WO2002101076A2 - Methods for targeted expression of therapeutic nucleic acid - Google Patents

Abstract

Expression vectors that include a pre-selected therapeutic nucleic acid operably linked to a tumor specific or cell type-speci fic promoter and a Tcf-4β-catenin enhancer are provided. The therapeutic nucleic acid preferably includes a gene encoding a therapeutic protein for treatment of, for example, cancer. Methods for targeted expression of therapeutic nucleic acid, and methods for treating cancer, utilizing the expression vectors described herein, are also provided. Host cells are also provided that have been transformed with the expression vectors described herein.

Description

METHODS FOR TARGETED EXPRESSION OF THERAPEUTIC NUCLEIC ACID

The present invention was made with Government support under grant number R41 CA 77938-01 awarded by the National Institutes of Health. The Government has certain rights in this invention. CROSS-REFERENCE TO RELATED APPLICATIONS

The present application claims priority to U.S. provisional patent applications 60/297,831 and 60/361,137, filed June 13, 2001 and March 1, 2002, respectively, both of which are incorporated by reference herein in their entirety.

BACKGROUND OF THE INVENTION The present invention relates generally to expression vectors that may be used for tumor and/or cell-type targeted expression of therapeutic nucleic acid. More specifically, expression vectors for targeted expression of therapeutic nucleic acid that include a Tcf-4/β-catenin transcriptional enhancer, a rumor specific or cell type specific promoter element and a therapeutic nucleic acid are provided. Cancer gene therapy strategies offer the potential for improving current therapeutic targeting to tumor cells and increasing regulatory control of a desired course of treatment. The use of a gene to intercede at a therapeutic step that occurs early in cancer pathogenesis can allow fundamental phenotypic changes to the tumors [Gomez-Navarro, J. et al. (1999) E r. J. Cancer, 6, 867-885]. Like all therapies for cancer, and especially in regard to metastatic disease, a critical efficiency determinant is how specific the treatment is for the tumor cells as compared to its general toxicity of non-tumor cells. For gene therapies, this could be accomplished by tumor-specific targeting of vectors and by specifically restricting expression of the gene to only tumor cells. This latter approach could be achieved by expressing the therapeutic gene from a tumor specific regulatory element, and is a rapidly expanding area of cancer gene therapy research [Gomez-Navarro, J. et al. (1999) Eur. J. Cancer, 6, 867-885; and Nettlebeck, D. M. et al. (2000) Trends Genet., 16, 174-181]. A few representative examples of promoters that have been characterized for tumor specific expression of a therapeutic gene in various adenocarcinomas include carcinoembryonal antigen (CEA) [Osaki, T. et al. (1994) Cancer Res., 54, 5258-5261; Brand, K. et al. (1998) Gene Ther., 5, 1363-1371; and Cao, G. et al. (1999) Gene Ther., 6, 83-90], mucin-l(MUCl/DF3)[Chen, L. et al (1995) J. Clin. Invest., 96, 2775- 2782; and Stackhouse, M. A. et al. (1999) Cancer Gene Ther., 6, 209-219], and erbB2 [Stackhouse, M. A. et al. (1999) Cancer Gene Ther., 6, 209-219; and Ring, C. J. et al. (1996) Gene Ther., 3, 1094- 1103]. In general, these types of tumor-specific promoters alone can suffer from lack of activity and specificity if the underlying genetic defect is absent or variable within the targeted tumor type [Nettlebeck, D. M. et al. (2000) Trends Genet., 16, 174-181]. Methods for target expression of therapeutic nucleic acid for treatment of, for example, cancer are needed. The present invention addresses this need. SUMMARY OF THE INVENTION

It has been discovered that use of selected enhancer sequences in a vector may be utilized to direct tumor specific and/or cell-type specific expression of therapeutic nucleic acids. Accordingly, expression vectors for targeted expression of therapeutic nucleic acids that may be advantageously utilized, for example, in methods of treatment of various diseases or disorders, including cancer, are provided.

In one form, an expression vector includes a pre-selected therapeutic nucleic acid operably linked to a tumor specific or cell-type specific promoter and a Tcf-4β-catenin enhancer.

In another aspect of the invention, methods for targeted expression of therapeutic nucleic acid for the treatment of, for example, cancer are provided. In one embodiment, a method includes administering to a mammal in need of treatment a therapeutic vector that includes a pre-selected nucleic acid operably linked to a tumor specific or cell-type specific promoter and a Tcf-4β-catenin enhancer. The pre-selected nucleic acid preferably includes a gene that encodes a therapeutic protein.

In yet another aspect of the invention, host cells are provided that have use in, for example, production of desired therapeutic proteins, including desired polypeptides and peptides. The cells include an expression vector that includes a gene encoding a desired therapeutic protein. The gene is operably linked to a tumor specific or cell type-specific promoter and a Tcf-4β-catenin enhancer. A preferred tumor-specific promoter is the human c-fos promoter.

In yet another aspect of the invention, methods for treating cancer, including epithelial carcinomas such as colon cancer, are provided. In one embodiment, a method includes administering to a mammal in need of treatment a therapeutic vector that includes a pre-selected nucleic acid operably linked to a tumor specific or cell type-specific promoter and a Tcf-4β-catenin enhancer. In one form, the pre-selected nucleic acid includes a gene encoding a protein, and the method further comprises administering a prodrug that is activated by the protein to a product that is toxic to mammalian tumor cells.

It is an object of the invention to provide methods for targeted expression of therapeutic nucleic acid for the treatment of cancer.

It is a further object of the invention to provide expression vectors for use in treating cancer or otherwise providing desired proteins. It is a further object of the invention to provide methods for treating cancer.

These and other objects and advantages of the present invention will be apparent from the descriptions herein. BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A depicts a plasmid pTCF/fos-Luc, a luciferase reporter plasmid used to evaluate Tcf-4 activity in cell lines and includes a 4 repeat Tcf-4 responsive enhancer element with a murine c-fos promoter; FIG. IB depicts plasmid pFCT/fos-Luc, a negative control plasmid with scrambled Tcf-4 repeat elements (obtained from pFOPFLASH, a gift from Dr. Marc van de Wetering). FIG. 1C depicts a pTCF/fos-TK enhancer/promoter/gene schematic. This plasmid was used for the cell line expression of the herpes simplex virus type 1 thymidine kinase (HSV-TK) as described Example 4.

FIG. 2 shows a graph indicating the luciferase reporter activity in various human colon cell lines transfected with either pTCF/fos-Luc and pFCT/fos-Luc. CSC-1, NCM425 and NCM-460 cells are human colon cell lines derived from normal tissues as further described in Example 1. All other cell lines tested were established lines derived from human colon tumors.

FIG. 3 depicts a graph showing the luciferase activity associated with basal transcription in indicated cell lines transfected with pTOPLESS and pGL3 luciferase reporter plasmids as further described in Example 1. The gray bars indicate pGL3 Basic activity, the black bars pTOPLESS-Luc activity, and the numbers in parentheses are pTCF/fos-Luc activity for each cell line. HCT8, SW480, HCT116, Colo320 and SW620, human colon tumor cell lines; NCM460, normal colon mucosa cell line.

FIG. 4 shows a graph indicating luciferase reporter activity in primary human colon cells transfected with pTCF/fos-Luc. The indicated cell lines were transiently transfected with the pTCF/fos-Luc reporter plasmid. Luciferase activity results were normalized to a separate renilla- luciferase control assay as further described in Example 2. HCC, derived from human colon tumor tissues; COP, derived from pre-cancerous colon polyp tissues; NCM, derived from normal colon tissues.

FIG. 5 depicts a graph showing luceriferase reporter activity in colon cell lines transfected with pFCT/fos-Luc or pTCF/fos-Luc as further described in Example 3.

HCT8, SW480, HT29, Colo320, LoVo and SW620, human colon tumor cell lines; NCM460, normal colon mucosa cell line. Cells transfected with pFCT/fos-Luc include an "FCT" designation whereas cells transfected with pTCF/fos-Luc include a "TCF" designation.

FIG. 6 shows a graph indicating luciferase reporter activity in human breast tumor cells transfected with pTCF/fos-Luc and treated with doxorubicin, 9-cis retinioic acid, or butyrate as further described in Example 3. MDA435 and MDA231, human breast tumor cell lines.

FIG. 7 depicts a Western blot of showing expression of HSV-TK in cells transfected with cDNA-TK, pTcf-TK(includes SEQ ID NO:5) or psTCF-TK (includes SEQ ID NO:6), as determined with an anti-HSV-TK antibody and as further described in Example 4. SW620, SW480, HCT8, human colon tumor cell lines; NCM460, normal colon mucosa cell line;HSV-TK, Herpes Simplex Virus thymidine kinase; pcDNA-TK, deleted promoter construct derived from pcDNA3.1 plasmid that includes the HSV thymidine kinase gene; pTcf-TK that includes HSV thymidine kinase gene, one copy of a c-fos promoter (promoter sequence shown in SEQ ID NO:5) and four copies of Tcf-4/β- catenin enhancer; psTcf-TK that includes the HSV thymidine kinase gene, one copy of a truncated c- fos promoter (SEQ ID NO:6) and 4 copies of Tcf-4/β-catenin.

FIG. 8A shows a graph of the soluble extracted, phosphorylated ganciclovir (GCV) metabolites in cell lines transfected with pTcf-TK as further described in Example 4; FIG. 8B shows a graph of [³H]GCV incorporated into DNA in cell lines transfected with pTcf-TK as further described in Example 4. NCM460, normal colon mucosa cell line; SW480, SW620, HCT8; human colon tumor cell lines.

FIG. 9A depicts a graph showing the amount of cells remaining when SW480 cells (human colon tumor cell line), transfected with pTcf-TK, were treated with GCV; FIG. 9B shows a similar graph using NCM-460 (normal colon mucosa cell line) transfected cells. The experiment was performed as described in Example 4.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

For the purposes of promoting an understanding of the principles of the invention, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations and further modifications of the invention, and such further applications of the principles of the invention as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the invention relates.

The present invention relates to expression vectors that may be advantageously used, for example, for tumor and/or cell-type specific expression of desired or otherwise pre-selected therapeutic nucleic acids. The invention takes advantage of the accumulation of β-catenin in various cancers, including colon cancer and other epithelial carcinomas, which leads to upregulated gene transcription by the Tcf-4/β-catenin complex through binding to the Tcf-4/β-catenin enhancer. The inventors of the present invention have determined that vectors that include a Tcf-4/β-catenin enhancer operably linked to a tumor specific or cell type specific promoter and a desired therapeutic nucleic acid which preferably encodes a desired therapeutic protein allow for tumor specific or cell type specific expression of the nucleic acid. This specificity of expression allows greater flexibility in the administration of the therapeutic nucleic acid to patients in need of such treatment. For example, higher vector doses may be delivered as concerns of expression of the therapeutic nucleic acid in, for example, non-tumor cells or tissues is minimized. Methods for tumor and/or cell-specific expression of therapeutic nucleic acid for the treatment of, for example, cancer in a mammal are also provided, as are methods for treating cancer, such as epithelial carcinoma. Cell lines that produce a desired polypeptide are also provided herein.

In one aspect of the invention, expression vectors are provided for expressing a desired therapeutic nucleic acid in a mammal. A vector, as used herein and as known in the art, refers to a construct that includes genetic material designed to direct transformation of a targeted cell. A vector may contain multiple genetic elements positionally and sequentially oriented, i.e., operably linked with other necessary or desired elements such that the nucleic acid in a nucleic acid cassette can be transcribed and, if desired, translated in the transfected cell.

In one form, an expression vector includes a desired or otherwise pre-selected therapeutic nucleic acid including a nucleotide sequence that is operably linked to a tumor specific or cell type specific promoter and preferably at least one Tcf-4/β-catenin enhancer sequence. As defined herein, a nucleotide sequence is "operably linked" to another nucleotide sequence when it is placed in a functional relationship with another nucleotide sequence. For example, if a coding sequence is operably linked to a promoter sequence, this generally means that the promoter may promote transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, since enhancers may function when separated from the promoter by several kilobases and intronic sequences may be of variable lengths, some nucleotide sequences may be operably linked but not contiguous. Additionally, as defined herein, a nucleotide sequence is intended to refer to a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, and derivatives thereof. The terms "encoding" and "coding" refer to the process by which a nucleotide sequence, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce a polypeptide.

In a preferred form of the invention, the Tcf-4/β-catenin enhancer has the nucleotide sequence set forth in SEQ ID NO: 1 (5' AWCAAWGN 3' , wherein W is A or T/U and N may be A, G, C or T, preferably G). Additionally, the Tcf-4/β-catenin enhancer also includes the complementary strand of SEQ ID NO: 1 and is set forth in SEQ ID NO:2. The enhancer sequence set forth in SEQ ID NO: 1 may be positioned in the vector in a 5' to 3' direction and associated with its complementary strand set forth in SEQ ID NO:2. Alternatively, the enhancer sequence set forth in SEQ ID NO:2 may be positioned in the vector in a 5' to 3' direction and associated with its complementary strand set forth in SEQ ID NO:l. The vector may include more than one copy of the Tcf-4/β-catenin enhancer sequence. For example, the vector may include about one to about twenty Tcf-4/β-catenin enhancer sequences, preferably about three to about four sequences. Therefore, the vector may include about one, two, three, four or more nucleotide sequences as set forth in SEQ ID NO: 1 or, alternatively, SEQ ID NO:2. When present in more than one copy in the vector, the Tcf-4/β-catenin enhancer sequences are separated by at least about seven nucleotides, preferably about two to about fourteen nucleotides. In a preferred form of the invention, the Tcf-4/β-catenin enhancer sequences are separated by about seven nucleotides as seen in SEQ ID NO:3 and SEQ ID NO:4. The vector may include about one to about twenty of these sixteen nucleotide sequences may be present in the vector, preferably about three to four. These spacer nucleotide sequences serve to separate the enhancers arid may be selected from a wide variety of nucleotide sequences. A preferred spacer nucleotide sequence is set forth in SEQ ID NO:5 from nucleotide 35 to nucleotide 41. The spacer nucleotide sequences are typically selected so that they do not substantially interfere with the tumor-specific and/or cell-specific gene expression. By "substantially interfere", it is meant herein that nucleic acid transcript production will not be reduced by more than about 25%, preferably no more than about 10%, and further preferably no more than about 2% compared to transcript production utilizing the spacer nucleotide sequence set forth in SEQ ID NO:5 from nucleotide 35 to nucleotide 41. A preferred vector includes the above- referenced Tcf-4/β-catenin enhancer sequences, a promoter as described herein, a 5' mRNA leader sequence, a translation initiation site, a nucleic acid cassette that includes the desired sequence to be expressed, a 3' untranslated region, and a polyadenylation signal. As one further example, a vector may include the nucleotide sequence set forth in SEQ ID NO:5 (which includes four repeats of a Tcf- 4/β-catenin enhancer sequence extending from nucleotide 27 to nucleotide 79, the c-fos promoter extending from nucleotide 98 to nucleotide 276, a non-specific cloning artifact sequence from nucleotide 277 to nucleotide 304 and an ATG initiation site extending from nucleotides 305-307) or SEQ ID NO: 6 (includes four repeats of a Tcf-4/β-catenin enhancer sequence extending from nucleotides 27 to 79, a c-fos promoter extending from nucleotides 98 to 179, a non-specific cloning artifact sequenee extending from nucleotides 180 to 191, and an ATG initiation site extending from nucleotide 192 to nucleotide 194).

Recombinant expression vectors may be constructed by incorporating the above-recited nucleotide sequences within a vector according to methods well known to the skilled artisan and as described, for example, in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, Cold Springs Harbor, New York (1982). Other references describing molecular biology and recombinant DNA techniques are also further explained in, for example, DNA Cloning: A Practical Approach, Volumes I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. (1985)); Transcription and Translation (B. D. Hames & S. J. Higgins eds. (1984)); Animal Cell Culture (R. I. Freshney, ed. (1986)); Immobilized Cells And Enzymes (IRL Press, (1986)); and B. Perbal, A Practical Guide To Molecular Cloning (1984); and Current Protocols in Molecular Biology (Ausubel et al., eds.), John Wiley & Sons, which is regularly and periodically updated. A wide variety of vectors are known that have use in the invention. Suitable vectors include plasmid vectors, retroviral vectors, adenoviral vectors, adeno-associated virus vectors, and herpes viral vectors. The vectors may include other known genetic elements necessary or desirable for efficient expression of the pre-selected nucleic acid sequence.

It is realized that the Tcf-4/β-catenin enhancer nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 may be further modified and result in an enhancer that effectively promotes transcription of a desired gene. Standard procedures may be utilized to determine other enhancer sequences derived from SEQ ID NOS 1 or 2 that may function to promote transcription from a desired gene and that may have use in the present invention. The invention encompasses Tcf-4/β-catenin enhancer nucleotide sequences that have at least about 60% identity, preferably at least about 70% identity, more preferably at least about 80% identity, and further more preferably at least about 90% identity to the nucleotide sequence set forth in SEQ ID NO:l or SEQ ID NO:2 that functions to promote and/or otherwise enhance transcription of a desired or other pre-selected nucleotide sequence as described herein. Percent identity may be determined, for example, by comparing sequence information using the advanced BLAST computer program, version 2.0.8, available from the National Institutes of Health. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990) and as discussed in Altschul, et al., J. Mol. Biol. 215:403-410 (1990); Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877 (1993); and Altschul et al. Nucleic Acids Res. 25:3389-3402 (1997).

Additionally, Tcf-4/β-catenin enhancer nucleotide sequences having substantial similarity to the sequence set forth in SEQ ID NO:l and/or SEQ ID NO:2 are provided. By "substantial similarity", it is meant herein that the nucleotide sequence is sufficiently similar to a reference nucleotide sequence that it will hybridize therewith under moderately stringent conditions. This method of determining similarity is well known in the art to which the invention pertains. Briefly, moderately stringent conditions are defined in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^nd ed. Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press (1989) as including the use of a prewashing solution of 5X SSC (a sodium chloride/sodium citrate solution), 0.5% sodium dodecyl sulfate (SDS), 1.0 mM ethylene diaminetetracetic acid (EDTA) (pH 8.0) and hybridization and washing conditions of 55°C, 5X SSC. A further requirement of the Tcf-4/β-catenin enhancer nucleotide sequence is that it enhance transcription of a pre-selected nucleotide sequence, such as the nucleotide sequences herein encoding a pre-selected therapeutic gene.

The Tcf-4/β-catenin enhancer is operably linked to a tumor-specific or cell type-specific promoter. By "tumor specific", it is meant herein that the promoters are preferably active in tumor cells, and thus do not promote a significant amount of transcription of an operably linked nucleotide sequence, or are otherwise "silent", when present in normal cells and/or tissues (i.e., non-tumor cells and/or tissues). Such normal cells are characterized as having, for example, cell surface markers indicative of the specific normal cell type and do not migrate in soft agar. It will be understood, however, that tumor-specific promoters may have a detectable amount of "background" activity in those tissues in which they are silent. The degree to which a promoter is selectively activated in a target tissue can be expressed as a selectivity ratio (activity in a target tissue/activity in a control tissue). In this regard, a tumor-specific promoter useful in the practice of the present invention typically has a selectivity ratio of about 2 to about 1000, or more depending on the circumstances. Preferred selectivity ratios are at least about 2, more preferably at least about 10, further preferably at least about 50, more preferably at least about 100, and further more preferably at least about 500. It is more preferred that the tumor-specific promoters do not promote any quantity of transcription of an operably linked nucleotide sequence in a normal cell and/or tissue.

By "cell type specific", it is meant herein that the promoters are active preferably only in certain cell types (e.g., prostate cells) that form specified tissues and thus do not promote a significant amount of transcription of an operably linked nucleotide sequence, or are otherwise "silent", when present in a different cell type (e.g., breast cells). It is more preferred that the cell type specific promoters do not promote any quantity of transcription of an operably linked nucleotide sequence in a cell type other than the specified cell type. A wide variety of such tumor specific and cell type specific promoters may be selected. Exemplary tumor specific promoters include, for example, a fos promoter, including c-fos and v-fos; a cyclin D promoter, a cox-2 promoter, a myc promoter, including c-myc and v-myc, breast carcinoma specific promoters such as the HER2/neu promoter or carcinoembryonic antigen (CEA) promoter; hepatocellular carcinoma specific promoters such as carcinoembryonic antigen promoter; and adenocarcinoma specific promoters, such as mucin- 1(MUC1/DF3) promoter and an erbB2 promoter. Exemplary cell type specific promoters include, for example, liver specific promoters, such as the phosphoenolpyruvate carboxykinase promoter and the albumin promoter; B cell specific promoters such as the IgG promoter; pancreatic acinar cell specific promoters, such as the elastase promoter. Other tumor specific and cell type specific promoters may be selected by the skilled artisan and are further described, for example, in U.S. Patent No. 5,997,859.

The vectors include a desired or otherwise pre-selected therapeutic nucleic acid. As defined herein, a therapeutic nucleic acid is one which includes a nucleotide sequence which, when expressed, produces a product that will have a negative effect on growth and/or metastasis of a tumor. The product may be ribonucleic acid (RNA) or a protein, including peptides and polypeptides or combinations thereof. In preferred forms of the invention, the expression product of the therapeutic nucleotide sequence will allow for killing of the tumor cells. The expression product may act directly to have a negative effect on tumor cells, or may act indirectly through another agent. For example, the pre-selected therapeutic nucleotide sequence may be a gene encoding a protein that acts indirectly by activating a substrate, such as a prodrug, to an active form of the drug that will effect tumor cell death or otherwise have a negative effect on the tumor with respect to growth and/or metastasis. As used herein, the term "prodrug" means any compound useful in the methods of the present invention that can be converted to a product toxic to tumor cells (i.e., has a negative effect on growth and/or metastasis and preferably effects tumor cell death). The prodrug is converted to a toxic product by the gene product of the therapeutic nucleic acid sequence in the vector useful in the method of the present invention. Representative examples of such a prodrug include ganciclovir which is converted in vivo to a toxic compound by HSV-thymidine kinase. Other representative examples of prodrugs include acyclovir, l-(2-deoxy-2-fluoro-β.-D-arabinofuranosyl)-5-iodouracil (FIAU), 6-methoxypurine arabinoside, and 5-fluorocytosine. Exemplary therapeutic genes include those coding for herpes simplex virus thymidine kinase (activates, e.g., ganciclovir), Varicella-Zoster virus thymidine kinase (activates, e.g., 6-methoxypurine arabinoside) and cytosine deaminase (activates 5-fluorocytosine).

Alternatively, the pre-selected therapeutic nucleic acid may encode an antisense nucleic acid sequence that may directly prevent transcription and/or translation of, a gene involved in the carcinogenic process. The antisense nucleic acid may be designed to, for example, bind to transcriptional control regions of an oncogene to prevent transcription of the oncogene. Many of such oncogenes, and their nucleotide sequences, are known to the art, and include, for example, Ras, Myc, Abl, Rel, Her-2, Raf, Fms, Fos, Jun, p53 and Sis. Such oncogenes encode, for example, altered forms of growth factors, receptor tyrosine kinases, membrane associated non-receptor tyrosine kinases, membrane associated G Proteins, serine/threonine kinases or transcription factors. The antisense nucleotide sequence may have a length of at least about 20 nucleotides, but may range in length from about 20 to about 1000 nucleotides, or may be the entire length of the gene target. The skilled artisan can easily select an appropriate target and select an appropriate length of antisense nucleic acid in order to have the desired therapeutic effect by standard procedures known to the art, and as described, for example, in Methods in Enzymology, Antisense Technology, Parts A and B (Volumes 313 and 314) (M. Phillips, Ed.), Academic Press, (1999). In yet other forms of the invention, the therapeutic nucleic acid may be a gene that encodes a protein that is itself toxic to the particular cell and therefore may act directly in having a negative effect on tumor cells. For example, exemplary genes in this category include those encoding diphtheria toxin, ricin, pseudomonas exotoxin, or portions thereof toxic to mammalian cells, including diphtheria toxin A chain, and ricin A chain. Such genes, or other genes suitable for use in the invention, are more particularly described in U.S. Patent No. 6,057,299. Other bacterial or other microbial toxins known to the art may be utilized.

In yet other forms of the invention, the pre-selected therapeutic nucleic acid may also encode a protein product that has some other benefit to a mammal, as more fully described below.

In yet another aspect of the invention, host cells that may advantageously form cell lines are also provided herein. The cells include a vector as described above. Such vectors may be utilized to transfect cells in cell culture in order to generate a cell line that contains the expression vector and which will produce the polypeptide of interest. When expressed in a cell line as described herein, the vector preferably includes a nucleotide sequence that encodes a therapeutic protein that can provide some advantage to a mammal. For example, the protein may be one that is no longer produced in the mammal, is produced in insufficient quantities to be effective in performing its function, or is mutated or otherwise altered such that it either no longer functions or is only partially active for its intended function. Examples of such proteins that may advantageously be produced in the cell lines described herein include growth hormone, insulin, adenosine deaminase, cytokines, growth factors, cystic fibrosis transmembrane conductance regulator and low density lipoprotein receptor or other desired products that are desired to be produced in, for example, relatively high yields. Additionally, a preferred vector is one that includes other nucleotide sequences, such as those encoding selectable markers known to the art. For example, the selectable marker may be include genes encoding bleomycin, adenosine deaminase, aminoglycoside phophotransferase, histidinol dehydrogenase, or other mammalian selectable markers known to the art. A wide variety of cell lines may be transfected with the vectors. Preferred cell lines are mammalian cell lines, and preferably human cell lines. A preferred cell line is one that, for example, includes elevated levels of Tcf-4/B-catenin complexes available for binding to the enhancer sequences described herein for enhancing transcription of a desired protein or other expression product. Exemplary cell lines include human colon tumor cell lines such as HT-29, WiDr, SW620, SW480, HCT-8, Colo205 and HCT- 116.

Where it is desired to produce a particular protein that may be subsequently isolated from the cell lines described herein, the vectors may further include another nucleotide sequence insert that encodes a protein that may aid in the purification of a desired protein that may be expressed in cell lines described herein. The additional nucleotide sequence may be positioned in the vector such that a fusion, or chimeric, protein is obtained. For example, a desired protein may be produced having at its C-terminal end linker amino acids, as known in the art, joined to the other protein. The additional nucleotide sequence may include, for example, the nucleotide sequence encoding glutathione-S- transferase (GST). After performing purification procedures known to the skilled artisan, the additional amino acid sequence can be cleaved with an appropriate enzyme. For example, if the additional amino acid sequence is that of GST, then thrombin may be used to separate the desired protein from GST. The desired protein may then be isolated from the other proteins, or fragments thereof, by methods known to the art.

In yet another aspect of the invention, methods for treating cancer are also provided. In one form, a method includes administering to a mammal in need of treatment a vector that includes a preselected therapeutic nucleic acid sequence operably linked to a tumor specific or cell type specific promoter and a Tcf-4/β-catenin enhancer. The desired therapeutic nucleotide sequence, such as a preselected therapeutic gene, may then be expressed to form an expression product to treat the particular cancer. The preferred expression product and vector have been described in detail herein. The treatment may result in a decrease in the size, proliferation and/or metastasis of the tumor, and preferably results in killing of the tumor. The method may be used to treat, for example, dysplasia, pre-cancer and cancer. As known in the art, the term cancer refers to a disease that affects a wide variety of cell types. The disease is characterized by an abnormal proliferation of cells and/or tissues, which may take the form of a tumor. The properties of cancerous cells are well known to the skilled artisan and include exhibition of loss of contact inhibition, invasiveness and the ability to metastasize. A wide variety of tumors may be treated according to the methods of the present invention. Exemplary tumors arise from cancers that include, for example, epithelial carcinomas, and adenomas. Such cancers may affect organs, including tissues and cells derived therefrom, selected from, for example, colon, prostate, breast, ovaries, esophagus, and stomach.

The vector may be administered to the mammal in a wide variety of ways. In one form, the vector may be administered in vivo, by, for example, direct injection into the tumor of interest. In another form, a vector may be administered using an ex vivo strategy. The affected mammalian tissue may be harvested under sterile conditions, cultured and transfected with the vector by a wide variety of known methods. Such methods are known to the art and include mechanical methods, chemical methods, lipophilic methods and electroporation. Exemplary mechanical methods include, for example, microinjection and use of a gene gun with, for example, a gold particle substrate for the DNA to be introduced. Exemplary chemical methods include, for example, use of calcium phosphate or DEAE-Dextran. Exemplary lipophilic methods include use of Iiposomes and other cationic agents for lipid-mediated transfection. Such methods are well known to the art and many of such methods are described in, for example, Gene Transfer Methods: Introducing DNA into Living Cells and Organisms, (Norton and Steel (eds.), Biotechniques Press (2000); and Current Protocols in Molecular Biology (Ausubel et al., eds.), John Wiley & Sons, which is regularly and periodically updated.

The vector is administered to the mammal in an amount sufficient to allow expression of the therapeutic gene in desired or otherwise targeted cells, such as tumor cells. This amount may vary depending on the nature of the therapeutic gene, the nature of the vector, the extent and nature of the disease, and the cell type and such an amount may be determined by the skilled artisan.

The vector is preferably administered to a mammal in need of treatment. A wide variety of mammals may be treated according to the methods of the present invention. Exemplary mammals include humans, dogs, cats, and farm animals, such as cattle, sheep, goats, and pigs, or other desired mammal.

In preferred forms of a method of treating cancer, a composition that includes a transcriptional regulatory agent that regulates transcription of the therapeutic nucleotide sequence may be administered in addition to administration of the aforementioned expression vector. The composition may include a transcriptional regulatory agent that may increase or decrease transcriptional activation of the pre-selected nucleotide sequence. Decreasing transcriptional activation of the pre-selected nucleotide sequence allows control over the expression if such expression should not be desired in some circumstances after the vector has been administered. Exemplary agents that increase transcriptional activation include short chain fatty acids, including salts thereof; and phorbol esters, or a combination thereof. By "short chain fatty acid", it is meant herein a fatty acid having a carbon chain length no longer than about 12 carbon atoms, preferably about 3 to about 6 carbon atoms. A preferred short chain fatty acid is butyric acid, and preferably a salt thereof, such as sodium butyrate. Exemplary agents that decrease transcriptional activation include doxorubicin, and retinoids, such as cis-retinoic acid. The agent may be administered prior to or after administration of the vector or it may be co-administered with the vector.

The mammal in need of treatment is preferably treated with the composition that includes a transcriptional regulatory agent in an amount sufficient to regulate, such as increase or decrease, transcription as desired. This amount may vary depending on the circumstances. For example, in the treatment of cancer, including epithelia carcinomas, such as colon cancer, the amount of transcriptional regulatory agent utilized may depend on the nature and extent of the cancer, the nature of the therapeutic nucleic acid utilized, and the nature of the expression vector. Such amounts may be readily determined by the skilled artisan.

In yet another aspect of the invention, methods for targeted expression of therapeutic nucleic acids are provided. The methods advantageously allow for tumor-specific and/or cell-specific expression of the therapeutic nucleic acids. In one form, a method includes administering to a mammal in need of treatment a vector that includes a pre-selected therapeutic nucleic acid sequence operably linked to a tumor specific or cell type specific promoter and a Tcf-4/β-catenin enhancer. The pre-selected nucleotide sequence, such as a pre-selected gene, may then be expressed to form an expression product to treat the particular disease or other disorder. The expression product and vector have been described in detail herein. , Reference will now be made to specific examples illustrating the vectors, host cells and methods above. It is to be understood that the examples are provided to illustrate preferred embodiments and that no limitation to the scope of the invention is intended thereby.

EXAMPLES

In accordance with the present invention, a unique combination of gene transcriptional regulatory elements with increased specificity for colon and other epithelial tumors was tested for expression of cancer therapeutic genes. More specifically, Tcf-4/β-catenin enhancer/c-fos promoter luciferase reporter cassette ("pTCF/fos-Luc") was tested in a series of primary and established human colon cells derived from normal, polyp, and tumor tissues. To examine the expression of a therapeutic gene, the same TCF/fos element was linked with the herpes simplex virus type-1 thymidine kinase (HSV-TK) gene. HSV-TK in combination with the prodrug ganciclovir (GCV) has been utilized in many pre-clinical and clinical studies for the treatment of different cancers [Freeman, S. M. (1996) Sem. Oncol., 23, 31-45]. The rationale for this approach is based on the ability of HSV- TK to selectively phosphorylate GCV, which ultimately leads to GCV incorporation into DNA and cell death via cell cycle arrest and as yet uncharacterized apoptotic pathways [Drake, R. R. et al. (1999) J. Biol. Chem., 274, 37186-37192; and Halloran, P. J. et al. (1998) Cancer Res., 58, 3855- 3865]. In vivo, GCV-mediated cell killing initiates a primary inflammatory-like immune response against the tumor that can lead to long-term secondary tumor immunity responses [Freeman, S. M. (1996) Sem. Oncol., 23, 31-45; Freeman, S. et al (1997) Lancet, 349, 2-3; and Melcher, A. et al. (1998) Nature Med., 4, 581-587]. To characterize the specific expression of HSV-TK by Tcf-4/β-catenin, a series of human colon cell lines derived from human tumor or normal colon tissues were used [Moyer, M. P. et al. (1996) In Vitro Cell. Devel. Biol.: Animal, 32, 315-317]. These cell lines were screened for luciferase reporter gene activities, and then a subset was characterized for HSV-TK expression and GCV cell killing.

Materials and Methods for Examples Cell Lines

The human colon tumor cell lines HT-29, WiDr, SW620, SW480, HCT-8, COLO205 and HCT-116 were obtained from ATCC. The NCM460 (normal colon mucosa) and NCM425 cell lines were developed by INCELL Corp. (San Antonio, TX) from patients with non-diseased colon. The CSC-1 (colon crypt stem cell) cell line was derived from uninvolved, colon mucosa tissue near the resected margin of a removed human adenocarcinoma [Moyer, M. P. et al. (1996) In Vitro Cell. Devel. Biol: Animal, 32, 315-317; and Stauffer, J. S. et al. (1995) Amer. Jour, of Surgery, 169, 190- 196]. Unless indicated, all cell lines were maintained in M3:10 media (obtained from INCELL Corp.). A panel of epithelial cells derived from 3 polyp (COP), 6 tumor (HCC) and 4 normal (NCM) patient cells were brought out of cryopreservation and maintained in M3:20 (INCELL), including two sets of normal-tumor pairs (NCM218/HCC195; NCM625/HCC451) derived from the same patient.

Tcf-4/β-catenin Luciferase Constructs and Transfections

The luciferase reporter plasmids pTCF/fos-Luc and pFCT/fos-Luc were kindly provided by Dr. Mark van der Wetering [Korinek, V. et al. (1997) Science, 275, 1784-1787]. The pTCF/fos-Luc construct comprises four tandem repeats of the Tcf-4 binding sequence (ATCAAAGG, 82 bp total), 5' to a murine c-fos promoter (194 bp) driving expression of the luciferase gene. The pFCT/fos-Luc was designed as a negative control plasmid that contains altered repeat sequences (GCCAAAGG) not recognized by Tcf-4 [Korinek, V. et al. (1997) Science, 275, 1784-1787]. The Tcf-4 enhancer-deleted vector, pTOPLESS, was generated by digesting pTCF/fos-Luc with Sal I to remove the 82 bp enhancer sequences. Following gel purification, the pTOPLESS plasmid was generated by re-ligation of the Sal I site.

For the data reported in FIG. 2, 2 X10⁶ cells were transiently transfected by being electroporated (1180 volts/240 resistance; GIBCO/BRL) in triplicate with 10 Dg of the pTCF/fos-Luc or pFCT/fos-Luc plasmid. For the INCELL epithelial cell line series, cells were transfected using a panel of lipids supplied in the Perfect Lipid Transfection kit (InVitrogen). For each cell line, 5 X 10⁵ cells were seeded (in triplicate) into a 24- well plate (Costar) in M3:20 media provided by INCELL Corp. The following day, lipids #2 and #6 were used in combination in a 6:6:2 ratio (μg) of each lipid to the reporter DNA plasmid. As an internal control for transfection efficiencies, a Renilla luciferase plasmid, pRL-TK (Promega), under transcriptional control of a minimal HSV-TK promoter was used at ratios of 10: 1 with pTCF/fos-Luc or pFCT/fos-Luc. For all other reporter assays presented, transient transfection of 2 X 10⁵ cells with 2 μg pTCF/fos-Luc, 1 μg pRL-TK, and 8-14 μl lipofectin reagent (GIBCO/BRL) was performed. Where indicated, butyrate or another compound were added 24 hr. post-transfection. For all luciferase reporter assays, a Dual-Luciferase Reporter kit from Promega and a Turner TD-20e luminometer were used to determine luciferase activity, which is expressed as the ratio (relative light units, RLU) of firefly luciferase activity to Renilla luciferase activity 48 hrs. post-transfection (or electoporation).

pTcf-TK The 5' DNA sequences comprising the Tcf-4 enhancer, c-fos promoter, and luciferase gene start site in pTOPFLASH were sequenced. Primers specific for a 300 bp fragment comprising the Tcf4/β-catenin-c-fos enhancer/promoter sequences were designed with 5'-BglII and 3 -BamHI sites incorporated. Illustrated in Table 1, the Bglll primer was

5'-GTAAGATCTGTTTCTAGAGTCGACCTGCAGCCCAAG-3' (SEQ ID NO: 7) and the BamHI primer was 5'-GTAGGATCCATGGGAGATCCTCTAGAGAGACACTGT-3' (SEQ ID NO: 8). The resulting PCR product was purified and digested with Bglll and BamHI, then ligated into a Bglll site in the plasmid pcDNA-TK derived from ρcDNA3 (Promega). The CMV promoter element and portions of the multiple cloning site of pcDNA3 were removed by prior digestion with Bglll and BamHI, and a 1.1 kb HSV-TK gene with 5 -Bglll and 3'-BamHI ends was ligated into this site [Drake, R. R. et al. (1999) J. Biol. Chem., 274, 37186-27192]. The 300 bp PCR product was subsequently ligated into the Bglll site of the pcDNA-TK vector.

A second (186 bp) vector (SEQ ID NO: 6) containing the Tcf-4 enhancer and c-fos promoter elements was constructed that contained 114 bp between the ATG start site and 3' end of the c-fos promoter of the first Tcf/c-fos construct (SEQ ID NO:5). For this purpose a new BamHI primer, 5'- GCGGATCCCGTGCAGTCGCGGTTGGAGTAGT AGGCGCC-3' (SEQ ID NO:9) was designed for the 3' end. A 186 bp product was PCR amplified using the 5'BgIlT primer (SEQ ID NO:7) and 2nd BamHI primer (SEQ ID NO:9). pTOPFLASH was used as a template DNA. The amplified product was purified, digested with Bglll / BamHI and ligated with Bglll digested pcDNA-TK as above to generate a second pTcf-TK construct (SEQ ID NO. 5).

Transient Transfection of Cell Lines with Tcf-TK : GCV Metabolism, Cell Killing and HSV-TK Western Blotting

A standard transfection condition was the use of 1.75 μg plasmid DNA and 11 μl lipofectin reagent (GIBCO/BRL) per 0.2 X 10⁶ cells in 1.0 ml OPTIMEM media, incubated for 18 hrs. Variations to this protocol are indicated where appropriate. For metabolic labeling experiments,

SW480, HCT8, SW620 and NCM460 cells were plated at 0.4 X 10⁶ cells/well and transfected for 18 hrs with 11 μl lipofectin reagent plus 1.75 μ pcDNA-TK, 1.75 μg pTcf-TK(SEQ ID NO:5) or 1.75 μg pTcf-TK(including SEQ ID NO:6), each condition in triplicate. Control wells were incubated with 11 μl lipofectin reagent alone. The cells were then incubated in 1 ml fresh media containing 1 μM [³H]GCV for 18 hrs. Cells were extracted in 70 % methanol and evaluated for levels of phosphorylated GCV and incorporation of GCV into DNA as previously described in [Drake, R. R. et al. (1999) /. Biol. Chem., 2 , 37186-37192], For cell killing with GCV, SW480 cells were plated at 0.15 X 10⁶ cells/well and transfected for 16 hrs with 11 μl lipofectamine alone, 1.75 μg of pcDNA-TK or 1.75 μg pTcf-TK, each condition in triplicate. Fresh media (3 ml) containing 10 μM GCV was added to the cells for 48 hrs. Viable cell numbers were determined using trypan blue dye exclusion and automated cell counting. Western blot analysis of each cell line was done using a polyclonal, rabbit anti-HSV-TK antibody (a gift from Dr. Margaret Black, Washington State University) [Drake, R. R. et al. (1999) J. Biol. Chem., 21 A, 37186-37192]. Cell numbers were normalized to 1 X 10⁶ cells/0.1 ml gel loading buffer, and equal protein loading was quantitated as previously described in Drake, R. R. et al. [(1999) /. Biol. Chem., 21 A, 37186-2719], Blotted HSV-1 TK protein bands were visualized on film using ECL chromophore reagents (Amersham).

EXAMPLE 1 Tcf-4 Reporter Activity in Colon Cell Lines Based on the frequent mutations of APC and β-catenin in colorectal carcinomas and the resulting increase in gene regulation by nuclear localized Tcf-4/β-catenin complexes [Kinzler, K. W. et al. (1996) Cell, 87, 159-170; Morin, P. J. et al. (1997) Science, 275, 1787-1790; and Rubinfeld, B. et al (1997) Science, 275, 1790-1792], a Tcf-4/β-catenin enhancer motif linked with a promoter was tested herein as a tumor specific gene expression element. In order to identify candidate cell lines for further analysis with expression of a therapeutic gene, a panel of nine human colon tumor and normal cell lines were screened for luciferase reporter gene activities using pTCF/fos-Luc (Tcf-4/β-catenin enhancer/c-fos promoter-luciferase gene construct obtained from pTOPFLASH, a gift from Dr. Marc van de Wetering)) and an inactive form, pFCT/fos-Luc (FCT is a mutated, non-functional Tcf4 enhancer) (see FIG. 1). The screen included two cell lines, SW480 and SW620, that have been previously reported to have high Tcf/β-catenin dependent activity [He, T. C. et al. (1998) Science, 281, 1509-1512; Crawford, H. C. et al. (1999) Oncogene, 18, 2883-2891; and Korinek, V. et al. (1997) Science, 275, 1784-1787]. Each tumor line is known to have a mutated APC gene [Ilyas, M. et al. (1997) Proc. Nat. Acad. Sci. USA, 94, 10330-10334].

For use as potential negative control cell lines, two non-tumor colon cell lines were tested. The NCM460 and NCM425 (normal colon mucosa) cell lines were developed by Incell Corp. from patients with non-diseased colon and the CSC-1 (colon crypt stem cell) cell line was developed from Incell Corp. and derived from uninvolved, colon mucosa tissue near the resected margin of a removed human adenocarcinoma [Moyer, M. P. et al, (1996) In Vitro Cell. Devel. Biol: Animal, 32, 315-317; and Stauffer, J. S. et al. (1995) Amer. Jour, of Surgery, 169, 190-196]. Although these "normal" colon cells are immortalized and have been characterized immunohistochemically as having mutant p53 protein, they have most cell surface markers indicative of normal colon cells, do not form tumors when infected into nude mice and do not migrate in soft agar [Moyer, M. P. et al. (1996) In Vitro Cell. Devel. Biol: Animal, 32, 315-317; and Stauffer, J. S. et al. (1995) Amer. Jour, of Surgery, 169, 190- 196]. The CSC-1 line has been shown to express a truncated form of APC, but has minimal Tcf-4 and β-catenin protein expression [Mann, B. et al. (1999) Proc. Nat. Acad. Sci. USA, 96, 1603-1608].

As shown in FIG. 2, the SW480, SW620, Colo 320 and HCT-8 cell lines displayed the most Tcf-4/β-catenin dependent activity between the pTCF/fos and pFCT/fos luciferase activities. The normal colon-derived NCM460 and CSC-1 cells had barely detectable Tcf-4/β-catenin enhancer activities, and are therefore consistent with being good negative controls. Using a luciferase reporter plasmid lacking the Tcf-4 enhancer elements, pTOPLESS-Luc, the luciferase activity ratios in HCT-8, SW480, HCT116 and NCM460 cells were 57-fold, 15-fold, 7-fold and 9-fold lower respectively than pTCF/fos luciferase activities (see FIG. 3). For the data in FIG. 3, the indicated cell lines were plated (2 X 10⁵/well) and transfected with lipofectamine (10 μl/well), 2 μg of pTOPLESS-Luc, pGL3 Basic or pTCF/fos-Luc plasmid, and 1 μg of renilla-TK plasmid in 1.5 ml OPTIMEM media for 18 hrs. Fresh media was added, and 48 hrs. later the cells were analyzed for luciferase activity. Furthermore, a comparison of the activities of pTCF-Luc, pTOPLESS, and a luciferase plasmid driven by a strong constitutive murine retroviral LTR (long terminal repeat) promoter (pGL3-LTR) were examined in the three normal colon cell lines and SW620 cells, the results of which are seen in Table 2.

Table 1. Firefly and Renilla Luciferase Activities in Selected Cell Lines Transfected with pTCF/fos-Luc, pTOPLESS or pGL3-LTR*

Cell Line/Promoter No TCF (RLU Ratio) + TCF Enhancer (RLU Ratio)

CSC-1 - Fos 0.009 0.04

CSC-1 - LTR 6.0

NCM460 - Fos 0.003 0.04 NCM460 - LTR 8.7

NMC425 - Fos 0.06 0.39

NCM425 - LTR 16.7

SW620 - Fos 0.32 4.2

SW620 - LTR 7.4

Because the pGL3-LTR activity was consistently high in the normal cell lines and SW620 tumor line (Table 1), but TCF-fos activity was low in the normal cell lines, these results again highlight the tumor specific responsiveness of the TCF-fos element.

EXAMPLE 2 Tcf-4 activity in Primary Cell/Tissue

Although many colon cancer cell lines have provided much information about colon cell regulation and certain aspects of malignancy, extensive comparative differential analyses between normal, pre-malignant and malignant cells have not been possible primarily due to the short-term nature of cultures derived from GI mucosal epithelium [Stauffer, J. S. et al. (1995) Amer. Jour, of Surgery, 169, 190-196]. Recently, a series of new, continuous GI cell lines derived from freshly isolated tissues from patients with and without colon disease have been developed by selective culturing of epithelial cells in enriched media [Moyer, M. P. et al. (1996) In Vitro Cell. Devel. Biol: Animal, 32, 315-317; and Stauffer, J. S. et al. (1995) Amer. Jour, of Surgery, 169, 190-196]. A panel of these new cell lines representing tissues derived from normal (NCM), polyp (COP), and tumor (HCC) were used for transfection studies with the pTCF/fos-Luc reporter plasmid. The colon cell lines indicated in FIG. 4 (developed by Incell Corp.) were plated (2 X 10⁵/well) and transfected with lipofectamine (10 μl/well), 2 μg of pTCF/fos-Luc plasmid or pFCT/fos-Luc plasmid, and 1 μg of renilla-TK plasmid in 1.0 ml OPTIMEM media for 18 hrs. Fresh media was added, and 48 hrs. later, the cells were analyzed for luciferase activity. At 24 hrs. post fresh media addition, half of the plated cells were treated with butyrate (1.4 mM) for an additional 24 hrs.

As shown in FIG. 4, all of the NCM lines tested had minimal Tcf-4/β-catenin dependent activities relative to the COP and HCC lines. One of the three polyps (COP14) showed a 2-fold increase over NCM, while 5 out of the 6 tumor lines had a 2-fold or higher increase in activity compared to the NCM lines. If the average luciferase activities in each cell category were determined, the COP and HCC cells demonstrated over 2-fold and 7-fold increases in activity relative to the NCM cells.

EXAMPLE 3

Effects of Butyrate on pTCF/fos-Luc and pFCT/fos-Luc Activities

The short chain fatty acid, butyrate, has been reported to increase the expression of Tcf-4/β- catenin responsive genes [Bordonaro, M. et al. (1999) Cell Growth Diff., 10, 713-20; and Barshishat, M. et al. (2000) British J. Cancer, 82, 195-203]. This drug was added to SW620, Colo320, HCT8, SW480, HT-29, NCM460, and LoVo cell lines to assess the effects on luciferase reporter activities of pTCF/fos-Luc and pFCT/fos-Luc. Cells (8 wells/cell line) were transfected with lipofectamine (12 μl per 2 X10⁵ cells) and 2 μg pTCF/fos-Luc (or pFCT/fos-Luc)/ 1 μg pRL-TK plasmids for 24 hrs., followed by growth in regular media for 24 hrs. To half of the transfected cells, an optimized dose of 1.4 mM butyrate was added for an additional 24 hrs. prior to evaluation of luciferase activities. Fresh media was added, and 48 hrs. later, the cells were analyzed for luciferase activity. At 24 hrs. post fresh media addition, half of the plated cells were treated with butyrate (1.4 mM) for an additional 24 hrs.

As shown in FIG. 5, the addition of butyrate resulted in a 4-fold increase in RLU activity in the HCT-8 cells transfected with pTCF/fos-Luc, while decreased activity ratios were observed in other high activity lines like Colo320, SW480, and SW620. The NCM460, HT-29, and LoVo cells had minimal pTCF/fos-Luc activities with or without butyrate. What is not apparent from the ratio data in FIG. 5 is the effect on the two luciferase activities. The individual firefly and renilla luciferase numbers for some of these cell lines are presented in Table 2.

Table 2. Firefly and Renilla Luciferase Activities in Selected Cell Lines Transfected with pTCF/fos-Luc and pFCT/fos-Luc, plus and minus 1.4 mM Butyrate, 24 hr. Treatment.

Ratios Firefly Luciferase (RLU) Renilla Luciferase (RLU) (FireflyrRenilla)

Cell Line (FCT/TCF) - butyrate + butyrate - butyrate + butyrate - butyrate -butyrate

HT29 - FCT/fos 0.2 1.8 72 320 0.003 0.005

HT29 - TCF/fos 0.8 6.0 40 211 0.021 0.027

LoVo - FCT/fos 5.4 31 1269 1450 0.004 0.022

LoVo - TCF/fos 50 340 932 1106 0.052 0.31

Colo320 - FCT/fos 9.0 156 103 15500 0.09 0.01

Colo320 - TCF/fos 676 21570 122 9310 5.5 2.3

HCT8 - FCT/fos 4.4 36 4.7 1501 0.09 0.03

HCT8- TCF/fos 22 2368 19 432 1.4 5.5

SW620 - FCT/fos 19 40 3050 0.38 0.03

SW620 - TCF/fos 186 2712 44 2169 4.4 1.25

In each cell line tested, the presence of butyrate resulted in 7-fold increases in pTCF/fos-Luc reporter activities in the weak responders (HT-29, LoVo), and increased 14-, 32- and 108-fold in the SW620, Colo320, and HCT8 cells, respectively. There is also a correspondingly large increase in renilla luciferase activity controlled by a basal thymidine kinase promoter. Luciferase activities driven by FCT/fos were also enhanced with butyrate, but not to the same degree as with the correct Tcf4 motif of pTCF/fos.

Compounds like doxorubicin [Yang, S. Z. et al. (1999) Int. J. Oncvol, 15, 1109-1115] and 9- cis-retinoic acid [Easwaran, V. et al. (1999) Curr. Biol, 9, 1415-1418] have been reported to transcriptionally repress expression of Tcf-4/β-catenin responsive genes. MDA435 and MDA231 cell lines were plated (2 X 10⁵/well) and transfected with lipofectamine (11 μl/well), 2 μg of pTCF/fos-Luc plasmid, and 1 μg of renilla-TK plasmid in 1.0 ml OPTIMEM media for 18 hrs. Fresh media was added, and 48 hrs. later, the cells were analyzed for luciferase activity. At 24 hrs. post fresh media addition, a portion of the plated cells were treated with 1 μM doxorubicin, 2.5 μM 9-cis- retinoic acid or 1.4 mM butyrate for an additional 24 hrs. As shown in FIG. 6, 1 μM doxorubicin added for 24 hrs to two human breast tumor cell lines, MDA-435 and MDA-231, transfected with TCF/fos-Luc resulted in a 5- 10-fold reduction in RLU activities compared to untreated transfected control cells. Under similar conditions, the addition of 9-cis-retinoic acid (2.5 μM) had little effect. As presented in Table 3, the effects of doxorubicin, 9-cis-retinoic acid, and butryate (1.4 mM) on the individual firefly and renilla luciferase activities are shown.

Table 3. Firefly and Renella Luciferase Activities in MDA-231 and MDA-435 Breast Tumor Cell Lines Transfected with pTCF/fos-Luc, plus and minus 2.5 μM 9-cis-Retinoic Acid, 1 μM Doxorubicin or 1.4 mM Butyrate, 24 hr. Treatment.

Firefly Renilla Ratio Firefly Renilla Ratio

Cell Line No Drug No Drug (RLU) Doxorub Doxorub (RLU)

MDA-231 - TCF/fos 9.2 19.8 0.46 10.9 242 0.04

MDA-435 - TCF/fos 4.4 13.3 0.33 1.9 32 0.06

Firefly Renilla Ratio Firefly Renilla Ratio

Cell Line cisRA cisRA (RLU) butyrate butvrate butvrate

MDA-231 - TCF/fos 8.8 16.9 0.52 29.9 278 0.11

MDA-435 - TCF/fos 5.0 20 0.25 16.8 248 0.07

Like butyrate, it appears that doxorubicin is affecting the activity of many transcription factors based on the increased basal Renilla luciferase activities. However, the effect is repressive on firefly luciferase, as compared with the activation of the butyrate treated cells.

EXAMPLE 4

Generation of pTCF-TK and Expression in Cell Lines

The two versions of Tcf-4/β-catenin enhancer and c-fos promoter sequences were PCR- amplified and inserted into the plasmid pcDNA-TK as described in accordance with the Materials and Methods section of the present application. The sequence of the 5' region incorporating the Tcf4/β- catenin enhancer and c-fos promoters sequences is shown in the sequence listing as SEQ ID NOS:5 and 6. Also shown in the Sequence Listing is SEQ ID NO:l, and its complementary sequence SEQ ID NO:2, which represents a Tcf enhancer that may be repeated in a vector. Multiple copies of the repeat can be used in the plasmid, although the preferred number is 3 or 4 copies. The murine c-fos promoter sequence is present in SEQ ID NOS:5 and 6 as nucleotides 98 to 179. The two new plasmids, termed pTcf-TK, were used to transfect the NCM460, HCT-8, SW480, and SW620 cell lines. Attempts at isolating individual G418-resistant clones, or cell pools from the transfected HCT8, SW480 and SW620 cells were made. It was found, under the conditions utilized, that the majority of cells died within 4 days. No stable HSV-TK expressing cells could be isolated from these transfections. Attempts at isolating G418 resistant, stable transfectants from the NCM460 cells was not made. However, these cells survived the transfection procedure longer than 4 days. For the three transfected tumor cell lines, these results suggested that the either the plasmid constructs and the lipids used in transfection, or the levels of HSV-TK generated from the plasmids, were toxic to these cells even without addition of GCV. Transfection of cells with lipofectamine alone or with the pcDNA-TK plasmid did not result in the same level of cell death (see also Fig 9) . Therefore, a series of pTcf-TK transfection experiments with 1-3 day time lines, and use of anti-HSV-TK antibodies, GCV cytoxicity assays and metabolic labeling with [³H]GCV were done to evaluate this toxic effect. SW480, HCT8, SW620 and NCM460 cells were plated at 0.4 X 10⁶ cells/well and transfected for 18 hrs with lipofectamine alone, 1.75 μg promoterless pcDNA-TK, 1.75 μg pTcf-TK(including SEQ ID NO:5) or 1.75 μg pTcf-TK( includes SEQ ID NO:6). After 24 hrs of growth in fresh media, cell proteins were processed for separation on SDS-polyacrylamide gels. Cell extracts were prepared and evaluated by western blot with anti-HSV-TK antibody. Cell numbers were normalized to 1 X 10⁶/0.1 ml gel loading buffer, and equal protein loading was quantitated as previously described in

Drake, R. R. et al. [(1999) /. Biol. Chem., 27 , 37186-37192]. Blotted HSV-1 TK protein bands were visualized on film using ECL chromophore reagents (Amersham).

As shown in FIG. 7, there was significant expression of HSV-TK protein in the three tumor cell lines transfected with either pTcfTK construct. In contrast, in the NCM460 cells, only trace levels of HSV-TK were detected [only in the pTcf-TK (SEQ. 5) transfected cells]. There was no apparent leaky expression of HSV-TK in any of the cell lines transfected with the pcDNA-TK vector (Fig. 7). To determine whether the expressed HSV-TK was functional, identical transfection protocols were performed [SW480, HCT8, SW620 and NCM460 cells were plated at 0.2 X 10⁶ cells/well and transfected for 16 hrs with either lipofectamine alone, 1.75 μg pcDNA-TK, 1.75 μg psTcf-TK (includes SEQ ID NO:6) or 1.75 μg pTcf-TK (includes SEQ ID NO:5), each condition in triplicate. The cells were then incubated in 1 ml fresh media containing 1 μM [³H]GCV for 12 hrs. Cells were extracted in 70 % methanol and evaluated for levels of phosphorylated GCV and incorporation of GCV into DNA as previously described in [Drake, R. R. et al. (1999) /. Biol. Chem., 21 A, 37186- 37192]. Values obtained for lipid alone cells were used to normalize the values presented for each condition in the graphs, except that at 24 hours post-transfection, 1 μM [³H]GCV was added for 12 hours. Cells were isolated, counted and then extracted with 70% methanol. The soluble supernatant and insoluble DNA pellet were quantitated for levels of [³H]GCV incorporation by scintillation counting.

As shown in FIG. 8A, only cells transfected with either the pTcf-TK or psTCF-TK construct had significant levels of soluble [³H]GCV metabolites. Again, only minimal metabolism of [³H]GCV was found for the NCM460 cells. To evaluate the proportion of phosphorylated GCV metabolite to free GCV in the methanol soluble fraction of the pTcf-TK (includes SEQ ID NO:5) samples, thin layer chromatography with PEI-cellulose plates developed in 0.8 M LiCl was performed. From this separation, the percentage of phosphorylated-GCV metabolites present in the soluble fractions relative to unphosphorylated GCV (as presented Fig 8A) were 62% in SW480, 70% for HCT8, 88% for SW620 and 55% in NCM460 (data not shown). This indicates that 45% of the already low levels of recovered metabolites in the NCM460 cells represent free GCV, consistent with the trace expression levels of HSV-TK in the pTcf-TK western blot (Fig. 7). Analysis of [³H]GCV levels in the methanol insoluble pellet is indicative of GCV incorporation into cellular DNA. As presented in FIG. 8B, the levels of [³H]GCV incorporated into the DNA were highest in the pTcf-TK transfected tumor cells, but not the NCM460 cells.

To examine whether GCV metabolism resulted in increased tumor cell killing, SW480 and NCM460 cells were plated at 0.15 X 10⁶ cells/well and transfected for 16 hrs with either lipofectamine alone, 1.75 μg of pcDNA-TK or 1.75 μg pTcf-TK (including SEQ ID NO:5), each condition in triplicate. Fresh media (3 ml) containing no GCV, or 10 μM GCV was added to the cells for 48 hrs. Viable cell numbers were determined using trypan blue dye exclusion and automated cell counting. After 2 days, cells were stained with trypan blue and cell numbers determined by automated counting. As shown in FIG. 9A, only in the Tcf-TK (includes SEQ ID NO:5) transfected SW480 cells did GCV addition have any significant toxic effect, while no effect was observed in the similarly treated NCM460 cells (FIG. 9B). The cumulative results presented in FIGS. 7-9 indicate functional and tumor cell specific expression of HSV-TK delivered via the pTCF-TK plasmids.

Discussion

The experimental approach herein is based on the disruption of β-catenin localization in colon adenocarcinomas due to mutations in its gene or the regulatory adenomatous polyopsis coli (APC) gene. In the molecular progression of sporadic colon cancer, 80% of patients have gene mutations in APC and frequent mutations in β-catenin [Kinzler, K. W. et al. (1996) Cell, 87, 159-170; and Morin, P. J., et al. (1997) Science, 275,1787-1790]. The biochemical relationship between APC and β- catenin and the effects that mutations in either protein have on signal transduction pathways and gene regulation is complex, β-catenin has at least two normal and distinct cellular roles. At the plasma membrane, β-catenin complexes with α-catenin and serves as a major component of the adheren junctions that link the actin cytoskeleton to cadherin cell-cell adhesion receptors [Ben-Zee'ev, A. et al. (1998) Curr. Opin. Cell Biol., 10, 629-639]. In addition, unbound β-catenin can translocate into the nucleus [Molenaar, M. et al. (1996) Cell, 86, 391-399; and Simcha, I. et al. (1998) J. Cell Biol., 141, 1433-1448] and complex with transcription factors of the LEF-1 family (like Tcf-4) for initiation of specific gene expression [Riese, J. et al. (1997) Cell, 88, 777-787; and van de wetering, M. et al. ( 1997) Curr. Opin. Genet. Dev., 7, 459-466] . The levels of free β-catenin in the cell are regulated at the plasma membrane by a separate protein complex consisting of APC [Su, L. K. et al. (1993) Science, 262, 1734-1737; and Rubinfeld, B. et al (1993) Science, 262, 1731-1734], axin/conductin [Hart M. de los Santos, R. et al (1998) Curr. Biol., 8, 573-581; and Behrens, J. et al (1998) Science, 280, 596-599] and glycogen synthase kinase- 3β [Rubinfeld, B. et al. (1996) Science, 272, 1023-1026]. Phosphorylation of β-catenin by GSK-3β in the complex [Yost, C. et al. (1996) Gene Dev., 10, 1443-1454; and Ikeda, S. et al. (1998) EMBO J., 17, 1372-1384] leads to its degradation by the ubiquitin-proteosome system [Salomon, D. et al (1997) J. Cell Biol., 139, 1325-1335; and Aberle, H. et al. (1997) EMBO J., 16, 37977-3804]. In the cells with mutated forms of APC or β-catenin proteins, these degradation complexes do not form and this leads to accumulation of β-catenin levels commonly found in human cancers [Kinzler, K. W. et al. (1996) Cell, 87, 159-170; and Rubinfeld, B. et al. (1997) Science, 275, 1790-1792]. The elevated β- catenin levels allow for upregulated gene transcription by the β-catenin/Tcf-4 complex [Ben-Zee' ev, A. et al. (1998) Curr. Opin. Cell Biol., 10, 629-639; and Gumbiner, B. M. (1997) Curr. Biol., 7, R443- R446]. Additionally, the levels of free β-catenin can be modulated via the APC-axin/conductin- GSK3 complex through interaction of the highly conserved Wnt-1 oncogene and its signaling pathway [Li, Y. et al (1998) Mol. Cell. Biol, 18, 7216-7224; and Hinck, L. et al. (1994) J. Cell Biol., 124, 729-741].

Alterations in the levels and regulation of β-catenin have not only been linked to progression of colon carcinoma [Kinzler, K. W. et al. (1996) Cell, 87, 159-170; Su, L. K. et al. (1993) Association of the APC tumor suppressor protein with catenins. Science, 262, 1734-1737; Samoitz, W. S. et al. (1999) Cancer Res., 59, 1442-1444; and Herter, P. et al. (1999) J. Cancer Res. Clin. One, 125, 297- 304], but they also have been implicated in progression of other forms of cancer including breast [Bukholm, I. K. et al. (1998) J. Pathology, 185, 262-266], liver [de La Coste, A. et al. (1998) Proc. Nat. Acad. Sci USA, 95, 8847-8851], bladder [Giroldi, L. A. et al. (1998) Int. J. Cancer, 82, 70-76], ovarian/uterine [Kobayashi, K. et al. (1999) Japan. J. Cancer Res., 90, 55-59; and Fukuchi, T. et al. (1998) Cancer Res., 58, 3526-3528], prostate [Voeller, H. J. et al. (1998) Cancer Res., 58, 2520-

2523], esophageal [Kimura Y. et al. (1999) Int. J. Cancer, 84, 174-178; and Sanders D. S. et al. (1998) Int. J. Cancer, 79, 573-579], nasal pharyngeal [Zheng, Z. et al (1999) Human Path., 30, 458-466], skin [Chan, E. F. et al. (1999) Nature Genet., 21, 410-413] and thyroid [Garcia-Rostan G. et al. (1999) Cancer Res., 59, 1811-1815]. In addition to the link between mutated forms of APC/β-catenin and increased gene expression via β-catenin/Tcf-4, it is likely that defects in other proteins and signaling components associated with the regulation of free β-catenin play an as yet uncharacterized role in Tcf- 4 responsive gene transcription.

The APC and β-catenin mutations result in the activation of cancer promoting gene transcription by the β-catenin/Tcf-4 complex, which binds to a specific enhancer element in these genes. Some genes activated by this complex have been identified and include c-Myc [He, T. C. et al.

(1998) Science, 281, 1509-1512], c-jun and fra-1 [Mann, B. et al. (1999) Proc. Nat. Acad. Sci. USA, 96, 1603-1608], cyclin D [Shtutman M. et al. (1999) Proc. Natl. Acad. Sci USA, 96, 5522-5527; and Tetsu, O. et al. (1999) Nature, 398, 422-426] and metalloproteinase 7 (MMP7) [Crawford, H. C. et al.

(1999) Oncogene, 18, 2883-2891]. It appears that the LEF-1 family of transcription factors, of which Tcf-4 is a member, acts as DNA binding scaffolding proteins that alone do not affect transcription

[Roose, J. et al. (1999) Biochim. Biophys. Acta, 1424, M23-M27]. They must interact with a partner protein (like β-catenin), and this complex leads to gene regulation via interactions with basal transcription machinery [Hsu, S. C. et al. (1998) Mol. Cell. Biol., 18, 4807-4818]. β-catenin has been shown to translocate into the nucleus independent of any association with Lef/Tcf binding [Prieve M. G. et al. (1999) Mol. Cell. Biol., 19, 4503-4515], and other non-DNA binding proteins may be involved in forming or stabilizing the β-catenin and Tcf-4 interactions [Prieve M. G. et al. (1999) Mol. Cell. Biol., 19, 4503-4515].

Because expression of the therapeutic genes in the present invention is based on common mutations in the APC and β-catenin genes of adenocarcinomas, and/or lead to increased levels of β- catenin in tumor cells, most normal cells and tissues will not have the transcription factor complexes necessary for gene expression with the gene construct of the present invention. Thus, expression of the therapeutic gene in the present invention is limited to tumor cells with altered β-catenin function. Based on the results reported herein, the therapeutic vector containing the gene construct has the potential for immediate application for therapeutic gene expression in many forms of colon cancer. Because disregulation of β-catenin is associated with other forms of cancer such as prostate, breast, ovarian, esophageal, gastric), the gene construct may be utilized in other current gene therapy treatments.

Because mutations in the APC gene and β-catenin gene are frequently associated with epithelial carcinoma progression for many types of cancer, the effectiveness of a Tcf-4/β-catenin transcriptional enhancer element involved in the cellular response to these mutations was evaluated for its ability to act as a tumor specific regulator of therapeutic gene expression in a panel of human tumor and normal colon cell lines. Many of the colon tumor cell lines had been previously characterized as having Tcf-4/β-catenin responsive expression using reporter gene assays [Morin, P. J. et al. (1997) Science, 275, 1787-1790; Crawford, H. C. et al. (1999) Oncogene, 18, 2883-2891; and Korinek, V. et al. (1997) Science, 275, 1784-1787]. However, to date, the Tcf-4/β-catenin element linked with the c-fos promoter has not been evaluated for generating sufficient expression levels of a therapeutic gene. Using the HSV-TK gene, in combination with GCV, it was demonstrated that the Tcf-4/β-catenin enhancer and c-fos promoter efficiently directs expression of HSV-TK resulting in phosphorylation of GCV and cell death . Even in the absence of GCV, it was found that HSV-TK expression directed by both Tcf/fos elements leads to cell death. The levels of HSV-TK found in the responsive transfected tumor cells was quite high as determined by western blotting with HSV-TK antibody, especially in the context of the short time frame of the analysis. Why the cells die in the absence of GCV in not known. This could be due to 1) too much HSV-TK being produced that it overwhelms the cell; 2) the high expression level of HSV-TK could lead to aberrant thymidine phosphorylation, disrupting the normal deoxynucleotide pools required for normal DNA replication processes, or 3) the commercial backbone vector, pcDNA3, or the pcDNA-TK derivative, are toxic to cells.

A majority of the regulatory constructs previously reported as having tumor specific expression profiles have been promoter elements [Gomez-Navarro, J. et al. (1999) Cancer, 6, 867-885 and Nettlebeck, D. M. et al. (2000) Trends Genet., 16, 174-181]. One notable exception has been the use of PSA enhancer sequences with the PSA promoter for therapeutic gene expression for prostate cancer [Latham, J. P. F. et al. (2000) Cancer Res., 60, 334-341; and Lee, S. E. et al. (2000) Anticancer Res., 20, 417-422]. The PSA enhancer/promoter combination has proven to provide higher levels of gene expression than the PSA promoter alone. A potential clinical drawback to the PSA approach is the activity and toxicity of these constructs in normal prostate cells [Nettlebeck, D. M. et al. (2000) Trends Genet., 16, 174-181]. The approach taken in the present invention with the Tcf-4/β-catenin enhancer is based on tumor specific conditions with transcriptional activity dependent on transcription factor complexes found only in the tumor phenotype. The luciferase reporter results comparing Tcf-4/β-catenin enhancer and c-fos promoter with the c-fos only pTCF/fos-Luc vector highlight the dependence of the enhancer elements as the primary determinants of gene expression. Additionally, an increasing number of genes with Tcf-4/β-catenin 5' regulatory sequences have been identified, including c-myc, cyclin D, c-jun, MMP-7, and gastrin [He, T. C. et al. (1998) Science, 281, 1509-1512; Crawford, H. C. et al. (1999) Oncogene, 18, 2883-2891; and Koh T. J. et al. (2000) . Clin. Invest., 106, 533-539]. Promoter sequences from these genes, and others yet to be identified, may be manipulated for use with the Tcf-4/β-catenin enhancer. Another unique aspect of Tcf-4/β-catenin regulation is the modulation of responsive genes by chemical modifiers like butyrate, phorbol esters, doxorubicin and retinoids. Short chain fatty acids like butyrate and trichostatin A have been reported to increase Tcf-4/β-catenin mediated gene expression [Bordonaro, M. et al. (1999) Cell Growth Dijf., 10, 713-20; and Barshishat, M. et al. (2000) British J. Cancer, 82, 195-203]. Addition of the phorbol ester PMA has also been reported to increase gene expression [Baulida, J. et al. (1999) Biochemical J., 344-565-570].

Conversely, the addition of doxorubicin [Yang, S. Z. et al. (1999) Int. J. Oncol, 15, 1109- 1115] or retinoids [Easwaran, V. et al. (1999) Curr. Biol, 9, 1415-1418] has been reported to decrease Tcf-4/β-catenin mediated gene expression. Because of the demonstrated variability of transcriptional regulation of Tcf-4/β-catenin expression in different tumor cell lines (as shown in FIG. 1), addition of an inducible stimulating agent could enhance expression in marginally responsive cells. Conversely, the possibility of having a repressor option in the context of viral-based gene therapies could be important. Thus, the drug inducibility (or repression) options conferred with the Tcf-4/β-catenin enhancer make this an important element for potential clinical use in therapeutic gene expression.

Because the mutations that lead to activation of Tcf-4/β-catenin expression are common in many types of epithelial adenocarcinomas, these cassettes could find widespread use in other tumor therapies besides those described herein for colon and breast. Furthermore, as genetic profiling of patient adenocarcinomas becomes more available, the cassetted approach of the Tcf-4/β-catenin enhancer with a tumor-type specific promoter element matched to each individual tumor could be used to increase therapeutic gene expression. These studies have demonstrated the feasibility of using the Tcf-4/c-fos element as a potential tumor-specific promoter for gene therapies. It has functioned more effectively in colon tumor cells relative to normal colon cells, and there is an elevated transcriptional response to butyrate. Clearly, butyrate activates multiple transcriptional pathways besides Tcf-4-responsive genes, and this is consistent with its known differentiating activities in colon tumor cells [Mariadason, J. M. et al. (2000) Cancer Res., 60, 4561-4571]. This could prove to be advantageous for tumor therapies, as delivery of a therapeutic gene or vector that could be stimulated with butyrate could prove doubly effective. Butyrate is known to induce apoptosis and the therapeutic gene could complement and enhance this effect.

A large number of methodologies for DNA delivery have been developed. The presently available methodologies include: transfection with a viral vector; fusion with a lipid; and cationic supported DNA introduction. Each of these techniques has advantages and disadvantages so that the selection of the form of administration or delivery will depend upon the particular situation. Notwithstanding, it is desirable to employ a DNA transfer method that accomplishes the following objectives: (1) is capable of directing the therapeutic gene into specific target cell or tissue types (e.g., colon cancer cells), (2) is highly efficient in mediating uptake of the therapeutic gene into the target cell population, and (3) is suited for use in vivo for therapeutic application.

While the invention has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected. In addition, all references cited herein are indicative of the level of skill in the art and are hereby incorporated by reference in their entirety.

Claims

CLAIMSWhat is claimed is:

1. An expression vector, comprising a pre-selected therapeutic nucleic acid operably linked to a tumor specific or cell type specific promoter and a Tcf-4/β-catenin enhancer.

2. The expression vector of claim 2, wherein the tumor specific or cell type specific promoter is a mammalian promoter.

3. The expression vector of claim 2, wherein the tumor specific or cell type specific promoter is selected from the group consisting of a fos promoter, a carcinoembryonic antigen promoter, a cyclin D promoter, a cox-2 promoter, and a myc promoter.

4. The expression vector of claim 2, wherein the tumor specific or cell type specific promoter is a c-fos promoter.

5. The expression vector of claim 1, wherein said Tcf-4/β-catenin enhancer has a nucleotide sequence as set forth in SEQ ID NO:l or SEQ ID NO:2.

6. The expression vector of claim 1, wherein said therapeutic nucleic acid encodes a protein.

7. The method of claim 6, wherein said protein is an enzyme.

8. The method of claim 7, wherein said enzyme activates a prodrug selected from the group consisting of ganciclovir and derivatives thereof, acyclovir and derivatives thereof, 5- fluorocystosine and 6-methoxypurine arabinoside.

9. The method of claim 1, wherein said pre-selected therapeutic nucleic acid encodes antisense ribonucleic acid.

10. The method of claim 1, wherein said expression vector comprises the nucleotide sequence selected from the group consisting of SEQ JD NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ

ID NO:6.

11. A method for targeted expression of therapeutic nucleic acid for the treatment of cancer, comprising administering to a mammal in need of treatment a therapeutic vector comprising a pre-selected therapeutic nucleic acid operably linked to a tumor specific or cell type specific promoter and a Tcf-4β-catenin enhancer.

12. The method of claim 11, wherein said pre-selected therapeutic nucleic acid comprises a gene.

13. The method of claim 12, wherein said gene encodes a protein that activates a prodrug substrate of Herpes Simplex Virus thymidine kinase.

14. The method of claim 13, wherein said substrate is ganciclovir or derivatives thereof.

15. The method of claim 12, wherein said gene encodes a protein that activates a prodrug selected from the group consisting of ganciclovir and derivatives thereof, acyclovir and derivatives thereof, 5-fluorocytosine and 6-methoxypurine arabinoside.

16. The method of claim 11, wherein said pre-selected therapeutic nucleic acid encodes antisense ribonucleic acid.

17. The method of claim 11, wherein the vector is a virus or plasmid.

18. The method of claim 17, wherein the virus or plasmid comprises pTcf-TK.

19. The method of claim 17, wherein the virus or plasmid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.

20. The method of claim 11, wherein the tumor specific or cell type specific promoter is a mammalian promoter.

21. The method of claim 11, wherein the tumor specific or cell type specific promoter is selected from the group consisting a fos promoter, a carcinoembryonic antigen promoter, a cyclin D promoter, a cox-2 promoter, and a myc promoter.

22. The method of claim 11, wherein the tumor specific or cell type specific promoter is a c-fos promoter.

23. The method of claim 11, wherein the therapeutic vector is administered to the mammal in an amount sufficient to allow expression of the therapeutic gene in targeted tumor cells and tissues.

24. The method of claim 11, wherein said method comprises expressing said pre-selected therapeutic nucleic acid in organs selected from the group consisting of colon, prostate, breast, ovaries, esophagus, and stomach.

25. The method of claim 11, wherein the mammal is human.

26. The method of claim 11, further comprising administering a composition comprising a transcriptional regulatory agent.

27. The method of claim 26, wherein said agent is selected from the group consisting of butyric acid and salts thereof, phorbol esters, doxorubicin, retinoids, and combinations thereof.

28. The method of claim 11, wherein said pre-selected therapeutic nucleic acid encodes a protein that is toxic to a mammalian cell.

29. The method of claim 28, wherein said protein is selected from the group consisting of diphtheria toxin, ricin, and pseudomonas exotoxin.

30. A host cell cell, comprising an expression vector comprising a gene encoding a desired polypeptide, said gene operably linked to a tumor specific or cell type specific promoter and a

Tcf-4/β-catenin enhancer.

31. The cell of claim 30, wherein the tumor specific or cell type specific promoter is a mammalian promoter.

32. The cell of claim 30, wherein the tumor specific or cell type specific promoter is selected from the group consisting of a fos promoter, a carcinoembryonic antigen promoter, a cyclin

D promoter, a cox-2 promoter, and a myc promoter.

33. The cell of claim 31, wherein the tumor specific or cell type specific promoter element is c-fos.

34. The cell of claim 30, wherein said Tcf-4/β-catenin enhancer has a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:2.

35. A method for treating cancer, comprising administering to a mammal in need of treatment a therapeutic vector comprising a pre-selected therapeutic nucleic acid operably linked to a tumor specific or cell type specific promoter and a Tcf-4β-catenin enhancer.

36. The method of claim 35, wherein said cancer is epithelial carcinoma.

37. The method of claim 36, wherein said epithelial carcinoma is present in tissues from organs selected from the group consisting of colon, prostate, breast, ovaries, esophagus, and stomach.

38. The method of claim 35, wherein said Tcf-4β-catenin enhancer has a nucleotide sequence as set forth in SEQ ID NO:l or SEQ ID NO:2.

39. The method of claim 35, wherein said vector comprises the nucleotide sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.

40. The method of claim 35, wherein said pre-selected nucleic acid includes a gene encoding a protein, said method further comprising administering a prodrug that is activated by said protein to a product toxic to mammalian tumor cells.

41. The method of claim 35, further comprising administering a composition comprising a transcriptional regulatory agent.

42. The method of claim 41, wherein said agent is selected from the group consisting of butyric acid and salts thereof, phorbol esters, doxorubicin, retinoids, and combinations thereof.