WO2002089728A2 - Recombinant rhabdoviruses as live-viral vaccines - Google Patents

Recombinant rhabdoviruses as live-viral vaccines Download PDF

Info

Publication number
WO2002089728A2
WO2002089728A2 PCT/US2002/012637 US0212637W WO02089728A2 WO 2002089728 A2 WO2002089728 A2 WO 2002089728A2 US 0212637 W US0212637 W US 0212637W WO 02089728 A2 WO02089728 A2 WO 02089728A2
Authority
WO
WIPO (PCT)
Prior art keywords
vims
recombinant
envelope protein
subunit
rhabdovims
Prior art date
Application number
PCT/US2002/012637
Other languages
French (fr)
Other versions
WO2002089728A3 (en
Inventor
Matthias J. Schnell
Roger J. Pomerantz
Original Assignee
Thomas Jefferson University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Thomas Jefferson University filed Critical Thomas Jefferson University
Publication of WO2002089728A2 publication Critical patent/WO2002089728A2/en
Publication of WO2002089728A3 publication Critical patent/WO2002089728A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24161—Methods of inactivation or attenuation
    • C12N2710/24164—Methods of inactivation or attenuation by serial passage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20141—Use of virus, viral particle or viral elements as a vector
    • C12N2760/20143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to the fields of molecular biology and virology, and to a method of treating an HTV-l infection and to a method of treating an HCV infection, more particularly, to the induction of both humoral and cellular immunity against HTV-l and against HCV.
  • New anti-retro viral strategies against human HIV-1 result in a dramatic decrease in mortality among infected humans in developed countries, but the development of a successful vaccine to prevent infection is still the major goal to halt the HIV-1 pandemic.
  • a human being is infected with HIV-1 every 10 seconds on average, and in the heavily affected countries in Africa, such as Zambia and Kenya, nearly 40% of young adults are HTV-1 -seropositive.
  • HIV vaccine strategies including recombinant proteins (Goebel, F.D., et al., European Multinational IMMTJNO AIDS Vaccine Study Group Aids, 5:643-50, 1999; Quinnan, G.V., Jr., et al, AIDS Research & Human Retroviruses, 15:561-70, 1999; VanCott, T.C., et al., J.
  • live-viral vectors may be excellent vaccine candidates for an HIV-1 vaccine.
  • protective immunodeficiency virus vaccine that is non-pathogenic for a wide range of animal species when administered orally or intramuscularly, as well as being able to induce the required neutralizing antibody and CTL responses.
  • the HTV-1 envelope protein is stably and functionally expressed and induces a strong humoral response directed against the HTV-1 envelope protein after a single boost with recombinant HIV-1 protein boost (gpl20) in mice. Moreover, high neutralization titers against HTV-1 are detected in the mouse sera. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.).
  • the present invention fulfills this long sought need and further relates to recombinant RV vaccines expressing HTV-1 envelope proteins to induce HTV-1 -specific CTLs. Specifically, a single inoculation of the HTV-1 virus vaccines of the present invention induce a solid and long-lasting memory CTL response specific for HTV-1 proteins. These recombinant viruses are non-pathogenic for a wide range of animal species when administered orally or intramuscularly.
  • the coding region of the HIV-1 gpl60 (strains NL4-3 and 89.6) is cloned between the RV glycoprotein (G) and polymerase (L) proteins under the control of a RV transcription Stop/Start signal, the resulting recombinant RVs expressed HIV-1 gpl60 along with the other RV proteins.
  • HCV Hepatitis C virus
  • HCV is a small, enveloped positive strand RNA virus of the Flaviviridae family (Clarke, 1997).
  • the 9.6 kilobase genome consists of a 5' nontranslated region (NTR) which contains an internal ribosome entry site (IRES) to begin translation of the viral polyprotein (Le, Siddiqui, and Maizel, 1996), which is cleaved by both host and viral proteases to yield four structural and six non-structural (NS) proteins (Reed and Rice, 1998).
  • NTR nontranslated region
  • IVS internal ribosome entry site
  • the genome encodes two envelope glycoproteins, El and E2, which are released from the polyprotein via signal peptidase cleavages (Grakoui et al., 1993).
  • Both proteins are largely modified by N-linked glycosylation and are thought to be type I integral transmembrane proteins with C-terminal hydrophobic anchor domains.
  • Expression of both the glycoproteins in mammalian cell-lines illustrates their retention in the endoplasmic reticulum (ER), with no surface expression detectable (Duvet et al., 1998).
  • the E2 glycoprotein contains two hypervariable regions (HVR), with HVRl located at amino acid positions 390-410, and HVR2 located at positions 474-480 (Weiner et al., 1991). Antibodies directed against the HVRl of E2 have been implicated in controlling HCV infection (Kato et al., 1993).
  • HVRl of E2 contains both B-cell and cytotoxic T-lymphocyte (CTL) epitopes.
  • CTL cytotoxic T-lymphocyte
  • antibodies specifically directed at this region reportedly blocked viral attachment in susceptible cells, further implicating E2 as responsible for viral attachment to the host cell (Kojima et al., 1994; Leroux-Roels et al., 1996; Lesniewski et al., 1995).
  • HCV vaccine studies involving E2 have utilized several strategies in a murine mode,l including purified recombinant antigens, DNA immunization (Gordon et al., 2000), DNA priming in conjunction with recombinant viruses such as Semliki Forest Virus and canarypox (Pancholi et al., 2000; Vidalin et al., 2000), DNA priming with recombinant protein boosting (Song et al., 2000), replication-deficient recombinant adenovirus (Makimura et al., 1996), and plasmid DNA immunization (Inchauspe, 1999).
  • E2 661 truncated E2 glycoprotein
  • HCV the purported cellular receptor for HCV
  • the present invention provides RV-based vectors wherein the expression of HCV glycoproteins induce an immune response to HCV.
  • Recombinant RV-vectors encoding HCV glycoprotein(s), or a modified version of the E2 glycoprotein with 85 amino acids of its carboxy-terminus deleted are provided herein. Additionally, recombinant RV-vectors expressing the modified version of the E2 glycoprotein along with the human CD4 transmembrane domain (TMD) and the CD4 or RV glycoprotein (G) cytoplasmic domain (CD) are provided.
  • TMD human CD4 transmembrane domain
  • G CD4 or RV glycoprotein
  • CD cytoplasmic domain
  • the resulting recombinant RVs stably expressed the respective HCV glycoproteins, and elicited both humoral and cellular immune responses in immunized mice.
  • FFU means "foci forming units"
  • HCV hepatitis C virus
  • TMD means "transmembrane domain
  • CD means "cytoplasmic domain
  • N means "nucleoprotein
  • ER means "endoplasmic reticulum"
  • RV means "rhabdovirus
  • CTL means "cytotoxic T-lymphocyte”
  • ELISA means "enzyme-linked immunosorbant assay”
  • boost vaccine vector is “boost virus”
  • boost virus is “boost vaccine vector”
  • biological sample refers to a sample of tissue or fluid isolated from an individual, including but not limited to, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vitro cell culture constituents (including, but not limited to, conditioned medium resulting from the growth of cells in cell culture medium, putatively virally infected cells, recombinant cells, and cell components).
  • the present invention is directed to recombinant non-segmented negative- stranded RNA virus vectors expressing an immunodeficiency virus genes as a live- viral vaccine (e.g., HTV-1 vaccine) and methods of making and using the same. More in particular the invention relates to recombinant Rhabdoviruses which express gene products of a human immunodeficiency virus and to immunogenic compositions which induce an immunological response against immunodeficiency virus infections when administered to a host.
  • a live- viral vaccine e.g., HTV-1 vaccine
  • live-viral vaccines are non- pathogenic for a wide range of animal species when administrated orally or intramuscularly and induce protective immune responses such as neutralizing antibody response and long lasting cellular (such as cytotoxic T lymphocyte (CTL)) responses against the immunodeficiency viruses.
  • protective immune responses such as neutralizing antibody response and long lasting cellular (such as cytotoxic T lymphocyte (CTL)) responses against the immunodeficiency viruses.
  • CTL cytotoxic T lymphocyte
  • the invention is a recombinant non-segmented negative- stranded RNA virus vector having: (a) a modified negative-stranded RNA virus genome that is modified to have one or more new restriction sites, or not to have one or more genes otherwise present in the genome; (b) a new transcription unit that is inserted into the modified negative-stranded RNA virus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant non- segmented negative-stranded RNA virus vector is replication competent, and the heterologous viral nucleic acid sequence encod s atf antige'nic" polypeptide.
  • the recombinant non- segmented negative-stranded RNA virus vector that is used as a live- viral vaccine is a recombinant Rhabdovirus vector.
  • This vector includes (a) a modified Rhabdovirus genome; (b) a new transcription unit inserted into the Rhabdovirus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant Rhabdovirus vector is replication competent, and the heterologous viral nucleic acid sequence encodes an antigenic polypeptide.
  • the modified Rhabdovirus genome is, for example, modified rabies virus genome or a modified vesicular stomatitis virus genome.
  • the modifications in the Rhabdovirus genome include creation of new restriction sites and/or deletion of one or more genes such as the native G (glycoprotein) gene of the Rhabdovirus, ⁇ gene of rabies virus, etc.
  • the modified Rhabdovirus genome has a further modification to have a glycoprotein from another class of virus in place of the native glycoprotein.
  • the glycoprotein from another class of virus is vesicular stomatitis virus glycoprotein.
  • the modified rabies virus genome has a third modification to have contiguity of structural genes different from that in the rhabodvirus genome after the second modification.
  • heterologous viral nucleic acid refers to the viral nucleic acid that encodes the antigenic polypeptide that induces immune response.
  • a full-length HTV envelope protein, HTV gpl60, HTV gag, HTV gpl20, and full-length STV envelope protein are some of the antigenic polypeptides that are expressed in the recombinant viral vectors of the present invention.
  • heterologous viral nucleic acid does not include the native gene sequences of the one or more classes of Rhabdoviruses in a recombinant Rhabdovirus such as, for example, VSV G gene in the recombinant RV.
  • the sequence of the cytoplasmic domain of Rhabdovirus G gene is fused to other sequences before cloning into the modified Rhabdovirus genome.
  • One such example is a chimeric VSV/RV glycoprotein where the fusion protein has VSV ectodomain and transmembrane domain, and RV cytoplasmic domain.
  • Another such example is a chimeric HJV-l/RV glycoprotein where the fusion protein has HTV-1 gpl60 ectodomain and transmembrane domain, and RV &Vt ⁇ p'iasmiC'' ' dtfrh n.” ' THus ' in some cases, the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein such that the resulting chimeric protein has a fusion between the transmembrane domain of the heterologous protein and cytoplasmic domain of the glycoprotein.
  • the glycoprotein gene of the recombinant Rhabdovirus is deleted and the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein which functionally substitutes for the recombinant Rhabdoviruses glycoprotein gene.
  • a recombinant Rhabdovirus that expresses a functional HTV envelope protein.
  • the recombinant Rhabdovirus is replication-competent.
  • the Rhabdovirus can be a recombinant rabies virus or a recombinant vesicular stomatitis virus.
  • the HTV envelope protein expressed from the recombinant Rhabdovirus is from any HTV-1 isolate.
  • a recombinant ⁇ gene deficient Rhabdovirus having a heterologous nucleic acid segment encoding an immunodeficiency virus envelope protein or a subunit thereof is provided.
  • the recombinant ⁇ gene deficient Rhabdovirus is a rabies virus and the immunodeficiency virus envelope protein, or a subunit thereof, is from a human immunodeficiency virus or from a simian immunodeficiency virus.
  • the subunit or a fragment of the immunodeficiency envelope protein includes fragments having only a part of the contiguous amino acids of the envelope protein.
  • subunits or fragments include, for example, HTV gpl20, HTV gp41, HTV gp40, the envelop proteins expressed by HTV NI - 3 and HTV 89 , 6 , and the subunits of other immunodeficiency viruses.
  • a method of inducing an immunological response in a mammal includes the steps of: (a) delivering to a tissue of the mammal a recombinant Rhabdovirus vector that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated imm riod ⁇ f ⁇ ciei ⁇ c 1 Virus 1envelop "' ⁇ 5fbfein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
  • the recombinant Rhabdovirus has a rabies virus genome.
  • the rabies virus genome In the method where the rabies virus genome is used, it is deficient in ⁇ gene.
  • rabies virus genome is also deficient in a rabies virus glycoprotein gene or rabies virus genome has glycoprotein gene from another class of Rhabdovirus in place of the rabies virus glycoprotein.
  • Boosting the animal can be done by delivering an effective dose of a boost vaccine vector instead of the isolated immunodeficiency virus envelope protein.
  • an immunogenic composition having any of the above mentioned recombinant Rabdoviruses along with an adjuvant is provided.
  • a method of inducing an immunological response in a mammal which includes the steps of: (a) delivering to a tissue of the mammal a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
  • the method where the non-segmented negative-stranded RNA virus is used includes a Rabies virus or a Vesicular Stomatitis virus.
  • a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal. This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof.
  • an effective dose of an isolated immunodeficiency virus en el ⁇ pe"p ⁇ ot'e ⁇ 7WsWun ⁇ t ' thereol, m an adjuvant or an effective dose of a boost vaccine vector is delivered to the mammal, thereby inducing a neutralizing antibody response and/or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof.
  • the immunodeficiency virus is any HTV-1 virus.
  • the non-segmented negative-stranded RNA virus is a Rhabdovirus.
  • the long-lasting cellular response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
  • a non-segmented negative- stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal.
  • This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof, thereby thereby inducing a neutralizing antibody response and/or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof.
  • the immunodeficiency virus is any HTV-1 virus.
  • the non-segmented negative-stranded RNA virus is a Rhabdovirus.
  • the long-lasting CTL response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
  • Figure 1 Schematically shows a method for the construction of recombinant
  • Figure 2 A graph showing One-step growth curves of BSR cells that were infected with the recombinant RVs (SBN, SBN-89.6, and SBN-NL4-3)
  • FIG. 1 Western blot analysis of ⁇ recombinant rabies viruses (RVs) expressing HTV-1 gpl60.
  • Figure 4 A composite photograph showing Sup-Tl cells after these cells were infected (using a MOI of 1) with SBN, SBN-89.6, or SBN-NL4-3.
  • Figure 5 A graph showing ELISA reactivity of mouse sera against HTV-1 gpl20.
  • Figure 7. Schematic representation of a method for the construction of RV- based expression vectors with foreign viral glycoproteins.
  • Figure 8 Schematic representation of a method for the construction of full- length and RV-glycoprotein deleted RVs expressing HTV-1 g l60.
  • Stimulator cells are prepared (infra), then added back to the effector cell population at a ratio of 3:1. Cytolytic activity of cultured CTLs is determined by measurement of the percent 51 Cr released (infra).
  • Figure 10 CTLs from HTV-1 gpl60 immunized mice cross-kill target cells expressing heterologous HTV-1 envelope proteins. Groups of six 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl0 7 foci-forming units recombinant
  • RV expressing HTV-1 envelope protein from strains NL4-3 (A) or 89.6 (B).
  • spleens were aseptically removed and splenocytes were stimulated in-vitro with vaccinia virus expressing the homologous
  • HTV-1 envelope protein (infra).
  • Target cells are prepared by infection with vaccinia virus expressing HTV-1 envelope proteins from strains NL4-3 (vCB41), 89.6 (vBD3),
  • CD8 + T-cells are depleted from the cell culture (CD8 " ) and enriched (CD8 + ) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer. Chromium release assays are completed (infra) on cultures depleted (CD8 " ) or enriched (CD8 + ) of CD8 T-cells, or unprocessed cultures (CD8 + /CD8 " ).
  • Target cells are prepared (infra) by infection with vaccinia virus expressing HTV-l envelope proteins from NL4-3 (vCB41). Background levels were equal to, or below, 6% specific lysis.
  • FIG. 12 Construction of recombinant RV genomes.
  • the SPBN vector derived from the RV vaccine strain SAD B16 is illustrated.
  • a transcription Stop/Start signal was introduced in addition to four unique restriction enzyme sites (Smal, Pad, BsiWI and Nhel).
  • the HCV proteins (blue box) were introduced into pSPBN using the BsiWI and Nhel sites resulting in the plasmids pSBPN-ElE2p7 (B), pSPBN-E2CD4 (C), and pSPBN-E2CD4G (D).
  • E2CD4 and E2CD4G are a truncated version of HCV E2 lacking 85 amino acids at their C-terminus, fused to the TMD (green box) and CD of human CD4 (light blue box) or TMD of CD4 and CD of RV G (red box), respectively.
  • FIG. 13 Immunoflourescence studies of recombinant RVs expressing HCV proteins.
  • BSR cells were infected with the recombinant RVs SBPN (A, A', A"), SPBN-ElE2p7 (B, B ⁇ B"), or pSPBN-E2CD4G (C, C ⁇ C") at a MOI of 0.1 and 48 hours after infection, cell were fixed, permeabilized (A', B ⁇ C ⁇ A", B", C") or not (A, B, and C), and stained with a monoclonal antibody directed against E2 (A, A', B, B ⁇ C, and C) or RV N (A", B", or C").
  • FIG. 14 Western Blot analysis of HCV proteins expressed by RV.
  • BSR cells were infected with recombinant RVs as indicated (SPBN, SPBN-ElE2p7, SPBN-E2CD4, SPBN-E2CD4G at a MOI of 5.
  • Cell lysates were separated by SDS- PAGE and transfered to a nitrocellulose membrane. Blots were probed with monoclonal antibodies directed against the HCV El and E2 glycoproteins as indicated ( ⁇ -El, cxEl+E2 or ⁇ El).
  • Figure 15 Incorporation of HCV proteins in recombinant RVs.
  • Purified particles of SPBN, SPBN-E2CD4 or SPBN-E2CD4G were separated by SDS-PAGE and visualized by Coomassie blue staining (CB, lanes 1, 2, 3) or transferred to a nitrocellulose membrane before ( ⁇ -E2) or after digestion with N-glycosidase F ( ⁇ - RV-G-tail). Blots were probed with a monoclo ⁇ 'ar'a ⁇ it ⁇ bodl'ds di ' f ⁇ ' dted againsfthe ' HCV E2 ( -E2 lanes 4,5 and 6) or a polyclonal rabbit serum specific for the RV G CD ( ⁇ - RV-G-tail, lanes 7, 8, 9).
  • FIG 16. Recombinant SPBN-E2CD4G virions as a diagnostic tool.
  • ELISA plates were coated with recombinant HCV E2 derived from purified SPBN-E2CD4G virions and incubated with sera from three HCV-positive patients (HCV1-3), pooled sera from HCV and RV-negative donors (HCV- RV-).
  • Sera from a RV- vaccinated donor (HCV-/RV+) and HTV-1-positive patient (HTV+/RV-) served as controls.
  • the error bars indicate the standard deviations.
  • Figure 17. ELISA reactivity of mouse sera against HCV E2.
  • mice Four groups of five mice each were immunized with live recombinant RV (SPBN, SPBN-E2CD4G) as indicated, and 5 weeks after the initial immunization the mice were boosted twice with killed SPBN-E2CD4 or SPBN virions as indicated in the Figure (Boost). Ten days after the second boost, sera were collected and analyzed by ELISA. Each bar represent the reactivity of a single mouse serum at a 1: 100 serum dilution.
  • FIG. 18 Immunization of mice with SPBN-ElE2p7 induces HCV E2- specific CTLs. 6-8 week old female BALB/c mice were immunized intraperitonially (i.p.) with lxlO 7 FFU of SPBN-ElE2p7. Spleens were harvested 11 weeks after immunization, cultured and stimulated with the E2 peptide 1323 and TL-2. A standard chromium release assay was performed one week after harvesting, against P815 cells pulsed (+ peptide) or not (- peptide) with peptide 1323.
  • Rhabdoviruses such as Rabies virus and Vesicular Stomatitis virus are members of the family Rhabdoviridae. Rabies virus possesses a negative stranded
  • RNA genome of approximately 12kb The genome is modularly organized and similar to that of vesicular stomatitis virus (VSV). These Rhabdoviruses encode five structural proteins. The five open reading frames coding for the viral structural proteins are nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein
  • the viral polymerase-complex begins transcription at the 3' end of the encapsidated genome to generate a short leader RNA followed by sequential synthesis d ⁇ fi e ral'''RT ⁇ J s ' " '
  • the 1 ' ' ⁇ uclebpf ⁇ tein (N), the phosphoprotein (P), the viral polymerase (L), and the genomic RNA form a helical ribonucleoprotein complex (RNP).
  • the RNP is surrounded by a host cell- derived envelope membrane which contains the matric protein (M) on the inner side of the membrane, and the transmembrane glycoprotein (G) which mediates binding of the virus to specific receptors on the cell membrane.
  • a number of recombinant Rhabdovirus vectors are generated and are used to express functional genes, including, but not limited to, full- length HTV-1 envelope proteins and HCV envelope proteins. From the recombinant Rhabdovirus vectors of the invention all the dominant epitopes for neutralizing antibodies, cytotoxic T-lymphocytes (CTL), and antibody-dependent cell cytotoxicity are expressed at one time.
  • CTL cytotoxic T-lymphocytes
  • the construction of different recombinant Rhabdovirus vectors expressing HTV, HCV, SIV or other viral genes is described in the following paragraphs.
  • RNA vectors that express heterologous genes or gene sequences are constructed.
  • an expression vector with its own glycoprotein is constructed.
  • X can be cloned at different genome sites to regulate expression levels.
  • an 'expression "vector "with" a glycoprotein from another virus or another viral serotype is constructed (see Fig. 7 as an example for the RV vector with VSV glycoprotein).
  • This vector is used as boost virus to induce a stronger immune response.
  • HTV-1 gpl60 HTV-1 gag, or any other HTV-1 gene; any STV or HTV-2 gene, HCV, HCV E2, or any other viral antigen).
  • X can be cloned at different genome sites to regulate expression levels.
  • the present invention relates to constructs of recombinant RVs (rabies viruses) expressing HTV-1 gpl60, where the RV glycoprotein (G) is replaced with that of a chimeric vesicular stomatitis virus (VSV) G /RV-cytoplasmic domain (serotype Indiana or New Jersey). Of note, this method is not restricted to VSV glycoprotein.
  • chimeric RV/VSV viruses are not neutralized by the humoral response against the RV G and therefore allow a second productive infection.
  • the use of a recombinant chimeric RV/VSV can be used to display the properly folded HTV-1 envelope protein on the surface of the infected cell.
  • the present invention further relates to constructs of recombinant RVs containing the gene encoding the ectodomain of HCV E2, with the 85 carboxy- terminal amino acids deleted, fused to the transmemebrane domain (TMD) and cytoplasmic domain (CD) of human CD4, or the TMD of CD4 and the CD of RV G.
  • TMD transmemebrane domain
  • CD cytoplasmic domain
  • RV nucleoprotein which was previously shown to be an exogenous superantigen (Lafon, et al., Nature, 358, 507-10, 1992; Lafon, M. Research in Immunology, 144:209-13, 1993), might help to enhance the immune response against the HTV-1 envelope, as well as the HCV E2 envelope.
  • RV Rabies Virus
  • a recombinant RV with rearranged genome, VSV glycoprotein, and HTV-1 gpl60 (X) can be constructed to have: 3'-X-N-P-G(VSV serotype NJ)-M-L-5'.
  • RVs or VSVs having a foreign glycoprotein instead of their own is constructed tor entry into specific host cells, i.e'.', to ' mimic h ijfopis ⁇ i of anotner virus (e.g., HTV-1, Hepatitis C) in order to induce a stronger immune response (Fig. 8).
  • This construct can be represented as 3 -N-P-M-HTV-l-gpl60-L.
  • these constructs can have, in addition, their own glycoproteins (e.g., 3 -N-P-M-HTV-l- gpl60-G-L).
  • Transgenic mice expressing human CD4 and CXCR4 are generated to analyze the in vivo induction of an immune response of the G-related RVs expressing HTV-1 gpl60/RVG and HCV E2.
  • a recombinant expression vector either
  • RV or VSV having multiple genes and multiple transcription stop/start signals is constructed.
  • This construct is represented as 3 -N-P-M-G-X-Y-L-5' where X and Y are heterologous genes.
  • X can be HTV-1 gpl60 and Y can be HTV-1 gag or X can be HCV El and Y can be HCV E2.
  • An alternative construct can be 3 -N-Z- P-M-G-X-Y-L-5' where, for example, X can be HTV-1 g ⁇ l60, Y can be HTV-1 gag and Z can be HTV-1 tat; or X can be HCV El, Y can be HCV E2, and Z can be HCV p7.
  • Rabies virus is a negative- stranded RNA virus of the Rhabdovirus family and it possesses a relatively simple, modular genome organization coding for five structural proteins (supra and Conzelmann, et al., Virology, 175:485-99, 1990).
  • the present invention relates to an RV vaccine strain-based vector, which is non-pathogenic for a wide range of animal species when administrated orally or intramuscularly. This vector shows advantages over other viral vectors, for several reasons.
  • Rhabdoviruses have a cytoplasmic replication cycle and there is no evidence for recombination and/or integration into the host cell genome. (Rose, et al., Rhabdovirus genomes and their products, Plenum Publishing Corp., New York, 1997). In contrast to most other viral vectors only a negligible seropositivity exists in the human population to RV and immunization with a RV-based vector "rlCV, infra)" wiiT not interfere with immunity against the vector itself. In addition, RV grows to high titers g
  • FFU focal forming units
  • rabies virus vectors The following different recombinant rabies virus vectors are constructed.
  • This vector also contains a Smal site upstream of the RV glycoprotein, which is used to delete the RV glycoprotein gene (G).
  • the vector is called RV-SBN.
  • RVs expressing HTV-lgp- 160 ecto- and transmembrane domain fused to the RV G cytoplasmic domain HTV- Igpl60-RVG are constructed.
  • the chimeric gpl60 RVG protein is expressed by RV and incorporated into RV virions. RVs expressing HCV glycoproteins are also generated (SPBN-ElE2p7, infra). Additionally, two similar RV recombinant viruses are also generated. SPBN-E2CD4 (infra) contains the ectodomain of HCV E2, with a 85 amino acid deletion at the carboxy-terminus, fused to the trans- and cytoplasmic domains of human CD4. Alternatively, the ectodomain of HCV E2 is fused to the transmembrane domain of human CD4 and the cytoplasmic domain of RV G (SPBN- E2CD4G, infra).
  • RV-SPBN is used as a boost vaccine vector or a boost virus.
  • a recombinant rabies virus based expression vector with foreign viral glycoproteins is constructed and the recombinant virus is recovered.
  • a Smal restriction enzyme site is introduced downstream of the M/G transcription Stop/Start sequence and a Pad site upstream of the synthetic transcription Stop/Start sequence, which is used to express foreign genes from the RV vector.
  • These two sites can be " ⁇ feed r t ⁇ fep ⁇ ac tfter R VgiyCdpr ⁇ tein with that from other viruses.
  • VSV/RV glycoprotein VSV ectodomain and transmembrane domain, RV cytoplasmic domain
  • HTV-l HTV-l
  • this method can be applied to every glycoprotein and foreign antigen in different Rhabdoviruses (see infra), as shown in the same figure (glycoprotein X, foreign protein Y).
  • recombinant RVs expressing chimeric gpl60/RV G without expressing RV G are generated. These G-deleted RVs have a different tropism as compared to wild-type RV (which infects most cells) and specifically infect only cells expressing the HTV-1 receptor human CD4 and one of the HTV-1 coreceptors (eg, CXCR4 or CCR5).
  • Both the full-length and RV-glycoprotein deleted recombinant rabies RVs are constructed and recovered (Fig. 8).
  • the Smal and BsiWI restriction enzyme sites are used to delete RV glycoprotein and fuse the M G transcription Stop/Start sequence to the HJV-l/RV chimeric glycoprotein (HTV-1 gpl60 ectodomain and transmembrane domain, RV cytoplasmic domain).
  • the recovered RV-vector is, analogous to the HTV-1 virus, specific for cells expressing human CD4 and the appropriate HTV-1 co- receptor. It should be noted that this method can be applied to every glycoprotein which supports infection of certain cell types by rhabdoviruses. It can also be used to express additional foreign antigens (HTV-1 Gag, HTV protease, STV proteins, Hepatitis A, B or C proteins (see HCV, infra), and other viral and non-viral proteins).
  • a recombinant replication-competent rabies virus expression vector having all of the above combinations can be constructed.
  • a recombinant rabies virus vector having other glycoproteins especially to construct boost viruses
  • having genome rearrangements and expressing multiple viral antigens from the same or different viruses (e.g. HTV-1 gpl60, Hepatitis B, Hepatitis C (infra)).
  • Products, methods and compositions There are provided by the invention, products, compositions and methods for assessing treating viral diseases, particularly HTV (ATDS) and HCV (hepatitis) and administering a recombinant Rhadovirus of the invention to an organism to raise an immunological response against invading viruses, especially against immunodeficiency virus infections and hepatitis v ' ⁇ fuS mle r ⁇ n'sT
  • HTV HTV
  • HCV hepatitis
  • Another aspect of the invention relates to a method for inducing an immunological response in an individual, particularly a mammal, which involves inoculating the individual with a recombinant virus of the invention followed by the appropriate recombinant protein boost, adequate to produce antibody and/ or T cell immune response to protect the individual from infection, particularly immunodeficiency infection and hepatitis C infection, and most particularly HTV-1 and 2 infections, as well as HCV infections. Also provided are methods whereby such immunological response slows the HTV replication and the HCV replication.
  • Yet another aspect of the invention relates to a method of inducing immunological responses in an individual which comprises delivering to such individual a nucleic acid vector, sequence or ribozyme to direct the expression of HTV envelope polypeptides (or HCV envelope polypeptides, or a fragment or a variant thereof, infra), or a fragment or a variant thereof, for expressing the HTV envelope polypeptide (or HCV envelope polypeptides, or a fragment or a variant thereof, infra), or a fragment or a variant thereof, in vivo in order to induce an immunological response, such as, to produce antibody and/ or T cell immune response.
  • HTV envelope polypeptides or HCV envelope polypeptides, or a fragment or a variant thereof, infra
  • an immunological response such as, to produce antibody and/ or T cell immune response.
  • Antibody and/or T cell responses include, for example, cytokine-producing T cells or cytotoxic T cells, to protect the individual, preferably a human, from the viral disease, whether that disease is already established within the individual or not.
  • One example of administering the gene is by accelerating it into the desired cells as a coating on particles or otherwise.
  • Such nucleic acid vector may comprise DNA, RNA, a ribozyme, a modified nucleic acid, a DNA RNA hybrid, a DNA-protein complex or an RNA-protein complex.
  • compositions that induce an immunological response
  • a further aspect of the invention relates to an immunological composition that when introduced into an individual, preferably a human, capable of having induced within it an immunological response.
  • the immunological response that is induced is to a polynucleotide and/or polypeptide encoded therefrom, wherein the composition comprises a recombinant Rhabdoviruses of the invention which encodes and expresses an antigen of an exogeneous viral prdtem", such as Tii'V el ⁇ Vel ⁇ pe ' p ' fotem or polypeptide, HCV envelope protein or peptide, etc.
  • the exogeneous polypeptides include antigenic or immunologic polypeptides.
  • the immunological response is used therapeutically or prophylactically and takes the form of antibody immunity and/or cellular immunity, such as cellular immunity arising from CTL or CD4+ T cells.
  • compositions comprising a Rhabdovirus vector of the present invention for administration to a cell or to a multicellular organism.
  • the Rhabdovirus vectors of the invention may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to an individual.
  • a pharmaceutical carrier suitable for administration to an individual Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a recombinant virus of the invention and a pharmaceutically acceptable carrier or excipient.
  • Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof.
  • the formulation should suit the mode of administration.
  • the invention further relates to diagnostic and pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
  • the recombinant vectors of the invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
  • compositions may be administered in any effective, convenient manner including, for instance, administration by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
  • the active agent may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic.
  • the pharmaceutical compositions of the invention are preferably administered by injection to achieve a systematic effect against relevant viral pathogens.
  • the daily dosage level of the active composition of the invention will be from 10 2 FFU to 10 8 FFU of virus in the composition or 10 ⁇ g/kg tolO mg/kg of body weight of recombinant protein.
  • the physician in any event will determine the actual dosage and duration of treatment that will be most suitable for an individual and can vary with the age, weight and response of the particular individual.
  • the above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention.
  • a vaccine composition is conveniently in injectable form. Conventional adjuvants may be employed to enhance the immune response.
  • a suitable unit dose for vaccination is preferably administered daily and with or without an interval of at least lweek. With the indicated dose range, no adverse toxicological effects are observed with the compounds of the invention that would preclude their administration to suitable individuals.
  • the recombinant virions of the present invention are useful for producing an HCV antigenic polypeptide(s), for example the E2 glycoprotein, or subunits thereof, which reacts immunologically with a biological sample from a patient, such as, but not limited to, serum, containing HCV antibodies.
  • the present invention also encompasses antibodies raised against the HCV specific epitopes in these antigenic polypeptides, which are useful in immunoassays to detect the presence of the HCV virus and/or viral antigens, in biological samples. Design of the immunoassays is subject to a great deal of variation, and many formats are known in the art.
  • the immunoassay will utilize at least one viral epitope derived from HCV.
  • the immunoassay uses a combination of viral epitopes derived from HCV. These epitopes may be derived from the same, for example from the E2 glycoprotein, or from different viral polypeptides, for example from the E2 and El polypeptides.
  • An immunoassay may use, for example, a monoclonal antibody directed towards a viral epitope(s), a combination of monoclonal antibodies directed towards epitopes of one viral antigen, monoclonal antibodies directed towards epitopes of different viral antigens, polyclonal antibodies directed towards the same viral antigen, or polyclonal antibodies directed towards dirrerent viral antigens.
  • Protocols may be based, for example, upon competition, or direct reaction, or sandwich type assays (infra). Protocols may also, for example, use solid supports, or may be by immunoprecipitation. Most assays involve the use of labeled antibody or polypeptide; the labels may be, for example, enzymatic, fluorescent, chemiluminescent, radioactive, or dye molecules. Assays that amplify the signals from the probe are also known; examples of which are assays which utilize biotin and avidin, and enzyme-labeled and mediated immunoassays, such as ELISA assays (infra).
  • an immunoassay for an anti-HCV antibody(s) will involve selecting and preparing the test sample suspected of containing the antibodies, such as a biological sample, then incubating it with an antigenic (i.e., epitope-containing) HCV polypeptide(s) under conditions that allow antigen-antibody complexes to form, and then detecting the formation of such complexes. Suitable incubation conditions are well known in the art.
  • the immunoassay may be, without limitations, in a heterogeneous or in a homogeneous format, and of a standard or competitive type.
  • the polypeptide is typically bound to a solid support to facilitate separation of the sample from the polypeptide after incubation.
  • solid supports that can be used are nitrocellulose (e.g., in membrane or microtiter well form), polyvinyl chloride (e.g., in sheets or microtiter wells), polystyrene latex (e.g., in beads or microtiter plates, polyvinylidine fluoride, diazotized paper, nylon membranes, activated beads, and Protein A beads.
  • the solid support containing the antigenic polypeptide is typically washed after separating it from the test sample, and prior to detection of bound antibodies. Both standard and competitive formats are known in the art.
  • test sample is incubated with antigen in solution.
  • antigen in solution.
  • it may be under conditions that will precipitate any antigen-antibody complexes which are formed.
  • Both standard and competitive formats for these assays are known in the art.
  • the amount of HCV antibodies forming the antibody- antigen complex is directly monitored. This may be accomplished by determining whether labeled anti-xenogemc (e.g., anti-huma ⁇ l) " antib ' oclies " which " recognize an epitope on anti-HCV antibodies will bind due to complex formation.
  • labeled anti-xenogemc e.g., anti-huma ⁇ l
  • antib ' oclies which " recognize an epitope on anti-HCV antibodies will bind due to complex formation.
  • the amount of HCV antibodies in the sample is deduced by monitoring the competitive effect on the binding of a known amount of labeled antibody (or other competing ligand) in the complex.
  • Complexes formed comprising anti-HCV antibody are detected by any of a number of known techniques, depending on the format.
  • unlabeled HCV antibodies in the complex may be detected using a conjugate of antixenogeneic Ig complexed with a label, (e.g., an enzyme label).
  • the test sample typically a biological sample
  • anti-HCV antibodies under conditions that allow the formation of antigen-antibody complexes.
  • Various formats can be employed. For example, a "sandwich assay" may be employed, where antibody bound to a solid support is incubated with the test sample; washed; incubated with a second, labeled antibody to the HCV antigenic polypeptides, and the support is washed again (infra). HCV antigenic polypeptides are detected by determining if the second antibody is bound to the support.
  • a test sample is usually incubated with antibody and a labeled, competing antigen is also incubated, either sequentially or simultaneously.
  • Kits suitable for immunodiagnosis and containing the appropriate labeled reagents are constructed by packaging the appropriate materials, including the polypeptides of the invention containing HCV epitopes or containing antibodies directed against HCV epitopes in suitable containers, along with the remaining reagents and materials required for performing the assay, as well as a suitable set of assay instructions.
  • HCV antigenic polypeptides such as E2 and/or El glycoproteins
  • E2 and/or El glycoproteins may be used as an immunogen to generate antibodies which recognize such an immunogen.
  • antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, " and an aD " expression library.
  • HCV antigenic polypeptides Various procedures known in the art may be used for the production of polyclonal antibodies to HCV antigenic polypeptides.
  • various host animals can be immunized by injection with the HCV antigenic polypeptides, including but not limited to rabbits, mice, rats, tc.
  • adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances uch as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and otentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • corynebacterium parvum otentially useful human adjuvants
  • any technique which rovides for the production of antibody molecules by continuous cell lines in culture may be used.
  • human antibodies may be used and can be obtained by using human hybridomas (Cote et al, 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96).
  • Recombinant RV vectors expressing an HIV-1 envelope protein In a preferred emodiment recombinant RVs expressing HTV-1 envelope protein is explained.
  • a new vector is constructed based on the previously described infectious RV cDNA clone pSAD-L16. (Schnell, et al., EMBO Journal, 13:4195-4203, 1994).
  • the ⁇ gene is deleted from the RV genome and a new transcription unit, containing a RV Stop/Start signal and two single sites (BsiWI and Nhel), is introduced into the RV genome (see also Generation of recombinant vectors, supra).
  • the resulting plasmid is designated pSBN (Fig. 1).
  • the SBN RV-vector is recovered by the reported methods and displayed the same growth characteristics and similar viral titers as SAD-L16, indicating that neither the deletion of the ⁇ gene nor the new transcription unit affected the RV vector (deleted).
  • HTV-1 envelope genes (NL4-3 and 89.6) to be expressed from SBN are generated by PCR and cloned between the BsiWI and Nhel sites, resulting in the plasmids pSBN-NL4-3 and pSBN-89.6 (Fig.l). All constructs are checked via DNA sequencing. It should be noted that foreign genes up to at least 4kb are stable within the RV genome and a full length HTV-1 envelope protein is expressed from the recombinant RVs.
  • Recombinant RVs expressing either HTV-1 N - 3 or HTV-1 8 .6 envelope proteins are recovered by transfection of cells stably expressing the T7-RNA-polymerase with plasmids encoding the RV N, P, and L proteins along with a plasmid coding for the respective RV full-length anti-genomic RNA. Three days after transfection, supematants of transfected cells are transferred to fresh cells and three days later analyzed by indirect immunofluorescence microscopy for expression of HTV-1 gpl60.
  • the recombinant RVs expressing HTV-1 gag are also constructed and recovered with the same procedure used for the recombinant RVs expressing HTV-1 envelope protein.
  • recombinant RVs expressing HTV-1 envelope protein are examined. A three-fold lower titer for SBN-NL4-3 and a 10-fold titer reduction for SBN-89.6 is noticed, as compared to wild-type SBN.
  • a one-step growth curve of the recombinant RVs is performed. BSR cells are infected with a MOI of ten to allow synchronous infection of all cells. After replacing the virus inoculum with fresh medium, viral titers are determined at the indicated time-points (Fig. 2).
  • HTV-1 gpl60 by recombinant RVs is also examined.
  • cell lysates from recombinant RV infected cells are analyzed by Western immunoblotting with an antibody directed against RV (Fig. 3, -rabies) or HTV-1 g ⁇ l20 (Fig. 3, -g ⁇ l20).
  • Two bands of the expected size for HTV-1 gpl60 and gpl20 are detected in lysates from cells infected with SBN-89.6 or SBN-NL4-3 (Fig. 3, lanes 3 and 4), but are not observed in cell lysates of mock-infected or SBN infected cells (Fig. 3, lanes 1 and 2).
  • the Western blot probed with an ⁇ RV antibody confirmed that all viruses (Fig. 3, lanes 2, 3, and 4) infected the target cells.
  • Envelope proteins expressed in recombinant RVs are functional to determine whether the expressed HTV-1 envelope protein is functionally expressed from RV, the recombinant RVs are analyzed in a fusion assay in a human T cell-line (Sup-Tl). This experiment confirmed that wild-type RV is able to infect and replicate in human T cell-lines. Because wild-type RV infects cells by receptor- mediated endocytosis, the RV glycoprotein (G) can only cause fusion of infected cells at a low pH. (Whitt, et al., Virology, 185:681-8, 1991).
  • Envelope protein from the dual-tropic HTV-1 strain (89.6) will induce cell fusion if coexpressed with CD4 and CCR5, whereas NL4-3 gpl60 will only induce fusion on cells expressing CD4 and the HTV-1 coreceptor CXCR4.
  • Infection of 3T3 murine cells expressing human CD4 does not result in cell fusion regardless of the recombinant RV used, whereas syncytium-formation is detected in 3T3 cells expressing CD4 and CXCR4 after infection with SBN-NL4-3 or SBN-89.6.
  • SBN-NL4-3 or SBN-89.6 As expected, only expression of HTV-1 89 . 6 envelope protein in 3T3 cells, expressing CD4 and CCR5, caused fusion of these cells.
  • Anti-gpl20 antibody response in mice infected with RV expressing HTV-1 gpl60 is also analyzed.
  • One likely requirement lor a successtul fiiv-l vaccine is the ability to induce a strong humoral response against the HTV-1 protein gpl60.
  • groups of five BALB/c mice are inoculated subcutaneously in both rear footpads with 10 6 FFU of SBN, SBN-89.6, or 10 5 FFU SBN-NL4-3. Mice are bled 11, 24, and 90 days after the initial infection with RV and the sera are analyzed by ELISA.
  • mice Twelve days after the subunit boost, the mice are bled and the immune response is analyzed by an HTV-1 gpl20 ELISA.
  • the results demonstrate that an HTV-envelope subunit boost elicits a strong immune response against HTV-1 gpl20 only in mice previously infected with SBN-89.6 or SBN-NL4-3 (Fig. 5). Wild-type RV (SBN) infected mice reacted only in the lowest serum dilution (1:160) after the boost.
  • An ELISA specific for HTV-1 gp41 is negative for all mouse sera, even after the boost with recombinant HTV-1 gpl20/gp41. These data are confirmed by Western blot analysis (Fig. 6).
  • HTV-1 neutralizing antibody (NA) titers are determined in MT-2 cells by a vital dye staining assay using HTV-IN - 3 -
  • the mouse serum is able to neutralize a tissue culture laboratory adapted (TCLA)''H -fNi -3 ''stra , ft""a't 'i 'a 'T:800 serum dilution after immunization with SBN-NL4-3 and an envelope subunit booster injection of recombinant gpl20 (TUB strain), whereas immunization with SBN-NL4-3 did not induce detectable neutralizing antibody.
  • mice with recombinant RV expressing HTV-1 gpl60 results in a strong priming of the immune system, as indicated by vigorous humoral responses after a single boost with HTV-1 g ⁇ l20 protein or gp41.
  • boosting with another recombinant RV using a different viral glycoprotein for infection of the mice, or recombinant VSV expressing HTV-1 gpl60 can be tested for an even stronger response. Induction of long-lasting HIV-1 gpl60-specific CTL.
  • RV-based vectors are excellent for B cell priming (supra).
  • the present invention further relates to the memory CTL response against HIV-1 envelope protein expressed by the attenuated RV-based vectors. As noted, increasing evidence suggests that the induction of a vigorous, long-lasting CTL response is an important feature for a successful HIV-1 vaccine.
  • mice were immunized with 2 x 10 7 foci forming units (FFU) of the recombinant RV expressing HIV- 1 NL4 _ 3 envelope protein (SBN-NL4-3) (supra and infra). Three mice are sacrificed 105 or 135 days after infection and the spleens are removed. One third of the splenocyte cultures are infected with a multiplicity of infection (moi) of 1 with a recombinant vaccinia virus expressing HlV-l ⁇ gpl ⁇ O for 16 hours, deactivated using Psoralen and N treatment, and added back to the culture as presenter cells.
  • moi multiplicity of infection
  • Stimulated effector cells are analyzed 7 days after activation for their ability to kill P815 target cells infected with vaccinia wild-type virus, a recombinant vaccinia virus expressing HIV-1 ⁇ gpl60 or HIV-1 Gag.
  • a strong cytotoxic response is detected only against P815 target cells infected with the recombinant vaccinia virus expressing HIV-1 envelope protein. Only a low percentage of lysis is observed for P815 cells infected with the other two vaccinia viruses.
  • these responses are achieved after a single inoculation with recombinant RV expressing HIV-1 envelope protein, which indicates that RV-based vectors are able to induce long-lasting CTLs after a single vaccination.
  • HTV-1 envelope amino acid sequences There is a significant difference in HTV-1 envelope amino acid sequences but cross-protection between divergent viruses will be a likely requirement for a protective HTV-1 vaccine.
  • mice are immunized intraperitoneally (i.p) either with 2 x 10 7 recombinant RV expressing HTV-1 gpl60 from a laboratory- adapted, CXCR4-tropic (NL4-3) or a dual-tropic (CXCR4 and CCR5) isolate (89.6).
  • mice from each group are sacrificed, the spleens are removed, and the pooled splenocytes are stimulated with a recombinant vaccinia virus expressing the homologous HTV-1 envelope protein (NL4- 3 or 89.6).
  • effector cells are analyzed for their ability to lyse P815 cells infected with recombinant vaccinia viruses expressing HTV-1 envelope protein from the laboratory-adapted, CXCR4-tropic HTV-1 strain (NL4-3), the dual-tropic strain (89.6), and two primary, CCR5-tropic HTV-1 strains (Ba-L and JR-FL).
  • Activated splenocytes from SBN- NL4-3 immunized mice achieved a specific lysis of P815 cells expressing gpl60 JR- FL or 89.6 in the 40% range at an effecto ⁇ target (E:T) ratio of 50:1 and are also able to cross-kill target cells expressing HTV-lBa- L gpl60. Cross-killing is also observed with effector cells from SBN-89.6 primed mice.
  • P815 target cells are lysed in the same range as observed for activated splenocytes from mice immunized with SBN- NL4-3, but lysed only about 20% P815 cells expressing HTV-1 NL A- 3 - These data indicate that CTLs against HTV-1 gpl60 induced by RV-based vectors may be directed against different epitopes within the HTV-1 envelope protein.
  • HTV-l-svecific CTL activity is mediated by CD8 + T-cells
  • the phenotype of the T-cell subpopulation mediating cytolytic activity is assessed by selective depletion.
  • Three mice are immunized with 2 x 10 7 FFU of recombinant RV expressing HTV-1 N 4 - 3 envelope protein, eighteen weeks later the spleens are removed.
  • Splenocytes are re-stimulated with a recombinant vaccinia virus expressing the homologous HTV- ⁇ envelope protein for 7 days.
  • Tmmuno- magnetic bead cell separation is completed to both deplete and positively isolate CD8 T T-cells from the activated splenocyte culture.
  • Chromium release assays are completed using cultures depleted of CD8 + T-cells (CD8 " ), cultures of isolated CD8 cells (CD8 + ) or unprocessed cultures (CD8 + /CD8 " ).
  • P815 target cells are infected with vaccinia virus expressing HTV-I N M- 3 gpl60 or HTV-1 gag.
  • the CD8 + T-cell depleted cultures show no activity while the CD8 + T-cell enriched and unprocessed cultures show high specific lysis at E:T ratios of 25:1 and 12.5:1, respectively.
  • the CD8 + T-cell enriched population is also enriched in lytic units, as the CTL activity is still on a plateau at 12.5:1, in contrast to the unselected population.
  • These data indicate that the cytolytic activity is mediated by the CD8 + T-cell sub-population.
  • these results imply that in addition to antibodies, recombinant RV vectors also generate long-lived anti-HTV-1 CD8 + T-cell responses.
  • El and E2 are present on the surface of HCV virions (Dubuisson, 2000). Furthermore, HCV E2 has been reported to interact with CD81, a potential receptor for HCV (Pileri et al., 1998).
  • the present invention provides a Rhabdovirus-based vector that expresses El and/or E2 for use as an HCV vaccine wherein HCV glycoprotein(s) are presented to the immune system for the generation of both a cellular and an immune response.
  • RV vaccine strain-based vector To generate RV recombinant viruses a RV vaccine strain-based vector is used with a new RV transcription unit, containing a RV Stop/Start signal and two single sites ( Figure 12 and supra).
  • RV recombinant viruses Two similar RV recombinant viruses are generated.
  • TMD transmembrane domain
  • CD cytoplasmic domain
  • RV vectors stably express large foreign genes (McGettigan et al., 2001a; Mebatsion et al., 1996; Schnell et al., 2000).
  • the infectious RVs were detected in tissue culture supematants of cells transfected by standard RV recovery protocols for pSPBN, pSPBN-ElE2p7, pSPBN-E2CD4, and pSPBN-E2CD4G (Finke and Conzelmann, 1999).
  • the recombinant RVs expressing HCV proteins grew to the same (or greater) titers as SPBN, which were at least 10 8 FFU.
  • HCV envelope proteins El and E2 interact to form a non-covalent heterodimeric complex, which is retained in the endoplasmic reticulum (ER).
  • ER endoplasmic reticulum
  • the chimeric HCV E2 protein containing the transmembrane domain (TMD) and cytoplasmic domain (CD) of CD4 is transported to the cell surface (Dubuisson, 2000).
  • BSR cells were infected with SPBN-ElE2p7 ( Figure 13, Panels A, A', A"), SPBN-E2CD4G ( Figure 13, Panels B, B', B") or SPBN ( Figure 13, Panels C, C C") at a multiplicity of infection (MOI) of 0.1.
  • MOI multiplicity of infection
  • E2CD4 chimeric E2 proteins
  • E2CD4G containing the CD4 TMD and the RV G CD
  • Recombinant HCV E2 is incorporated into RV virions.
  • a recombinant virion containing HCV E2 is provided by the present invention and is useful for producing E2 antigen for diagnostic use, as well as for a killed vaccine against HCV.
  • BSR cells were infected with SPBN, SPBN-E2CD4 and SPBN-E2CD4G with a MOI of 0.1.
  • virus was purified from the supematants of infected cells by a 20% to 70% density sucrose gradient. Viral proteins were separated by SDS-PAGE and detected by Coomassie blue staining.
  • the recombinant virions were then analyzed by Western blotting using an antibody directed against E2.
  • the recombinant E2 was readily detected in both SPBN- E2CD4 and SPBN-E2CD4G particles ( Figure 15, lanes 5 and 6), whereas no signal was detected for SPBN ( Figure 15, lane 4) or SPBN-ElE2p7. It was surprising that both E2CD4 and E2CD4G were incorporated into RV particles since an earlier finding by Mebatsion et al. indicated that the RV G CD is a requirement for incorporation of a foreign glycoprotein into RV virions (Mebatsion et al., 1996). This is not the case for HCV E2, as quantification of E2 indicated that the content of the recombinant E2CD4 was at least 60% of E2CD4G.
  • RV G CD The presence of the RV G CD in the HCV envelope protein expressed by SPBN-E2CD4G was also verified by Western blotting using an antibody specific for the RV G CD. Previous studies with this antibody showed that recombinant E2CD4G co-migrates with RV G, which made it impossible to distinguish between the two proteins. RV G contains only three to four N-linked glycosylation sites, whereas HCV E2 is a heavily O- and N-glycosylated. Therefore, the RV virions were digested with N-glycosidase F to remove the N-glycan chains. As illustrated in Figure 15, lane 7-9, the anti-RV G antibody detected a band of similar size and intensity of deglycosylated RV G, whereas two prominent additional bands were detected in virions containing E2 envelope protein with the RV G.
  • Recombinant HCV E2 is primarily produced by transfection of cells with plasmids encoding a naive E2 or a truncated form of HCV E2, which is secreted in the tissue culture supernatant. In both cases, only small amounts of protein are produced.
  • RVs are easy to grow and purify and 1 mg RV G protein can be extracted from 1 liter of tissue supematants of RV infected cells.
  • RV virions are readily deactivated prior to purification and, therefore, handling infectious material is lirmted"to ' tne'gfow ' ffi' ' ⁇ f " tH ' e viruses".'
  • a control serum from a RV-vaccinated person showed a similar ELISA titer to that of the HCV-positive patients due to the presence of the RV G in the recombinant SPBN-E2CD4G virion used to coat the plates.
  • Figure 16, HCV-/RV+ Only the sera from the RV vaccinated donor reacted with the control ELISA plates, coated with SPBN derived glycoprotein. As expected, the sera from the HCV patients did not react with the SPBN coated plates.
  • the present invention provides recombinant RVs as a quick and easy tool to screen for seroconversion against E2 in HCV-infected individuals.
  • Recombinant RVs expressing HCV glycoproteins are immunogenic in mice. Induction of a humoral immune response
  • the immune responses which may protect humans from HCV infection are not well-defined, but it is likely that both cellular and humoral responses will be required for protection of infection or clearence of HCV.
  • To analyze the immunogenicity of the RV vector expressing HCV proteins a group of ten female BALB/c mice were infected with lxlO 7 FFU of SPBN-E2CD4G, a group of five mice with an equal amount of the RV vector SPBN, and left five mice uninfected.
  • mice Fourteen days post immunization, all mice were bled and sera analyzed by ELISA using recombinant HCV E2. No E2-specific antibodies were detected.
  • mice were bled and sera analyzed by an HCV-specific ELISA.
  • E2-specific antibodies were expected in the sera of mice primed with live SPBN- E2CD4G and boosted with killed SPBN-E2CD4G, but only two out of five mice had E2-specific antibodies.
  • no adjuvant was used for the immunization with the killed virions, which may explain why only a portion of the mice developed antibodies directed against HCV E2.
  • mice from each group received a second immunization with the same killed virions that were used for the first immunization. Ten days later, the mice were bled and E2-specific ELISAs performed. The results ( Figure 17) show that all mice boosted with the killed virions containing the HCV E2 seroconverted, whereas sera from SPBN-E2CD4G primed mice that were boosted twice with killed SPBN virions were negative. These results indicate that two inoculations with inactivated RV virions containing chimeric HCV E2 are able to induce a potent humoral response directed against HCV E2. Of note, priming with the recombinant RV SPBN-E2CD4G did not result in a stronger B cell response against HCV E2, as seen in unprimed or SPBN primed mice.
  • HCV glycoproteins In contrast to HTV-1 gpl60 (supra), limited information is available for specific CTL epitopes of HCV glycoproteins in mice. To analyze if a single inoculation with the RV-based vaccine vehicle expressing the HCV glycoproteins El and E2 is able to induce a cellular response against HCV E2, ten female BALB/c mice
  • the present invention relates to RV-based vectors expressing HTV-1 envelope proteins. These vectors are able to induce a humoral response against HTV-1 gpl60 after a single immunization followed by a boost injection with recombinant HTV-1 gpl20. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.). Expanding evidence suggests that CTL responses play a major role in the anti- viral immune response against HTV-1. (Brander, C. and B. D. Walker, Current Opinion in Immunology, 11:451-9, 1999.). The development of an effective prophylactic HTV-1 vaccine therefore requires the selection of HTV-1 antigen(s) capable of inducing long- lasting and broadly reactive CTL responses. The present invention further relates to RV-based vectors to induce such responses.
  • RV nucleoprotein which was previously shown to be an exogenous superantigen (Lafon, M., Research in Immunology, 144:209-13, 1993; Lafon, M., et al., Nature, 358:507-10, 1992), might help to enhance a general immune response against the HTV-1 envelope after a single immunization.
  • the recombinant RVs of the present invention are able to induce cross-reactive CTLs against a variety of different HTV-1 envelope proteins.
  • Previous studies showed that single amino acid exchanges can abrogate CTL cross-reactivity, whereas other examinations indicated that single or even double amino acid substitutions frequently did not abrogate cross-killing. (Cao, H., et al., J. Virol, 71:8615-23, 1997; Johnson, R. P., et al., Journal of Experimental Medicine, 175:961-71, 1992; Johnson, R. P., et al., Journal of Immunology, 147:1512-21, 1991.).
  • the present invention demonstrates the ability of the murine sera to neutralize HTV-1 strain.
  • recombinant RVs are excellent vectors for B cell priming.
  • the present invention also shows that a single vaccination with recombinant RV expressing HTV-1 envelope protein elicits a strong, long-lasting CTL response specific against HTV-1 proteins, such as the envelope protein of different HTV-1 strains.
  • RVs of the present invention Using the recombinant RVs of the present invention, all of the dominant epitopes for neutralizing antibodies, cytotoxic lymphocytes, and antibody dependent cell cytotoxicity are expressed at one time, thereby eliciting both humoral and cell-mediated immunity against HTV-1.
  • the present invention further relates to RV-based vectors expressing HCV envelope proteins.
  • HCV vaccines using both killed RV particles containing recombinant HCV E2 and live, replication-competent, RV vaccine stra ⁇ h-ba " sed ' vectors. '"" "i ' hree " "K'V Vectors expressing HCV envelope proteins were constructed.
  • One vector expresses the HCV envelope proteins El and E2.
  • a second vector expresses a modified version of E2, with an 85 amino acid deletion at its carboxy-terminus, and the TMD and CD of human CD4.
  • the third vector expresses the modified version of E2 with the TMD of human CD4 and the CD of the RV glycoprotein.
  • the present invention reveals that a RV vaccine vector is able to induce long- lasting CTL responses against HCV E2 but the specific killing was not as strong as previously seen for HTV-1 Gag or envelope (supra).
  • Our data are consistent with those of other groups who used other HCV vaccine approaches in BALB/c mice and detected only a low percentage of specific CTLs against HCV E2 (Vidalin et al., 2000). More recently, Gordon et al. characterized a new MHC class I E2-specific epitope for the H-2d haplotype (Gordon et al., 2000), which may be helpful for further studies of cellular responses against HCV E2 in BALB/c mice.
  • the present invention clearly indicates that RV-based vectors are potent vectors for the induction of E2- specific CTLs.
  • HCV-specific humoral response for a HCV vaccine are more conflicting.
  • Infection of host cells with enveloped viruses is typically mediated by an interaction between the viral glycoprotein(s) in the host-cell derived membrane and a cellular receptor(s) on the host cell.
  • HVRl hypervariable region 1
  • Previous studies indicate that the hypervariable region 1 (HVRl) of E2 binds to the cellular CD81 molecule of the host cell (Flint et al., 1999). Hence, it is probable that host-produced antibodies against E2 would neutralize the attachment and/or fusion of HCV virions to host cells during a natural infection.
  • the present invention provides a new vaccine strategy to immunize against HCV.
  • the present invention provides HCV proteins that are stably expressed and induce a long-lasting cellular response as well as a strong E2-specific B-cell response in vivo.
  • FIG. 1 Shown in Fig. 1 is a schematic representation of a method for the construction of recombinant RV genomes.
  • the wild-type RV genome with its five open reading frames is shown (SAD L16).
  • SAD L16 wild-type RV genome with its five open reading frames
  • SBN G and L genes
  • the cDNA sequence encoding HTV-1 89 . 6 or HTV-IN L - 3 gpl60 is inserted using the BsiWI and Nhel sites resulting in the plasmids, pSBN-89.6 or pSBN-NL4-3 (bottom). Two single sites are introduced in the previously described RV cDNA pSAD
  • two fragments are amplified by PCR from pSN using Vent polymerase (New England Biolabs Inc.) and the forward primers RP1 5 - TTTTGCTAGCTTATAAAGTGCTGGGTCATCTAAGC-3' (SEQ ID NO: 3) or RP10 5'-CACTACAAGTCAGTCGAGACTTGGAATGAGATC-3' (SEQ ID NO: 4).
  • the reverse primers were RP18 5 -TCTCGAGTGTTCTCTCTCCAACAA-3' (SEQ ID NO: 5) and RP17 5'-
  • RP17 contains a RV transcription Stop/Start sequence (underlined) and a BsiWI and Nhel site (shown in italics). PCR products are digested with Nhel, ligated, and the 3.5 kb band eluted from an agarose gel. After gel elution the band is digested with Clal/Mlul and ligated to the previously Clal/Mlul digested pSN. The plasmid is designated pSBN.
  • HIV-1 gpl60 genes encoding the envelope protein of the HIV-1 strains 89.6 and NL4-3, are amplified by PCR using Vent polymerase, the forward primer 5'-
  • GGGC ⁇ GCAGC ⁇ CGAGCG ⁇ ACGAAAATGAGAGTGAAGGAGATCAGG-3 ' (SEQ ID NO: 7) containing Pstl/XhoI/BsiWI sites (italics), and the reverse primer 5'- CC ⁇ C ⁇ AGATTATAGCAAAGCCCTTTCCAAG-3' (SEQ ID NO: 8) containing a Xbal (italics) site.
  • the PCR products are digested with Pstl and Xbal and cloned to pBluescript II SK + (Stratagene).
  • the HIV-1 gpl60 genes are excised with BsiWI and Xbal and ligated to pSBN, which had been digested with BsiWI and Nhel.
  • the resulting plasmids are entitled pSBN-89.6 and pSBN-NL4-3.
  • PCR polymerase chain reactions
  • pSBN was described previously (Schnell et al., 2000) and was the target to introduce a new single restriction site (Pad, bold) downstream of the RV G gene by site-directed mutagenesis (GeneEditor) using the primer
  • the resulting plasmid was designated pSPBN.
  • the gene encoding the structural proteins ElE2p7 of HCV was amplified by PCR from pTMl/ElE2p7 (Michalak et al., 1997), using the forward primer
  • RP58 5'-CTCGAGCGTACGAAAATGAATTCCGACCTCATGG-3' (SEQ. ID. NO: 10) containing a BsiWI site (bold), and the reverse primer
  • PCR product was digested with BsiWI and Nhel and cloned into pSPBN previously digested with BsiWI and Nhel. The resulting plasmid was entitled pSPBN-ElE2p7.
  • RV encoding the HCV E2 ED with an 85 amino acid deletion at its carboxy-terminus and containing the CD4 TMD and the RV G CD (rather than the CD4 CD) was PCR amplified from pSBN (Schnell et al., 2000) using the forward primer RP29 5'-CCC GGGTTAACAGAAGAGTCAATC GATCAGAAC-3' (Hpal, bold; SEQ. ID.
  • HCV E2 with an 85 amino acid deletion at its carboxy-terminal end, fused to the TMD of CD4 was amplified by PCR from pTMl/E2 661 -CD4 using the primers RP74 and RP57 5'-AACGAAGAAGATGCCTAGCCC-3' (SEQ. ID. NO: 16).
  • the first PCR product was digested with Hpal, ligated to the second one and the ligation was PCR re-amplified with the primers RP56 and RP8.
  • the PCR product was cloned utilizing the BsiWI and Xbal sites into pSPBN previously digested with BsiWI and Nhel.
  • the resulting plasmid was designated pSPBN-E2CD4G.
  • Example 2 Recovery of infectious RVfrom cDNA.
  • BSR-T7 cells which stably express T7 RNA polymerase (a generous gift of Drs. S. Finke and K.-K. Conzelmann) are transfected with 5 ⁇ g of full-length RV cDNA in addition to plasmids coding for the RV N-, P-, and L- proteins (2.5 ⁇ g, 1.25 ⁇ g, and 1.25 ⁇ g) respectively, using a CaJPO, ⁇ transfection kit (Stratagene) as indicated by the vendor. Three days after transfection, tissue culture supematants are transferred onto fresh BSR cells and infectious RV is detected three days later by immunostaining against the RV-N protein (Centocor).
  • Shown in Fig. 2 is a graph showing One-step growth curves of recombinant RV BSR cells that are infected with the recombinant RVs (SBN, SBN-89.6, and SBN- NL4-3). The viral titers are determined in duplicate at the indicated time-points.
  • BSR cells (a BHK-21 clone) are plated in 60 mm dishes and 16 hours later infected (7xl0 6 cells) with a multiplicity of infection (MOI) of 5 with SBN, SBN- 89.6, or SBN-NL4-3 in a total volume of 2 ml. After incubation at 37°C for 1 hour, inocula are removed and cells are washed four times with phosphate-buffered saline (PBS) to remove any unabsorbed vims. Three milliliters of complete medium is added back and 100 ⁇ l of tissue culture supematants are removed at 4,16, 24 and 48 hours after infection. Vims aliquots are titered in duplicate on BSR cells.
  • MOI multiplicity of infection
  • FIG. 3 the Western blot analysis of recombinant RVs expressing HTV-1 gpl60 is shown.
  • Sup-Tl cells are infected with a MOI of 2 with SBN, SBN-89.6, or SBN-NL4-3 and lysed 24 h later. Proteins are separated by SDS-PAGE and analyzed by Western blotting.
  • An antibody directed against gpl20 detected two bands at the expected size for HTV-1 gpl60 and gpl20 in cell-lysates infected with SBN-89.6 or SBN-NL4-3 ( -gpl20, lanes 3 and 4). No signal is detected either in the mock or SBN infected cells ( ⁇ -gpl20, lanes 1 and 2). Successful infection of the cells by the recombinant RVs is confirmed with a polyclonal antibody directed against RV ( ⁇ -rabies, lanes 2, 3, and 4).
  • Shown in Fig. 4. are Sup-Tl cells which are infected using a MOI of 1 with SBN, SBN-89.6, or SBN-NL4-3. Twenty-four hours after infection, syncytia- formation is detected in cell cultures infected with recombinant RV expressing HTV-1 gpl60 (panel SBN-89.6 and SBN-NL4-3), indicating expression of functional HTV-1 envelope protein. No cell fusion is detected in cultures infected with wild-type RV (panel SBN).
  • mice Groups of five 4-6 week old female BALB/c mice obtained from Jackson Laboratories are inoculated subcutaneously in both rear footpads with 10 foci forming units (FFU) SBN, SBN-89.6, or 10 5 NL4-3 in DMEM + 10% FBS. Three out of five mice in each group are boost immunized intraperitonealy three months after infection with 10 ⁇ g recombinant gp41 (TTTB, Intracel Inc.) and 10 ⁇ g recombinant gpl20 (TUB, Intracel Inc.) in 100 ⁇ l complete Freunds adjuvant. HCV immunization for humoral response
  • mice were immunized intraperitoneally (i.p.) with lxlO 7 FFU of the respective RV.
  • sucrose purified RV SPBN or SPBN-E2CD4G
  • ⁇ -Propiolactone 1:1000
  • mice were vaccinated/boosted i.p. with 20 ⁇ g of killed RV particles as indicated in the text and figure legends.
  • sera were collected and analyzed for HCV-specific antibodies by ELISAs (infra).
  • mice Groups of five 6 to 8 week old female BALB/c mice (Harlan) were inoculated intraperitoneally (i.p.) with 10 7 foci-forming units (FFU) of SPBN-ElE2p7.
  • FFU foci-forming units
  • spleens from three mice of each group were aseptically removed, combined, and single cells suspensions were prepared. Red blood cells were lysed with ACK lysing buffer (BioWhitaker), splenocytes washed twice in RPMI-1640 media containing 10% fetal bovine serum and pulsed with 5 ⁇ g/ml peptidel323 [EATYSRCGSGPWJTPRCMVD (SEQ. ID.
  • Example 5 Enzyme-linked Immunosorbent Assay (ELISA ). HIV assay Recombinant HTV-1 gpl20 ( ⁇ TTB strain, Intracel) is resuspended in coating buffer (50 mM Na 2 CO 3 , pH 9.6) at a concentration of 200 ng/ml and plated in 96 well ELISA MaxiSorp plates (Nunc) at 100 ⁇ l in each well. After overnight incubation at 4°C, plates are washed three times (PBS pH 7.4, 0.1% Tween-20), blocked with blocking buffer (PBS, pH 7.4, 5% dry milk powder) for 30 minutes at room temperature, and incubated with serial dilutions of sera for 1 hour.
  • coating buffer 50 mM Na 2 CO 3 , pH 9.6
  • coating buffer 50 mM Na 2 CO 3 , pH 9.6
  • Nunc 96 well ELISA MaxiSorp plates
  • HRP horseradish peroxidase-conjugated
  • H+L horseradish peroxidase-conjugated
  • plates are washed three times and 200 ⁇ l OPD-substrate (o-phenylenediamine dihydrochloride, Sigma) is added to each well.
  • OPD-substrate o-phenylenediamine dihydrochloride, Sigma
  • Optical density is determined at 490 nm.
  • Shown in Fig. 5 is a graph depicting ELISA reactivity of mouse sera against HTV-1 gpl20.
  • mice Five mice each are immunized with recombinant RVs (SBN, SBN-89.6, or SBN-NL4-3) and 3 months after the initial infection three mice from each group are boosted with recombinant HTV-1 gpl20 and gp41 (SBN*, SBN-89.6*, or SBN-NL4-3*). Each data point on the graph indicates the average of mice from each group in three independent experiments. One mouse of the SBN-89.6 group did not react to the boost injection and is not included in the graph. The error bars indicate the standard deviations.
  • HCV assay HCV assay
  • 96-well MaxiSorp plates (Nunc) were coated with recombinant E2 (ImmunoDiagnostic Inc.) in coating buffer (50mM Na 2 CO 3 pH 9.6) at a concentration of 2.5 ⁇ g/ml and incubated overnight at 4°C. Plates were washed three with 0.05% PBS/Tween and blocked with 5% dry milk powder in PBS for one hour at room temperature. Mouse sera were diluted in IX PBS, added to the plates and incubated at room temperature for one hour.
  • the secondary antibody (goat ⁇ -mouse HRP conjugated, Jackson ImmunoResearch) diluted 1:5000 in IX PBS was added and the plates were incubated for 30 minutes at 37°C.
  • OPD substrate (Sigma) was added to the plates after washing three times with 0.05% PBS/Tween. Substrate reaction was stopped by the addition of 50 ⁇ l 2M H 2 SO 4 to each well. Plates were read at 490nm.
  • Human T-lymphocytic cells (Sup-Tl) cells are infected with a MOI of 2 for 24 hours and resuspended in lysis buffer 50mM Tris, pH 7.4; 150 mM NaCl, 1% NP-40, 0.1% SDS, and lx protease inhibitor cocktail (Sigma) for 5 minutes. The protein suspension is transferred to a microfuge tube and spun for 1 minute at 10,000 x g to remove cell debris. Proteins are separated by 10% SDS-PAGE and transferred to a PVDF-Plus membrane (Osmonics).
  • blots are incubated with sheep ⁇ -gpl20 antibody (ARRRP) (1:1000) or human -rabies sera (1:500) in blocking buffer for 1 hour.
  • ARRRP sheep ⁇ -gpl20 antibody
  • HRP horseradish peroxidase-conjugated antibodies
  • Western blot analysis to detect anti-HTV-1 antibody is performed using a commercial Western Blot kit (QualiCode HTV- 1/2 Kit, Immunetics) according to the manufacturer's instructions, except for the mouse sera in which ⁇ -human IgG conjugate is substituted with a 1:5000 dilution of an alkaline phosphatase-conjugated goat anti-mouse IgG (H+L) (Jackson47lmmunoResearch Laboratories). Shown in Fig. 6 is the Western blot analysis of mice semm antibody response to TiLV-1 antigens.
  • Sera from one mouse of each group (SBN, SBN-89.6, or SBN-NL4-3), which are immunized by the RVs ( ⁇ -SBN, ⁇ -SBN-89.6 or OI-SBN-NL4-3), or immunized and boost injected with recombinant gpl20 and gp41 ( ⁇ -SBN*, ⁇ -SBN- 89.6* or ⁇ -SBN-NL4-3*), are tested at 1:100 dilutions.
  • a highly positive and weakly positive human control semm is used to detect the position of the HTV-1 proteins. SC indicates the semm control.
  • BSR cells were infected with a MOI of 5 for 48 hours and resuspended in lysis buffer [50mM Tris, pH 7.4/150mM NaCl/1% NP-40/.l% SDS/ IX protease inhibitor cocktail (Sigma)] on ice for five minutes. The suspension was transferred to a microcentrifuge tube and spun for one minute at 14,000 rpm to remove cell debris. Proteins were separated by 10% SDS/PAGE and transferred to a PVDF-Plus membrane (Osmonics, Minnetonka, MN). Blots were blocked for one hour [5% dry milk powder in PBS (pH 7.4)].
  • blots were washed twice using a 0.1% PBS-Tween-20 solution and incubated with either monoclonal murine ⁇ -E2 antibody (H52, 1:1000) (Flint et al., 1999), monoclonal murine ⁇ -El antibody (A4, 1:1000) (Dubuisson, 2000) or rabbit ⁇ -RV-G tail antibody (1:20,000) (Foley et al., 2000) in 0.1% PBS-Tween for one hour. Blots were then washed three times with 0.1% PBS- Tween.
  • Example 7 Virus Neutralization Assays. HTV-1 strains are recovered on 293T cells and vims stocks are expanded on
  • vaccinia vims is inactivated using Psoralen (Sigma) (infra). Stimulator cells are added back to the effector cell population at a ratio of 3:1 and 10% T-STIM (Collaborative Biomedical Products) is added as a source of interleukin-II (TL-2).
  • the vims is inactivated using psoralen (Sigma). Psoralen is added to cells to achieve a final concentration of 5 ⁇ g/ml. Following a ten minute incubation at 37°C the cells were treated with long- wave UV (365 nm) for 4 minutes and washed twice with PBS.
  • Example 10 Preparation of chromium labeled target cells.
  • Target cells are prepared by infection with vaccinia vims expressing the HIV-1 protein (see specific figure legend for specific protein) for one hour at a moi of 10, washed to remove excess vims, and incubated for 16 hours at 37°C. To measure background, target cells are infected with vaccinia vims expressing HIV-1
  • Target cells are washed once in PBS, incubated with 100 ⁇ Ci 51 Cr for one hour to label the cells, washed two times in PBS and added to effector cells at various E:T ratios (see figures) for four hours at 37°C.
  • the percent specific 51 Cr release is calculated as 100 x ⁇ experimental '"' release - spontaneous release)/(maximum release - spontaneous release).
  • Maximum release was determined from supematants of cells that were lysed by the addition of 5% Triton X-100. Spontaneous release was determined from target cells incubated without added effector cells.
  • Example 11 Preparation ofCD8+ depleted T cells.
  • CD8 + T-cells are depleted from the cell culture (CD8 ) and enriched (CD8 + ) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer.
  • Example 12 Immunofluorescence microscopy.
  • BSR cells were plated in six- well plates containing coverslips and infected with a multiplicity of infection (MOI) of 0.1 for 48 hours. Cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. For internal immunostaining cells were permeabilized with 1% Triton in (phosphor-buffered saline) PBS for 5 minutes at room temperature. Cells were washed three times with PBS-Glycine [lOmM glycine in PBS (pH 7.4)] and incubated with a monoclonal mouse antibody directed against HCV E2 (H53, 1:600) for 1 hour at room temperature and again washed three times with PBS-Glycine.
  • MOI multiplicity of infection
  • Example 13 Use ofE2 proteins derived from purified recombinant virions.
  • Recombinant RVs in the supematants from SPBN or SPBN-E2CD4RVG infected BSR cells were sucrose purified and incubated for 30 minutes with 1% Triton X-100 in PBS.
  • RV Ribonucleoprotein (RNP) complex was removed by centrifugation at 16,000 g at 4° C for an hour. Supematants were removed and used directly to coat
  • 96-well MaxiSorp plates (Nunc) were coated with glycoprotein(s) derived from 25 ⁇ g purified SPBN or SPBN-E2CD4G virions for each plate in coating buffer (50 mM Na 2 CO 3 , pH 9.6) and incubated overnight at 4°C. Plates were washed three times with 0.05% P S7Tweeri' ' and '! blbcked ' '' ' w ⁇ ffi '' ' ' 5 ' % "dry milk powder in IX PBS for 1 hour at room temperature.
  • BRSV bovine respiratory syncytial vims
  • COCQUEREL L., MEUNIER, J. C, PH LEZ, A., WYCHOWSKI, C, and DUBUISSON, J. (1998).
  • a retention signal necessary and sufficient for endoplasmic reticulum localization maps to the transmembrane domain of hepatitis C vims glycoprotein E2. Journal of Virology 72(3), 2183-91.
  • DUVET DUVET, S., COCQUEREL, L., PILLEZ, A., CACAN, R., VERBERT, A.,
  • FARCI P., ALTER, H. J., GOVINDARAJAN, S., WONG, D. C, ENGLE, R.,
  • FARCI P., ALTER, H. J., WONG, D. C, MILLER, R. H., GOVTNDARAJAN, S.,
  • FARCI P., SHIMODA, A., COIANA, A., DIAZ, G., PEDDIS, G., MELPOLDER, J. C,
  • STRAZZERA A., CHIEN, D. Y., MUNOZ, S. J., BALESTR ⁇ ERI, A., PURCELL, R.
  • STRAZZERA A., SH ⁇ M ⁇ ZU, Y., SHAPIRO, M., ALTER, H. J., and PURCELL, R. H.
  • Vims promoters determine interference by defective RNAs: selective amplification of mini-RNA vectors and rescue from cDNA by a 3' copy-back ambisense rabies vims. Journal of
  • Vaccination of chimpanzees with plasmid DNA encoding the hepatitis C vims (HCV) envelope E2 protein modified the infection after challenge with homologous monoclonal HCV. Hepatology 32(3), 618-25. FORNS, X., TH ⁇ MME, R., GOVINDARAJAN, S., EMERSON, S. U, PURCELL, R. H,
  • Hepatitis C vims lacking the hypervariable region 1 of the second envelope protein is infectious and causes acute resolving or persistent infection in chimpanzees. Proc. Natl. Acad. Sci. U SA 97(24), 13318-13323. FRIED, M. W., and HOOE AGLE, J. H. (1995). Therapy of hepatitis C. Seminars in Liver Disease 15(1), 82-91.
  • FROLOV I., AGAPOV, E., HOFFMAN, T. A., JR., PRAGAI, B. M., LIPPA, M.,
  • GORDON E. J., BHAT, R., LIU, Q., WANG, Y. F., TACKNEY, C, and PRJJS ⁇ CE, A.
  • KATO N.
  • SEKIYA H
  • OOTSUYAMA Y.
  • NAKAZAWA T.
  • HDTKATA M.
  • KOJ ⁇ MA M., OSUGA, T., TSUDA, F., TANAKA, T., and OKAMOTO, H. (1994).
  • KRAWCZYNSKI K., ALTER, M. J., TANKERSLEY, D. L., BEACH, M.,
  • ROBERTSON B. H., LAMBERT, S., KUO, G., SPELBR ⁇ STG, J. E., MEEKS, E.,
  • MAJOR M. E., MJHALIK, K., FERNANDEZ, J., SEIDMAN, J., KLEINER, D.,
  • HTV-1 Human Immunodeficiency Vims Type 1 (HTV-1) Envelope Protein
  • PELERI P., UEMATSU, Y., CAMPAGNOLI, S., GALLI, G., FALUGI, F., PETRACCA,
  • PRINCE A. M., BROTMAN, B., HU ⁇ MA, T., PASCUAL, D., JAEFERY, M., and
  • PR ⁇ NCE A. M., BROTMAN, B., LEE, D. H., REN, L., MOORE, B. S., and SCHEFFEL, J. W. (1999). Significance of the anti-E2 response in self-limited and chronic hepatitis C vims infections in chimpanzees and in humans.
  • SHJMIZU Y. K., HTJTKATA, M., IWAMOTO, A., ALTER, H. J., PURCELL, R. H, and YOSHIKURA, H. (1994).
  • HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins.
  • HCV hepatitis C vims
  • WEEMER A. J., GEYSEN, H. M., CHRISTOPHERSON, C, HALL, J. E., MASON, T. J., SARACCO, G., BON ⁇ NO, F., CRAWFORD, K., MARION, C. D., CRAWFORD, K. A., and ET AL. (1992b).
  • HCV hepatitis C vims

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

This invention provides recombinant, replication-competent Rhabdovirus vaccine strain-based expression vectors for expressing heterologous viral antigenic polypeptides such as immunodeficiency virus envelope proteins or subparts thereof. An additional transcription stop/start unit within the Rhabdovirus genome is inserted to express the heterologous antigenic polypeptides. The HIV-1 gp160 protein is stably and functionally expressed, as indicated by fusion of human T cell-lines after infection with the recombinant RVs. Inoculation of mice with the recombinant Rabies viruses expressing HIV-1 gp160 induces a strong humoral response directed against the HIV-1 envelope protein after a single boost with an isolated recombinant HIV-1 gp120 protein. Moreover, high neutralization titers, up to 1:800, against HIV-1 are detected in the mouse sera. These recombinant viral vectors expressing viral antigenic polypeptides provide useful and effective pharmaceutical compositions for the generation of viral-specific immune responses.

Description

RECOMBINANT RHABDOVIRUSES AS LIVE- IRAL VACCINES
GOVERNMENT RIGHTS TO THE INVENTION
This invention was made in part with government support under grant AI44340 awarded by the National Institute of Health. The government has certain rights to the invention.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority, in part, under 35 U.S.C. §120 based upon U.S. Non-Provisional Application No. 09/494,262, filed January 28, 2000. This application is a continuation-in-part of U.S. Non-Provisional Application No. 09/761,312, filed January 17, 2001. This application claims priority, in part, under 35 U.S.C. §119 based upon U.S. Provisional Application No. 60/285,552, filed April 20, 2001.
FIELD OF THE INVENTION
The present invention relates to the fields of molecular biology and virology, and to a method of treating an HTV-l infection and to a method of treating an HCV infection, more particularly, to the induction of both humoral and cellular immunity against HTV-l and against HCV.
BACKGROUND OF THE INVENTION
Great success has been made in the therapy of HTV-1 infection during the last several years. (Holtzer, et al., Annals of Phannacotherapy 33:198-209, 1999; Bonfanti, et al., Biomedicine & Phannacotherapy, 53:93-105, 1999). However, the development of a protective immunodeficiency virus vaccine (e.g., HTV-1 vaccine) still remains a major goal in-- Waiting1 tmmunoden'cϊefl'cy virus pandemics. Most successful vaccines against viral diseases have been composed of killed or attenuated viruses. (Hilleman, M. R., Nature Medicine, 4:507-14, 1998). This approach does not seem to be suitable for immunodeficiency viruses, particularly HTV-1 because killed HTV-1 virus induces only a poor neutralizing antibody response and no cytotoxic T lymphocyte (CTL) response.
New anti-retro viral strategies against human HIV-1 result in a dramatic decrease in mortality among infected humans in developed countries, but the development of a successful vaccine to prevent infection is still the major goal to halt the HIV-1 pandemic. A human being is infected with HIV-1 every 10 seconds on average, and in the heavily affected countries in Africa, such as Zambia and Uganda, nearly 40% of young adults are HTV-1 -seropositive.
Currently, a variety of HIV vaccine strategies are being investigated, including recombinant proteins (Goebel, F.D., et al., European Multinational IMMTJNO AIDS Vaccine Study Group Aids, 5:643-50, 1999; Quinnan, G.V., Jr., et al, AIDS Research & Human Retroviruses, 15:561-70, 1999; VanCott, T.C., et al., J. Virol, 73:4640-50, 1999), peptides (Bekyakov, I.M., et al., Journal of Clinical Investigation, 102:2072- 81, 1998; Berzofsky, J.A., et al., Immunological Reviews, 170:151-72. 1999; Pinto L.A., et al., AIDS, 13:2003-12, 1999), naked DNA (Bagarazzi, M. L., et al., 1999 Journal of Infectious Diseases, 180:1351-5, 1999; Barouch, D. H., et al., Science 290:486-492, 2000; Cafaro, A., et al., Nature Medicine, 5:643-50, 1999; Lu, S., et al. AIDS Research & Human Retroviruses, 14:151-5, 1998; Putkonen, P., et al., Virology, 250:293-301, 1998; Robinson, H. L., Aids, 1 S109-19, 1997; Weiner, D. B., and R C. Kennedy, Scientific American, 281:50-7, 1999.), replication-competent and incompetent (replicon) live viral vectors (Berglund, P., et al., AIDS Research & Human Retroviruses, 13:1487-95, 1997; Mossman, S. P., et al., /. Virol, 70:1953-60, 1996; Natuk, R. J., et al., Proc. Natl. Acad. Sci. USA, 89:7777-81, 1992; Ourmanov, I., et al, J. Virol, 74:2740-2751, 2000; Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.), and prime-boost combinations, [for review see (5)]. A large number of these vaccine strategies have been tested in the simian immunodeficiency virus (SIV) macaque model system, but to date no potent protective immunity has been obtained, although some amelioration of disease course has been seen. (Barouch, D. H., et al., Science, 290:486-492, 2000; Davis, N. L., et al, J. Virol, 74:371-8, 2000; Ourmanov, I., i,etiial.,'fr W t,li'74?274 - y5 * OOO.). So far, the only effective method to protect macaques from SIV infection is the use of live, attenuated SIV. Desrosiers and colleagues showed that a genetically modified, ne -deleted SIV strain that does not cause disease in rhesus monkeys induced high
5 anti-SIV titers of antibodies and cytotoxic T lymphocyte (CTL) activity. (Daniel, M. D., et al, Science, 258, 1938-1941, 1992; Kestler, H. W., et al., Cell, 65:651-662, 1991.). Subsequent challenge of the immunized animals with infectious doses of a pathogenic SIV strain yielded protection from infection. (Daniel, M. D., et al., Science, 258:1938-1941, 1992). A major drawback in the use of attenuated lentiviral
0 vaccine approaches is the finding that even ne/-deleted SIV can give rise to an ATDS- like disease in both neonatal and adult macaques. (Baba, T. W., et al., Science, 267:1820-5, 1995; Baba, T. W., et al., Nature Medicine, 5:194-203, 1999; Desrosiers, R. C, AIDS Research & Human Retroviruses, 10:331-2, 1994.). Additional concerns regarding the use of attenuated lentiviruses arise from the recent finding that
5 recombination of live, attenuated SIV with challenge virus in some cases results in an even more virulent strain. (Gundlach, B. R., et al., J. Virol, 74:3537-3542, 2000.). However, the results indicated that live-viral vectors may be excellent vaccine candidates for an HIV-1 vaccine.
For the foregoing reasons, there is a great need for the development of a
:0 protective immunodeficiency virus vaccine that is non-pathogenic for a wide range of animal species when administered orally or intramuscularly, as well as being able to induce the required neutralizing antibody and CTL responses.
The immune response(s) required to protect against HIV-1 infection is currently unknown, but a protective immune response against HIV-1 might require
:5 both major arms of the immune systems. Recent reports on vaccine approaches using recombinant HIV-1 envelope protein suggests that an exclusively humoral response is not sufficient to protect against an HIV-1 infection, but the passive transfer of three monoclonal antibodies directed against HIV-1 envelope protein resulted in protection of macaques against subsequent challenge with pathogenic HIV-1/SIV chimeric virus. ι0 (Mascola, J. R., et al., Nature Medicine, 6:207-10, 2000.). Other studies indicate that a cell-mediated response plays an important role in controlling an HIV-1 infection. (Brander, C. and B. D. Walker, Current Opinion in Immunology, 11:451-9 1999; Goulder, P. J., et al., Anti-HTV cellular immunity: recent advances towards . . have HIV-1 -specific CTLs but no detectable antibodies against HIV-1 (Pinto, L. A., et al., Journal of Clinical Investigation, 96:867-76, 1995; Rowland- Jones, S. L., et al., Journal of Clinical Investigation, 102:1758-65, 1998.). In the present invention, the ability of recombinant non-segmented negative- stranded RNA viruses expressing an immunodeficiency virus gene(s) as an immunodeficiency virus vaccine (e.g., HIV-1 vaccine) is disclosed. Specifically, the ability of a Rhabdovirus-based recombinant viruses to induce an immune response against HIV is demonstrated. The HTV-1 envelope protein is stably and functionally expressed and induces a strong humoral response directed against the HTV-1 envelope protein after a single boost with recombinant HIV-1 protein boost (gpl20) in mice. Moreover, high neutralization titers against HTV-1 are detected in the mouse sera. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.).
Little information is available regarding the induction of CTL responses against foreign proteins expressed by rhabdovirus-based vectors. The present invention fulfills this long sought need and further relates to recombinant RV vaccines expressing HTV-1 envelope proteins to induce HTV-1 -specific CTLs. Specifically, a single inoculation of the HTV-1 virus vaccines of the present invention induce a solid and long-lasting memory CTL response specific for HTV-1 proteins. These recombinant viruses are non-pathogenic for a wide range of animal species when administered orally or intramuscularly. In a specific embodiment when the coding region of the HIV-1 gpl60 (strains NL4-3 and 89.6) is cloned between the RV glycoprotein (G) and polymerase (L) proteins under the control of a RV transcription Stop/Start signal, the resulting recombinant RVs expressed HIV-1 gpl60 along with the other RV proteins.
In addition to HTV, treatment regimens targeted against Hepatitis C virus (HCV), the primary etiological agent of non-A, non-B hepatitis, are expensive, show a relatively low rate of response, and carry the potential for significant side effects (Fried and Hoofnagle, 1995). The majority of patients (70%) with HCV develop chronic hepatitis and a third of these cases progress to liver cirhossis. All infected individuals have an increased risk of hepatocellular carcinoma (Aihara and Miyazaki, 1998) Therefore, there is a long sought, yet unfulfilled need for the development of a protective vaccine against HCV. The present invention fulfills this need by glycoprotein(s) to induce an immune response against HCV.
HCV is a small, enveloped positive strand RNA virus of the Flaviviridae family (Clarke, 1997). The 9.6 kilobase genome consists of a 5' nontranslated region (NTR) which contains an internal ribosome entry site (IRES) to begin translation of the viral polyprotein (Le, Siddiqui, and Maizel, 1996), which is cleaved by both host and viral proteases to yield four structural and six non-structural (NS) proteins (Reed and Rice, 1998). The genome encodes two envelope glycoproteins, El and E2, which are released from the polyprotein via signal peptidase cleavages (Grakoui et al., 1993). Both proteins are largely modified by N-linked glycosylation and are thought to be type I integral transmembrane proteins with C-terminal hydrophobic anchor domains. Expression of both the glycoproteins in mammalian cell-lines illustrates their retention in the endoplasmic reticulum (ER), with no surface expression detectable (Duvet et al., 1998). The E2 glycoprotein contains two hypervariable regions (HVR), with HVRl located at amino acid positions 390-410, and HVR2 located at positions 474-480 (Weiner et al., 1991). Antibodies directed against the HVRl of E2 have been implicated in controlling HCV infection (Kato et al., 1993). In addition, the HVRl of E2 contains both B-cell and cytotoxic T-lymphocyte (CTL) epitopes. Furthermore, antibodies specifically directed at this region reportedly blocked viral attachment in susceptible cells, further implicating E2 as responsible for viral attachment to the host cell (Kojima et al., 1994; Leroux-Roels et al., 1996; Lesniewski et al., 1995).
To date, HCV vaccine studies involving E2 have utilized several strategies in a murine mode,l including purified recombinant antigens, DNA immunization (Gordon et al., 2000), DNA priming in conjunction with recombinant viruses such as Semliki Forest Virus and canarypox (Pancholi et al., 2000; Vidalin et al., 2000), DNA priming with recombinant protein boosting (Song et al., 2000), replication-deficient recombinant adenovirus (Makimura et al., 1996), and plasmid DNA immunization (Inchauspe, 1999). Each of these strategies has experienced limited success in producing both a humoral and cellular immune response. Overall, E2 generates a potent antibody response, but a weak CTL response in mice in contrast to the core protein (Saito et al., 1997) or nonstructural proteins (Gordon et al, 2000). One potential reason E2 has not generated a significant CTL response in previous studies is the form of the protein that is preseiϊted'br1 encoded. Recent work by Flint et. al (Flint et al., 2000) indicates that a monomeric form of the truncated E2 glycoprotein (E2661) preferentially binds CD81, the purported cellular receptor for HCV, as compared to the aggregated form of E2661. Additionally, intracellular forms of E2661 bind CD81 with greater affinity than extracellular forms.
The present invention provides RV-based vectors wherein the expression of HCV glycoproteins induce an immune response to HCV. Recombinant RV-vectors encoding HCV glycoprotein(s), or a modified version of the E2 glycoprotein with 85 amino acids of its carboxy-terminus deleted are provided herein. Additionally, recombinant RV-vectors expressing the modified version of the E2 glycoprotein along with the human CD4 transmembrane domain (TMD) and the CD4 or RV glycoprotein (G) cytoplasmic domain (CD) are provided. In addition to the RV proteins necessary for expression of immune stimulating virions, the resulting recombinant RVs stably expressed the respective HCV glycoproteins, and elicited both humoral and cellular immune responses in immunized mice.
ABBREVIATIONS
"FFU" means "foci forming units"
"MOI" means "multiplicity of infection" "HIV" means "human immunodeficiency virus"
"HCV" means "hepatitis C virus"
"TMD" means "transmembrane domain"
"CD" means "cytoplasmic domain"
"ED" means "ectodomain" "G" means "glycprotein"
"N" means "nucleoprotein"
"ER" means "endoplasmic reticulum"
"RV" means "rhabdovirus"
"CTL" means "cytotoxic T-lymphocyte" "ELISA" means "enzyme-linked immunosorbant assay"
"kD" means "kilodalton" DEFINITIONS
"boost vaccine vector" is "boost virus" "boost virus" is "boost vaccine vector" "biological sample" refers to a sample of tissue or fluid isolated from an individual, including but not limited to, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vitro cell culture constituents (including, but not limited to, conditioned medium resulting from the growth of cells in cell culture medium, putatively virally infected cells, recombinant cells, and cell components).
SUMMARY OF THE INVENTION
The present invention is directed to recombinant non-segmented negative- stranded RNA virus vectors expressing an immunodeficiency virus genes as a live- viral vaccine (e.g., HTV-1 vaccine) and methods of making and using the same. More in particular the invention relates to recombinant Rhabdoviruses which express gene products of a human immunodeficiency virus and to immunogenic compositions which induce an immunological response against immunodeficiency virus infections when administered to a host. These recombinant live-viral vaccines are non- pathogenic for a wide range of animal species when administrated orally or intramuscularly and induce protective immune responses such as neutralizing antibody response and long lasting cellular (such as cytotoxic T lymphocyte (CTL)) responses against the immunodeficiency viruses.
In general aspects, the invention is a recombinant non-segmented negative- stranded RNA virus vector having: (a) a modified negative-stranded RNA virus genome that is modified to have one or more new restriction sites, or not to have one or more genes otherwise present in the genome; (b) a new transcription unit that is inserted into the modified negative-stranded RNA virus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant non- segmented negative-stranded RNA virus vector is replication competent, and the heterologous viral nucleic acid sequence encod s atf antige'nic" polypeptide.
Specifically, in one embodiment of the invention, the recombinant non- segmented negative-stranded RNA virus vector that is used as a live- viral vaccine is a recombinant Rhabdovirus vector. This vector includes (a) a modified Rhabdovirus genome; (b) a new transcription unit inserted into the Rhabdovirus genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into the new transcription unit, where the recombinant Rhabdovirus vector is replication competent, and the heterologous viral nucleic acid sequence encodes an antigenic polypeptide. The modified Rhabdovirus genome is, for example, modified rabies virus genome or a modified vesicular stomatitis virus genome. The modifications in the Rhabdovirus genome include creation of new restriction sites and/or deletion of one or more genes such as the native G (glycoprotein) gene of the Rhabdovirus, ψ gene of rabies virus, etc. In some instances, the modified Rhabdovirus genome has a further modification to have a glycoprotein from another class of virus in place of the native glycoprotein. The glycoprotein from another class of virus is vesicular stomatitis virus glycoprotein. In some other instances, the modified rabies virus genome has a third modification to have contiguity of structural genes different from that in the rhabodvirus genome after the second modification. The term heterologous viral nucleic acid as used herein refers to the viral nucleic acid that encodes the antigenic polypeptide that induces immune response. For example, a full-length HTV envelope protein, HTV gpl60, HTV gag, HTV gpl20, and full-length STV envelope protein are some of the antigenic polypeptides that are expressed in the recombinant viral vectors of the present invention. The term heterologous viral nucleic acid as used herein does not include the native gene sequences of the one or more classes of Rhabdoviruses in a recombinant Rhabdovirus such as, for example, VSV G gene in the recombinant RV.
In the case of a modified Rhabdovirus genome where G gene is deleted, the sequence of the cytoplasmic domain of Rhabdovirus G gene is fused to other sequences before cloning into the modified Rhabdovirus genome. One such example is a chimeric VSV/RV glycoprotein where the fusion protein has VSV ectodomain and transmembrane domain, and RV cytoplasmic domain. Another such example is a chimeric HJV-l/RV glycoprotein where the fusion protein has HTV-1 gpl60 ectodomain and transmembrane domain, and RV &Vtσp'iasmiC'''dtfrh n."'THus' in some cases, the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein such that the resulting chimeric protein has a fusion between the transmembrane domain of the heterologous protein and cytoplasmic domain of the glycoprotein. In some cases, the glycoprotein gene of the recombinant Rhabdovirus is deleted and the heterologous viral nucleic acid is fused to the sequence of the cytoplasmic domain of the G gene of the modified Rhabdovirus genome to produce a chimeric protein which functionally substitutes for the recombinant Rhabdoviruses glycoprotein gene.
In another embodiment of the invention a recombinant Rhabdovirus that expresses a functional HTV envelope protein is provided. The recombinant Rhabdovirus is replication-competent. The Rhabdovirus can be a recombinant rabies virus or a recombinant vesicular stomatitis virus. The HTV envelope protein expressed from the recombinant Rhabdovirus is from any HTV-1 isolate.
In still another embodiment of the invention, a recombinant Ψ gene deficient Rhabdovirus having a heterologous nucleic acid segment encoding an immunodeficiency virus envelope protein or a subunit thereof is provided. In such cases, the recombinant Ψ gene deficient Rhabdovirus is a rabies virus and the immunodeficiency virus envelope protein, or a subunit thereof, is from a human immunodeficiency virus or from a simian immunodeficiency virus. The subunit or a fragment of the immunodeficiency envelope protein includes fragments having only a part of the contiguous amino acids of the envelope protein. These subunits or fragments include, for example, HTV gpl20, HTV gp41, HTV gp40, the envelop proteins expressed by HTV NI -3 and HTV 89,6, and the subunits of other immunodeficiency viruses.
In yet another embodiment of the invention, a method of inducing an immunological response in a mammal is provided. This method includes the steps of: (a) delivering to a tissue of the mammal a recombinant Rhabdovirus vector that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated imm riodέfϊcieiϊc 1 Virus 1envelop "'τ5fbfein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
The recombinant Rhabdovirus has a rabies virus genome. In the method where the rabies virus genome is used, it is deficient in Ψ gene. In some cases, rabies virus genome is also deficient in a rabies virus glycoprotein gene or rabies virus genome has glycoprotein gene from another class of Rhabdovirus in place of the rabies virus glycoprotein. Boosting the animal can be done by delivering an effective dose of a boost vaccine vector instead of the isolated immunodeficiency virus envelope protein.
In another embodiment of the invention an immunogenic composition having any of the above mentioned recombinant Rabdoviruses along with an adjuvant is provided.
In yet another embodiment of the invention a method of inducing an immunological response in a mammal is provided which includes the steps of: (a) delivering to a tissue of the mammal a non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or a subunit thereof, effective to induce an immunological response to the envelope protein; (b) expressing the envelope protein, or the subunit thereof, in vivo; (c) boosting the animal by delivering an effective dose of an isolated immunodeficiency virus envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and (d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect the mammal from an immunodeficiency virus.
The method where the non-segmented negative-stranded RNA virus is used includes a Rabies virus or a Vesicular Stomatitis virus.
It is a further object of the invention to present a method of treating a mammal infected with an immunodeficiency virus. A non-segmented negative-stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal. This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof. An effective dose of an isolated immunodeficiency virus en elόpe"pτot'eϊή7WsWunϊt'thereol, m an adjuvant or an effective dose of a boost vaccine vector is delivered to the mammal, thereby inducing a neutralizing antibody response and/or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof. In one embodiment the immunodeficiency virus is any HTV-1 virus. In another embodiment the non-segmented negative-stranded RNA virus is a Rhabdovirus. In a further embodiment there is an induction of mucosal immunity to the functional immunodeficiency virus envelope protein, or subunit thereof. In another embodiment the long-lasting cellular response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
It is another object of the invention to present a method of protecting a mammal from an immunodeficiency virus infection. A non-segmented negative- stranded RNA virus that expresses a functional immunodeficiency virus envelope protein, or subunit thereof is administered to the mammal. This RNA virus will express the functional immunodeficiency virus envelope protein, or subunit thereof, thereby thereby inducing a neutralizing antibody response and/or long lasting cellular immune response to the functional immunodeficiency virus envelope protein, or subunit thereof. In one embodiment the immunodeficiency virus is any HTV-1 virus. In another embodiment the non-segmented negative-stranded RNA virus is a Rhabdovirus. In a further embodiment there is an induction of mucosal immunity to the functional immunodeficiency virus envelope protein, or subunit thereof. In another embodiment the long-lasting CTL response is a cross-reactive CTL response wherein the cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency virus strains.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Schematically shows a method for the construction of recombinant
RV genomes.
Figure 2. A graph showing One-step growth curves of BSR cells that were infected with the recombinant RVs (SBN, SBN-89.6, and SBN-NL4-3)
Figure 3. Western blot analysis of ι recombinant rabies viruses (RVs) expressing HTV-1 gpl60.
Figure 4. A composite photograph showing Sup-Tl cells after these cells were infected (using a MOI of 1) with SBN, SBN-89.6, or SBN-NL4-3.
Figure 5. A graph showing ELISA reactivity of mouse sera against HTV-1 gpl20.
Figure 6. Western blot analysis of mice serum antibody response to HTV-1 antigens.
Figure 7. Schematic representation of a method for the construction of RV- based expression vectors with foreign viral glycoproteins. Figure 8. Schematic representation of a method for the construction of full- length and RV-glycoprotein deleted RVs expressing HTV-1 g l60.
Figure 9. CTLs from HTV-1 gpl60 immunized mice induce long-lasting HTV-
1 gpl60-specific CTLs. Groups of three 6- to 8-week-old female BALB/c mice
(Harlan Sprague) are inoculated i.p. with 2xl07 foci-forming units of recombinant RV expressing HTV-INU-3 envelope protein. 105 to 135 days after the single inoculation, spleens are aseptically removed and single cells suspensions are prepared (infra).
Stimulator cells are prepared (infra), then added back to the effector cell population at a ratio of 3:1. Cytolytic activity of cultured CTLs is determined by measurement of the percent 51Cr released (infra). Figure 10. CTLs from HTV-1 gpl60 immunized mice cross-kill target cells expressing heterologous HTV-1 envelope proteins. Groups of six 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl07 foci-forming units recombinant
RV expressing HTV-1 envelope protein from strains NL4-3 (A) or 89.6 (B). Three and four weeks after the single inoculation, spleens were aseptically removed and splenocytes were stimulated in-vitro with vaccinia virus expressing the homologous
HTV-1 envelope protein (infra). Target cells are prepared by infection with vaccinia virus expressing HTV-1 envelope proteins from strains NL4-3 (vCB41), 89.6 (vBD3),
JR-FL (vCB28), or Ba-L (vCB43). Chromium release assays are completed (infra).
The results are shown from two different, independent experiments. Figure 11. Cytolytic activity is mediated by CD8+ T-cells. Groups of three 6- to 8-week-old female BALB/c mice are inoculated i.p. with 2xl07 foci-forming units recombinant RV expressing HTV-1 envelope protein from the NL4-3 strain. Eighteen weeks after the single inoculation, spleens are aseptically removed and splenocytes are stimulated in vitro with vaccinia virus expressing 'fflV-ΪNi 3 "eή'velope protein (infra). Seven days post in vitro stimulation, CD8+ T-cells are depleted from the cell culture (CD8") and enriched (CD8+) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer. Chromium release assays are completed (infra) on cultures depleted (CD8") or enriched (CD8+) of CD8 T-cells, or unprocessed cultures (CD8+/CD8"). Target cells are prepared (infra) by infection with vaccinia virus expressing HTV-l envelope proteins from NL4-3 (vCB41). Background levels were equal to, or below, 6% specific lysis.
Figure 12. Construction of recombinant RV genomes. At the top (A), the SPBN vector derived from the RV vaccine strain SAD B16 is illustrated. Through site directed mutagenesis and a PCR strategy, a transcription Stop/Start signal was introduced in addition to four unique restriction enzyme sites (Smal, Pad, BsiWI and Nhel). The HCV proteins (blue box) were introduced into pSPBN using the BsiWI and Nhel sites resulting in the plasmids pSBPN-ElE2p7 (B), pSPBN-E2CD4 (C), and pSPBN-E2CD4G (D). E2CD4 and E2CD4G are a truncated version of HCV E2 lacking 85 amino acids at their C-terminus, fused to the TMD (green box) and CD of human CD4 (light blue box) or TMD of CD4 and CD of RV G (red box), respectively.
Figure 13. Immunoflourescence studies of recombinant RVs expressing HCV proteins. BSR cells were infected with the recombinant RVs SBPN (A, A', A"), SPBN-ElE2p7 (B, B\ B"), or pSPBN-E2CD4G (C, C\ C") at a MOI of 0.1 and 48 hours after infection, cell were fixed, permeabilized (A', B\ C\ A", B", C") or not (A, B, and C), and stained with a monoclonal antibody directed against E2 (A, A', B, B\ C, and C) or RV N (A", B", or C").
Figure 14. Western Blot analysis of HCV proteins expressed by RV. BSR cells were infected with recombinant RVs as indicated (SPBN, SPBN-ElE2p7, SPBN-E2CD4, SPBN-E2CD4G at a MOI of 5. Cell lysates were separated by SDS- PAGE and transfered to a nitrocellulose membrane. Blots were probed with monoclonal antibodies directed against the HCV El and E2 glycoproteins as indicated (α-El, cxEl+E2 or αEl). Figure 15. Incorporation of HCV proteins in recombinant RVs. Purified particles of SPBN, SPBN-E2CD4 or SPBN-E2CD4G were separated by SDS-PAGE and visualized by Coomassie blue staining (CB, lanes 1, 2, 3) or transferred to a nitrocellulose membrane before (α-E2) or after digestion with N-glycosidase F (α- RV-G-tail). Blots were probed with a monocloώ'ar'aϊitϊbodl'ds di'fέ'dted againsfthe'HCV E2 ( -E2 lanes 4,5 and 6) or a polyclonal rabbit serum specific for the RV G CD (α- RV-G-tail, lanes 7, 8, 9).
Figure 16. Recombinant SPBN-E2CD4G virions as a diagnostic tool. ELISA plates were coated with recombinant HCV E2 derived from purified SPBN-E2CD4G virions and incubated with sera from three HCV-positive patients (HCV1-3), pooled sera from HCV and RV-negative donors (HCV- RV-). Sera from a RV- vaccinated donor (HCV-/RV+) and HTV-1-positive patient (HTV+/RV-) served as controls. The error bars indicate the standard deviations. Figure 17. ELISA reactivity of mouse sera against HCV E2. Four groups of five mice each were immunized with live recombinant RV (SPBN, SPBN-E2CD4G) as indicated, and 5 weeks after the initial immunization the mice were boosted twice with killed SPBN-E2CD4 or SPBN virions as indicated in the Figure (Boost). Ten days after the second boost, sera were collected and analyzed by ELISA. Each bar represent the reactivity of a single mouse serum at a 1: 100 serum dilution.
Figure 18. Immunization of mice with SPBN-ElE2p7 induces HCV E2- specific CTLs. 6-8 week old female BALB/c mice were immunized intraperitonially (i.p.) with lxlO7 FFU of SPBN-ElE2p7. Spleens were harvested 11 weeks after immunization, cultured and stimulated with the E2 peptide 1323 and TL-2. A standard chromium release assay was performed one week after harvesting, against P815 cells pulsed (+ peptide) or not (- peptide) with peptide 1323.
DETAILED DESCRIPTION OF THE INVENTION
Rhabdoviruses such as Rabies virus and Vesicular Stomatitis virus are members of the family Rhabdoviridae. Rabies virus possesses a negative stranded
RNA genome of approximately 12kb. The genome is modularly organized and similar to that of vesicular stomatitis virus (VSV). These Rhabdoviruses encode five structural proteins. The five open reading frames coding for the viral structural proteins are nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein
(G), and polymerase (L). After infection, the viral polymerase-complex (P and L) begins transcription at the 3' end of the encapsidated genome to generate a short leader RNA followed by sequential synthesis dϊ fi e ral'''RT^ΑJs '"'The1''ήuclebpfόtein (N), the phosphoprotein (P), the viral polymerase (L), and the genomic RNA form a helical ribonucleoprotein complex (RNP). The RNP is surrounded by a host cell- derived envelope membrane which contains the matric protein (M) on the inner side of the membrane, and the transmembrane glycoprotein (G) which mediates binding of the virus to specific receptors on the cell membrane.
The generation of non-segmented negative-strand RNA viruses entirely from cDNA has been reported by the inventors. (Schnell et. al., EMBO, 13:4195-4203, 1994). The approach involved intracellular expression of anti-genomic RNA in cells also expressing the viral proteins required for formation of an active RNP complex, namely, the nucleoprotein (N), the phosphoprotein (P), and the viral polymerase (L). This method avoids problems of antisense that are encountered when expressing the non-encapsidated negative-strand genomic RNAs, and positive strand mRNAs, and the same method was later also successful in the recovery of another Rhabdovirus, VSV. (Lawson et al., PNAS, USA, 92:4477-81, 1995).
In the present invention a number of recombinant Rhabdovirus vectors are generated and are used to express functional genes, including, but not limited to, full- length HTV-1 envelope proteins and HCV envelope proteins. From the recombinant Rhabdovirus vectors of the invention all the dominant epitopes for neutralizing antibodies, cytotoxic T-lymphocytes (CTL), and antibody-dependent cell cytotoxicity are expressed at one time. The construction of different recombinant Rhabdovirus vectors expressing HTV, HCV, SIV or other viral genes is described in the following paragraphs.
Recombinant Rhabdovirus expression vectors
Several different recombinant Rhabdovirus-based and replication-competent expression vectors that express heterologous genes or gene sequences are constructed. In one aspect of the invention an expression vector with its own glycoprotein is constructed. The genome of this recombinant expression vector can be represented as: 3'-N-P-M-G-X-L-5' where X=foreign gene (e.g. HTV-1 gpl60, HTV-1 gag, or any other HTV-1 gene; any STV , HTV-2, Hepatitis C gene, or any other viral antigen) (see Fig. 1). X can be cloned at different genome sites to regulate expression levels. In another aspect of the invention an 'expression "vector "with "a glycoprotein from another virus or another viral serotype is constructed (see Fig. 7 as an example for the RV vector with VSV glycoprotein). This vector is used as boost virus to induce a stronger immune response. The genome of this recombinant expression vector is represented as: 3 -N-P-M-G (from another virus or viral serotype)-X-L-5' (for example, 3 -N-P-M-G from VSV serotype Tndiana)-X-L-5') where X=foreign gene specific (e.g. HTV-1 gpl60, HTV-1 gag, or any other HTV-1 gene; any STV or HTV-2 gene, HCV, HCV E2, or any other viral antigen). X can be cloned at different genome sites to regulate expression levels. The present invention relates to constructs of recombinant RVs (rabies viruses) expressing HTV-1 gpl60, where the RV glycoprotein (G) is replaced with that of a chimeric vesicular stomatitis virus (VSV) G /RV-cytoplasmic domain (serotype Indiana or New Jersey). Of note, this method is not restricted to VSV glycoprotein. Because Rhabdoviruses have only a single surface protein on their virions, chimeric RV/VSV viruses are not neutralized by the humoral response against the RV G and therefore allow a second productive infection. The use of a recombinant chimeric RV/VSV can be used to display the properly folded HTV-1 envelope protein on the surface of the infected cell.
The present invention further relates to constructs of recombinant RVs containing the gene encoding the ectodomain of HCV E2, with the 85 carboxy- terminal amino acids deleted, fused to the transmemebrane domain (TMD) and cytoplasmic domain (CD) of human CD4, or the TMD of CD4 and the CD of RV G.
It should be noted that repeated expression of the RV nucleoprotein, which was previously shown to be an exogenous superantigen (Lafon, et al., Nature, 358, 507-10, 1992; Lafon, M. Research in Immunology, 144:209-13, 1993), might help to enhance the immune response against the HTV-1 envelope, as well as the HCV E2 envelope. In case of Rabies Virus (RV) the cytoplasmic domain of the RV glycoprotein is fused to the foreign glycoproteins.
It should be noted that all genes within the recombinant genome can be rearranged to attenuate the virus or to enhance transcription of the foreign gene. For example, a recombinant RV with rearranged genome, VSV glycoprotein, and HTV-1 gpl60 (X) can be constructed to have: 3'-X-N-P-G(VSV serotype NJ)-M-L-5'.
In still another aspect of the invention a recombinant expression vector (either
RVs or VSVs) having a foreign glycoprotein instead of their own is constructed tor entry into specific host cells, i.e'.', to'mimic h ijfopisπi of anotner virus (e.g., HTV-1, Hepatitis C) in order to induce a stronger immune response (Fig. 8). This construct can be represented as 3 -N-P-M-HTV-l-gpl60-L. Alternatively these constructs can have, in addition, their own glycoproteins (e.g., 3 -N-P-M-HTV-l- gpl60-G-L). Again, it should be noted that all genes within the recombinant genome can be rearranged to attenuate the virus or to enhance transcription of the foreign gene. Transgenic mice expressing human CD4 and CXCR4 are generated to analyze the in vivo induction of an immune response of the G-related RVs expressing HTV-1 gpl60/RVG and HCV E2. In still another aspect of the invention a recombinant expression vector (either
RV or VSV) having multiple genes and multiple transcription stop/start signals is constructed. This construct is represented as 3 -N-P-M-G-X-Y-L-5' where X and Y are heterologous genes. For example, X can be HTV-1 gpl60 and Y can be HTV-1 gag or X can be HCV El and Y can be HCV E2. An alternative construct can be 3 -N-Z- P-M-G-X-Y-L-5' where, for example, X can be HTV-1 gρl60, Y can be HTV-1 gag and Z can be HTV-1 tat; or X can be HCV El, Y can be HCV E2, and Z can be HCV p7.
A Rhabdovirus vaccine In a preferred embodiment, an immunodeficiency virus vaccine based on recombinant rabies virus vectors is described. Rabies virus (RV) is a negative- stranded RNA virus of the Rhabdovirus family and it possesses a relatively simple, modular genome organization coding for five structural proteins (supra and Conzelmann, et al., Virology, 175:485-99, 1990). The present invention relates to an RV vaccine strain-based vector, which is non-pathogenic for a wide range of animal species when administrated orally or intramuscularly. This vector shows advantages over other viral vectors, for several reasons. First, its modular genome organization makes genetic modification easier than for the majority of more complex genomes of DNA and plus-stranded RNA viruses. Second, Rhabdoviruses have a cytoplasmic replication cycle and there is no evidence for recombination and/or integration into the host cell genome. (Rose, et al., Rhabdovirus genomes and their products, Plenum Publishing Corp., New York, 1997). In contrast to most other viral vectors only a negligible seropositivity exists in the human population to RV and immunization with a RV-based vector
Figure imgf000019_0001
"rlCV, infra)" wiiT not interfere with immunity against the vector itself. In addition, RV grows to high titers g
10 foci forming units (FFU) in various cell-lines without killing the cells, which probably results in longer expression of HTV-1 genes (or HCV genes, infra) compared to a cytopathogenic vector.
Generation of recombinant vectors
The following different recombinant rabies virus vectors are constructed. A new infectious Rabies Virus (RV) vector with a deletion of the ψ-gene (a ~ 400 bases long non-coding sequence fused to the G RNA) and new transcription unit containing a short transcription Stop/Start signal (to express foreign genes) and two single sites (BsiWI and Nhel) to introduce foreign genes is constructed. This vector also contains a Smal site upstream of the RV glycoprotein, which is used to delete the RV glycoprotein gene (G). The vector is called RV-SBN. RVs expressing HTV-lgp- 160 ecto- and transmembrane domain fused to the RV G cytoplasmic domain (HTV- Igpl60-RVG) are constructed. The chimeric gpl60 RVG protein is expressed by RV and incorporated into RV virions. RVs expressing HCV glycoproteins are also generated (SPBN-ElE2p7, infra). Additionally, two similar RV recombinant viruses are also generated. SPBN-E2CD4 (infra) contains the ectodomain of HCV E2, with a 85 amino acid deletion at the carboxy-terminus, fused to the trans- and cytoplasmic domains of human CD4. Alternatively, the ectodomain of HCV E2 is fused to the transmembrane domain of human CD4 and the cytoplasmic domain of RV G (SPBN- E2CD4G, infra). A recombinant virus displaying a foreign envelope protein on its surface will induce a strong immune response against this antigen. Another RV vector is also generated which is identical to RV-SBN but has, in addition, a single Pad site downstream of RV G protein. This vector is used to functionally replace RV G with VSV G or other viral glycoproteins. This vector is called RV-SPBN and is used as a boost vaccine vector or a boost virus.
As shown in Fig. 7, a recombinant rabies virus based expression vector with foreign viral glycoproteins is constructed and the recombinant virus is recovered. For this construct a Smal restriction enzyme site is introduced downstream of the M/G transcription Stop/Start sequence and a Pad site upstream of the synthetic transcription Stop/Start sequence, which is used to express foreign genes from the RV vector. These two sites (SmalPac) can be"ιfeedrtό fepϊac tfter R VgiyCdprόtein with that from other viruses. In Fig. 7 a chimeric VSV/RV glycoprotein (VSV ectodomain and transmembrane domain, RV cytoplasmic domain), in combination with HTV-l is shown as an example. However, it should be noted that this method can be applied to every glycoprotein and foreign antigen in different Rhabdoviruses (see infra), as shown in the same figure (glycoprotein X, foreign protein Y).
In another experiment, recombinant RVs expressing chimeric gpl60/RV G without expressing RV G (G-deleted RVs) are generated. These G-deleted RVs have a different tropism as compared to wild-type RV (which infects most cells) and specifically infect only cells expressing the HTV-1 receptor human CD4 and one of the HTV-1 coreceptors (eg, CXCR4 or CCR5).
Both the full-length and RV-glycoprotein deleted recombinant rabies RVs are constructed and recovered (Fig. 8). The Smal and BsiWI restriction enzyme sites are used to delete RV glycoprotein and fuse the M G transcription Stop/Start sequence to the HJV-l/RV chimeric glycoprotein (HTV-1 gpl60 ectodomain and transmembrane domain, RV cytoplasmic domain). The recovered RV-vector is, analogous to the HTV-1 virus, specific for cells expressing human CD4 and the appropriate HTV-1 co- receptor. It should be noted that this method can be applied to every glycoprotein which supports infection of certain cell types by rhabdoviruses. It can also be used to express additional foreign antigens (HTV-1 Gag, HTV protease, STV proteins, Hepatitis A, B or C proteins (see HCV, infra), and other viral and non-viral proteins).
In still another aspect of the invention a recombinant replication-competent rabies virus expression vector having all of the above combinations can be constructed. For example, a recombinant rabies virus vector having other glycoproteins (especially to construct boost viruses) without or with their own G, having genome rearrangements, and expressing multiple viral antigens from the same or different viruses (e.g. HTV-1 gpl60, Hepatitis B, Hepatitis C (infra)).
Products, methods and compositions There are provided by the invention, products, compositions and methods for assessing treating viral diseases, particularly HTV (ATDS) and HCV (hepatitis) and administering a recombinant Rhadovirus of the invention to an organism to raise an immunological response against invading viruses, especially against immunodeficiency virus infections and hepatitis v'ϊfuS mle røn'sT
Methods for induction of an immune response
Another aspect of the invention relates to a method for inducing an immunological response in an individual, particularly a mammal, which involves inoculating the individual with a recombinant virus of the invention followed by the appropriate recombinant protein boost, adequate to produce antibody and/ or T cell immune response to protect the individual from infection, particularly immunodeficiency infection and hepatitis C infection, and most particularly HTV-1 and 2 infections, as well as HCV infections. Also provided are methods whereby such immunological response slows the HTV replication and the HCV replication.
Yet another aspect of the invention relates to a method of inducing immunological responses in an individual which comprises delivering to such individual a nucleic acid vector, sequence or ribozyme to direct the expression of HTV envelope polypeptides (or HCV envelope polypeptides, or a fragment or a variant thereof, infra), or a fragment or a variant thereof, for expressing the HTV envelope polypeptide (or HCV envelope polypeptides, or a fragment or a variant thereof, infra), or a fragment or a variant thereof, in vivo in order to induce an immunological response, such as, to produce antibody and/ or T cell immune response. Antibody and/or T cell responses include, for example, cytokine-producing T cells or cytotoxic T cells, to protect the individual, preferably a human, from the viral disease, whether that disease is already established within the individual or not. One example of administering the gene is by accelerating it into the desired cells as a coating on particles or otherwise. Such nucleic acid vector may comprise DNA, RNA, a ribozyme, a modified nucleic acid, a DNA RNA hybrid, a DNA-protein complex or an RNA-protein complex.
Compositions that induce an immunological response
A further aspect of the invention relates to an immunological composition that when introduced into an individual, preferably a human, capable of having induced within it an immunological response. The immunological response that is induced is to a polynucleotide and/or polypeptide encoded therefrom, wherein the composition comprises a recombinant Rhabdoviruses of the invention which encodes and expresses an antigen of an exogeneous viral prdtem", such as Tii'V elϊVelϋpe'p'fotem or polypeptide, HCV envelope protein or peptide, etc. Specifically, the exogeneous polypeptides include antigenic or immunologic polypeptides. The immunological response is used therapeutically or prophylactically and takes the form of antibody immunity and/or cellular immunity, such as cellular immunity arising from CTL or CD4+ T cells.
In a further aspect of the invention there are provided compositions comprising a Rhabdovirus vector of the present invention for administration to a cell or to a multicellular organism.
Pharmaceutical compositions
The Rhabdovirus vectors of the invention may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to an individual. Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a recombinant virus of the invention and a pharmaceutically acceptable carrier or excipient. Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration. The invention further relates to diagnostic and pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
The recombinant vectors of the invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
Methods of administration
The pharmaceutical compositions may be administered in any effective, convenient manner including, for instance, administration by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others. In therapy or as a prophylactic, the active agent may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic. The pharmaceutical compositions of the invention are preferably administered by injection to achieve a systematic effect against relevant viral pathogens. For administration to mammals, and particularly Humans',''!-' is™expecte<ϊ that the daily dosage level of the active composition of the invention will be from 102FFU to 108 FFU of virus in the composition or 10 μg/kg tolO mg/kg of body weight of recombinant protein. The physician in any event will determine the actual dosage and duration of treatment that will be most suitable for an individual and can vary with the age, weight and response of the particular individual. The above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention. A vaccine composition is conveniently in injectable form. Conventional adjuvants may be employed to enhance the immune response. A suitable unit dose for vaccination is preferably administered daily and with or without an interval of at least lweek. With the indicated dose range, no adverse toxicological effects are observed with the compounds of the invention that would preclude their administration to suitable individuals.
Immunoassay and Diagnostic Kits
The recombinant virions of the present invention are useful for producing an HCV antigenic polypeptide(s), for example the E2 glycoprotein, or subunits thereof, which reacts immunologically with a biological sample from a patient, such as, but not limited to, serum, containing HCV antibodies. The present invention also encompasses antibodies raised against the HCV specific epitopes in these antigenic polypeptides, which are useful in immunoassays to detect the presence of the HCV virus and/or viral antigens, in biological samples. Design of the immunoassays is subject to a great deal of variation, and many formats are known in the art. The immunoassay will utilize at least one viral epitope derived from HCV. In one embodiment, the immunoassay uses a combination of viral epitopes derived from HCV. These epitopes may be derived from the same, for example from the E2 glycoprotein, or from different viral polypeptides, for example from the E2 and El polypeptides. An immunoassay may use, for example, a monoclonal antibody directed towards a viral epitope(s), a combination of monoclonal antibodies directed towards epitopes of one viral antigen, monoclonal antibodies directed towards epitopes of different viral antigens, polyclonal antibodies directed towards the same viral antigen, or polyclonal antibodies directed towards dirrerent viral antigens.
Protocols may be based, for example, upon competition, or direct reaction, or sandwich type assays (infra). Protocols may also, for example, use solid supports, or may be by immunoprecipitation. Most assays involve the use of labeled antibody or polypeptide; the labels may be, for example, enzymatic, fluorescent, chemiluminescent, radioactive, or dye molecules. Assays that amplify the signals from the probe are also known; examples of which are assays which utilize biotin and avidin, and enzyme-labeled and mediated immunoassays, such as ELISA assays (infra).
Immunoassaying for anti-HCV antibod (s)
Typically, an immunoassay for an anti-HCV antibody(s) will involve selecting and preparing the test sample suspected of containing the antibodies, such as a biological sample, then incubating it with an antigenic (i.e., epitope-containing) HCV polypeptide(s) under conditions that allow antigen-antibody complexes to form, and then detecting the formation of such complexes. Suitable incubation conditions are well known in the art. The immunoassay may be, without limitations, in a heterogeneous or in a homogeneous format, and of a standard or competitive type.
In a heterogeneous format, the polypeptide is typically bound to a solid support to facilitate separation of the sample from the polypeptide after incubation. Examples of solid supports that can be used are nitrocellulose (e.g., in membrane or microtiter well form), polyvinyl chloride (e.g., in sheets or microtiter wells), polystyrene latex (e.g., in beads or microtiter plates, polyvinylidine fluoride, diazotized paper, nylon membranes, activated beads, and Protein A beads. The solid support containing the antigenic polypeptide is typically washed after separating it from the test sample, and prior to detection of bound antibodies. Both standard and competitive formats are known in the art.
In a homogeneous format, the test sample is incubated with antigen in solution. For example, it may be under conditions that will precipitate any antigen-antibody complexes which are formed. Both standard and competitive formats for these assays are known in the art.
In a standard format, the amount of HCV antibodies forming the antibody- antigen complex is directly monitored. This may be accomplished by determining whether labeled anti-xenogemc (e.g., anti-humaϊl) " antib'oclies "which" recognize an epitope on anti-HCV antibodies will bind due to complex formation. In a competitive format, the amount of HCV antibodies in the sample is deduced by monitoring the competitive effect on the binding of a known amount of labeled antibody (or other competing ligand) in the complex.
Complexes formed comprising anti-HCV antibody (or, in the case of competitive assays, the amount of competing antibody) are detected by any of a number of known techniques, depending on the format. For example, unlabeled HCV antibodies in the complex may be detected using a conjugate of antixenogeneic Ig complexed with a label, (e.g., an enzyme label).
Immunassay for HCV antisen(s)
In immunoassays, the test sample, typically a biological sample, is incubated with anti-HCV antibodies under conditions that allow the formation of antigen-antibody complexes. Various formats can be employed. For example, a "sandwich assay" may be employed, where antibody bound to a solid support is incubated with the test sample; washed; incubated with a second, labeled antibody to the HCV antigenic polypeptides, and the support is washed again (infra). HCV antigenic polypeptides are detected by determining if the second antibody is bound to the support. In a competitive format, which can be either heterogeneous or homogeneous, a test sample is usually incubated with antibody and a labeled, competing antigen is also incubated, either sequentially or simultaneously. These and other formats are well known in the art.
Kits suitable for immunodiagnosis and containing the appropriate labeled reagents are constructed by packaging the appropriate materials, including the polypeptides of the invention containing HCV epitopes or containing antibodies directed against HCV epitopes in suitable containers, along with the remaining reagents and materials required for performing the assay, as well as a suitable set of assay instructions.
Preparation of anti-HCV antibodies
According to the invention, HCV antigenic polypeptides, such as E2 and/or El glycoproteins, may be used as an immunogen to generate antibodies which recognize such an immunogen. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, "and an aD" expression library.
Various procedures known in the art may be used for the production of polyclonal antibodies to HCV antigenic polypeptides. For the production of antibody, various host animals can be immunized by injection with the HCV antigenic polypeptides, including but not limited to rabbits, mice, rats, tc. Various adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances uch as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and otentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.
For preparation of monoclonal antibodies directed toward HCV antigenic polypeptides any technique which rovides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497). According to the invention, human antibodies may be used and can be obtained by using human hybridomas (Cote et al, 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96).
Recombinant RV vectors expressing an HIV-1 envelope protein In a preferred emodiment recombinant RVs expressing HTV-1 envelope protein is explained. To generate RV recombinant viruses expressing HTV-1 gpl60, a new vector is constructed based on the previously described infectious RV cDNA clone pSAD-L16. (Schnell, et al., EMBO Journal, 13:4195-4203, 1994). Using site directed mutagenesis and a PCR strategy, the Ψ gene is deleted from the RV genome and a new transcription unit, containing a RV Stop/Start signal and two single sites (BsiWI and Nhel), is introduced into the RV genome (see also Generation of recombinant vectors, supra). The resulting plasmid is designated pSBN (Fig. 1). The SBN RV-vector is recovered by the reported methods and displayed the same growth characteristics and similar viral titers as SAD-L16, indicating that neither the deletion of the Ψ gene nor the new transcription unit affected the RV vector (deleted). The
HTV-1 envelope genes (NL4-3 and 89.6) to be expressed from SBN are generated by PCR and cloned between the BsiWI and Nhel sites, resulting in the plasmids pSBN-NL4-3 and pSBN-89.6 (Fig.l). All constructs are checked via DNA sequencing. It should be noted that foreign genes up to at least 4kb are stable within the RV genome and a full length HTV-1 envelope protein is expressed from the recombinant RVs.
Recombinant RVs expressing either HTV-1N -3 or HTV-18 .6 envelope proteins are recovered by transfection of cells stably expressing the T7-RNA-polymerase with plasmids encoding the RV N, P, and L proteins along with a plasmid coding for the respective RV full-length anti-genomic RNA. Three days after transfection, supematants of transfected cells are transferred to fresh cells and three days later analyzed by indirect immunofluorescence microscopy for expression of HTV-1 gpl60. A positive signal for g l60 in cells infected with recombinant SBN-NL4-3 and SBN- 89.6 confirmed the successful recovery of recombinant RVs expressing HTV-1 envelope protein. The recombinant RVs expressing HTV-1 gag are also constructed and recovered with the same procedure used for the recombinant RVs expressing HTV-1 envelope protein.
Growth characteristics of recombinant RVs
Growth characteristics of recombinant RVs expressing HTV-1 envelope protein are examined. A three-fold lower titer for SBN-NL4-3 and a 10-fold titer reduction for SBN-89.6 is noticed, as compared to wild-type SBN. To examine the differences in virus replication in detail, a one-step growth curve of the recombinant RVs is performed. BSR cells are infected with a MOI of ten to allow synchronous infection of all cells. After replacing the virus inoculum with fresh medium, viral titers are determined at the indicated time-points (Fig. 2). Both recombinant RVs expressing HTV-1 gpl60 replicated at only a slightly reduced rate compared to wild- type RV, with the final titers being 2.3- (SBN-NL4-3) or 8-fold (SBN-89.6) reduced. The 20% longer genome size of the recombinant RVs cannot explain the slower growth of these viruses. A recombinant RV expressing a 1.9 kb gene (firefly luciferase) grew to wild-type RV titers. (Mebatsion, et al., Proceedings of the National Academy of Sciences of the United States of America, 93:7310-4, 1996). Expression of foreign glycoprotein by recombinant KVs
Expression of HTV-1 gpl60 by recombinant RVs is also examined. To ensure the expression of HTV-1 gpl60 by the recombinant viruses, cell lysates from recombinant RV infected cells are analyzed by Western immunoblotting with an antibody directed against RV (Fig. 3, -rabies) or HTV-1 gρl20 (Fig. 3, -gρl20). Two bands of the expected size for HTV-1 gpl60 and gpl20 are detected in lysates from cells infected with SBN-89.6 or SBN-NL4-3 (Fig. 3, lanes 3 and 4), but are not observed in cell lysates of mock-infected or SBN infected cells (Fig. 3, lanes 1 and 2). The Western blot probed with an αRV antibody confirmed that all viruses (Fig. 3, lanes 2, 3, and 4) infected the target cells.
Envelope proteins expressed in recombinant RVs are functional To determine whether the expressed HTV-1 envelope protein is functionally expressed from RV, the recombinant RVs are analyzed in a fusion assay in a human T cell-line (Sup-Tl). This experiment confirmed that wild-type RV is able to infect and replicate in human T cell-lines. Because wild-type RV infects cells by receptor- mediated endocytosis, the RV glycoprotein (G) can only cause fusion of infected cells at a low pH. (Whitt, et al., Virology, 185:681-8, 1991). In contrast to wild-type RV, large syncytium-formation is detected in Sup-Tl cells 24 hours after infection with SBN-89.6 or SBN-NL4-3 (Fig. 4). These results indicate that the expressed HTV-1 envelope proteins are properly folded, transported to the cell surface, and are recognized by the HTV-1 receptor and coreceptor, CD4 and CXCR4.
Envelope protein from the dual-tropic HTV-1 strain (89.6) will induce cell fusion if coexpressed with CD4 and CCR5, whereas NL4-3 gpl60 will only induce fusion on cells expressing CD4 and the HTV-1 coreceptor CXCR4. Infection of 3T3 murine cells expressing human CD4 does not result in cell fusion regardless of the recombinant RV used, whereas syncytium-formation is detected in 3T3 cells expressing CD4 and CXCR4 after infection with SBN-NL4-3 or SBN-89.6. As expected, only expression of HTV-189.6 envelope protein in 3T3 cells, expressing CD4 and CCR5, caused fusion of these cells.
Induction of a humoral immune response in mice
Anti-gpl20 antibody response in mice infected with RV expressing HTV-1 gpl60 is also analyzed. One likely requirement lor a successtul fiiv-l vaccine is the ability to induce a strong humoral response against the HTV-1 protein gpl60. To determine whether the recombinant gpl60 proteins expressed by recombinant RV are able to induce an anti-HTV-1 immune response, groups of five BALB/c mice are inoculated subcutaneously in both rear footpads with 106 FFU of SBN, SBN-89.6, or 105 FFU SBN-NL4-3. Mice are bled 11, 24, and 90 days after the initial infection with RV and the sera are analyzed by ELISA.
No response to the HTV-1 envelope is detected in the sera of immunized animals, but an ELISA using RV glycoprotein, instead of HTV-1 gpl20, as an antigen confirmed the RV infection and detected high level of antibodies against RV as early as 11 days after infection. Several studies on viral vectors expressing HTV-1 gpl60 indicated that a booster infection or a boost with a recombinant protein is necessary to induce detectable serum antibody response against HTV-1 envelope protein. The high antibody titer detected in the RV ELISA indicated that an additional infection with the recombinant RV would not be promising, therefore 3 out of 5 mice from every group were boosted with lOμg of recombinant gpl20 and gp41 in complete Freund adjuvant. Twelve days after the subunit boost, the mice are bled and the immune response is analyzed by an HTV-1 gpl20 ELISA. The results demonstrate that an HTV-envelope subunit boost elicits a strong immune response against HTV-1 gpl20 only in mice previously infected with SBN-89.6 or SBN-NL4-3 (Fig. 5). Wild-type RV (SBN) infected mice reacted only in the lowest serum dilution (1:160) after the boost. An ELISA specific for HTV-1 gp41 is negative for all mouse sera, even after the boost with recombinant HTV-1 gpl20/gp41. These data are confirmed by Western blot analysis (Fig. 6). Only sera from mice infected with SBN-89.6 or SBN-NL4-3 and subsequently boosted with recombinant protein are able to react with gpl20, whereas all other sera failed to detect any HTV-1 protein. None of the sera had gp41-specific bands, even with a gp41 subunit immunization.
Induction of neutralizing antibodies An experiment is also carried out to see whether primary virus infection followed by recombinant protein boost induces neutralizing antibodies against HTV-1.
In this experiment, HTV-1 neutralizing antibody (NA) titers are determined in MT-2 cells by a vital dye staining assay using HTV-IN -3- The mouse serum is able to neutralize a tissue culture laboratory adapted (TCLA)''H -fNi -3''stra,ft""a't'i'a 'T:800 serum dilution after immunization with SBN-NL4-3 and an envelope subunit booster injection of recombinant gpl20 (TUB strain), whereas immunization with SBN-NL4-3 did not induce detectable neutralizing antibody. These results are confirmed in two independent experiments. The sera from wild-type RV (SBN) infected mice which received a recombinant g l20 boost displayed only a very low NA titer of 1:50 (Table 1). These results indicate that a boost injection with recombinant gpl20 following the priming with recombinant RV expressing HTV-1 gpl60 elicits high titers of NA.
Table 1. Neutralizing antibody totres of sera from mice infected with different RVs followed by boost injection of recombinant HTV-1 gpl20/gp41.
Figure imgf000030_0001
The results presented herein demonstrate that a recombinant RV expressing a full-length HTV-1 envelope protein is generated. The foreign gene is stably expressed by replication competent RV and induces a strong humoral response in mice against HTV-1 envelope protein after infection with recombinant RV and a single subsequent boost of HTV-1 gpl20 protein. Infection of mice with recombinant RV expressing HTV-1 gpl60 results in a strong priming of the immune system, as indicated by vigorous humoral responses after a single boost with HTV-1 gρl20 protein or gp41. Thus, boosting with another recombinant RV using a different viral glycoprotein for infection of the mice, or recombinant VSV expressing HTV-1 gpl60 can be tested for an even stronger response. Induction of long-lasting HIV-1 gpl60-specific CTL.
Recombinant RV expressing HIV-1 envelope protein from a laboratory- adapted HIV-1 strain (NL4-3) and a primary HTV-1 isolate (89.6) show that RV-based vectors are excellent for B cell priming (supra). (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.). The present invention further relates to the memory CTL response against HIV-1 envelope protein expressed by the attenuated RV-based vectors. As noted, increasing evidence suggests that the induction of a vigorous, long-lasting CTL response is an important feature for a successful HIV-1 vaccine.
To analyze the potency of RV-based vectors to induce a cytotoxic response against HIV-1, six mice were immunized with 2 x 107 foci forming units (FFU) of the recombinant RV expressing HIV- 1NL4_3 envelope protein (SBN-NL4-3) (supra and infra). Three mice are sacrificed 105 or 135 days after infection and the spleens are removed. One third of the splenocyte cultures are infected with a multiplicity of infection (moi) of 1 with a recombinant vaccinia virus expressing HlV-l^^gplόO for 16 hours, deactivated using Psoralen and N treatment, and added back to the culture as presenter cells. Stimulated effector cells are analyzed 7 days after activation for their ability to kill P815 target cells infected with vaccinia wild-type virus, a recombinant vaccinia virus expressing HIV-1 ^^ gpl60 or HIV-1 Gag. As can be observed in Figure 9, a strong cytotoxic response is detected only against P815 target cells infected with the recombinant vaccinia virus expressing HIV-1 envelope protein. Only a low percentage of lysis is observed for P815 cells infected with the other two vaccinia viruses. Of note, these responses are achieved after a single inoculation with recombinant RV expressing HIV-1 envelope protein, which indicates that RV-based vectors are able to induce long-lasting CTLs after a single vaccination.
CTLs from HTV-1 gplόO immunized mice cross-kill target cells expressing a heterologous HIV-1 envelope protein
There is a significant difference in HTV-1 envelope amino acid sequences but cross-protection between divergent viruses will be a likely requirement for a protective HTV-1 vaccine. To analyze the potency of the vaccine candidate to induce cross-reactive CTLs against gplόϋ rrorri dlilefent v-T Strains;" spleriόcytes from mice immunized with a recombinant RV expressing HTV-1 gpl60 are screened against P815 target cells expressing homologous and heterologous HTV-l envelope proteins. For this approach, two groups of six mice are immunized intraperitoneally (i.p) either with 2 x 107 recombinant RV expressing HTV-1 gpl60 from a laboratory- adapted, CXCR4-tropic (NL4-3) or a dual-tropic (CXCR4 and CCR5) isolate (89.6).
Three and five weeks after the immunization, three mice from each group are sacrificed, the spleens are removed, and the pooled splenocytes are stimulated with a recombinant vaccinia virus expressing the homologous HTV-1 envelope protein (NL4- 3 or 89.6). Seven days after the stimulation, effector cells are analyzed for their ability to lyse P815 cells infected with recombinant vaccinia viruses expressing HTV-1 envelope protein from the laboratory-adapted, CXCR4-tropic HTV-1 strain (NL4-3), the dual-tropic strain (89.6), and two primary, CCR5-tropic HTV-1 strains (Ba-L and JR-FL). The results from two different, independent experiments are shown in Figure 10A for mice immunized with a RV expressing HTV-1 NL^ Env and in Figure 10B for mice immunized with RV expressing HTV-189.6 Env. As expected, a strong, specific lysis of P815 cells expressing the homologous antigen is observed for both groups. More striking, these effector cells are able to cross-kill P815 target cells expressing heterologous HTV-1 envelope proteins. Activated splenocytes from SBN- NL4-3 immunized mice achieved a specific lysis of P815 cells expressing gpl60 JR- FL or 89.6 in the 40% range at an effectoπtarget (E:T) ratio of 50:1 and are also able to cross-kill target cells expressing HTV-lBa-L gpl60. Cross-killing is also observed with effector cells from SBN-89.6 primed mice. P815 target cells are lysed in the same range as observed for activated splenocytes from mice immunized with SBN- NL4-3, but lysed only about 20% P815 cells expressing HTV-1 NLA-3- These data indicate that CTLs against HTV-1 gpl60 induced by RV-based vectors may be directed against different epitopes within the HTV-1 envelope protein.
HTV-l-svecific CTL activity is mediated by CD8+ T-cells The phenotype of the T-cell subpopulation mediating cytolytic activity is assessed by selective depletion. Three mice are immunized with 2 x 107 FFU of recombinant RV expressing HTV-1N 4-3 envelope protein, eighteen weeks later the spleens are removed. Splenocytes are re-stimulated with a recombinant vaccinia virus expressing the homologous HTV- ^envelope protein for 7 days. Tmmuno- magnetic bead cell separation is completed to both deplete and positively isolate CD8T T-cells from the activated splenocyte culture. Chromium release assays are completed using cultures depleted of CD8+ T-cells (CD8"), cultures of isolated CD8 cells (CD8+) or unprocessed cultures (CD8+/CD8"). P815 target cells are infected with vaccinia virus expressing HTV-INM-3 gpl60 or HTV-1 gag. As illustrated in Figure 11, the CD8+ T-cell depleted cultures show no activity while the CD8+ T-cell enriched and unprocessed cultures show high specific lysis at E:T ratios of 25:1 and 12.5:1, respectively. Indeed, the CD8+ T-cell enriched population is also enriched in lytic units, as the CTL activity is still on a plateau at 12.5:1, in contrast to the unselected population. These data indicate that the cytolytic activity is mediated by the CD8+ T-cell sub-population. Furthermore, these results imply that in addition to antibodies, recombinant RV vectors also generate long-lived anti-HTV-1 CD8+ T-cell responses.
Construction of recombinant RVs expressing HCV structural proteins.
El and E2 are present on the surface of HCV virions (Dubuisson, 2000). Furthermore, HCV E2 has been reported to interact with CD81, a potential receptor for HCV (Pileri et al., 1998). The present invention provides a Rhabdovirus-based vector that expresses El and/or E2 for use as an HCV vaccine wherein HCV glycoprotein(s) are presented to the immune system for the generation of both a cellular and an immune response.
To generate RV recombinant viruses a RV vaccine strain-based vector is used with a new RV transcription unit, containing a RV Stop/Start signal and two single sites (Figure 12 and supra). The gene encoding the HCV El, E2, and p7 proteins, to be expressed from SPBN, were generated by PCR and cloned between the BsiWI and Nhel sites, resulting in plasmid pSPBN-ElE2p7.
To analyze if the expression of the HCV E2 on the surface of the infected cell enhances HCV immunogenicity, two similar RV recombinant viruses are generated. One contains the gene encoding the ectodomain of HCV E2, with an 85 amino acid deletion at the carboxy-terminal end, fused to the transmembrane domain (TMD) and cytoplasmic domain (CD) of human CD4 (CD4). The second recombinant virus contains the gene encoding the ectodomain of HCV E2, with an 85 amino acid deletion at the carboxy-terminal end, fused to the TMD of CD4 and the CD of RV G. These constructs were PCR amplified and "the" resϋffiri'|" irbdtιctg"ei fιed"' to the BsiWI/Nhel sites of pSPBN, resulting in pSPBN-E2CD4 and pSPBN-E2CD4G, respectively (Figure 12). The pSPBN-E2CD4G was constructed on the basis of a previous finding that the RV CD is required for incorporation of a foreign glycoprotein into RV virions (Mebatsion and Conzelmann, 1996c; Mebatsion et al., 1997).
As shown previously, RV vectors stably express large foreign genes (McGettigan et al., 2001a; Mebatsion et al., 1996; Schnell et al., 2000). The infectious RVs were detected in tissue culture supematants of cells transfected by standard RV recovery protocols for pSPBN, pSPBN-ElE2p7, pSPBN-E2CD4, and pSPBN-E2CD4G (Finke and Conzelmann, 1999). In contrast to the previously constructed recombinant RVs expressing HTV-1 gpl60 (Schnell et al., 2000; supra), the recombinant RVs expressing HCV proteins grew to the same (or greater) titers as SPBN, which were at least 108FFU.
Expression of HCV glycoproteins by recombinant RVs.
The HCV envelope proteins El and E2 interact to form a non-covalent heterodimeric complex, which is retained in the endoplasmic reticulum (ER). The chimeric HCV E2 protein containing the transmembrane domain (TMD) and cytoplasmic domain (CD) of CD4 is transported to the cell surface (Dubuisson, 2000). To ensure that the replacement of the CD of E2CD4 with that of RV G did not interfere with the surface expression of the recombinant protein, BSR cells were infected with SPBN-ElE2p7 (Figure 13, Panels A, A', A"), SPBN-E2CD4G (Figure 13, Panels B, B', B") or SPBN (Figure 13, Panels C, C C") at a multiplicity of infection (MOI) of 0.1. Cells were fixed 48 hours later with paraformaldehyde. Infected cells were analyzed directly by immunofluorescence microscopy with a monoclonal antibody directed against HCV E2 (Figure 13 panels A', B', C). Alternatively, cells were permeabilized with Triton X-100 for internal staining with an antibody against HCV E2 (Figure 13 panels A, B, C) or RV N protein (Figure 13 panels A", B", C"). The results indicate that the chimeric E2 protein containing the CD4 TMD and the RV G CD is transported to the surface of the infected cell. Furthermore, immunostaining with a conformation-sensitive monoclonal antibody revealed that the recombinant HCV E2 protein is properly folded. To analyze the expression and processing "of HCV"ΕT" "and" Ε2!"" y" the recombinant viruses, lysates from cells infected with recombinant RVs were separated by SDS-PAGE under reducing conditions, followed by Western immunoblotting using HCV E2 specific monoclonal antibodies (H-52). Cell lysates infected with SPBN-ElE2p7 had two bands of the expected size for the uncleaved precursor of the E1E2 polyprotein and for the cleaved E2 (Figure 14, lane 2). A band similar in size to the E2 expressed by SPBN-ElE2p7 was also detected in lysates from SPBN- E2CD4 and SPBN-E2CD4G infected cells. In addition, a more diffuse, slow- migrating band, which was not observed for wild-type E2, was detected for both chimeric E2 proteins (E2CD4, containing the CD4 TMD and CD; and E2CD4G, containing the CD4 TMD and the RV G CD).
Previous experiments by Dubuisson and coworkers suggested that the slower- migrating band of E2 corresponded to E2 molecules no longer retained in the endoplasmic reticulum (ER), but were processed by Golgi enzymes resulting in removal of their glycans (Cocquerel et al, 2000). It is interesting to note that only the slower migrating form of E2 is incorporated into RV virions (Figure 15, lanes 5 and 6), thereby supporting the theory that these molecules reach the cell surface. In contrast, the faster migrating band is retained in the ER.
Immunoblotting with the monoclonal antibody A4, directed against HCV El (Dubuisson et al., 1994), detected a band of about 27 kD, as expected for HCV El, only in cell lysates infected with the recombinant RV SPBN-ElE2p7 (Figure 14, lanes 6 and 10). This result confirmed the cleavage of the ElE2p7 precursor protein even in a non-human cell-line (BSR). Infection with all four recombinant RVs was confirmed with a human polyclonal serum directed against RV G protein.
Recombinant HCV E2 is incorporated into RV virions. A recombinant virion containing HCV E2 is provided by the present invention and is useful for producing E2 antigen for diagnostic use, as well as for a killed vaccine against HCV. To analyze incorporation of the chimeric E2 proteins into RV particles, BSR cells were infected with SPBN, SPBN-E2CD4 and SPBN-E2CD4G with a MOI of 0.1. Three days after infection, virus was purified from the supematants of infected cells by a 20% to 70% density sucrose gradient. Viral proteins were separated by SDS-PAGE and detected by Coomassie blue staining. The results in (Figure 15, lanes 1-3) showed equal amounts and" trie" "same pattern of the RV proteins for all three recombinant viruses, but no additional protein of the expected size for the HCV E2 could be detected in the viral particles. The lack of detection of E2 may be due to E2 incorporation at low levels or that E2 is migrating through the gel as a more diffuse band then the other RV proteins due to the presence of multiple O- and N-linked glycans.
The recombinant virions were then analyzed by Western blotting using an antibody directed against E2. The recombinant E2 was readily detected in both SPBN- E2CD4 and SPBN-E2CD4G particles (Figure 15, lanes 5 and 6), whereas no signal was detected for SPBN (Figure 15, lane 4) or SPBN-ElE2p7. It was surprising that both E2CD4 and E2CD4G were incorporated into RV particles since an earlier finding by Mebatsion et al. indicated that the RV G CD is a requirement for incorporation of a foreign glycoprotein into RV virions (Mebatsion et al., 1996). This is not the case for HCV E2, as quantification of E2 indicated that the content of the recombinant E2CD4 was at least 60% of E2CD4G.
The presence of the RV G CD in the HCV envelope protein expressed by SPBN-E2CD4G was also verified by Western blotting using an antibody specific for the RV G CD. Previous studies with this antibody showed that recombinant E2CD4G co-migrates with RV G, which made it impossible to distinguish between the two proteins. RV G contains only three to four N-linked glycosylation sites, whereas HCV E2 is a heavily O- and N-glycosylated. Therefore, the RV virions were digested with N-glycosidase F to remove the N-glycan chains. As illustrated in Figure 15, lane 7-9, the anti-RV G antibody detected a band of similar size and intensity of deglycosylated RV G, whereas two prominent additional bands were detected in virions containing E2 envelope protein with the RV G.
Reactivity of recombinant RV virions with human sera.
Recombinant HCV E2 is primarily produced by transfection of cells with plasmids encoding a naive E2 or a truncated form of HCV E2, which is secreted in the tissue culture supernatant. In both cases, only small amounts of protein are produced.
On the other hand, recombinant RVs are easy to grow and purify and 1 mg RV G protein can be extracted from 1 liter of tissue supematants of RV infected cells. In addition, RV virions are readily deactivated prior to purification and, therefore, handling infectious material is lirmted"to 'tne'gfow'ffi''όf"tH'e viruses".'
To analyze the antigenicity of the recombinant RV particles containing HCV E2, ELISA plates were coated with recombinant HCV E2 glycoprotein derived from purified SPBN-E2CD4G virions. The results (Figure 16) indicate that the sera from three randomly chosen HCV-positive patients had high E2-specific ELISA titers, between 1:400 to 1:1,600 (Figure 16, HCV1-3), whereas pooled human control sera from HCV- and RV-negative donors, and a serum from a HTV-1 -positive patient, did not react (Figure 16). A control serum from a RV-vaccinated person showed a similar ELISA titer to that of the HCV-positive patients due to the presence of the RV G in the recombinant SPBN-E2CD4G virion used to coat the plates. (Figure 16, HCV-/RV+). Only the sera from the RV vaccinated donor reacted with the control ELISA plates, coated with SPBN derived glycoprotein. As expected, the sera from the HCV patients did not react with the SPBN coated plates. Thus, the present invention provides recombinant RVs as a quick and easy tool to screen for seroconversion against E2 in HCV-infected individuals.
Recombinant RVs expressing HCV glycoproteins are immunogenic in mice. Induction of a humoral immune response
The immune responses which may protect humans from HCV infection are not well-defined, but it is likely that both cellular and humoral responses will be required for protection of infection or clearence of HCV. To analyze the immunogenicity of the RV vector expressing HCV proteins, a group of ten female BALB/c mice were infected with lxlO7 FFU of SPBN-E2CD4G, a group of five mice with an equal amount of the RV vector SPBN, and left five mice uninfected.
Fourteen days post immunization, all mice were bled and sera analyzed by ELISA using recombinant HCV E2. No E2-specific antibodies were detected. Previous experiments with recombinant RVs expressing HTV-1 gρl60 indicated that the induction of a humoral response against HTV-1 gpl60 required a boost with recombinant HTV-1 gpl20 (Schnell et al., 2000; supra). Therefore, the mice were given a boost vaccination using killed RV particles derived from SPBN-E2CD4G infected cells were used as a source of recombinant HCV E2. A group of five mice primed with live SPBN-E2CD4G and boos'ted 'wi'th kille SPBN particles' served as a control.
Ten days later, mice were bled and sera analyzed by an HCV-specific ELISA. E2-specific antibodies were expected in the sera of mice primed with live SPBN- E2CD4G and boosted with killed SPBN-E2CD4G, but only two out of five mice had E2-specific antibodies. Of note, no adjuvant was used for the immunization with the killed virions, which may explain why only a portion of the mice developed antibodies directed against HCV E2.
To analyze if a second inoculation with the same killed RV virions would induce a higher rate of serocoversion against HCV E2, mice from each group received a second immunization with the same killed virions that were used for the first immunization. Ten days later, the mice were bled and E2-specific ELISAs performed. The results (Figure 17) show that all mice boosted with the killed virions containing the HCV E2 seroconverted, whereas sera from SPBN-E2CD4G primed mice that were boosted twice with killed SPBN virions were negative. These results indicate that two inoculations with inactivated RV virions containing chimeric HCV E2 are able to induce a potent humoral response directed against HCV E2. Of note, priming with the recombinant RV SPBN-E2CD4G did not result in a stronger B cell response against HCV E2, as seen in unprimed or SPBN primed mice.
Induction of a cellular immune response
In contrast to HTV-1 gpl60 (supra), limited information is available for specific CTL epitopes of HCV glycoproteins in mice. To analyze if a single inoculation with the RV-based vaccine vehicle expressing the HCV glycoproteins El and E2 is able to induce a cellular response against HCV E2, ten female BALB/c mice
•η were vaccinated with 10 FFU of SPBN-ElE2p7 and spleens were harvested 11 weeks later. Splenocytes were cultured and stimulated for 7 days with an E2-specific peptide (1323), and T-Stim was added as a source of TL-2.
On the day of the assay, target cells were pulsed both with and without an E2 peptide (1323) and labeled with Cr51. Effectors and targets were incubated together at several ratios for four hours. Specific lysis was detected in a broad range of a effectoπtarget ratios of 100:1 to 12.5:1 (Figure 18), indicating that a single inoculation with the recombinant RV expressing HCV-E2 of the present invention induces a long-lasting, antigen-specific cellular imniuhe're'sporise'!'
Discussion(HIV)
The present invention relates to RV-based vectors expressing HTV-1 envelope proteins. These vectors are able to induce a humoral response against HTV-1 gpl60 after a single immunization followed by a boost injection with recombinant HTV-1 gpl20. (Schnell, M. J., et al., Proc. Natl. Acad. Sci. USA, 97:3544-3549, 2000.). Expanding evidence suggests that CTL responses play a major role in the anti- viral immune response against HTV-1. (Brander, C. and B. D. Walker, Current Opinion in Immunology, 11:451-9, 1999.). The development of an effective prophylactic HTV-1 vaccine therefore requires the selection of HTV-1 antigen(s) capable of inducing long- lasting and broadly reactive CTL responses. The present invention further relates to RV-based vectors to induce such responses.
In contrast to the observed humoral response, a single inoculation of mice with a recombinant RV expressing HTV-1 envelope protein results in a vigorous CTL response against HTV-1 Env. In addition, these responses are stable for at least 135 days after immunization. One explanation for these strong responses is that RV grows in various cell-lines without killing the cells, which results in longer expression of HTV-1 genes compared to a cytopathogenic viral vector. In addition, the expression of the RV nucleoprotein, which was previously shown to be an exogenous superantigen (Lafon, M., Research in Immunology, 144:209-13, 1993; Lafon, M., et al., Nature, 358:507-10, 1992), might help to enhance a general immune response against the HTV-1 envelope after a single immunization.
The recombinant RVs of the present invention are able to induce cross-reactive CTLs against a variety of different HTV-1 envelope proteins. Previous studies showed that single amino acid exchanges can abrogate CTL cross-reactivity, whereas other examinations indicated that single or even double amino acid substitutions frequently did not abrogate cross-killing. (Cao, H., et al., J. Virol, 71:8615-23, 1997; Johnson, R. P., et al., Journal of Experimental Medicine, 175:961-71, 1992; Johnson, R. P., et al., Journal of Immunology, 147:1512-21, 1991.). Therefore, the question remains if CTLs induced by recombinant RVs are directed against different epitopes. However, several studies indicating that CTLs from HTV-1 infected individuals show cross- reactivity even with different clades of HTV-1, indicating a broad cross- reactivity, is an important requirement for an HTV-rva'ccine": ( δ'/Ηr, et"aT.7 JT Tirol, 71:8615-23, 1997; Rowland-Jones, S. L., et al., Journal of Clinical Investigation, 102:1758-65, 1998.). There is currently only one study showing cross-clade CTLs reactivities induced with a canarypox-based HTV-1 vaccine in uninfected volunteers. (Ferrari, G., et al., Proc. Natl. Acad. Sci. USA, 94:1396-401, 1997.). The inventors of the present invention are currently analyzing if CTLs against HTV-1 gpl60 induced by recombinant RV are also cross-reactive against HTV-1 envelope protein from clades other than B.
In summary, the present invention demonstrates the ability of the murine sera to neutralize HTV-1 strain. Thus the present invention shows that recombinant RVs are excellent vectors for B cell priming. The present invention also shows that a single vaccination with recombinant RV expressing HTV-1 envelope protein elicits a strong, long-lasting CTL response specific against HTV-1 proteins, such as the envelope protein of different HTV-1 strains. These results further emphasize the use of RV as an HTV-1 vaccine.
In contrast to most other viral vectors, only a negligible sero-positivity exists in the human population to RV and immunization with a RV-based vector against HTV-1 will not interfere with immunity against the vector itself. Because oral immunization against RV with a RV vaccine strain is successful and apathogenic in chimpanzees (Report of the forth WHO Consultion on oral immunization of dogs against rabies, unpublished document WHO/Rab.Res./93.42, 1993.), a RV-based vector will also be promising in inducing mucosal immunity against HTV-1. Therefore, the present invention fulfills a long felt, yet unfulfilled need, for a method of treating HTV-1 infections. Using the recombinant RVs of the present invention, all of the dominant epitopes for neutralizing antibodies, cytotoxic lymphocytes, and antibody dependent cell cytotoxicity are expressed at one time, thereby eliciting both humoral and cell-mediated immunity against HTV-1.
The present invention further relates to RV-based vectors expressing HCV envelope proteins. Currently, no method exists to propagate HCV in vitro (Frolov et al., 1999; Lohmann et al, 2001), which eliminates the possibility of utilizing attenuated or killed HCV as a vaccine strategy. The present invention provides HCV vaccines using both killed RV particles containing recombinant HCV E2 and live, replication-competent, RV vaccine straιh-ba"sed 'vectors.'"" "i'hree""K'V Vectors expressing HCV envelope proteins were constructed. One vector expresses the HCV envelope proteins El and E2. A second vector expresses a modified version of E2, with an 85 amino acid deletion at its carboxy-terminus, and the TMD and CD of human CD4. The third vector expresses the modified version of E2 with the TMD of human CD4 and the CD of the RV glycoprotein.
The protective immune response against HCV is not well-defined, the initial HCV vaccine approach was to focus on both arms of the immune response (i.e. humoral and cellular). Increasing evidence indicates that cellular immune responses play an important role for a self -limited HCV infections and recovery from HCV infection. In general, both CD4+ helper T-cells and CD8+ cytotoxic T-cells seem to be more frequent and stronger in patients who recover then patients that develop a chronic infection (Liang et al., 2000). Moreover, one study indicated that the number of TFN-γ producing cells during the first six months after the onset of disease is associated with eradication of the HCV infection (Gruener et al., 2000).
The present invention reveals that a RV vaccine vector is able to induce long- lasting CTL responses against HCV E2 but the specific killing was not as strong as previously seen for HTV-1 Gag or envelope (supra). Our data are consistent with those of other groups who used other HCV vaccine approaches in BALB/c mice and detected only a low percentage of specific CTLs against HCV E2 (Vidalin et al., 2000). More recently, Gordon et al. characterized a new MHC class I E2-specific epitope for the H-2d haplotype (Gordon et al., 2000), which may be helpful for further studies of cellular responses against HCV E2 in BALB/c mice. The present invention clearly indicates that RV-based vectors are potent vectors for the induction of E2- specific CTLs.
In contrast to the cellular response(s), the requirements for an HCV-specific humoral response for a HCV vaccine are more conflicting. Infection of host cells with enveloped viruses is typically mediated by an interaction between the viral glycoprotein(s) in the host-cell derived membrane and a cellular receptor(s) on the host cell. Previous studies indicate that the hypervariable region 1 (HVRl) of E2 binds to the cellular CD81 molecule of the host cell (Flint et al., 1999). Hence, it is probable that host-produced antibodies against E2 would neutralize the attachment and/or fusion of HCV virions to host cells during a natural infection. The present invention provides a new vaccine strategy to immunize against HCV. Killed RV particles containing HCV E2 proteins are able to induce vigorous B- cell responses (supra). The reason for these strong responses could be that a viral glycoprotein displayed on a viral particle is more immunogenic than its soluble form. It has been shown for RV that soluble G, in contrast to the virion-associated G, fails to protect from lethal RV challenge (Dietzschold et al., 1983).
In summary, the present invention provides HCV proteins that are stably expressed and induce a long-lasting cellular response as well as a strong E2-specific B-cell response in vivo.
Examples
The following examples further illustrate the present invention, but of course are not in any way limiting its scope. The examples below are carried out using standard techniques, that are well known and routine to those of skill in the art, except where otherwise described in detail. The examples are illustrative, but do not limit the invention. All animal methods of treatment or prevention described herein are preferably applied to mammals, most preferably to humans.
Example 1: Plasmid construction.
HIV constructs
Shown in Fig. 1 is a schematic representation of a method for the construction of recombinant RV genomes. At the top, the wild-type RV genome with its five open reading frames is shown (SAD L16). Using a PCR strategy and site directed mutagenesis the entire Ψ gene is removed and a new minimal RV transcription unit containing two single sites is introduced between the G and L genes (SBN). The cDNA sequence encoding HTV-189.6 or HTV-INL -3 gpl60 is inserted using the BsiWI and Nhel sites resulting in the plasmids, pSBN-89.6 or pSBN-NL4-3 (bottom). Two single sites are introduced in the previously described RV cDNA pSAD
LI 6 upstream of the G (Smal) and Ψ gene (Nhel) by site directed mutagenesis (GeneEditor™ Promega Inc.) using the primers RP11 5 - CCTCAAAAGACCCCGGGAAAGATGGTTCCTCA'G-3' '(SE'Q '"TD "N0: ""'TJ'" and RP12 5 -GACTGTAAGGACYGGCTAGCCTTTCAACGATCCAAG-3' (SEQ ID NO: 2) resulting in the plasmid pSN. pSN is the target used to introduce a new transcription Stop/Start sequence, as well as a single BsiWI site using a polymerase chain reaction (PCR) strategy. First, two fragments are amplified by PCR from pSN using Vent polymerase (New England Biolabs Inc.) and the forward primers RP1 5 - TTTTGCTAGCTTATAAAGTGCTGGGTCATCTAAGC-3' (SEQ ID NO: 3) or RP10 5'-CACTACAAGTCAGTCGAGACTTGGAATGAGATC-3' (SEQ ID NO: 4). The reverse primers were RP18 5 -TCTCGAGTGTTCTCTCTCCAACAA-3' (SEQ ID NO: 5) and RP17 5'-
AAGCΓAGCAAAACGΓACGGGAGGGGTGTTAGTTTTTTTCATGGACTTGGAT
CGTTGAAAGGACG-3' (SEQ ID NO: 6). RP17 contains a RV transcription Stop/Start sequence (underlined) and a BsiWI and Nhel site (shown in italics). PCR products are digested with Nhel, ligated, and the 3.5 kb band eluted from an agarose gel. After gel elution the band is digested with Clal/Mlul and ligated to the previously Clal/Mlul digested pSN. The plasmid is designated pSBN.
The HIV-1 gpl60 genes, encoding the envelope protein of the HIV-1 strains 89.6 and NL4-3, are amplified by PCR using Vent polymerase, the forward primer 5'-
GGGCΓGCAGCΓCGAGCGΓACGAAAATGAGAGTGAAGGAGATCAGG-3 ' (SEQ ID NO: 7) containing Pstl/XhoI/BsiWI sites (italics), and the reverse primer 5'- CCΓCΓAGATTATAGCAAAGCCCTTTCCAAG-3' (SEQ ID NO: 8) containing a Xbal (italics) site. The PCR products are digested with Pstl and Xbal and cloned to pBluescript II SK + (Stratagene). After conformation of the sequence, the HIV-1 gpl60 genes are excised with BsiWI and Xbal and ligated to pSBN, which had been digested with BsiWI and Nhel. The resulting plasmids are entitled pSBN-89.6 and pSBN-NL4-3.
HCV constructs
All polymerase chain reactions (PCR) were performed using high fidelity Vent DNA polymerase (New England Biolabs) to minimize the introduction of sequence errors. pSBN was described previously (Schnell et al., 2000) and was the target to introduce a new single restriction site (Pad, bold) downstream of the RV G gene by site-directed mutagenesis (GeneEditor) using the primer
5'- GTGAGACCAGACTGTAATTAATTAACGTCCTTTCAΆCGΆTCC- TSEQ ID.
NO: 9), as indicated by the manufacturer (Promega). The resulting plasmid was designated pSPBN. The gene encoding the structural proteins ElE2p7 of HCV was amplified by PCR from pTMl/ElE2p7 (Michalak et al., 1997), using the forward primer
RP58 5'-CTCGAGCGTACGAAAATGAATTCCGACCTCATGG-3' (SEQ. ID. NO: 10) containing a BsiWI site (bold), and the reverse primer
RP59 5'-CGTTAAGCTAGCTCATGCGTATGCCCGCTG-3' (SEQ. ID. NO: 11) containing a Nhel (bold) site. The PCR product was digested with BsiWI and Nhel and cloned into pSPBN previously digested with BsiWI and Nhel. The resulting plasmid was entitled pSPBN-ElE2p7. A recombinant RV expressing the ectodomain (ED) of HCV E2, with an 85 amino acid deletion at its carboxy -terminus, fused to the transmembrane domain (TMD) and cytoplasmic domain (CD) of human CD4, was amplified by PCR from pTMl/E2661-CD4 (Cocquerel et al., 1998) using the forward primer RP 5'-CTCGAGCGTACGAAAATGGTCCTGGTAGTGCTG-3' (SEQ. ID. NO: 12) containing a BsiWI site (bold), and the reverse primer RP 75 5'AATTGCTAGCTCAAATGGGGCTACATGTCTTC-3'(SEQ. ID. NO: 13) containing a Nhe site (bold). The PCR product was cloned into pSPBN using the unique BsiWI and Nhel sites resulting in pSPBN-E2CD4. To construct a RV encoding the HCV E2 ED with an 85 amino acid deletion at its carboxy-terminus and containing the CD4 TMD and the RV G CD (rather than the CD4 CD) was PCR amplified from pSBN (Schnell et al., 2000) using the forward primer RP29 5'-CCC GGGTTAACAGAAGAGTCAATC GATCAGAAC-3' (Hpal, bold; SEQ. ID. NO: 14) and the reverse primer RP8 5'- CCTCTAGATTACAGTCTGGTCTCACCCCC-3' (Xbal, bold; SEQ. ID. NO: 15). The ED of HCV E2, with an 85 amino acid deletion at its carboxy-terminal end, fused to the TMD of CD4 was amplified by PCR from pTMl/E2661-CD4 using the primers RP74 and RP57 5'-AACGAAGAAGATGCCTAGCCC-3' (SEQ. ID. NO: 16). The first PCR product was digested with Hpal, ligated to the second one and the ligation was PCR re-amplified with the primers RP56 and RP8. The PCR product was cloned utilizing the BsiWI and Xbal sites into pSPBN previously digested with BsiWI and Nhel. The resulting plasmid was designated pSPBN-E2CD4G. Example 2: Recovery of infectious RVfrom cDNA.
For rescue experiments of the recombinant RVs, the previously described vaccinia virus-free RV recovery system is used (see Finke, et al., Journal of Virology, 73:3818-25, 1999). In brief, BSR-T7 cells, which stably express T7 RNA polymerase (a generous gift of Drs. S. Finke and K.-K. Conzelmann) are transfected with 5 μg of full-length RV cDNA in addition to plasmids coding for the RV N-, P-, and L- proteins (2.5 μg, 1.25 μg, and 1.25 μg) respectively, using a CaJPO,^ transfection kit (Stratagene) as indicated by the vendor. Three days after transfection, tissue culture supematants are transferred onto fresh BSR cells and infectious RV is detected three days later by immunostaining against the RV-N protein (Centocor).
Example 3: One-Step Growth Curve
Shown in Fig. 2 is a graph showing One-step growth curves of recombinant RV BSR cells that are infected with the recombinant RVs (SBN, SBN-89.6, and SBN- NL4-3). The viral titers are determined in duplicate at the indicated time-points.
BSR cells (a BHK-21 clone) are plated in 60 mm dishes and 16 hours later infected (7xl06 cells) with a multiplicity of infection (MOI) of 5 with SBN, SBN- 89.6, or SBN-NL4-3 in a total volume of 2 ml. After incubation at 37°C for 1 hour, inocula are removed and cells are washed four times with phosphate-buffered saline (PBS) to remove any unabsorbed vims. Three milliliters of complete medium is added back and 100 μl of tissue culture supematants are removed at 4,16, 24 and 48 hours after infection. Vims aliquots are titered in duplicate on BSR cells.
In Fig. 3 the Western blot analysis of recombinant RVs expressing HTV-1 gpl60 is shown. Sup-Tl cells are infected with a MOI of 2 with SBN, SBN-89.6, or SBN-NL4-3 and lysed 24 h later. Proteins are separated by SDS-PAGE and analyzed by Western blotting. An antibody directed against gpl20 detected two bands at the expected size for HTV-1 gpl60 and gpl20 in cell-lysates infected with SBN-89.6 or SBN-NL4-3 ( -gpl20, lanes 3 and 4). No signal is detected either in the mock or SBN infected cells (α-gpl20, lanes 1 and 2). Successful infection of the cells by the recombinant RVs is confirmed with a polyclonal antibody directed against RV (α-rabies, lanes 2, 3, and 4).
Shown in Fig. 4. are Sup-Tl cells which are infected using a MOI of 1 with SBN, SBN-89.6, or SBN-NL4-3. Twenty-four hours after infection, syncytia- formation is detected in cell cultures infected with recombinant RV expressing HTV-1 gpl60 (panel SBN-89.6 and SBN-NL4-3), indicating expression of functional HTV-1 envelope protein. No cell fusion is detected in cultures infected with wild-type RV (panel SBN).
Example 4: Immunization.
HIV immunization
Groups of five 4-6 week old female BALB/c mice obtained from Jackson Laboratories are inoculated subcutaneously in both rear footpads with 10 foci forming units (FFU) SBN, SBN-89.6, or 105 NL4-3 in DMEM + 10% FBS. Three out of five mice in each group are boost immunized intraperitonealy three months after infection with 10 μg recombinant gp41 (TTTB, Intracel Inc.) and 10 μg recombinant gpl20 (TUB, Intracel Inc.) in 100 μl complete Freunds adjuvant. HCV immunization for humoral response
To analyze seroconversion against HCV E2, mice were immunized intraperitoneally (i.p.) with lxlO7 FFU of the respective RV. For vaccination with killed RV particles, sucrose purified RV (SPBN or SPBN-E2CD4G) was deactivated by incubation with β-Propiolactone (1:1000) overnight at 4°C followed by another incubation at 37°C for 30 minutes. Mice were vaccinated/boosted i.p. with 20 μg of killed RV particles as indicated in the text and figure legends. Ten days after the boost, sera were collected and analyzed for HCV-specific antibodies by ELISAs (infra).
HCV cytotoxicity assays for CTL response
Groups of five 6 to 8 week old female BALB/c mice (Harlan) were inoculated intraperitoneally (i.p.) with 107 foci-forming units (FFU) of SPBN-ElE2p7. To analyze the induction of specific CTL response against E2, spleens from three mice of each group were aseptically removed, combined, and single cells suspensions were prepared. Red blood cells were lysed with ACK lysing buffer (BioWhitaker), splenocytes washed twice in RPMI-1640 media containing 10% fetal bovine serum and pulsed with 5 μg/ml peptidel323 [EATYSRCGSGPWJTPRCMVD (SEQ. ID. NO: 17), amino acids 592-610 in HCV strain la] and 10% T-STTM (Collaborative Biomedical Products) was added as a source of interleukin-2 (TL-2). Cytolytic activity of cultured CTLs was measured by a 4-hour assay with 51Cr labeled P815 target cells. Target cells were prepared by incubating with 10 μg/ml peptidel323 and 100 μCi 51Cr for two hours and washed twice. Target cells were added to effector cells at various E:T ratios for four hours. The percent specific 51Cr release was calculated as 100 x (experimental release - spontaneous release)/(maximum release - spontaneous release). Maximum release was determined from supematants of cells that were lysed by the addition of 5% Triton X-100. Spontaneous release was determined from target cells incubated without added effector cells.
Example 5: Enzyme-linked Immunosorbent Assay (ELISA ). HIV assay Recombinant HTV-1 gpl20 (ΓTTB strain, Intracel) is resuspended in coating buffer (50 mM Na2CO3, pH 9.6) at a concentration of 200 ng/ml and plated in 96 well ELISA MaxiSorp plates (Nunc) at 100 μl in each well. After overnight incubation at 4°C, plates are washed three times (PBS pH 7.4, 0.1% Tween-20), blocked with blocking buffer (PBS, pH 7.4, 5% dry milk powder) for 30 minutes at room temperature, and incubated with serial dilutions of sera for 1 hour. Plates are washed three times followed by the addition of horseradish peroxidase-conjugated (HRP) goat anti-mouse-IgG (H+L) secondary antibody (1:5000, Jackson ImmunoResearch Laboratories). After a 30 minute incubation at 37°C, plates are washed three times and 200 μl OPD-substrate (o-phenylenediamine dihydrochloride, Sigma) is added to each well. The reaction is stopped by the addition of 50 μl of 3 M H2SO4 per well. Optical density is determined at 490 nm. Shown in Fig. 5 is a graph depicting ELISA reactivity of mouse sera against HTV-1 gpl20. Five mice each are immunized with recombinant RVs (SBN, SBN-89.6, or SBN-NL4-3) and 3 months after the initial infection three mice from each group are boosted with recombinant HTV-1 gpl20 and gp41 (SBN*, SBN-89.6*, or SBN-NL4-3*). Each data point on the graph indicates the average of mice from each group in three independent experiments. One mouse of the SBN-89.6 group did not react to the boost injection and is not included in the graph. The error bars indicate the standard deviations. HCV assay
96-well MaxiSorp plates (Nunc) were coated with recombinant E2 (ImmunoDiagnostic Inc.) in coating buffer (50mM Na2CO3 pH 9.6) at a concentration of 2.5 μg/ml and incubated overnight at 4°C. Plates were washed three with 0.05% PBS/Tween and blocked with 5% dry milk powder in PBS for one hour at room temperature. Mouse sera were diluted in IX PBS, added to the plates and incubated at room temperature for one hour. After washing three times with 0.05% PBS/Tween, the secondary antibody (goat α-mouse HRP conjugated, Jackson ImmunoResearch) diluted 1:5000 in IX PBS was added and the plates were incubated for 30 minutes at 37°C. OPD substrate (Sigma) was added to the plates after washing three times with 0.05% PBS/Tween. Substrate reaction was stopped by the addition of 50 μl 2M H2SO4 to each well. Plates were read at 490nm.
Example 6: Western Blotting. HIV
Human T-lymphocytic cells (Sup-Tl) cells are infected with a MOI of 2 for 24 hours and resuspended in lysis buffer 50mM Tris, pH 7.4; 150 mM NaCl, 1% NP-40, 0.1% SDS, and lx protease inhibitor cocktail (Sigma) for 5 minutes. The protein suspension is transferred to a microfuge tube and spun for 1 minute at 10,000 x g to remove cell debris. Proteins are separated by 10% SDS-PAGE and transferred to a PVDF-Plus membrane (Osmonics). After blocking for 1 hour (5% dry milk powder in PBS pH 7.4), blots are incubated with sheep α-gpl20 antibody (ARRRP) (1:1000) or human -rabies sera (1:500) in blocking buffer for 1 hour. Secondary antibodies of goat α-human or donkey α-sheep horseradish peroxidase-conjugated (HRP) antibodies (1:5000) (Jackson ImmunoResearch Laboratories) are added and blots incubated for one hour. Each antibody incubation is followed by three washes with WB-wash buffer (PBS pH 7.4, 0.1% Tween-20). Chemiluminescence (NEN) is performed, as directed by the manufacturer.
Western blot analysis to detect anti-HTV-1 antibody is performed using a commercial Western Blot kit (QualiCode HTV- 1/2 Kit, Immunetics) according to the manufacturer's instructions, except for the mouse sera in which α-human IgG conjugate is substituted with a 1:5000 dilution of an alkaline phosphatase-conjugated goat anti-mouse IgG (H+L) (Jackson47lmmunoResearch Laboratories). Shown in Fig. 6 is the Western blot analysis of mice semm antibody response to TiLV-1 antigens. Sera from one mouse of each group (SBN, SBN-89.6, or SBN-NL4-3), which are immunized by the RVs (α-SBN, α-SBN-89.6 or OI-SBN-NL4-3), or immunized and boost injected with recombinant gpl20 and gp41 (α-SBN*, α-SBN- 89.6* or α-SBN-NL4-3*), are tested at 1:100 dilutions. A highly positive and weakly positive human control semm is used to detect the position of the HTV-1 proteins. SC indicates the semm control.
HCV
BSR cells were infected with a MOI of 5 for 48 hours and resuspended in lysis buffer [50mM Tris, pH 7.4/150mM NaCl/1% NP-40/.l% SDS/ IX protease inhibitor cocktail (Sigma)] on ice for five minutes. The suspension was transferred to a microcentrifuge tube and spun for one minute at 14,000 rpm to remove cell debris. Proteins were separated by 10% SDS/PAGE and transferred to a PVDF-Plus membrane (Osmonics, Minnetonka, MN). Blots were blocked for one hour [5% dry milk powder in PBS (pH 7.4)]. After blocking, blots were washed twice using a 0.1% PBS-Tween-20 solution and incubated with either monoclonal murine α-E2 antibody (H52, 1:1000) (Flint et al., 1999), monoclonal murine α-El antibody (A4, 1:1000) (Dubuisson, 2000) or rabbit α-RV-G tail antibody (1:20,000) (Foley et al., 2000) in 0.1% PBS-Tween for one hour. Blots were then washed three times with 0.1% PBS- Tween. Secondary antibodies of goat α-mouse or donkey α-rabbit HRP conjugated antibodies (1:5,000) (Jackson ImmunoResearch) were added, and blots were incubated for 1 hour. Again, blots were washed three times with 0.1% PBS-Tween and washed once with PBS (pH 7.4). Chemiluminescence (NEN) was performed as instructed by manufacturer. For quantification, Hyperfilm ECL film (Amersham Phamiacia Biotech) was preflashed with a Sensitize Preflash Unit as indicated by the manufacturer (Amersham Pharmacia Biotech) scanned and quantification was performed with NTH Image, version 1.61.
Example 7: Virus Neutralization Assays. HTV-1 strains are recovered on 293T cells and vims stocks are expanded on
MT-2 cells (HTV-1 NL4-3), frozen at -75° C and titered on MT-2 cells. Neutralization assays are performed according to Montefiori et al., (Journal of Clinical
Microbiology, 26, 231-5, 1998). Briefly, 8~5000 TCTD50 of HTV-lNL4-3 are incubated with serial dilutions oi mouse sera tor l hour. Ml -2 ceils are added and incubated at 37°C, 5% CO2 for 4-5 days. 100 μl of cells are transferred to a poly-L- lysine plate and stained with neutral red dye (Neutral Red, ICN) for 75 minutes. Cells are washed with PBS, lysed with acid alcohol and analyzed using a colorimeter at 550 nm. Protection is estimated to be at least 50% vims inhibition.
Example 8: Preparation of splenocytes
Spleens are aseptically removed and single cells suspensions are prepared. Red blood cells are lysed with ACK lysing buffer (BioWhitaker) and the remaining splenocytes are washed twice in RPMI-10 media containing 10% fetal bovine semm. Splenocytes are divided into effector and stimulator cells. Stimulator cells are prepared by infection with recombinant vaccinia vims (moi = 10) expressing an envelope protein from HIV-1 at a multiplicity of infection (moi) of 1 for two hours. Cells are washed with PBS once to remove excess vims and incubated for 16 hours at 37°C. After incubation, the vaccinia vims is inactivated using Psoralen (Sigma) (infra). Stimulator cells are added back to the effector cell population at a ratio of 3:1 and 10% T-STIM (Collaborative Biomedical Products) is added as a source of interleukin-II (TL-2).
Example 9: Inactivation of virus with Psoralen
Following incubation of splenocytes with the vaccinia vims, the vims is inactivated using psoralen (Sigma). Psoralen is added to cells to achieve a final concentration of 5 μg/ml. Following a ten minute incubation at 37°C the cells were treated with long- wave UV (365 nm) for 4 minutes and washed twice with PBS.
Example 10: Preparation of chromium labeled target cells.
Target cells (P815) are prepared by infection with vaccinia vims expressing the HIV-1 protein (see specific figure legend for specific protein) for one hour at a moi of 10, washed to remove excess vims, and incubated for 16 hours at 37°C. To measure background, target cells are infected with vaccinia vims expressing HIV-1
Gag (vP1287) or wild-type vaccinia (vP1170). Target cells are washed once in PBS, incubated with 100 μCi 51Cr for one hour to label the cells, washed two times in PBS and added to effector cells at various E:T ratios (see figures) for four hours at 37°C. The percent specific 51Cr release is calculated as 100 x ^experimental'"' release - spontaneous release)/(maximum release - spontaneous release). Maximum release was determined from supematants of cells that were lysed by the addition of 5% Triton X-100. Spontaneous release was determined from target cells incubated without added effector cells.
Example 11: Preparation ofCD8+ depleted T cells.
Seven days post in-vitro stimulation, CD8+ T-cells are depleted from the cell culture (CD8 ) and enriched (CD8+) using Dynabeads Mouse CD8 (Lyt2), as described by the manufacturer.
Example 12: Immunofluorescence microscopy.
BSR cells were plated in six- well plates containing coverslips and infected with a multiplicity of infection (MOI) of 0.1 for 48 hours. Cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. For internal immunostaining cells were permeabilized with 1% Triton in (phosphor-buffered saline) PBS for 5 minutes at room temperature. Cells were washed three times with PBS-Glycine [lOmM glycine in PBS (pH 7.4)] and incubated with a monoclonal mouse antibody directed against HCV E2 (H53, 1:600) for 1 hour at room temperature and again washed three times with PBS-Glycine. After incubation for another 30 min with donkey anti-mouse FTTC 1:100 (Jackson ImmunoReasearch) cells were washed three times with PBS-Glycine and analyzed by fluorescence microscopy. A FTTC-labeled antibody against RV N (Centocor) was used as described previously (Foley et al., 2000; Schnell et al., 2000).
Example 13: Use ofE2 proteins derived from purified recombinant virions. Recombinant RVs in the supematants from SPBN or SPBN-E2CD4RVG infected BSR cells were sucrose purified and incubated for 30 minutes with 1% Triton X-100 in PBS. RV Ribonucleoprotein (RNP) complex was removed by centrifugation at 16,000 g at 4° C for an hour. Supematants were removed and used directly to coat
ELISA plates or frozen at 80° C. 96-well MaxiSorp plates (Nunc) were coated with glycoprotein(s) derived from 25 μg purified SPBN or SPBN-E2CD4G virions for each plate in coating buffer (50 mM Na2CO3, pH 9.6) and incubated overnight at 4°C. Plates were washed three times with 0.05% P S7Tweeri''and'!blbcked''''wϊffi''''5'% "dry milk powder in IX PBS for 1 hour at room temperature. Human sera were diluted in IX PBS beginning with a 1:100 dilution, added to the plates, and incubated at room temperature for 1 hour. Plates were washed three times with .05% PBS/Tween and the secondary antibody (goat α-human horse radish peroxidase (HRP) conjugated, Jackson ImmunoResearch) diluted 1:5000 in PBS was applied and plates were incubated at 37°C for 30 minutes. Plates were washed three times with 0.05% PBS/Tween, and OPD substrate (Sigma) was added as instmcted by the vendor. Substrate reaction was stopped by the addition of 50 μl 2 M H2SO4 to each well. Plates were read at 490 nm using a Bio-Tek ELχ800 plate reader.
All publications and references, including but not limited to patent applications, cited in this specification, are herein incorporated by reference in their entirety as if each individiual publication or reference were specifically and individually indicated to be incorporated by reference herein as being fully set forth.
While this invention has been described with a reference to specific embodiments, it will be obvious to those of ordinary skill in the art that variations in these methods and compositions may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims.
REFERENCES''
ATΉA A, H., and MIYAZAKI, J. (1998). Gene transfer into muscle by electroporation in vivo [see comments]. Nature Biotechnology 16(9), 867-70. ALTER, M. J. (1997). Epidemiology of hepatitis C. Hepatology 26(3 Suppl 1),
62S-65S.
BATTEGAY, M., FIKES, J., DI BISCEGLIE, A. M., WENTWORTH, P. A., SETTE, A., CELIS, E., CHΓNG, W. M., GRAKOUI, A., RICE, C. M., and KUROKOHCHI, K. (1995). Patients with chronic hepatitis C have circulating cytotoxic T cells which recognize hepatitis C vims-encoded peptides binding to HLA-A2.1 molecules. Journal of Virology 69(4), 2462-70.
BUCHHOLZ, U. J., FINKE, S., and CONZELMANN, K. K. (1999). Generation of bovine respiratory syncytial vims (BRSV) from cDNA: BRSV NS2 is not essential for vims replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. Journal of Virology
73(1), 251-9.
CHOO, Q. L., KUO, G., RALSTON, R., WEINER, A., CHΓEN, D., VAN NEST, G., HAN, J., BERGER, K., THUDIUM, K., KUO, C, and ET AL. (1994). Vaccination of chimpanzees against infection by the hepatitis C vims. Proceedings of the National Academy of Sciences of the United States of America 91(4), 1294-8.
CHOO, Q. L., KUO, G., WEΓNER, A. J., OVERBY, L. R., BRADLEY, D. W., and HOUGHTON, M. (1989). Isolation of a cDNA clone derived from a blood-bome non-A, non-B viral hepatitis genome. Science 244(4902), 359-62. CLARKE, B. (1997). Molecular virology of hepatitis C vims. Journal of General Virology 78(Pt 10), 2397-410.
COCQUEREL, L., MEUNIER, J. C, PH LEZ, A., WYCHOWSKI, C, and DUBUISSON, J. (1998). A retention signal necessary and sufficient for endoplasmic reticulum localization maps to the transmembrane domain of hepatitis C vims glycoprotein E2. Journal of Virology 72(3), 2183-91. COCQUEREL, L., WYCHOWSKI, C, MINNER, F., PENIN, F., and DUBUISSON, J.
(2000). Charged residues in the transmembrane domains of hepatitis C vims glycoproteins play a major role in the processing, subcellular localization, and assembly of these envelope proteins. Journal of Virology 74(8), 3623-33.
DIETZSCHOLD, B., WIKTOR, T. J., WuNNER, W. H., and VARRICHIO, A. (1983).
Chemical and immunological analysis of the rabies soluble glycoprotein.
Virology 124(2), 330-7. DUBUISSON, J. (2000). Folding, assembly and subcellular localization of hepatitis C vims glycoproteins. Current Topics in Microbiology &
Immunology 242, 135-48.
DUBUISSON, J., Hsu, H. H, CHEUNG, R. C, GREENBERG, H. B., RUSSELL, D.
G., and RlCE, C. M. (1994). Formation and intracellular localization of hepatitis C vims envelope glycoprotein complexes expressed by recombinant vaccinia and Sindbis vimses. Journal of Virology 68(10), 6147-60.
DUVET, S., COCQUEREL, L., PILLEZ, A., CACAN, R., VERBERT, A.,
MORADPOUR, D., WYCHOWSKI, C, and DUBUISSON, J. (1998). Hepatitis C vims glycoprotein complex localization in the endoplasmic reticulum involves a determinant for retention and not retrieval. Journal of Biological Chemistry
273(48), 32088-95.
FARCI, P., ALTER, H. J., GOVINDARAJAN, S., WONG, D. C, ENGLE, R.,
LESNΓEWSKI, R. R., MUSHAHWAR, I. K., DESAI, S. M., MILLER, R. H., OGATA,
N., and ET AL. (1992). Lack of protective immunity against reinfection with hepatitis C vims. Science 258(5079), 135-40.
FARCI, P., ALTER, H. J., WONG, D. C, MILLER, R. H., GOVTNDARAJAN, S.,
ENGLE, R., SHAPIRO, M., and PURCELL, R. H. (1994). Prevention of hepatitis C vims infection in chimpanzees after antibody-mediated in vitro neutralization.
Proceedings of the National Academy of Sciences of the United States of America 91(16), 7792-6.
FARCI, P., SHIMODA, A., COIANA, A., DIAZ, G., PEDDIS, G., MELPOLDER, J. C,
STRAZZERA, A., CHIEN, D. Y., MUNOZ, S. J., BALESTRΓERI, A., PURCELL, R.
H., and ALTER, H. J. (2000). The outcome of acute hepatitis C predicted by the evolution of the viral quasispecies. Science 288(5464), 339-44. FARCI, P., SHΓMODA, A., WONG, D., CABEZON, T., DE GIOANNIS, D.,
STRAZZERA, A., SHΓMΓZU, Y., SHAPIRO, M., ALTER, H. J., and PURCELL, R. H.
(1996). Prevention of hepatitis C vims infection in chimpanzees by hyperimmune semm against the hypervariable region 1 of the envelope 2 protein. Proceedings of the National Acdde"my"of Sό' feϊtkes' bf ' the'V ifeWSϊdtes of America 93(26), 15394-9.
FINKE, S., and CONZELMANN, K. K. (1999). Vims promoters determine interference by defective RNAs: selective amplification of mini-RNA vectors and rescue from cDNA by a 3' copy-back ambisense rabies vims. Journal of
Virology 73(5), 3818-25.
FLINT, M., DUBUISSON, J., MAIDENS', C, HARROP, R., GUILE, G. R., BORROW, P., and MCKEAΉNG, J. A. (2000). Functional characterization of intracellular and secreted forms of a tmncated hepatitis C vims E2 glycoprotein. Journal of Virology 74(2), 702-9.
FLINT, M., MAIDENS, C, LOOMIS-PRICE, L. D., SHOTTON, C, DUBUISSON, J., MONK, P., HIGGESTBOTTOM, A., LEVY, S., and MCKEAΉNG, J. A. (1999). Characterization of hepatitis C vims E2 glycoprotein interaction with a putative cellular receptor, CD81. Journal of Virology 73(8), 6235-44. FOLEY, H. D., MCGETΉGAN, J. P., SILER, C. A., DIETZSCHOLD, B., and
SCHNELL, M. J. (2000). A recombinant rabies vims expressing vesicular stomatitis vims glycoprotein fails to protect against rabies vims infection. Proc. Natl. Acad. Sci. USA(91), 14680-5. FORNS, X., PAYETTE, P. J., MA, X., SATTERMELD, W., EDER, G., MUSHAHWAR, I. K., GOVINDARAJAN, S., DAVIS, H. L., EMERSON, S. U.,
PURCELL, R. H., and BUKH, J. (2000a). Vaccination of chimpanzees with plasmid DNA encoding the hepatitis C vims (HCV) envelope E2 protein modified the infection after challenge with homologous monoclonal HCV. Hepatology 32(3), 618-25. FORNS, X., THΓMME, R., GOVINDARAJAN, S., EMERSON, S. U, PURCELL, R. H,
CHISARI, F. V., and BUKH, J. (2000b). Hepatitis C vims lacking the hypervariable region 1 of the second envelope protein is infectious and causes acute resolving or persistent infection in chimpanzees. Proc. Natl. Acad. Sci. U SA 97(24), 13318-13323. FRIED, M. W., and HOOE AGLE, J. H. (1995). Therapy of hepatitis C. Seminars in Liver Disease 15(1), 82-91.
FROLOV, I., AGAPOV, E., HOFFMAN, T. A., JR., PRAGAI, B. M., LIPPA, M.,
SCHLESINGER, S., and RICE, C. M. (1999). Selection of RNA replicons capable of persistent noncytopamic replication m mammalian cens. journal of
Virology 73(5), 3854-65.
GORDON, E. J., BHAT, R., LIU, Q., WANG, Y. F., TACKNEY, C, and PRJJSΓCE, A.
M. (2000). Immune responses to hepatitis C vims stmctural and nonstmctural proteins induced by plasmid DNA immunizations. Journal of Infectious
Diseases 181(1), 42-50.
GRAKOUI, A., WYCHOWSKI, C, LIN, C, FEINSTONE, S. M., and RICE, C. M.
(1993). Expression and identification of hepatitis C vims polyprotein cleavage products. Journal of Virology 67(3), 1385-95. GRUENER, N. H, GERLACH, T. J., JUNG, M. C, DJEPOLDER, H. M., SCHJJRREN,
C. A., SCHRAUT, W. W., HOFFMANN, R., ZACHOVAL, R., SANTANTONIO, T.,
CUCCHIARINI, M., CERNY, A., and PATE, G. R. (2000). Association of hepatitis
C vims-specific CD8+ T cells with viral clearance in acute hepatitis C.
Journal of Infectious Diseases 181(5), 1528-36. INCHAUSPE, G. (1999). DNA vaccine strategies for hepatitis C [see comments].
Journal ofHepatology 30(2), 339-46.
KATO, N., SEKIYA, H, OOTSUYAMA, Y., NAKAZAWA, T., HDTKATA, M.,
OHKOSHI, S., and SHJMOTOHNO, K. (1993). Humoral immune response to hypervariable region 1 of the putative envelope glycoprotein (gp70) of hepatitis C vims. Journal of Virology 67(7), 3923-30.
KOJΓMA, M., OSUGA, T., TSUDA, F., TANAKA, T., and OKAMOTO, H. (1994).
Influence of antibodies to the hypervariable region of E2/NS1 glycoprotein on the selective replication of hepatitis C vims in chimpanzees. Virology 204(2),
665-72. KRAWCZYNSKI, K., ALTER, M. J., TANKERSLEY, D. L., BEACH, M.,
ROBERTSON, B. H., LAMBERT, S., KUO, G., SPELBRΠSTG, J. E., MEEKS, E.,
SINHA, S., and CARSON, D. A. (1996). Effect of immune globulin on the prevention of experimental hepatitis C vims infection. Journal of Infectious
Diseases 173(4), 822-8. LE, S. Y., SΓDDIQUI, A., and MAIZEL, J. V., JR. (1996). A common stmctural core in the internal ribosome entry sites of picornavirus, hepatitis C vims, and pestivims. Virus Genes 12(2), 135-47.
LEROUX-ROELS, G., ESQUΓVΈL, C. A., DELEYS, R., STUYVΈR, L., ELEWAUT, A., PHILIPPE, J., DESOMBERE, I., PARADΠS" J.;'
Figure imgf000057_0001
Lymphoproliferative responses to hepatitis C vims core, El, E2, and NS3 in patients with chronic hepatitis C infection treated with interferon alfa.
Hepatology 23(1), 8-16. LESNTEWSKI, R., OKASINSKI, G., CARRICK, R., VAN SANT, C, DESAI, S.,
JOHNSON, R., SCHEPFEL, J., MOORE, B., and MUSHAHWAR, I. (1995). Antibody to hepatitis C vims second envelope (HCV-E2) glycoprotein: a new marker of
HCV infection closely associated with viremia. Journal of Medical Virology
45(4), 415-22. LIANG, T. J., REHERMANN, B., SEEFF, L. B., and HOOFNAGLE, J. H. (2000).
Pathogenesis, natural history, treatment, and prevention of hepatitis C. Annals of Internal Medicine 132(4), 296-305.
LOHMANN, V., KORNER, F., DOBJERZEWSKA, A., and BARTENSCHLAGER, R.
(2001). Mutations in hepatitis C vims RNAs conferring cell culture adaptation. Journal of Virology 75(3), 1437-49.
MAJOR, M. E., MJHALIK, K., FERNANDEZ, J., SEIDMAN, J., KLEINER, D.,
KOLYKHALOV, A. A., RICE, C. M., and FEINSTONE, S. M. (1999). Long-term follow-up of chimpanzees inoculated with the first infectious clone for hepatitis C vims. Journal of Virology 73(4), 3317-25. MAKTMURA, M., MIYAKE, S., AKINO, N., TAKAMORI, K., MATSUURA, Y.,
MΓYAMURA, T., and SAΓΓO, I. (1996). Induction of antibodies against stmctural proteins of hepatitis C vims in mice using recombinant adenoviras. Vaccine
14(1), 28-36.
MCGETTTGAN, J. P., FOLEY, H. D., BELYAKOV, I. G., BERZOFSKY, J. A., POMERANTZ, R. J., and SCHNELL, M. J. (2001a). Rabies Vims-Based Vectors
Expressing Human Immunodeficiency Vims Type 1 (HTV-1) Envelope Protein
Induce a Strong, Cross-Reactive Cytotoxic T-Lymphocyte Response against
Envelope Proteins from Different HTV-1 Isolates. J. Virol. 75(9), 4430-4434.
MCGETΠGAN, J. P., SARMA, S., ORENSTEIN, J. M., POMERANTZ, R. J., and SCHNELL, M. J. (2001b). Expression and immunogenicity of human immunodeficiency vims tupe I Gag expressed by a replication-competent rhabdo vims-based vaccine vector. J. Virol, submitted.
MEBATSION, T., and CONZELMANN, K.-K. (1996c). Specific infection of CD4+ target cells by recombinant rabϊes~vϊrus7P ' rocXN' a' tCAcad.
Sci. USA. 93(21), 11366-70.
MEBATSION, T., FTNKE, S., WETLAND, F., and CONZELMANN, K. K. (1997). A
CXCR4/CD4 pseudotype rhabdovims that selectively infects HTV-1 envelope protein-expressing cells [see comments]. Cell 90(5), 841-7.
MEBATSION, T., SCHNELL, M. J., Cox, J. H, FINKE, S., and CONZELMANN, K.
K. (1996). Highly stable expression of a foreign gene from rabies vims vectors. Proceedings of the National Academy of Sciences of the United States of America 93(14), 7310-4. MICHALAK, J. P., WYCHOWSKI, C, CHOUKHI, A., MEUNJJER, J. C, UNG, S.,
RICE, C. M., and DUBUISSON, J. (1997). Characterization of tmncated forms of hepatitis C vims glycoproteins. Journal of General Virology 78(Pt 9), 2299-
306.
PANCHOLI, P., LIU, Q., TRICOCHE, N., ZHANG, P., PERKUS, M. E., and PRINCE, A. M. (2000). DNA prime-canarypox boost with polycistronic hepatitis C vims (HCV) genes generates potent immune responses to HCV stmctural and nonstructural proteins. Journal of Infectious Diseases 182(1), 18-27.
PELERI, P., UEMATSU, Y., CAMPAGNOLI, S., GALLI, G., FALUGI, F., PETRACCA,
R., WEΠMER, A. J., HOUGHTON, M., ROSA, D., GRANDI, G., and ABRIGNANI, S. (1998). Binding of hepatitis C vims to CD81. Science 282(5390), 938-41.
PRINCE, A. M., BROTMAN, B., HUΓMA, T., PASCUAL, D., JAEFERY, M., and
INCHAUSPE, G. (1992). Immunity in hepatitis C infection. Journal of Infectious
Diseases 165(3), 438-43.
PRΓNCE, A. M., BROTMAN, B., LEE, D. H., REN, L., MOORE, B. S., and SCHEFFEL, J. W. (1999). Significance of the anti-E2 response in self-limited and chronic hepatitis C vims infections in chimpanzees and in humans.
Journal of Infectious Diseases 180(4), 987-91.
REED, K. E., and RICE, C. M. (1998). Molecular characterization of hepatitis C vims. Current Studies in Hematology & Blood Transfusion(62), 1-37. ROSE, J. K., and SCHUBERT, M. (1987). "Rhabdovims genomes and their products." The rhabdovimses (R. R. Wagner, Ed.) Plenum Publishing Corp.,
New York.
SAΓTO, T., SHERMAN, G. J., KUROKOHCHI, K., GUO, Z. P., DONETS, M., Yu, M. Y., BERZOFSKY, J. A., AKATSUKX, T:;'"laM!,'FEiN T5NE';i "S'. -,'M. (1997). Plasmid DNA-based immunization for hepatitis C vims stmctural proteins: immune responses in mice [see comments]. Gastroenterology 112(4), 1321-30. SCHNELL, M. J., FOLEY, H. D., SΓLER, C. A., MCGETΠGAN, J. P.,
DIETZSCHOLD, B., and POMERANTZ, R. J. (2000). Recombinant rabies vims as potential live-viral vaccines for HTV-1. PNAS(10.1073/pnas.050589197 (Microbiology)).
SCHNELL, M. J., MEBATSION, T., and CONZELMANN, K. K. (1994). Infectious rabies vimses from cloned cDNA. EMBO Journal 13(18), 4195-203.
SHJMIZU, Y. K., HTJTKATA, M., IWAMOTO, A., ALTER, H. J., PURCELL, R. H, and YOSHIKURA, H. (1994). Neutralizing antibodies against hepatitis C vims and the emergence of neutralization escape mutant vimses. Journal of Virology 68(3), 1494-500. SlMMONDS, P., ALBERT!, A., ALTER, H. J., BONTNO, F,, BRADLEY, D. W.,
BRECHOT, C, BROUWER, J. T., CHAN, S. W., CHAYAMA, K., CHEN, D. S., and ET AL. (1994). A proposed system for the nomenclature of hepatitis C viral genotypes [letter]. Hepatology 19(5), 1321-4.
SONG, M. K., LEE, S. W., SUH, Y. S., LEE, K. J., and SUNG, Y. C. (2000). Enhancement of immunoglobulin G2a and cytotoxic T-lymphocyte responses by a booster immunization with recombinant hepatitis C vims E2 protein in E2 DNA-primed mice. Journal of Virology 74(6), 2920-5. VJJDALΓN, O., FOURNTLLIER, A., RENARD, N., CHEN, M., DEPLA, E.,
BOUCREUX, D., BRINSTER, C, BAUMERT, T., NAKANO, I., FUKUDA, Y., LJLJESTROM, P., TREPO, C, and INCHAUSPE, G. (2000). Use of Conventional or
Replicating Nucleic Acid-Based Vaccines and Recombinant Semliki Forest Derived Particles for the Induction of immune Responses Against Hepatitis C Vims Core and E2 Antigens. Virology 276, 259-270. WEINER, A. J., BRAUER, M. J., ROSENBLATT, J., RICHMAN, K. H., TUNG, J., CRAWFORD, K., BONΓNO, F., SARACCO, G., CHOO, Q. L., HOUGHTON, M., and
ET AL. (1991). Variable and hypervariable domains are found in the regions of
HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 180(2), 842-8. WEJJMER, A. J., GEYSEN, H. M., CHRisτdPHERSθN, "e.rϊMiit; 'J.
Figure imgf000060_0001
J., SARACCO, G., BONΓNO, F., CRAWFORD, K., MARION, C. D., and CRAWFORD, K. A. (1992a). Evidence for immune selection of hepatitis C vims (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections. Proceedings of the National Academy of Sciences of the United
States of America 89(8), 3468-72.
WEEMER, A. J., GEYSEN, H. M., CHRISTOPHERSON, C, HALL, J. E., MASON, T. J., SARACCO, G., BONΓNO, F., CRAWFORD, K., MARION, C. D., CRAWFORD, K. A., and ET AL. (1992b). Evidence for immune selection of hepatitis C vims (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections. Proceedings of the National Academy of Sciences of the United States of America 89(8), 3468-72.

Claims

CLAIMSWhat is claimed is:
1. A recombinant Rhabdovims vector comprising:
(a) a modified Rhabdovims genome;
(b) a new transcription unit inserted into the Rhabdovims genome to express heterologous nucleic acid sequences; and
(c) a heterologous viral nucleic acid sequence that is inserted into said new transcription unit, wherein the recombinant Rhabdovims vector is replication competent, and said heterologous viral nucleic acid sequence encodes an antigenic polypeptide.
2. The recombinant Rhabdovims vector of Claim 1, wherein said modified rhado virus genome is a modified rabies vims genome.
3. The recombinant Rhabdovims vector of Claim 2, wherein said modified rabies vims genome has a second modification to have a glycoprotein from another class of vims in place of a rabies vims glycoprotein.
4. The recombinant Rhabdovims vector of Claim 3, wherein said glycoprotein from another class of vims is vesicular stomatitis vims glycoprotein.
5. The recombinant Rhabdovims vector of Claim 3, wherein said modified rabies vims genome has a third modification to have contiguity of stmctural genes different from that in said modified rhabodvims genome after said second modification.
6. The recombinant Rhabdovims vector of Claim 1, wherein said heterologous viral nucleic acid encodes an antigenic polypeptide selected from the group consisting of a full-length HTV envelope protein, HTV gpl60, HTV gag, HTV gρl20, and full- length STV envelope protein.
7. The recombinant Rhabdovims vector of Claim''6;i"^hfeMih"'said"'fheterδlσgdus viral nucleic acid is fused to a sequence of a cytoplasmic domain of a glycoprotein gene of said modified Rhabdovims genome to produce a chimeric protein such that said chimeric protein has a fusion between a transmembrane domain of said heterologous protein and a cytoplasmic domain of said glycoprotein.
8. The recombinant Rhabdovims vector of Claim 1 further comprising a deletion of a recombinant Rhabdovims glycoprotein gene, and wherein said heterologous viral nucleic acid is fused to a sequence of a cytoplasmic domain of a glycoprotein gene of said modified Rhabdovims genome to produce a chimeric protein which functionally substitutes for said recombinant Rhabdovims glycoprotein gene.
9. A recombinant Rhabdovims that expresses a functional HTV envelope protein wherein said recombinant Rhabdovims is replication-competent.
10. The recombinant Rhabdovims of Claim 9, wherein said Rhabdovims is a recombinant rabies vims or a recombinant vesicular stomatitis vims.
11. The recombinant Rhabdovims of Claim 9, wherein said HTV envelope protein is from any HTV-1 isolate.
12. An immunogenic composition comprising a recombinant Rhabdovims vector as in any one of claims 1 to 9 and an adjuvant.
13. A recombinant Ψ gene deficient rabies vims comprising a heterologous nucleic acid segment encoding an immunodeficiency vims envelope protein, or a subunit thereof .
14. The recombinant Ψ gene deficient rabies vims of Claim 13, wherein said
Rhado vims is a rabies vims.
15. The recombinant Ψ gene deficient rabies vims or Claim 13, wherein Said immunodeficiency vims envelope protein, or a subunit thereof, is from a human immunodeficiency vims.
16. The recombinant Ψ gene deficient rabies vims of Claim 13, wherein said immunodeficiency vims envelope protein, or a subunit thereof, is from a simian immunodeficiency vims.
17. A method of inducing an immunological response in a mammal, comprising: a) delivering to a tissue of said mammal a recombinant Rhabdovims vector that expresses a functional immunodeficiency vims envelope protein, or a subunit thereof, effective to induce an immunological response to said envelope protein; b) expressing said envelope protein, or the subunit thereof, in vivo; c) boosting said mammal by delivering an effective dose of an isolated immunodeficiency vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect said mammal from an immunodeficiency vims.
18. The method of Claim 17, wherein said recombinant Rhabdovims comprises a rabies vims genome.
19. The method of Claim 18, wherein said rabies vims genome is deficient in Ψ gene.
20. The method of Claim 18, wherein said rabies vims genome is deficient in a rabies vims glycoprotein gene.
21. The method of Claim 19, wherein said rabies vims genome has glycoprotein gene from another class of Rhabdovims in place of a rabies vims glycoprotein.
22. A method of inducing an immunological response in a mammal, comprising: a) delivering to a tissue of said mammal a non-segmented negative-stranded RNA vims that expresses a functional immunodeficiency vims envelope protein, or a subunit thereof, effective to induce an immunological response to said envelope protein; b) expressing said envelope protein, or the subunit thereof, in vivo; c) boosting said mammal by delivering an effective dose of an isolated immunodeficiency vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect said mammal from an immunodeficiency vims.
23. The method of Claim 22, wherein said non-segmented negative-stranded RNA vims is a Rabies vims or a Vesicular Stomatitis vims.
24. A recombinant non-segmented negative-stranded RNA vims vector comprising: a) a modified negative-stranded RNA vims genome that is deficient in ψ gene; b) a new transcription unit that is inserted into said modified negative- stranded RNA vims genome to express heterologous nucleic acid sequences; and c) a heterologous viral nucleic acid sequence that is inserted into said new transcription unit, wherein said recombinant non-segmented negative- stranded RNA vims vector is replication competent, and said heterologous viral nucleic acid sequence encodes an antigenic polypeptide.
25. A method of treating a mammal infected with an immunodeficiency vims, comprising: a) administering to said mammal a non-segmented negative- stranded RNA vims that expresses a functional immunodeficiency vims envelope protein, or subunit thereof; b) expressing said functional immunodeficiency vims envelope protein, or subunit thereof; c) boosting said mammal by delivering an effective dose of an isolated immunodeficiency vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional immunodeficiency vims envelope protein, or subunit thereof.
26. The method of Claim 25, wherein said immunodeficiency vims is any HTV-1 vims.
27. The method of Claim 25, wherein said non-segmented negative- stranded RNA vims is a Rhabdovims.
28. The method of Claim 25, further comprising an induction of mucosal immunity to said functional immunodeficiency vims envelope protein, or subunit thereof.
29. The method of Claim 25, wherein said long-lasting cellular response further comprises a cross-reactive CTL response wherein said cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency vims strains.
30. A method of protecting a mammal from an immunodeficiency vims infection, comprising: a) administering to said mammal a non-segmented negative-stranded RNA vims that expresses a functional immunodeficiency vims envelope protein, or subunit thereof; b) expressing said functional immunodeficiency vims envelope protein, or subunit thereof; c) boosting said mammal by delivering an effective dose of an isolated immunodeficiency vims envelope ioteϊύXϋr$:"sύW Υ n"δiS6ϊ, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional immunodeficiency vims envelope protein, or subunit thereof.
31. The method of Claim 30, wherein said immunodeficiency vims is any HTV-1 vims.
32. The method of Claim 30, wherein said non-segmented negative- stranded RNA vims is a Rhabdovims.
33. The method of Claim 30, further comprising an induction of mucosal immunity to said functional immunodeficiency vims envelope protein, or subunit thereof.
34. The method of Claim 30, wherein said long-lasting cellular response further comprises a cross-reactive CTL response wherein said cross-reactive CTLs are directed against envelope proteins, or subunits thereof, from different immunodeficiency vims strains.
35. A recombinant Rhabdovims vector comprising:
(a) a modified Rhabdovims genome;
(b) a new transcription unit inserted into the Rhabdovims genome to express heterologous nucleic acid sequences; and
(c) a heterologous viral nucleic acid sequence that is inserted into said new transcription unit, wherein said recombinant Rhabdovims vector is replication competent, and said heterologous viral nucleic acid sequence encodes HCV El, E2, and p7 antigenic polypeptides.
36. A recombinant Rhabdovims vector comprising:
(a) a modified Rhabdovims genome;
(b) a new transcription unit inserted into the Rhabdovims genome to express heterologous nucleic acid sequences; and (c) a heterologous viral nucleic acid sequence that is inserted into said new transcription unit, wherein said recombinant Rhabdovims vector is replication competent, and said heterologous viral nucleic acid sequence encodes an ectodomain of HCV E2 that has an amino acid deletion at its carboxy-terminus fused to a transmembrane domain and a cytoplasmic domain of human CD4, wherein a chimeric E2 antigenic polypeptide is expressed.
37. A recombinant Rhabdovims vector comprising: (a) a modified Rhabdovims genome;
(b) a new transcription unit inserted into the Rhabdovims genome to express heterologous nucleic acid sequences; and
(c) a heterologous viral nucleic acid sequence that is inserted into said new transcription unit, wherein said recombinant Rhabdovirus vector is replication competent, and said heterologous viral nucleic acid sequence encodes an ectodomain of HCV E2 that has an amino acid deletion at its carboxy-terminus fused to a transmembrane domain of human CD4 and a cytoplasmic domain of a Rhabdovims glycoprotein wherein a chimeric E2 antigenic polypeptide is expressed.
38. A recombinant Rhabdovims that expresses a functional HCV envelope protein wherein said recombinant Rhabdovims is replication-competent.
39. An immunogenic composition comprising a recombinant Rhabdovims vector as in any one of claims 35 to 38 and an adjuvant.
40. A recombinant Ψ gene deficient rabies vims comprising a heterologous nucleic acid segment encoding a hepatitis C vims envelope protein, or a subunit thereof.
41. A method of inducing an immunological response in a mammal, comprising: a) delivering to a tissue of said mammal a recombinant non- segmented negative stranded RNA vims vector1 a expresses' a" functional hepatitis C vims envelope protein, or a subunit thereof, in an amount effective to induce an immunological response to said envelope protein; b) expressing said envelope protein, or the subunit thereof, in vivo; c) boosting said mammal by delivering an effective dose of an isolated heptatits C vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect said mammal from a heptatits C virus.
42. The method of Claim 41, wherein said recombinant Rhabdovims is deficient in Ψ gene.
43. The method of Claim 42, wherein said recombinant Rhabdovims comprises a rabies vims genome.
44. A method of inducing an immunological response in a mammal, comprising: a) delivering to a tissue of said mammal a recombinant non-segmented negative stranded RNA vims vector that expresses a functional hepatitis C vims envelope protein, or a subunit thereof, in an amount effective to induce an immunological response to said envelope protein; b) expressing said envelope protein, or the subunit thereof, in vivo; and c) inducing a long lasting cellular immune response thereto to protect said mammal from a heptatits C vims.
45. The method of Claim 44, wherein said recombinant Rhabdovims is deficient in Ψ gene.
46. The method of Claim 46, wherein said recombinant Rhabdovims comprises a rabies vims genome.
47. The method of Claim 41 or 44 wherein said non-segmented negative stranded RNA vims comprises a Rhabdovims vector."
48. A method of treating a mammal infected with a hepatitis C vims, comprising: a) administering to said mammal a non-segmented negative-stranded
RNA vims that expresses a functional hepatitic C vims envelope protein, or subunit thereof; b) expressing said functional hepatitic C vims envelope protein, or subunit thereof; c) boosting said mammal by delivering an effective dose of an isolated hepatitic C vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional hepatitic C vims envelope protein, or subunit thereof.
49. A method of treating a mammal infected with a hepatitis C vims, comprising: a) administering to said mammal a non-segmented negative-stranded RNA vims that expresses a functional hepatitic C vims envelope protein, or subunit thereof; b) expressing said functional hepatitic C vims envelope protein, or subunit thereof; and c) inducing a long lasting cellular immune response to said functional hepatitic C vims envelope protein, or subunit thereof.
50. The method of Claim 48 or 49, wherein said non-segmented negative- stranded RNA vims is a Rhabdovims.
51. A method of protecting a mammal from a hepatitis C vims infection, comprising: a) administering to said mammal a non-segmented negative-stranded
RNA vims that expresses a functional hepatitis C vims envelope protein, or subunit fne e'bf b) expressing said functional hepatitis C vims envelope protein, or subunit thereof; c) boosting said mammal by delivering an effective dose of an isolated hepatitis C vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional hepatitis C vims envelope protein, or subunit thereof.
52. A method of protecting a mammal from a hepatitis C vims infection, comprising: a) administering to said mammal a non-segmented negative- stranded RNA vims that expresses a functional hepatitis C vims envelope protein, or subunit thereof; b) expressing said functional hepatitis C vims envelope protein, or subunit thereof; and c) inducing a long lasting cellular immune response to said functional hepatitis C vims envelope protein, or subunit thereof.
53. A method of inducing an immunological response in a mammal, comprising: a) delivering to a tissue of said mammal a recombinant non-segmented negative stranded RNA vims virion wherein said virion has on its surface a functional hepatitis C vims envelope protein, or a subunit thereof, effective to induce an immunological response to said envelope protein; b) expressing said envelope protein, or the subunit thereof, in vivo; c) boosting said mammal by delivering an effective dose of an isolated heptatits C vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and d) inducing a neutralizing antibody response and/or long lasting cellular immune response thereto to protect said m"ammar'frbm"'r'a''Ke|)'ta ϊts C vims.
54. The method of Claim 53, wherein said recombinant Rhabdovims is deficient in Ψ gene.
55. The method of Claim 54, wherein said recombinant Rhabdovims comprises a rabies vims genome.
56. A method of inducing an immunological response in a mammal, comprising: a) delivering to a tissue of said mammal a recombinant non-segmented negative stranded RNA vims virion wherein said virion has on its surface a functional hepatitis C vims envelope protein, or a subunit thereof, effective to induce an immunological response to said envelope protein; b) expressing said envelope protein, or the subunit thereof, in vivo; and c) inducing a long lasting cellular immune response thereto to protect said mammal from a heptatits C vims.
57. The method of Claim 56, wherein said recombinant Rhabdovims is deficient in Ψ gene.
58. The method of Claim 57, wherein said recombinant Rhabdovims comprises a rabies vims genome.
59. The method of Claim 53 or 56 wherein said non-segmented negative stranded RNA vims comprises a Rhabdovims vector.
60. A method of treating a mammal infected with a hepatitis C vims, comprising: a) administering to said mammal a non-segmented negative-stranded
RNA vims virion wherein said virion has on its surface a functional hepatitic C vims envelope protein, or subunit thereof; b) boosting said mammal by delivering an effective "dose "of an "isolated hepatitic C vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and c) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional hepatitic C vims envelope protein, or subunit thereof.
61. A method of treating a mammal infected with a hepatitis C vims, comprising: a) administering to said mammal a non-segmented negative-stranded
RNA vims virion wherein said virion has on its surface a functional hepatitic C vims envelope protein, or subunit thereof; and b) inducing a long lasting cellular immune response to said functional hepatitic C vims envelope protein, or subunit thereof.
62. The method of Claim 60 or 61, wherein said non-segmented negative- stranded RNA virusϊs a Rhabdovims.
63. A method of protecting a mammal from a hepatitis C vims infection, comprising: a) administering to said mammal a non-segmented negative-stranded RNA vims virion wherein said virion has on its surface a functional hepatitis C vims envelope protein, or subunit thereof; b) boosting said mammal by delivering an effective dose of an isolated hepatitis C vims envelope protein, or a subunit thereof, in an adjuvant or by delivering an effective dose of a boost vaccine vector; and c) inducing a neutralizing antibody response and/or long lasting cellular immune response to said functional hepatitis C vims envelope protein, or subunit thereof.
64. A method of protecting a mammal from a hepatitis C vims infection, comprising: a) administering to said mammal 'a'nori-segrnente'a' ήegatϊve-str'arided RNA vims virion wherein said virion has on its surface a functional hepatitis C vims envelope protein, or subunit thereof; and b) inducing a long lasting cellular immune response to said functional hepatitis C virus envelope protein, or subunit thereof.
65. A method for diagnosing a patient with a hepatitis C infection, comprising: a) contacting an immobilized immunoassay reagent comprising an antigenic peptide of hepatitis C vims with a biological sample from said patient suspected of a hepatitis C infection under conditions such that any immunospecific binding occurs; and b) detecting or measuring an amount of said immunospecific binding by antibodies in said biological sample from said patient that are bound to said reagent, wherein detection of said antibodies indicates said hepatitis C infection.
66. The method of Claim 65 wherein said antigenic peptide of hepatitis C vims is an E2 antigen, or subunit thereof.
67. A method for diagnosing a patient with a hepatitis C infection, comprising: a) contacting an immobilized immunoassay reagent comprising an anti- hepatitis C antibody(s) with a biological sample from said patient suspected of a hepatitis C infection under conditions such that any immunospecific binding occurs; and b) detecting or measuring an amount of said immunospecific binding by hepatitis C vims and/or viral antigens in said biological sample from said patient that are bound to said reagent, wherein detection of said hepatitis C vims and/or viral antigens indicates said hepatitis C infection.
68. The method of Claim 67 wherein said immobilized immunoassay reagent comprises a polyclonal or monoclonal antibody that is capable of binding to and detecting said HCV vims and/or viral antigens in said biological sample of said patient.
PCT/US2002/012637 2001-04-20 2002-04-19 Recombinant rhabdoviruses as live-viral vaccines WO2002089728A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US28555201P 2001-04-20 2001-04-20
US60/285,552 2001-04-20

Publications (2)

Publication Number Publication Date
WO2002089728A2 true WO2002089728A2 (en) 2002-11-14
WO2002089728A3 WO2002089728A3 (en) 2003-07-10

Family

ID=23094739

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/012637 WO2002089728A2 (en) 2001-04-20 2002-04-19 Recombinant rhabdoviruses as live-viral vaccines

Country Status (1)

Country Link
WO (1) WO2002089728A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1549756A2 (en) * 2002-09-09 2005-07-06 University of Tennessee Research Foundation Recombinatant mutants of rhabdovirus and methods of use thereof
US7541038B2 (en) 2003-06-05 2009-06-02 Wyeth Holdings Corporation Fusogenic, self-propagating blebs as immunogenic compositions
WO2017176596A1 (en) * 2016-04-04 2017-10-12 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Multivalent vaccines for rabies virus and coronaviruses

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MEBATSION T. ET AL.: 'Highly stable expression of a foreign gene from rabies virus vectors' PROC. NATL. ACAD. SCI. USA vol. 93, July 1996, pages 7310 - 7314, XP002910312 *
MEBATSION T. ET AL.: 'Specific infection of CD4+ target cells by recombinant rabies virus pseudotypes carrying the HIV-1 envelope spike protein' PROC. NATL. ACAD. SCI. USA vol. 93, October 1996, pages 11366 - 11370, XP002100330 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1549756A2 (en) * 2002-09-09 2005-07-06 University of Tennessee Research Foundation Recombinatant mutants of rhabdovirus and methods of use thereof
EP1549756A4 (en) * 2002-09-09 2006-05-10 Univ Tennessee Res Foundation Recombinatant mutants of rhabdovirus and methods of use thereof
US7541038B2 (en) 2003-06-05 2009-06-02 Wyeth Holdings Corporation Fusogenic, self-propagating blebs as immunogenic compositions
WO2017176596A1 (en) * 2016-04-04 2017-10-12 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Multivalent vaccines for rabies virus and coronaviruses
US11041170B2 (en) 2016-04-04 2021-06-22 Thomas Jefferson University Multivalent vaccines for rabies virus and coronaviruses
EP4104854A3 (en) * 2016-04-04 2023-03-08 The United States of America as represented by the Secretary of the Department of Health and Human Services Multivalent vaccines for rabies virus and coronaviruses

Also Published As

Publication number Publication date
WO2002089728A3 (en) 2003-07-10

Similar Documents

Publication Publication Date Title
Siler et al. Live and killed rhabdovirus-based vectors as potential hepatitis C vaccines
Fournillier et al. Induction of hepatitis C virus E1 envelope protein-specific immune response can be enhanced by mutation of N-glycosylation sites
Caley et al. Humoral, mucosal, and cellular immunity in response to a human immunodeficiency virus type 1 immunogen expressed by a Venezuelan equine encephalitis virus vaccine vector
Netter et al. Antigenicity and immunogenicity of novel chimeric hepatitis B surface antigen particles with exposed hepatitis C virus epitopes
Forns et al. DNA immunization of mice and macaques with plasmids encoding hepatitis C virus envelope E2 protein expressed intracellularly and on the cell surface
Gavrilov et al. Effects of glycosylation on antigenicity and immunogenicity of classical swine fever virus envelope proteins
AU738585B2 (en) Synthesis and purification of hepatitis C virus-like particles
US8618275B2 (en) Efficient cell culture system for hepatitis C virus genotype 5A
US9598467B2 (en) Recombinant HCV E2 glycoprotein
Reyes-del Valle et al. Broadly neutralizing immune responses against hepatitis C virus induced by vectored measles viruses and a recombinant envelope protein booster
US20110206710A1 (en) Recombinant lentiviral vector for expression of a flaviviridae protein and applications thereof as a vaccine
AU669193B2 (en) Peptide for stimulation of cytotoxic T lymphocytes specific for hepatitis C virus
Vidalin et al. Use of conventional or replicating nucleic acid-based vaccines and recombinant Semliki forest virus-derived particles for the induction of immune responses against hepatitis C virus core and E2 antigens
Ma et al. DNA-based vaccination against hepatitis C virus (HCV): effect of expressing different forms of HCV E2 protein and use of CpG-optimized vectors in mice
US20070141668A1 (en) Cloned genome of infectious hepatitis C virus of genotype 2A and uses thereof
JPH11506328A (en) Diagnosis of positive-strand RNA viruses using isolated, unprocessed polypeptides and vaccination against positive-strand RNA viruses
WO2001021807A1 (en) Hepatitis c virus envelope two protein (e2) which lacks all or part of the hypervariable region one (hvr1), corresponding nucleic acids, chimeric viruses and uses thereof
Fournillier et al. Expression of noncovalent hepatitis C virus envelope E1-E2 complexes is not required for the induction of antibodies with neutralizing properties following DNA immunization
US8834893B2 (en) Nucleic acid derived from hepatitis C virus and expression vector, transformed cell, and hepatitis C virus particles each prepared by using the same
US20030091590A1 (en) Recombinant rhabdoviruses as live-viral vaccines
WO2002089728A2 (en) Recombinant rhabdoviruses as live-viral vaccines
US20030124146A1 (en) Recombinant Rhabdoviruses as live-viral vaccines
US20030021805A1 (en) Generation of HCV-like particles and chimeric HCV virus
EP1255849A2 (en) Recombinant rhabdoviruses as live-viral vaccines for immunodeficiency viruses
Freer et al. Dissection of seroreactivity against the tryptophan-rich motif of the feline immunodeficiency virus transmembrane glycoprotein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA CN JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP