WO2003089467A1 - Fragments of apoptin - Google Patents

Abstract

The invention relates to the protein Apoptin, more in particular the invention relates to fragments of Apoptin and even more particular the invention relates to fragments of Apoptin capable of inducing aberrant-specific apoptosis and/or capable of increasing the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell.

Description

Title: Fragments of Apoptin

The invention relates to the protein Apoptin, more in particular the invention relates to fragments of Apoptin and even more particular the invention relates to fragments of Apoptin capable of inducing aberrant-specific apoptosis and/or capable of increasing the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell.

Apoptosis is an active and programmed physiological process for eliminating superfluous, altered or malignant cells (Earnshaw, 1995, Duke et al., 1996). The terms transformed and tumorigenic and aberrant will be used interchangeably herein. Apoptosis is characterised by shrinkage of cells, segmentation of the nucleus, condensation and cleavage of DNA into domain- sized fragments, in most cells followed by internucleosomal degradation. The apoptotic cells fragment into membrane-enclosed apoptotic bodies. Finally, neighbouring cells and/or macrophages will rapidly phagocytose these dying cells (Wyllie et al., 1980, White, 1996). Cells grown under tissue -culture conditions and cells from tissue material can be analysed for being apoptotic with DNA-staining agents, such as e.g. DAPI, which stains normal DNA strongly and regularly, whereas apoptotic DNA is stained weakly and/or irregularly (Noteborn et al., 1994, Telford et al., 1992).

The apoptotic process can be initiated by a variety of regulatory stimuli (Wyllie, 1995, White 1996, Levine, 1997). Changes in the cell survival rate play an important role in human pathogenesis of diseases, e.g. in cancer development and autoimmune diseases, where enhanced proliferation or decreased cell death (Kerr et al., 1994, Paulovich, 1997) is observed. A variety of chemotherapeutic compounds and radiation have been demonstrated to induce apoptosis in tumor cells, in many instances via wild-type p53 protein (Thompson, 1995, Bellamy et al., 1995, Steller, 1995, McDonell et al., 1995).

Many tumors, however, acquire a mutation in p53 during their development, often correlating with poor response to cancer therapy. Certain _n^---,-.

PCT/NL03/00195

transforming genes of tumorigenic DNA viruses can inactivate p53 by directly binding to it (Teodoro, 1997). An example of such an agent is the large T antigen of the tumor DNA virus SV40. For several (leukemic) tumors, a high expression level of the proto-oncogene Bcl-2 or Bcr-abl is associated with a strong resistance to various apoptosis-inducing chemotherapeutic agents (Hockenberry 1994, Sachs and Lote , 1997).

For such tumors lacking functional p53 (representing more than half of the tumors) alternative anti-tumor therapies are under development based on induction of apoptosis independent of p53 (Thompson 1995, Paulovich et al., 1997). For this, one has to search for the factors involved in induction of apoptosis that do not need p53 and/or cannot be blocked by anti-apoptotic activities, such as Bcl-2 or Bcr-abl-like ones. These factors might be part of a distinct apoptosis pathway or might be (far) downstream of the apoptosis inhibiting compounds. Apoptin (also called VP3, the terms will be used interchangeably herein) is a small protein derived from chicken anemia virus (CAN; Noteborn and De Boer, 1996, Noteborn et al., 1991, Noteborn et al., 1994; 1998a), which induces apoptosis in human malignant and transformed cell lines, but not in untransformed human cell cultures. Apoptin fails to induce apoptosis in normal lymphoid, dermal, epidermal, endothelial and smooth-muscle cells, to name a few. However, when normal cells are transformed they become susceptible to apoptosis by Apoptin. Long-term expression of Apoptin in normal human fibroblasts revealed that Apoptin has no toxic or transforming activity in these cells (Danen-van Oorschot, 1997 and Noteborn, 1996). In normal cells, Apoptin was found predominantly in the cytoplasm, whereas in transformed or malignant cells i.e. characterised by hyperplasia, metaplasia or dysplasia, it was located in the nucleus, suggesting that the localization of Apoptin is related to its activity (Danen-van Oorschot et al. 1997). Apoptin-induced apoptosis occurs in the absence of functional p53 (Zhuang et al., 1995a), and cannot be blocked by Bcl-2, Bcr-abl (Zhuang et al., 1995), or the Bcl-2-associating protein BAG-1 (Danen-Van Oorschot, 1997a, Noteborn, 1996). Therefore, Apoptin is a therapeutic compound for the selective destruction of tumor cells, or other hyperplasia, metaplasia or dysplasia, especially for those tumor cells that have become resistant to (chemo)- therapeutic induction of apoptosis, due to the lack of functional p53 and (over)- expression of Bcl-2 and other apoptosis-inhibiting lesions (Noteborn and Pietersen, 1998). It appears that even pre -malignant, minimally transformed cells are sensitive to the death-inducing effect of Apoptin. In addition, Noteborn and Zhang (1998) have shown that Apoptin-induced apoptosis is suitable for the diagnosis of cancer-prone cells and treatment of cancer-prone cells. The fact that Apoptin does not induce apoptosis in normal human cells implies that there would be little or no toxic effect of Apoptin treatment in vivo. Noteborn and Pietersen (1998) and Pietersen et al. (1999) have provided evidence that adenovirus expressed Apoptin does not have a toxic effect in vivo. In addition, in nude mice it was shown that Apoptin has a strong anti- tumor activity.

Although it is clear that Apoptin is capable of providing aberrant- specific apoptosis, the domains (or fragments, the terms are used interchangeably herein) of Apoptin which provide Apoptin with this highly desired characteristic (i.e. the capability of inducing aberrant-specific apoptosis) are unknown. The present invention discloses fragments of Apoptin which are capable of inducing aberrant-specific apoptosis and fragments of Apoptin which are capable of increasing the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell. The present invention therefore provides, amongst others, an enlargement of the array of _n^---,-.

PCT/NL03/00195

therapeutic anti-cancer or anti-auto-immune-disease compounds available in the art.

In a first embodiment the invention provides an isolated or recombinant fragment of Apoptin capable of inducing aberrant-specific apoptosis. A fragment of Apoptin capable of inducing (or providing) aberrant-specific apoptosis is herein defined as any fragment of Apoptin capable of inducing apoptosis in tumor cells and/or cells involved in an auto-immune disease, but not capable of providing detectable apoptosis in normal (for example non- tumor) cells. A fragment of Apoptin can for example be a N-terminal fragment of Apoptin, a C-terminal fragment of Apoptin, a fragment from the interior part of Apoptin or combined parts thereof. With regard to a fragment that is structured by combining different parts of Apoptin, one can for example take a part of 10 to 20 amino acids from the N terminus of Apoptin (for example amino acids 20 to 40) and a part of 10 to 20 amino acids from the C-terminus of Apoptin (for example amino acids 80 to 100) and link these fragments by a chemical or proteinaceous linker. Such a combined fragment of Apoptin is, when compared to full length Apoptin, more easily produced, by methods known to the person skilled in the art, for example a protein expression system. Fragments of for example 10 to 20 amino acids can also more easily be made (compared to a larger fragment) with help of a peptide synthesiser and such (synthetic) peptides are then linked by a proteinaceous or chemical linker by known methods. Preferably, such a linker is flexible and allows the different fragments to take any desired conformation. It is clear that combined fragments can also be based on more than two, for example 3 or 4, (possibly different or identical) fragments. An example of a proteinaceous linker is disclosed herein with in the experimental part. In a more preferred embodiment the invention provides an isolated or recombinant fragment of Apoptin capable of inducing aberrant-specific apoptosis wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 1 to 60 (also referred to as Apoptin(l-βO)). As disclosed herein within the experimental part Apoptin 1-60 induces apoptosis in human p53- (Saos-2) tumor cells and human p53+ tumor cells (SW480) but not, at least not detectable, in normal cells such as CD31- fibroblasts, NH10 fibroblasts and mesenchymal stem cells and hence, Apoptin(l-60) is an example of a N-terminal fragment of Apoptin that is capable of inducing aberrant-specific apoptosis. In yet another preferred embodiment, the invention provides an isolated or recombinant fragment of Apoptin capable of inducing aberrant-specific apoptosis wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 70 to 121 (also referred to as Apoptin(70-121)). It is clear from the experimental part that Apoptin(70-121) is also capable of providing/inducing aberrant specific apoptosis and hence, the invention also provides an example of a C-terminal fragment of Apoptin capable of inducing aberrant-specific apoptosis. It is clear that both this C-terminal as well as the N-terminal fragment can be more easily (chemically) produced when compared to the full- length Apoptin(l-121). Furthermore, it is also disclosed herein that overexpression of a C-terminal fragment of Apoptin does not lead to multimeric structures and hence such a fragment is also more easily produced in an overexpression system when compared to the full-length Apoptin. Besides the herein disclosed fragments of Apoptin which are capable of inducing aberrant-specific apoptosis, the invention also includes a functional fragment and/or a functional equivalent of said fragments of Apoptin which is capable of inducing aberrant-specific apoptosis. A functional fragment or a functional equivalent is capable of providing aberrant-specific apoptosis but not necessarily in the same amount. A functional fragment is for example obtained by a deletion at either the N-terminus or the C-terminus or a combination thereof of a fragment of Apoptin which is capable of inducing aberrant-specific apoptosis. As disclosed herein within the experimental part, replacement of amino acids 2 to 4 of Apoptin with Alanine residues does not have an influence on the apoptosis inducing capability of said mutant, which strongly suggest that these amino acids can be deleted without imposing an effect on the apoptosis inducing capability. A functional equivalent is for example obtained by providing a fragment of Apoptin which is capable of inducing aberrant-specific apoptosis with a point mutation, an internal deletion or an insertion.

In another embodiment the invention provides a nucleic acid sequence encoding a fragment of Apoptin capable of inducing aberrant-specific apoptosis. A nucleic acid encoding a functional fragment and/or a functional equivalent of a fragment of Apoptin which is capable of inducing aberrant- specific apoptosis is also included.

In yet another embodiment the invention provides a vector comprising a nucleic acid according to the invention and therefore encoding a fragment of Apoptin capable of inducing aberrant-specific apoptosis. An example of such a vector is disclosed within the experimental part. In another embodiment the invention provides a gene delivery vehicle comprising a vector according to the invention which enables using a fragment of Apoptin capable of inducing aberrant-specific apoptosis for the treatment of a disease where enhanced cell proliferation or decreased cell death is observed via the use of gene-therapy. By equipping a gene delivery vehicle with a nucleic acid molecule encoding a fragment of Apoptin capable of inducing aberrant-specific apoptosis, and by targeting said vehicle to a cell or cells that show over-proliferating behaviour and/or have shown decreased death rates, said gene delivery vehicle provides said cell or cells with the necessary means of inhibiting or decreasing aberrant cells, providing therapeutic possibilities. Such a gene delivery vehicle, which is a independently infectious vector can for example be a virus (like an adenovirus or a retrovirus), or a liposome, or a polymer, or the like, that in it self can infect or in any other way deliver genetic information to for example tumor-cells that can be treated. Additionally, the invention provides a gene delivery vehicle which has additionally been supplemented with a specific ligand or target molecule or target molecules, by which the gene delivery vehicle can be specifically directed to deliver its genetic information at a target cell of choice. Such a target molecule can for instance be a viral spike protein, or receptor molecule, or antibody, reactive with a tumor cell surface receptor or protein. Furthermore, the invention provides a host cell comprising a vector or a gene delivery vehicle encoding a fragment of Apoptin capable of inducing aberrant-specific apoptosis. Such a host cell is for example useful for the protein production of a fragment of Apoptin, i.e. Apoptin(l-βO) or Apoptin(70- 121). In yet another embodiment the invention provides a pharmaceutical composition comprising a fragment of Apoptin capable of inducing aberrant- specific apoptosis, or a nucleic acid encoding a fragment of Apoptin capable of inducing aberrant-specific apoptosis, or a vector, or a gene delivery vehicle, or a host cell according to the invention. A pharmaceutical composition can either be in a solid form (for example, a pill) or in a fluidised form (for example, a liquid formulation). It is clear to a person skilled in the art that the active ingredient (for example, a proteinaceous substance comprising a fragment of Apoptin capable of inducing aberrant-specific apoptosis) can be accompanied by a pharmaceutical acceptable carrier or diluent. Such a pharmaceutical can be applied via different routes, for example an injection of Apoptin(l-60) into a tumor, dermal application or intravenously, It is clear that a pharmaceutical can comprise different fragments of Apoptin, for example an Apoptin(l-60) as well as an Apoptin(70-121). It is disclosed herein within the experimental part that the combination of these two fragment lead to an apoptosis inducing activity comparable to full-length Apoptin (1-121). Such fragments can be provided as a proteinaceous molecule but expression from a plasmid is also included herein. One can use one plasmid which comprises separate expression units for different fragments of Apoptin, however it is also possible to use two separate plasmids which both are capable of providing expression of a fragment of Apoptin capable of inducing aberrant-specific apoptosis. Or yet in another embodiment, different fragments of Apoptin are linked on a plasmid by a linker sequence. Herewith the invention provides a method for treating an individual carrying a disease where enhanced cell proliferation or decreased cell death is observed comprising treating said individual with a pharmaceutical composition according to the invention.

Furthermore, the invention provides use of a fragment of Apoptin capable of inducing aberrant-specific apoptosis or a nucleic acid encoding such a fragment of Apoptin, or a vector, or a gene delivery vehicle, or a host cell according to the invention in the preparation of a medicament for the treatment of a disease where enhanced cell proliferation or decreased cell death is observed. More preferably, said disease comprises cancer or autoimmune disease (for example rheumatoid arthritis).

The invention also provides use of a fragment of Apoptin capable of inducing aberrant-specific apoptosis, or a nucleic acid, or a vector, or a gene delivery vehicle, or a host cell according to the invention for the induction of apoptosis. More preferably, said apoptosis is aberrant-specific and even more preferably said apoptosis is p53-independent.

Besides the use of a fragment of Apoptin capable of inducing aberrant- specific apoptosis in a peptide based therapy, the Apoptin (1-60) is also used as a tool to further delineate the aberrant (tumor)-specific pathway via which Apoptin induces apoptosis, to find elements of this pathway. These elements may represent novel drug targets. In co-immunoprecipitations binding to known binding partners of Apoptin can be tested, to eliminate those that cannot bind to Apoptin (1-60). An inducible cell line can be made to use for micro-arrays or proteomics.

In another embodiment the invention provides a method to increase the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell comprising providing said protein with a fragment of Apoptin capable of increasing the amount of cytoplasmatic localisation of said protein in said cell. Proteins can be found throughout the whole cell. The localisation of a protein is for example determined by the presence of a retention signal on said protein. It is for example known that the retention signal "KDEL" is responsible for an endoplasmic reticulum localisation of a protein. It is disclosed herein within the experimental part that certain fragments of Apoptin are capable of increasing the amount of cytoplasmatic localisation of a particular protein in an aberrant cell. An aberrant cell is typically defined as a cell that is in some way dysregulated when compared to a non- aberrant/normal (the terms will be used interchangeably herein) cell. An aberrant cell can for example be dysregulated in growth, apoptosis, telomeric maintenance or production of cytokines etc. Examples of aberrant cells are tumor cells or cells involved in an auto-immune disease (for example rheumatoid arthritis cells). Preferably, the invention provides a method to increase the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell comprising providing said protein with a fragment of Apoptin capable of increasing the amount of cytoplasmatic localisation of said protein in said cell, wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 1 to 69. More preferably, said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 60 to 69. The feature of certain fragments of Apoptin to increase the amount of cytoplasmatic localisation of a particular protein in an aberrant cell is very useful in therapeutic regimes. For example the invention now provides a method for reducing the effects of a disease where enhanced cell proliferation or decreased cell death is observed comprising providing increasing the ratio of cytoplasmatic localisation versus nuclear localisation of a protein involved in said disease comprising providing said protein with a fragment of Apoptin capable of increasing the amount of cytoplasmatic protein in said cell. Preferably, the invention provides a method for reducing the effects of a disease where enhanced cell proliferation or decreased cell death is observed comprising providing increasing the ratio of cytoplasmatic localisation versus nuclear localisation of a protein involved in said disease by providing said protein with a fragment of Apoptin capable of increasing the amount of cytoplasmatic protein in said cell, wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 1 to 69 or between amino acids 60 to 69. Even more preferably, said fragment of Apoptin is linked (for example via a fusion protein or via chemical linkage) to a component that forms part of a hetero or homodimer, which dimer is involved as a nuclear transcription factor in the induction and/or maintenance of the aberrant state in aberrant cells. Examples of suitable dimers are myc/max, fos/jun (both hetero dimers) or NFκ-B (which can form either a homo dimer or a hetero dimer). The monomers of these dimers are produced within the cytoplasm of a cell and at a later stage dimerisation, either in the cytoplasm or in the nucleus, of the two monomers takes place. By, for example, overexpression in an aberrant cell of a fusion protein comprising a fragment of Apoptin capable of increasing the amount of cytoplasmatic localisation of a protein in an aberrant cell (said fragment is abbreviate as "X") and myc, renders the fusion protein X-myc to be typically present within the cytoplasm. As a result of the overexpressed fusion protein X-myc, X-myc/max dimerisation will preferentially take place in the cytoplasm. Hence, the max monomer is no longer functionally available for its dimerisation within the nucleus or cytoplasm with myc alone and/or the formed dimer X-myc/max will preferentially stay in the cytoplasm due to the characteristic of fragment X and thereby the effect of the myc/max transcription factor in the nucleus in aberrant cells is diminished.

The invention will be explained in more detail in the following description, which is not limiting the invention. EXPERIMENTAL PART

Plasmids

Description of pCMV-Apoptin, pCMVneo and pCMV-Desmin

The plasmid pCMV- Apoptin, which encodes a naturally occurring form of Apoptin, was described previously by Danen-Van Oorschot et al. (1997). In short, the plasmid pCMV-Apoptin contains the human cy tome galo virus (CMV) promoter and CAN DΝA sequences (nt 427-868) encoding Apoptin exclusively. The synthesized Apoptin protein harbours apoptotic activity and is identical to GenBank Q99152 except position 116 contains a K > R change. The empty vector pCMV-neo was described by Baker et al. (1990) and is used as a negative control. The plasmid pCMN-Desmin was described previously by Danen-Nan Oorschot et al. (1997). The plasmid contains the CMN promoter and encodes the muscle-specific cytoskeletal protein Desmin, which does not induce apoptosis when over-expressed and is therefore used as a negative control. Figure 1 shows the amino acid sequence of the Apoptin protein.

Construction of Apoptin(l-ΘO) and Apoptin(l-69) The plasmids encoding amino acids 1-60 and 1-69 of Apoptin were kindly donated by Dr D. Mumberg from Schering AG, Berlin. First, an Apoptin DΝA was constructed containing additional unique restriction enzyme sites that allow for ease of cloning, as mentioned above. Parts of the DΝA encoding amino acids 1-60 and 1-69 were cloned into the modified expression vector pIRESneo (Clontech), under the control of the CMN promoter.

Construction of ΝLS-Apoptin and ΝLS-l-69-Apoptin

DNA encoding the SV40-Large T nuclear localization signal (PPKKKRKV) was fused N-terminally to an Ndel/BamHI fragment, encoding full length Apoptin, or Ndeϊ/Bsrl fragment, encoding amino acids 1-69 of Apoptin, derived from the parental Apoptin plasmid pET16b-VP3. These fragments were next cloned into the pCMVneo vector mentioned above. The resulting plasmid, called pCMV-NLS-VP 3 and pCMV-NLS-VP3(l-69) respectively, were confirmed by sequence analysis and shown to express nuclearly-localized Apoptin and Apoptin fragment respectively.

Construction of alanine mutants

A series of 5-Alanine (Ala scanning mutants) of the Apoptin gene were a kind gift from Dr D. Mumberg from Schering AG, Berlin. First, an Apoptin DNA was constructed containing additional unique restriction enzyme sites that allow for ease of cloning of systematic Ala-mutants, of which the amino acid sequence is identical to Genbank Q99152, as shown in Figure 2. Then, sequential stretches of 5 amino acids of Apoptin were systematically exchanged by 5 Ala residues each using a linker substitution strategy. The Ala-mutants have been sequenced and cloned in a modified expression plasmid vector pIRESneo (ClonTech, USA) under the control of the CMV promoter. A schematic representation of the Ala- mutants of Apoptin is shown in Figure 3.

Construction of pMT2SM-AAP-l A clone encoding full length AAP-1, obtained from a cDNA library derived from Epstein-Barr virus-transformed human lymphocytes, was digested with Xho-l. The cDNA fragment was cloned into the vector pMT2SM- myc (Gebbink et al., 1997), providing the fragment with an in-frame N- terminal myc-tag (9E10) and conferring mammalian expression under the control of the MLP promoter (co-pending patent application PCT/NLOO/00612).

Description of pcDNA3-HA-FADD

The plasmid pcDNA3-HA-FADD was described previously by Chinnaiyan et al. (1995). In short, the plasmid contains the full length cDNA encoding FADD, with an HA epitope tag, under the regulation of the CMV promoter.

Construction of GFP-Apoptin and GFP-70-121 The vector phGFPS65T encodes GFP containing an activating mutation, and was obtained from ClonTech (USA). Amino acids 70-121 of Apoptin and full length Apoptin were fused C-terminally to GFP in this vector. Briefly, GFP is juxtaposed, via a 4 amino acid tether, to full length Apoptin to create GFP- Apoptin, or to the C-terminal portion of Apoptin to create GFP-70-121, where the numbers indicate the amino acid residues of Apoptin included in the construct. GFP and the GFP-fusion genes are under the regulation of the SN40 promoter, which is active in a broad range of mammalian cell types. For the construction of p GFP -Apoptin, the Ndeϊ-BamUl fragment of plasmid pGBT9- VP3 and the required BsrGl-Ndel linker and BaniHl-Notl linker were cloned in the BsrGI-Nofl-treated pGFPS65T plasmid resulting in GFP-Apoptin. For the construction of pGFP-70-121, the Ndeϊ-BamΗ.1 fragment of plasmid pGBT9-NP3 was treated with restriction enzyme _BsrL The SsrI-J3ατ7iHl fragment and the required -BsrGI-JBsrl linker and BaniHl-Notl linker were cloned in the BsrGI-iVoil-treated pGFPS65T plasmid resulting in GFP-70-121.

Construction of fusion products containing C-terminal Apoptin fragments phGFP-NP3(lll-121) was made by inserting a linker, which encodes a four amino acid spacer (Pro-Gly-Ala-Gly) and amino acids 111-121 of Apoptin, in between the JBsrGI and Not! sites of phGFP-S65T (Clontech, Palo Alto, CA, USA; the plasmid expresses a variant of GFP from Aequorea victoria which has been optimized for human codon usage and serine 65 has been mutated to threonine to enhance the fluorescent signal). PCR fragments of Apoptin aminoacids 80-121, 90-121, and 100-121 with overhanging BsrGl and Notl sites were cloned into phGFP-S65T to generate the plasmids phGFP-VP3(80- 121), phGFP-VP3(90-121) and phGFP-VP3(100-121).

For pMBP-VP3(80-121) the Apoptin gene was fused in frame to the Maltose-binding protein (MBP) in the bacterial expression vector pMalTB. The resulting fusion product consists of an N-terminal MBP moiety that is separated from the Apoptin part by a 10-Asn linker and a thrombin-cleavage site.

All plasmids were sequenced to confirm the correct reading frame of the fusion proteins, and proteins of the expected size were detected by Western blot analysis.

Cloning of MBP-66-121 and MBP-l-69-Hβ

The Apoptin gene was fused in frame in a bacterial expression vector encoding the Maltose-binding protein (MBP), a 10 Asn-linker and a Thrombin site. The expression system is based on a modified pMalc2 plasmid vector (New England Biolabs, USA), in which the factor Xa site has been replaced by a thrombin site. This modified vector was named pMalTB. A PCR fragment consisting of amino acids 66-121 of Apoptin and at the 5'-end a BamHl and at the 3'-end a Sail site, was cloned in pMalTB. The resulting fusion product consists of a N-terminal MBP-moiety that is separated from the Apoptin part by a 10 Asn-linker and a thrombin cleavage site. The resulting plasmid is called pMBP-66-121 and the proteinaceous substance encoded by this plasmid is designated pMBP-66-121.

The DNA sequences encoding the amino acids 1-69 of Apoptin were amplified from pET-22bNp3(l-69)Hβ (Leliveld, unpublished results), including the downstream T7 terminator, were cloned into pMalTB at BamHl and Sail. The construct is called pMBP-l-69-He.

The correct sequence of the essential parts of the pMBP-66-121 and pMBP-l-69-H6 construct was confirmed by means of the Sanger method (Sanger et al., 1977) and carried out by Base Clear, Leiden, The Netherlands. Purification and expression of MBP, MBP-66-121 and pMBP-l-69-He protein.

The plasmids pMBP-66-121 and ρMBP-1-69- He were independently transformed into bacteria derived from strain BL21 (DE3), and initial expression studies showed that the resultant MBP-66-121 and pMBP-l-69-Hβ proteins constituted roughly 10% of the soluble cytoplasmic protein, after 3 hours induction with 1 mM IPTG. Purification was carried out on amylose beads at pH 7.4 and 1M NaCl. Subsequently, elution in buffer containing 20mM HEPES pH 8.0, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 10 mM

Maltose, yielded about 100 mg of each MBP -Apoptin fusion protein per liter of bacterial culture. The purified protein batches were loaded on a UNO-SI chromatography column (BioRad), and the fractions that elute at 400-500 mM NaCl, 20 mM HEPES pH7.4, 1 M EDTA were pooled, dialyzed against PBS and concentrated with Millipore UltraFree spin filters.

The negative control preparation, Maltose-binding protein (MBP), was produced and purified in the way described above for MBP-66-121 and MBP-1- 69-He.

Cell lines and culturing

The following established cell lines have been described previously: Saos-2 human osteosarcoma cells (Diller et al. 1990), which are functionally deficient for p53 function; COS-1 cells, which are SV40 -transformed African green monkey kidney fibroblasts, were a kind gift from Dr. A.G. Jochemsen, Leiden University Medical Center; SW480, a human colorectal adenocarcinoma cell line, was derived from ATCC. SW480 cells were grown in Leibovitz's L-15 medium supplemented with 2 mM L-glutamine and 10% FBS. NW18, an SV40 -transformed human tumorigenic fibroblast (Weissman et al., 1983) was grown in MEM supplemented with 8% FBS.

Low-passage primary human fibroblasts (VH10) were a gift from Dr. L. Mullenders, Leiden University Medical Center, Department of Chemical Mutagenesis and Radiation Genetics; low passage CD31-negative normal diploid skin fibroblasts were a kind gift from Schering AG in Berlin; human mesenchymal stem cells were purchased from BioWhitacker (USA).

All cells were cultured in Dulbecco's Modified Eagle Medium (unless mentioned otherwise) supplemented with 10% fetal bovine serum and penicillin/streptomycin, and cultured at 5% C0₂ in a humidified 37°C incubator. The mesenchymal stem cells were cultured in dedicated medium purchased from the manufacturer for no more than 4 passages, using their protocols.

Transfections and microinjections

For biochemical analyses, cells were plated four hours before transfection on 9 cm dishes such that cultures were 25% confluent at the time of transfection. 20 μg DNA was transfected according to the CaP0₄ method as described previously (Van der Eb and Graham, 1980). The complexes were incubated on the cells in the presence of full serum overnight, and the cells were washed three times with PBS and provided with fresh complete medium the next morning. For apoptosis immunofluorescence assays, 0.8xl0⁵-1.2xl0⁵ cells were plated in each well of a 6-well plate containing glass coverslips, and transfected with 3 μg of DNA according to the CaP0 method. When microinjections were used instead of transfections, the following procedures were followed. Cells were cultured on glass-bottomed microinjection dishes (MatTek Corporation) or in 35 mm dishes containing glass Cellocate coverslips (Eppendorf). The cells were micro-injected in the nucleus with DNA at 100 ng/μl using an Eppendorf micro-injector with the injection-pressure condition of 0.5 psi. The cells were co-injected with Dextran-Rhodamine (MW: 70 kda; Molecular Probes) to be able to later identify injected cells. The cells were incubated at 37°C after injection until the cells were fixed with formaldehyde- methanol- acetone and stained and analysed as described in the section "Apoptotis assays" using specific antibodies.

Immunoprecipitation assay 40-44 hours post-transfection, cultures transfected with plasmids encoding myc-tagged AAP-1, mutant Apoptin, or controls were washed with ice-cold PBS, then lysed in 400 μl mild lysis buffer (50 mM Tris pH 7.5, 250 mM NaCl, 5 mM EDTA, 0,1 % TritonX-100, supplemented with the following protease or phosphatase inhibitors at standard concentrations: trypsin inhibitor, pepstatin, leupeptin, aprotinin, PMSF, β-glycerophosphate, and sodium fluoride). Lysates were incubated on ice for 30 minutes, centrifuged for 10 minutes at 13,000 rpm in a refrigerated microfuge, and the supernatants were immunoprecipitated with mouse monoclonal antibody 9E10 against the myc-tag and Protein A sepharose beads using standard methodology. The final pellet was resuspended in 2x denaturing Laemmli buffer and stored at -20°C until processing. Immunoprecipitation samples and lysates were run on 15% SDS-PAGE gels, and Western-transferred to Immobilon membranes (see below). The membranes were immunoprobed to detect the presence of AAP-1 and Apoptin mutants. Western blot analysis

Protein was electroblotted from gel to PVDF membranes (Immobilon, Millipore) using standard techniques. Membranes were blocked in a tris- buffered saline solution supplemented in 0.5% Tween-20 (TBS-T) and 5% non- fat dry milk (TBS-TM) for at least 1 hr, washed briefly in TBS-T, then incubated for 1 hr at room temperature with primary antibody, depending on the experiment, in TBS-TM at the following concentrations: rabbit polyclonal αVP3-C purified serum at 1:200; or mouse monoclonal anti-myc antibody 9E10 at 1:5,000. After 3x 5' washes in TBS-T, membranes were further incubated in the appropriate antibody (anti-mouse Ig, anti-rabbit Ig,) or Protein A conjugated to horseradish peroxidase. After 3x 20' washes in TBS-T, membranes were subjected to enhanced chemiluminescence using standard techniques, exposed to X-ray film (Kodak), and films were developed using standard automated methods.

Apoptosis assays

Constructs encoding Apoptin or mutants thereof, Desmin plasmid as a negative control, or FADD plasmid as a positive control were transfected into cells on glass coverslips, or microinjected into cells on glass-bottomed microinjection dishes or on Cellocate coverslips as described in the section "Transfections and microinjections". MBP-66-121 protein was also microinjected into cells. At 3-5 days post-transfection or 24-48 hours post- injection, apoptosis was scored as previously described (Danen-Nan Oorschot et al., 2000). Briefly, cells were fixed via sequential incubation with 1% formaldehyde for 10 minutes, 100% methanol for 5 minutes, and 80% acetone for 2 minutes. Cells were immunostained using 111.3 or αVP3-C as a primary antibody for Apoptin (mutants), mouse monoclonal antibody 33 against Desmin (Monosan), mouse monoclonal antibody against FADD (Transduction Laboratories), mouse monoclonal antibody ab65 against MBP (Abeam), and using FITC-conjugated goat-anti-mouse or goat-anti-rabbit Ig as a secondary antibody. Cells were counterstained with DAPI to detect DNA. Coverslips were mounted with DABCO/glycerol on slides and inspected by fluorescence microscopy. Only positive cells were assessed for apoptosis using nuclear morphology as the criterion. At least 100 cells per well were scored and the assays were done multiple times.

RESULTS

Apoptin(l-βO) induces apoptosis in human tumorigenic cells.

To examine whether Apoptin(l-βO) induces apoptosis in human tumor cells, cultures of human tumorigenic Saos-2, NW-18 and SW480 cells were transfected with plasmid encoding the N-terminal 60 amino acids of Apoptin. As a positive control, cells were transiently transfected with a plasmid encoding the complete Apoptin protein. As a negative control, cells were transfected with a plasmid encoding Desmin, which does not have apoptotic activity. Cells expressing Apoptin or Desmin were screened via direct immunofluorescence with antibodies directed against Apoptin or Desmin. Induction of apoptosis in Apoptin- or Desmin-positive cells was analysed with the help of DAPI, which causes a regular staining in intact nuclei, but an irregular and/or weak staining in apoptotic nuclei. Five days after transfection, around 10% of the Desmin-positive cells were apoptotic, which is the basal level due to the transfection event (Danen- Nan Oorschot, 1997). Five days after transfection, the percentage of apoptotic cells expressing complete Apoptin protein was about 60%. Approximately 50% of the tumor cells expressing Apoptin(l-60) underwent apoptosis at 5 days after transfection. The experiments were carried out five times independently. Therefore, we conclude that Apoptin(l-60) does induce apoptosis when expressed in human tumor cells, although to a somewhat lesser/slower extent than wild-type/complete Apoptin.

Besides the apoptotic activity of Apoptin(l-60) protein in human tumor cells, we also analysed its cellular localization. Apoptin(l-60) is localized throughout the whole cell, but more Apoptin(l-βO) protein is detected in the cytoplasm than in the nucleus. Apoptin(l-βO) does not induce apoptosis in normal human fibroblasts and mesenchymal stem cells.

Next, we examined the apoptotic activity of Apoptin(l-60) in normal human cells. To that end, normal human VH10 and CD31- fibroblasts and mesenchymal stem cells were microinjected with plasmid encoding Apoptin(l- 60). As a positive control, cells were microinjected with a plasmid encoding the wild-type/complete Apoptin protein or FADD, known to be involved in Fas- induced apoptosis. As a negative control, cells were transfected with a plasmid encoding Desmin. Cells expressing Apoptin, Desmin or FADD were screened via direct immunofluorescence with antibodies directed, respectively, against Apoptin, Desmin or FADD. Induction of apoptosis in Apoptin- or Desmin- positive cells was analysed with the help of DAPI. The experiments were carried out independently at least three times.

Two days after microinjection, almost all FADD-positive fibroblasts as well as mesenchymal cells underwent apoptosis. Almost none of the Desmin-, Apoptin- as well as Apoptin(l-60)-positive cells had become apoptotic. Apoptin was almost completely localized in the cytoplasm of microinjected cells. Apoptin(l-βO) was diffusely localized mainly in the cytoplasm of normal fibroblasts and mesenchymal stem cells, but occasionally Apoptin(l-60) could also be detected in the nucleus.

Therefore, we conclude that the N-terminal 1-60 amino-acids fragment of Apoptin still has the capability to induce apoptosis specifically in tumor cells. This proves that a part of Apoptin still retains its tumor specificity. Apoptotic activity and tumor specificity seem both to be present in the Apoptin(l-60) protein, which makes it possible that even a smaller part of the 1-60 amino acid N-terminal region of Apoptin can act in a similar way. This fact opens up possibilities not only for protein therapy for Apoptin(l-60) as described by us for the complete Apoptin in our co-pending patent application PCT/NL01/00664 but also for a peptide-based anti-cancer therapy. The fusion protein GFP-Apoptin(70-121) induces apoptosis in human tumor cells, but not in human normal mesenchymal stem cells.

To examine whether the Apoptin C-terminal part can induce apoptosis in human tumor cells, but not in normal cells, cultures of human tumorigenic Saos-2 cells and human mesenchymal stem cells were respectively transfected or microinjected with plasmid encoding the C-terminal 52 amino acids (position 70-121) of Apoptin. As a positive control, cells were transfected or microinjected with a plasmid encoding the GFP-Apoptin fusion protein. As a negative control, cells were transfected or microinjected with a plasmid encoding GFP, which does not have apoptotic activity. Cells expressing

Apoptin were screened via direct immunofluorescence with antibodies directed against Apoptin. Induction of apoptosis in Apoptin-positive cells was analysed as described above.

Five days after transfection, around 5% of the GFP -positive tumor cells were apoptotic, which is the basal level due to the transfection event (Danen- Van Oorschot et al, 1997). Five days after transfection, the percentage of apoptotic cells expressing Apoptin protein or GFP-Apoptin was about 80%. Approximately 30% of the cells expressing Apoptin(70- 121) underwent apoptosis at 5 days after transfection Two days after microinjection, mesenchymal stem cells containing GFP,

GFP-Apoptin or GFP-Apoptin(70-121) did not or only very slightly undergo apoptosis. In parallel experiments, it was shown that microinjection of Saos-2 cells with plasmid encoding Apoptin resulted in approximately 70-80% apoptosis among injected cells at two days after microinjection. Therefore, we conclude that the C-terminal region of Apoptin turns out to be tumor-specific as well regarding induction of apoptosis. Its apoptotic activity, however, is less strong than the N-terminal 1-60 region or the complete Apoptin protein. Apoptin 80-121 fragment contains a functional, bipartite-type NLS

Previous work has suggested that the nuclear localization of Apoptin may be correlated to its killing activity in tumor cells. In this study, we first set out to delineate the elements involved in nuclear localization of Apoptin. Apoptin contains two sequences that resemble NLSs based on the presence of positively charged amino acids (a.a.), namely a.a. 82-88 (NLS1; KPPSKKR) and a.a. 111-121 (NLS2; RPRTAKRRIRL). Deletion of a.a. 111-121 has already been shown to result in decreased nuclear localization, suggesting that NLS2 is involved in nuclear targeting (Zhuang et al., 1995).

To resolve the minimal requirements for nuclear localization of Apoptin in tumor cells, we made more N-terminal GFP fusions with fragments of Apoptin and determined their localization. Fusion of a.a. 70- 121 or 80-121, containing both putative NLSs, effectively redirected GFP to the nucleus, whereas fusion of a.a. 90-121, 100-121 or 111-121, which lack NLS1, did not. These data suggest that both NLSs are needed for efficient nuclear targeting.

To further test the requirement for both NLSs for nuclear localization, we mutated a.a. 86-90 (KKRSC) to alanines, creating the mutant Ala-86. The mutant Ala-86 was constructed by replacing aminoacids 86-90 of Apoptin with Alanine residues. To this end, first, an Apoptin DNA was constructed containing additional unique restriction enzyme sites that allow for ease of cloning (sAPO). Then, aminoacids 86- 90 of Apoptin were exchanged by 5 Alanine residues using a linker substitution strategy. The Ala-86-mutant and sAPO were sequenced and cloned in a modified expression plasmid vector pIRESneo (ClonTech) under the control of the CMN promoter.

Ala-86 exhibited a partial but significant impairment of nuclear localization, together with the formation of aggregates in the cytoplasm. These data indicate that the ΝLSs of Apoptin are indeed interdependent, consistent with them functioning as a bipartite -type NLS characterized by two basic domains separated by a spacer (Dingwall and Laskey, 1991).

Apoptin 80-121 fragment induces apoptosis in human tumor cells To delineate further the C-terminal apoptosis domain, we determined the cell killing activity of smaller fragments of Apoptin fused to GFP. Whereas expression of GFP-Apoptin(100-121) did not result in significant cell death, GFP-Apoptin(90-121) caused 12% of the cells to undergo apoptosis, which is moderate, but significantly higher (p=0.01) than the effect of wt GFP. In contrast, GFP-Apoptin(80-121) caused a robust level of apoptosis (30%), although less than that induced by GFP- Apoptin. Thus, aminoacids 80-121 are sufficient to induce the cell death conferrred by the C-terminal apoptosis domain of Apoptin.

Construction of MBP-Apoptin(80-121) made it possible to confirm that this Apoptin can still kill human tumor cells independent of its fusion partner. Human tumor Saos-2 cells were transfected with MBP- Apoptin(80-121) DNA and examined for apoptosis as described above. Therefore, these data further support the hypothesis that Apoptin contains two independent death domains, perhaps executed by different pathways.

Furthermore, we examined the cell killing activity of the mutant Ala-86, in which part of the bipartite NLS (namely NLS1) is disrupted. Ala-86 not only displayed impaired nuclear localization but also reduced apoptosis activity. These data show that a strong nuclear localization correlates with a more robust cell killing activity of parts of Apoptin, and, moreover, that a mutation which impairs nuclear localization of Apoptin also diminishes its cell killing activity.

Taken together, these data confirm that the two putative NLSs, one stretching from aminoacids 82-88, the other from aminoacids 111-121, actually function as such. Moreover, both stretches are required to obtain complete nuclear localization, since deletion or mutation of either of the two NLSs resulted in a diminished nuclear translocation. These data imply that Apoptin contains a bipartite-type NLS. The classic example of a bipartite NLS is the one defined for the protein nucleoplasmin, which consists of two basic domains separated by a spacer sequence of 10 amino acids. Other bipartite NLSs were found to have similarly short spacer sequences, e.g. interferon regulatory factor and hnRNP K (Robbins et al., 1991; Michael et al., 1997; Lau et al., 2000). However, a novel variant was recently found in hypoxia-inducible factors (HIF) that contain distinctly longer spacer sequences of 19 to 31 amino acids (Luo and Shibuya, 2001). Upon comparison of Apoptin to these sequences, we found that the Apoptin NLS is most similar to the HIF2α bipartite NLS, both in conserved residues and spacing.

The multimerization domain of Apoptin is located within the N- terminal region of Apoptin.

Noteborn et al. (our co-pending application PCT/NL01/00664) have described that Apoptin forms a multimeric structure. In order to evaluate the ability of both fragments to form multimers, Apoptin's N-terminal 69 residues and C-terminal 56 residues (66-121) were cloned separately as MBP fusion proteins. The MBP-Apoptin(l-69) fusion contained an additional C-terminal hexahistidine tag to facilitate further purification.

MBP-Apoptin(66-121) was expressed in a soluble form to about 50 mg per litre of culture. The purified MBP-Apoptin(66-121) migrated at approximately 50 kDa on SDS-PAGE. In contrast to the full-length fusion protein, MBP-Apoptin(66-121) consisted exclusively of two species of approximately 200 and 60 kDa, corresponding to an equilibrium between a monomer and a di- or trimer. Dynamic light scattering showed the presence of a solute species with an R_H of 4.6 ± 0.8 nm, which corresponds to an average molecular weight of 120 ± 50 kDa. This result shows that the C-terminal domain of Apoptin on its own is unable to form the type of higher-order multimers such as MBP-Apoptin(l-121) does.

The expression characteristics and amylose binding of MBP-Apoptin(l- 69)-Hβ mirrored those of MBP-Apoptin(l-121). Its apparent molecular weight on SDS-PAGE was 54 kDa. On Superose 6 HR10/30, MBP-Apoptin(l-69)-H₆ displayed the same elution profile as did MBP-Apoptin(l-121), meaning that the size of MBP-Apoptin(l-69)-Hβ in solution is close to 2.5 MDa as well. The second peak at 40 kDa represented an amount of unfused MBP that was cleaved off during purification. The resulting fraction of unfused Apoptin(l- 69)-Hβ co-eluted with the intact fusion protein. As mentioned earlier, the same observation was made in respect to cleaved-off Apoptin(l-121).

In E. coli, unfused Apoptin(l-69)-H6 was expressed in a soluble form at 37 °C, with an expression level of 1 to 2 mg per litre of culture (Apoptin(l-69)- Hβ was constructed and purified analogous to Apoptin- He who's cloning and purification is described in co-pending patent application PCT/NLOl/00664). Its apparent molecular weight on SDS-PAGE was around 12 kDa. After Ni²⁺- NTA purification, the homogeneity of Apoptin(l-69)-H6 was approximately 80%. When the Ni²⁺-NTA eluate was fractionated on a Sephacryl S100 HR gel filtration column, the Apoptin(l-69)-Hβ could only be recovered from the void volume. This result shows that the size of the N-terminal Apoptin fragment in solution is larger than 100 kDa. Both results demonstrate that the N-terminal 69 residues of Apoptin contain sufficient structural elements to account for its multimerisation behaviour. Hence, the sequence elements that dominate Apoptin's multimerisation properties have to be located predominantly within the N-terminal (69) residues of Apoptin.

Apoptin(l-69) does not induce apoptosis in human tumor cells or in normal cells.

The above-described experiments revealed that the 1-60 and 70-121 fragments of Apoptin induce tumor-specific apoptosis. We asked ourselves whether the Apoptin (1-69) fragment is also able to induce apoptosis in tumor cells only. To that end, Saos-2, NW18 and SW480 cells were transfected and normal human CD31- fibroblasts were microinjected with plasmid expressing Apoptin(l-69), with plasmid encoding GFP (negative control), or with plasmids encoding Apoptin or GFP-Apoptin fusion proteins (positive controls).

Both the human tumor cells and the normal fibroblasts did not undergo apoptosis upon expression of GFP protein and Apoptin(l-69), whereas as expected Apoptin or GFP-Apoptin expression resulted in induction of apoptosis in the three different human tumor cells, but not in normal CD31- fibroblasts. The Apoptin(l-69) protein was almost only located in the cytoplasm. Expression of GFP-Apoptin(l-69) fusion protein resulted in the almost complete cytoplasmic location of this fusion protein, whereas GFP is located throughout the whole cell. This observation illustrates that the 1-69 amino acid region of Apoptin has the ability to direct GFP to the cytoplasm. This implies that the 61-69 amino-acid region of Apoptin can mask the apoptotic activity of the 1-60 fragment due to a cytoplasmic retention activity by e.g. enabling binding to a cytoplasmic protein or causing nuclear export of the Apoptin(l-69) protein.

Transfection of human tumorigenic Saos-2 cells with a plasmid encoding NLS-Apoptin(l-69), which is targeted to the nucleus due to the covalently linked NLS-amino acid sequence, resulted in a significant induction of apoptotic cells.

Specific Ala-mutants of Apoptin are impaired in their binding with AAP-1.

The Apoptin-associating protein AAP-1 (Noteborn and Danen-Oorschot, co-pending patent application PCT/NLOO/00612) has been described to be involved in the tumor-specific Apoptin-induced apoptosis pathway. Overexpression of AAP-1 alone results in a tumor-specific apoptosis like Apoptin. Therefore, we examined which Apoptin Ala-mutants are involved in binding to AAP-1.

To that end, a series of COS-1 cells was transfected with two different plasmids, one plasmid encoding AAP-1 and the second plasmid encoding one of the Ala-mutants of Apoptin (Figure 3). By means of an immunoprecipitation assay, it could be shown that replacement of the Apoptin amino acids 41-50 in two steps, namely 41-45 and 46-50, and 101-110 (101-105 and 106-110) by alanines results in a strong impairment of the Apoptin binding to AAP-1. These data indicate that two Apoptin domains, positioned in the Apoptin regions aa 41-50 and at aa 101-110, are involved in binding to AAP-1. Next, we studied whether the replacement of the amino acids 41-45 and 46-50 would have an effect on the nuclear localization and/or induction of apoptosis. To that end, Saos-2 cells were transfected with plasmids encoding Apoptin or Apoptin Ala-mutants replacing amino acids positioned at aa 41-45 or at aa 46-50. As a negative control, the Saos-2 cells were transfected with plasmid encoding

Desmin. The cells were analyzed by immunofluorescence for the expression of the transgenes by using antibodies against Apoptin and Desmin and for induction of apoptosis by staining with DAPI. The results clearly show that replacement of aa 41-45 and to a lesser extent of aa 46-50 results in reduced nuclear location of the Apoptin protein. Especially, the replacement of the aa 41-45 by alanines resulted in a significant delay in the induction of apoptosis in comparison to wild-type Apoptin.

The fact that a specific mutation within the 1-60 aa region of Apoptin results, three days after transfection, in an impairment of binding to a cellular protein, which is known to be involved in tumor-specific induction of apoptosis, and in a delay in induction of apoptosis, underlines the tumor-specific activity of the 1-60 Apoptin fragment. Ala-mutants within 1-60 region that do not effect the apoptotic activity.

To examine whether parts within the 1-60 N-terminal region of Apoptin are not relevant or only very minor relevant for the tumor-specie apoptotic activity, we have carried out transfection studies with Ala mutants within the 1-60 region of Apoptin, as shown in Figure 3.

To that end, Saos-2 cells were separately transfected with plasmids encoding 12 different Ala-mutants (all located within the 1-60 region), Desmin (negative control) or wild-type Apoptin (positive control). Three days after transfection, Saos-2 containing all Ala-mutants except Ala-mutant 41-45 and Ala-mutant 56-60 underwent a similar significant level of apoptosis as observed for Saos-2 cells expressing wild-type Apoptin (30% of the postive cells). As expected, only 10% of the Desmin-positive cells were apoptotic, which is the background level due to the used transfection method. The obtained results clearly indicate that various parts of the 1-60 Apoptin region not or only very minorly affect its apoptotic activity.

In conclusion, three days after transfection, almost all Ala-mutants within the 1-60 region induce apoptosis in tumor cells to a similar extent as wildtype/complete Apoptin. Mutants 41-45 and 56-60 show a reduced or delayed apoptosis activity.

Apoptin is derived from the unique CAV virus encoding only 3 proteins

Apoptin is derived from the unique chicken anemia virus (CAN). CAV is, like certain bacteriophages and plant geminiviruses, a virus containing a single-stranded circular DΝA genome. Apart from CAV, 2 other non-enveloped, icosahedral animal viruses with a circular single- stranded have been described. The CAV capsid is composed of 32 structural subunits arranged as in a class P=3 icosahedron with a triangulation number of 3. CAV capsids contain a circular minus- stranded DNA genome, which seem to replicate via a rolling-circle model (Noteborn et al., 1998).

The CAV genome specifies a single polycistronic polyadenylated mRNA, which comprises 3 partially or completely overlapping genes encoding the completely different proteins VPl, VP2 and Apoptin (also called VP3). These CAV proteins are not homologous to any known proteins. The transcription of the CAV RNA is controlled by a unique promoter/enhancer, which seem to be regulated by a combination of host and viral proteins. Recently, dr Rutger Leliveld, Leiden University, Leiden, The Netherlands (personal communication) has gathered evidence that Apoptin binds ds DNA as well as ssDNA and RNA, which illustrates that Apoptin might be involved in the regulation of CAV DNA replication and/or CAV transcription. Most likely, the virus replication takes place in the nucleus of infected cells, whereas the CAV proteins are synthesized in the cytoplasm. All 3 CAV proteins are capable of entering the nucleus, which illustrates that all three proteins harbor the function to pass the nuclear membrane and/or to accumulate in the nucleus. Finally, one of the most striking effects of CAV infection is that infected sensitive cells will undergo apoptosis (Noteborn et al., 1998). Therefore, all the processes required for CAVs life cycle are carried out by only three CAV proteins in collaboration with cellular proteins. This feature clearly suggests that CAV proteins, among those Apoptin, will harbor various molecular-biological functions. Indeed, we have reported here that Apoptin is able to do so and e.g. is capable in forming multimers, entering the nucleus of tumor cells and folded in particular ways. The various functions of Apoptin will play a role in regulating the viral as well as host processes or their intrinsic interactions, among those of induction of apoptosis in sensitive (aberrant-specific) cells. Apoptin harbors elements inducing tumor-specific apoptosis in trans

Our data clearly reveal that both the N-terminal Apoptin(l-βO) as well as the C-terminal Apoptin (70- 121) regions are both inducing apoptosis in a tumor-specific way, although, both independent fragments induce apoptosis to a lesser extent in comparison to the wild-type Apoptin. Therefore, we examined whether co-microinjection of human tumor Saos-2 cells and CD31- fibroblasts cells with independent plasmids encoding Apoptin(l-60) and Apoptin(70-121) would achieve tumor- specific apoptosis. As negative controls, both tumor Saos-2 cells and normal CD31- fibroblasts were microinjected with plasmid encoding Apoptin(l-60) or Apoptin(70-121) only. As positive controls, both tumor and normal cells were microinjected with plasmid encoding wild-type Apoptin. The obtained data clearly showed that co-microinjection of the plasmids encoding Apoptin(l-βO) and Apoptin(70-121) induced apoptosis in a tumor-specific way, which reached levels of apoptosis that were not significantly less in comparison to the levels achieved for wild-type Apoptin, but clearly higher than Apoptin(l-60) or Apoptin(70-121) alone. Strikingly, the C-terminal fragment 70-121 accumulates mainly in the nucleus whereas the N-terminal 1-60 fragment is mainly present in the cytoplasm, which indicates that one Apoptin pathway might act via cytoplasmic compounds and others via nuclear ones, both in a tumor- specific fashion. Therefore, it is concluded that the various Apoptin tumor-specific apoptosis domains can act in trans with each other. The experiments with the Ala-mutants in the 1-60 region demonstrate that various amino-acids sets can be exchanged without a detectable effect on the level of apoptosis induction. Therefore, one is in the position to construct Apoptin fragments comprising of tumor-specific elements of the 1-60 region (covalently or non-covalently) linked with parts of the 70-121 region of Apoptin.

DESCRIPTION OF FIGURES

Figure 1. The amino acid sequence of Apoptin.

Figure 2. Generation of Apoptin mutants

Figure 3. Overview of Ala-mutants of Apoptin

REFERENCES

Baker, S.J., Markowitz, S., Fearon, E.R., Willson, J.K.V., and Vogelstein, B. (1990). Suppression of human colorectal carcinoma cell growth by wild-type p53. Science 249, 912-915.

Bellamy, C.O.C., Malcomson, R.D.G., Harrison, D.J., and Wyllie, H. (1995). Cell death and disease: The biology and regulation of apoptosis. Seminars in Cancer Biology 6, 3-12.

Chinnaiyan, A.M., O'Rourke, K., Tewari, M., and Dixit, V.M. (1995). FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505-512.

Danen-Van Oorschot, A.A.A.M., Fischer, D.F., Grimbergen, J.M., Klein, B., Zhuang, S.-M., Falkenburg, J.H.F., Backendorf, C, Quax, P.H.A., Van der Eb, J.A., and Noteborn, M.H.M. (1997). Apoptin induces apoptosis in human transformed and malignant cells but not in normal cells. Proceedings National Academy Sciences, USA: 94, 5843-5847.

Danen-Van Oorschot, A.A.A.M, Den Hollander, A., Takayama, S., Reed, J., Van der Eb, A.J. and Noteborn, M.H.M. (1997a). BAG-1 inhibits p53-induced but not Apoptin-induced apoptosis. Apoptosis 2, 395-402.

Danen-van Oorschot, A.A.A.M., van der Eb, A.J., and Noteborn, M.H.M.

(2000). The chicken anemia virus-derived protein apoptin requires activation of caspases for induction of apoptosis in human tumor cells. J Virol 74, 7072- 7078. Duke, R.C., Ocjius, D.M., Young, J, D-E. (1996). Cell suicide in health and disease. Scientific American December 1996, 48-55.

Diller, L., Kassel, J., Nelson, C, Gryka, M.A., Litwak, G., Gebhardt, M., Bressac, B., Ozturk, M., Baker, S.J., Vogelstein, B., and Friend, S.H. (1990). p53 functions as a cell cycle control protein in osteosacomas. Molecular Cellular Biology 10, 5772-5781.

Dingwall, C. and Laskey, R.A. (1991). Nuclear targeting sequences--a consensus? Trends Biochem Sci 16, 478-481.

Earnshaw, W.C., 1995. Nuclear changes in apoptosis. Current Opinion in Cell Biology 7, 337-343.

Evan GI, Lewis GK, Ramsay G, Bishop JM, 1985 Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol Cell Biol Dec;5(12):3610-3616.

Gebbink, M.F., Kranenburg, O., Poland, M., van Horck, F.P., Houssa, B., and Moolenaar, W.H. (1997). Identification of a novel, putative Rho-specific

GDP/GTP exchange factor and a RhoA-binding protein: control of neuronal morphology. J Cell Biol: 137, 1603-1613.

Hockenberry, D.M. (1994). Bcl-2 in cancer, development and apoptosis. Journal of Cell Science, Supplement 18, 51-55.

Kerr, J.F.R., Winterford, CM., and Harmon, B.V. (1994). Apoptosis: Its significance in cancer and cancer therapy. Cancer 73, 2013-2026. Lau, J.F., Parisien, J.P., and Horvath, CM. (2000). Interferon regulatory factor subcellular localization is determined by a bipartite nuclear localization signal in the DNA-binding domain and interaction with cytoplasmic retention factors. Proc Natl Acad Sci U S A 97, 7278-7283.

Levine, A.J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88, 323-331.

Luo, J.C and Shibuya, M. (2001). A variant of nuclear localization signal of bipartite-type is required for the nuclear translocation of hypoxia inducible factors (lalpha, 2alpha and 3alpha). Oncogene 20, 1435-1444.

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. CSHL Press, New York, USA.

McDonell T.J., Meyn, R.E., Robertson, L.E. (1995). Implications of apoptotic cell death regulation in cancer therapy. Seminars in Cancer Biology 6, 53-60.

Michael, W.M., Eder, P.S., and Dreyfuss, G. (1997). The K nuclear shuttling domain: a novel signal for nuclear import and nuclear export in the hnRNP K protein. EMBO J 16, 3587-3598.

Noteborn, M.H.M. (1996). PCT application WO 96/41191. Apoptin induces apoptosis in human transformed and malignant cells but not in normal cells as essential characteristic for the development of an anti-tumor therapy.

Noteborn, M.H.M., and De Boer, G.F. (1996). Patent USA/no. 5,941,073 Cloning of chicken anemia DNA. Noteborn, M.H.M., De Boer, G.F., Van Roozelaar, D., Karreman, C, Kranenburg, O., Vos, J., Jeurissen, S., Zantema, A., Hoeben, R., Koch, G., Van Ormondt, H., and Van der Eb, A.J. (1991). Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. Journal of Virology 65, 3131-3139.

Noteborn, M.H.M., and Pietersen, A. (1998). A gene delivery vehicle expressing the apoptosis-inducing proteins VP2 and/or Apoptin. PCT Application no. PCT/NL98/00213

Noteborn, M.H.M., Todd, D., Verschueren, C.A.J., De Gauw, H.W.F.M., Curran, W.L., Veldkamp, S., Douglas, A.J., McNulty, M.S., Van der Eb, A.J., and Koch, G. (1994). A single chicken anemia virus protein induces apoptosis. Journal of Virology 68, 346-351.

Noteborn, M.H.M., and Zhang, Y. (1998). Methods and means for determining the transforming capability of agents, for determining the predisposition of cells to become transformed and prophylactic treatment of cancer using Apoptin-like activity. PCT Application no. PCT/NL98/00457

Noteborn, M.H.M., Danen-van Oorschot, A.A.A.M., Van der Eb, A.J. (1998a). Chicken anemia virus: Induction of apoptosis by a single protein of a single- stranded DNA virus. Seminars in Virology 8, 497-504.

Noteborn M.H.M., Zhang, Y.-H. and Van der Eb, A.J. (1998b). Viral protein Apoptin induces apoptosis in tumor cells and after UV-treatment in untransformed cells from cancer-prone individuals: A review. Mutation Research 400, 447-456. Noteborn M.H.M. and Danen-Oorschot A.A.A.M., PCT/NLOO/00612 (WO01/16165), Apoptin-associating protein.

Noteborn M.H.M. et al., PCT/NLOl/00664 (WO02/20809), A delivery method for the tumor specific apoptosis inducing activity of Apoptin.

Paulovich, A.G., Toczyski, D., Hartwell, H. (1997). When checkpoints fail. Cell 88, 315-321.

Pietersen, A.M., Van der Eb, M.M., Rademaker, H.J., Van den Wollenberg, D.J.M., Rabelink, M.J.W.E., Kuppen, P.J.K., Van Dierendonck, J.H., Van Ormondt, H., Masman, D., Van de Velde, C.J.H., Van der Eb, Hoeben, R.C., and Noteborn, M.H.M. (1999). Specific tumor-cell killing with adenovirus vectors containing the Apoptin gene. Gene Therapy 6, 882-892.

Robbins, J., Dilworth, S.M., Laskey, R.A., and Dingwall, C. (1991). Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64, 615- 623.

Sachs, L. and Lotem, J. (1993). Control of programmed cell death in normal and leukemia cells: New implications for therapy. Blood 82, 15-21.

Sanger, F., Nicklen, S., and Coulsen, A.R. (1977). DNA sequencing with chain- terminating inhibitors. Proceedings National Academic Sciences USA 74, 5463-5467.

Steller, H. (1995). Mechanisms and genes of cellular suicide. Science 267, 1445-1449. Telford, W.G., King, L.E., Fraker, P.J. (1992). Comparative evaluation of several DNA binding dyes in the detection of apoptosis-associated chromatin degradation by flow cytometry. Cytometry 13, 137-143.

Teodoro, J.G. and Branton, P.E. (1997). Regulation of apoptosis by viral gene products. Journal of Virology 71, 1739-1746.

Thompson, C.B. (1995). Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-1462.

Van der Eb, A.J. and Graham, F.L. (1980). Assay of transforming activity of tumor virus DNA. Meth.Enzymol. 65, 826-839.

Weissman, B.E. and Stanbridge, E.J. (1983). Complexity of control of tumorigenic expression in intraspecies hybrids of human SV40-transformed fibroblasts and normal human fibroblast cell lines. Cytoge net. Cell Genet. 35, 263-268.

White, E. (1996). Life, death, and the pursuit of apoptosis. Genes and development 10, 1-15.

Wyllie, A.H. (1995). The genetic regulation of apoptosis. Current Opinion in Genetics and Development 5, 97-104.

Wyllie, A.H., Kerr, J.F.R., Currie, A.R. (1980). Cell death: The significance of apoptosis. International Review of Cytology 68, 251-306.

Zhuang, S.-M., Landegent, J.E., Verschueren, C.A.J., Falkenburg, J.H.F., Van Ormondt, H., Van der Eb, A.J., Noteborn, M.H.M. (1995). Apoptin, a protein encoded by chicken anemia virus, induces cell death in various human hematologic malignant cells in vitro. Leukemia 9 Si, 118-120.

Zhuang, S.-M., Shvarts, A., Van Ormondt, H., Jochemsen, A.-G., Van der Eb, A.J., Noteborn, M.H.M. (1995a). Apoptin, a protein derived from chicken anemia virus, induces a p53-independent apoptosis in human osteosarcoma cells. Cancer Research 55, 486-489.

Claims

Claims

1. An isolated or recombinant fragment of Apoptin capable of inducing aberrant-specific apoptosis.

2. An isolated or recombinant fragment of Apoptin according to claim 1 wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 1 to 60.

3. An isolated or recombinant fragment of Apoptin according to claim 1 wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 70 to 121.

4. A nucleic acid encoding a fragment of Apoptin according to any one of claims 1 to 3.

5. A vector comprising a nucleic acid according to claim 4.

6. A gene delivery vehicle comprising a fragment of Apoptin according to any one of claims 1 to 3, or a nucleic acid according to claim 4, or a vector according to claim 5.

7. A host cell comprising a fragment of Apoptin according to any one of claims 1 to 3, or a nucleic acid according to claim 4, or a vector according to claim 5, or a gene delivery vehicle according to claim 6.

8. A pharmaceutical composition comprising a fragment of Apoptin according to any one of claims 1 to 3, or a nucleic acid according to claim 4, or a vector according to claim 5, or a gene delivery vehicle according to claim 6, or a host cell according to claim 7.

9. Use of a fragment of Apoptin according to any one of claims 1 to 3, or a nucleic acid according to claim 4, or a vector according to claim 5, or a gene delivery vehicle according to claim 6, or a host cell according to claim 7 in the preparation of a medicament for the treatment of a disease where enhanced cell proliferation or decreased cell death is observed.

10. Use according to claim 9, wherein said disease comprises cancer or autoimmune disease.

11. Use of a fragment of Apoptin according to any one of claims 1 to 3, or a nucleic acid according to claim 4, or a vector according to claim 5, or a gene delivery vehicle according to claim 6, or a host cell according to claim 7 for the induction of apoptosis.

12. Use according to claim 11, wherein said apoptosis is aberrant-specific.

13. A method to increase the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell comprising providing said protein with a fragment of Apoptin capable of increasing the amount of cytoplasmatic localisation of said protein in said cell.

14. A method to increase the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell according to claim 13 wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 1 to 69.

15. A method to increase the ratio of cytoplasmatic localisation versus nuclear localisation of a protein in an aberrant cell according to claim 13 or 14 wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 60 to 69.

16. A method for reducing the effects of a disease where enhanced cell proliferation or decreased cell death is observed comprising providing increasing the ratio of cytoplasmatic localisation versus nuclear localisation of a protein involved in said disease by providing said protein with a fragment of Apoptin capable of increasing the amount of cytoplasmatic protein in said cell.

17. A method for reducing the effects of a disease where enhanced cell proliferation or decreased cell death is observed according to claim 16, wherein said fragment of Apoptin comprises amino acids which in the Apoptin of Figure 1 are located between amino acids 1 to 69 or between amino acids 60 to 69. 1/4

Figure 1

1 NALQEDTPP GPSTVFRPPT SSRPLEΪPHC REIRIGIAGI TITLSΪ-CGCA NARAPTLRSA Si TADNSESTGF KNVPDLRTDQ PKPPSKKRSC DPSEYRVSEL KESLITTTPS RPRTARRRIR 121 I,

2/4

Figure 2

Generation of Apoptin mutants

A recombinant Apoptin cDNA C.sApoptin") was generated by ligation and subsequent cloning of overlapping DNA oligonucleotides. The sequence of the sApoptin cDNA is shown below:

Ec RX SiaaX Stul

* *

GAATTCGCCGCCATGAACGCTC'tCCAAGAAGATACTCCACCCGGgCCATCAACGGTΞTTCAGGCC-XlCAACA

•^■186 -+ + I + + +-- 5

CTTAAGCGGCGGTACTTGCGAGAGGTTCTTCTATGAGGTGGGCCTGGTAGTTGCCACAAGTCCGGTGGTTGr

M N A L Q F D T P P G P S T V F R P P 'l

Bag! Pstl BsaBI

TCAAGTGCCGGCAACCTTTGGGGAGTGACGTCTCTCTAGGCCTAACCATAGCGACCTTAA S S R P L F, T P H C R E I R I G I A G T

Bbvl BglXX

ACAATCACTCTATCGCTGTGTGGCrσCGCGAATGCTCGCGCTCCCACGCTAAGArcϊGCA 606 ^ +-^■ + + - + +-- C65

TGTTAGTGAGA-'AGCGACACACCGACGCGCTTACGAGCGCGAGGGTGCGATTCTAGACGT T I T I- S I, C G C A N A R P T L R S A

SacXX AgeX Bell

* * I *

ACCGC6gACAA-'TC\AGA. .CCACCGG-? TCRAG. TGTGCCGGACTTGAGGACg^flTCAA

666 + —— (•- -.-.+ ₊ ^ ₊ 72E

TGACGCCTGTTAAGTCTTTCGTGACCAAAGTTCTTACACGGCCTGAACTCCTGGCTAGTΓ T A D N S F, S T G F K N V P D L R T D O

BsrB-J Eαo47XXX Ξa.cl

* * *

CCC.^GCCTCCT3' G-^GAAGCGCTCC GCGACCCCTCCGAGTACAGGGTRAGCGAGC --- .26 + ^"-— + -. + I _{+ 785}

GGGT'rCGGAGGCJAGCTTCTTCGCTAGGACGCTGGGGAGGCTCATCTCCCATTCGCTCGA P K P P S K K R S C D P S E Y s ≥ 3/4 (Figure 2, co-vt.)

HindllX NgoMIV

*

2\AAGA.A*lGCrTGA TACCACTAC CCCAGCCGgCCCCGAACCGCAA.AAAGGCGTATAAGA

786 + -.^■ + 1 ^■ + ^■ T 84;

TTTCTTTCGAACTAATGGTGATGAGGGTCGGCTGGGGCTTGGCGTTTTTCCGCATATTCT

K E S L I T T T F S R P R T A K R I R

CTGTAAC CGAGGGA CG

846 +- 851

GACATTGAGCTCCCTAGG

L * Xhoϊ BamHl α.inear) AP<>f.m55918,gb_vi check: 3701 team: 486 Lo:

851

The upper strand shows the sequence of sApoptin with new unique restriction sites marked in red. The lower strand shows the wildtype Apoptin sequence.

This recombinant Apoptin cDNA contains numerous point mutations creating unique restriction sites within the Apoptin cDNA without altering the Apoptin. amino acid sequence.

For the generation of the various Ala-mutants oligonucleotides were synthesized containing nucleotide sequences coding for 5 consecutive Alanine residues and carrying the respective restriction sites for insertion at the requested site. For the a Apoptin deletion mutants stop codons were introduced into the sequence.

The oligos were annealed, and cloned into the vector pUCl9 - sApoptin that had been digested with the same restriction e»2ymes. After ligation and transformation, the entire mutant sApoptin cDNA was cloned into the vector pIN T7 IKESneo using the EcoRl and BamHl sites.

4/4