the primer design problems, in contrast conventional primers even having high T_m generate non-specific products even under high annealing temperature.

Example 3.-Identification and characterization of differentially expressed mRNAs during mouse embryonic development using ACP system

The ACP system of the subject invention has been applied to detect differentially expressed mRNAs in embryonic developments. Specifically, two different procedures and results using different stages of conceptus total RNAs as starting materials are described herein. The primers used in the subject invention are shown in Table 1.

Al. PROCEDULE l Step (1): First-strand cDNA synthesis

The first-strand cDNAs were prepared under the same conditions as used in the cDNA synthesis of Example 1 using the dTι₀-ACPl or JYC5-Tι₅-ACP as a cDNA synthesis primer. The resultant cDNAs were purified by a spin column (PCR purification Kit, QIAGEN) to remove primers, dNTP, and the above reagents. It is necessary to perform the purification step prior to the determination of the cDNAs concentration using the UV spectroscopy at an absorbance of 260 mn. The same amount of cDNAs from each sample was used for comparing their amplification patterns using the ACP system described herein.

Step (2): First-stage PCR amplification using ACP The following ACPs were used as arbitrary ACPs (ARACPs) for the first PCR amplification;

ACP3 5'- GTCTACCAGGCATTCGCTTCATimiGCCATCGACS -3' (SEQ ID NO. 3) ACP5 5 ' - GTCTACCAGGCATTCGCTTCATIIIIIAGGCGATGCS -3 ' (SEQ ID NO. 5) ACP8 5 '- GTCTACCAGGCATTCGCTTCATIIIIICTCCGATGCS -3 ' (SEQ ID NO. 8) ACP10 5'-GTCTACCAGGCATTCGCTTCATIIIIIGCCATCGACC-3' (SEQ ID NO. 13)

ACP13 5'-GTCTACCAGGCATTCGCTTCATπiIIAGGCGATGCG-3' (SEQ ID NO. 16) ACP14 5'-GTCTACCAGGCATTCGCTTCATiπiICTCCGATGCC-3' (SEQ ID NO. 17) The 5'-end portion sequences of the dTι₀-ACPl and ARACPs serve as universal primer sequences only for the second-PCR amplification. The universal primers are JYC2 and JYC4.

The first-strand cDNAs produced from step (1) are amplified by the following first-stage PCR amplification using one of ARACPs (ACP3, ACP5, ACP8, ACP10, ACP13, or ACP14) and the dT₁₀-ACPl as 5' and 3' primers, respectively. The first-stage PCR amplification was conducted in a 50 μl volume containing 50 ng of the first-strand cDNA, 5 μl of 10 x PCR reaction buffer (Promega), 3 μl of 25 mM MgCl₂, 5 μl of dNTP (0.2 mM each dATP, dCTP, dGTP, dTTP), 5 μl of 5' primer (1 μM), 5 μl of 3' primer (1 μM), and 0.5 μl of Taq polymerase (5units/μl; Promega). The PCR reactions were as follows: 5 min at 94 °C. followed by 20 cycles of 94 °C. for 1 min, 50 °C. for 1 min, and 72 °C. for 1 min; followed by a 5 min final extension at 72 °C. The cycle of the first-stage PCR amplification can be various by the types of samples. For example, the 20 cycles of the first PCR amplification were used for mouse conceptus samples.

Step (3): Second-stage PCR amplification using universal primers corresponding to the 5 '-end portion sequences of ACPs

The amplified cDNA products produced from step (2) are re-amplified by the following second-stage PCR amplification using two universal primers, JYC4 and JYC2, each corresponding to the 5'-end portion sequences of ARACP and dTι₀-ACPl, respectively. The second-stage PCR amplification was conducted in a 50 μl volume containing 5 μl of the first amplified cDNA products (50 μl), 5 μl of 10 x PCR reaction buffer (Promega), 3 μl of 25 mM MgCl₂, 5 μl of 2 mM dNTP, 1 μl of 5' primer (10 μM), 1 μl of 3 ' primer (10 μM), and 0.5 μl of Taq polymerase (5units/μl). The PCR reactions were as follows: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 1 min, 65 °C. for 1 min, and 72 °C. for 1 min; followed by a 5 min final extension at 72 °C.

A2. PROCEDULE 2

The alternative procedure comprises the following steps of: (a) providing a first sample of nucleic acids representing a first population of mRNA transcripts and a second sample of nucleic acids representing a second population of mRNA transcripts;

(b) contacting each of the first nucleic acid sample and the second nucleic acid sample with a first ACP, wherein the first ACP has a hybridizing sequence sufficiently complementary to a region of the first and second population of mRNA transcripts to hybridize therewith;

(c) reverse transcribing the mRNA to which the first ACP hybridizes to produce a first population of DNA strands that are complementary to the mRNAs in the first nucleic acid sample to which the first ACP hybridizes, and a second population of DNA strands that are complementary to the mRNA in the second nucleic acid sample to which the first ACP hybridizes;

(d) purifying and quantifying the complementary DNA strands produced as a result ofthe reverse transcription step (c);

(e) synthesizing a second DNA strand complementary to each of the first and second populations of DNA strands using a second ACP under low stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein the second ACP has a hybridizing sequence sufficiently complementary to the first and second populations of DNA strands; (f) amplifying each second DNA strand obtained from step (e) under high stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension to generate first and second populations of amplification products using two universal primers each comprising a sequence corresponding to each 5 '-end portion of the first and second annealing control primers; and (g) comparing the amount of individual amplification products in the first and second populations of amplification products.

The first-strand cDNAs are synthesized using JYC5-T₁₅-ACP. JYC5-T₁₅-ACP 5 '

(SEQ ID NO. 61) The 5 '-end portion sequence ofthe JYC5-Tι₅-ACP serves as a 3' universal primer sequence to be used only for the second stage of PCR amplification; JYC5 5'-CTGTGAATGCTGCGACTACGAT (SEQ ID NO. 60) Step (1): First-strand cDNA synthesis

1. Combine the followings in a sterile 0.2 ml microcentrifuge tube:

3 μg Total RNA

2 μl 10 μM JYC5-T₁₅-ACP

2. Add sterile H₂0 to a final volume of 9.5 μl. Mix contents and spin the tube briefly in a microcentrifuge.

3. Incubate the tube at 80 °C. for 3 minutes or use a thermocycler for the same puφose.

4. Cool the tube on ice for 2 minutes. Spin down the contents ofthe tube briefly in a microcentrifuge. 5. Add the following reagents to the same reaction tube: 4 μl 5x First-strand buffer (Promega)

5 μl dNTP (2mM each dATP, dCTP, dGTP, dTTP) 0.5μl RNasin inhibitor (40 units/μl, Promega) 1 μl M-MLV reverse transcriptase (200 U/μl)

6. Mix contents and spin the tube briefly in a microcentrifuge.

7. Incubate the tube at 42 °C. for 90 min.

8. Incubate the tube at 94 °C. for 2 minutes to terminate first-strand synthesis. 9. Place the tube on ice for 2 min.

10. Purify the resultant cDNAs by a spin column (PCR purification Kit, QIAGEN) to remove primers, dNTP, and the above reagents.

11. Next, measure the concentration of the cDNAs using the UV spectroscopy at an absorbance of 260 nm. 12. Process to step 2.

Step (2): Second-strand cDNA synthesis using ACP

The same amount of cDNAs from each sample was used for the comparison of their amplification patterns using the ACPs in described herein. The second-strand cDNA was synthesized using arbitrary ACP10 by hot start PCR method in which the procedure is to set up the complete reactions without the DNA polymerase and incubate the tubes in the thermal cycler to complete the initial denaturation step at >90 °C. Then, while holding the tubes at a temperature above 90 °C, the appropriate amount of DNA polymerase can be pipetted into the reaction.

1. Combine the following reagents in a sterile 0.2 ml microcentrifuge tube:

1 μl First-strand cDNA prepared by step 1

5 μl 10 x PCR buffer (Roche)

5 μl 2 mM dNTP

1 μl 10 μM arbitrary ACP (5' primer) 29.5 μl Sterile dH₂0 49.5 μl Total volume

2. Mix contents and spin the tube briefly in a microcentrifuge.

3. Place the tube in the preheated thermal cycler at 94 °C. 4. Add the 0.5 μl of Taq polymerase (5units/μl; Promega) into the reaction, while holding the tube at the temperature 94 °C.

5. Conduct PCR reaction under the following conditions: one cycle of 94 °C. for 5 min, 50 °C. for 3 min, and 72 °C. for 1 min; followed by denaturing the first amplification product at 94 °C. Step (3): PCR Amplification of the second-strand cDNAs using universal primers corresponding to the 5 '-end portion sequences of ACPs

1. After the completion of the first stage PCR amplification, while holding the tubes at a temperature above 94 °C, add 2 μl of 10 μM JYC4 and 2 μl of 10 μM JYC5, in which each corresponds to the 5 '-end portion sequences of both 5' and 3' ACPs, respectively, into the reaction mixture used in step (2).

2. Conduct second stage PCR reactions under the following conditions: 40 cycles of 94 °C. for 40 sec, 68 °C. for 40 sec, and 72 °C. for 40 sec; followed by a 5 min final extension at 72 °C.

B. Separation of amplified PCR products by electrophoresis analysis and recovery of the differentially displayed bands

The amplified products were analyzed by electrophoresis in a 2% agarose gel and detected by staining with ethidium bromide. Several major bands differentially expressed during embryonic development (E4.5, El 1.5, and El 8.5) were selected, excised and extracted from the gels using GENECLEAN II Kit (BIO 101).

C. Re-amplification ofthe recovered bands

The bands obtained from step B were re-amplified using the same universal primers and PCR conditions as used in PROCEDURE 1 or 2. D. Cloning and sequencing ofthe re-amplified fragments

Each amplified fragment was cloned into the pGEM-T Easy vector (Promega) and sequenced with the ABI PRISM 310 Genetic Analyzer (Perkin Elmer Biosystem) using

BigDye Terminator cycle sequencing kit (Perkin Elmer). Computer-assisted sequence analysis was carried out using the BLAST search program (Basic Local Alignment Search

Tool).

E. Northern analysis

Twenty micrograms of total RNA from conceptus tissues were resolved on denaturing 1% agarose gels containing formaldehyde, transferred onto nylon membranes (Hybond-N, Amersham, USA), and hybridized with a ³ P -labeled subcloned PCR product in

QuikHyb solution (Stratagene, USA) overnight at 58 °C. as previously described (Chun et al., 1999; Hwang et al., 2000). Blots were washed at 65 °C. twice for 20 min in 2 x SSC, 0.1% SDS, twice for 20 min in 1 x SSC, 0.1% SDS, and twice for 20 min in 0.1 x SSC, 0.1% SDS. The membranes were exposed to Kodak X-Omat XK-1 film with a Fuji intensifying screen at -80 °C.

FIG. 10A-D shows the amplified cDNA products obtained from different stages of mouse conceptus samples by PROCEDURE 1 using the following primers sets; a set of ACP3 and dT₁₀-ACPl for the lanes 1-3 of FIG. 10A; a set of ACP5 and dT₁₀-ACPl for the lanes 1-6 and of FIG. 10B and a set of ACP8 and dT₁₀-ACPl for the lanes 7-12 of FIG. 10B, respectively. FIG. 10B also shows additional results of the amplified cDNA products using another ACP sets. FIG. 10 C-D shows the amplified products using two primer sets of the ACP10 and dT₁₀-ACPl(FIG. 10C), and ACP14 and dT₁₀-ACPl(FIG. 10D), respectively. Many differentially expressed bands in a specific stage were obtained, subcloned into the pGEM-T Easy vector (Promega), and sequenced. Sequence analysis reveals that all of the clones are known genes except two novel genes (Table 2). The expression patterns were confirmed by Northern blot analysis using mouse conceptus stage blot (Seegene, Inc., Seoul, Korea).

FIG. 11 shows the amplified cDNA products obtained from different stages of mouse conceptus samples (E4.5: lane 1; El 1.5: lane 2; E18.5: lane 3) by PROCEDURE 2, using a set of ACPIO and JYC5-T_[5-ACP. Many differentially expressed bands in a specific stage were obtained, subcloned into the pGEM-T Easy vector (Promega), and sequenced. Sequence analysis reveals that all of the clones are known genes except one DEG 2 (Table 2). The expression patterns were confirmed by Northern blot analysis using mouse conceptus stage blot (Seegene, Inc., Seoul, Korea).

FIG. 12 shows the results of Northern blots for representing six different clones. One of the clones, DEG6, was further examined for its expression during embryonic development. DEG6, which is turned out as a novel gene by sequence analysis, shows an interesting expression patterns: after a strong expression appeared at early pregnant stage (E4.5), the expression patterns were gradually reduced, however, its expression was recovered at late development stage (E17.5 and E18.5) (FIG. 13). Consistent with the results of agarose gel analysis, Northern blot analysis showed that the expression patterns of the clones are identical to the original bands on the agarose gels, indicating that all ofthe clones are true positive products. Thus, the ACP system produces only positive products without any false positives, which means that the ACP system eliminates the problem of false positives.

These results indicate that the method using ACP system for isolating differentially expressed genes produces only real PCR products and completely eliminates false positive products. Freedom from false positives which is one major bottleneck remaining for the previous Differential Display technique is especially important in the screening step for the verification ofthe cDNA fragments identified by Differential Display.

Example 5.— Method for rapid amplification of 3 '-ends of cDNA (3 '-RACE) using ACP system

In the present example, in order to demonstrate if the ACP system of the present invention can eliminate such background problems arising from primer used in cDNA synthesis in comparison with the conventional oligo-dT cDNA synthesis primer which generates high background, the ACP-based 3 '-RACE and the conventional 3 '-RACE were used.

In the conventional 3 '-RACE, the poly(A) tail of mRNA molecules is exploited as a priming site for PCR amplification and thus the oligo-dT primer is used as a 3' primer for the conventional 3 '-RACE. In contrast, the ACP system of the present invention uses the poly(A) tail of mRNA as a priming site only for the cDNA synthesis but not for the subsequent PCR amplification.

Mouse first-strand cDNAs were prepared under the same conditions as used in the cDNA synthesis of Example 1 using Oligo VdT₁₅-ACP 5'-

GCTTGACTACGATACTGTGCGAIIIIITTTTTTTTTTTTTTTV-3' (SEQ ID NO. 57) (V is A, C, or G) as a cDNA synthesis primer and then, directly used as templates for the subsequent PCR amplification without the purification step for the removal of the cDNA synthesis primer. For the conventional 3 '-RACE, the first-strand cDNAs were synthesized using the following cDNA synthesis primer;

CDS III/3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-(dT)₃₀-VN-3' (SEQ ID NO. 35) (V is A, C or G; N is A, C, T or G).

This cDNS synthesis primer, CDS III/3', was used as 3' primer for subsequent PCR amplification.

The PCR amplification was conducted in a 50 μl volume containing 50 ng of the first-strand cDNA, 5 μl of 10 x PCR buffer (Promega), 1 μl of a gene-specific 5 'primer (10 μM), lμl of universal 3' primer JYC2 (10 μM) or CDS 111/3' (10 μM), 3 μl of 25 mM MgCl₂, 5 μl of 2 mM dNTP, 0.5 μl Taq polymerase (5units/μl; Promega). The PCR reactions were conducted under the following conditions: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 1 min, 65 °C. for 1 min, and 72 °C. for 1 min; followed by a 5 min final extension at 72 °C. Amplified products were analyzed by electrophoresis in a 2% agarose gel followed by ethidium bromide staining.

FIG. 14 shows the results of Esxl 3'-RACE. The conventional 3'-RACE (lane 1) was compared with ACP-based 3'-RACE (lane 2). The conventional 3'-RACE method produced non-specific products as well as DNA smear background, whereas the ACP-based 3 '-RACE produced only a single band, which is the expected size of 348-bp. These results indicate that the ACP-based 3 '-RACE is not involved in the background problems such as DNA smear and non-specific products.

Example 6.-Method for rapid amplification of 5 '-end (5'-RACE and full-length cDNAs using ACP system

The ACP system of the subject invention was also used to amplify the 5 '-ends of cDNA fragments. The first-strand cDNAs are synthesized using Oligo VdTi₅-ACP, or Random dN₆-ACP. Oligo VdT₁₅-ACP 5'-GCTTGACTACGATACTGTGCGAIIIIITTTTTTTTTTTTTTTV-3'

(SEQ ID NO. 57), wherein V can be A, C, or G.

Random dN₆-ACP 5'-GCTTGACTACGATACTGTGCGAIIIIINNNNNN-3' (SEQ ID NO. 58), wherein N can be A, C, G, or T.

After the complete synthesis of the first strand cDNA sequences present in the form of mRNA-cDNA intermediates, cytosine residues are tailed at the 3 '-end of the first strand cDNA sequences by the terminal transferase reaction of reverse transcriptase in the presence of manganese. The 3 '-end of the first strand cDNAs were extended using the first strand cDNA 3 '-end extending ACP (rG3-ACP, rG2-ACP, or dG3-ACP) and then, directly used as templates for the subsequent PCR amplification without the purification step for the removal of the first strand cDNA 3 '-end extending ACP as well as the cDNA synthesis primer.

The sequences ofthe first-strand cDNA 3 '-end extending ACPs are: rG3-ACP 5'-GTCTACCAGGCATTCGCTTCATIHHGGr(GGG)-3' (SEQ ID NO. 36), rG2-ACP 5'- GTCTACCAGGCATTCGCTTCATIIIIIGGr(GG)-dG-3' (SEQ ID NO. 37), rGl-ACP 5'- GTCTACCAGGCATTCGCTTCATIIIIIGGr(G)-d(GG)-3' (SEQ ID NO. 59), and dG3-ACP 5'- GTCTACCAGGCATTCGCTTCATIIIIIGGd(GGG)-3' (SEQ ID NO. 38) (wherein r and d represent ribonucleotide and deoxyribonucleotide, respectively)

A. First-strand full-length cDNA synthesis

PROTOCOL A: First-strand cDNA synthesis using the ACP system of the subject invention

1. Combine the followings in a sterile 0.2 ml microcentrifuge tube:

3 μg Total RNA 2 μl 10 μM of Oligo VdT₁₅-ACP or Random dN₆-ACP

2. Add sterile H₂0 to a final volume of 10 μl. Mix contents and spin the tube briefly in a microcentrifuge. 3. Incubate the tube in a 65 °C. water bath for 15 minutes or use a thermocycler for the same puφose.

4. Cool the tube on ice for at least 2 minutes. Spin down the contents of the tube briefly in a microcentrifuge.

5. Add the following reagents to the same reaction tube:

4 μl 5x First-strand buffer (Invitrogen) l μl 0.1 M DTT

2 μl BSA (lmg/ml)

2 μl dNTP (10 mM each dATP, dCTP, dGTP, dTTP) 0.4 μl 100 mM MnCl₂

0.5μl RNasin inhibitor (40 units/μl, Promega)

6. Mix contents and spin the tube briefly in a microcentrifuge.

7. Incubate the tube at 42 °C. for 2 minutes in an incubator or thermocycler 8. Add 1 μl of Superscript II reverse transcriptase (200 units/μl; Invitrogen)

9. Incubate the tube at 42 °C. for 1 hour in an incubator or thermocycler

10. Add 1 μl of 10 μM first strand cDNA 3'-end extending ACP (rG3-ACP, rG2- ACP, or dG3-ACP)

11. Add 0.3 μl of Superscript II reverse transcriptase (200 units/μl; Invitrogen) 12. Incubate the tube at 42 °C. for 30 minutes in an incubator or thermocycler

13. Incubate the tube at 70 °C. for 15 minutes in an incubator or thermocycler to terminate first-strand synthesis.

14. Place the tube on ice or can be stored at -20 °C.

PROTOCOL B: First-strand full-length cDNA synthesis by CapFinder method The following primers are used in the CapFinder method (Clontech);

SMART TV™ Oligonucleotide 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACG GCCr(GGG)-3' (SEQ ID NO. 33),

5' PCR primer 5'-AAGCAGTGGTATCAACGCAGAGT-3' (SEQ ID NO. 34), and CDS iπ/3' PCR primer.

1. Combine the followings in a sterile 0.2 ml microcentrifuge tube:

3 μg Total RNA

1 μl 10 μM CDS III/3 ' PCR primer (Clontech)

1 μl 10 μM SMART IV Oligonucleotide (Clontech)

2. Add sterile H₂0 to a final volume of 5 μl. Mix contents and spin the tube briefly in a microcentrifuge.

3. Incubate the tube at 72 °C. for 2 minutes.

4. Cool the tube on ice for 2 minutes. Spin down the contents ofthe tube briefly in a microcentrifuge. 5. Add the following reagents to the same reaction tube:

2 μl 5x First-strand buffer (Clontech) 1 μl 20 mM DTT

1 μl dNTP (10 mM each dATP, dCTP, dGTP, dTTP) 1 μl PowerScript Reverse Transcriptase (Clontech)

10 μl Total volume

6. Mix contents and spin the tube briefly in a microcentrifuge.

7. Incubate the tube at 42 °C. for 1 hour 8. Place the tube on ice or can be stored at -20 °C.

B. PCR amplification

PROTOCOL C: Amplification of a target 5 '-end cDNA fragment using ACP system or conventional 5 '-RACE method

In the present example, in order to demonstrate that the current CapFinder 5'- RACE technology generates high background, whereas the ACP system of the present invention can eliminate such background problems arising from contamination of primers such as the CapFinder primer, SMART IV Oligonucleotide (Clontech), and cDNA synthesis primer, CDS III/3' PCR primer (Clontech), used in cDNA synthesis, the ACP-based 5'- RACE was compared with the CapFinder 5 '-RACE method for the amplification of 5 '-ends of mouse JunB and beta-actin cDNAs. The mouse JunB mRNA is a relatively rare transcript in mouse 18.5-day-old placenta RNA, whereas mouse beta-actin is a relatively abundant. 1. Combine the following reagents in a sterile 0.2 ml microcentrifuge tube:

1 μl First-strand cDNA prepared from Protocol A or B

5 μl 10 x PCR buffer (Promega)

5 μl 25 mM MgCl₂

5 μl 2 mM dNTP

1 μl 10 μM gene-specific 5 '-RACE primer 1 μl 10 μM JYC2 or 5' PCR primer (Clontech)

0.5 μl Taq Polymerase (5 units/μl; Promega)

31.5 μl Sterile dH₂0

50 μl Total volume 2. Mix contents and spin the tube briefly in a microcentrifuge.

3. Conduct PCR reaction under the following conditions: 5 min at 94 °C, followed by 30 cycles of 94 °C. for 40 seconds, 58 °C. for 40 seconds, and 72 °C. for 1 min 30 sec; followed by a 5 min final extension at 72 °C.

4. Analyze the amplified products by electrophoresis in a 2% agarose gel followed by ethidium bromide staining.

As shown in FIG. 15, the CapFinder methods for mouse JunB and beta-actin 5'- RACE using the 5' PCR primer (Clontech) and the gene-specific primer produced high backgrounds such as DNA smear (lanes 1 and 3) as described by many researchers (Chenchik et al., 1998; Matz et al., 1999; Schramm et al., 2000), whereas the ACP-based 5'- RACE of the present invention generated only a single band which corresponds each to the expected size 155-bp or 319-bp of mouse JunB (lane 2) or mouse beta-actin (lane 4) 5'-end cDNA fragment, respectively. These examples illustrate that ACP system can be used to fundamentally eliminate such background problems arising from contamination of primers used during cDNA synthesis, without the purification step for the removal of primers used in the cDNA synthesis. FIG. 16 also shows that the ACP system of the subject invention permits the nonspecific products not to be formed, which are generated by the CapFinder method (lane 1). The first-strand cDNA was synthesized either by CapFinder method (lane 1) or ACP method (lanes 2, 3, and 4) and then, directly used as template in the subsequent PCR amplification for mouse prolactin-like protein PLP-C alpha 5 '-RACE. The PLP-C alpha- specific 5 ' -RACE primer is: PLP-C alpha 5 ' -GAGAGGATAGTTTCAGGGAC-3 ' (SEQ ID

NO. 40). The first-strand cDNA 3 '-end extending ACPs comprising either three riboguanines (rG3-ACP; lane 2), three deoxyriboguanines (dG3-ACP; lane 4), or a combination of two riboguanines and one deoxyriboguanine (rG2-ACP; lane 3) at the 3 '-end generated 5 '-end cDNAs so that a single band which corresponds to the expected size 506- bp of mouse PLP-C alpha 5 '-end cDNA fragment was produced from the ACP-based PCR for PLP-C alpha 5 '-RACE.

PROTOCOL D: Amplification of 5' enriched cDNA fragments using ACP system The first-strand cDNAs are synthesized using Random dN₆-ACP in Protocol A.

The PCR amplification was performed by hot start PCR method in which the procedure is to set up the complete reactions without the DNA polymerase and incubate the tubes in the thermal cycler to complete the initial denaturation step at >90 °C. Then, while holding the tubes at a temperature above 70 °C, the appropriate amount of DNA polymerase can be pipetted into the reaction.

1. Combine the following reagents in a sterile 0.2 ml microcentrifuge tube:

1 μl First-strand cDNA prepared by Random dN₆-ACP in Protocol A 5 μl 10 x PCR buffer (Promega)

5 μl 25 mM MgCl₂ 5 μl 2 mM dNTP l μl 10 μM JYC2 (3 ' primer) l μl 10 μM JYC4 (5' primer)

31.5 μl Sterile dH₂0

49.5 μl Total volume

2. Mix contents and spin the tube briefly in a microcentrifuge.

3. Place the tube in the preheated thermal cycler at 94 °C.

4. Add the 0.5 μl of Taq polymerase (5units/μl; Promega) into the reaction, while holding the tube at the temperature 94 °C. 5. Conduct PCR reaction under the following conditions: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 40 seconds, 68 °C. for 40 seconds, and 72 °C. for 1 min 30 sec; followed by a 5 min final extension at 72 °C.

6. Analyze the amplified products by electrophoresis in a 2% agarose gel followed by ethidium bromide staining.

PROTOCOL E: Amplification of full-length enriched cDNAs using ACP system

The first-strand cDNAs are synthesized using Oligo VdT₁₅-ACP in Protocol A. The PCR amplification was performed by hot start PCR method as in Protocol D.

1. Combine the following reagents in a sterile 0.2 ml microcentrifuge tube:

1 μl First-strand cDNA prepared by Oligo VdT₁₅-ACP in Protocol A

5 μl 10 x PCR buffer (Promega)

5 μl 25 mM MgCl₂

5 μl 2 mM dNTP 1 μl 10 μM JYC2 (3 ' primer)

1 μl 10 μM JYC4 (5 ' primer)

31.5 μl Sterile dH₂0

49.5 μl Total volume 2. Mix contents and spin the tube briefly in a microcentrifuge. 3. Place the tube in the preheated thermal cycler at 94 °C.

4. Add the 0.5 μl of Taq polymerase (5units/μl; Promega, Madison, USA) into the reaction, while holding the tube at the temperature 94 °C.

5. Conduct PCR reaction under the following conditions: 5 min at 94 °C. followed by 30 cycles of 94 °C. for 40 seconds, 68 °C. for 40 seconds, and 72 °C. for 1 min 30 sec; followed by a 5 min final extension at 72 °C.

To evaluate the efficiency of the method using ACP in the amplification of full- length cDNAs, the full-length cDNAs amplified by either the above procedures of ACP method or the current CapFinder method were blotted to a Hybond-N membrane

(Amersham/United States Biochemical). The mouse glyceraldehydes-3 -phosphate dehydrogenase (GAPDH) cDNA was labeled with [alpha-³²P]dCTP using a random labeling kit (Roche Diagnostics Co, Indianapolis, USA) and used as a probe. As shown in FIG. 17, the GAPDH cDNA probe detected a single band which corresponds to the expected size 1.3-kb of full-length GAPDH cDNA. As expected, several fold stronger signal was detected in the PCR products generated by the above ACP method

(lane 2) than by the CapFinder method (lane 1). This example illustrates that the ACP method of the present invention much more effectively amplifies full-length cDNAs than the CapFinder method does.

TABLE 1

Seq.

No. ID Designation Sequence information

1 ACPI 5'-GTCTACCAGGCATTCGCTTCATiπiICAGGAGTGG-3'

2 ACP2 5'-GTCTACCAGGCATTCGCTTCATHπiGGCGACGATS-3'

3 ACP3 5'-GTCTACCAGGCATTCGCTTCATimiGCCATCGACS-3'

4 ACP4 5'-GTCTACCAGGCATTCGCTTCATiπiIAGATGCCCGW-3' 5 ACP5 5'-GTCTACCAGGCATTCGCTTCATimiAGGCGATGCS-3' ACP6 5 '-GTCTACCAGGCATTCGCTTCATπrflTCTCCCGGTS-3 '

ACP7 5'-GTCTACCAGGCATTCGCTTCATΠIIITTGTGGCGGS-3'

ACP8 5'-GTCTACCAGGCATTCGCTTCATIIΠICTCCGATGCS-3'

ACP9 5 '-GTCTACCAGGCATTCGCTTCATΠIΠCCTGCGGGTW-3 '

JYC2 5'- GCTTGACTACGATACTGTGCGA -3'

JYC3 5'- TCACAGAAGTATGCCAAGCGA -3'

JYC4 5'- GTCTACCAGGCATTCGCTTCAT -3'

ACPIO 5'-GTCTACCAGGCATTCGCTTCATIIIIIGCCATCGACC-3'

ACP 11 5 '-GTCTACCAGGCATTCGCTTCATΠIΠGCCATCGACG-3 '

ACP12 5'-GTCTACCAGGCATTCGCTTCATIΠIIAGGCGATGCC-3'

ACP13 5 '-GTCTACCAGGCATTCGCTTCATIIΠIAGGCGATGCG-3 '

ACP14 5'~GTCTACCAGGCATTCGCTTCATIΠIICTCCGATGCC-3'

ACP 15 5 '-GTCTACCAGGCATTCGCTTCATIIΠICTCCGATGCG-3 '

CRP2I0 5 ' -GTCTACCAGGCATTCGCTTCATGCCATCGACC-3 '

ACP16 5'-GTCTACCAGGCATTCGCTTCATΠGCCATCGACC-3'

ACP17 5 '-GTCTACCAGGCATTCGCTTCATΠΠGCCATCGACC-3 '

ACP 18

ACP19 dT-JYC3 5'-CACAGAAGTATGCCAAGCGACTCGAGTTTTTTTTTT

TTTTT-3' dT-JYC2 5'-GCTTGACTACGATACTGTGCGATTTTTTTTTTTTTTT-3'

JYC2-T13C 5 ' - CTTGACTACGATACTGTGCGATTTTTTTTTTTTTC-3 '

JYC2-T13G 5 ' -GCTTGACTACGAT ACTGTGCGATTTTTTTTTTTTTG-3 '

JYC2-T13A 5 ' -GCTTGACTACGATACTGTGCGATTTTTTTTTTTTTA-3 ' dT_I0-JYC2 5 ' -GCTTGACTACGATACTGTGCGATTTTTTTTTT-3 ' dTio-ACPl 5 ' -GCTTGACTACGATACTGTGCGAmπTTTTTTTTTT-3 '

DEG 2 GCCATCGACCCGTTTCTCTAGCCCCATCTTCATGTGT TTTAATGAGATGATATTAATTCATTACATTCATGGAT AATATGTCCCTGAGTACATTCTAATCTAGATTTAACT TCAAAAAAAAAAAAAAAAA

DEG 5 AGGCGATGCGGGCTGTACTCTGGGTGGCTGCCACAGT CTCATGAGAAACCAAGGGCAAAGGACCAAGGAAAAG GGTCTCAGGCCCCTAAAGCAGTGGCTTTCAACCATCCT AATGTTGTGACCTTTTAATACAGTTCCTCATGTTGTG TGACCCCCCAACCATAAAATGATTTTTGTTTCTACTTC AAAAAAAAAAAAAAAAAAAAAA SMART IV 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACG

GCCr(GGG)-3' 5 5 '' PPCCRR PPrriimmer 5 '-AAGCAGTGGTATCAACGCAGAGT-3 '

CDS III/3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-(dT)₃₀

VN-3' rG3-ACP 5 ' -GTCT ACC AGGCATTCGCTTC ATIIIIIGGr(GGG)-3 ' rG2-ACP 5 '-GTCTACCAGGCATTCGCTTCATIIIIIGGr(GG)d(G)-3 ' dG3-ACP 5 '-GTCTACCAGGCATTCGCTTCATIIIIIGGd(GGG)-3 ' O Olliiggoo ddTTιn₈--AACP 5'-GCTTGACTACGATACTGTGCGAIfflITTTTTTTTT

PLP-Cα 5 '-GAGAGGATAGTTTCAGGGAC-3 '

JunB3 5'-CTCCGTGGTACGCCTGCTTTCTC-3' β -actin 1 5 '-TCGTCACCCACATAGGAGTC-3 ' β -actin 2 5'-CTAAGAGGAGGATGGTCGC-3'

EsxN7 5 '-GCCGGTTGCAGAGCACC-3 '

EsxC6 5'-GAACCATGTTTCTGAATGCC-3'

EsxN7-ACP 5'-GTCTACCAGGCATTCGCTTCATΠIΠGCCGGT TGCAGAGCACC-3'

EsxC6-ACP 5'-GCTTGACTACGATACTGTGCGAIiπiGAACCAT

GTTTCTGAATGCC-3'

EsxNl 5 '-GAATCTGAAACAACTTTCTA-3 '

EsxC2 5'-GATGCATGGGACGAGGCACC-3'

EsxNl-ACP 5'-GTCTACCAGGCATTCGCTTCATIΠΠGAATCT

GAAACAACTTTCTA-3 '

EsxN3 5 '-CGCCGCACCCCTGCCCGCA-3 '

EsxC5 5'-GATGCATGGGACGAGGCA-3' 53 EsxN3-ACP 5'-GTCTACCAGGCATTCGCTTCATimiCGCCGC ACCCCTGCCCGCA-3 '

54 Oligo-dT is

55 EsxC2-ACP 5 ' -GCTTGACT ACGATACTGTGCGAIIIIIGATGC A

TGGGACGAGGCACC-3 '

56 EsxC5-ACP 5'- CTTGACTACGATACTGTGCGAIIIIIGATGCA TGGGACGAGGCA-3' 57 01igoVdT₁₅-ACP 5'- GCTTGACT ACGATACTGTGCGAIIIIITTTTTT

TTTTTTTTTV -3' 58 dN₆-ACP 5' -GCTTGACT ACGATACTGTGCGAIiπiNNNNNN-3'

59 rGl-ACP 5'-GTCTACCAGGCATTCGCTTCATiπiIGGr(G)d(GG)-3'

60 JYC5 5'-CTGTGAATGCTGCGACTACGAT-3'

61 JYC5-T₁₅-ACP 5'-CTGTGAATGCTGCGACTACGATππiTTTTTT

62 JYC5-T₁₅V-ACP 5'-CTGTGAATGCTGCGACTACGATIIIIITTTTTTT

TTTTTTTTV-3' 63 JYC5-T_I5VN-ACP 5'-CTGTGAATGCTGCGACTACGATmiITTTTTT

TTTTTTTTTVN-3'

S = G or C

W = A or T

V = A, G₅ or C

N = A, G, C, or T

I is deoxyinosine r is ribose d is deoxyribose

TABLE 2

Differentially expressed cDNA fragments cloned by the ACP system of the present invention Nomenclature Identity Homology

DEG l Tropomyosin 2 (beta) Mouse 92%

DEG 2 Novel Novel

DEG 3 Hypothetical protein (Tes gene) Mouse 99%

DEG 4 Protease-6 Mouse 92%

DEG 5 Novel Novel

DEG 6 Cytochrome c oxidase, subunit Vb Mouse 99%

DEG 7 Hydroxylacyl-Coenzyme A dehydrogense (Hadh) Mouse 98%

DEG 8 Troponin T2, cardiac (Tnnt2) Mouse 94%

DEG 9 RNA binding motif protein, X chromosome Mouse 96%

DEG 10 Peroxiredoxin 6 (Prdx6) Mouse 89%

DEG 11 11 days or 13 days embryo cDNA Mouse 98%

References

Bauer, D., Muller, H., Reich, J., Ahrenkiel, V., Warthoe, P., Strauss, M. (1993) Identification of differentially expressed mRNA species by an improved display technique (DDRT-PCR). Nucleic Acids Res. 21, 4272-4280.

Bauer, D., Warthoe, P., Rohde, M., Struss, M. (1994) PCR Methods & App: Manual Supplement., pp. S97-S108. Cold Spring Harbor Laboratory, Cold Spring Harbor,

NY.

Carninci, P., Westover, A., Nishiyama, Y., Ohsumi, T., Itoh, M., Nagaoka, S., Sasaki, N, Okazaki, Y., Muramatsu, M., Hayashizaki, Y. (1997) High efficiency selection of full-length cDNA by improved biotinylated cap trapper. DNA Res. 4, 61-66. Chenchik, A., Zhu, Y., Diatchenko, L., Li, R, Hill, J., Siebert, P. (1998)

Generation and use of high-quality cDNA from small amounts of total RNA by Smart™ PCR. In Siebert, P. and Larrick, J. (eds), Gene Cloning and analysis by RT-PCR. Biotechniques Books, Natick, MA, pp. 305-319.

Chenchik, A., Zhu, Y., Diatchenko, L., Siebert, P. Methods and compositions for generating full-length cDNA having arbitrary nucleotide sequence at the 3'-end. U.S. Pat. No. 5,962,271. Date of Patent: Oct. 5, 1999.

Chenchik, A., Zhu, Y., Diatchenko, L., Siebert, P. Methods and compositions for full-length cDNA cloning using a template-switching oligonucleotide. U.S. Pat. No. 5,962,272. Date of Patent: Oct. 5, 1999.

Chun, J.Y., Han, Y.J., Ahn, K.Y. (1999) Psx homeobox gene is X-linked and specifically expressed in trophoblast cells o mouse placenta. Dev. Dyn. 216, 257-266

Clark, J.M. (1988) Novel non-templated nucleotide addition reactions catalyzed by prokaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677-9686. Combates, N., Pardinas, J.R, Parimoo, S., Prouty, S.M., Stenn, K.S. Technique for differential display. U.S. Pat. No. 6,045,998. Date of Patent: Apr. 4, 2000.

D'Aquila, R.T., Bechtel, L.J., Videler, J.A., Eron, J.J., Gorczyca, P., Kaplan, J.C. (1991) Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res., 19, 3749. Diachenko, L.B., Ledesma, J., Chenchik, A.A., Siebert, P.D. (1996) Combining the technique of RNA fingeφrinting and differential display to obtain differentially expressed mRNA. Biochem. Biophys. Res. Commun. 219, 824-828.

Dieffenbach, C.W., Lowe, T.M.J, Dveksler, G.S. (1995) General concepts for PCR primer design. PCR primer: a Laboratory Manual., pp. 133-142, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. NY.

Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K., Mattick, J.S. (1991) 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res., 19, 4008.

Franz, O., Bruchhaus, I., Roeder, T. (1999) Verification of differential gene transcription using virtual northern blotting. Nucleic Acids Res., 27, 1-3.

Frohman, M.A., Dush, M.K., Martin, G.R. (1988) Rapid production of full- length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002.

Fromont-Racine, M., Bertrand, E., Pictet, R, Grange, T. (1993) A highly sensitive method for mapping the 5' termini of mRNAs. Nucleic Acids Res., 21, 1683-1684.

Gottschlich, S., Goeoegh, t, Folz, B.J., Lippert, B.M., Werner, J.A. (1997) Optimized differential display and reamplification parameters for silver staining. Res. Commun. Mol. Path. Pharm. 97, 237-240.

Gromova, I., Gromov, P., Celis, J.E. (1999) Identification of true differentially expressed mRNAs in a pair of human bladder transitional cell carcinomas sing an improved differential display procedure. Electrophoresis 20, 241-248.

Guegler, K., Tan, R., Rose, M.J. Methods and compositions for producing 5' enriched cDNA libraries. U.S. Pat. No. 6,083,727. Date of Patent: Jul. 4, 2000.

Guegler, K., Tan, R., Rose, M.J. Methods and compositions for producing full length cDNA libraries. U.S. Pat. No. 6,326,175. Date of Patent: Dec. 4, 2001. Hogan, B., Bedding, R., Costantini, F., Lacy, E. (1994) Manipulating the moue embryo: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Hwang, I.T., Lee, Y.H., Moon, B.C., Ahn, K.Y., Lee, S.W., Chun, J.Y. (2000) Identification and characterization of a new member ofthe placental prolactin-like protein-C (PLP-C) subfamily, PLP-Cβ. Endocrinology 141, 3343-3352.

Hayashizaki, Y. Method for forming full length cDNA libraries. U.S. Pat. No. 6,143,528. Date of Patent: Nov. 7, 2000.

Ito, T., Kito, K., Adati, N., Mitsui, Y., Hagiwara, H., Sakaki, Y. (1994) Fluorescent differential display: arbitrarily primed RT-PCR fingeφrinting on an automated DNA sequencer. FEBSLett. 351, 231-236.

Jefferies, D., Botman, M. F., Lester, D, Whitehead, C. C, Thoφ, B. H. (1998) Cloning differentially regulate genes from chondrocytes using agarose gel differential display. Biochim. Biophys. Acta 1396, 237-241.

Kociok, N., Unfried, K., Eser, P., Krott, R, Schraermeyer, TJ., Heimarm, K. (1998) The nonradioisotopic representation of differentially expressed mRNA by a combination of

RNA fingeφrinting and differential display. Mol. Biotechnol. 9, 25-33.

Korn, B., Sedlacek, Z., Manca, A., Kioschis, P., Konecki, D., Lehrach, H.,

Poutska, A. (1992) A strategy for the selection of transcribed sequences in the Xq28 region.

Hum. Mol. Genet. 1, 235-242. Kulpa, D., Topping, R, Telesnitskt, A. (1997) Determination of the site of first strand transfer during Moloney murine leukemia virus reverse transcription and identification of strand transfer-associated reverse transcriptase errors. EMBO J. 16, 856- 865.

Liang, P., Pardee, A.B. (1992) Differential display of eukaryotic messenger RNA by means ofthe polymerase chain reaction. Science 257, 967-971. Ledbetter, S.A., Nelson, D.L., Warren, S.T., Ledbetter, D.H. (1990) Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction. Genomics 6,475-481.

Loakes, D., Brown, D.M. (1994) 5-Nitroindole as an universal base analog. Nucleic Acids Res. 22, 4039-4043. Luehrsen, K.R., Marr, L.L., Van Der Knaap, E., Cumberledge, S. (1997) Analysis of differential display RT-PCR products using fluorescent primers and genescan software. BioTechniques 22, 168-174.

Matz, M.V., Lukyanov, S.A. (1998) Different strategies of differential display: areas of application. Nucleic Acids Res. 26, 5537-5543. Matz, M., Shagin, D., Bogdanova, E., Britanova, O., Lukyanov, S., Diatchenko,

L., Chenchik., A. (1999) Amplification of cDNA ends based on templateswitching effect and step-out PCR. Nucleic Acids Res. 27, 1558-1560.

McClelland, M., Chada, K., Welsh, J., Ralph, D. (1993). Arbitrary primed PCR fingeφrinting of RNA applied to mapping differentially expressed genes. In Symposium on DNA fingerprinting: State ofthe science, November, 1992 (ed. S.D. Pena et al.). Birkhauser

Verlag, Basel, Switzerland.

McPherson, M.J., Moller, S.G. (2000) PCR. BIOS Scientific Publishers, Springer- Verlag New York Berlin Heidelberg, NY.

Meunier, J.R., Grimont, PA.D. (1993) Factors affecting reproducibility of amplified polymoφhic DNA fmgeφrints. Res. Microbiol. 144, 373-379.

Mullis, K.B., Faloona, F.A. (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350.

Mullis, K.B., Erlich, H.A, Arnheim, N., Horn, G.T., Saiki, R.K., Scharf, S.J. Process for amplifying, detecting, and or cloning nucleic acid sequences. U.S. Pat. No. 4,683,195. Date of Patent: Jul. 28, 1987.

Mullis, K.B. Process for amplifying nucleic acid sequences. U.S. Pat. No. 4,683,202. Date of Patent: Jul. 28, 1987.

Mullis, K.B., Erlich, H.A, Amheim, N., Horn, G.T., Saiki, R.K., Scharf, S.J. Process for amplifying, detecting, and/or cloning nucleic acid sequences. U.S. Pat. No. 4,800,159. Date of Patent: Jan. 24, 1989. Nichols, R, Andrews, P.C., Ahang, P., Bergstrom, D.E. (1994) A universal nucleoside for use at ambiguous sites in DNA primers. Nature 369, 492-493.

Ohtsuka, E., Matsuka, S., Ikehara M., Takahashi, Y., Matsubara K. (1985) An alternative approach to deoxyohgonucleotides as hybridization probes by insertion of deoxyinosine at ambiguous codon positions. J. Biol. Chem. 260, 2605-2608. Ralph, D., Welsh, J., McClelland, M. (1993) RNA fmgeφrinting using arbitrary primed PCR identifies differentially regulated RNAs in Mink lung (MvlLu) cells growth arrested by TGF-β. Proc. Natl. Acad. Sci. 90, 10710-10714.

Rompf, R, Kahl, G. (1997) mRNA differential display in agarose gels. BioTechniques 23, 28-32. Rosok, O., Odeberg, J., Rode, M., Stokke, T., Funderud, S., Smeland, E. (1996) solid-phase method for differentially display of genes expressed in hematopoietic stem cells. BioTechniques 21, 114-121.

Ruano, G., Fenton,W., Kidd, K.K. (1989) Biphasic amplification of very dilute DNA samples via "booster PCR". Nucleic Acids Res. 17, 5407. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A.,

Amheim, N. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354.

Sakanari, J.A., Staunton, C.E., Eakin, A.E., Craik, C.S. (1989) Serine proteases from nematode and protozoan parasites: Isolation of sequence homologs using generic molecular probes. Proc. Natl. Acad. Sci. 86, 4863-4867.

Schaefer, B.C. (1995) Revolutions in rapid amplification of cDNA ends: New strategies for polymerase chain reaction cloning of full-length cDNA ends. Anal. Biochem. 227, 255-273.

Schmidt W.M., Mueller, M.W. (1999) CapSelect: A highly sensitive method for 5' CAP-dependent rerichment of full-length cDNA in PCR-mediated analysis of mRNAs.

Nucleic Acids Res. 27, e31. Schramm, G., Bruchhaus, I., Roeder, T. (2000) A simple and reliable 5 '-RACE approach. Nucleic Acids Res. 28, e96.

Smith, N.R., Aldersley, M., Li, A., High, A.S., Moynihan, T.P., Markham, A.F., Robinson. P. A. (1997) Automated differential display using a fluorescently labeled universal primer. BioTechniques 23, 274-279.

Sompayrac, L., Jane, S., Burn, T.C., Tene, D.G., Danna, K.J. (1995) Overcoming limitations o the mRNA differential display technique. Nucleic Acids Res. 23, 4738-4739.

Stone, B., Wharton, W. (1994) Targeted RNA fingeφrinting: the cloning of differentially-expressed cDNA fragments enriched for members of the zinc finger gene family. Nucleic Acids Res. 22, 2612-2618.

Suzuki, Y., Yoshitomo-Nakagawa, K., Maruyama, K., Suyama, A., Sugano, S. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene 200, 149-156.

Tagle, D.A., Swaroop, M., Lovett, M., Collins, F.S. (1993) Magnetic bead capture of expressed sequences encoded within large genomic segments. Nature 361. 751-753.

Villeponteau, B., Feng, J., Funk, W., Linskens, M.H.K. Method and kit for enhanced differential display. U.S. Pat. No. 5,580,726. Date of Patent: Dec. 3, 1996.

Welsh, J., McClelland, M. (1990) Fingeφrinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18, 7213-7218. Welsh, J., McClelland, M. (1991) Genomic fingeφrinting using arbitrarily primed

PCR and a matrix of pairwise combinations of primers. Nucleic Acids Res. 19, 5275-5279.

Williams, J.G.K., Kubelik, A.R, Livak, K.J., Rafalki, J.A., Tingey, S.V. (1990) DNA polymoφhisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531-6535.

Industrial Applicability

(a) primer annealing specificity is improved by the effect ofthe deoxyinosine residue group on the annealing of 3'- and 5 '-end portions of ACP in accordance with the alteration of annealing temperature, which requires two stage PCR amplifications. (b) amplification of non-specific PCR products is interrupted by two-stage PCR amplifications which are performed at low and high stringent conditions.

(c) mispriming which is a major cause of false product amplification during PCR can be significantly minimized.

(d) the efficiency of PCR amplification is increased, which makes it easier to detect rare mRNAs.

(e) the reproducibility of PCR products is increased, which saves a great amount of time and cost.

(f) agarose gel electrophoresis followed by ethidium bromide staining can be used for detecting differentially displayed RT-PCR products. (g) the background problems arising from contamination of the primer(s) used for cDNA synthesis for 5'- or 3 '-RACE (rapid amplification of cDNA ends) can be eliminated.

Claims

1. An annealing control primer capable of improving primer annealing specificity in associated with the alteration of primer annealing temperature, which comprises a 3 '-end portion and a 5 '-end portion separated by at least two deoxyinosine residues, universal bases or non-discriminatory base analogs, wherein the presence of deoxyinosine group positioned between the 3'- and 5'- end portions plays as a switch in controlling primer annealing to a template nucleic acid in associated with annealing temperature during polymerase chain reaction (PCR), such that the presence of deoxyinosine group positioned between said 3'- and 5'- end portions interrupts the annealing of said 5 '-end portion as well as limits primer annealing to said 3'- end portion at a first annealing temperature, and also, said 5'-end portion comprises a universal primer sequence and serves as a universal priming site for subsequent amplification of reaction product generated from the annealing and extension of said 3 '-end portion sequence to the template nucleic acid with the annealing of said 3 '-end portion bothered or interrupted at a second annealing temperature.

2. The annealing control primer of claim 1, wherein said first annealing temperature of said annealing control primer should be lower than said second annealing temperature.

3. The annealing control primer of claim 1, wherein said first annealing temperature of said annealing control primer is between about 37°C and 65°C.

4. The annealing control primer of claim 1, wherein said second annealing temperature of said annealing control primer is between about 50°C and 72°C.

5. The annealing control primer of claim 1, wherein said template nucleic acid of said annealing control primer is mRNA or cDNA derived from mRNA.

6. The annealing control primer of claim 1, wherein said template nucleic acid of said annealing control primer is single or double stranded DNA.

7. The annealmg control primer of claim 1, wherein said annealing control primer has a general formula of 5'-dN_x-dI_y-dN_z-3', wherein dN_x represents the 5 '-end portion and contains a pre-selected arbitrary nucleotide sequence; dN_z represents the 3 '-end portion; dl_y represents a deoxyinosine group having at least two deoxyinosine residues; dN represents a deoxyribonucleotide; x, y, and z each independently represent an integer, wherein x is the number of nucleotides in the 5 '-end portion, y is the number of deoxyinosine residues separating the 5'-end portion and 3 '-end portion and z is the number of nucleotides in the 3 '-end portion.

8. The annealing control primer of claim 7, wherein y is at least 3.

9. The annealing control primer of claim 7, wherein x represents an integer of 15 to 60.

10. The annealing control primer of claim 7, wherein y represents an integer of 2 to 15.

11. The annealing control primer of claim 7, wherein z represents an integer of 6 to 30.

12. The annealing control primer of claim 7, wherein x is an integer of 15 to 60, y is an integer of 2 to 15 and z is an integer of 6 to 30.

13. The annealing control primer of claim 7, wherein said deoxyribonucleotides are selected from the group consisting of dAMP, dTMP, dCMP, dGMP, modified nucleotides and non-natural nuclotides.

14. The annealing control primer of claim 7, wherein dN_x includes a sequence that is recognized by a restriction endonuclease.

15. The annealing control primer of claim 7, wherein dN_x comprises at least one nucleotide with a hapten group.

16. The annealing control primer of claim 7, wherein dN_z is substantially complementary to a target sequence in the template nucleic acid.

17. The annealing control primer of claim 7, wherein dN_z is a deoxythymidine nucleotide sequence.

18. The annealing control primer of claim 7, wherein dN₂ comprises at least 10 contiguous deoxythymidine nucleotides having 3'-NV, wherein V is one of deoxyadenosine, deoxycytidine, or deoxyguanosine, and N is one of deoxyadenosine, deoxythymidine, deoxycytidine, or deoxyguanosine.

19. The annealing control primer of claim 7, wherein dN_z comprises at least 10 contiguous deoxythymidine nucleotides having 3'-V, wherein V is one of deoxyadenosine, deoxycytidine or deoxyguanosine.

20. The annealing control primer of claim 7, wherein dN_z is a random nucleotide sequence.

21. The annealing control primer of claim 7, wherein dN_z is a sequence substantially complementary to a consensus sequence found in a gene family.

22. The annealing control primer of claim 7, wherein dN_z is a degenerate sequence comprising a plurality of combinations of nucleotides encoding a predetermined amino acid sequence.

23. The annealing control primer of claim 7, wherein dN_z comprises at least one ribonucleotide.

24. The annealing control primer of claim 1, wherein said annealing control primer has a general formula of 5'-dN_x-dI_y-dN_z-3', wherein dN_x represents the 5 '-end portion and contains a pre-selected arbitrary nucleotide sequence; dN_z represents the 3 '-end portion; dl represents at least two universal bases or non-discriminatory base analogs; dN represents a deoxyribonucleotide; x, y, and z each independently represent an integer, wherein x is the number of nucleotides in the 5 '-end portion, y is the number of deoxyinosine residues separating the 5 '-end portion and 3 '-end portion and z is the number of nucleotides in the 3 '-end portion.

25. The annealing control primer of claim 24, wherein said dl is a non- discriminatory base analogue.

26. The annealing control primer of claim 24, wherein said dl is a universal base.

27. The annealing control primer of claim 24, wherein said dl is l-(2'-deoxy- beta-D-ribofuranosyl)-3-nitropyrrole.

28. The annealing control primer of claim 24, wherein said dl is 5-Nitroindole.

29. A kit comprising said universal primers of claim 1.

30. A kit comprising at least one annealing control primer comprising a 3 '-end portion and a 5 '-end portion separated by at least two deoxyinosine residues, universal bases or non-discriminatory base analogs, wherein the presence of deoxyinosine group positioned between the 3'- and 5'- end portions plays as a switch in controlling primer annealing to a template nucleic acid in associated with annealing temperature during polymerase chain reaction (PCR), such that the presence of deoxyinosine group positioned between said 3'- and 5'- end portions interrupts the annealing of said 5 '-end portion as well as limits primer annealing to said 3'- end portion at a first annealing temperature, and also, said 5 '-end portion comprises a universal primer sequence and serves as a universal priming site for subsequent amplification of reaction product generated from annealing and extension of said 3 '-end portion sequence to the template nucleic acid with the annealing of said 3 '-end portion bothered or interrupted at a second annealing temperature.

31. The kit of claim 30 comprising at least one annealing control primer comprising a 3 '-end portion and a 5 '-end portion separated by at least five deoxyinosine residues, universal bases or non-discriminatory base analogs, wherein the presence of deoxyinosine group positioned between the 3'- and 5'- end portions plays as a switch in controlling primer annealing to a template nucleic acid in associated with annealing temperature during polymerase chain reaction (PCR), such that the presence of deoxyinosine group positioned between said 3'- and 5'- end portions interrupts the annealing of said 5'-end portion as well as limits primer annealing to said 3'- end portion at a first annealing temperature, and also, said 5 '-end portion comprises a universal primer sequence and serves as a universal priming site for subsequent amplification of reaction product generated from annealing and extension of said 3 '-end portion sequence to the template nucleic acid with the annealing of said 3 '-end portion bothered or interrupted at a second annealing temperature.

32. A method for selectively amplifying a target nucleic acid sequence from a nucleic acid molecule or mixture of nucleic acids using annealing control primers, said method comprising carrying out a two-stage polymerase chain reaction (PCR) comprising:

(a) amplifying the target nucleic acid sequence in a first-stage PCR comprising at least two cycles of primer annealing, primer extending and denaturing, by annealing a pair of annealing control primers of claim 1 to the target nucleic acid sequence at a first annealing temperature under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein the annealing control primers comprise each a 3 '-end portion and a 5 '-end portion separated by at least two deoxyinosine residues, universal bases or non-discriminatory base analogs, and wherein the 3 -end portion of each annealing control primer comprises a hybridizing sequence sufficiently complementary to a region of said target nucleic acid sequence to hybridize therewith and anneals to a site on said target nucleic acid at a first annealing temperature and wherein the 5 '-end portion comprises a universal primer sequence and serves as a universal priming site at a second annealing temperature; extending the primers to obtain first amplification product; denaturing the first amplification product to obtain denatured amplification product; and

(b) re-amplifying the denatured amplification product at the second annealing temperature, which is high stringent conditions, in a second-stage PCR comprising at least one cycle of annealing, primer extending and denaturing, by annealing universal primers corresponding to the 5 '-end portion sequences ofthe annealing control primers to the 5 '-end sequences ofthe denatured amplification product generated by the annealing control primers from the step (a) and extending the primers to generate second amplification product.

33. The method according to claim 32, wherein said target nucleic acid is DNA.

34. The method according to claim 32, wherein said target nucleic acid is RNA.

35. The method according to claim 32, wherein said first-stage PCR is repeated at least 2 times.

36. The method according to claim 32, wherein said second-stage PCR is repeated at least 10 times.

37. The method according to claim 32, wherein said first annealing temperature is at least 40 °C.

38. The method according to claim 32, wherein said second annealing temperature is at least 50 °C.

39. The method according to claim 32, wherein said second annealing temperature should be higher than said first annealing temperature.

40. A method for detecting DNA complementary to differentially expressed mRNA in two or more nucleic acid samples using annealing control primers, comprising the steps of:

(b) separately contacting each of said first nucleic acid sample and said second nucleic acid sample with a first annealing control primer, wherein said first annealing control primer has a hybridizing sequence substantially complementary to the differentially expressed mRNA to hybridize therewith;

(c) reverse transcribing said differentially expressed mRNA to which said first annealing control primer hybridizes to produce a first population of DNA strands that are complementary to said differentially expressed mRNA in said first nucleic acid sample to which said first annealing control primer hybridizes, and a second population of DNA strands that are complementary to said differentially expressed mRNA in said second nucleic acid sample to which said first annealing control primer hybridizes;

(d) purifying and quantifying each of said first and second populations of complementary DNA strands; (e) contacting each of said first and second populations of DNA strands with a second annealing control primer at a first annealing temperature, wherein said second annealing control primer has a hybridizing sequence sufficiently complementary to said first and second populations of DNA strands;

(f) extending said second annealing control primer using DNA polymerase to produce a second DNA strand complementary to said first and second populations of DNA strands;

(g) amplifying each second DNA strand obtained from step (f) at a second annealing temperature, by at least one PCR cycle comprising denaturing, annealing and primer extension to obtain said first and second populations of amplification products using two universal primers each comprising a sequence corresponding to each 5 '-end portion of said first and second annealing control primers; and

(h) comparing the presence or level of individual amplification products in said first and second populations of amplification products.

41. The method according to claim 40, wherein said first nucleic acid sample comprises mRNA expressed in a first cell and said second nucleic acid sample comprises mRNA expressed in a second cell.

42. The method according to claim 40, wherein said first nucleic acid sample comprises mRNA expressed in a cell at a first developmental stage and said second nucleic acid sample comprises mRNA expressed in said cell at second developmental stage.

43. The method according to claim 40, wherein said first nucleic acid sample comprises mRNA expressed in a tumorigenic cell and said second nucleic acid sample comprises mRNA expressed in a normal cell.

44. The method according to claim 40, wherein said first annealing temperature should be lower than said second annealing temperature.

45. The method according to claim 40, wherein said first annealing control primer has a general formula of 5'-dNi5-₃o-dI₂-ιo-dTιo-2o-3', wherein dN represents a deoxyribonucleotide and contains a pre-selected arbitrary nucleotide sequence; dl represents a deoxyinosine, universal base or non-discriminatory base analog; dT represents a deoxythymidine.

46: The first annealing control primer of claim 45, wherein said dl is l-(2'- deoxy-beta-D-ribofuranosyl)-3-nitropyrrole.

47. The first annealing control primer of claim 45, wherein said dl is 5- Nitroindole.

48. The first annealing control primer of claim 45, wherein dT further comprises 3 '-V, wherein V is one of deoxyadenosine, deoxycytidine or deoxyguanosine.

49. The first annealing control primer of claim 45, wherein dT further comprises 3'-NV, wherein V is one of deoxyadenosine, deoxycytidine, or deoxyguanosine, and N is one of deoxyadenosine, deoxythymidine, deoxycytidine, or deoxyguanosine.

50. The method according to claim 40, wherein said first annealing control primer is selected from the group consisting of SEQ ID Nos. 30, 39, 57 and 61-63.

51. The method according to claim 40, wherein said second annealing control primer has the general formula of 5'-dNi₅-₃o-dI₂-ιo-dN₈-ι₅-3' and said formula follows the same rule of the formula of claim 7, wherein dN represents a deoxyribonucleotide and contains a pre-selected arbitrary nucleotide sequence; dl represents a deoxyinosine, universal base or non-discriminatory base analog.

52. The method according to claim 40, wherein said second annealing control primer is selected from the group consisting of SEQ ID Nos. 1-9, 13-18 and 20-23.

53. The method according to claim 40, wherein the at least one PCR cycling in step (g) is repeated at least 10 times.

54. The method according to claim 40, wherein said first annealing temperature used in step (e) is between about 45 °C and 55 °C.

55. The method according to claim 40, wherein said second annealing temperature used in step (g) is between about 55 °C and 72 °C.

56. The method according to claim 40, wherein said universal primers used in step (g) are selected from the group consisting of SEQ ID Nos. 10-12 and 60.

57. The method according to claim 40, wherein the comparing of step (h) comprises resolving each of said first and second populations of amplification products by gel electrophoresis through an ethidium bromide-stained agarose gel and comparing the presence or level of bands of a particular size.

58. The method according to claim 40, wherein the comparing of step (h) comprises resolving each of said first and second populations of amplification products by gel electrophoresis through a denaturing polyacrylamide gel and comparing the presence or level of bands of a particular size.

59. The method according to claim 40, wherein the nucleotide sequence of each of said first and second annealing control primers contains a restriction endonuclease recognition site.

60. The method according to claim 40, wherein the nucleotide sequence of each of said first and second annealing control primers comprises at least one nucleotide with a hapten group.

61. The method of claim 40 further comprising isolating the amplified cDNA product.

62. The method of claim 61 further comprising cloning the isolated cDNA product into a vector.

63. The method according to claim 40, wherein at least one of said first and second annealing control primers contains a plurality of deoxyohgonucleotides.

64. A kit comprising said first and second annealing control primers of claim 40.

65. A method for amplifying a target cDNA fragment comprising 5'-end region corresponding to the 5 '-end of mRNA using annealmg control primers, comprising the steps of:

(a) contacting said mRNA with a conventional Oligo dT primer or random primer as a cDNA synthesis primer under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein said cDNA synthesis primer comprises a hybridizing sequence at 3 '-end portion sufficiently complementary to a region of the mRNAs to hybridize therewith;

(b) reverse transcribing said mRNA to which said cDNA synthesis primer hybridizes to produce first-strand cDNA that is complementary to said mRNA to which said cDNA synthesis primer hybridizes, resulting in forming mRNA-cDNA intermediate;

(c) permitting cytosine residues to be tailed at the 3 '-end of said first strand cDNA by the terminal transferase reaction of reverse transcriptase in the presence of manganese under the form of said mRNA-cDNA intermediate;

(d) contacting a first annealing control primer to the cytosine tail at the 3 '-end of said first cDNA strand in the form of said mRNA-cDNA intermediate, wherein said first annealing control primer comprises at least three guanine residues at its 3 '-end to hybridize the cytosine tail ofthe 3 '-end of said first cDNA strand; (e) extending the tailed 3 '-end of said first strand cDNA to generate an additional sequence complementary to said first annealing control primer using reverse transcriptase, wherein said first annealing control primer is used as a template in the extension reaction.

(f) synthesizing the second-strand cDNA of said extended first-strand cDNA using a universal primer by at least one cycle of PCR comprising denaturing, annealing and primer extension, wherein said universal primer has a sequence complementary to the 5'- end extended sequence ofthe first-strand cDNA;

(g) synthesizing a target cDNA strand using a second annealing control primer at a first annealing temperature by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein said second annealing control primer comprises a gene-specific sequence at the 3 ' -end portion;

(h) amplifying said target cDNA strand using two universal primers at a second annealing temperature, which is high stringent conditions, by at least one PCR cycle comprising denaturing, annealing and primer extension, wherein said universal primers have sequences complementary to both 3'- and 5 '-ends of said target cDNA strand, which comprises the sequences of said first and second annealing control primers at both 3'- and

5'-ends.

66. The method according to claim 65, wherein said first annealing temperature should be lower than said second annealing temperature.

67. The method according to claim 65, wherein said first annealing control primer has a general formula of 5'-dNι₅-₃₀-dI₂-ιo-dNι-ιo-G₃-3', wherein dN represents a deoxyribonucleotide and contains a pre-selected arbitrary deoxynucleotide sequence; dl represents a deoxyinosine, universal base or non-discriminatory base analog; G₃ represents three guanines.

68. The first annealing control primer of claim 67, wherein G₃ is three riboguanines.

69. The first annealing control primer of claim 67, wherein G₃ is three deoxyguanines.

70. The first annealing control primer of claim 67, wherein G₃ is a combination of riboguanine and deoxyguanine.

71. The method according to claim 65, wherein said method further comprises introducing said double-stranded cDNA obtained from the step (h) of claim 65 into vectors.

72. A kit comprising at least one annealing control primer of claim 65.

73. A method for amplifying a population of full-length double-stranded cDNAs complementary to mRNAs using annealing control primers, wherein said cDNAs comprise the complete 5 '-end sequence information of said mRNAs, said method comprising the steps of:

(a) contacting said mRNAs with a first annealing control primer under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein said first annealing control primer comprises a hybridizing sequence at 3 '-end portion sufficiently complementary to the poly A tail of said mRNAs to hybridize;

(b) reverse transcribing said mRNAs to which said first annealing control primer hybridizes to produce first strand cDNA sequences that are complementary to said mRNAs to which said first annealing control primer hybridizes therewith, resulting in forming mRNA-cDNA intermediates; (c) permitting cytosine residues to be tailed at the 3 '-end of said first strand cDNAs by the terminal transferase reaction of reverse transcriptase in the presence of manganese under the form of said mRNA-cDNA intermediates;

(d) contacting a second annealing control primer to the cytosine tails at the 3 '-end of said first cDNA strands in the form of said mRNA-cDNA intermediates, wherein said second annealing control primer comprises at least three guanine residues at its 3 '-end to hybridize the cytosine tails ofthe 3 '-end of said first cDNA strands;

(e) extending the tailed 3 '-ends of said first strand cDNAs to generate additional sequences complementary to said second annealing control primer using reverse transcriptase, wherein said second annealing control primer is used as a template in the extension reaction;

(f) amplifying the extended first strand cDNAs using two universal primers to obtain amplification products of full-length cDNAs complementary to said mRNAs, by at least one cycle of PCR comprising denaturing, annealing and primer extension, wherein said universal primers have sequences complementary to both 3'- and 5 '-ends of said extended first strand cDNAs, which comprises the sequences of said first and second annealing control primers at both 3'- and 5 '-ends.

74. The method according to claim 73, wherein said method further comprises introducing said double-stranded cDNA molecules obtained from the step (f) of claim 73 into vectors.

75. A kit comprising at least one annealing control primer of claim 73.

76. A method for amplifying 5 '-enriched double-stranded cDNA molecules complementary to mRNA molecules using annealing control primers, comprising the steps of: (a) contacting said mRNA molecules with a first annealing control primer under conditions sufficient for template driven enzymatic deoxyribonucleic acid synthesis to occur, wherein said first annealing control primer comprises at least six random nucleotide sequences at 3 '-end portion; (b) performing steps (b)-(f) of claim 73 to amplify 5 '-enriched double-stranded cDNA molecules.

77. The method according to claim 76, wherein said method further comprises introducing said double-stranded cDNA molecules obtained from the step (f) of claim 76 into vectors.

78. A kit comprising at least one annealing control primer of claim 76.