WO2002077183A2

WO2002077183A2 - Identification of essential genes in microorganisms

Info

Publication number: WO2002077183A2
Application number: PCT/US2002/009107
Authority: WO
Inventors: Liangsu Wang; Carlos Zamudio; Cheryl Malone; Robert Haselbeck; Kari L. Ohlsen; Judith W. Zyskind; Daniel Wall; John D. Trawick; Grant J. Carr; Robert Yamamoto; R. Allyn Forsyth; H. Howard Xu
Original assignee: Elitra Pharmaceuticals, Inc.
Priority date: 2001-03-21
Filing date: 2002-03-21
Publication date: 2002-10-03
Also published as: WO2002077183A9; AU2002306849A1

Abstract

The sequences of antisense nucleic acids which inhibit the proliferation of prokaryotes are disclosed. Cell-based assays which employ the antisense nucleic acids to identify and develop antibiotics are also disclosed. The antisense nucleic acids can also be used to identify proteins required for proliferation, express these proteins or portions thereof, obtain antibodies capable of specifically binding to the expressed proteins, and to use those expressed proteins as a screen to isolate candidate molecules for rational drug discovery programs. The nucleic acids can also be used to screen for homologous nucleic acids that are required for proliferation in cells other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, and Pseudomonas aeruginosa. The nucleic acids of the present invention can also be used in various assay systems to screen for proliferation required genes in other organisms.

Description

IDENTIFICATION OF ESSENTIAL GENES IN MICROORGANISMS

Sequence Listing

The present application is being filed along with quadruplicate copies of a CD-ROM marked "Copy 1 - SEQUENCE LISTING PART," "Copy 2 - SEQUENCE LISTING PART," "Copy 3 - SEQUENCE LISTING PART," and "CRF" containing a Sequence Listing in electronic fonnat. The quadruplicate copies of the CD-ROM each contain a file entitled

034VPC_fmal.ST25.txt, created on March 15, 2002, which is 181,323,311 bytes in size.

Background ofthe Invention

Since the discovery of penicillin, the use of antibiotics to treat the ravages of bacterial infections has saved millions of lives. With the advent of these "miracle drugs," for a time it was popularly believed that humanity might, once and for all, be saved from the scourge of bacterial infections. In fact, during the 1980s and early 1990s, many large pharmaceutical companies cut back or eliminated antibiotics research and development. They believed that infectious disease caused by bacteria finally had been conquered and that markets for new drugs were limited. Unfortunately, this belief was overly optimistic .

The tide is beginning to turn in favor of the bacteria as reports of drug resistant bacteria become more frequent. The United States Centers for Disease Control announced that one ofthe most powerful known antibiotics, vancomycin, was unable to treat an infection of the common Staphylococcus aureus (staph). This organism is commonly found in our environment and is responsible for many nosocomial infections. The import of this announcement becomes clear when one considers that vancomycin was used for years to treat infections caused by Staphylococcus species as well as other stubborn strains of bacteria. In short, bacteria are becoming resistant to our most powerful antibiotics. If this trend continues, it is conceivable that we will return to a time when what are presently considered minor bacterial infections are fatal diseases. Over-prescription and improper prescription habits by some physicians have caused an indiscriminate increase in the availability of antibiotics to the public. The patients are also partly responsible, since they will often improperly use the drug, thereby generating yet another population of bacteria that is resistant, in whole or in part, to traditional antibiotics.

The bacterial pathogens that have haunted humanity remain, in spite of the development of modern scientific practices to deal with the diseases that they cause. Drug resistant bacteria are now an increasing threat to the health of humanity. A new generation of antibiotics is needed to once again deal with the pending health threat that bacteria present.

Discovery of New Antibiotics

As more and more bacterial strains become resistant to the panel of available antibiotics, new antibiotics are required to treat infections. In the past, practitioners of pharmacology would have to rely upon traditional methods of drug discovery to generate novel, safe and efficacious compounds for the treatment of disease. Traditional drug discovery methods involve blindly testing potential drug candidate-molecules, often selected at random, in the hope that one might prove to be an effective treatment for some disease. The process is painstaking and laborious, with no guarantee of success. Today, the average cost to discover and develop a new drug exceeds US $500 million, an "d the average time from laboratory to patient is 15 years. Improving this process, even incrementally, would represent a huge advance in the generation of novel antimicrobial agents. Newly emerging practices in drug discovery utilize a number of biochemical techniques to provide for directed approaches to creating new drugs, rather than discovering them at random. For example, gene sequences and proteins encoded thereby that are required for the proliferation of a cell or microorganism make excellent targets since exposure of bacteria to compounds active against these targets would result in the inactivation of the cell or microorganism. Once a target is identified, biochemical analysis of that target can be used to discover or to design molecules that interact with and alter the functions of the target. Use of physical and computational techniques to analyze structural and biochemical properties of targets in order to derive compounds that interact with such targets is called rational drug design and offers great potential. Thus, emerging drug discovery practices use molecular modeling techniques, combinatorial chemistry approaches, and other means to produce and screen and/or design large numbers of candidate compounds.

Nevertheless, while this approach to drug discovery is clearly the way of the future, problems remain. For example, the initial step of identifying molecular targets for investigation can be an extremely time consuming task. It may also be difficult to design molecules that interact with the target by using computer modeling techniques. Furthermore, in cases where the function of the target is not lαiown or is poorly understood, it may be difficult to design assays to detect molecules that interact with and alter the functions of the target. To improve the rate of novel drug discovery and development, methods of identifying important molecular targets in pathogenic cells or microorganisms and methods for identifying molecules that interact with and alter the functions of such molecular targets are urgently required. Escherichia coli represents an excellent model system to understand bacterial biochemistry and physiology. The estimated 4288 genes scattered along the 4.6 x 10⁶ base pairs of the Escherichia coli (E. coli) chromosome offer tremendous promise for the understanding of bacterial biochemical processes. In turn, this knowledge will assist in the development of new tools for the diagnosis and treatment of bacteria-caused human disease. The entire E. coli genome has been sequenced, and this body of information holds a tremendous potential for application to the discovery and development of new antibiotic compounds. Yet, in spite of this accomplishment, the general functions or roles of many of these genes are still unknown. For example, the total number of proliferation-required genes contained within the E. coli genome is unknown, but has been variously estimated at around 200 to 700 (Armstrong, K.A. and Fan, D.P. Essential Genes in the metB-malB Region of Escherichia coli K12, 1975, J. Bacteriol. 126: 48-55).

Staphylococcus aureus is a Gram positive microorganism which is the causative agent of many infectious diseases. Local infection by Staphylococcus aureus can cause abscesses on skin and cellulitis in subcutaneous tissues and can lead to toxin-related diseases such as toxic shock and scalded skin syndromes. Staphylococcus aureus can cause serious systemic infections such as osteomyelitis, endocarditis, pneumonia, and septicemia. Staphylococcus aureus is also a common cause of food poisoning, often arising from contact between prepared food and infected food industry workers. Antibiotic resistant strains of Staphylococcus aureus have recently been identified, including those that are now resistant to all available antibiotics, thereby severely limiting the options of care available to physicians.

Pseudomonas aeruginosa is an important Gram negative opportunistic pathogen. It is the most common Gram negative found in nosocomial infections. P. aeruginosa is responsible for 16% of nosocomial pneumonia cases, 12% of hospital-acquired urinary tract infections, 8% of surgical wound infections, and 10% of bloodstream infections. Immunocompromised patients, such as neutropenic cancer and bone marrow transplant patients, are particular susceptible to opportunistic infections. In this group of patients, P. aeruginosa is responsible for pneumonia and septicemia with attributable deaths reaching 30%. P. aeruginosa is also one of the most common and lethal pathogens responsible for ventilator-associated pneumonia in intubated patients, with directly attributable death rates reaching 38%. Although P. aeruginosa outbreaks in burn patients are rare, it is associated with 60% death rates. In the AIDS population, P. aeruginosa is associated with 50% of deaths. Cystic fibrosis patients are characteristically susceptible to chronic infection by P. aeruginosa, which is responsible for high rates of illness and death. Cunent antibiotics work poorly for CF infections (Van Delden & Igelwski. 1998. Emerging Infectious Diseases 4:551-560; references therein).

The gram negative enteric bacterial genus, Salmonella, encompasses at least 2 species. One of these, S. enterica, is divided into multiple subspecies and thousands of serotypes or serovars (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467). The S. enterica human pathogens include serovars Typhi, Paratyphi, Typhimurium, Cholerasuis, and many others deemed so closely related that they are variants of a widespread species. Worldwide, disease in humans caused by Salmonella is a very serious problem. In many developing countries, S. enterica ser. Typhi still causes often- fatal typhoid fever. This problem has been reduced or eliminated in wealthy industrial states. However, enteritis induced by Salmonella is widespread and is the second most common disease caused by contaminated food in the United States (Edwards, BH 1999 "Salmonella and Shigella species" Clin. Lab Med. 19(3):469-487). Though usually self-limiting in healthy individuals, others such as children, seniors, and those with compromising illnesses can be at much greater risk of serious illness and death.

Some S. enterica serovars (e.g. Typhimurium) cause a localized infection in the gastrointestinal tract. Other serovars (i.e. Typhi and Paratyphi) cause a much more serious systemic infection. In animal models, these roles can be reversed which has allowed the use of the relatively safe S. enterica ser. Typhimurium as a sunogate in mice for the typhoid fever agent, S. enterica ser. Typhi. In mice, S. enterica ser Typhimurium causes a systemic infection similar in outcome to typhoid fever. Years of study ofthe Salmonella have led to the identification of many determinants of virulence in animals and humans. Salmonella is interesting in its ability to localize to ana mvaae the intestinal epithelium, induce morphologic changes in target cells via injection of certain cell- remodeling proteins, and to reside intracellularly in membrane-bound vesicles (Wallis, TS and Galyov, EE 2000 "Molecular basis of Salmonella-induced enteritis." Molec. Microb. 36:997-1005; Falkow, S "The evolution of pathogenicity in Escherichia, Shigella, and Salmonella," Chap. 149 in Neidhardt, et al. eds pp 2723-2729; Gulig, PA "Pathogenesis of Systemic Disease," Chap. 152 in Neidhardt, et al. ppp 2774-2787). The immediate infection often results in a severe watery dianhea but Salmonella also can establish and maintain a subclinical carrier state in some individuals. Spread is via food contaminated with sewage. The gene products implicated in Salmonella pathogenesis include type three secretion systems (TTSS), proteins affecting cytoplasmic structure of the target cells, many proteins carrying out functions necessary for survival and proliferation of Salmonella in the host, as well as "traditional" factors such as endotoxin and secreted exotoxins. Additionally, there must be factors mediating species-specific illnesses. Despite this most ofthe genomes of S. enterica ser. Typhi (see http://www.sanger.ac.uk/Projects/S_typhi/ for the genome database) and S. enterica ser. Typhimurium (see http://genome.wustl.edu/gsc/bacterial/salmonella.shtml for the genome database) are highly conserved and are mutually useful for gene identification in multiple serovars. The Salmonella are a complex group of enteric bacteria causing disease similar to but distinct from other gram negative enterics such as E. coli and have been a focus of biomedical research for the last century.

Enterococcus faecalis, a Gram positive bacterium, is by far the most common member of the enterococci to cause infections in humans. Enterococcus faecium generally accounts for less than 20% of clinical isolates. Enterococci infections are mostly hospital-acquired though they are also associated with some community-acquired infections. Of nosocomial infections enterococci account for 12%> of bacteremia, 15%> of surgical wound infections, 14% of urinary tract infections, and 5 tol5%> of endocarditis cases (Huycke, M. M., D. F., Sahm and M. S. Gilmore. 1998. Emerging Infectious Diseases 4:239-249). Additionally enterococci are frequently associated with intraabdominal and pelvic infections. Enterococci infections are often hard to treat because they are resistant to a vast anay of antimicrobial drugs, including aminoglycosides, penicillin, ampicillin and vancomycin. The development of multiple-drug resistant (MDR) enterococci has made this bacteria a major concern for treating nosocomial infections.

Cunent drug discovery methods involve screening large number of prospective therapeutic compounds to identify those that are effective therapeutic agents or that can be optimized to provide an effective therapeutic agents. For example, the compounds to be evaluated for therapeutic activity may be members of a library of compounds generated by combinatorial chemistry or members of a library of natural products.

Unfortunately, cunent methods are laborious and time consuming and may yield compounds which have already been identified or which act on gene products which are already targeted by an existing therapeutic agent. In addition, a large number of compounds have been identified which have antimicrobial activity but which cannot be administered to individuals suffering from infection due to the fact that their targets are unknown.

The above reasons underscore the urgency of developing new antibiotics that are effective against Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Salmonella typhimurium. Accordingly, there is an urgent need for more novel methods to identify and characterize bacterial genomic sequences that encode gene products involved in proliferation, and are thereby potential new targets for antibiotic development. Likewise, there is a need for rapid screening techniques which yield novel compounds or compounds which act on novel targets as well as a need for methods which permit the identification ofthe target on which a compound with antimicrobial activity acts.

Prior to the present invention, the discovery of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Salmonella typhimurium genes required for proliferation of the microorganism was a painstaking and slow process. Rapid screening techniques for identifying novel targets on which novel compounds act were undeveloped. While the detection and identification of new cellular drug targets within a Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Salmonella typhimurium cell is key for novel antibiotic development and effective treatment, the cunent methods of drug target discovery available prior to this invention have required painstaking processes requiring years of effort.

Summary ofthe Invention Some aspects ofthe present invention are described in the numbered paragraphs below.

1. A purified or isolated nucleic acid sequence comprising a nucleotide sequence consisting essentially of one of SEQ ID NOs: 1-6213, wherein expression of said nucleic acid inhibits proliferation of a cell.

2. The nucleic acid sequence of Paragraph 1, wherein said nucleotide sequence is complementary to at least a portion of a coding sequence of a gene whose expression is required for proliferation of a cell.

3. The nucleic acid of Paragraph 1, wherein said nucleic acid sequence is complementary to at least a portion of a nucleotide sequence of an RNA required for proliferation of a cell.

4. The nucleic acid of Paragraph 3, wherein said RNA is an RNA comprising a sequence of nucleotides encoding more than one gene product.

5. A purified or isolated nucleic acid comprising a fragment of one of SEQ ID NOs.: 1-6213, said fragment selected from the group consisting of fragments comprising at least 10, at least 20, at least 25, at least 30, at least 50 and more than 50 consecutive nucleotides of one of SEQ ID NOs: 1-6213. 6. The fragment of Paragraph 5, wherein said fragment is included in a nucleic acid obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacter oides fragϊlis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabratd), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia aster oides, Pasteur ella haemolytica, Pasteur ella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

7. The fragment of Paragraph 5, wherein said fragment is included in a nucleic acid obtained from an organism other than Escherichia coli. 8. A vector comprising a promoter operably linked to the nucleic acid of any one of

Paragraphs 1-7.

9. The vector of Paragraph 8, wherein said promoter is active in a microorganism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

10. A host cell containing the vector of Paragraph 8 or Paragraph 9.

11. A purified or isolated antisense nucleic acid comprising a nucleotide sequence complementary to at least a portion of an intragenic sequence, intergenic sequence, sequences spanning at least a portion of two or more genes, 5' noncoding region, or 3' noncoding region within an operon comprising a proliferation-required gene whose activity or expression is inhibited by an antisense nucleic acid comprising the nucleotide sequence of one of SEQ ID NOs.: 1-6213.

12. The purified or isolated antisense nucleic acid of Paragraph 11, wherein said antisense nucleic acid is complementary to a nucleic acid from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia ehterdcblitic^' a, Yersinia pestis and any species falling within the genera of any ofthe above species.

13. The purified or isolated antisense nucleic acid of Paragraph 11, wherein said nucleotide sequence is complementary to a nucleotide sequence of a nucleic acid from an organism other than E. coli.

14. The purified or isolated antisense nucleic acid of Paragraph 11, wherein said proliferation-required gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

15. A purified or isolated nucleic acid comprising a nucleotide sequence having at least 70% identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 1-6213, the nucleotide sequences complementary to SEQ ID NOs.: 1-6213 and the sequences complementary to fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 1-6213 as detennined using BLASTN version 2.0 with the default parameters. 16. The purified or isolated nucleic acid of Paragraph 15, wherein said nucleic acid is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Tondopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae,^' Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 17. The nucleic acid of Paragraph 15, wherein said nucleic acid is obtained from an organism other than E. coli. 18. A vector comprising a promoter operably linked to a nucleic acid encoding a polypeptide whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of any one of SEQ ID NOs.: 1-6213.

19. The vector of Paragraph 18, wherein said nucleic acid encoding said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii,

Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

20. The vector of Paragraph 18, wherein said nucleotide sequence encoding said polypeptide is obtained from an organism other than E. coli.

21. A host cell containing the vector of Paragraph 18.

22. The vector of Paragraph 18, wherein said polypeptide comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 42398-

78581.

23. The vector of Paragraph 18, wherein said promoter is operably linked to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397. 24. A purified or isolated polypeptide comprising a polypeptide whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of any one of SEQ ID NOs.: 1-6213, or a fragment selected from the group consisting of fragments comprising at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of one ofthe said polypeptides.

25. The polypeptide of Paragraph 24, wherein said polypeptide comprises an amino acid sequence of any one of SEQ ID NOs.: 42398-78581 or a fragment comprising at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

26. The polypeptide of Paragraph 24, wherein said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 27. The polypeptide of Paragraph 24, wherein said polypeptide is obtained from an organism other than E. coli.

28. A purified or isolated polypeptide comprising a polypeptide having at least 25% amino acid identity to a polypeptide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or at least 25% amino acid identity to a fragment comprising at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of a polypeptide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 as determined using FASTA version 3.0t78 with the default parameters. 29. The polypeptide of Paragraph 28, wherein said polypeptide has at least 25%> identity to a polypeptide comprising one of SEQ ID NOs: 42398-78581 or at least 25% identity to a fragment comprising at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of a polypeptide comprising one of SEQ ID NOs.: 42398- 78581 as determined using FASTA version 3.0t78 with the default parameters.

30. The polypeptide of Paragraph 28, wherein said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

31. The polypeptide of Paragraph 28, wherein said polypeptide is obtained from an organism other than E. coli. 32. An antibody capable of specifically binding the polypeptide of one of Paragraphs

28-31.

33. A method of producing a polypeptide, comprising introducing a vector comprising a promoter operably linked to a nucleic acid comprising a nucleotide sequence encoding a polypeptide whose expression is inhibited by an antisense nucleic acid comprising one of SEQ ID NOs.: 1-6213 into a cell.

34. The method of Paragraph 33, further comprising the step of isolating said polypeptide. 35. The method of Paragraph 33, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

36. The method of Paragraph 33, wherein said nucleic acid encoding said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lcrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 37. The method of Paragraph 33, wherein said nucleic acid encoding said polypeptide is obtained from an organism other than E. coli.

38. The method of Paragraph 33, wherein said promoter is operably linked to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397. 39. A method of inhibiting proliferation of a cell in an individual comprising inhibiting the activity or reducing the amount of a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product. 40. The method of Paragraph 39, wherein said method comprises inhibiting said activity or reducing said amount of a gene product in an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 41. The method of Paragraph 39, wherein said method comprises inhibiting said activity or reducing said amount of a gene product in an organism other than E. coli.

42. The method of Paragraph 39, wherein said gene product is present in an organism other than E. coli.

43. The method of Paragraph 39, wherein said gene product comprises a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

44. A method for identifying a compound which influences the activity of a gene product required for proliferation, said gene product comprising a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said metho comprising: contacting said gene product with a candidate compound; and determining whether said compound influences the activity of said gene product.

45. The method of Paragraph 44, wherein said gene product is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

46. The method of Paragraph 44, wherein said gene product is from an organism other than E. coli.

47. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is an enzymatic activity. 48. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is a carbon compound catabolism activity.

49. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is a biosynthetic activity.

50. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is a transporter activity.

51. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is a transcriptional activity.

52. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is a DNA replication activity. 53. The method of Paragraph 44, wherein said gene product is a polypeptide and said activity is a cell division activity.

54. The method of Paragraph 44, wherein said gene product is an RNA.

55. The method of Paragraph 44, wherein said gene product is a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

56. A compound identified using the method of Paragraph 44.

57. A method for identifying a compound or nucleic acid having the ability to reduce the activity or level of a gene product required for proliferation, said gene product comprising a gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising:

(a) contacting a target gene or RNA encoding said gene product with a candidate compound or nucleic acid; and

(b) measuring an activity of said target.

58. The method of Paragraph 57, wherein said target gene or RNA is from an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

59. The method of Paragraph 57, wherein said target gene or RNA is from an organism other than E. coli.

60. The method of Paragraph 57, wherein said gene product is from an organism other than E. coli.

61. The method of Paragraph 57, wherein said target is a messenger RNA molecule and said activity is translation of said messenger RNA. 62. The method of Paragraph 57, wherein said target is a messenger RNA molecule and said activity is transcription of a gene encoding said messenger RNA.

63. The method of Paragraph 57, wherein said target is a gene and said activity is transcription of said gene. 64. The method of Paragraph 57, wherein said target is a nontranslated RNA and said activity is processing or folding of said nontranslated RNA or assembly of said nontranslated RNA into a protein/RNA complex.

65. The method of Paragraph 57, wherein said target is a messenger RNA molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of

SEQ ID NOs.: 42398-78581.

66. The method of Paragraph 57, wherein said target comprises a nucleic acid selected from the group consisting of SEQ ID NOS.: 6214-42397.

67. A compound or nucleic acid identified using the method of Paragraph 57. 68. A method for identifying a compound which reduces the activity or level of a gene product required for proliferation of a cell, wherein the activity or expression of said gene product is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising the steps of:

(a) providing a sublethal level of an antisense nucleic acid comprising a nucleotide sequence complementary to a nucleic acid comprising a nucleotide sequence encoding said gene product in a cell to reduce the activity or amount of said gene product in said cell, thereby producing a sensitized cell;

(b) contacting said sensitized cell with a compound; and

(c) determining the degree to which said compound inhibits proliferation of said sensitized cell relative to a cell which does not contain said antisense nucleic acid.

69. The method of Paragraph 68, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

70. The method of Paragraph 68, wherein said cell is a Gram positive bacterium. 71. The method of Paragraph 68, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

72. The method of Paragraph 68, wherein said bacterium is Staphylococcus aureus.

73. The method of Paragraph 72, wherein said Staphylococcus species is coagulase negative.

74. The method of Paragraph 72, wherein said bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

75. The method of Paragraph 68, wherein said cell is an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacteriurn diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsidatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

76. The method of Paragraph 68, wherein said cell is not an E. coli cell.

77. The method of Paragraph 68, wherein said gene product is from an organism other than E. coli. 78. The method of Paragraph 68, wherein said antisense nucleic acid is transcribed from an inducible promoter.

79. The method of Paragraph 68, further comprising the step of contacting said cell with a concentration of inducer which induces transcription of said antisense nucleic acid to a sublethal level. 80. The method of Paragraph 68, wherein growth inhibition is measured by monitoring optical density of a culture growth solution.

81. The method of Paragraph 68, wherein said gene product is a polypeptide.

82. The method of Paragraph 81, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581. 83. The method of Paragraph 68, wherein said gene product is an RNA.

84. The method of Paragraph 68, wherein nucleic acid encoding said gene product comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

85. A compound identified using the method of Paragraph 68.

86. A method for inhibiting cellular proliferation comprising introducing an effective amount of a compound with activity against a gene whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a compound with activity against the product of said gene into a population of cells expressing said gene. 87. The method of Paragraph 86, wherein said compound is an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or a proliferation-inhibiting portion thereof.

88. The method of Paragraph 86, wherein said proliferation inhibiting portion of one of SEQ ID NOs.: 1-6213 is a fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 51 consecutive nucleotides of one of SEQ ID NOs.: 1-6213.

89. The method of Paragraph 86, wherein said population is a population of Gram positive bacteria.

90. The method of Paragraph 89, wherein said population of Gram positive bacteria is selected from the group consisting of a population of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

91. The method of Paragraph 86, wherein said population is a population of Staphylococcus aureus.

92. The method of Paragraph 91, wherein said population is a population of a bacterium selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

93. The method of Paragraph 86, wherein said population is a population of a bacterium selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 94. The method of Paragraph 86, wherein said population is a population of an organism other than E. coli.

95. The method of Paragraph 86, wherein said product of said gene is from an organism other than E. coli. 96. The method of Paragraph 86, wherein said gene encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

97. The method of Paragraph 86, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

98. A composition comprising an effective concentration of an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or a proliferation-inhibiting portion thereof in a pharmaceutically acceptable canier.

99. The composition of Paragraph 98, wherein said proliferation-inhibiting portion of one of SEQ ID NOs.: 1-6213 comprises at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs.: 1-6213. 100. A method for inhibiting the activity or expression of a gene in an operon required for proliferation wherein the activity or expression of at least one gene in said operon is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising contacting a cell in a cell population with an antisense nucleic acid complementary to at least a portion of said operon. 101. The method of Paragraph 100, wherein said antisense nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a proliferation- inhibiting portion thereof.

102. The method of Paragraph 100, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

103. The method of Paragraph 100, wherein said cell is not an E. coli cell.

104. The method of Paragraph 100, wherein said gene is from an organism other than E. coli. 105. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by introducing a plasmid which expresses said antisense nucleic acid into said cell population.

106. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by introducing a phage which encodes said antisense nucleic acid into said cell population.

107. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by expressing said antisense nucleic acid from the chromosome of cells in said cell population.

108. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by introducing a promoter adjacent to a chromosomal copy of said antisense nucleic acid such that said promoter directs the transcription of said antisense nucleic acid.

109. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by introducing a retron which expresses said antisense nucleic acid into said cell population. 110. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by introducing a ribozyme into said cell-population, wherein a binding portion of said ribozyme comprises said antisense nucleic acid.

111. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by introducing a liposome comprising said antisense nucleic acid into said cell. 112. The method of Paragraph 100, wherein said cell is contacted with said antisense nucleic acid by electroporation of said antisense nucleic acid into said cell.

113. The method of Paragraph 100, wherein said antisense nucleic acid is a fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs.: 1-6213. 114. The method of Paragraph 100 wherein said antisense nucleic acid is a synthetic oligonucleotide.

115. The method of Paragraph 100, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397. 116. A method for identifying a gene which is required for proliferation of a cell comprising:

(a) contacting a cell with an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, wherein said cell is a cell other than the organism from which said nucleic acid was obtained;

(b) determining whether said nucleic acid inhibits proliferation of said cell; and

(c) identifying the gene in said cell which encodes the mRNA which is complementary to said antisense nucleic acid or a portion thereof.

117. The method of Paragraph 116, wherein said cell is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

118. The method of Paragraph 116 wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

119. The method of Paragraph 116, wherein said cell is not E. coli. 120. The method of Paragraph 116, further comprising operably linking said antisense nucleic acid to a promoter which is functional in said cell, said promoter being included in a vector, and introducing said vector into said cell. 121. A method for identifying a compound having the ability to inhibit proliferation of a cell comprising:

(a) identifying a homolog of a gene or gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 in a test cell, wherein said test cell is not the cell from which said nucleic acid was obtained;

(b) identifying an inhibitory nucleic acid sequence which inhibits the activity of said homolog in said test cell;

(c) contacting said test cell with a sublethal level of said inhibitory nucleic acid, thus sensitizing said cell;

(d) contacting the sensitized cell of step (c) with a compound; and

(e) determining the degree to which said compound inhibits proliferation of said sensitized cell relative to a cell which does not contain said inhibitory nucleic acid.

122. The method of Paragraph 121, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

123. The method of Paragraph 121, wherein step (a) comprises identifying a nucleic acid homologous to a gene or gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 or a nucleic acid encoding a homologous polypeptide to a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 by using an algorithm selected from the group consisting of BLASTN version 2.0 with the default parameters and FASTA version 3.0t78 algorithm with the default parameters to identify said homologous nucleic acid or said nucleic acid encoding a homologous polypeptide in a database. 124. The method of Paragraph 121 wherein said step (a) comprises identifying a homologous nucleic acid or a nucleic acid comprising a sequence of nucleotides encoding a homologous polypeptide by identifying nucleic acids which hybridize to said nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 or the complement of said nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213. 125. The method of Paragraph 121 wherein step (a) comprises expressing a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 in said test cell.

126. The method of Paragraph 121, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in a test cell selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

127. The method of Paragraph 121, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in a test cell other than E. coli. . 128. The method of Paragraph 121, wherein said inhibitory nucleic acid is an antisense nucleic acid.

129. The method of Paragraph 121, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion of said homolog.

130. The method of Paragraph 121, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion ofthe operon encoding said homolog.

131. The method of Paragraph 121, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises directly contacting the surface of said cell with said inhibitory nucleic acid.

132. The method of Paragraph 121, wherein the step of contacting the cell with a sublethal level of said inhibitoiy nucleic acid comprises transcribing an antisense nucleic acid complementary to at least a portion ofthe RNA transcribed from said homolog in said cell.

133. The method of Paragraph 121, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581. 134. The method of Paragraph 121, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

135. A compound identified using the method of Paragraph 121. 136. A method of identifying a compound having the ability to inhibit proliferation comprising:

(a) contacting a test cell with a sublethal level of a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 or a portion thereof which inhibits the proliferation of the cell from which said nucleic acid was obtained, thus sensitizing said test cell;

(b) contacting the sensitized test cell of step (a) with a compound; and

(c) determining the degree to which said compound inhibits proliferation of said sensitized test cell relative to a cell which does not contain said nucleic acid. 137. The method of Paragraph 136, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

138. A compound identified using the method of Paragraph 136.

139. The method of Paragraph 136, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lcrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis,

Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

140. The method of Paragraph 136, wherein the test cell is not E. coli.

141. A method for identifying a compound having activity against a biological pathway required for proliferation comprising: (a) sensitizing a cell by providing a sublethal level of an antisense nucleic acid complementary to a nucleic acid encoding a gene product required for proliferation, wherein the activity or expression of said gene product is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, in said cell to reduce the activity or amount of said gene product;

(b) contacting the sensitized cell with a compound; and

(c) determining the degree to which said compound inhibits the growth of said sensitized cell relative to a cell which does not contain said antisense nucleic acid.

142. The method of Paragraph 141, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

143. The method of Paragraph 141, wherein said cell is selected from the group consisting of bacterial cells, fungal cells, plant cells, and animal cells.

144. The method of Paragraph 141, wherein said cell is a Gram positive bacterium. 145. The method of Paragraph 144, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

146. The method of Paragraph 145, wherein said Gram positive bacterium is Staphylococcus aureus. 147. The method of Paragraph 146, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

148. The method of Paragraph 141, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species.

149. The method of Paragraph 141, wherein said cell is not an E. coli cell.

150. The method of Paragraph 141, wherein said gene product is from an organism other than E. coli.

151. The method of Paragraph 141, wherein said antisense nucleic acid is transcribed from an inducible promoter.

152. The method of Paragraph 141, further comprising contacting the cell with an agent which induces transcription of said antisense nucleic acid from said inducible promoter, wherein said antisense nucleic acid is transcribed at a sublethal level.

153. The method of Paragraph 141, wherein inhibition of proliferation is measured by monitoring the optical density of a liquid culture.

154. The method of Paragraph 141, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

155. The method of Paragraph 141, wherein said nucleic acid encoding said gene product comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.:

6214-42397.

156. A compound identified using the method of Paragraph 141.

157. A method for identifying a compound having the ability to inhibit cellular proliferation comprising: (a) contacting a cell with an agent which reduces the activity or level of a gene product required for proliferation of said cell, wherein said gene product is a gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213; (b) contacting said cell with a compound; and (c) determining whether said compound reduces proliferation of said contacted cell by acting on said gene product.

158. The method of Paragraph 157, wherein said determining step comprises determining whether said compound reduces proliferation of said contacted cell to a greater extent than said compound reduces proliferation of cells which have not been contacted with said agent. 159. The method of Paragraph 157, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lcrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 160. The method of Paragraph 157, wherein said cell is not an E. coli cell. 161. The method of Paragraph 157, wherein said gene product is from an organism other than E. coli.

162. The method of Paragraph 157, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises an antisense nucleic acid to a gene or operon required for proliferation. 163. The method of Paragraph 157, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises a compound lαiown to inhibit growth or proliferation of a cell.

164. The method of Paragraph 157, wherein said cell contains a mutation which reduces the activity or level of said gene product required for proliferation of said cell. 165. The method of Paragraph 157, wherein said mutation is a temperature sensitive mutation.

166. The method of Paragraph 157, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581. 167. A compound identified using the method of Paragraph 157.

168. A method for identifying the biological pathway in which a proliferation-required gene or its gene product lies, wherein said gene or gene product comprises a gene or gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising:

(a) providing a sublethal level of an antisense nucleic acid which inhibits the activity of said proliferation-required gene or gene product in a test cell; (b) contacting said test cell with a compound lαiown to inhibit growth or proliferation of a cell, wherein the biological pathway on which said compound acts is known; and

(c) determining the degree to which said proliferation of said test cell is inhibited relative to a cell which was not contacted with said compound. 169. The method of Paragraph 168, wherein said determining step comprises determining whether said test cell has a substantially greater sensitivity to said compound than a cell which does not express said sublethal level of said antisense nucleic acid.

170. The method of Paragraph 168, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

171. The method of Paragraph 168, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

172. The method of Paragraph 168, wherein said test cell is not an E. coli cell. 173. The method of Paragraph 168, wherein said gene product is from an organism other than E. coli.

174. A method for determining the biological pathway on which a test compound acts comprising: (a) providing a sublethal level of an antisense nucleic acid complementary to a proliferation-required nucleic acid in a first cell, wherein the activity or expression of said proliferation-required nucleic acid is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213 and wherein the biological pathway in which said proliferation-required nucleic acid or a protein encoded by said proliferation-required nucleic acid lies is lαiown,

(b) contacting said first cell with said test compound; and

(c) determining the degree to which said test compound inhibits proliferation of said first cell relative to a cell which does not contain said antisense nucleic acid.

175. The method of Paragraph 174, wherein said determining step comprises determining whether said first cell has a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said antisense nucleic acid.

176. The method of Paragraph 174, further comprising:

(d) providing a sublethal level of a second antisense nucleic acid complementary to a second proliferation-required nucleic acid in a second cell, wherein said second proliferation-required nucleic acid is in a different biological pathway than said proliferation-required nucleic acid in step (a); and

(e) determining whether said second cell does not have a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said second antisense nucleic acid, wherein said test compound is specific for the biological pathway against which the antisense nucleic acid of step (a) acts if said first cell has a substantially greater sensitivity to said test compound than said second cell.

177. The method of Paragraph 174, wherein said first cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

178. The method of Paragraph 174, wherein said first cell is not an E. coli cell.

179. The method of Paragraph 174, wherein said proliferation-required nucleic acid is from an organism other than E. coli.

180. A purified or isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213.

181. A compound which interacts with a gene or gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of one of SEQ ID NOs.: 1-6213 to inhibit proliferation.

182. The compound of Paragraph 181, wherein said gene product is a polypeptide comprising one of SEQ ID NOs.: 42398-78581.

183. The compound of Paragraph 181, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

184. A compound which interacts with a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of one of SEQ ID NOs.: 1-6213 to inhibit proliferation.

185. A method for manufacturing an antibiotic comprising the steps of: screening one or more candidate compounds to identify a compound that reduces the activity or level of a gene product required for proliferation, said gene product comprising a gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213; and manufacturing the compound so identified.

186. The method of Paragraph 185, wherein said screening step comprises performing any one ofthe methods of Paragraphs 44, 68, 121, 136, 141, and 157.

187. The method of Paragraph 185, wherein said gene product is a polypeptide comprising one of SEQ ID NOs:42398-78581.

188. A method for inhibiting proliferation of a cell in a subject comprising administering an effective amount of a compound that reduces the activity or level of a gene product required for proliferation of said cell, said gene product comprising a gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 to said subject.

189. The method of Paragraph 188 wherein said subject is selected from the group consisting of vertebrates, mammals, avians, and human beings. 190. The method of Paragraph 188, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

191. The method of Paragraph 188, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida Iwusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 192. The method of Paragraph 188, wherein said cell is not E. coli.

193. The method of Paragraph 188, wherein said gene product is from an organism other than E. coli.

194. A purified or isolated nucleic acid consisting essentially of the coding sequence of one of SEQ ID NOs: 6214-42397. 195. A fragment of the nucleic acid of Paragraph 8, said fragment comprising at least

10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs: 6214-42397. 196. A purified or isolated nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 6214-42397, the nucleotide sequences complementary to SEQ ID NOs.:6214-42397, and the nucleotide sequences complementary to fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 6214-42397 as determined using BLASTN version 2.0 with the default parameters.

197. The nucleic acid of Paragraph 196, wherein said nucleic acid is from an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 198. The nucleic acid of Paragraph 196, wherein said nucleic acid is from an organism other than E. coli.

199. A method of inhibiting proliferation of a cell comprising inhibiting the activity or reducing the amount of a gene product in said cell or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product in said cell, wherein said gene product is selected from the group consisting of a gene product having having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213.

200. The method of Paragraph 199, wherein said method comprises inhibiting said activity or reducing said amount of said gene product or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product in an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 201. The method of Paragraph 199, wherein said method comprises inhibiting said activity or reducing said amount of said gene product or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product in an organism other than E. coli.

202. The method of Paragraph 199, wherein said gene product is from an organism other than E. coli.

203. The method of Paragraph 199, wherein said gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

204. The method of Paragraph 199, wherein said gene product is encoded by a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucloetide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

205. A method for identifying a compound which influences the activity of a gene product required for proliferation comprising: contacting a candidate compound with a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as detennined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1- 6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213; and determining whether said candidate compound influences the activity of said gene product. 206. The method of Paragraph 205, wherein said gene product is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

207. The method of Paragraph 205, wherein said gene product is from an organism other than E. coli.

208. The method of Paragraph 205, wherein said gene product is a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as detennined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

209. The method of Paragraph 205, wherein said gene product is encoded by a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least

70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397, a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

210. A compound identified using the method of Paragraph 205.

211. A method for identifying a compound or nucleic acid having the ability to reduce the activity or level of a gene product required for proliferation comprising:

(a) providing a target that is a gene or RNA, wherein said target comprises a nucleic acid that encodes a gene product selected from the group consisting of a gene product having having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleic acid identity as detennined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213;

(b) contacting said target with a candidate compound or nucleic acid; and

(c) measuring an activity of said target.

212. The method of Paragraph 211, wherein said target gene or RNA is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori,

Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei,

Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica,

Yersinia pestis and any species falling within the genera of any ofthe above species.

213. The method of Paragraph 211, wherein said target gene or RNA is from an organism other than E. coli.

214. The method of Paragraph 211, wherein said gene product is from an organism other than is. coli.

215. The method of Paragraph 211, wherein said target is a messenger RNA molecule and said activity is franslation of said messenger RNA.

216. The method of Paragraph 211, wherein said compound is a nucleic acid and said activity is translation of said gene product. 217. The method of Paragraph 211, wherein said target is a gene and said activity is transcription of said gene.

218. The method of Paragraph 211, wherein said target is a nontranslated RNA and said activity is processing or folding of said nontranslated RNA or assembly of said nontranslated RNA into a protein/RNA complex. 219. The method of Paragraph 211, wherein said target gene is a messenger RNA molecule encoding a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581. 220. The method of Paragraph 11, wherein said target gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

221. A compound or nucleic acid identified using the method of Paragraph 211. 222. A method for identifying a compound which reduces the activity or level of a gene product required for proliferation of a cell comprising:

(a) providing a sublethal level of an antisense nucleic acid complementary to a nucleic acid encoding said gene product in a cell to reduce the activity or amount of said gene product in said cell, thereby producing a sensitized cell, wherein said gene product is selected from the group consisting of a gene product having having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:l- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213; (b) contacting said sensitized cell with a compound; and

223. The method of Paragraph 222, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

224. The method of Paragraph 222, wherein said sensitized cell is a Gram positive bacterium.

225. The method of Paragraph 224, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

226. The method of Paragraph 225, wherein said bacterium is Staphylococcus aureus. 221. The method of Paragraph 224, wherein said Staphylococcus species is coagulase negative. 228. The method of Paragraph 226, wherein said bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

229. The method of Paragraph 222, wherein said sensitized cell is an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 230. The method of Paragraph 222, wherein said cell is an organism other than E. coli.

231. The method of Paragraph 222, wherein said gene product is from an organism other than E. coli.

232. The method of Paragraph 222, wherein said antisense nucleic acid is transcribed from an inducible promoter. 233. The method of Paragraph 222, further comprising the step of contacting said cell with a concentration of inducer which induces transcription of said antisense nucleic acid to a sublethal level.

234. The method of Paragraph 222, wherein growth inhibition is measured by monitoring optical density of a culture medium. 235. The method of Paragraph 222, wherein said gene product is a polypeptide.

236. The method of Paragraph 235, wherein said polypeptide comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

237. The method of Paragraph 222, wherein said gene product is an RNA.

238. The method of Paragraph 222, wherein said nucleic acid encoding said gene product comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

239. A compound identified using the method of Paragraph 222.

240. A method for inhibiting cellular proliferation comprising introducing a compound with activity against a gene product or a compound with activity against a gene encoding said gene product into a population of cells expressing said gene product, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited • by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1- 6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213.

241. The method of Paragraph 240, wherein said compound is an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or a proliferation-inhibiting portion thereof.

242. The method of Paragraph 240, wherein said proliferation inhibiting portion of one of SEQ ID NOs.: 1-6213 is a fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 51 consecutive nucleotides of one of SEQ ID NOs.: 1-6213. 243. The method of Paragraph 240, wherem said population is a population of Gram positive bacteria.

244. The method of Paragraph 243, wherein said population of Gram positive bacteria is selected from the group consisting of a population of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

245. The method of Paragraph 243, wherein said population is a population of Staphylococcus aureus.

246. The method of Paragraph 245, wherein said population is a population of a bacterium selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus GMrews RN4220.

247. The method of Paragraph 240, wherein said population is a population of a bacterium selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida h'usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

248. The method of Paragraph 240, wherein said population is a population of an organism other than E. coli. 249. The method of Paragraph 240, wherein said product of said gene is from an organism other than E. coli.

250. The method of Paragraph 240, wherein said gene product is selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398- 78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

251. The method of Paragraph 240, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

252. A preparation comprising an effective concentration of an antisense nucleic acid in a pharmaceutically acceptable canier wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid comprising a sequence having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a proliferation-inhibiting portion thereof, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions.

253. The preparation of Paragraph 252, wherein said proliferation-inhibiting portion of one of SEQ ID NOs.: 1-6213 comprises at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs.: 1-6213.

254. A method for inhibiting the activity or expression of a gene in an operon which encodes a gene product required for proliferation comprising contacting a cell in a cell population with an antisense nucleic acid comprising at least a proliferation-inhibiting portion of said operon in an antisense orientation, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70%_> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:l-6213, a gene product having at least 25%> amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213.

255. The method of Paragraph 254, wherein said antisense nucleic acid comprises a nucleotide sequence having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide seqence selected from the group consisting of SEQ ID NOs.: 1-6213, a proliferation inhibiting portion thereof, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid which comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions.

256. The method of Paragraph 254, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida h'usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

257. The method of Paragraph 254, wherein said cell is not an E. coli cell.

258. The method of Paragraph 254, wherein said gene is from an organism other than E. coli. 259. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by introducing a plasmid which transcribes said antisense nucleic acid into said cell population.

260. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by introducing a phage which transcribes said antisense nucleic acid into said cell population.

261. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by transcribing said antisense nucleic acid from the chromosome of cells in said cell population. 262. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by introducing a promoter adjacent to a chromosomal copy of said antisense nucleic acid such that said promoter directs the synthesis of said antisense nucleic acid.

263. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by introducing a retron which expresses said antisense nucleic acid into said cell population.

264. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by introducing a ribozyme into said cell-population, wherein a binding portion of said ribozyme is complementary to said antisense oligonucleotide.

265. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by introducing a liposome comprising said antisense oligonucleotide into said cell.

266. The method of Paragraph 254, wherein said cell is contacted with said antisense nucleic acid by electroporation of said antisense nucleic acid into said cell.

267. The method of Paragraph 254, wherein said antisense nucleic acid has at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs.: 1-6213.

268. The method of Paragraph 254 wherein said antisense nucleic acid is a synthetic oligonucleotide.

269. The method of Paragraph 254, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

270. A method for identifying a gene which is required for proliferation of a cell comprising: (a) contacting a cell with an antisense nucleic acid selected from the group consisting of a nucleic acid at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a proliferation-inhibiting portion thereof, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, wherein said cell is a cell other than the organism from which said nucleic acid was obtained; (b) determining whether said nucleic acid inhibits proliferation of said cell; and

271. The method of Paragraph 270, wherein said cell is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, an Bacillus species.

272. The method of Paragraph 270 wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

273. The method of Paragraph 270, wherein said cell is not E. coli. 274. The method of Paragraph 270, further comprising operably linking said antisense nucleic acid to a promoter which is functional in said cell, said promoter being included in a vector, and introducing said vector into said cell.

275. A method for identifying a compound having the ability to inhibit proliferation of a cell comprising:

(a) identifying a homolog of a gene or gene product whose activity or level is inhibited by an antisense nucleic acid in a test cell, wherein said test cell is not the microorgaism from which the antisense nucleic acid was obtained, wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1- 6213, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions;

(c) contacting said test cell with a sublethal level of said inhibitory nucleic acid, thus sensitizing said cell; (d) contacting the sensitized cell of step (c) with a compound; and

(e) determining the degree to which said compound inhibits proliferation of said sensitized cell relative to a cell which does not express said inhibitory nucleic acid.

276. The method of Paragraph 275, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

277. The method of Paragraph 275, wherein step (a) comprises identifying a homologous nucleic acid to a gene or gene product whose activity or level is inhibited by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 or a nucleic acid encoding a homologous polypeptide to a polypeptide whose activity or level is inhibited by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 by using an algorithm selected from the group consisting of BLASTN version 2.0 with the default parameters and FASTA version 3.0t78 algorithm with the default parameters to identify said homologous nucleic acid or said nucleic acid encoding a homologous polypeptide in a database.

278. The method of Paragraph 275 wherein said step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide by identifying nucleic acids comprising nucleotide sequences which hybridize to said nucleic acid having at least 70%) nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 or the complement of the nucleotide sequence of said nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213.

279. The method of Paragraph 275 wherein step (a) comprises expressing a nucleic acid having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a sequence selected from the group consisting of SEQ ID NOs. 1-6213 in said test cell. 280. The method of Paragraph 275, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in an test cell selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

281. The method of Paragraph 275, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in a test cell other than is. coli.

282. The method of Paragraph 275, wherein said inhibitory nucleic acid is an antisense nucleic acid. 283. The method of Paragraph 275, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion of said homolog.

284. The method of Paragraph 275, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion ofthe operon encoding said homolog. 285. The method of Paragraph 275, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises directly contacting said cell with said inhibitory nucleic acid.

286. The method of Paragraph 275, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises expressing an antisense nucleic acid to said homolog in said cell.

287. The method of Paragraph 275, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

288. The method of Paragraph 275, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

289. A compound identified using the method of Paragraph 275.

290. A method of identifying a compound having the ability to inhibit proliferation comprising: (a) sensitizing a test cell by contacting said test cell with a sublethal level of an antisense nucleic acid, wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 or a portion thereof which inhibits the proliferation of the cell from which said nucleic acid was obtained, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditionst; (b) contacting the sensitized test cell of step (a) with a compound; and

(c) determining the degree to which said compound inhibits proliferation of said sensitized test cell relative to a cell which does not contain said antisense nucleic acid. 291. The method of Paragraph 290, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

292. A compound identified using the method of Paragraph 290. 293. The method of Paragraph 290, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lo-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species.

294. The method of Paragraph 290, wherein the test cell is not E. coli.

295. A method for identifying a compound having activity against a biological pathway required for proliferation comprising: (a) sensitizing a cell by providing a sublethal level of an antisense nucleic acid complementary to a nucleic acid encoding a gene product required for proliferation, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:l- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213;

(b) contacting the sensitized cell with a compound; and

(c) determining the extent to which said compound inhibits the growth of said sensitized cell relative to a cell which does not contain said antisense nucleic acid. 296. The method of Paragraph 295, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

297. The method of Paragraph 295, wherein said cell is selected from the group consisting of bacterial cells, fungal cells, plant cells, and animal cells. 298. The method of Paragraph 295, wherein said cell is a Gram positive bacterium.

299. The method of Paragraph 298, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

300. The method of Paragraph 299, wherein said Gram positive bacterium is Staphylococcus aureus.

301. The method of Paragraph 298, wherein said Gram positive bacterium is selected from the group consisting oi Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

302. The method of Paragraph 295, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lo-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

303. The method of Paragraph 295, wherein said cell is not an E. coli cell.

304. The method of Paragraph 295, wherein said gene product is from an organism other than E. coli. 305. The method of Paragraph 295, wherein said antisense nucleic acid is transcribed from an inducible promoter.

306. The method of Paragraph 305, further comprising contacting the cell with an agent which induces expression of said antisense nucleic acid from said inducible promoter, wherein said antisense nucleic acid is expressed at a sublethal level. 307. The method of Paragraph 295, wherein inhibition of proliferation is measured by monitoring the optical density of a liquid culture.

308. The method of Paragraph 295, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a sequence selected from the group consisting of SEQ ID NOs.: 42398-78581. 309. The method of Paragraph 295, wherein said nucleic acid encoding said gene product comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

310. A compound identified using the method of Paragraph 295. 311. A method for identifying a compound having the ability to inhibit cellular proliferation comprising:

(a) contacting a cell with an agent which reduces the activity or level of a gene product required for proliferation of said cell, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25%_> amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213; (b) contacting said cell with a compound; and (c) determining the degree to which said compound reduces proliferation of said contacted cell relative to a cell which was not contacted with said agent. 312. The method of Paragraph 311, wherein said detennining step comprises determining whether said compound reduces proliferation of said contacted cell to a greater extent than said compound reduces proliferation of cells which have not been contacted with said agent. 313. The method of Paragraph 311, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 314. The method ofParagraph 311, wherein said cell is not an E. co/z^' cell. 315. The method of Paragraph 311, wherein said gene product is from an organism other than E. coli.

316. The method of Paragraph 311, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises an antisense nucleic acid to a gene or operon required for proliferation. 317. The method of Paragraph 311, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises a compound known to inhibit growth or proliferation of a cell.

318. The method of Paragraph 311, wherein said cell contains a mutation which reduces the activity or level of said gene product required for proliferation of said cell. 319. The method of Paragraph 311, wherein said mutation is a temperature sensitive mutation.

320. The method ofParagraph 311, wherein said gene product comprises a gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

321. A compound identified using the method of Paragraph 311.

322. A method for identifying the biological pathway in which a proliferation-required gene product or a gene encoding a proliferation-required gene product lies comprising:

(a) providing a sublethal level of an antisense nucleic acid which inhibits the activity or reduces the level of said gene encoding a proliferation-required gene product or said said proliferation-required gene product in a test cell, wherein said proliferation- required gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:l- 6213, a gene product having at least 25%> amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213;

(b) contacting said test cell with a compound lαiown to inhibit growth or proliferation of a cell, wherein the biological pathway on which said compound acts is lαiown; and (c) determining the degree to which said compound inhibits proliferation of said test cell relative to a cell which does not contain said antisense nucleic acid. 323. The method of Paragraph 322, wherein said determining step comprises determining whether said test cell has a substantially greater sensitivity to said compound than a cell which does not express said sublethal level of said antisense nucleic acid. 324. The method of Paragraph 322, wherein said gene product comprises a polypeptide having at least 25%> amino acid identity as determined using FASTA version 3.0t78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

325. The method of Paragraph 322, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia,

Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lo-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Corynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

326. The method ofParagraph 322, wherein said test cell is not an E. coli cell.

327. The method ofParagraph 322, wherein said gene product is from an organism other than E. coli.

328. A method for determining the biological pathway on which a test compound acts comprising:

(a) providing a sublethal level of an antisense nucleic acid complementary to a proliferation-required nucleic acid in a cell, thereby producing a sensitized cell, wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid having at least 70%) nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 or a proliferation-inhibiting portion thereofa nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions and wherein the biological pathway in which said proliferation-required nucleic acid or a protein encoded by said proliferation- required polypeptide lies is lαiown, (b) contacting said cell with said test compound; and

329. The method of Paragraph 328, wherein said determining step comprises detennining whether said sensitized cell has a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said antisense nucleic acid.

330. The method of Paragraph 328, further comprising :

(e) determining whether said second cell does not have a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said second antisense nucleic acid, wherein said test compound is specific for the biological pathway against which the antisense nucleic acid of step (a) acts if said sensitized cell has substantially greater sensitivity to said test compound than said second cell.

331. The method of Paragraph 328, wherein said sensitized cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans,

Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis,

Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis),

Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 332. The method ofParagraph 328, wherein said sensitized cell is not an E. coli cell.

333. The method of Paragraph 328, wherein said proliferation-required nucleic acid is from an organism other than E. coli.

334. A compound which inhibits proliferation by interacting with a gene encoding a gene product required for proliferation or with a gene product required for proliferation, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as detennined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213.

335. The compound of Paragraph 334, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

336. The compound of Paragraph 334, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

337. A method for manufacturing an antibiotic comprising the steps of: screening one or more candidate compounds to identify a compound that reduces the activity or level of a gene product required for proliferation wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID

NOs: 1-6213, a gene product having at least 25%> amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs. : 1 -6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1- 6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213 ; and manufacturing the compound so identified.

338. The method of Paragraph 337, wherein said screening step comprises performing any one of the methods of Paragraphs 205 , 211 , 222, 275 , 290, 295 , 311.

339. The method of Paragraph 337, wherein said gene product comprises a polypeptide having at least 25%) amino acid identity as determined using FASTA version 3.0t78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581. 340. A method for inhibiting proliferation of a cell in a subject comprising administering an effective amount of a compound that reduces the activity or level of a gene product required for proliferation of said cell, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213.

341. The method of Paragraph 340 wherein said subject is selected from the group consisting of vertebrates, mammals, avians, and human beings.

342. The method of Paragraph 340, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581. 343. The method of Paragraph 340, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 344. The method ofParagraph 340, wherein said cell is not E. coli. 345. The method ofParagraph 340, wherein said gene product is from an organism other thanE. coli.

346. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

347. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture.

348. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

349. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 350. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

351. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%> amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-

78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 352. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.

353. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said strains which overexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

354. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said strains which overexpress said gene products a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

355. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said culture.

356. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture. 357. The method of Paragraph 356, wherein the products of said amplification reaction are labeled with a detectable dye.

358. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said identification step comprises performing a hybridization procedure. 359. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said identification step comprises contacting a nucleic acid anay with a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.

360. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said organism is selected from the group consisting of bacteria,, fungi, and protozoa.

361. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said culture is a culture of an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

362. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said compound is obtained from a library of natural compounds. 363. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said compound is obtained from a library of synthetic compounds.

364. The method of Paragraph 346, 347, 348, 349, 350 or 351, wherein said compound is present in a crude or partially purified state.

365. The method of Paragraph 346, 347, 348, 349, 350 or 351, further comprising detennining whether said gene product in said strain which proliferated more rapidly in said culture has a counterpart in at least one other organism.

366. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of sfrains on a solid growth medium wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting said anay of strains with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

367. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed; contacting said array of sfrains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly on said solid medium.

368. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed; contacting said anay of sfrains with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

369. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1- 6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed; contacting said anay of strains with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

370. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of sfrains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting said anay of strains with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium. 371. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of sfrains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-

78581 is overexpressed; contacting said anay of strains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly on said solid medium.

372. The method of Paragraph 366, 367, 368, 369, 370 or 371, wherein at least one strain in said array does not overexpresses a gene product which is essential for proliferation of said organism. 373. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

374. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

375. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a sfrain whose proliferation is inhibited by said compound. 376. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound. 377. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a sfrain whose proliferation is inhibited by said compound. 378. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%_> amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound. 379. The method of Paragraph 373, 374, 375, 376, 377 or 378, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.

380. A method of profiling a compound's activity comprising: performing the method ofParagraph 346 on a first culture using a first compound; performing the method of Paragraph 346 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

381. A method of profiling a compound' s activity comprising: performing the method of Paragraph 347 on a first culture using a first compound; performing the method of Paragraph 347 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture. 382. A method of profiling a compound's activity comprising: performing the method ofParagraph 348 on a first culture using a first compound; performing the method of Paragraph 348 on a second culture using a second compound; and comparing the strains identified in said first culture to the sfrains identified in said second culture.

383. A method of profiling a compound' s activity comprising: performing the method ofParagraph 349 on a first culture using a first compound; performing the method of Paragraph 349 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture. 384. A method of profiling a compound' s activity comprising: performing the method ofParagraph 350 on a first culture using a first compound; performing the method of Paragraph 350 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

385. A method of profiling a compound' s activity comprising: perfonning the method ofParagraph 351 on a first culture using a first compound; performing the method of Paragraph 351 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

386. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said array overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

387. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

388. A method of profiling a first compound's activity comprising: growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each strain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium. 389. A method of profiling a first compound' s activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each strain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25%o amino acid identity as detennined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ

ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium. 390. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of strains which grow on said second solid medium. 391. A method of profiling a first compound' s activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-

78581 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium. 392. The method of any one of Paragraphs 380, 381, 382, 383, 384, 385, 386, 387, 388,

389, 390 or 391, wherein said first compound is present in a crude or partially purified state.

393. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

394. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

395. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

396. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture. 397. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

398. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-

78581 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture. 399. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein at least one sfrain in said culture does not underexpresses a gene product which is essential for proliferation of said organism.

400. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said sfrains which underexpresess said gene products comprise a nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

401. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said strains which underexpress said gene products express an antisense nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism, wherein expression of said antisense nucleic acid reduces expression of said gene product in said strain.

402. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said strain which proliferated more slowly.

403. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more slowly. ' 404. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein the products of said amplification reaction are labeled with a detectable dye.

405. The method of Paragraph 404, wherein said identification step comprises perfonning a hybridization procedure.

406. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said identification step comprises contacting a nucleic acid anay with a nucleic acid encoding said gene product in said cell which proliferated more slowly.

407. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said organism is selected from the group consisting of bacteria, fungi, protozoa.

408. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said culture is a culture of an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species. 409. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said compound is obtained from a library of natural compounds. 410. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said compound is obtained from a library of synthetic compounds.

411. The method of Paragraph 393, 394, 395, 396, 397 or 398, wherein said compound is present in a crude or partially purified state.

412. The method of Paragraph 393, 394, 395, 396, 397 or 398, further comprising detennining whether said gene product in said sfrain which proliferated more slowly in said culture has a counterpart in at least one other organism.

413. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

414. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

415. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

416. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound. 417. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound. 418. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%> amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound. 419. A method of profiling a compound's activity comprising: performing the method ofParagraph 393 on a first culture using a first compound; perfonning the method of Paragraph 393 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture. 420. A method of profiling a compound's activity comprising: performing the method ofParagraph 394 on a first culture using a first compound; performing the method of Paragraph 394 on a second culture using a second compound; and comparing the strains identified in said first culture to the sfrains identified in said second culture.

421. A method of profiling a compound' s activity comprising: performing the method ofParagraph 395 on a first culture using a first compound; perfonning the method of Paragraph 395 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

422. A method of profiling a compound's activity comprising performing the method ofParagraph 396 on a first culture using a first compound; performing the method of Paragraph 396 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture. 423. A method of profiling a compound' s activity comprising perfonning the method ofParagraph 397 on a first culture using a first compound; performing the method of Paragraph 397 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

424. A method of profiling a compound's activity comprising performing the method ofParagraph 398 on a first culture using a first compound; performing the method of Paragraph 398 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture.

425. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

426. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

427. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

428. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium. 429. A method of profiling a first compound ' s activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium. 430. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

431. The method of any one of Paragraphs 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429 or 430, wherein said first compound is present in a crude or partially purified state. 432. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

433. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ

ID NOs.: 6214-42397 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

434. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

435. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:

1-6213 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

436. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

437. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as detennined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938- 78581 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

438. A culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed.

439. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed.

440. A culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed.

441. A culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as detennined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed.

442. A culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed.

443. A culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as detennined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed.

444. The culture of Paragraph 438, 439, 440, 441, 442 or 443, wherein said sfrains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

445. The culture of Paragraph 438, 439, 440, 441, 442 or 443, wherein said sfrains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

446. The culture of Paragraph 438, 439, 440, 441, 442 or 443, wherein said culture is a culture of an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

447. A culture comprising a a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed.

448. A culture comprising a a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed.

449. A culture comprising a a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed.

450. A culture comprising a a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%_> nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed.

451. A culture comprising a a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed.

452. A culture comprising a a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed.

453. The culture of Paragraph 447, 448, 449, 450, 451 or 452, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

454. The culture of Paragraph 447, 448, 449, 450, 451 or 452, wherein said sfrains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

455. The culture of Paragraph 447, 448, 449, 450, 451 or 452, wherein said culture is a culture of an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

456. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherem said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

457. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

458. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each ofthe overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene. 459. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

460. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

461. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0f78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

462. The method of Paragraph 456, 457, 458, 459, 460 or 461, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate overexpression of said gene products.

463. The method of Paragraph 456, 457, 458, 459, 460 or 461, wherein the nucleotide sequence of each ofthe genes encoding an overexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates overexpression of said gene products.

464. The method ofParagraph 463, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a franscriptional activator, a franscriptional tenninator, a nucleotide sequence which introduces a bend in the DNA and an upsfream activating sequence. 465. The method of Paragraph 456, 457, 458, 459, 460 or 461, wherein the step of identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene comprises performing an amplification reaction and detecting a unique amplification product conesponding to said gene.

466. The method of Paragraph 462, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

467. The method of Paragraph 462, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

468. The method of Paragraph 462, wherein said promoters which replaced the native promoters in each sfrain comprise regulatable promoters.

469. The method of Paragraph 462, wherein said promoters which replaced the native promoters in each sfrain each sfrain comprise constitutive promoters.

470. The method of Paragraph 456, 457, 458, 459, 460 or 461, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa. 471. The method of Paragraph 456, 457, 458, 459, 460 or 461, wherein said culture is a culture of an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

472. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes and wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1- 6213 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

473. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes and wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene. 474. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

475. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

476. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

477. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes , wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene. 478. The method of Paragraph 472, 473, 474, 475, 476 or 477, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate underexpression of said gene products.

479. The method of Paragraph 472, 473, 474, 475, 476 or 477, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates underexpression of said gene products. 480. The method ofParagraph 479, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a franscriptional activator, a franscriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upsfream activating sequence. 481. The method of Paragraph 472, 473, 474, 475, 476 or 477, wherein the step of identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture by detecting the unique product conesponding to said gene comprises performing an amplification reaction and detecting a unique amplification product conesponding to said gene.

482. The method of Paragraph 478, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

483. The method of Paragraph 478, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

484. The method of Paragraph 478, wherein said promoters which replaced the native promoters in each sfrain comprise regulatable promoters.

485. The method of Paragraph 478, wherein said promoters which replaced the native promoters in each sfrain each sfrain comprise constitutive promoters.

486. The method of Paragraph 472, 473, 474, 475, 476 or 477, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa. 487. The method of Paragraph 472, 473, 474, 475, 476 or 477, wherein said culture is a culture of an organism selected from the group consisting oi Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

488. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths ofthe amplification products obtained in said amplification reaction.

489. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths ofthe amplification products obtained in said amplification reaction.

490. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed; perfonning an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction. 491. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1- 6213, a gene product having at least 25% amino acid identity as detennined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths ofthe amplification products obtained in said amplification reaction.

492. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.:

6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths ofthe amplification products obtained in said amplification reaction.

493. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of strains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25%> amino acid identity as detennined using FASTA version

3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed or underexpressed; perfonning an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths ofthe amplification products obtained in said amplification reaction.

494. The method of Paragraph 488, 489, 490, 491, 492 or 493, wherein one member of each primer pair for each of said genes is labeled with a detectable dye. 495. The method ofParagraph 488, 489, 490, 491, 492 or 493, wherein: said nucleic acid sample is divided into N aliquots; and said amplification reaction is perfoπned on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

496. The method of Paragraph 494, further comprising pooling the amplification products from each ofthe aliquots prior to determining the lengths ofthe amplification products.

497. The method of Paragraph 488, 489, 490, 491, 492 or 493, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter. 498. The method of Paragraph 496, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

499. The method of Paragraph 496, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.

500. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of sfrains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of sfrains comprises the same sfrains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed or underexpressed. 501. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of strains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same sfrains as said first culture or collection of strains wherein said second culture or collection of strains .has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed or underexpressed.

502. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of strains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of sfrains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of sfrains comprises the same sfrains as said first culture or collection of sfrains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a sfrain in which a gene product comprising an amino acid ₍sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed.

503. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of strains comprises the same strains as said first culture or collection of sfrains wherein said second culture or collection of strains has not been contacted with said compound; perfonning a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ

ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed or underexpressed. 504. A method for identifying the target of a compound which inhibits the proliferation anism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of sfrains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of strains comprises the same strains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed.

505. A method for identifying the target of a compound which inhibits the proliferation ganism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of sfrains has not been contacted with said compound; perfonning a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second culture or collection of strains comprise a sfrain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25 %_> amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938- 78581 is overexpressed or underexpressed. 506. The method of Paragraph 500, 501, 502, 503, 504 or 505, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

507. The method of Paragraph 500, 501, 502, 503, 504 or 505, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

508. The method of Paragraph 500, 501, 502, 503, 504 or 505, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

509. The method of Paragraph 500, 501, 502, 503, 504 or 505, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.

510. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths ofthe amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed or underexpressed.

511. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; perfonning an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths ofthe amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed or underexpressed.

512. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths ofthe amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths ofthe amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed. 513. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; perfonning an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths ofthe amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths ofthe amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 10% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

1-6213 is overexpressed or underexpressed.

514. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths ofthe amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed.

515. A method for detennining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths ofthe amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths ofthe amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938- 78581 is overexpressed or underexpressed.

516. The method of Paragraph 510, 511, 512, 513, 514 or 515, wherein one member of each primer pair for each of said genes is labeled with a detectable dye. 517. The method ofParagraph 510, 511, 512, 513, 514 or 515, wherein: said nucleic acid sample is divided into N aliquots; and said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

518. The method of Paragraph 517, further comprising pooling the amplification products from each ofthe aliquots prior to determining the lengths ofthe amplification products. 519. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of sfrains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed or underexpressed.

520. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of sfrains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

6214-42397 is overexpressed or underexpressed. 521. A method for detennining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed. 522. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; perfonning an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as detennined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-

6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed or underexpressed. 523. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed. 524. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: ^l obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-

78581 is overexpressed or underexpressed.

525. The method ofParagraph 519, 520, 521, 522, 523 or 524, wherein said primer pairs are divided into at least two sets, each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs.

526. The method ofParagraph 519, 520, 521, 522, 523 or 524, wherein: said nucleic acid sample is divided into N aliquots; and said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

527. The method of Paragraph 526, further comprising pooling the amplification products from each ofthe aliquots prior to determining the lengths ofthe amplification products. 528. The method of Paragraph 519, 520, 521, 522, 523 or 524, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

529. The method of Paragraph 528, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

530. The method of Paragraph 528, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter. Definitions By "biological pathway" is meant any discrete cell function or process that is canied out by a gene product or a subset of gene products. Biological pathways include anabolic, catabolic, enzymatic, biochemical and metabolic pathways as well as pathways involved in the production of cellular structures such as cell walls. Biological pathways that are usually required for proliferation of cells or microorganisms include, but are not limited to, cell division, DNA synthesis and replication, RNA synthesis (transcription), protein synthesis (franslation), protein processing, protein transport, fatty acid biosynthesis, electron transport chains, cell wall synthesis, cell membrane production, synthesis and maintenance, and the like. By "inhibit activity of a gene or gene product" is meant having the ability to interfere with the function of a gene or gene product in such a way as to decrease expression of the gene, in such a way as to reduce the level or activity of a product of the gene or in such a way as to inhibit the interaction of the gene or gene product with other biological molecules required for its activity.

Agents which inhibit the activity of a gene include agents that inhibit transcription of the gene, agents that inhibit processing of the transcript of the gene, agents that reduce the stability of the transcript of the gene, and agents that inhibit franslation of the mRNA transcribed from the gene.

In microorganisms, agents which inhibit the activity of a gene can act to decrease expression of the operon in which the gene resides or alter the folding or processing of operon RNA so as to reduce the level or activity of the gene product. The gene product can be a non-translated RNA such as ribosomal RNA, a franslated RNA (mRNA) or the protein product resulting from franslation of the gene mRNA. Of particular utility to the present invention are antisense RNAs that have activities against the operons or genes to which they specifically hybridze.

By "activity against a gene product" is meant having the ability to inhibit the function or to reduce the level or activity of the gene product in a cell. This includes, but is not limited to, inhibiting the enzymatic activity of the gene product or the ability of the gene product to interact with other biological molecules required for its activity, including inhibiting the gene product's assembly into a multimeric structure.

By "activity against a protein" is meant having the ability to inhibit the function or to reduce the level or activity ofthe protein in a cell. This includes, but is not limited to, inhibiting the enzymatic activity of the protein or the ability of the protein to interact with other biological molecules required for its activity, including inhibiting the protein's assembly into a multimeric structure.

By "activity against a nucleic acid" is meant having the ability to inhibit the function or to reduce the level or activity of the nucleic acid in a cell. This includes, but is not limited to, inhibiting the ability of the nucleic acid interact with other biological molecules required for its activity, including inhibiting the nucleic acid's assembly into a multimeric structure. By "activity against a gene" is meant having the ability to inhibit the function or expression ofthe gene in a cell. This includes, but is not limited to, inhibiting the ability of the gene to interact with other biological molecules required for its activity.

By "activity against an operon" is meant having the ability to inhibit the function or reduce the level of one or more products of the operon in a cell. This includes, but is not limited to, inhibiting the enzymatic activity of one or more products ofthe operon or the ability of one or more products ofthe operon to interact with other biological molecules required for its activity.

By "antibiotic" is meant an agent which inhibits the proliferation of a cell or microorganism. By "E. coli or Escherichia coli" is meant Escherichia coli or any organism previously categorized as a species of Shigella including Shigella boydii, Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella 2A.

By "homologous coding nucleic acid" is meant a nucleic acid homologous to a nucleic acid encoding a gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 or a portion thereof. In some embodiments, the homologous coding nucleic acid may have at least 97%, at least 95%, at least 90%>, at least 85%>, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42,397 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. In other embodiments the homologous coding nucleic acids may have at least 97%, at least 95%>, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOs.: 1-6213 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Identity may be measured using BLASTN version 2.0 with the default parameters or tBLASTX with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997). Alternatively a "homologuous coding nucleic acid" could be identified by membership of the gene of interest to a functional orthologue cluster. All other members of that orthologue cluster would be considered homologues. Such a library of functional orthologue clusters can be found at http://www.ncbi.nlm.nih.gov/COG. A gene can be classified into a cluster of orthologous groups or COG by using the COGNITOR program available at the above web site, or by direct BLASTP comparison of the gene of interest to the members of the COGs and analysis of these results as described by Tatusov, R.L., Galperin, M.Y., Natale, D. A. and Koonin, EN. (2000) The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Research v. 28 n. 1, pp33-36.

Homologous coding nucleic acids and the homologous polypeptides which they encode may also be identified using a "reciprocal" best-hit analysis. To facilitate the identification of homologous coding nucleic acids and homologous polypeptides, paralogous genes within each of 51 organisms are identified and clustered prior to comparison to other organisms. Briefly, the polypeptide sequence of each polypeptide encoded by each open reading frame (ORF) in a given organism is compared to the polypeptide sequence encoded by every other ORF for that organism for each of the 51 pathogenic organisms (PathoSeq Sept 2001 release) using BLASTP 2.09 algorithm without filtering. Simultaneously, the polypeptide sequence encoded by each ORF of an organism is compared to the polypeptide sequences encoded by each of the ORFs in the remaining 51 organisms. Those polypeptides within a single organism that shared a higher degree of sequence identity to one another than to polypeptide sequences obtained from any other organisms are clustered as "paralog" sequences for "reciprocal" best-hit analysis. For each reference organism, the 50 homologous coding nucleic acids (and the 50 homologous polypeptides which they encode) can be detennined by identifying the ORFs in each of the 50 comparison organisms which encode a polypeptide sharing the highest degree of amino acid sequence identity to the polypeptide encoded by the ORF from the reference organism. The accuracy of the identification of the predicted homologous coding nucleic acids (and the homologous polypeptides which they encode) is confirmed by a "reciprocal" BLAST analysis in which the polypeptide sequence of the predicted homologous polypeptide is compared against the polypeptides encoded by each of the ORFS in the reference organism using BLASTP 2.09 algorithm without filtering. Only those polypeptides that share the highest degree of amino acid sequence identity in each portion ofthe two-way comparison are retained for further analysis. The term "homologous coding nucleic acid" also includes nucleic acids comprising nucleotide sequences which encode polypeptides having at least 99%, 95%>, at least 90%), at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% maino acid identity or similarity to a polypeptide comprising the amino acid sequence of one of SEQ ID NOs: 42,398-78,581 or to a polypeptpide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence of one of SEQ ID NOs: 1-6213 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, TBLASTN with the default parameters, or tBLASTX with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997).

Additionally, homologous coding nucleic acids and the homologous polypeptides which they encode may be identified using a "reciprocal" best-hit analysis. To facilitate the identification of homologous coding nucleic acids and homologous polypeptides, paralogous genes within each of 51 organisms are identified and clustered prior to comparison to other organisms. Briefly, the polypeptide sequence of each polypeptide encoded by each open reading frame (ORF) in a given organism is compared to the polypeptide sequence encoded by every other ORF for that organism for each of the 51 pathogenic organisms (PathoSeq Sept 2001 release) using BLASTP 2.09 algorithm without filtering. Simultaneously, the polypeptide sequence encoded by each ORF of an organism is compared to the polypeptide sequences encoded by each of the ORFs in the remaining 51 organisms. Those polypeptides within a single organism that shared a higher degree of sequence identity to one another than to polypeptide sequences obtained from any other organisms are clustered as "paralog" sequences for "reciprocal" best-hit analysis.

For each reference organism, the 50 homologous coding nucleic acids (and the 50 homologous polypeptides which they encode) can be determined by identifying the ORFs in each of the 50 comparison organisms which encode a polypeptide sharing the highest degree of amino acid sequence identity to the polypeptide encoded by the ORF from the reference organism. The accuracy of the identification of the predicted homologous coding nucleic acids (and the homologous polypeptides which they encode) is confirmed by a "reciprocal" BLAST analysis in which the polypeptide sequence of the predicted homologous polypeptide is compared against the polypeptides encoded by each of the ORFS in the reference organism using BLASTP 2.09 algorithm without filtering. Only those polypeptides that share the highest degree of amino acid sequence identity in each portion ofthe two-way comparison are retained for further analysis.

The term "homologous coding nucleic acid" also includes coding nucleic acids which hybridize under stringent conditions to a nucleic acid selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOS.: 6214-42,397 and coding nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.: 6214-42,397. As used herein, "stringent conditions" means hybridization to filter-bound nucleic acid in 6xSSC at about 45°C followed by one or more washes in O.lxSSC/0.2% SDS at about 68°C. Other exemplary stringent conditions may refer, e.g., to washing in 6xSSC/0.05%> sodium pyrophosphate at 37°C, 48°C, 55°C, and 60°C as appropriate for the particular probe being used.

The term "homologous coding nucleic acid" also includes coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consisting of the sequences complementary to one of SEQ ID NOS.: 6214-42,397 and coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.: 6214-42,397. As used herein, "moderate conditions" means hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2xSSC/0.1% SDS at about 42-65°C. The tenn "homologous coding nucleic acids" also includes nucleic acids comprising nucleotide sequences which encode a gene product whose activity may be complemented by a gene encoding a gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213. In some embodiments, the homologous coding nucleic acids may encode a gene product whose activity is complemented by the gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42,397. In other embodiments, the homologous coding nucleic acids may comprise a nucleotide sequence encode a gene product whose activity is complemented by one ofthe polypeptides of SEQ ID NOs. 42,398-78,581.

The term "homologous antisense nucleic acid" includes nucleic acids comprising a nucleotide sequence having at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70%) nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 1-6213 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Homologous antisense nucleic acids may also comprising nucleotide sequences which have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the sequences complementary to one of sequences of SEQ ID NOS.: 6214-42,397 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Nucleic acid identity may be determined as described above.

The term "homologous antisense nucleic acid" also includes antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 1-6213 and antisense nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 1-6213. Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42,397 and antisense nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 6214-42,397.

The term "homologous antisense nucleic acid" also includes antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 1-6213 and antisense nucleic acids comprising nucleotide seuqences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 1-6213. Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide seuqences which hybridize under moderate conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42,397 and antisense nucleic acids which comprising nucleotide sequences hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 6214-42,397. By "homologous polypeptide" is meant a polypeptide homologous to a polypeptide whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or by a homologous antisense nucleic acid. The term "homologous polypeptide" includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213 or by a homologous antisense nucleic acid, or polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide to a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 or by a homologous antisense nucleic acid. Identity or similarity may be determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997). Additionally, homologous coding nucleic acids and the homologous polypeptides which they encode may be identified using a "reciprocal" best-hit analysis. To facilitate the identification of homologous coding nucleic acids and homologous polypeptides, paralogous genes within each of 51 organisms are identified and clustered prior to comparison to other organisms. Briefly, the polypeptide sequence of each polypeptide encoded by each open reading frame (ORF) in a given organism is compared to the polypeptide sequence encoded by every other ORF for that organism for each of the 51 pathogenic organisms (PathoSeq Sept 2001 release) using BLASTP 2.09 algorithm without filtering. Simultaneously, the polypeptide sequence encoded by each ORF of an organism is compared to the polypeptide sequences encoded by each of the ORFs in the remaining 51 organisms. Those polypeptides within a single organism that shared a higher degree of sequence identity to one another than to polypeptide sequences obtained from any other organisms are clustered as "paralog" sequences for "reciprocal" best-hit analysis. For each reference organism, the 50 homologous coding nucleic acids (and the 50 homologous polypeptides which they encode) can be determined by identifying the ORFs in each of the 50 comparison organisms which encode a polypeptide sharing the highest degree of amino acid sequence identity to the polypeptide encoded by the ORF from the reference organism. The accuracy of the identification of the predicted homologous coding nucleic acids (and the homologous polypeptides which they encode) is confinned by a "reciprocal" BLAST analysis in which the polypeptide sequence of the predicted homologous polypeptide is compared against the polypeptides encoded by each of the ORFS in the reference organism using BLASTP 2.09 algorithm without filtering. Only those polypeptides that share the highest degree of amino acid sequence identity in each portion ofthe two-way comparison are retained for further analysis.

The term homologous polypeptide also includes polypeptides having at least 99%>, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide selected from the group consisting of SEQ ID NOs: 42,398-78,581 and polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide selected from the group consisting of SEQ ID NOs: 42,398-78,581.

The invention also includes polynucleotides, preferably DNA molecules, that hybridize to one of the nucleic acids of SEQ ID NOs.: 1-6213, SEQ ID NOs.: 6214-42,397 or the complements of any of the preceding nucleic acids. Such hybridization may be under sfringent or moderate conditions as defined above or under other conditions which permit specific hybridization. The nucleic acid molecules of the invention that hybridize to these DNA sequences include oligodeoxynucleotides ("oligos") which hybridize to the target gene under highly stringent or stringent conditions. In general, for oligos between 14 and 70 nucleotides in length the melting temperature (Tm) is calculated using the formula:

Tm (°C) = 81.5 + 16.6(log[monovalent cations (molar)] + 0.41 (% G+C) - (500/N) where N is the length of the probe. If the hybridization is canied out in a solution containing formamide, the melting temperature may be calculated using the equation: Tm(°C) = 81.5 + 16.6(log[monovalent cations (molar)] + 0.41 (% G+C) - (0.61) (% formamide) - (500/N) where N is the length of the probe. In general, hybridization is canied out at about 20-25 degrees below Tm (for DNA-DNA hybrids) or about 10-15 degrees below Tm (for RNA-DNA hybrids).

Other hybridization conditions are apparent to those of skill in the art (see, for example, Ausubel, F.M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York, at pp. 6:3.1-6.3.6 and 2.10.3. The term, Salmonella, is the generic name for a large group of gram negative enteric bacteria that are closely related to Escherichia coli. The diseases caused by Salmonella are often due to contamination of foodstuffs or the water supply and affect millions of people each year. Traditional methods of Salmonella taxonomy were based on assigning a separate species name to each serologically distinguishable strain (Kauffmann, F 1966 The bacteriology of the Enter obacteriaceae. Munksgaard, Copenhagen). Serology of Salmonella is based on surface antigens (O [somatic] and H [flagellar]). Over 2,400 serotypes or serovars of Salmonella are lαiown (Popoff, et al. 2000 Res. Microbiol. 151:63-65). Therefore, each serotype was considered to be a separate species and often given names, accordingly (e.g. S. paratyphi, S. typhimurium, S. typhi, S. enteriditis, etc.).

However, by the 1970s and 1980s it was recognized that this system was not only cumbersome, but also inaccurate. Then, many Salmonella species were lumped into a single species (all serotypes and subgenera I, II, and IV and all serotypes of Arizona) with a second subspecies, S. bongorii also recognized (Crosa, et al., 1973, J. Bacteriol. 115:307-315). Though species designations are based on the highly variable surface antigens, the Salmonella are very similar otherwise with a major exception being pathogenicity determinants.

There has been some debate on the conect name for the Salmonella species. Cunently (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467), the accepted name is Salmonella enterica.

S. enterica is divided into six subspecies (I, S. enterica subsp. enterica; II, S. enterica, subsp. salamae; Ilia, S. enterica subsp. arizonάe; Illb, S. enterica subsp. diarizonae; IV, S. enterica subsp. houtenae; and VI, S. enterica subsp. indica). Within subspecies I, serotypes are used to distinguish each of the serotypes or serovars (e.g. S. enterica serotype Enteriditis, S. enterica serotype Typhimurium, S. enterica serotype Typhi, and S. enterica serotype Choleraesuis, etc.). Cunent convention is to spell this out on first usage (Salmonella enterica ser. Typhimurium) and then use an abbreviated form (Salmonella Typhimurium or S. Typhimurium). Note, the genus and species names (Salmonella enterica) are italicized but not the serotype/serovar name (Typhimurium).

Because the taxonomic committees have yet to officially approve of the actual species name, this latter system is what is employed by the CDC (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-

2467). Due to the concerns of both taxonomic priority and medical importance, some of these serotypes might ultimately receive full species designations (S.typhi would be the most notable).

Therefore, as used herein "Salmonella enterica or S. enterica " includes serovars Typhi, Typhimurium, Paratyphi, Choleraesuis, etc." However, appeals ofthe "official" name are in process and the taxonomic designations may change (S. choleraesuis is the species name that could replace S. enterica based solely on priority).

By "identifying a compound" is meant to screen one or more compounds in a collection of compounds such as a combinatorial chemical library or other library of chemical compounds or to characterize a single compound by testing the compound in a given assay and determining whether it exhibits the desired activity.

By "inducer" is meant an agent or solution which, when placed in contact with a cell or microorganism, increases transcription, or inhibitor and/or promoter clearance/fidelity, from a desired promoter.

As used herein, "nucleic acid" means DNA, RNA, or modified nucleic acids. Thus, the terminology "the nucleic acid of SEQ ID NO: X" or "the nucleic acid comprising the nucleotide sequence" includes both the DNA sequence of SEQ ID NO: X and an RNA sequence in which the thymidines in the DNA sequence have been substituted with uridines in the RNA sequence and in which the deoxyribose backbone of the DNA sequence has been substituted with a ribose backbone in the RNA sequence. Modified nucleic acids are nucleic acids having nucleotides or structures which do not occur in nature, such as nucleic acids in which the internucleotide phosphate residues with methylphosphonates, phosphorothioates, phosphoramidates, and phosphate esters. Nonphosphate internucleotide analogs such as siloxane bridges, carbonate brides, thioester bridges, as well as many others lαiown in the art may also be used in modified nucleic acids. Modified nucleic acids may also comprise, α-anomeric nucleotide units and modified nucleotides such as 1,2- dideoxy-d-ribofuranose, 1,2-dideoxy-l-phenylribofuranose, and N , Λ^-ethano-5-:methyl-cytosine are contemplated for use in the present invention. Modified nucleic acids may also be peptide nucleic acids in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically completely different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units.

As used herein, "sub-lethal" means a concentration of an agent below the concentration required to inhibit all cell growth.

Brief Description ofthe Drawings Figure 1A illustrates a method for replacing a promoter using a promoter replacement cassette comprising a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3 ' region which is homologous to sequences 3' ofthe natural promoter in the chromosome.

Figure IB illustrates a method for replacing a promoter using a promoter replacement cassette comprising a nucleic acid encoding an identifiable or selectable marker disposed between the 5 ' region which is homologous to the sequence 5 ' of the natural promoter and the promoter which is to replace the chromosomal promoter and a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker.

Figures 2A and 2B illustrate one method for identifying amplification products which are undenepresented or ovenepresented in a culture.

Figures 3A and 3B illustrate another method for identifying amplification products which are undenepresented or ovenepresented in a culture.

Figure 4 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a sfrain in the culture is not complementary to all or a portion of the gene encoding the target ofthe compound (i.e. a nonspecific strain).

Figure 5 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is complementary to all or a portion of the gene encoding the target ofthe compound, the hybridization intensity for that sfrain will be intimately conelated with the concentration ofthe compound (i.e. a specific strain). Figure 6 illustrates an oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the promoter is the promoter which drives expression of the yabB yabC ftsLftsImurE genes in an operon for use in inserting the lac operator into the promoter. Figure 7 is an IPTG dose response curve in E. coli transformed with an IPTG-inducible plasmid containing either an antisense clone to the E. coli ribosomal protein rplΨ (AS-rplW) which is required for protein synthesis and essential for cell proliferation, or an antisense clone to the elaD

(AS-elaD) gene which is not known to be involved in protein synthesis and which is also essential for proliferation.

Figure 8A is a tetracycline dose response curve in E. coli transformed with an IPTG- inducible plasmid containing antisense to rplW (AS-rplW) in the absence (0) or presence of IPTG at concentrations that result in 20% and 50% growth inhibition.

Figure 8B is a tetracycline dose response curve in E. coli transformed with an IPTG- inducible plasmid containing antisense to elaD (AS-elaD)in the absence (0) or presence of IPTG at concentrations that result in 20% and 50%> growth inhibition.

Figure 9 is a graph showing the fold increase in tetracycline sensitivity of E. coli fransfected with antisense clones to essential ribosomal proteins L23 (AS-rplW) and L7/L12 and

L10 (AS-rplLrplJ). Antisense clones to genes lαiown to not be directly involved in protein synthesis, atpB/E (AS-atpB/E ), visC (AS-visC), elaD (AS-elaD), yohH (AS-yohH), are much less sensitive to tetracycline.

Figure 10 illustrates the results of an assay in which Staphylococcus aureus cells transcribing an antisense nucleic acid complementary to the gyrB gene encoding the β subunit of gyrase were contacted with several antibiotics whose targets were lαiown. Figure 11 illustrates a microtifration plate which contains antibiotic and inducer at gradient concentrations in a matrix format in 10 times excess quantity.

Figure 12 illustrates the results of an experiment demonstrating that at appropriate concentrations of inducer, cells which overexpress the deβ gene product were able to grow at elevated concentrations ofthe antibiotic actinonin Figure 13 illustrates the results of an experiment demonstrating that at appropriate concentrations of inducer cells which overexpress the folA gene product were able to grow at elevated concentrations ofthe antibiotic frimethoprim.

Figure 14 illustrates the results of an experiment demonstrating that overexpression of the fabl gene confers resistance to triclosan, which acts on the gene product of the fabl gene, but does not confer resistance to cerulenin, frimethoprim, or actinonin, each of which act on other gene products.

Figure 15 illustrates the results of an experiment demonstrating that overexpression of the folA gene confers resistance to trimethoprim, which acts on the gene product of thefolA gene but does not confer resistance to triclosan, cemlenin, or actinonin, each of which act on other gene products.

Figure 16 illustrates the results of an experiment demonstrating that overexpression of the defB gene confened resistance to actinonin, which acts on the gene product of the deβ gene but does not confer resistance to cerulenin, frimethoprim, or triclosan, each of which act on other gene products.

Figure 17 illustrates the results of an experiment demonstrating that overexpression of the fabF gene confened resistance to cerulenin, which acts on the gene product of the fabF gene, β keto-acyl canier protein synthase but does not confer resistance to triclosan, frimethoprim, or actinonin, each of which act on other gene products.

Figure 18 illustrates the results of experiments in which a mixture of nine sfrains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or frimethoprim to inhibit the growth of sfrains which do not overexpress the targets of these antibiotics.

Detailed Description of Embodiments ofthe Invention The present invention describes a group of prokaryotic genes and gene families required for cellular proliferation. Exemplary genes and gene families from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera and Yersinia pestis are provided. A proliferation-required gene or gene family is one where, in the absence or substantial reduction of a gene transcript and/or gene product, growth or viability of the cell or microorganism is reduced or eliminated. Thus, as used herein, the terminology "proliferation-required" or "required for proliferation" encompasses instances where the absence or substantial reduction of a gene transcript and/or gene product completely eliminates cell growth as well as instances where the absence of a gene transcript and/or gene product merely reduces cell growth. These proliferation-required genes can be used as potential targets for the generation of new antimicrobial agents. To achieve that goal, the present invention also encompasses assays for analyzing proliferation-required genes and for identifying compounds which interact with the gene and/or gene products of the proliferation-required genes. In addition, the present invention contemplates the expression of genes and the purification of the proteins encoded by the nucleic acid sequences identified as required proliferation genes and reported herein. The purified proteins can be used to generate reagents and screen small molecule libraries or other candidate compound libraries for compounds that can be further developed to yield novel antimicrobial compounds.

The present invention also describes methods for identification of nucleotide sequences homologous to these genes and polypeptides described herein, including nucleic acids comprising nucleotide sequences homologous to the nucleic acids of SEQ ID NOS.: 6214-42397 and polypeptides homologous to the polypeptides of SEQ ID NOs.: 42398-78581. For example, these sequences may be used to identify homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides in microorganisms such as Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments, the homologous coding nucleic acids, homologus antisense nucleic acids, or homologous polypeptides are identified in an organism other than E. coli.

The homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides, may then be used in each of the methods described herein, including methods of identifying compounds which inhibit the proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods of inhibiting the growth of the organism containing the homologous coding nucleic acid, homologus antisense nucleic acid or homologous polypeptide, methods of identifying compounds which influence the activity or level of a gene product required for proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods for identifying compounds or nucleic acids having the ability to reduce the level or activity of a gene product required for proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods of inhibiting the activity or expression of a gene in an operon required for proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods for identifying a gene required for proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods for identifying the biological pathway in which a gene or gene product required for proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide lies, methods for identifying compounds having activity against biological pathway required for proliferation of the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods for determining the biological pathway on which a test compound acts in the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods of replacing an endogenous promoter with a regulatable promoter which controls the expression of the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods of inserting an operator within or near an endogenous promoter to provide regulatable expression of the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, methods of identifying the target on which a compound acts in the organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide, and methods of inhibiting the proliferation ofthe organism containing the homologous coding nucleic acid, homologous antisense nucleic acid or homologous polypeptide in a subject. In some embodiments of the present invention, the methods are perfonned using an organism, other than E. coli or a gene or gene product from an organism other than E. coli.

One embodiment of the present invention utilizes a novel method to identify proliferation- required sequences. Generally, a library of nucleic acid sequences from a given source are subcloned or otherwise inserted immediately downstream of an inducible promoter on an appropriate vector, such as a Staphylococcus aureuslE. coli or Pseudomonas aeruginosa/ E. coli shuttle vector, or a vector which will replicate in both Salmonella typhimurium and Klebsiella pneumoniae, or other vector or shuttle vector capable of functioning in the intended organism, thus forming an expression library. It is generally prefened that expression is directed by a regulatable promoter sequence such that expression level can be adjusted by addition of variable concentrations of an inducer molecule or of an inhibitor molecule to the medium. For example, a number of regulatable promoters useful for regulating the expression of nucleic acid sequences over a wide range of expression levels are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001. Temperature activated promoters, such as promoters regulated by temperature sensitive repressors, such as the lambda Cι_S57 repressor, are also envisioned. Although the insert nucleic acids may be derived from the chromosome ofthe cell or microorganism into which the expression vector is to be introduced, because the insert is not in its natural chromosomal location, the insert nucleic acid is an exogenous nucleic acid for the purposes of the discussion herein. The term "expression" is defined as the production of a sense or antisense RNA molecule from a gene, gene fragment, genomic fragment, chromosome, operon or portion thereof. Expression can also be used to refer to the process of peptide or polypeptide synthesis. An expression vector is defined as a vehicle by which a ribonucleic acid (RNA) sequence is transcribed from a nucleic acid sequence carried within the expression vehicle. The expression vector can also contain features that permit translation of a protein product from the transcribed RNA message expressed from the exogenous nucleic acid sequence canied by the expression vector. Accordingly, an expression vector can produce an RNA molecule as its sole product or the expression vector can produce a RNA molecule that is ultimately translated into a protein product.

Once generated, the expression library containing the exogenous nucleic acid sequences is introduced into a population of cells (such as the organism from which the exogenous nucleic acid sequences were obtained) to search for genes that are required for bacterial proliferation. Because the library molecules are foreign, in context, to the population of cells, the expression vectors and the nucleic acid segments contained therein are considered exogenous nucleic acid.

Expression of the exogenous nucleic, acid fragments in the test population of cells containing the expression library is then activated. Activation of the expression vectors consists of subjecting the cells containing the vectors to conditions that result in the expression of the exogenous nucleic acid sequences canied by the expression library. The test population of cells is then assayed to determine the effect of expressing the exogenous nucleic acid fragments on the test population of cells. Those expression vectors that negatively impact the growth of the cells upon induction of expression of the random sequences contained therein are identified, isolated, and purified for further study.

In some embodiments, vectors which comprises a regulatable fusion promoter selected from a suite of fusion promoters, wherein the promoter suite is useful for modulating both the basal and maximal levels of transcription of a nucleic acid over a wide dynamic range thus allowing the desired level of production of a franscript, can be used to express exogenous nucleic acids, including the nucleic acids of the present invention. Such promoters are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001, the disclosure of which is incorported herein by reference in its entirety.

In some other embodiments, vectors useful for the production of stabilized mRNA having an increased lifetime (including antisense RNA) in Gram negative organisms are described in U.S. Provisional Patent Application Serial Number 60/343,512, filed December 21, 2001. Briefly, the stabilized antisense RNA may comprise an antisense RNA which was identified as inhibiting proliferation as described above which has been engineered to contain at least one stem loop flanking each end of the antisense nucleic acid. In some embodiments, the at least one stem-loop structure formed at the 5' end of the stabilized antisense nucleic acid comprises a flush, double stranded 5' end. In some embodiments, one or more ofthe stem loops comprises a rho independent terminator. In additional embodiments, the stabilized antisense RNA lacks a ribosome binding site. In further embodiments, the stabilized RNA lacks sites which are cleaved by one or more RNAses, such as RNAse E or RNAse III. In some embodiments, the stabilized antisense RNA may be transcribed in a cell which the activity of at least one enzyme involved in RNA degradation has been reduced. For example, the activity of an enzyme such as RNase E, RNase II, RNase III, polynucleotide phosphorylase, and poly(A) polymerase, RNA helicase, enolase or an enzyme having similar functions may be reduced in the cell.

Alternatively, genes required for proliferation may be identified by replacing the natural promoter for the proliferation required gene with a regulatable promoter as described above. The growth of such sfrains under conditions in which the promoter is active or non-repressed is compared to the growth under conditions in which the promoter is inactive or repressed. If the sfrains fail to grow or grow at a substantially reduced rate under conditions in which the promoter is inactive or repressed but grow normally under conditions in which the promoter is active or non- repressed, then the gene which is operably linked to the regulatable promoter encodes a gene product required for proliferation. For example, proliferation-required genes and gene products identified using promoter replacement are described in U.S. Patent Application Serial Number 09/948,993.

For example, in some embodiments, the natural promoter may be replaced using techniques which employ homologous recombination to exchange a promoter present on the chromosome of the cell with the desired promoter. In such methodology, a nucleic acid comprising a promoter replacement cassette is introduced into the cell. As illusfrated in Figure 1A, the promoter replacement cassette comprises a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3 ' region which is homologous to sequences 3' of the natural promoter in the chromosome. In some embodiments, the promoter replacement cassette may also include a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter. If desired, the promoter replacement cassette may also contain a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker, as illustrated in Figure IB. As illusfrated in Figure 1A and IB, homologous recombination is allowed to occur between the chromosomal region containing the natural promoter and the promoter replacement cassette. Cells in which the promoter replacement cassette has integrated into the chromosome are identified or selected. To confirm that homologous recombination has occuned, the chromosomal structure of the cells may be verified by Southern analysis or PCR. In some embodiments, the promoter replacement cassette may be introduced into the cell as a linear nucleic acid, such a PCR product or a restriction fragment. Alternatively, the promoter replacement may be introduced into the cell on a plasmid. Figures 1A and IB illustrates the replacement of a chromosomal promoter with a desired promoter through homologous recombination.

In some embodiments, the cell into which the promoter replacement cassette is introduced may carry mutations which enhance its ability to be transformed with linear DNA or which enhance the frequency of homologous recombination. For example, if the cell is an Escherichia coli cell it may have a mutation in the gene encoding Exonuclease V of the RecBCD recombination complex. If the cell is an Escherichia coli cell it may have a mutation that activates the RecET recombinase ofthe Rac prophage and/or a mutation that enhances recombination through the RecF pathway. For example, the Escherichia coli cells may be RecB or RecC mutants carrying an sbcA or sbcB mutation. Alternatively, the Escherichia coli cells may be recD mutants. In other embodiments the Escherichia coli cells may express the λ Red recombination genes. For example, Escherichia coli cells suitable for use in techniques employing homologous recombination have been described in Datsenko, K.A. and Wanner, B.L, PNAS 97:6640-6645 (2000); Murphy, K.C, J. Bact 180: 2053- 2071 (1998); Zhang, Y, et al. Nature Genetics 20: 123-128 (1998); and Muyrers, J.P.P. et al, Genes & Development 14: 1971-1982 (2000). It will be appreciated that cells carrying mutations in similar genes may be constructed in organisms other than Escherichia coli.

In some embodiments of the present invention, a regulatable fusion promoter selected from a suite of fusion promoters, wherein the promoter suite is useful for modulating both the basal and maximal levels of transcription of a nucleic acid over a wide dynamic range thus allowing the desired level of production of a franscript, is with the promoter replacement methods described above. Such promoters are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001, the disclosure of which is incorported herein by reference in its entirety.

A variety of assays are contemplated to identify nucleic acid sequences that negatively impact growth upon expression. In one embodiment, growth in cultures expressing exogenous nucleic acid sequences and growth in cultures not expressing these sequences is compared. Growth measurements are assayed by examining the extent of growth by measuring optical densities. Alternatively, enzymatic assays can be used to measure bacterial growth rates to identify exogenous nucleic acid sequences of interest. Colony size, colony morphology, and cell morphology are additional factors used to evaluate growth of the host cells. Those cultures that fail to grow or grow at a reduced rate under expression conditions are identified as containing an expression vector encoding a nucleic acid fragment that negatively affects a proliferation-required gene.

Once exogenous nucleic acids of interest are identified, they are analyzed. The first step ofthe analysis is to acquire the nucleotide sequence ofthe nucleic acid fragment of interest. To achieve this end, the insert in those expression vectors identified as containing a nucleotide sequence of interest is sequenced, using standard techniques well lαiown in the art. The next step of the process is to determine the source ofthe nucleotide sequence. As used herein "source" means the genomic region containing the cloned fragment. Determination of the gene(s) conesponding to the nucleotide sequence is achieved by comparing the obtained sequence data with databases containing lαiown protein and nucleotide sequences from various microorganisms. Thus, initial gene identification is made on the basis of significant sequence similarity or identity to either characterized or predicted Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Salmonella typhimurium genes or their encoded proteins and/or homologues in other species.

The number of nucleotide and protein sequences available in database systems has been growing exponentially for years. For example, the complete nucleotide sequences of Caenorhabditis elegans and several bacterial genomes, including E. coli, Aeropyrum pernix, Aquifex aeolicus, Archaeoglobus fulgidus, Bacillus subtilis, Borrelia burgdorferi, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium tetani, Coiynebacterium diptheria, Deinococcus radiodurans, Haemophilus influenzae, Helicobacter pylori 26695, Helicobacter pylori J99, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Pseudomonas aeruginosa, Pyrococcus abyssi, Pyrococcus horikoshii, Rickettsia prowazekii, Synechocystis PCC6803, Ttiermotoga maritima, Treponema pallidum, Bordetella pertussis, Campylobacter jejuni, Clostridium acetobutylicum, Mycobacterium tuberculosis CSU#93, Neisseria gonorrhoeae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrobaculum aerophilum, Pyrococcus furiosus, Rhodobacter capsulatus, Salmonella typhimurium, Streptococcus mutans, Streptococcus pyogenes, Ureaplasma urealyticum and Vibrio cholera are available. This nucleotide sequence information is stored in a number of databanks, such as GenBank, the National Center for Biotechnology Information (NCBI), the Genome Sequencing Center (http://genome.wustl.edu/gsc/salmonella.shtml), and the Sanger Centre

(http://www.sanger.ac.Uk/projects/S typhi) which are publicly available for searching. A variety of computer programs are available to assist in the analysis of the sequences stored within these databases. FASTA, (W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA" Methods in Enzymology 183:63- 98), Sequence Retrieval System (SRS), (Etzold & Argos, SRS an indexing and retrieval tool for flat file data libraries. Comput. Appl. Biosci. 9:49-57, 1993) are two examples of computer programs that can be used to analyze sequences of interest. In one embodiment of the present invention, the BLAST family of computer programs, which includes BLASTN version 2.0 with the default parameters, or BLASTX version 2.0 with the default parameters, is used to analyze nucleotide sequences.

BLAST, an acronym for "Basic Local Alignment Search Tool," is a family of programs for database similarity searching. The BLAST family of programs includes: BLASTN, a nucleotide sequence database searching program, BLASTX, a protein database searching program where the input is a nucleic acid sequence; and BLASTP, a protein database searching program. BLAST programs embody a fast algorithm for sequence matching, rigorous statistical methods for judging the significance of matches, and various options for tailoring the program for special situations. Assistance in using the program can be obtained by e-mail at blast@ncbi.nlm.nih.gov. tBLASTX can be used to translate a nucleotide sequence in all three potential reading frames into an amino acid sequence.

Bacterial genes are often transcribed in polycistronic groups. These groups comprise operons, which are a collection of genes and intergenic sequences under common regulation. The genes of an operon are transcribed on the same mRNA and are often related functionally. Given the nature of the screening protocol, it is possible that the identified exogenous nucleic acid conesponds to a gene or portion thereof with or without adjacent noncoding sequences, an intragenic sequence (i.e. a sequence within a gene), an intergenic sequence (i.e. a sequence between genes), a nucleotide sequence spanning at least a portion of two or more genes, a 5' noncoding region or a 3' noncoding region located upstream or downstream from the actual nucleotide sequence that is required for bacterial proliferation. Accordingly, it is often desirable to determine which gene(s) that is encoded within the operon is individually required for proliferation.

In one embodiment of the present invention, an operon is identified and then dissected to determine which gene or genes are required for proliferation. Operons can be identified by a variety of means known to those in the art. For example, the RegulonDB DataBase described by Huerta et al. (Nucl. Acids Res. 26:55-59, 1998), which may also be found on the website http://www.cifn.unam.mx/Computational_Biology/reguIondb/, provides infonnation about operons in Escherichia coli. The Subtilist database (http://bioweb.pasteur.fr/GenoList/SubtiList), ( Moszer, I, Glaser, P. and Danchin, A. (1995) Microbiology 141: 261-268 and Moszer, I (1998) FEBS Letters 430: 28-36, may also be used to predict operons. This database lists genes from the fully sequenced, Gram positive bacteria, Bacillus subtilis, together with predicted promoters and terminator sites. This information can be used in conjunction with the Staphylococcus aureus genomic sequence data to predict operons and thus produce a list of the genes affected by the antisense nucleic acids of the present invention. The Pseudomonas aeruginosa web site (http://www.pseudomonas.com) can be used to help predict operon organization in this bacterium. The databases available from the Genome Sequencing Center

(http://genome.wustl.edu/gsc/salmonella.shtml), and the Sanger Centre

(http://www.sanger.ac.Uk/projects/S typhi) may be used to predict operons in Salmonella typhimurium. The TIGR microbial database has an incomplete version of the E. faecalis genome http://www.tigr.org/cgi-bin/BlastSearch/blast.cgi?organism=e_faecalis. One can take a nucleotide sequence and BLAST it for homologs.

A number of techniques that are well lαiown in the art can be used to dissect the operon. Analysis of RNA transcripts by Northern blot or primer extension techniques are commonly used to analyze operon transcripts. In one aspect of this embodiment, gene disruption by homologous recombination is used to individually inactivate the genes of an operon that is thought to contain a gene required for proliferation.

Several gene disruption techniques have been described for the replacement of a functional gene with a mutated, non-functional (null) allele. These techniques generally involve the use of homologous recombination. One technique using homologous recombination in Staphylococcus aureus is described in Xia et a.. 1999, Plasmid 42: 144-149. This technique uses crossover PCR to create a null allele with an in-frame deletion ofthe coding region of a target gene. The null allele is constructed in such a way that nucleotide sequences adjacent to the wild type gene are retained. These homologous sequences sunounding the deletion null allele provide targets for homologous recombination so that the wild type gene on the Staphylococcus aureus chromosome can be replaced by the constructed null allele. This method can be used with other bacteria as well, including Salmonella and Klebsiella species. Similar gene disruption methods that employ the counter selectable marker sacB (Schweizer, H. P, Klassen, T. and Hoang, T. (1996) Mol. Biol. of Pseudomonas. ASM press, 229-237, are available for Pseudomonas, Salmonella and Klebsiella species. E. faecalis genes can be disrupted by recombining in a non-replicating plasmid that contains an internal fragment to that gene (Leboeuf, C, L. Leblanc, Y. Auffray and A. Hartke. 2000. J. Bacteriol. 182:5799-5806.

The crossover PCR amplification product is subcloned into a suitable vector having a selectable marker, such as a drug resistance marker. In some embodiments the vector may have an origin of replication which is functional in E. coli or another organism distinct from the organism in which homologous recombination is to occur, allowing the plasmid to be grown in E. coli or the organism other than that in which homologous recombination is to occur, but may lack an origin of replication functional in Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis such that selection of the selectable marker requires integration of the vector into the homologous region of the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis chromosome. Usually a single crossover event is responsible for this integration event such that the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutatis, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera or Yersinia pestis chromosome now contains a tandem duplication of the target gene consisting of one wild type allele and one deletion null allele separated by vector sequence. Subsequent resolution of the duplication results in both removal of the vector sequence and either restoration of the wild type gene or replacement by the in-frame deletion. The latter outcome will not occur if the gene should prove essential. A more detailed description of this method is provided in Example 10 below. It will be appreciated that this method may be practiced with any of the nucleic acids or organisms described herein.

Recombinant DNA techniques can be used to express the entire coding sequences of the gene identified as required for proliferation, or portions thereof. The over-expressed proteins can be used as reagents for further study. The identified exogenous sequences are isolated, purified, and cloned into a suitable expression vector using methods well lαiown in the art. If desired, the nucleic acids can contain the nucleotide sequences encoding a signal peptide to facilitate secretion of the expressed protein. Expression of fragments of the bacterial genes identified as required for proliferation is also contemplated by the present invention. The fragments ofthe identified genes can encode a polypeptide comprising at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 75, or more than 75 consecutive amino acids of a gene complementary to one ofthe identified sequences ofthe present invention. The nucleic acids inserted into the expression vectors can also contain endogenous sequences upstream and downstream ofthe coding sequence.

When expressing the encoded protein of the identified nucleic acid required for bacterial proliferation or a fragment thereof, the nucleic acid to be expressed is operably linked to a promoter in an expression vector using conventional cloning technology. The expression vector can be any of the bacterial, insect, yeast, or mammalian expression systems known in the art. Commercially available vectors and expression systems are available from a variety of suppliers including Genetics Institute (Cambridge, MA), Stratagene (La Jolla, California), Promega (Madison, Wisconsin), and Invitrogen (San Diego, California). If desired, to enhance expression and facilitate proper protein folding, the codon usage and codon bias ofthe sequence can be optimized for the particular expression organism in which the expression vector is introduced, as explained by Hatfield, et al, U.S. Patent No. 5,082,767, incorporated herein by this reference. Fusion protein expression systems are also contemplated by the present invention. Following expression of the protein encoded by the identified exogenous nucleic acid, the protein may be purified. Protein purification techniques are well lαiown in the art. Proteins encoded and expressed from identified exogenous nucleic acids can be partially purified using precipitation techniques, such as precipitation with polyethylene glycol. Alternatively, epitope tagging ofthe protein can be used to allow simple one step purification ofthe protein, hi addition, chromatographic methods such as ion-exchange chromatography, gel filtration, use of hydroxyapaptite columns, immobilized reactive dyes, chromatofocusing, and use of high-performance liquid chromatography, may also be used to purify the protein. Electrophoretic methods such as one-dimensional gel electrophoresis, high- resolution two-dimensional polyacrylamide electrophoresis, isoelectric focusing, and others are contemplated as purification methods. Also, affinity chromatographic methods, comprising antibody columns, ligand presenting columns and other affinity chromatographic matrices are contemplated as purification methods in the present invention.

The purified proteins produced from the gene encoding sequences identified as required for proliferation can be used in a variety of protocols to generate useful antimicrobial reagents. In one embodiment of the present invention, antibodies are generated against the proteins expressed from the identified exogenous nucleic acids. Both monoclonal and polyclonal antibodies can be generated against the expressed proteins. Methods for generating monoclonal and polyclonal antibodies are well lαiown in the art. Also, antibody fragment preparations prepared from the produced antibodies discussed above are contemplated.

In addition, the purified protein, fragments thereof, or derivatives thereof may be administered to an individual in a pharmaceutically acceptable carrier to induce an immune response against the protein. Preferably, the immune response is a protective immune response which protects the individual. Methods for determining appropriate dosages of the protein and pharmaceutically acceptable caniers may be determined empiracally and are familiar to those skilled in the art. Another application for the purified proteins of the present invention is to screen small molecule libraries for candidate compounds active against the various target proteins of the present invention. Advances in the field of combinatorial chemistry provide methods, well lαiown in the art, to produce large numbers of candidate compounds that can have a binding, or otherwise inhibitory effect on a target protein. Accordingly, the screening of small molecule libraries for compounds with binding affinity or inhibitory activity for a target protein produced from an identified gene is contemplated by the present invention.

In some embodiments ofthe present invention, a cell sensitized by expressing an an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, an antisense nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a nucleic acid complementary to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid complementary to a nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid complementary to a nucleic acid which encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a nucleic acid complementary to a nucleic acid which encodes at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a homologous antisense nucleic acid, an antisense nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a homologous nucleic acid, a nucleic acid complementary to a homologous coding nucleic acid, a nucleic acid complementary to at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a homologous coding nucleic acid, a nucleic acid complementary to a nucleic acid which encodes a homologous polypeptide, or a nucleic acid complementary to a nucleic acid which encodes at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a homologous polypeptide, is contacted with one or more candidate compounds from a small molecule library. Candidate compounds which further inhibit the proliferation of the sensitized cell may be identified as possessing inhibitory activity for a target protein or product produced by the gene to which the antisense sequence is complementary.

A number of vectors useful in the above methods are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001.

In some embodiments of the present invention, the methods for the production of stabilized RNA, as described in U.S. Patent Application Serial Number 60/343,512, can be used for the production of a stabilized transcript, which conesponds to a nucleic acid described herein, having an increased lifetime in Gram-negative organisms. Briefly, the stabilized antisense RNA may comprise an antisense RNA which was identified as inhibiting proliferation as described above which has been engineered to contain at least one stem loop flanking each end of the antisense nucleic acid, hi some embodiments, the at least one stem-loop structure formed at the 5' end ofthe stabilized antisense nucleic acid comprises a flush, double stranded 5 ' end. In some embodiments, one or more of the stem loops comprises a rho independent terminator. In additional embodiments, the stabilized antisense RNA lacks a ribosome binding site. In further embodiments, the stabilized RNA lacks sites which are cleaved by one or more RNAses, such as RNAse E or RNAse III. In some embodiments, the stabilized antisense RNA may be transcribed in a cell which the activity of at least one enzyme involved in RNA degradation has been reduced. For example, the activity of an enzyme such as RNase E, RNase II, RNase III, polynucleotide phosphorylase, and poly(A) polymerase, RNA helicase, enolase or an enzyme having similar functions may be reduced in the cell.

The present invention further contemplates utility against a variety of other pathogenic microorganisms in addition to Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae and Yersinia pestis. For example, homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from other pathogenic microorganisms (including nucleic acids homologous to the nucleic acids of SEQ ID NOs.: 6214-42397, nucleic acids homologous to the antisense nucleic acids of SEQ ID NOs.: 1-6213, and polypeptides homologous to the polypeptides of SEQ ID NOs.: 42398-78581) may be identified using methods such as those described herein. The homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides may be used to identify compounds which inhibit the proliferation of these other pathogenic microorganisms using methods such as those described herein.

For example, the proliferation-required nucleic acids, antisense nucleic acids, and polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis described herein (including the nucleic acids of SEQ ID NOs.: 6214-42397, the antisense nucleic acids of SEQ ID NOs: 1-6213, and the polypeptides of SEQ ID NOs.: 42398- 78581) may be used to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides required for proliferation in prokaryotes and eukaryotes. For example, nucleic acids or polypeptides required for the proliferation of protists, such as Plasmodium spp.; plants; animals, such as Entamoeba spp. and Contracaecum spp; and fungi including Candida spp, (e.g., Candida albicans), Cryptococcus neoformans, and Aspergillus fumigatus may be identified. In one embodiment of the present invention, monera, specifically bacteria, including both Gram positive and Gram negative bacteria, are probed in search of novel gene sequences required for proliferation. Likewise, homologous antisense nucleic acids which may be used to inhibit growth of these organisms or to identify antibiotics may also be identified. These embodiments are particularly important given the rise of drug resistant bacteria.

The number of bacterial species that are becoming resistant to existing antibiotics is growing. A partial list of these microorganisms includes: Escherichia spp., such as E. coli, Enterococcus spp, such as E. faecalis; Pseudomonas spp, such as P. aeruginosa, Clostridium spp, such as C. botulinum, Haemophilus spp, such as H. influenzae, Enterobacter spp, such as E. cloacae, Vibrio spp, such as V. cholera; Moraxala spp, such as M. catarrhalis; Streptococcus spp, such as S. pneumoniae, Neisseria spp, such as N. gonorrhoeae; Mycoplasma spp, such as Mycoplasma pneumoniae; Salmonella typhimurium; Helicobacter pylori; Escherichia coli; and Mycobacterium tuberculosis. The genes and polypeptides identified as required for the proliferation oi Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the nucleic acids of SEQ ID NOs.: 6214- 42397, the sequences complementary to the nucleic acids of SEQ ID NOs.: 6214-42397, and the polypeptides of SEQ ID NOs.: 42398-78581) can be used to identify homologous coding nucleic acids or homologous polypeptides required for proliferation from these and other organisms using methods such as nucleic acid hybridization and computer database analysis. Likewise, the antisense nucleic acids which inhibit proliferation of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the antisense nucleic acids of SEQ ID NOs.: 1-6213 or the sequences complementary thereto) may also be used to identify antisense nucleic acids which inhibit proliferation of these and other microorganisms or cells using nucleic acid hybridization or computer database analysis.

In one embodiment ofthe present invention, the nucleic acid sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the nucleic acids of SEQ ID NOs.: 6214- 42397 and the antisense nucleic acids of SEQ ID NOs. 1-6213) are used to screen genomic libraries generated from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Yersinia pestis and other bacterial species of interest. For example, the genomic library may be from Gram positive bacteria, Gram negative bacteria or other organisms including Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative species of Staphylococcus. In some embodiments, the genomic library may be from an organism other than E. coli. Standard molecular biology techniques are used to generate genomic libraries from various cells or microorganisms. In one aspect, the libraries are generated and bound to nitrocellulose paper. The identified exogenous nucleic acid sequences of the present invention can then be used as probes to screen the libraries for homologous sequences. For example, the libraries may be screened to identify homologous coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213, nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs. 1-6213, nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a nucleic acid complementary to one of SEQ ID NOs. 1-6213, nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides ofthe sequence complementary to one of SEQ ID NOs. 1- 6213, nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 6214-42397, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 6214-42397, nucleic acids comprising nucleotide sequences which hybridize under sfringent conditions to a nucleic acid complementary to one of SEQ ID NOS.: 6214-42397, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOS.: 6214- 42397. The libraries may also be screened to identify homologous nucleic coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs. 1-6213, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOs. 1-6213, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 1-6213, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 6214-42397, nucleic acids comprising nucleic acid sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 6214-42397, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOS.: 6214-42397 and nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOS.: 6214-42397.

The homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides identified as above can then be used as targets or tools for the identification of new, antimicrobial compounds using methods such as those described herein, hi some embodiments, the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides may be used to identify compounds with activity against more than one microorganism. [Placeholder]

For example, the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%>, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 1- 6213, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. The preceding methods may also be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the nucleotide sequences of SEQ ID NOS.: 6214-42397, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. Identity may be measured using BLASTN version 2.0 with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI- BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389- 3402 (1997). For example, the homologous polynucleotides may comprise a coding sequence which is a naturally occuning allelic variant of one of the coding sequences described herein. Such allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NOs: 1-6213, SEQ ID NOS.: 6214-42397 or the nucleotide sequences complementary thereto.

Additionally, the above procedures may be used to isolate homologous coding nucleic acids which encode polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide comprising the sequence of one of SEQ ID NOs: 42398-78581 or to a polypeptpide whose expression is inhibited by a nucleic acid of one of SEQ ID NOs: 1-6213 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997).

Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides may be identified by searching a database to identify sequences having a desired level of nucleotide or amino acid sequence homology to a nucleic acid or polypeptide involved in proliferation or an antisense nucleic acid to a nucleic acid involved in microbial proliferation. A variety of such databases are available to those skilled in the art, including GenBank and GenSeq. In some embodiments, the databases are screened to identify nucleic acids with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid required for proliferation, an antisense nucleic acid which inhibits proliferation, or a portion of a nucleic acid required for proliferation or a portion of an antisense nucleic acid which inhibits proliferation. For example, homologous coding sequences may be identified by using a database to identify nucleic acids homologous to one of SEQ ID Nos. 1-6213, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, nucleic acids homologous to one of SEQ ID NOS.: 6214-42397, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 6214-42397, nucleic acids homologous to one of SEQ ID Nos. 1-6213, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof or nucleic acids homologous to the sequences complementary to any ofthe preceding nucleic acids. In other embodiments, the databases are screened to identify polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid sequence identity or similarity to a polypeptide involved in proliferation or a portion thereof. For example, the database may be screened to identify polypeptides homologous to a polypeptide comprising one of SEQ ID NOs: 42398-78581, a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID NOs: 1-6213 or homologous to fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of any of the preceding polypeptides. In some embodiments, the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from cells or microorganisms other than the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis species from which they were obtained. For example the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from microorganisms such as Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsidatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative Staphylococcus . In some embodiments, the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides are from an organism other than E. coli.

In another embodiment, gene expression anays and microanays can be employed. Gene expression anays are high density anays of DNA samples deposited at specific locations on a glass chip, nylon membrane, or the like. Such anays can be used by researchers to quantify relative gene expression under different conditions. Gene expression anays are used by researchers to help identify optimal drug targets, profile new compounds, and determine disease pathways. An example of this technology is found in U.S. Patent No. 5,807,522. It is possible to study the expression of all genes in the genome of a particular microbial organism using a single anay. For example, the anays may consist of 12 x 24 cm nylon filters containing PCR products conesponding to ORFs from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the nucleic acids of SEQ ID NOs.: 6214-42397) . 10 ngs of each PCR product are spotted every 1.5 mm on the filter. Single stranded labeled cDNAs are prepared for hybridization to the anay (no second strand synthesis or amplification step is done) and placed in contact with the filter. Thus the labeled cDNAs are of "antisense" orientation. Quantitative analysis is done by phosphorimager.

Hybridization of cDNA made from a sample of total cell mRNA to such an anay followed by detection of binding by one or more of various techniques lαiown to those in the art results in a signal at each location on the anay to which cDNA hybridized. The intensity of the hybridization signal obtained at each location in the anay thus reflects the amount of mRNA for that specific gene that was present in the sample. Comparing the results obtained for mRNA isolated from cells grown under different conditions thus allows for a comparison of the relative amount of expression of each individual gene during growth under the different conditions.

Gene expression anays may be used to analyze the total mRNA expression pattern at various time points after induction of an antisense nucleic acid complementary to a proliferation- required gene. Analysis of the expression pattern indicated by hybridization to the anay provides information on other genes whose expression is influenced by antisense expression. For example, if the antisense is complementary to a gene for ribosomal protein L7/L12 in the 50S subunit, levels of other mRNAs may be observed to increase, decrease or stay the same following expression of antisense to the L7/L12 gene. If the antisense is complementary to a different 50S subunit ribosomal protein mRNA (e.g. L25), a different mRNA expression pattern may result. Thus, the mRNA expression pattern observed following expression of an antisense nucleic acid comprising a nucleotide sequence complementary to a proliferation required gene may identify other proliferation-required nucleic acids. In addition, the mRNA expression patterns observed when the bacteria are exposed to candidate drug compounds or lαiown antibiotics may be compared to those observed with antisense nucleic acids comprising a nucleotide sequence complementary to a proliferation-required nucleic acid. If the mRNA expression pattern observed with the candidate drug compound is similar to that observed with the antisense nucleic acid, the drug compound may be a promising therapeutic candidate. Thus, the assay would be useful in assisting in the selection of promising candidate drug compounds for use in drug development.

In cases where the source of nucleic acid deposited on the anay and the source of the nucleic acid being hybridized to the anay are from two different cells or microorganisms, gene expression anays can identify homologous nucleic acids in the two cells or microorganisms. The present invention also contemplates additional methods for screening other microorganisms for proliferation-required genes. In one aspect of this embodiment, an antisense nucleic acid comprising a nucleotide sequence complementary to the proliferation-required sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis, or a portion thereof, is transcribed in an antisense orientation in such a way as to alter the level or activity of a nucleic acid required for proliferation of an autologous or heterologous cell or microorganism. For example, the antisense nucleic acid may be a homologous antisense nucleic acid such as an antisense nucleic acid homologous to the nucleotide sequence complementary to one of SEQ ID NOs.: 6214- 42397, an antisense nucleic acid comprising a nucleotide sequence homologous to one of SEQ ED Nos.: 1-6213, or an antisense nucleic acid comprising a nucleotide sequence complementary to a portion of any ofthe preceding nucleic acids. The cell or microorganism transcribing the homologous antisense nucleic acid may be used in a cell-based assay, such as those described herein, to identify candidate antibiotic compounds, h another embodiment, the conserved portions of nucleotide sequences identified as proliferation-required can be used to generate degenerate primers for use in the polymerase chain reaction (PCR). The PCR technique is well lαiown in the art. The successful production of a PCR product using degenerate primers generated from the nucleotide sequences identified herein indicates the presence of a homologous gene sequence in the species being screened. This homologous gene is then isolated, expressed, and used as a target for candidate antibiotic compounds. In another aspect of this embodiment, the homologous gene (for example a homologous coding nucleic acid) thus identified, or a portion thereof, is transcribed in an autologous cell or microorganism or in a heterologous cell or microorganism in an antisense orientation in such a way as to alter the level or activity of a homologous gene required for proliferation in the autologous or heterologous cell or microorganism. Alternatively, a homologous antisense nucleic acid may be transcribed in an autologous or heterologous cell or microorganism in such a way as to alter the level or activity of a gene product required for proliferation in the autologous or heterologous cell or microorganism. The nucleic acids homologous to the genes required for the proliferation oi Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or the sequences complementary thereto may be used to identify homologous coding nucleic acids or homologous antisense nucleic acids from cells or microorganisms other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis to inhibit the proliferation of cells or microorganisms other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis by inhibiting the activity or reducing the amount of the identified homologous coding nucleic acid or homologous polypeptide in the cell or microorganism other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or to identify compounds which inhibit the growth of cells or microorganisms other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis as described below. For example, the nucleic acids homologous to proliferation-required genes from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or the sequences complementary thereto may be used to identify compounds which inhibit the growth of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the nucleic acids homologous to proliferation-required sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including nucleic acids homologous to one of SEQ ID NOs.: 6214-42397) or the sequences complementary thereto (including nucleic acids homologous to one of SEQ ID NOs.: 1- 6213) are used to identify proliferation-required sequences in an organism other than E. coli.

In another embodiment of the present invention, antisense nucleic acids complementary to the sequences identified as required for proliferation or portions thereof (including antisense nucleic acids comprising a nucleotide sequence complementary to one of SEQ ID NOs.: 6214-42397 or portions thereof, such as the nucleic acids of SEQ ID NOs.: 1-6213) are transfened to vectors capable of function within a species other than the species from which the sequences were obtained. For example, the vector may be functional in Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida lcrusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the vector may be functional in an organism other than E. coli. As would be appreciated by one of ordinary skill in the art, vectors may contain certain elements that are species specific. These elements can include promoter sequences, operator sequences, repressor genes, origins of replication, ribosomal binding sequences, termination sequences, and others. To use the antisense nucleic acids, one of ordinary skill in the art would know to use standard molecular biology techniques to isolate vectors containing the sequences of interest from cultured bacterial cells, isolate and purify those sequences, and subclone those sequences into a vector adapted for use in the species of bacteria to be screened. Vectors for a variety of other species are lαiown in the art. For example, numerous vectors which function in E. coli are lαiown in the art. Also, Pia et al. have reported an expression vector that is functional in a number of relevant hosts including: Salmonella typhimurium, Pseudomonas putida, and Pseudomonas aeruginosa. J. Bacteriol. 172(8):4448-55 (1990). Brunschwig and Darzins (Gene (1992) 111:35-4, described a shuttle expression vector for Pseudomonas aeruginosa. Vectors useful for the production of stabilized mRNA having an increased lifetime (including antisense RNA) in Gram negative organisms are described in U.S. Provisional Patent Application Serial Number 60/343,512, filed December 21, 2001. Similarly many examples exist of expression vectors that are freely transferable among various Gram positive microorganisms. Expression vectors for Enterococcus faecalis may be engineered by incoφorating suitable promoters into a pAK80 backbone (Israelsen, H, S. M. Madsen, A. Vrang, E. B. Hansen and E. Johansen. 1995. Appl. Environ. Microbiol. 61:2540-2547. A number of vectors useful for nucleic acid expression (including antisense nucleic acid expression) in Enterococcus faecalis, Staphylococcus areus as well as other Gram positive organisms are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001. Following the subcloning of the antisense nucleic acids complementary to proliferation- required sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or portions thereof into a vector functional in a second cell or microorganism of interest (i.e. a cell or microorganism other than the one from which the identified nucleic acids were obtained), the antisense nucleic acids are conditionally transcribed to test for bacterial growth inhibition. The nucleotide sequences of the nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis that, when transcribed, inhibit growth of the second cell or microorganism are compared to the lαiown genomic sequence of the second cell or microorganism to identify the homologous gene from the second organism. If the homologous sequence from the second cell or microorganism is not lαiown, it may be identified and isolated by hybridization to the proliferation-required Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis sequence of interest or by amplification using PCR primers based on the proliferation-required nucleotide sequence of interest as described above. In this way, sequences which may be required for the proliferation of the second cell or microorganism may be identified. For example, the second microorganism may be Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsidatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments ofthe present invention, the second microorganism is an organism other than E. coli.

The homologous nucleic acid sequences from the second cell or microorganism which are identified as described above may then be operably linked to a promoter, such as an inducible promoter, in an antisense orientation and introduced into the second cell or microorganism. The techniques described herein for identifying Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis genes required for proliferation may thus be employed to determine whether the identified nucleotide sequences from a second cell or microorganism inhibit the proliferation of the second cell or microorganism. For example, the second microorganism may be Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Ciyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the second microorganism may be an organism other than E. coli. Antisense nucleic acids required for the proliferation of microorganisms other than

Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Coiynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or the genes conesponding thereto, may also be hybridized to a microanay containing the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the nucleic acids of SEQ ID NOs.: 6214- 42397) to gauge the homology between the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis sequences and the proliferation-required nucleic acids from other cells or microorganisms. For example, the proliferation-required nucleic acid may be from Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the proliferation-required nucleotide sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous nucleic acids are used to identify proliferation-required sequences in an organism other than E. coli. In some embodiments ofthe present invention, the proliferation-required sequences may be from an organism other than E. coli. The proliferation-required nucleic acids from a cell or microorganism other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis may be hybridized to the anay under a variety of conditions which permit hybridization to occur when the probe has different levels of homology to the nucleotide sequence on the microanay. This would provide an indication of homology across the cells or microorganisms as well as clues to other possible essential genes in these cells or microorganisms.

In some embodiments ofthe present invention, the essential gene products described herein are used in methods of identifying a target on which a compound that inhibits cellular proliferation acts. Such methods are described in the U.S. Patent Application entitled METHODS FOR IDENTIFYING THE TARGET OF A COMPOUND WHICH INHIBITS CELLULAR PROLIFERATION, filed February 8, 2002. As employed herein, some embodiments of methods used to identify a target on which a compound that inhibits cellular proliferation acts utilize collections or cultures of sfrains comprising sfrains which either overexpress a different gene product which is required for cellular proliferation (such as the gene products described herein) or underexpress a different gene product (such as the gene products described herein) which is required for cellular proliferation (i.e. at least some of the sfrains in the culture overexpress or underexpress a gene product required for cellular proliferation). In some embodiments, the present invention uses collections or cultures of strains comprising both sfrains which overexpress gene products required for cellular proliferation and sfrains which underexpress the same gene products required for cellular proliferation. Preferably, each of the strains present in the culture or collection either overexpresses or underexpresses a different gene product which is required for cellular proliferation (i.e. all of the strains in the culture overexpress or underexpress a gene product required for cellular proliferation). However, in some embodiments, the culture or collection may include one or more sfrains which do not overexpress or underexpress a gene product which is required for proliferation. The gene product which is overexpressed or underexpressed in each sfrain may be any gene product which is required for cellular prolifereation, including a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214- 42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide.

As used herein the term "culture" refers to a plurality of strains growing in a single aliquot of a liquid growth medium and the term "collection" refers to a plurality of strains each of which is growing in a separate aliquot of liquid growth medium or a different location on a solid growth medium.

In some embodiments, if desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product described herein which is required for cellular proliferation. In this embodiment, the gene products which are overexpressed or underexpressed in one or more of the sfrains may be functionally related or functionally unrelated. This may facilitate the identification of compounds when two or more gene products share similar functions in the cell or where the cell has multiple biochemical pathways which lead to a particular end product.

Alternatively, if the gene product described herein to be overexpressed or underexpressed is encoded by a gene which is part of an operon containing a plurality of genes, the desired gene may be overexpressed or underexpressed while the remaining genes in the operon are expressed at levels where they do not impact the ability of the cell to grow in the presence of a particular compound. For example, the desired gene may be placed under the control of a regulatable promoter, a franscriptional terminator may be placed 3' of the desired gene and a promoter, preferably a constitutive promoter, may be placed 3' of the franscriptional terminator and 5' of the remaining genes in the operon.

In some embodiments, the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213. In some embodiments, the culture or collection of strains may comprise sfrains which in aggregate overexpress or underexpress at least two gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, at least 10 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, at least 20 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, at least 30 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, at least 50 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, at least 100 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, at least 300 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213 or more than 300 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 1-6213, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting ot SEQ ID NOs. 1-6213. Alternatively, if desired, one or more of the sfrains in the culture or collection of sfrains may overexpress or underexpress more than one gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213. In other embodiments, the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, at least 10 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, at least 20 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, at least 30 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, at least 50 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214- 42397, at least 100 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, at least 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, wherein each strain in the culture or collection of sfrains overexpresses or underexpresses a single gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 6214-42397. Alternatively, if desired, one or more strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 6214-42397.

In some embodiments the culture or collection of strains comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, at least 10 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, at least 20 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, at least 30 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, at least 50 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, at least 100 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, at least 300 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 or more than 300 gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product selected from the group consisting of SEQ ID NOs. 42938-78581. Alternatively, if desired one or more of the sfrains in the culture or collection of sfrains may overexpress or underexpress more than one gene product selected from the group consisting of SEQ ID NOs. 42938-78581.

In other embodiments, the culture or collection of strains comprises a sfrain in which at least one of the gene products encoded by a homologous coding nucleic acid as defined above is overexpressed or underexpressed. In some embodiments, the culture or collection of strains may comprise sfrains which in aggregate overexpress or underexpress at least 2, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300 or more than 300 gene products encoded by a homologous coding nucleic acid as defined above. If desired the culture or collection of sframs may comprise one or more sfrains which overexpress or underexpress more than one gene product encoded by a homologous coding nucleic acid. In further embodiments, the culture or collection of strains comprises a strain in which at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300 or more than 300 homologous polypeptides as defined above is overexpressed or underexpressed. If desired the culture or collection of sfrains may comprise one or more sfrains which overexpress or underexpress more than one homologous polypeptide. For example, in some embodiments, the culture or collection of sfrains comprises a sfrain in which at least one gene product selected from the group consisting of a gene product having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25%o amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed or underexpressed, wherein each sfrain overexpresses or underexpresses one gene product. In some embodiments, the culture or collection of sfrains may comprise sfrains in which in aggregate at least 2, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products selected from the group consisting of a gene product having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under sfringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product.

If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under sfringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213. In further embodiments, the culture or collection of sfrains comprises a strain in whicn aτ least one gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under sfringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product. In some embodiments, the culture or collection of strains comprises a sfrain or a group of strains in which in aggregate at least 2, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed, wherein each sfrain overexpresses or underexpresses one gene product.

If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under sfringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions.

In additional embodiments, the culture or collection of sfrains comprises a sfrain in which at least one gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ED NOs: 42938-78581 is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product. In some embodiments, the culture or collection of sfrains comprises a sfrain or a group of strains in which in aggregate at least 2, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products compnsmg a polypeptide selected from the group consisting of a polypeptide having at least 25%> amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed or underexpressed, wherein each sfrain overexpresses or underexpresses one gene product.

If desired, one or more of the sfrains in the culture or collection of strains may overexpress or underexpress more than one polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581.

The methods of the present invention may be used to identify the targets of compounds which inhibit the proliferation of any desired cell or organism. In some embodiments, these methods are employed to identify the targets of compounds which inhibit the proliferation of bacteria, fungi, or protozoans. In further embodiments, these methods are employed to identify the targets of compounds which inhibit the growth of an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boirelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any ofthe above species. Overexpression may be obtained using a variety of techniques familiar to those skilled in the art. For example, overexpression may be obtained by operably linking a gene encoding a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214- 42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, or a gene product comprising a homologous polypeptide to a promoter which transcribes a higher level of mRNA encoding or comprising the gene product than does a wild type cell.

A variety of promoters may be used to overexpress the gene product described herein, including a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide. The promoters used to overexpress the gene product may be relatively strong promoters, promoters which possess a moderate level of activity, or relatively weak promoters and may be either constitutive or regulatable promoters. In some embodiments, several strains, each of which overexpresses the gene product to a different extent, may be used in order to optimize the degree of overexpression ofthe gene product.

In some embodiments, each of the gene products required for proliferation may be placed under the confrol of several different promoters of varying strengths to create several different strains which express the gene product at varying levels. The level of expression of the gene product in each of the sfrains is compared to that in wild type cells in order to identify a promoter which provides a desired level of expression relative to wild type cells (i.e. a desired level of overexpression or underexpression). The strain having the desired level of expression is then included in a culture or collection of strains to be contacted with a test compound as discussed below. Examples of suites of regulatable promoters having varying strengths that are useful for the expression of gene products at varying levels are described in U.S. Patent Application Serial Number 10/032,393, filed on December 21, 2002.

The promoter is selected to be active in the type of cell in which the gene product is to be expressed. For example, for overexpression of the gene product in mammalian cells, the gene encoding the gene product may be operably lmked to promoters such as the SV40 promoter, the metallothionine promoter, the MMTV promoter, the RSV promoter, the tetP promoter, the adenovirus major late promoter or other promoters lαiown to those skilled in the art. In yeast, the gene encoding the gene product may be operably linked to promoters such as the CYC1, ADHI, ADHII, GAL1, GAL10, PH05, PGK or other promoters used in the art. Similarly, in bactena, the gene encoding the gene product may be operably linked to the , SP6, T3, frc promoter, lac promoter, temperature regulated lambda promoters, the Bacillus aprE and nprE promoters (U.S. Patent No. 5,387,521), the bacteriophage lambda P and P_R promoters (Renaut, et al, (1981) Gene 15: 81) the trp promoter (Russell, et al, (1982) Gene 20: 23), the tac promoter (de Boer et al,

(1983) Proc. Natl. Acad. Sci. USA 80: 21), B. subtilis alkaline protease promoter (Stahl et al,

(1984) J. Bacteriol. 158, 411-418) alpha amylase promoter of B. subtilis (Yang et al, (1983) Nucleic Acids Res. 11, 237-249) or B. amyloliquefaciens (Tarkinen, et al, (1983) J. Biol. Chem. 258, 1007-1013), the neutral protease promoter from B. subtilis (Yang et al, (1984) J. Bacteriol. 160, 15-21), T7 RNA polymerase promoter (Studier and Moffatt (1986) J Mol Biol. 189(1):113- 30), B. subtilis xyl promoter or mutant tetR promoter active in bacilli (Geissendorfer & Hillen (1990) Appl. Microbiol. Biotechnol. 33:657-663), Staphylococcal enterotoxin D promoter (Zhang and Stewart (2000) J. Bacteriol. 182(8):2321-5), cap8 operon promoter from Staphylococcus aureus (Ouyang et al, (1999) J. Bacteriol. 181(8):2492-500), the lactococcal nisA promoter (Eichenbaum (1998) Appl Environ Microbiol. 64(8):2763-9), promoters from in Acholeplasma laidlawii (Jarhede et al, (1995) Microbiology 141 ( Pt 9):2071-9), porA promoter oi Neisseria meningitidis (Sawaya et al, (1999) Gene 233:49-57), the fbpA promoter of Neisseria gonorrhoeae (Forng et al, (1997) J. Bacteriol. 179:3047-3052), Coiynebacterium diphtheriae toxin gene promoter (Schmitt and Holmes (1994) J. Bacteriol. 176(4): 1141-9), the hasA operon promoter from Group A Streptococci (Alberti et al, (1998) Mol Microbiol 28(2):343-53), the rpoS promoter oi Pseudomonas putida (Kojic and Venturi (2001) J. Bacteriol. 183:3712-3720), the Acinetobacter baumannii phosphate regulated ppk gene promoter (Gavigan et al. Microbiology 145:2931-7 (1999)); the Acinetobacter baumannii adhCl promoter which is induced under iron limitation and repressed when the cells are cultured in the presence of free inorganic iron (Echenique et al. Microbiology 147:2805-15 (2001)); the fiaB promoter of pGK12 active in Borrelia burgdorferi (Sartakova et al, Proc Natl Acad Sci U S A. 97(9):4850-5 (2000)); the use of Ptrc promoter results in strong inducer-dependent expression in Burkholderia spp (Santos et al, FEMS Microbiol Lett 195(l):91-6 (2001)); the iron regulated sodA promoter oi Bordetella pertussis (Graeff-Wohlleben et al, J Bacteriol 179(7):2194-201 (1997)); UV-inducible ben and uviAB promoters in Clostrdia spp (Gamier and Cole Mol Microbiol 2(5):607-14 (1988)); the heat-inducible clpB promoter of Campylobacter jejuni (Thies et al. Gene 230(l):61-7 (1999)); promoters carrying bacteriophage Cl operator sites in Klebsiella pneumoniae (Schoefield et al, J Bacteriol 183(23):6947-50 (2001)); the Proteus mirabilis ureR promoter (Poore et al, J Bacteriol 183(15):4526-35 (2001)); and the heat-inducible groESL promoter in Listeria monocytogenes, and the IPTG inducible promoter in pLEX5BA (Krause et al, J. Mol. Biol. 274: 365 (1997). In another embodiment, which may be useful in Staphylococcus aureus, the promoter is a novel inducible promoter system, XylT5, comprising a modified T5 promoter fused to the xylO operator from the xylA promoter of Staphylococcus aureus. This promoter is described in U.S. Patent Application Serial Number 10/032,393. In another embodiment the promoter may be a two- component inducible promoter system in which the T7 RNA polymerase gene is integrated on me chromosome and is regulated by lac\JV5l lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41, and a T7 gene 10 promoter, which is transcribed by T7 RNA polymerase, is fused with a lacO operator. In another embodiment the promoter may be the promoters from the plasmids pEPEF3 or pEPEFH, which harbor xylose inducible promoters functional in E. faecalis, described in U.S. Patent Application Serial No. 10/032,393. Other promoters which may be used are familiar to those skilled in the art. In fungi, the gene encoding the gene product may be operably linked to the CaACTl promoter (Morschhauser, Mol. Gen. Genet. 257: 412-420 (1998), or other promoters familiar to those skilled in the art. It will appreciated that other combinations of organisms and promoters may also be used in the present invention.

In some embodiments, overexpression may be achieved by using homologous recombination to replace the natural promoter which drives expression ofthe proliferation-required genes described herein with a regulatable promoter. For example, the methods described in U.S. Patent Application 09/948,993 may be used to place the gene required for proliferation under the control of a regulatable promoter. Examples of gene products, which are encoded by genes that can be overexpressed by regulatable promoters introduced by such promoter replacement methods include a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide.

Briefly, in some embodiments of these methods in which natural promoters are replaced by regulatable promoters, the cells may be haploid, such as bacterial cells. Regulatable promoters that are useful for promoter replacement in bacterial cells include, but are not limited to, the promoters described in U.S. Patent Application Serial Number 10/032,393 filed December 21, 2001. A linear promoter replacement cassette comprising a regulatable promoter flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell. In some embodiments, the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified. The cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number 09/948,993. Upon homologous recombination, the natural promoter is replaced with the regulatable promoter, leaving the gene required for proliferation under the control of the regulatable promoter. Sfrains in which the gene required for proliferation is under control of the regulatable promoter are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell. For example, the strains may be grown in the presence of an inducer which induces expression from the regulatable promoter, or under conditions in which the action of a repressor on the regulatable promoter is reduced or eliminated.

Alternatively, rather than replacing the native promoters of each of the genes encoding a proliferation-required gene product described herein with a single desired replacement promoter, a plurality of replacement promoters which provide desired expression levels for the gene products to be overexpressed or underexpressed are used. The method is perfonned as described above except that rather than using a single labeled primer complementary to a nucleotide sequence within the single replacement promoter, a plurality of labeled primers complementary to suitable nucleotide sequences in the plurality of replacement promoters are used. Alternatively, in embodiments in which the level or activity of proliferation-required gene products described herein is reduced by transcribing an antisense nucleic acid complementary to at least a portion of the genes encoding such gene products, the strains may be designed such that the length of the nucleotide sequence encoding the antisense nucleic acid is different for each gene. Amplification reactions are performed as described above using primers at each end of the gene encoding the antisense nucleic acid such that the amplification product conesponding to each gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length. Alternatively, the lengths of the nucleotide sequences encoding the antisense nucleic acids may not be unique for each gene, but the primers used in the amplification reaction may be selected such that the length of the amplification product conesponding to each gene is unique.

In another embodiment, the native promoters may be replaced with promoters which include therein or adjacent thereto a unique nucleotide sequence which is distinct from that present in the other replacement promoters in the sfrains in the culture or collection of strains. In this embodiment, each promoter includes or has adjacent thereto a unique "tag" which may be used to identify sfrains which proliferate more rapidly or more slowly in the culture or collection of sfrains. The tag may be detected using hybridization based methods or amplification based methods, including the amplification method which generates amplification products having a unique size for each proliferation required gene described above.

Alternatively, the native promoter which directs the transcription of the proliferation- required genes described herein may rendered regulatable by inserting a regulatory element into the chromosome of the cell via homologous recombination such that the regulatory element regulates the level of transcription from the promoter. Examples of gene products, which are encoded by genes that have promoters which can be rendered regulatable by regulatory elements inserted by such methods include a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide.

A variety of regulatory elements may be used to regulate the expression of essential gene products described herein. The regulatory element may be an operator which is recognized by a repressor (e.g. lac, tet, araBAD repressors) or a nucleotide sequence which is recognized by a transcriptional activator. In some embodiments, the regulatory element may be a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA or an upsfream activating sequence. A linear regulatory element insertion cassette comprising a regulatory element flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell. In some embodiments, the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified. The cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number 09/948,993. Upon homologous recombination, the regulatory element is inserted into the chromosome, leaving the gene required for proliferation under the confrol of the regulatory element. Strains in which the gene required for proliferation is under confrol of the regulatory element are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell. For example, the strains may be grown in the presence of an inducer which induces expression from the promoter, or under conditions in which the action of a repressor on the promoter is reduced or eliminated. It will be appreciated that the amplification method which generates amplification products having a unique size for each proliferation required gene may be used to detect sfrains which are ovenepresented or undenepresented in the culture or collection of strains. For example, if desired, primers complementary to a nucleotide sequence within the regulatory element may be used in the amplification reaction. The promoter replacement cassette or regulatory element insertion cassette may be a double stranded nucleic acid, such as an amplicon generated through PCR or other amplification methods, or a single stranded nucleic acid, such as an oligonucleotide. For example, single stranded nucleic acids may be introduced into the chromosome using the methods described in Ellis et al, PNAS 98: 6742-6746, 2001. In some embodiments, the cell into which the promoter replacement cassette or regulatory element insertion cassette is introduced has an enhanced frequency of recombination. For example, the cells may lack or have a reduced level or activity of one or more exonucleases which would ordinarily degrade the DNA to be inserted into the chromosome. In further embodiments, the cells may both lack or have reduced levels of exonucleases and express or overexpress proteins involved in mediating homologous recombination. For example, if the methods are performed in Escherichia coli or other enteric prokaryotes, cells in which the activity of exonuclease V of the RecBCD recombination pathway, which degrades linear nucleic acids, has been reduced or eliminated, such as recB, recC, or recD mutants may be used. In some embodiments, the cells have mutations in more than one of the recB, recC, and recD genes which enhance the frequency of homologous recombination. For example the cells may have mutations in both the recB and recC genes.

The promoter replacement or regulatory element insertion methods may also be performed in Escherichia coli cells in which the activity of the RecET recombinase system of the Rac prophage has been activated, such as cells which carry an sbcA mutation. The RecE gene ofthe rac prophage encodes ExoVHI a 5 '-3' exonuclease, while the RecT gene ofthe Rac prophage encodes a single stranded DNA binding protein which facilitates renaturation and D-loop formation. Thus, the gene products of the RecE and RecT genes or proteins with analogous functions facilitate homologous recombination. The RecE and RecT genes lie in the same operon but are normally not expressed. However, sbcA mutants activate the expression the RecE and RecT genes. In some embodiments, the methods may be perfonned in cells which cany mutations in the recB and recC genes as well as the sbcA mutation. The RecE and RecT gene may be constitutively or conditionally expressed. For example, the methods may be performed in E. coli strain JC8679, which canies the sbcA23, recB21 and recC22 mutations.

In some embodiments, the methods may be perfonned in Escherichia coli cells in which recombination via the RecF pathway has been enhanced, such as cells which carry an sbcB mutation.

It will be appreciated that the RecE and RecT gene products, or proteins with analogous functions may be conditionally or constitutively expressed in prokaryotic organisms other than E. coli. In some embodiments, these proteins may be conditionally or constitutively expressed in Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei,

111 Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. For example, plasmids encoding these gene products may be introduced into the organism. If desired, the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the organism in which they are to be expressed. Similarly, in some embodiments, the organism may contain mutations analogous to the recB, recC, recD, sbcA or sbcB mutations which enhance the frequency of homologous recombination. In further embodiments, the promoter replacement or regulatory element insertion methods may be conducted in cells which utilize the Red system of bacteriophage lambda (λ) or analogous systems from other phages to enhance the frequency of homologous recombination. The Red system contains three genes, (γ, β and exo whose products are the Gam, Bet and Exo proteins (see Ellis et al. PNAS 98:6742-6746, 2001. The Gam protein inhibits the RecBCD exonuclease V, thus pennitting Beta and Exo to gain access to the ends of the DNA to be integrated and facilitating homologous recombination. The Beta protein is a single stranded DNA binding protein that promotes the annealing of a single stranded nucleic acid to a complementary single stranded nucleic acid and mediates strand exchange. The Exo protein is a double-stranded DNA dependent 5 '-3' exonuclease that leaves 3' overhangs that can act as substrates for recombination. Thus, constitutive or conditional expression of the λ Red proteins or proteins having analogous functions facilitates homologous recombination.

It will be appreciated that the λ Beta, Gam and Exo proteins, or proteins with analagous functions may be expressed constitutively or conditionally in prokaryotic organisms other than E. coli. In some embodiments, these proteins may be conditionally or constitutively expressed in Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma eapsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris,

112 Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bύngon, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. For example, plasmids encoding these gene products may be introduced into the organism. If desired, the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the organism in which they are to be expressed.

In some embodiments, the cells may have an increased frequency of homologous recombination as a result of more than one of the aforementioned characteristics. In some embodiments, the enhanced frequency of recombination may be a conditional characteristic of the cells which depends on the culture conditions in which the cells are grown. For example, in some embodiments, expression of the λ Red Gam, Exo, and Beta proteins or recE and recT proteins may be regulated. Thus, the cells may have an increased frequency of homologous recombination as a result of any combination of the aforementioned characteristics. For example, in some embodiments, the cell may carry the sbcA and recBC mutations.

In some embodiments, a linear double stranded DNA to be inserted into the chromosome of the organism is introduced into an organism constitutively or conditionally expressing the recE and recT or the λ Beta, Gam and Exo proteins or proteins with analogous functions as described above. In some embodiments, the organism may be Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolytic s, Streptϋ^' c^' όTcUs pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments, the double stranded DNA may be introduced into an organism having the recBC and sbcA mutations or analogous mutations.

In other embodiments, a single stranded DNA to be inserted into the chromosome of the organism is introduced into an organism expressing the λ Beta protein or a protein with an analogous function. In some embodiments the single stranded DNA is introduced into an organism expressing both the λ Beta and Gam proteins or proteins with analogous functions. In further embodiments, the single stranded DNA is introduced into an organism expressing the λ Beta, Gam and Exo proteins or proteins with analogous functions. The λ proteins or analogous proteins may be expressed constitutively or conditionally. In some embodiments, the organism may be Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida la-usei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any ofthe above species. In some embodiments, the linear nucleic acid may be introduced into the chromosome of a first organism which has an enhanced frequency of homologous recombination and then transfened to a second organism which is less amenable to direct application of the present methods. For example, the linear nucleic acid may be introduced into the chromosome of E. coli and transfened into a second organism via conjugation or transduction. After introduction into the second organism, the nucleic acid is inserted into the chromosome of the second organism via homologous recombination, thereby effectively fransfe ing the regulatory element from the chromosome of the first organism into the conesponding location in the chromosome ofthe second organism. In other embodiments, the cells may be diploid cells, such as fungal cells, hi some embodiments, one copy of the gene encoding the proliferation-required gene product may be disrupted, rendering it inactive. In further embodiments, one copy of the gene encoding the proliferation-required gene product may be disrupted and the other copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter. Such sfrains may be generated by disrupting the first copy of the gene encoding the proliferation- required gene product by homologous recombination using a disruption cassette comprising a nucleotide sequence encoding an expressible dominant selectable marker flanked on each side by nucleic acids homologous to the target sequence to be disrupted. The second copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter by homologous recombination using a promoter replacement cassette comprising a regulatable promoter flanked on each side by nucleic acids homologous to the natural promoter for the proliferation-required gene. The promoter replacement cassette may also include a nucleotide sequence encoding a selectable marker located 5' of the regulatable promoter but between the nucleic acids homologous to the natural promoter. In other embodiments, overexpression may be achieved by operably linking a proliferation- required gene product described herein to a desired promoter in a vector. The vector may be a vector which replicates extrachromosomally or a vector which integrates into the chromosome. For example, if the vector is to be used in bacterial cells, the vector may be a pBR322 based vector or a bacteriophage based vector such as PI or lambda. If the vector is to be used in Saccharomyces cerevisae, it may be a vector based on the 2 micron circle or a vector incorporating a yeast chromosomal origin of replication. If the vector is to be used in mammalian cells, it may be a retroviral vector, SV40 based vector, a vector based on bovine papilloma virus, a vector based on adenovirus, or a vector based on adeno-associated virus. If the vector is to be used in Candida albicans it may be a vector comprising a promoter selected from the group consisting of the CaPCKl, MET25, MAL2, PH05, GAL1.10, STE2 or STE3 promoters. In some embodiments, the vectors described in the following publications may be used: Op 10, an efficient and convenient integrating vector for Candida albicans. Murad et al. Yeast 16(4):325-7 (2000); Transforming vector pCPW7, Kvaal et al, : Infect Immun 67(12):6652-62 (1999); Transforming vector pCWOP16, Kvaal et al, : Infect Immun 65(ll):4668-75 (1997); double-ARS vector, pRMl, to be used for direct cloning in Ca by complementation of the histidine auxofrophy of strain CA9, Pia et al. Gene 165(l):115-20 (1995); pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication (cited in Sanglard and Fiechter Yeast 8(12): 1065-75 (1992); A plasmid vector (denoted pRC2312) was constructed, which replicates autonomously in Escherichia coli, Saccharomyces cerevisiae and Candida albicans. It contains LEU2, URA3 and an autonomously replicating sequence (ARS) from C. albicans, Cannon et al, Mol Gen Genet 235(2- 3):453-7 (1992); Expression vector (CIpl0-MAL2p) for use in Candida albicans has been constructed in which a gene of interest can be placed under the confrol of the CaMAL2 maltase promoter and stably integrated at the CaRPIO locus (Baclcen et al. Yeast 16(12): 1121-9 (2000)); (Volker, R. S, A. Sonneborn, C. E. Leuker, and J. F. Ernst. 1997. Efglp, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO 16:1982-1991.); and a C. albicans transformation vector containing the C. albicans URA3 gene, a Candida ARS sequence, and a portion of the Saccharomyces cerevisiae 2 microns circle containing the replication origin was constructed. Goshorn et al. Infect Immun 60(3):876-84 (1992). A variety of other vectors suitable for use in foregoing organisms or in any other organism in which the present invention is to be practiced are familiar to those skilled in the art. Underexpression of a proliferation-required gene product described herein may be obtained in a variety of ways. For example, in one embodiment underexpression of the proliferation- required gene product may be achieved by providing an agent, such as an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, an antisense nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a nucleic acid complementary to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid complementary to a nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid complementary to a nucleic acid which encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581, a nucleic acid complementary to a nucleic acid which encodes at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a homologous antisense nucleic acid, an antisense nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a homologous nucleic acid, a nucleic acid complementary to a homologous coding nucleic acid, a nucleic acid complementary to at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a homologous coding nucleic acid, a nucleic acid complementary to a nucleic acid which encodes a homologous polypeptide, or a nucleic acid complementary to a nucleic acid which encodes at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a homologous polypeptide, which reduces the level or activity of the gene product within the cell. In one embodiment, the agent may comprise an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 which is complementary to a nucleic acid encoding the proliferation-required gene product or complementary to a portion of a nucleic acid encoding the proliferation-required gene product.

In one example of antisense-inhibition-based underexpression, a nucleic acid which encodes the antisense nucleic acid may be operably linked to a regulatable promoter. When grown under appropriate conditions, such as media containing an inducer of transcription or an agent which alleviates repression of transcription, the antisense nucleic acid is expressed in the cell, thereby reducing the level or activity ofthe gene product within the cell. In some embodiments, the concentration of the inducer of transcription or the agent which alleviates repression of transcription may be varied to provide optimal results. Such methods have been described previously herein and in U.S. Patent Application Serial Number 09/815,242, U.S. Patent Application Serial Number 09/492,709, U.S. Patent Application Serial Number 09/711,164, or U.S. Patent Application Serial Number 09/741,669.

Alternatively, underexpression of a proliferation-required gene product described herein may be achieved by constructing strains in which the expression of the gene product is under the confrol of a constitutive or regulatable promoter using methods such as those described above with respect to methods in which the gene product is overexpressed. To provide cells which underexpress the gene product, the cells are grown under conditions in which the gene product is expressed at a level lower than that of a wild type cell. For example, the cells may be grown under conditions in which a repressor reduces the level of transcription from the regulatable promoter.

In other embodiments, underexpression may be achieved by operably linking the gene required for proliferation to a desired promoter in a vector as described above with respect to embodiments in which gene products required for proliferation are overexpressed. In some embodiments, the vector may be present in cells in which the chromosomal copy or copies of the gene has been disrupted.

Examples of gene products, which are encoded by genes that can be underexpressed using methods such as those described above with respect to methods in which the gene product is overexpressed include a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide. One embodiment of the invention includes a method for identifying a gene product described herein on which a compound which inhibits the proliferation of an organism acts. The method employs a culture which comprises a mixture of sfrains of the organism. At least some of the sfrains in the culture overexpress a different gene product which is required for the proliferation of the organism. Preferably, each of the strains in the culture overexpresses a different gene product which is required for proliferation of the organism (i.e. all of the strains in the culture overexpress a gene product which is required for proliferation of the organism). For example, the gene product which is overexpressed in each sfrain may be a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide.

Sfrains that overexpress the proliferation-required gene product may be obtained using the methods described above. The culture may comprise any number of strains which overexpress a gene product required for proliferation. For example the culture may comprise at least two strains, at least 10 sfrains, at least 20 sfrains, at least 30, sfrains, at least 50 strains, at least 100 sfrains, at least 300 sfrains or more than 300 sfrains which overexpress a gene product required for proliferation. In some embodiments, the ^' culture may comprise sfrains which in aggregate overexpress all or most ofthe gene products required for proliferation of the organism.

The culture is contacted with a compound which inhibits proliferation of the organism. The compound may be a candidate drug compound obtained from any source. For example, the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract. The culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of sfrains of the organism in the culture which do not overexpress the gene product on which the compound acts, such that strains which overexpress said gene product on which the compound acts proliferate more rapidly in the culture than sfrains which do not overexpress said gene product on which said compound acts. Thus, after a sufficient period of time, the sfrain which overexpresses the gene product on which the compound acts will be more prevalent in the culture than sfrains which do not overexpress the gene product on which the compound acts. In a prefened embodiment, the growth conditions and incubation period are selected so that only one sfrain, the strain overexpressing the target of the compound, is recovered from the culture. Thus, in one embodiment, a plurality of cultures containing a plurality of strains each of which overexpresses a different proliferation-required gene product may be grown in the presence of varying concentrations of the compound. In addition to varying the compound concentrations, in embodiments where expression of the proliferation-required gene product is under the confrol of a regulatable promoter, the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter. It will be appreciated, that the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the sfrains which overexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).

The identity ofthe overexpressed gene product which is the target of the compound may be determined using a variety of methods. For example, in some embodiments of the present invention, the nucleic acids present in the culture or collection of sfrains which was contacted with the compound may be compared to the nucleic acids present in a confrol culture or collection of sfrains which was not contacted with the compound to identify nucleic acids which are ovenepresented in the culture or collection of strains contacted with the test compound relative to the control culture or collection of strains. Alternatively, in some embodiments, the nucleic acids present in a culture or collection of sfrains contacted with the test compound may be analyzed to identify those nucleic acids which are present without comparison to a confrol culture or collection of sfrains.

In some embodiments, the sfrains which proliferated more rapidly in the culture or collection of sfrains, i.e. strains having an enhanced ability to proliferate in the presence of a test compound relative to other sfrains in the culture or collection of sfrains, are identified as follows. Amplification products which are conelated with each of the overexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound. The amplification products are distinguished from one another to determine whether a particular amplification product is ovenepresented in the culture or collection of sfrains. In some embodiments, the amplification products conesponding to each of the gene products have lengths which permit them to be distinguished from one another. In another embodiment, one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto. In some embodiments, amplification products which are ovenepresented are identified by comparing the amplification products from the culture or collection of sfrains which was contacted with the test compound to the amplification products from a culture or collection of sfrains which was not contacted with the test compound. Alternatively, amplification products which are ovenepresented may be identified by simply identifying the amplification products obtained from the culture or collection of sfrains contacted with the test compound (for example, only one or a few sfrains may have proliferated in the presence of the test compound). The above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating sfrains which overexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more rapidly or more slowly in the presence of a test compound.

For example, in some embodiments of the present invention, each of the native promoters of each of the genes encoding gene product required for proliferation are replaced by a single desired replacement promoter. After growth of the culture or collection of strains containing the strains in which the promoters have been replaced in the presence of a test compound for a desired period of time, an amplification reaction is performed on nucleic acids obtained from the culture as follows.

The nucleic acids from the culture or collection of sfrains may be divided into at least two aliquots if desired. In a prefened embodiment the nucleic acids from the culture or collection of sfrains are divided into four aliquots. A single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into at least two portions, one portion for each aliquot of nucleic acids. Each portion of the primer is labeled with a distinct detectable dye, such as the 6FAM™, TET™, VIC™, HEX™, NED™, and PET™ dyes obtainable from Applied Biosystems (Foster City, CA). For example, the DS-31 or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers. Alternatively, the HEX™, NED, JOE, TMR and TET™ dyes available from Amersham Biosciences may be used. Thus, if the nucleic acids from the culture are not divided into aliquots, a single primer labeled with a single dye may be used. If the nucleic acids from the culture are divided into aliquots, at least 2, at least 3, at least 4 or more than 4 primers labeled with distinguishable dyes may be used. Each of the portions of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of sfrains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon. In some embodiments, the primers are divided into 3 portions, 4 portions or more than 4 portions, with each portion having a dye which is distinguishable from the dyes on the other portions thereon.

Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes. Each of the aliquots receives primers unique to 1/N proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e. if the culture or collection of strains consisted of 100 strains in which a gene required for proliferation was placed under the confrol of the replacement promoter and was divided into four aliquots, then each of the four aliquots of nucleic acids from the culture or collection of sfrains would receive primers complementary to 25 of the genes). The unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length ofthe amplification product produced with the other unlabeled primers. Preferably, the amplification products are between about 100-about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used. In addition, in some of the embodiments some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.

A nucleic acid amplification reaction is conducted on each ofthe nucleic acid aliquots. The amplification products are then separated by length to identify amplification products having increased representation in the culture or collection of strains (i.e. amplification products derived from cells which proliferated more rapidly in the culture or collection of sfrains). The amplification products are then conelated with the conesponding genes to determine which sfrains proliferated more rapidly in the culture or collection of strains. If desired, amplification products having increased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of strains which was contacted with the compound to amplification products obtained from a confrol culture or collection of strains which was not contacted with the compound. Alternatively, if desired, the amplification products which are obtained from a culture which was contacted with the compound may be directly identified without comparison to a confrol culture which was not contacted with the compound.

For example, in some embodiments, the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis. The amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having increased or decreased representation in the culture or collection of sfrains. Figures 2A and 2B illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of strains underexpressing genes required for proliferation indicates that a test compound acts on the gene conesponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is ovenepresented in an amplification reaction conducted on a culture or collection of sfrains overexpressing genes required for proliferation because the test compound acted on the conesponding gene. Alternatively, in another embodiment, a first amplification reaction is performed on nucleic acids obtained from a culture or collection of sfrains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upsfream or downstream of all ofthe overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstream of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the sfrains (such as a primer complementary to a nucleotide sequence within each ofthe proliferation-required genes). One of the two amplification primers for each of the proliferation required genes is labeled with a dye as described above. Preferably, the common primer complementary to a nucleotide sequence upsfream or downstream of all of the overexpressed genes is labeled with the dye. The primers used in the amplification reaction are designed so that the amplification product conesponding to each proliferation-required gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length. A second amplification reaction is conducted on a confrol culture or collection of sfrains which was not contacted with the compound using the same primers as in the first amplification reaction. The amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are ovenepresented in the culture or collection of sfrains. For example, the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another. If desired, in the embodiment where the amplification products from the first amplification reaction are run in a different lane or capillary than the amplification products from the second amplification reaction, the same dye may be used to label the primers in the first and second amplification reactions. Alternatively, if desired, different dyes may be used to label the primers in the first and second amplification reactions. If desired, in the embodiment where the amplification products from the first amplification reaction are run in a different lane or capillary than the amplification products from the second amplification reaction, the same dye may be used to label the primers in the first and second amplification reactions. Alternatively, if desired, different dyes may be used to label the primers in the first and second amplification reactions.

Alternatively, in some embodiments, the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction. In this embodiment, the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product. Figures 3A and 3B illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of sfrains underexpressing genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene conesponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is ovenepresented in an amplification reaction conducted on a culture or collection of sfrains overexpressing genes required for proliferation because the test compound acted on the conesponding gene.

If desired, rather than dividing the culture into aliquots, individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of sfrains. Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes. The resulting amplification products from each of the individual amplification reactions are pooled and amplification products having increased representation in the culture are identified as described above.

In another embodiment, a culture or collection of sfrains in which gene products required for proliferation are overexpressed from regulatable promoters which replaced the native promoters ofthe genes encoding these gene products is allowed to grow in the presence of a test compound for a desired number of generations. Preferably, the culture or collection of strains is allowed to grow in the presence of the test compound for at least 20 generations. Nucleic acids are isolated from the culture or collection of strains and an amplification reaction is performed using a primer which is complementary to a nucleotide sequence within the replacement promoter(s) or a nucleotide sequence adjacent to the a 5' end thereof and primers which are complementary to a nucleotide sequence within the proliferation required genes or nucleotide sequences adjacent thereto. The resulting amplification product(s) is directly sequenced using a primer complementary to a nucleotide sequence within the replacement promoter.

In one embodiment of the present invention, the vector containing the nucleotide sequence encoding the proliferation-required gene product is obtained from a sfrain which proliferated more rapidly in the culture using methods such as plasmid preparation techniques. Nucleic acid sequencing techniques are then employed to determine the nucleotide sequence of the gene which was overexpressed.

Alternatively, the identity of the overexpressed gene product which is the target of the compound may be determined by perfonning a nucleic acid amplification reaction, such as a polymerase chain reaction (PCR), to identify the nucleotide sequence of the gene which was overexpressed. For example, aliquots of a nucleic acid preparation, such as a purified plasmid, from the strain which is recovered from the culture may each be contacted with pairs of PCR primers which would amplify a different proliferation-required gene to determine which pair of primers yields an amplification product.

An alternative method for determining the identity of the gene product described herein which is the target of the compound involves obtaining a nucleic acid anay, such as a DNA chip, which contains each of the proliferation-required genes which were overexpressed in the strains in the culture. Each proliferation-required gene occupies a lαiown location in the anay. A nucleic acid preparation, such as a plasmid preparation, from the recovered sfrain is labeled with a detectable agent, such as radioactive or fluorescent moiety, and placed in contact with the nucleic acid anay under conditions which permit the labeled nucleic acid to hybridize to complementary nucleic acids on the anay. The location on the anay to which the labeled nucleic acids hybridize is determined to identify the gene which was overexpressed in the recovered strain. If desired the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a control culture which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly identified without comparison to nucleic acids from a control culture. In some instances, more than one sfrain may proliferate more rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to restrict proliferation only to cells which overexpress one gene product (i.e. the target gene product). While strains which overexpress the target gene product will be the most prevalent strain in the culture, other strains may also have proliferated. In such instances, the identity of the gene product in the sfrain which is most prevalent in the culture may be identified by quantitating the levels of each of the genes encoding proliferation-required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or anay technology as described above. In other instances, multiple sfrains will exhibit more rapid proliferation in the culture as a result of a common functional attribute. For example, the strains which proliferate more rapidly may each overexpress a gene product with a common enzymatic activity, such as serine protease activity for example. Alternatively, the strains which proliferate more rapidly may each overexpress a gene product with a common functional domain, such as a cAMP binding domain. In such instances, the common attribute of the sfrains which proliferate more rapidly may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the overexpressed genes in the sfrains which proliferated more rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protein is a serine protease. If desired, the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the sfrains than the original compound). For example, it is possible that a nonessential gene product expressed in the cell might also bind to the initial test compound in addition to the gene product required for proliferation, hi such an instance, it is desirable to obtain a derivative of the initial test compound which is specific for the gene product required for proliferation. In addition, it is possible that two gene products required for proliferation might bind to the initial test compound but specificity for one of the gene products is desired.

Rather than employing a single culture which contains multiple strains each of which overexpresses a proliferation-required gene product described herein, the methods of the present invention may be performed using an anay of individual strains (i.e. a collection of strains) each of which overexpresses a different proliferation-required gene product. For example, individual strains each overexpressing a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the sfrains in each of the wells is determined to identify a sfrain which proliferated more rapidly. The identity of the overexpressed gene product in the strain that proliferated more rapidly is determined as described above.

In another embodiment, individual sfrains each overexpressing a different proliferation- required gene product (i.e. a collection of sfrains) are grown at different locations on a solid medium, such as an agar plate. The medium contains the compound and where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of each of the sfrains is determined to identify a strain which proliferated more rapidly. The identity of the overexpressed gene product in the sfrain that proliferated more rapidly is determined as described above. The above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug. In particular, if the product is a natural product, it is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it. Thus, in some embodiments ofthe present invention, the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of lαiown drugs. If the target is identical to that of a lαiown drug, further development ofthe compound is halted.

Alternatively, an anay of sfrains each of which overexpresses a different gene product described herein (i.e. a collection of sfrains) is grown on solid medium containing a compound to be evaluated. The location of each strain in the anay and the gene product overexpressed by that sfrain is lαiown. The pattern of colonies which grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow in the presence of previously identified drugs. If the pattern of colonies which grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow in the presence of a previously identified drug, further development ofthe compound is halted.

Additionally in some embodiments, the sequence of the gene product in a sfrain which proliferated more rapidly in the assays described above is compared to the sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species. Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP or FASTA. The ability of the compound to inhibit the growth of the heterologous species may then be confinned by comparing the growth of cells of the heterologous species in the presence and absence ofthe compound.

Cunent methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming. The above methods may be employed to allow the targets of a large number of compounds to be rapidly identified. In such methods, the methods described above are simultaneously perfonned for each of a large number of compounds. For example, the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library. In such methods, a plurality of cultures each comprising a plurality of strains each of which overexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which overexpresses a different gene product required for proliferation is obtained. Each culture or collection of strains is contacted with a different compound in the library and the target ofthe compound is identified as described above. In another embodiment, the gene product described herein on which a compound which inhibits the proliferation of an organism acts is identified using a culture which comprises a mixture of strains of the organism including sfrains which underexpress a different gene product which is required for proliferation of the organism (i.e. at least some of the strains in the culture underexpress a gene product which is required for proliferation of the organism). Preferably, each of the strains in the culture underexpress a different a gene product which is required for the proliferation ofthe organism (i.e. all ofthe strains in the culture underexpress a gene product which is required for the proliferation of the organism). In some embodiments, the culture comprises at least one sfrain which underexpresses a gene product selected from the group consisting of a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214- 42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide.

Sfrains underexpressing the proliferation-required gene products described herein may be obtained using the methods described above. The culture may comprise any number of strains. For example the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 strains, at least 100 strains, at least 300 strains or more than 300 sfrains which underexpress a gene product required for proliferation. In some embodiments, the strains in the culture in aggregate may underexpress all or most of the gene products required for proliferation of the organism.

The culture is contacted with a compound which inhibits proliferation ofthe organism. The compound may be a candidate drug compound obtained from any source. For example, the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract. The culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which underexpress the gene product on which the compound acts, such that strains which do not underexpress the gene product on which the compound acts proliferate more rapidly in the culture than strains which do underexpress said gene product on which said compound acts. Thus, after a sufficient period of time, the sfrain which underexpresses the gene product on which the compound acts will be less prevalent in the culture than sfrains which do not underexpress the gene product on which the compound acts. In one embodiment, the growth conditions and incubation period are selected so that only one sfrain, the strain underexpressing the target of the compound, proliferates at a reduced rate in the culture. In another embodiment, the growth conditions may be selected so that the strain underexpressing the target of the compound is not recovered from the culture. Thus, in one embodiment, a plurality of cultures containing a plurality of strains each of which underexpresses a different proliferation-required gene product may be grown in the presence of varying concentrations of the compound. In addition to varying the compound concentrations, in embodiments where expression of the proliferation-required gene product is under the control of a regulatable promoter, the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter. It will be appreciated, that the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the strains which underexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).

The identity of the underexpressed gene product which is the target of the compound may be determined using a variety of methods. For example, in some embodiments of the present invention, the nucleic acids present in the culture or collection of sfrains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are undenepresented in the culture or collection of sfrains contacted with the test compound relative to the control culture or strains. Alternatively, in some embodiments, the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are missing or present at reduced levels without comparison to a confrol culture or collection of sfrains.

In some embodiments of the present invention, the strains which proliferated more slowly in the culture or collection of sfrains, i.e. strains having an decreased ability to proliferate in the presence of a test compound or which do not proliferate in the presence of a test compound, are identified as follows. Amplification products which are conelated with each ofthe underexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound. The amplification products are distinguished from one another to determine whether a particular amplification product is undenepresented in the culture or collection of sfrains. In some embodiments, the amplification products conesponding to each of the gene products have lengths which permit them to be distinguished from one another. In another embodiment, one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto. In some embodiments, amplification products which are undenepresented are identified by comparing the amplification products from the culture or collection of sfrains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound. Alternatively, amplification products which are undenepresented in the culture or collection of strains may be identified simply by determining which amplification products are missing or present at reduced levels in the culture or collection of sfrains. The above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating sfrains which underexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more slowly in the presence of a test compound. For example, in some embodiments of the present invention, each of the native promoters of each of the genes encoding gene product required for proliferation are replaced by a single desired replacement promoter. After growth of the culture or collection of sfrains containing the sfrains in which the promoters have been replaced in the presence of a test compound for a desired period of time, an amplification reaction is performed on nucleic acids obtained from the culture as follows.

The nucleic acids from the culture or collection of strains are divided into at least two aliquots. In a prefened embodiment the nucleic acids from the culture or collection of sfrains are divided into four aliquots. A single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into four groups Each group is labeled with a distinct detectable dye, such as the 6FAM™, TET™, VIC™, HEX™, NED™, and PET™ dyes obtainable from Applied Biosystems (Foster City, CA). For example, the DS-31 or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers. Each ofthe groups of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of strains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon. Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control ofthe replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes. Each of the aliquots receives primers unique to 1/N proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e. if the culture or collection of strains consisted of 100 sfrains in which a gene required for proliferation was placed under the confrol of the replacement promoter and was divided into four aliquots, then each of the four aliquots of nucleic acids from the culture or collection of sfrains would receive primers complementary to 25 of the genes). The unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length ofthe amplification product produced with the other unlabeled primers. Preferably, the amplification products are between about 100-about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used. In addition, in some of the embodiments some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.

A nucleic acid amplification reaction is conducted on each ofthe nucleic acid aliquots. The amplification products are then separated by length to identify amplification products decreased representation or which are absent in the culture or collection of strains. The amplification products are then conelated with the conesponding genes to determine which strains proliferated more slowly in the culture or collection of sfrains. If desired, amplification products having decreased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of strains which was contacted with the compound to amplification products obtained from a control culture or collection of strains which was not contacted with the compound. Alternatively, if desired, the amplification products which are missing or present at reduced levels in a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound. For example, in some embodiments, the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis. The amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are detennined to identify those amplification products having decreased representation in the culture or collection of strains. Figures 2A and 2B illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of strains underexpressing genes required for proliferation indicates that a test compound acts on the gene conesponding to the missing amplification product.

Alternatively, in another embodiment, a first amplification reaction is perfonned on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upsfream or downstream of all ofthe overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upsfream of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the strains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes). One of the two amplification primers for each of the proliferation required genes is labeled with a dye as described above. Preferably, the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye. The primers used in the amplification reaction are designed so that the amplification product conesponding to each proliferation-required gene has a unique length. A second amplification reaction is conducted on a control culture or collection of sfrains which was not contacted with the compound using the same primers as in the first amplification reaction. The amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are undenepresented in the culture or collection of sfrains. For example, the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another.

Alternatively, in some embodiments, the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction. In this embodiment, the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product. Figures 3A and 3B illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of sfrains underexpressing genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene conesponding to the missing amplification product.

If desired, rather than dividing the culture into aliquots, individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of strains. Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes. The resulting amplification products from each of the individual amplification reactions are pooled and amplification products having decreased representation in the culture are identified as described above.

In an alternative embodiment, the representation of each strain in the culture may be assessed by hybridizing detectably labeled nucleic acids encoding the proliferation-required gene products, or portions thereof, obtained from the culture to an anay comprising nucleic acids encoding the gene products required for proliferation or portions thereof. Each nucleic acid encoding a gene product required for proliferation or portion thereof occupies a lαiown location on the anay. The signal from each location on the anay is quantitated to identify those nucleic acids encoding a proliferation-required gene product which are undenepresented in the culture. If desired the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a control culture which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly analyzed without comparison to nucleic acids from a control culture. In another alternative, each sfrain underexpressing a gene product required for proliferation may be constructed to contain a unique nucleic acid sequence (refened to herein as a "tag"). The tag may be included in the cliromosome of each sfrain or in an extrachromosomal vector. For example, the tag could be included in a vector encoding an antisense nucleic acid complementary to a gene encoding a gene product required for proliferation or a portion of such a gene or the tag may be included in the antisense nucleic acid itself . The representation of each strain in the culture may be assessed by performing an amplification reaction using primers complementary to each of the tags and quantitating the levels of the resulting amplification products to identify a tag which is undenepresented or absent from the culture. Since each tag conesponds to one sfrain, the sfrain which is undenepresented or absent from the culture may be identified. If desired the tags present in a culture which was contacted with the compound may be compared to the tags present in a confrol culture which was not contacted with the compound. Alternatively, the tags present in a culture which was contacted with the compound may be analyzed without comparison to a confrol culture.

It will be appreciated that, if desired, unique tags may also be used in embodiments in which gene products required for proliferation are overexpressed. In some aspects of such embodiments, the tags may be within or adjacent to the promoter which drives expression of the gene encoding the gene product. In such embodiments, the gene product which is overexpressed in sfrains which proliferate more rapidly in the culture may be identified by detecting the presence or amount ofthe unique tag conesponding to that gene product in the culture.

In some instances, more than one strain may proliferate less rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to reduce the proliferation only in cells which underexpress one gene product (i.e. the target gene product). While sfrains which underexpress the target gene product will be the least prevalent sfrain in the culture, other strains may also be undenepresented. In such instances, the identity of the gene product in the sfrain which is least prevalent in the culture (or not recovered from the culture) may be identified by quantitating the levels of each of the genes encoding proliferation-required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or anay technology as described above.

In other instances, multiple sfrains will exhibit less rapid proliferation in the culture as a result of a common functional attribute. For example, the strains which proliferate less rapidly (or the sfrains which are not recovered from the culture) may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example. Alternatively, the strains which proliferate less rapidly (or the sfrains which are not recovered from the culture) may each underexpress a gene product with a common functional domain, such as a cAMP binding domain. In such instances, the common attribute of the sfrains which proliferate less rapidly (or the sfrains which are not recovered from the culture) may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the underexpressed genes in the strains which proliferated less rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protein is a serine protease. If desired, the compound may be derivatized and the efficacy of the derivatized compound against each of the sfrains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the sfrains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the sfrains than the original compound).

Rather than employing a single culture which contains multiple sfrains each of which underexpresses a proliferation-required gene product described herein, the methods of the present invention may be perfonned using an anay of individual sfrains (i.e. a collection of sfrains) each of which underexpresses a different proliferation-required gene product. For example, individual sfrains each underexpressing a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the sfrains in each of the wells is determined to identify a sfrain which proliferated less rapidly or which did not proliferate at all. The identity of the underexpressed gene product in the sfrain that proliferated less rapidly or which did not proliferate at all is determined as described above.

In another embodiment, individual strains each underexpressing a different proliferation- required gene product (i.e. a collection of strains) are grown at different locations on a solid medium, such as an agar plate. The medium contains the compound and, where appropriate, an agent which regulates the level of expression from the promoter. The level of proliferation of each of the sfrains is determined to identify a strain which proliferated less rapidly (or a strain which is not recovered from the culture). The identity of the underexpressed gene product in the sfrain that proliferated less rapidly (or the sfrain which is not recovered from the culture) is determined as described above.

The above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug. In particular, if the product is a natural product is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it. Thus, in some embodiments ofthe present invention, the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of lαiown drugs. If the target is identical to that of a lαiown drug, further development ofthe compound is halted.

Alternatively, an anay of strains each of which underexpresses a different gene product described herein (i.e. a collection of sfrains) is grown on solid medium containing a compound to be evaluated. The location of each strain in the anay and the gene product underexpressed by that sfrain is known. The pattern of colonies which grow less rapidly or fail to grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow less rapidly or fail to grow in the presence of previously identified drugs. If the pattern of colonies which grow less rapidly or fail to grow in the presence ofthe compound being evaluated is the same as the pattern of colonies which grow less rapidly or fail to grow in the presence of a previously identified drug, further development ofthe compound is halted. Additionally, the nucleotide sequence ofthe gene product described herein in a sfrain which proliferated less rapidly (or a sfrain which was not recovered from the culture) in the assays described above is compared to the nucleotide sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species. Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be detennined using a computer program such as BLASTP or FASTA. The ability ofthe compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells ofthe heterologous species in the presence and absence ofthe compound.

In other embodiments, the present invention uses collections or cultures of sfrains comprising both sfrains which overexpress gene products described herein required for cellular proliferation and sfrains which underexpress the same gene products required for cellular proliferation. The gene product which is overexpressed or underexpressed in each sfrain may be a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214- 42397, a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a gene product whose activity or level is inhibited by a homologous antisense nucleic acid, a gene product encoded by a homologous coding nucleic acid, and a gene product comprising a homologous polypeptide.

The culture or collection of strains is contacted with a compound and the nucleic acids present in the culture or collection of sfrains are analyzed. Preferably, nucleic acids derived from overexpressing strains can be distinguished from those derived from underexpressing sfrains. For example, the overexpressing sfrains may be obtained using promoter replacement as described above while the underexpressing sfrains may be obtained by expressing antisense nucleic acids. Accordingly, in one embodiment, amplification primers may be designed which will uniquely amplify nucleic acids from the overexpressing strains or the underexpressing sfrains. If a compound acts on a gene product which was overexpressed and underexpressed in the culture, then the amplification product obtained from the sfrain in the culture or collection which overexpressed gene product will be ovenepresented in the culture or collection while the amplification product obtained from the strain which underexpressed the gene product will be undenepresented in the culture or collection. If desired, nucleic acids from a culture or collection which was contacted with the compound may be compared to nucleic acids from a confrol culture or collection which was not contacted with the compound. Alternatively, nucleic acids from a culture or collection which was contacted with the compound may be directly analyzed without comparison to a control culture or collection. In some embodiments, strains are constructed in which a nucleic acid complementary to a gene encoding a gene product described herein required for proliferation or a portion thereof is operably linked to a regulatable promoter. For example, in some embodiments, the strains may transcribe an antisense nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 or fragments thereof which inhibit proliferation or reduce the activity or level of the gene product encoded by the gene comprising a nucleotide sequence complementary to the antisense nucleic acid or homologous antisense nucleic acids or fragments thereof. In other embodiments, the strains may transcribe an antisense nucleic acid which reduces the activity or level of a gene product encoded by SEQ ID NOs.: 6214-42397, the polypeptides of SEQ ID NOs.: 42398-78581, homologous coding nucleic acids or homologous polypeptides. A culture comprising a plurality of such sfrains wherein each sfrain expresses an antisense nucleic acid against a different gene product required for proliferation is grown in the presence of varying levels of a compound which inhibits proliferation and in the presence of varying levels of an agent which regulates the level of transcription from the regulatable promoter. Nucleic acids samples are obtained from the culture, detectably labeled and hybridized to a solid support comprising nucleic acids containing the genes encoding the proliferation-required gene products or a portion thereof. The level of hybridization is quantitated for each nucleic acid encoding each ofthe proliferation-required gene products to determine the rate at which each of the sfrains proliferated in the culture. If the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e. a nonspecific sfrain), then the hybridization intensity for that strain will not be conelated with the concenfration of the compound (See Figure 4), while if the antisense nucleic acid expressed by a sfrain in the culture is complementary to all or a portion of the gene encoding the target of the compound, the hybridization intensity for that sfrain will be intimately conelated with the concentration of the compound (See Figure 5). In this manner, the target of the compound may be identified. It will be appreciated that, as described above, rather than growing the strains in a single culture, each sfrain may be grown in a different location on a solid medium or in a different well of a multiwell plate.

The methods described above can be simultaneously performed for each of a large number of compounds. For example, the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library. In such methods, a plurality of cultures each comprising a plurality of sfrains each of which overexpresses or underexpresses a different gene product required for proliferation or a plurality of collections of individual sfrains each of which overexpresses or underexpresses a different gene product required for proliferation is obtained. Each culture or collection of strains is contacted with a different compound in the library and the target of the compound is identified as described above.

In still another embodiment, the antisense nucleic acids ofthe present invention (including the antisense nucelic acids of SEQ ED NOs. 1-6213 fragments thereof or homologous antisense nucleic acids or fragements thereof) that inhibit bacterial growth or proliferation can be used as antisense therapeutics for killing bacteria. The antisense sequences can be complementary to one of SEQ ID NOs.: 6214-42397 or fragments thereof, homologous coding nucleic acids or fragments thereof. Alternatively, antisense therapeutics can be complementary to operons in which proliferation-required genes reside (i.e. the antisense nucleic acid may hybridize to a nucleotide sequence of any gene in the operon in which the proliferation-required genes reside). Further, antisense therapeutics can be complementary to a proliferation-required gene or portion thereof with or without adjacent noncoding sequences, an intragenic sequence (i.e. a sequence within a gene), an intergenic sequence (i.e. a sequence between genes), a sequence spanning at least a portion of two or more genes, a 5' noncoding region or a 3' noncoding region located upstream or downstream from the actual sequence that is required for bacterial proliferation or an operon containing a proliferation-required gene.

In addition to therapeutic applications, the present invention encompasses the use of nucleic acids complementary to nucleic acids required for proliferation as diagnostic tools. For example, nucleic acid probes comprising nucleotide sequences complementary to proliferation-required sequences that are specific for particular species of cells or microorganisms can be used as probes to identify particular microorganism species or cells in clinical specimens. This utility provides a rapid and dependable method by which to identify the causative agent or agents of a bacterial infection. This utility would provide clinicians the ability to accurately identify the species responsible for the infection and amdminister a compound effective against it. In an extension of this utility, antibodies generated against proteins translated from mRNA transcribed from proliferation-required sequences can also be used to screen for specific cells or microorganisms that produce such proteins in a species- specific manner.

Other embodiments ofthe present invention include methods of identifying compounds which inhibit the activity of gene products required for cellular proliferation using rational drug design. As discussed in more detail below, in such methods, the structure ofthe gene product is determined using techniques such as x-ray crystallography or computer modeling. Compounds are screened to identify those which have a structure which would allow them to interact with the gene product or a portion thereof to inhibit its activity. The compounds may be obtained using any of a variety of methods familiar to those skilled in the art, including combinatorial chemistry. In some embodiments, the compounds may be obtained from a natural product library. In some embodiments, compounds having a structure which allows them to interact with the active site of a gene product, such as the active site of an enzyme, or with a portion of the gene product which interacts with another biomolecule to form a complex are identified. If desired, lead compounds may be identified and further optimized to provide compounds which are highly effective against the gene product. The following examples teach the genes of the present invention and a subset of uses for the genes identified as required for proliferation. These examples are illustrative only and are not intended to limit the scope ofthe present invention.

EXAMPLES The following examples are directed to the identification and exploitation of genes required for proliferation. Methods of gene identification are discussed as well as a variety of methods to utilize the identified sequences. It will be appreciated that any of the antisense nucleic acids, proliferartion- required genes or proliferation-required gene products described herein, or portions thereof, may be used in the procedures described below, including the antisense nucleic acids of SEQ ED NOs.: 1-6213, the nucleic acids of SEQ ID NOS.: 6214-42397, or the polypeptides of SEQ ID NOs.: 42398-78581. Likewise, homologous antisense nucleic acids, homologous coding nucleic acids, homologous polypeptides or portions of any of the above-mentioned nucleic acids or polypeptides, may be used in any ofthe procedures described below. Genes Identified as Required for Proliferation of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa and Salmonella typhimurium.

Genomic fragments were operably linked to an inducible promoter in a vector and assayed for growth inhibition activity. Example 1 describes the examination of a library of genomic fragments cloned into vectors comprising inducible promoters. Upon induction with xylose or IPTG, the vectors produced an RNA molecule conesponding to the subcloned genomic fragments. In those instances where the genomic fragments were in an antisense orientation with respect to the promoter, the transcript produced was complementary to at least a portion of an mRNA (messenger RNA) encoding a Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa or Salmonella typhimurium gene product such that they interacted with sense mRNA produced from various Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa or Salmonella typhimurium genes and thereby decreased the translation efficiency or the level of the sense messenger RNA thus decreasing production of the protein encoded by these sense mRNA molecules, hi cases where the sense mRNA encoded a protein required for proliferation, bacterial cells containing a vector from which transcription from the promoter had been induced failed to grow or grew at a substantially reduced rate. Additionally, in cases where the franscript produced was complementary to at least a portion of a non- translated RNA and where that non-translated RNA was required for proliferation, bacterial cells containing a vector from which transcription from the promoter had been induced also failed to grow or grew at a substantially reduced rate. In contrast, cells grown under non-inducing conditions grow at a normal rate.

The above method was used to identify genes required for cellular proliferation in Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa and Salmonella typhimurium. Additionally, a number of genes required for cellular proliferation in Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa and Salmonella typhimurium, which have been described in the following U.S. Patent Applications: U.S. Patent Application Serial Number 09/492,709, filed January 27, 2000; U.S. Patent Application Serial Number 09/711,164, filed November 9, 2000; U.S. Patent Application Serial Number 09/741,669, filed December 19, 2000 and U.S. Patent Application Serial Number 09/815,242 filed March 21, 2001, U.S. Provisional Patent Application Serial Number 60/342,923, filed October 25, 2001, have been previously identified using the above method.

EXAMPLE 1 Inhibition of Bacterial Proliferation after Induction of Antisense Expression

To identify genes required for proliferation of E. coli, random genomic fragments were cloned into the IPTG-inducible expression vector pLEX5BA (Krause et al, J. Mol. Biol. 274: 365 (1997) or a modified version of pLEX5BA, pLEX5BA-3' in which a synthetic linker containing a T7 terminator was ligated between the Pstl and Hindlll sites of pLEX5BA. In particular, to construct pLEX5BA-3', the following oligonucleotides were annealed and inserted into the Pstl and Hindffl sites of pLEX5BA:

5' -GTCTAGCATAACCCCTTGGGGCCTCTAAΑCGGGTCCTTGAGGGGTTTTTTGA-3 ' (SEQ ID NO: 78584)

5 ' -AGCTTCAAAAAACCCCTCAAGGACCCGTTTAGAGGCCCCAAGGGGTTAT GCTAGACTGCA-3 ' (SEQ ID NO: 78585)

Random fragments of E. coli genomic DNA were generated by DNAsel digestion or sonication, filled in with T4 polymerase, and cloned into the Smal site of pLEX5BA or pLEX5BA-

3 ' . Upon activation or induction, the promoter franscribed the random genomic fragments.

A number of vectors which allow the production of transcripts which have an extended lifetime in E. coli as well as other Gram negative bacteria can also be utilized in conjunction with these antisense inhibition experiments. Such vectors are described in U.S. Provisional Patent Application Serial Number 60/343,512, filed December 21, 2001. Briefly, the stabilized antisense RNA may comprise an antisense RNA which was identified as inhibiting proliferation as described above which has been engineered to contain at least one stem loop flanking each end of the antisense nucleic acid. In some embodiments, the at least one stem-loop structure formed at the 5' end of the stabilized antisense nucleic acid comprises a flush, double stranded 5' end. In some embodiments, one or more ofthe stem loops comprises a rho independent terminator. In additional embodiments, the stabilized antisense RNA lacks a ribosome binding site. In further embodiments, the stabilized RNA lacks sites which are cleaved by one or more RNAses, such as RNAse E or RNAse III. In some embodiments, the stabilized antisense RNA may be franscribed in a cell which the activity of at least one enzyme involved in RNA degradation has been reduced. For example, the activity of an enzyme such as RNase E, RNase II, RNase III, polynucleotide phosphorylase, and ρoly(A) polymerase, RNA helicase, enolase or an enzyme having similar functions may be reduced in the cell. To study the effects of franscriptional induction in liquid medium, growth curves were carried out by back diluting cultures 1:200 into fresh media with or without 1 mM IPTG and measuring the OD ₅₀ every 30 minutes (min). To study the effects of transcriptional induction on solid medium, 10², 10³, 10⁴, 10⁵, 10⁶, 10⁷ and 10^s fold dilutions of overnight cultures were prepared. Aliquots of from 0.5 to 3 μl of these dilutions were spotted on selective agar plates with or without 1 mM IPTG. After overnight incubation, the plates were compared to assess the sensitivity ofthe clones to IPTG.

Of the numerous clones tested, some clones were identified as containing a sequence that inhibited E. coli growth after IPTG induction. Accordingly, the gene to which the inserted nucleic acid sequence conesponds, or a gene within the operon containing the inserted nucleic acid, is required for proliferation in E. coli.

Nucleic acids involved in proliferation of Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa and Salmonella typhimurium were identified as follows. Randomly generated fragments of Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa or Salmonella typhimurium genomic DNA were franscribed from inducible promoters.

In the case of Staphylococcus aureus, a novel inducible promoter system, XylT5, comprising a modified T5 promoter fused to the xylO operater from the xylA promoter of Staphylococcus aureus was used. The promoter is described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001. Transcription from this hybrid promoter is inducible by xylose.

Randomly generated fragments of Salmonella typhimurium genomic DNA were transcribed from an IPTG inducible promoter in pLEX5BA (Krause et al, J. Mol. Biol. 274: 365 (1997) or a derivative thereof. Randomly generated fragements oi Klebsiella pneumoniae genomic DNA were expressed from an IPTG inducible promoter in pLEX5BA-Kan. To construct pLEX5BA-kan, pLEX5BA was digested to completion with CM in order to remove the bla gene. Then the plasmid was freated with a partial Notl digestion and blunted with T4 DNA polymerase. A 3.2 kbp fragment was then gel purified and ligated to a blunted 1.3 kbp kan gene from pKanπ. Kan resistant transfonnants were selected on Kan plates. Orientation of the kan gene was checked by Srnal digestion. A clone, which had the kan gene in the same orientation as the bla gene, was used to identify genes required for proliferation oi Klebsiella pneumoniae. Randomly generated fragments of Pseudomonas aeruginosa genomic DNA were trancribed from a two-component inducible promoter system. Integrated on the chromosome was the T7 RNA polymerase gene regulated by lacUVδl lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41. On a separate plasmid, a T7 gene 10 promoter, which is franscribed by T7 RNA polymerase, was fused with a lacO operator followed by a multiple cloning site. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of an mRNA or a non-translated RNA encoding a gene product involved in proliferation, then induction of transcription from the promoter will result in detectable inhibition of proliferation. In the case of Staphylococcus aureus, a shotgun library of Staphylococcus aureus genomic fragments was cloned into the vector pXyIT5-P15a, which harbors the XylT5 inducible promoter. The vector was linearized at a unique BanϊEl site immediately downstream of the XyIT5 promoter/operator. The linearized vector was freated with shrimp alkaline phosphatase to prevent reclosure ofthe linearized ends. Genomic DNA isolated from Staphylococcus aureus sfrain RN450 was fully digested with the restriction enzyme Sau3A , or , alternatively, partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 0.1 to 1, and ligated to form a shotgun library. The ligated products were transformed into electrocompetent E. coli sfrain XLl-Blue MRF

(Stratagene) and plated on LB medium with supplemented with carbenicillin at 100 μg/ml. Resulting colonies numbering 5 x 10⁵ or greater were scraped and combined, and were then subjected to plasmid purification.

The purified library was then transformed into electrocompetent Staphylococcus aureus RN4220. Resulting fransformants were plated on agar containing LB + 0.2% glucose (LBG medium) + chloramphenicol at 15 μg/ml (LBG+CM15 medium) in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and anayed into wells of 384 well culture dishes. Each well contained lOOμl of LBG + CM15 liquid medium. Inoculated 384 well dishes were incubated 16 hours at 37°C, and each well was robotically gridded onto solid LBG + CM15 medium with or without 2% xylose. Gridded plates were incubated 16 hours at 37°C, and then manually scored for anayed colonies that were growth-compromised in the presence of xylose.

Arrayed colonies that were growth-sensitive on medium containing 2% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis as follows: Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing LBG + CM15, and were incubated for 16 hours at 37°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well anay and then gridded onto media containing 2% xylose or media lacking xylose. After growth for 16 hours at 37°C, the anays that resulted on the two media were compared to each other. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on xylose medium but failed to grow at the same serial dilution on the non-xylose plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 10 or less on the xylose plate and grow at a serial dilution of 10 or less on the non-xylose plate, then the conesponding clone received a score of "4" representing the log difference in growth observed.

For Salmonella typhimurium and Klebsiella pneumoniae growth curves were carried out by back diluting cultures 1:200 into fresh media containing 1 mM IPTG or media lacking IPTG and measuring the OD ₅₀ every 30 minutes (min). To study the effects of transcriptional induction on solid medium, 10², 10³, 10⁴, 10⁵, 10⁶, 10⁷ and 10⁸ fold dilutions of overnight cultures were prepared. Aliquots of from 0.5 to 3 μl of these dilutions were spotted on selective agar plates with or without 1 mM JJPTG. After overnight incubation, the plates were compared to assess the sensitivity ofthe clones to IPTG.

Nucleic acids involved in proliferation of Pseudomonas aeruginosa were identified as follows. Randomly generated fragments of Pseudomonas aeruginosa genomic DNA were franscribed from a two-component inducible promoter system. Integrated on the cliromosome was the T7 RNA polymerase gene regulated by lacUV5l lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41). On an expression plasmid there was a T7 gene 10 promoter, which is franscribed by T7 RNA polymerase, fused with a lacO operator followed by a multiple cloning site. Transcription from this hybrid promoter is inducible by IPTG. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of an mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.

A shotgun library of Pseudomonas aeruginosa genomic fragments was cloned into the vectors pEP5, pEP5S, or other similarly constructed vectors which harbor the TllacO inducible promoter. The vector was linearized at a unique Srnal site immediately downstream of the TllacO promoter/operator. The linearized vector was freated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends. Genomic DNA isolated from Pseudomonas aeruginosa sfrain PAOl was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to fonn a shotgun library. The ligated products were transformed into electrocompetent E. coli sfrain XLl-Blue MRF^'

(Stratagene) and plated on LB medium with carbenicillin at 100 μg/ml or Streptomycin 100 μg/ml. Resulting colonies numbering 5 x 10⁵ or greater were scraped and combined, and were then subjected to plasmid purification.

The purified library was then transformed into electrocompetent Pseudomonas aeruginosa strain PAOl. Resulting transformants were plated on LB agar with carbenicillin at 100 μg/ml or Streptomycin 40 μg/ml in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and anayed into wells of 384 well culture dishes. Each well contained 100 μl of LB + CB 100 or Streptomycin 40 liquid medium. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid LB + CB100 or Streptomycin 40 medium with or without 1 mM IPTG. Gridded plates were incubated 16 hours at 37°C, and then manually scored for anayed colonies that were growth- compromised in the presence of IPTG. Arrayed colonies that were growth-sensitive on medium containing 1 mM IPTG, yet were able to grow on similar medium lacking IPTG, were subjected to further growth sensitivity analysis as follows: Colonies from the plate lacking IPTG were manually picked and inoculated into individual wells of a 96 well culture dish containing LB + CB100 or Streptomycin 40, and were incubated for 16 hours at 30°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well anay and then gridded onto media with and without 1 mM IPTG. After growth for 16 hours at 37°C, the anays of serially diluted spots that resulted were compared between the two media. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on IPTG medium but failed to grow at the same serial dilution on the non-IPTG plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 10⁴ or less on the IPTG plate and grow at a serial dilution of 10^s or less on the IPTG plate, then the conesponding clone received a score of "4" representing the log difference in growth observed.

Following the identification of those vectors that, upon induction, negatively impacted Pseudomonas aeruginosa growth or proliferation, the inserts or nucleic acid fragments contained in those vectors were isolated for subsequent characterization. Vectors of interest were subjected to nucleic acid sequence determination.

Nucleic acids involved in proliferation of E. faecalis were identified as follows. Randomly generated fragments of genomic DNA were expressed from the vectors pEPEF3 or pEPEF14, which contain the CP25 or P59 promoter, respectively, regulated by the xyl operator/repressor.

These plasmids as well as other vectors useful for the expression of nucleic acids in Enterococcus faecalis and other Gram positive organisms are described in U.S. Patent Application Serial Number

10/032,393, filed December 21, 2001, the disclosure or which is incorportated herein by reference in its entirety. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of a mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.

A shotgun library of E. faecalis genomic fragments was cloned into the vector pEPEF3 or pEPEF14, which harbor xylose inducible promoters. The vector was linearized at a unique Smal site immediately downstream of the promoter/operator. The linearized vector was freated with alkaline phosphatase to prevent reclosure of the linearized ends. Genomic DNA isolated from E. faecalis strain OG1RF was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library.

The ligated products were transformed into electrocompetent E. coli strain TOP 10 cells (Invitrogen) and plated on LB medium with erythromycin (Enn) at 150 μg/ml. Resulting colonies numbering 5 x 10⁵ or greater were scraped and combined, and were then subjected to plasmid purification.

The purified library was then transformed into electrocompetent E. faecalis sfrain OG1RF. Resulting transformants were plated on Todd-Hewitt (TH) agar with erythromycin at 10 μg/ml in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and anayed into wells of 384 well culture dishes. Each well contained 100 μl of THB + Erm 10 μg/ml. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid TH agar + Erm with or without 5%> xylose. Gridded plates were incubated 16 hours at 37°C, and then manually scored for anayed colonies that were growth-compromised in the presence of xylose. Anayed colonies that were growth-sensitive on medium containing 5% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis. Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing THB + Erm 10, and were incubated for 16 hours at 30°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilution on plates containing 5%> xylose or plates lacking xylose. After growth for 16 hours at 37°C, the anays of serially diluted spots that resulted were compared between the two media. Colonies that grew similarly on both media were scored as a negative and conesponding colonies were no longer considered. Colonies on xylose medium that failed to grow to the same serial dilution compared to those on the non- xylose plate were given a score based on the differential. For example, colonies on xylose medium that only grow to a serial dilution of -4 while they were able to grow to -8 on the non-xylose plate, then the conesponding fransformant colony received a score of "4" representing the log difference in growth observed.

Following the identification of those vectors that, upon induction, negatively impacted E. faecalis growth or proliferation, the inserts or nucleic acid fragments contained in those expression vectors were isolated for subsequent characterization. The inserts in the vectors of interest were subjected to nucleotide sequence determination.

It will be appreciated that other restriction enzymes and other endonucleases or methodologies may be used to generate random genomic fragments. In addition, random genomic fragments may be generated by mechanical shearing. Sonication and nebulization are two such techniques commonly used for mechanical shearing of DNA. EXAMPLE 2

Nucleotide Sequence Determination of Identified Clones Transribing Nucleic Acid Fragments with

Detrimental Effects on Escherichia coli. Staphylococcus aureus. Enterococcus faecalis. Klebsiella pneumoniae. Pseudomonas aeruginosa or Salmonella typhimurium Proliferation Plasmids from clones that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows.

The nucleotide sequences of the nucleic acid sequences which inhibited the growth of

Escherichia coli were detennined using plasmid DNA isolated using QIAPREP (Qiagen, Valencia,

CA) and methods supplied by the manufacturer. The primers used for sequencing the inserts were 5' - TGTTTATCAGACCGCTT - 3' (SEQ ID NO: 78586) and 5' - ACAATTTCACACAGCCTC - 3'

(SEQ JO NO: 78587). These sequences flank the polylinker in pLEX5BA.

Staphylococcus aureus were determined as follows. Staphylococcus aureus were grown in standard laboratory media (LB or TB with 15 ug/ml Chloramphenicol to select for the plasmid). Growth was carried out at 37°C overnight in culture tubes or 2 ml deep well microtiter plates.

Lysis of Staphylococcus aureus was performed as follows. Cultures (2-5 ml) were cenfrifuged and the cell pellets resuspended in 1.5 mg/ml solution of lysostaphin (20 μl/ml of original culture) followed by addition of 250 μl of resuspension buffer (Qiagen). Alternatively, cell pellets were resuspended directly in 250 μl of resuspension buffer (Qiagen) to which 5-20 μl of a 1 mg/ml lysostaphin solution were added.

DNA was isolated using Qiagen miniprep kits or Wizard (Qiagen) miniprep kits according to the instructions provided by the manufacturer.

The genomic DNA inserts were amplified from the purified plasmids by PCR as follows.

1 μl of Qiagen purified plasmid was put into a total reaction volume of 25 μl Qiagen Hot Start PCR mix. For Staphylococcus aureus, the following primers were used in the PCR reaction:

_PXylT5F: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 78588)

LexL TGTTTTATCAGACCGCTT (SEQ ID NO: 78589)

Similar methods were conducted for Salmonella typhimurium and Klebsiella pneumoniae.

For Salmonella typhimurium and Klebsiella pneumoniae the following primers were used: 5 ' - TGTTTTATCAGACCGCTT - 3 ' (SEQ ID NO: 78589) and

5 '-ACAATTTCACACAGCCTC-3 ' (SEQ ID NO: 78587)

PCR was canied out in a PE GenAmp with the following cycle times:

Step l. 95° C 15 min

Step 2. 94° C 45 sec Step 3. 54° C 45 sec

Step 4. 72° C l minute

Step 5. Return to step 2, 29 times

Step 6. 72° C 10 minutes Step 7. 4° C hold

The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.

For Pseudomonas aeruginosa, plasmids from fransformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows. Pseudomonas aeruginosa were grown in standard laboratory media

(LB with carbenicillin at 100 μg/ml or Streptomycin 40 μg/ml to select for the plasmid). Growth was carried out at 30°C overnight in 100 ul culture wells in microtiter plates. To amplify insert

DNA 2 ul of culture were placed into 25 ul Qiagen Hot Start PCR mix. PCR reactions were in 96 well microtiter plates. For plasmid pEP5S the following primers were used in the PCR reaction:

T7L1+: GTCGGCGATATAGGCGCCAGCAACCG (SEQ ID NO: 78590) pStrA3: ATAATCGAGCATGAGTATCATACG (SEQ ID NO: 78591)

PCR was canied out in a PE GenAmp with the following cycle times:

Step l. 95° C 15 min Step 2. 94° C 45 sec

Step 3. 54° C 45 sec

Step 4. 72° C 1 minute

Step 5. Return to step 2, 29 times

Step 6. 72° C 10 minutes Step 7. 4° C hold

The purified PCR products were then directly cycle sequenced with Qiagen Hot Start PCR mix. The following primers were used in the sequencing reaction: T7/L2: ATGCGTCCGGCGTAGAGGAT (SEQ ID NO: 78592)

PCR was canied out in a PE GenAmp with the following cycle times:

Step l. 94° C 15 min

Step 2. 96° C 10 sec

Step 3. 50° C 5 sec Step 4. 60 C 4 min

Step 5. Return to step 2, 24 times

Step 6. 4° C hold

The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions. For E. faecalis, plasmids from transformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows. E. faecalis were grown in THB 10 μg/ml Erm at 30°C overnight in 100 ul culture wells in microtiter plates. To amplify insert DNA 2 ul of culture were placed into 25 μl Qiagen Hot Start

PCR mix. PCR reactions were in 96 well microtiter plates. The following primers were used in the

PCR reaction: pXylT5: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 78588) and the pEP/pAKl primer.

PCR was canied out in a PE GenAmp with the following cycle times:

Step 1. 95° C 15 min

Step 2. 94° C 45 sec

Step 3. 54° C 45 sec Step 4. 72° C 1 minute

Step 5. Return to step 2, 29 times

Step 6. 72° C 10 minutes

Step 7. 4° C hold

The purified PCR products were then directly cycle sequenced with Qiagen Hot Start PCR mix. The following primers were used in the PCR reaction: pXylT5: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 78588)

PCR was canied out in a PE GenAmp with the following cycle times: Step l. 94° C 15 min

Step 2. 96° C 10 sec

Step 3. 50° C 5 sec

Step 4. 60° C 4 min

Step 5. Return to step 2, 24 times Step 6. 4° C hold

The amplified genomic DNA inserts from each of the above procedures were subjected to automated sequencing. Sequence identification numbers (SEQ ID NOs) and clone names for the identified inserts are listed in Table IA and discussed below.

EXAMPLE 3

Comparison Of Isolated Nucleic Acids to Known Sequences The nucleotide sequences of the subcloned fragments from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa and Salmonella typhimurium obtained from the expression vectors discussed above were compared to known sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium and other microorganisms as follows. First, to confirm that each clone originated from one location on the chromosome and was not chimeric, the nucleotide sequences of the selected clones were compared against the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa or Salmonella typhimurium genomic sequences to align the clone to the correct position on the chromosome. The NCBI BLASTN v 2.0.9 program was used for this comparison, and the incomplete Staphylococcus aureus genomic sequences licensed from TIGR, as well as the NCBI nonredundant GenBank database were used as the source of genomic data. Salmonella typhimurium sequences were compared to sequences available from the Genome Sequencing Center (http://genome.wustl.edu/gsc/salmonella.shtml), and the Sanger Centre (http://www.sanger.ac.ulJprojects/S__typhi). Pseudomonas aeruginosa sequences were compared to a proprietary database and the NCBI GenBank database. The E. faecalis sequences were compared to a proprietary database. The BLASTN analysis was performed using the default parameters except that the filtering was turned off. No further analysis was performed on inserts which resulted from the ligation of multiple fragments.

In general, antisense molecules and their complementary genes are identified as follows. First, all possible full length open reading frames (ORFs) are extracted from available genomic databases. Such databases include the GenBank nonredundant (nr) database, the unfinished genome database available from TIGR and the PathoSeq database developed by Incyte Genomics. The latter database comprises over 40 annotated bacterial genomes including complete ORF analysis. If databases are incomplete with regard to the bacterial genome of interest, it is not necessary to extract all ORFs in the genome but only to extract the ORFs within the portions of the available genomic sequences which are complementary to the clones of interest. Computer algorithms for identifying ORFs, such as GeneMark, are available and well lαiown to those in the art. Comparison of the clone DNA to the complementary ORF(s) allows determination of whether the clone is a sense or antisense clone. Furthermore, each ORF extracted from the database can be compared to sequences in well annotated databases including the GenBank (nr) protein database, SWISSPROT and the like. A description ofthe gene or of a closely related gene in a closely related microorganism is often available in these databases. Similar methods are used to identify antisense clones corresponding to genes encoding non-translated RNAs. In order to generate the gene identification data compiled in Table IB, each of the cloned nucleic acid sequences discussed above corresponding to SEQ ID NO.s 1-6213 was used to identify the corresponding Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa or Salmonella typhimurium ORFs in the PathoSeq v.4.1 (March 2000 release) database of microbial genomic sequences. For this purpose, the NCBI BLASTN 2.0.9 computer algorithm was used. The default parameters were used except that filtering was turned off. The default parameters for the BLASTN and BLASTX analyses were: Expectation value (e)=10

Alignment view options: pairwise Filter query sequence (DUST with BLASTN, SEG with others)=T

Cost to open a gap (zero invokes behavior)=0

Cost to extend a gap (zero invokes behavior)=0

X dropoff value for gapped alignment (in bits) (zero invokes behavior)=0

Show GFs in deflines=F Penalty for a nucleotide mismatch (BLASTN only)= ! 3

Reward for a nucleotide match (BLASTN onIy)=l

Number of one-line descriptions (V)=500

Number of alignments to show (B)=250

Tlireshold for extending hits=default Perform gapped alignment (not available with BLASTX)=T

Query Genetic code to use=l

DB Genetic code (for TBLAST[nx] only=l

Number of processors to use=l

SeqAlign file Believe the query defline=F

Matrix=BLOSUM62

Word Size= default

Effective length ofthe database (use zero for the real size)=0

Number of best hits from a region to keep=100 Length of region used to judge hits=20

Effective length ofthe search space (use zero for the real size)=0

Query strands to search against database (for BLAST[nx] and TBLASTX), 3 is both, 1 is top, 2 is bottom=3

Produce HTML output=F

Alternatively, ORFs were identified and refined by conducting a survey of the public and private data sources. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com). For Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typhi, genomic sequences from PathoSeq v 4.1 (Mar 2000 release) was reanalyzed for ORFs using the gene finding software GeneMark v 2.4a, which was purchased from GenePro Inc. 451 Bishop St., N.W., Suite B, Atlanta, GA, 30318, USA.

Antisense clones were identified as those clones for which transcription from the inducible promoter would result in the expression of an RNA antisense to a complementary ORF, intergenic or intragenic sequence. Those clones containing single inserts and that caused growth sensitivity upon induction are listed in Table IA.

The gene descriptions in the PathoSeq database derive from annotations available in the public sequence databases described above. Where a clone was found to share significant sequence identity to two or more adjacent ORFs, it was listed once for each ORF and the PathoSeq information for each ORF was compiled in Table IB.

Table IA lists the SEQ ID NOs. and clone names of the inserts which inhibited proliferation. This information was used to identify the ORFs (SEQ ID NOs.: 6214-42397) whose gene products (SEQ ID NOs. 42398-78581) were inhibited by the nucleic acids comprising the nucleotide sequences of SEQ ID NOs. 1-6213. Table IB lists the clone name and the PathoSeq

Locus containing the clone.

TABLE IB

Table IC provides a cross reference between PathoSeq Gene Loci listed in Table IB and the SEQ ED NOs. of the corresponding PathoSeq polypeptides and the SEQ ID NOs- of the nucleic acids which encode them. The Gene Locus IDs provided in Table IC each comprise a nine digit alpha-numeric identifier that can be used to determine the organism from which each Gene Locus and corresponding SEQ ED NOs. were identified. Specifically, the first letter of the Gene Locus ID corresponds to the first letter of the genus name of the organism described herein from which the Gene Locus was identified and the second and third letters of the Gene Locus ID correspond to the first two letters of the species name of this organism. For example, the identifier EFA205257 describes a gene locus identified from Enterococcus faecalis. In those instances where the three letter identifier is the same for different organisms, the exact identity of the organism which corresponds to the Gene Locus ID can be determined by referring to the organism designation in the sequence listing for the coding nucleic acid or polypeptide SEQ ID NO. that corresponds to the particular Gene Locus ID.

σs o σs CN m vo r-- r- 0r- 00 CN IT- 00 O r T-

00 00 00 00 00 00 oo 00 σs

CO CO CO CO CO CO CO CO CO O CO CO CO CO CO C

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

PH PH PH P-i 3 P-, 3 PH3 PH3 PH3 PH3 PH3 PH3 PH3 PH3 PH3 PH3 PH3 PH s CN CO >n VO c- 00 Q\ O

>n m in vo VO VO VO VO VO VO VO vo VO r- r- t in m m > vo VO vo vo VO vo vo so vo vo VO VO VO vo

VO vo vo vo VO VO vo SO VO vo SO VO VO VO VO vo so vo v r- 00 Λ o CN CO Tf m vo t-- 0

IT- r- oo 00 00 oo oo oo 00 oo o co CO co co CO co co co CO co co co co co c co co CO O co co O co co O co c oo r c σs σs

o CN CO Tf in VO t~- oo σs O σs o o o o o o o o o o in i in in in in in ■n i

Tf Tf Tf Tf Tf Tf Tf T m in i r- 00 σs o CN co Tf in vo r

CN CN CN CN CN N CN O O co co co CO CO co co O CO CO co CO CO CO co c

00 00 oo 00 00 00 00 00 00 00 00 00 00 0

in o VO in in VO VO CO CN l~- c-- oo i vo O o CO 00 n σs CO t- CN o o 00 0

VO σs CN Tf oo σs m C o o o in f CN CN o i-H i

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN On^" CN C

PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH CH P pq pq pq pq pq pq pq pq pq pq pq p

VO r~- 00 σs o CN co Tf in VO r- oo O CO co co co co CO f Tf Tf Tf Tf f Tf Tf ^■tf

Tf Tf Tf Tf Tf Tf f Tf Tf ^■tf

CN CN CN CN CN CN C CN CN CN CN

Tf Tf Tf Tf Tf Tf

CN co "tf m VO f- 00 σs o CN CO ^■tf i m <n in in i m in ιn in m VO VO VO VO VO V

CN CN CN CN N N CN N CN N CN CN N N CN CN CN CN r C

VO VO VO VO VO so vo VO vo VO SO VO VO VO VO VO vo so s

Tf i VO t- 00 σs r^

CO CO CO CO CO CO CO CO CO CO

VO VO VO vo VO VO VO vo vo VO

00 00 © CN CN CO •n CN vo σs CN

Tf Tf in r- OO 00 σs σs ON CN

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

Pi PH PH P PH PH PH' PH PH PH PH PH PH PH PH PH PH oo ON © CN CO Tf in VO c-- 00 ON © T-

00 00 σ r

VO VO VO VO VO SO vo vo VO VO vo o vo vo vo VO vo S

VO VO VO VO VO SO SO VO VO vo VO VO VO VO VO vo vo vo VO v

•n vo r-» 00 ON © CN CO Tf in VO f

ON ON σs © © © © © © ©

VO vo vo V co co CO CO co co co CO co O co O co O

ON o CN CO Tf in r- 00 © CN CO " σs © © © o O o © ©

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

PH PH PH PH PH PH PH PH P PH PH PH PH PH P Q CJ O OCJ CJ U O CJ O t~- OO ON © CN co Tf in SO Γ- 00 ON

CN CN CN CN CN CN CN c r- r- r- f- r- r- r-

Tf Tf r- r- r

Tf Tf Tf Tf T i in VO r- 00 σs o N O Tf in v O CO O CO O CO CO CO O Tf Tf Tf Tf Tf Tf Tf in in m oo oo oo oo oo oo oo 00 oo oo 00 oo o

O in CN r- CN CO o 00 00 ,_, Tf Tf r- r- o

CN f "tf Tf CN CN CO VO © CN 00 Tf "

CN CN CN in CN ON CN CN © CO C o CO CO CO CN co CO © CO co CO CN CO CN T-

pq w pq pq pq pq pq pq pq pq p

VO r- 00 ON © CN O Tf in VO r- 0 in m in in in m in in VO VO VO V O VO SO o vo vo VO SO VO vo VO VO VO VO VO VO vo

CN CN CN CN CN cN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

"tf Tf Tf Tf Tf Tf Tf f

CN CO Tf m VO r- 00 ON © CN CO ^■tf r- r- r- r- r- r- 00 OO 00 oo oo

VO vo vo VO SO SO SO vo VO vo vo VO SO VO vo V

CO Tf Tf Tf VO vo vo r- f- 00 σs σs © © CN CN CO CO co Tf in in ιn m r- m o VO VO σs © CN co CO VO

CN CN CN CN CN CN CN CN CN CN CN N N CN N CN rN- σs σs CN O CO

CN CN co co co co O CO co CO CO CO CO Tf Tf Tf Tf Tf r T- 00 ON © CN f Tf Tf in m in in in in >n in in in in in in in in in in in in in in wo m in in in in m n in in in in in in in in in in in in in in in in m in m in in in in in in •n ■n in

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

3 PH3 PH3 PH P3H3 PH P3H3 PH3 PH3 PH3 PH3 PH3 PH3 Pi3 PH3 PH3 PH 3 PH 3 PH3 PH3 PH3 P P 3H P 3i3 PH P3H P3H-3 PH3 Pi3 PH3 PH3 PH3 PH P 3H 3 PH P 3H P3i3 PH P3H P3H3 PH P3H3 PH3 Pi3 PH3 PH3 PH3 Pi3 Pi3 PH 3 PH3 P 3 PH-3 PH 3 Pi

Q O Tf in VO r- 00 ON © CN O Tf in O O 00 σs © CN CO in VO Γ- 00 ON © CN O Tf m VO C- 00 σs © CN CO Tf m VO Γ- 00 σs © CN CO in vo

ON ON σs σs σs σs σs O o © © © © O © © o CN CN CN CN CN CN CN CN CN CN CO co CO co CO CO CO O co CO Tf Tf Tf Tf Tf Tf Tf cf o IT- r- t~- o t~- r- OO oo oo oo oo 00 OO oo oo OO OO oo oo oo OO OO OO OO OO oo 00 oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo 00 oo oo oo OO oo oo oo oo oo to VO vo vo VO VO vo SO VO VO SO SO o O VO SO SO VO SO vo so VO VO VO VO SO O vo VO VO VO vo vo vo vo vo VO vo vo VO vo vo vo vo VO vo VO vo VO vo vo VO vo vo VO

00 vo VO vo SO VO vo vo vo vo vo vo O SO VO vo VO so VO vo VO VO VO vo vo VO S VO so VO vo VO VO vo vo SO VO VO VO VO vo vo vo VO vo S VO vo VO VO VO VO VO vo VO σs © CN co Tf in vo r- 00 ON O CN CO Tf in VO t- 00 σs o CN O Tf in o IT- 00 σs © CN CO Tf in VO r- oo ON © CN CO Tf in vo ιτ- oo ON © CN o o τ-H CN CN CN CN CN N CN CN CN CN CO CO O co CO CO CO CO O CO Tf Tf f f Tf Tf Tf Tf Tf in in in in in in in ιn in in VO O VO

XT vo VO VO VO SO VO VO vo VO VO VO VO VO vo SO VO vo VO VO VO VO vo vo VO VO vo vo vo vo VO so o vo VO VO vo VO vo VO VO VO VO VO O VO VO vo vo vo VO VO vo VO vo

§ ω © © © © o o © © © © © © © © © © © © © © © © o © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © ©

00 O co co O O CO CO CO CO CO co co co CO O co O CO CO CO O CO O co CO CO co O O CO CO CO CO CO co O CO O CO CO CO co CO CO CO CO CO co CO CO CO CO CO CO a VO (-- oo ON © co OO σs co in r- © CN CN VO r- in VO r- 0r0- σr-s © Tf r- r- 00 ON © CN CO Tf in σs r- 00 ON CN CO ON in oo _t__l o in 00 ON © Tf to <N CN CN CN CN CO CO CO co in n VO VO VO vo r- r- r- 00 oo 00 σs ON σs © © © © © © CN CN CN CN CO Tf Tf in in vo vo VO CN

3 CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN N CN CN CN O CO O o o © o © © © © © © o © o o o © © © © o © © © © © © © o © o © © © © o o © © © © © © o © o © o © o o © o o o © o o O o © © © © © © o o o © o © © © © o o © © © © o © o o © © o © o o o © O © © © © o © © O © o o o o o o o ©

1-1 CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

9a ^ ^ ^ ^ ^ ^ Z Z ^ Z ^ ^ ^ ^ ^ ^ ^ Z TH TH TH ^ ^ ^ ^ Z TH TH TH TH .H TH Z TH TH ^ ^ ^ ^ ^ Z ^ TH ^ ^ ^ ^ Z .H TH Z ^ ^ ^

PH PH PH PH PH PH PH PH PH PH PH Pi PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH P_H PH PH Pi PH PH PH PH PH Pi PH PH to PH PH Pi o ϋϋϋ J CJ CJ CJ O O u ϋϋϋ J CJ CJ CJ CJ ϋ CJ J J J ϋ CJ ϋ ϋ CJ ϋϋϋϋϋϋϋ CJ CJ J CJ Ό CJ J o ϋ CJ J J ϋ ϋ CJ J J O O

.3 Q CN co Tf in VO IT- oo ON © CN O Tf in VO r T- 00 ON O CN CO Tf in VD r- 00 ON o CN co Tf in VO r- OO ON O CN co Tf in vo

Tf Tf Tf f Tf Tf f Tf Tf in in in in in in in ιn m in vo VO r- 00 ON O CN co m

-£> O O S co co CO CO CO CO VO vo VO VO O vo VO VO r-

X - C-- O I-- O r- r- r- (-• r- r- r- r- r- ιτ- Γ- r- ιτ- OO OO 00 oo 00 00

2 r toT

Tf Tf Tr-f r- t- ιr- r-- r- r-

Tf Tr-f r T-f r T--f Tr- r- r- r- l~- f Tf Tf Tf Tr- t~- f Tf r T- r- r- f Tf Tf Tf r- r- t— ir- ιτ- r- r- r- r- ι-~ r- t~- r- r- c~~ f- r- r- t— ir- r- r- r- r- r-

Tf Tf Tf f Tf Tf Tf Tf f Tf Tf Tf Tf Tf f Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf f Tf Tf Tf

PH 00 in in in in in in in in in in ιn in in in in in in in in in in in in in in in in in in m in in in in in in in in in in in in in m m in in i in in in in m in

00 ON © CN CO Tf n o r- 00 ON © CN CO Tf in vo r- 00 ON © CN CO Tf in vo r- r 00 σs © CN co in vo r- 00 ON © CN CO Tf in SO r- 00 ON o n rt 3 Tf Tf in in in in in in in in in in VO vo vo VO vo vo VO vo VO VO r- f- l r- r-- c-- t-~ r- 00 00 00 00 00 00 00 00 ON σs ON σs ON σs σs ON σs σs © o T" in in in in in in in i in i in in in in in in in in in in in in in in n i in in in in •n- rm- 00 OO in in in in in in m in in in in in in in in in in in in in SO VO rt to 00 00 00 oo oo oo oo oo oo oo oo oo 00 00 00 oo 00 oo oo oo oo 00 oo OO 00 oo 00 00 oo 00 oo oo oo oo oo oo oo oo oo 00 oo oo oo oo oo 00 00 00 oo oo oo oo oo oo 00

Q oo 00 00 SO © © © ιτ- vo in ir- VO r- σs co Tf in t- oo co co Tf Tf in VO © σs vo 00 VO in co Tf 00 oo in VO in VO CO CN co CN CN CO CN oo

CO CN VO 00 in o © co co CO CO m ON co co CN N f- VO 00 co co vo SO oo CN σs © © Tf vo vo in vo © CN Tf VO 00 CO © 00 CO in Tf O CO in Tf m

3 σs in in in m © CN CN CN IT- © r- CN CN VO VO vo r- CN CN CN CN © vo CN CN C- r- in •tf o CN VO SO r- © CN in in CN 00 t~- f co co co O CN Tf Tf CO co co co co co co CN O co CO O co © CN N co co o o co Tf co o co o © r C-N- ON Tf vo

CN Tf CN N o o T CN CN co O co CN co o © © © © © © © © © © © © © © o © © © © © © © © © © © o O © © © © © © © © © © © © © © © © © o © o O © © © © © rt CO CO r-H to ΓH ooooooooooooooooooooooooooooooooooooooooooooooooooo o-o o to OOUUUUUCJϋOOϋOUOOOϋOOOUUUOCJOOUUOOOϋOOUUUOUOϋϋUOOOOϋUOOϋ o pq w pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq ω pq pq pq pq pq pq pq pq pq pq pq pq pq pq W pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq

CO

00 t- St Q © CN CO Tf m VO r- 00 σs © CN CO Tf m VO r- 00 σs © CN CO Tf •n VO o 00 ON © CN CO Tf in ^ t 00 σs CN CO Tf m VO r- r- ιr- r- t~- i~- t-- r- f- r- 00 OO 00 oo 00 00 00 00 00 00 ON ON ON σs σs σs σs σs ON o © © © o r- 00 σs © CN CO o ON © © © © © © CN CN CN CN t- g c VO vo VO SO VO VO vo vo SO vo VO SO O VO SO VO VO VO o VO VO VO VO VO VO vo SO VO VO VO t-- C— C-- r- l~- o r- ιr- f- t-- I-- t-- r- r-- C-- r- r- r- r- r- r- r- r- r-

© ot CN CN <N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN N CN CN CN CN CN CN CN CN CN CN CN CN N CN N CN 0 Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf f "tf Tf Tf "t

CN PH 0 f Tf Tf Tf Tf Tf Tf Tf Tf f Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf

©

O - IP VO r- OO σs O CN O Tf in VO IT- 00 σs © CN CO Tf in VO r- OO ON O CN co Tf in VO r- OO σs © CN co Tf •n SO ιr- oo σs O N CO Tf in VO r- oo σs xT 00 00 oo oo ON ON ON ON σs σs σs σs ON σs O O O © © o © © o O CN CN CN CN CN N CN N CN CN co co co co co co O co CO O

P ω Tf Tf Tf •tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf in in m in in in in in in in in m in in in in in UO m in •n m in in in in m in in m in in in in in in in in in m

00 vo VO VO vo VO VO vo VO VO VO vo vo VO vo o vo VO O VO ^,VO vo SO vo vo so VO VO O so vo vo VO VO o VO VO VO VO VO vo ^■vo VO vo ^o o -VO VO VO vo vo O vo vo .o

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

6541 42725 ECO103566 18603 54787 CPN200330 30664 66848 PAE205544

6542 42726 ECO 100662 18604 54788 CPN200331 30665 66849 PAE205547

6543 42727 ECO102788 18605 54789 CPN200332 30666 66850 PAE205551

6544 42728 ECO103807 18606 54790 CPN200333 30667 66851 PAE205552

6545 42729 ECO103885 18607 54791 CPN200335 30668 66852 PAE205553

6546 42730 ECO100256 18608 54792 CPN200336 30669 66853 PAE205554

6547 42731 ECO103515 18609 54793 CPN200343 30670 66854 PAE205555

6548 42732 ECO 102787 18610 54794 CPN200344 30671 66855 PAE205559

6549 42733 ECO102310 18611 54795 CPN200348 30672 66856 PAE205560

6550 42734 ECO 101480 18612 54796 CPN200361 30673 66857 PAE205563

6551 42735 ECO102819 18613 54797 CPN200363 30674 66858 PAE205564

6552 42736 ECO 100135 18614 54798 CPN200364 30675 66859 PAE205565

6553 42737 ECO100136 18615 54799 CPN200367 30676 66860 PMU100003

6554 42738 ECO100140 18616 54800 CPN200372 30677 66861 PMU100004

6555 42739 ECO101684 18617 54801 CPN200377 30678 66862 PMU100006

6556 42740 ECO102303 18618 54802 CPN200382 30679 66863 PMU100019

6557 42741 ECO100236 18619 54803 CPN200392 30680 66864 PMU100031

6558 42742 ECO101994 18620 54804 CPN200393 30681 66865 PMU100032

6559 42743 ECO 100850 18621 54805 CPN200407 30682 66866 PMU100034

6560 42744 ECO202902 18622 54806 CPN200413 30683 66867 PMU100036

6561 42745 ECO 103054 18623 54807 CPN200415 30684 66868 PMU100037

6562 42746 ECO103528 18624 54808 CPN200424 30685 66869 PMU100041

6563 42747 ECO102880 18625 54809 CPN200429 30686 66870 PMU100043

6564 42748 ECO 102847 18626 54810 CPN200430 30687 66871 PMU100045

6565 42749 ECO 103408 18627 54811 CPN200431 30688 66872 PMU100060

6566 42750 ECO 103237 18628 54812 CPN200432 30689 66873 PMU100062

6567 42751 ECO 103780 18629 54813 CPN200434 30690 66874 PMU100069

6568 42752 ECO 102470 18630 54814 CPN200435 30691 66875 PMU100071

6569 42753 ECO 104019 18631 54815 CPN200436 30692 66876 PMU100079

6570 42754 ECO103646 18632 54816 CPN200439 30693 66877 PMU100093

6571 42755 ECO101084 18633 54817 CPN200442 30694 66878 PMU100098

6572 42756 ECO103572 18634 54818 CPN200448 30695 66879 PMU100105

6573 42757 ECO102335 18635 54819 CPN200450 30696 66880 PMU100112

6574 42758 ECO102764 18636 54820 CPN200453 30697 66881 PMU100113

6575 42759 ECO103710 18637 54821 CPN200454 30698 66882 PMU100114

6576 42760 ECO 102950 18638 54822 CPN200455 30699 66883 PMU100115

6577 42761 ECO 102949 18639 54823 CPN200456 30700 66884 PMU100117

6578 42762 ECO 103159 18640 54824 CPN200457 30701 66885 PMU100119

6579 42763 ECO101436 18641 54825 CPN200459 30702 66886 PMU100124

6580 42764 ECO101822 18642 54826 CPN200460 30703 66887 PMU100125

6581 42765 ECO103671 18643 54827 CPN200466 30704 66888 PMU100128

6582 42766 ECO103672 18644 54828 CPN200469 30705 66889 PMU100129

6583 42767 ECO101945 18645 54829 CPN200470 30706 66890 PMU100131

6584 42768 ECO 100473 18646 54830 CPN200472 30707 66891 PMU100133

6585 42769 ECO 102783 18647 54831 CPN200473 30708 66892 PMU100134

6586 42770 ECO 103221 18648 54832 CPN200477 30709 66893 PMU100136

6587 42771 ECO 103222 18649 54833 CPN200478 30710 66894 PMU100137

6588 42772 ECO 102690 18650 54834 CPN200479 30711 66895 PMU100138

6589 42773 ECO101712 18651 54835 CPN200483 30712 66896 PMU100139

6590 42774 ECO 103960 18652 54836 CPN200500 30713 66897 PMU100140

6591 42775 ECO 103220 18653 54837 CPN200501 30714 66898 PMU100141

6592 42776 ECO 100262 18654 54838 CPN200505 30715 66899 PMU100142

6593 42777 ECO 103422 18655 54839 CPN200506 30716 66900 PMU100143

6594 42778 ECO102507 18656 54840 CPN200508 30717 66901 PMU100144

6595 42779 ECO 102749 18657 54841 CPN200514 30718 66902 PMU100145

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

6651 42835 ECO102839 18713 54897 CPN200741 30774 66958 PMU100292

6652 42836 ECO100886 18714 54898 CPN200747 30775 66959 PMU100293

6653 42837 ECO 103298 18715 54899 CPN200756 30776 66960 PMU100301

6654 42838 ECO 100799 18716 54900 CPN200757 30777 66961 PMU100303

6655 42839 ECO104132 18717 54901 CPN200758 30778 66962 PMU100317

6656 42840 ECO205205 18718 54902 CPN200766 30779 66963 PMU100319

6657 42841 ECO103318 18719 54903 CPN200772 30780 66964 PMU100324

6658 42842 ECO 103781 18720 54904 CPN200776 30781 66965 PMU100328

6659 42843 ECO 102340 18721 54905 CPN200789 30782 66966 PMU100329

6660 42844 ECO 102075 18722 54906 CPN200790 30783 66967 PMU100331

6661 42845 ECO103580 18723 54907 CPN200792 30784 66968 PMU100333

6662 42846 ECO 104026 18724 54908 CPN200793 30785 66969 PMU100339

6663 42847 ECO 100409 18725 54909 CPN200794 30786 66970 PMU100344

6664 42848 ECO101752 18726 54910 CPN200796 30787 66971 PMU100346

6665 42849 ECO101753 18727 54911 CPN200800 30788 66972 PMU100347

6666 42850 ECO 100851 18728 54912 CPN200802 30789 66973 PMU100348

6667 42851 ECO102641 18729 54913 CPN200806 30790 66974 PMU100351

6668 42852 ECO101940 18730 54914 CPN200812 30791 66975 PMU100354

6669 42853 ECO302775 18731 54915 CPN200813 30792 66976 PMU100355

6670 42854 ECO100996 18732 54916 CPN200824 30793 66977 PMU100358

6671 42855 ECO 100997 18733 54917 CPN200827 30794 66978 PMU100359

6672 42856 ECO103883 18734 54918 CPN200838 30795 66979 PMU100364

6673 42857 ECO100809 18735 54919 CPN200839 30796 66980 PMU100365

6674 42858 ECO100810 18736 54920 CPN200841 30797 66981 PMU100369

6675 42859 ECO104036 18737 54921 CPN200842 30798 66982 PMU100370

6676 42860 ECO102722 18738 54922 CPN200846 30799 66983 PMU100376

6677 42861 ECO102040 18739 54923 CPN200847 30800 66984 PMU100379

6678 42862 ECO101498 18740 54924 CPN200848 30801 66985 PMU100388

6679 42863 ECO201937 18741 54925 CPN200849 30802 66986 PMU100389

6680 42864 ECO101088 18742 54926 CPN200850 30803 66987 PMU100392

6681 42865 ECO 102990 18743 54927 CPN200851 30804 66988 PMU100405

6682 42866 ECO100798 18744 54928 CPN200855 30805 66989 PMU100411

6683 42867 ECO101525 18745 54929 CPN200856 30806 66990 PMU100412

6684 42868 ECO101526 18746 54930 CPN200861 30807 66991 PMU100413

6685 42869 ECO103943 18747 54931 CPN200869 30808 66992 PMU100414

6686 42870 ECO104090 18748 54932 CPN200871 30809 66993 PMU100416

6687 42871 ECO101679 18749 54933 CPN200876 30810 66994 PMU100425

6688 42872 ECO103049 18750 54934 CPN200877 30811 66995 PMU100433

6689 42873 ECO101780 18751 54935 CPN200879 30812 66996 PMU100435

6690 42874 ECO101637 18752 54936 CPN200887 30813 66997 PMU100438

6691 42875 ECO 101406 18753 54937 CPN200889 30814 66998 PMU100439

6692 42876 ECO100153 18754 54938 CPN200890 30815 66999 PMU100440

6693 42877 ECO100113 18755 54939 CPN200891 30816 67000 PMU100444

6694 42878 ECO101700 18756 54940 CPN200893 30817 67001 PMU100448

6695 42879 ECO100167 18757 54941 CPN200894 30818 67002 PMU100453

6696 42880 ECO103160 18758 54942 CPN200895 30819 67003 PMU100455

6697 42881 ECO103161 18759 54943 CPN200896 30820 67004 PMU100456

6698 42882 ECO103064 18760 54944 CPN200902 30821 67005 PMU100460

6699 42883 ECO102056 18761 54945 CPN200903 30822 67006 PMU100463

6700 42884 ECO100974 18762 54946 CPN200907 30823 67007 PMU100465

6701 42885 ECO103523 18763 54947 CPN200908 30824 67008 PMU100466

6702 42886 ECO100102 18764 54948 CPN200909 30825 67009 PMU100483

6703 42887 ECO101882 18765 54949 CPN200910 30826 67010 PMU100486

6704 42888 ECO102259 18766 54950 CPN200914 30827 67011 PMU100513

6705 42889 ECO102136 18767 54951 CPN200915 30828 67012 PMU100517 σs CO Tf in © O 00 CN VO CO Tf 00

Tf Tf Tf m in in vo f- f- 00 00 oo 00 vo vo VO VO O O vo VO vo

CN co Tf in VO Γ- OO ON O CN CO Tf in v

Tf Tf Tf in in in in in in m in in m VO VO SO o VO vo vo r- r- r- r- r- r- r vo VO VO vo vo vo VO vo VO o VD VO vo o vo σs © CN CO Tf in VO r- 00 σs © CN r- 00 00 0

00 00 oo 00 oo oo 00 00 00 00 00 00

CO co CO CO CO O CO co CO co co O O co co CO CO co co

CN CN CN <N CN CN CN CN CN CN CN CN CN CN C

Irt CJ CJ CJ CJ CJ U CJ ϋ

CN CO Tf in VO r- OO ON O CN O Tf i

ON σs ON σs ON ON O O © o ©

ON ON ON σs σs σs σs ON σs ON σs σs σs o O O o ©

Tf in in in in in i i

ON O CN CO Tf m vo c- 00 σs © l-H

CN CN

00 OO 00 00 0

00 00 00 00 00 00 oo oo 00 00 00 00 00

vo 00 00 ON 00 © in _→ CO f in 00 in 00 r

VO SO 00 Tf CN m CN N CO in Tf O

CN co r- © vo o 00 © in CN N CO Tf 00 0

Tf in CN o CN co CN CO © ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ pq pq pq pq pq pq pq pq pq pq pq

ON © CN CO

CO CO CO O CO CO CO CO Tf f Tf "tf σs ON σs σs σs ON ON σs ON ON ON ON σs ON ON ON

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

Tf Tf Tf Tf Tf ^■tf r- 00 σs © CN CO f in VO r- 00 ON

Tf Tf Tf Tf Tf Tf Tf Tf in in in ■n in in in ■n in m vo VO VO VO VO VO VO vo VO vo vo vo vo vo VO vo o

c^ ^ co co co c σs σs σN ON σs σs σs σs σs σs σs σs σs o©[rj (o©ii c©on no© co©T) o(©T) (o©ti _fo©n to©f| (o©fj

CN CN CN CN C

PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH Pi P

00 σs © CN co Tf in VO t-~ OO ON ©

CN CN CN CN CN CN CN CN CN CN CO C

CN CN CN CN CN CN CN CN C t- ιr- r- C

VO V© v© V© V© v© V© v© v© v© v© V© v© V© v© vo V in VO IT- oo ON © CN CO Tf ■n O r O CO co CO CO CO CO CO "tf Tf Tf f f Tf T

CO co CO co CO CO co CO CO ro co CO co co co

CO Tf © CO CO Tf in 00 V© T- vo VO t- t- t-- 00 00 σs ON ON © C

CO ro co CO CO CO CO co CO co CO CO ro ro CO Tf Tf T

E-H E-i E-i E-H f-H H t→ t-H t-H

ON o CN ro Tf in vo r- oo ON

V© o VO r ι i

Tf in vo t- 00 ON © _l_₁ N ro Tf m v t- 00 00 oo 00 00 00 0 σs ON ON σs ON ON ON OS ON σs O

00 00 00 00 OO 00 OO 00 00 00 00 00 00 0

ON in VO O CN in O t-- V

Tf in f- co Tf OO ON in OO OO in CO V©

OO CN C

CO CO o CN co CN CN ro co CO CN C

O

pq pq w w w pq pq pq pq pq pq

VO o CN ro f m vo t- 0 ro co co ro ro ro ro co ro co co r

Tf Tf Tf Tf Tf Tf "tf N ro Tf in vo t- 00 σs © CN co ^■

CN CN CN CN C

ON σs σs σs ON ON ON σs σs σs ON ON σs O o vo VO V© vo vo vo vo V© VO vo VO VO O VO vo v

CO in vo co "tf c-- σs © co in cN vo .—t "rf CN CO CO CO co co in in in in vo vo VO f- t- 00 00

00 OO 00 00 00 CN CN PH t-ι E-I E-H

co co ro e^ o ro

— c — t — r-^ t — t — t — c— - c — t — r— t — - t — c — tr— - tr— t: — • c — t — ^• t — ^■ c — t— - t— - t — r— tr— t — • t—- t —

ι co τf © vo t— σs cN in vo OO OO OO OO ON OS ON OS © © © CN CN C^

σs © τ-ι cN co τf in vo t— i vo vo vo vo vo v© vo t— t— t— t— t— t— t— t— t— t— t— t— t— t— t— t— t— t—

oo oo oo oo oo oo oo

oo in t— l cO Tf VO ON ON O © © © !— I i i— i cN rO ro rO cO CO CO CO CO C^ C^ Tf Tf Tf Tf Tf Tf Tf Tf

vo t— ι cN co τf in vo t— oo ON O ON ON OS ON ON Os O O O O O O O © ©

"tf in vo t— oo σs © τ-H CN cθ _"tf in vo σs σs σs σs © © © © © © © © O O τ- I rt i— τf τf τf "tf τf "tf τf τf l^ (ϊl O^ O O^ O\ 0^ o o^ O^

Tf co co CO t— T-H 00 ro in CN CN CN CN C^"N^'

3 PH3PH3PH3PH3PH 3 PH3PH 3PH3PH3PH Ot— J ii —-π I cN c CoO ' XtfT i *n/ 1 v sof t l— — oo σs © τ —-H I C CNN c CoO - TtfT i vnt v©^ ι ι—^- o υovj σ UNs θ τ-H CN co τf in vo t- oo CN- co co cO cO - cO - c - cO - cO - cθ rrOO τf τf τf τf τf τf τf τf τf m in in in in in in co co ro ro ro ro ro ro ro co Tf Tf Tf -tf Tf Tf

VO rt τ-H CN cN τ-H CN τf

CN CN CN CO CO O CN CN c^ cO c^ cO CO CO CO

'^H; i io CN CN CN CN CN CN CN t— t— t— t— t— t— t— t- t— t— t- r- t— t— Φ O VO W 10 © ¹O

^

σN t— σs cN cN in oo ro ιn ro σs oθ τ-ι oo oo oo © © © τ-H τ-H τ-H τ-H CN CN co co 'tf in t- t— σs σs © © τ-H co t— t— t— t—

τ— ι cN ro τf in vo t- oo σs © τ— I vo vo vo vo t— c— t— t— t— t— t— t— t— t— oo oo 5\ 0\ 0\ 0\ OS OS OS ft

σs CN © σs σs

ON in ro Tf OO CN CN Tf CO in

Tf VO © t— t— Tf

Tf CN CN N

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

3 PH3 PH3 PH 3 Pi 3 P3 PH 3 PH 3 PH3 PH3 PH3 PH 3 PH 3 PH3 PH ro Tf in vo t— OO ON O T- i cN rO 00 00 0N 0N Os 0S 0N 0N 0N 0N 0N 0N © O O © ro co c

r- t—

1—

©

<N

H

CJ

PH

CO so

T-H t- t-

©

<N

©

O

τ-ι τ4- t— CN t— © VO ON CN in _ vo CN t 00 00 00 © T-H CN in vo o r- r— c~ t ^ PH PH PH PH PH PH PH PH PH PH PH P PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH P cΛ ^^■ ιn ¹ I (CsN| MCN (CNsl MCN (^^ M N N (sl M cιl M m (τl m ^^ll m tη t 't ^ ^ ^ ^ OOS^ lOϊSι OOsι OO^S 0CT^s OOS (O3N^ ( 0^ 0^ O^ O^ 0^ O^ 0^ O^ 5^ 0\ 0 0^ σι O\ 0 O^ 0^ 0^ 0 0^ 0 t— t- t- t- t— t- t— t— t- t— t— t— t— t VO VO VO V ^■O - VO VO VO VO VO VO VO VO VO VO VO VO VO VO VO V O H ( r— r— r— r— r— r— r— t — r— t — r

oo co in vo t— oO rt CN -_xf oo -_xf Os cN Os © cN vo oo ON CN co -_xf in v© r- cN m vo oo oo t— cN ON i vvpo vvpo svoo tt--- tt—- tt—— ttf- tt— t— 00 00 00 00. O _N . C t— t CN CN CN CN CN CN CN C^ m

in vo oo σs © τ-H CN co τf i t r i——— tr i—-— r ι—— t c i——— t r i——— o o ooσu oooooσ ooϋooj oouovoj oouoou ooυ oooo oooo oooo oooo oooo oooo oooo oooo oooo oooo oo in i i in in in in in in in i

OO ON OS ON ON ON ON OS CJS ON ON O vo vo v© so vo vo vo v© v© s© r— t C O^ O\ O ^Λ σι O^ O Λ O^ O

CO vo

CO σs in in oo in VO CN CN I—

00 VO VO N N CN CN t C

00 00 OO oo co oo oo oo oo oo oo xn 00 00 00 00 00 00 00 00 xn xn xn xn x O _H ( | © i— i rH r-H i— i τ-H τ-H τ— i t— i i— tr—— t t—— t t—— tt—— t r—- tr—- t t—- tt—— t t—— tt—— O ooO OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo OoOo O CC^^ CCOO CCOO CCOO CCO CC CCO CCOO CC^^ CO CO C C^ CO c ) CO C CO C^

CN CN CN CN CN CN CN CN CN CO CO CO CO CO CO CO CO CO vo vo vo vo vo vo t— t— i— t— i— i— t— r> t— t— t- t- t- t— t— r-

Tf . v _© t .- t— CN in σN σ^ PH PH PH PH PH PH PH PH PH PH PH PH PH P^ PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH ιΛ ιo ^ ι>3 O H M ffl < ι^l V oo oo oo oo oo oo oo oo oo o

cN "tf © τ— i c co in cN Tf σs © © © © vo

vo t— oo σs O i— I CN CO in ON OS ON ON Os ON ON Os © © © © O O O O © © © © © — ⁱ — ⁱ — ⁱ — ⁱ

co CN o in o ON o oo CN Tf 00 in O in t— © CN in in

CN © CN

00 00 00 00 00 00

00 O 00 00 00 00 00 o 00

CO Tf •n VP r- 00 O co co co co Tf Tf Tf Tf

Tf

Tf Tf Tf

vo τf vo cN τf t— oo cN in t- "tf in vo t— co τ oo σs © τ-H rt co t— t t— t— t— t— t— oo oo oo oo oo o

PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH-PH PH PH P PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH P ^co -xf i^|Λn Cvo t— oMo moN o H l n ^ ιιl ^o ^ oo O rt rt rt rt rt rt CN CN CN CN CN CN CN CN CN CO C co co ro co co co ro c^ oo oo oo oo oo oo oo oo oo o

t— oo σs O i— ι CN co "tf in vo t co cO cO CO "tf τf 'tf τf 'tf -tf τf τ CN CN CN CN CN CN CN CN C^

in σs i— ι τf v© O cN CO T t— OO OO OO ON ON © Tf T

M ft CN CN CN CN CN CN CN CN CN C^

rt CN m vo t— VO vo ON ON CO t— t— CO co vo 00 © Tf CO VO t _- Tf vo i— I i— I

OO 00 00 oo oo OO CN CN OO OO OO OO OO xn xn xn σs O τ-H CN ro τf ιn vo r- oo CN CN CN

^|ιι W ^ M a θ H N cfi 't ιo β oo a θ H N cτi ^ O-N O -N O -s O -N O -N O -N O -N O -N O -s O -N — — l l— I rt CN CN CN CN CN < © © i©— '.^■-© i— < 0ι— * 0 v— * 0 © <— ' ©._, ©._. ©._, 0.— ' ©v—' 0i—' 0^ 0 © © ©.—' 0v— ' 0i— ' 0>—; OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO

Q ON O Tf in vo r- 00 σs vo in CN © CN © CN σs © 00 CN 00 Tf o O m t- in Tf VO t- 00 CN r- σs CO in t- CO vo t— σs © Tf ON © CN Tf σ to Tf in in in in •n in in vo VO t- 00 σs σs © CN CN CN CO CO Tf in vo V© vo t- σs © © © © CN ro CO CO Tf •tf Tf Tf Tf m t- t- 00 00 ON ON σs σs σ o 3 in m in in in in in in m in m in m in vo VO VO vo VO Vp VO VO VO vo vo vo vo vo VO t— c— t- r- r- t— t— t— t- t— r- t- t— r- r- t— t- t- r- t- r- r- t- t— l o © o o © © o o o o © © © o o © © O © o © © © © o o o o o o o o © © o o © © © © © © o © © o o o o © o © © © o o o © © o o o o o © © o o o o o © © © © © © o © © o o o O o o o o o © © o © © o o o o o © o o o o © © © r- t-l

© ω E-i E-H H H E-H E-! H H H H H H H H t-l t-l H H H E-H H H E-H H H H E-i H H tH H H E-i E-H H H H t-l H H f-H t-H f-H H H f-H H H H H H E-H E-i σs a CD PH PH PH P^ PH PH PH PH P^ PH PH PH PH P^ PH PH PH PH PH PH PH P^ P^ PH P^ PH PH

<N ϋ PH PH PH PH PH PH PH Pi PH PH

.3 P CO Tf in VO r- 00 ON © CN CO Tf in VP t- 00 σs © CN O Tf m SO t— 00 ON © CN CO Tf in VO r- 00 σs © CN CO Tf in VO t— 00 σs © CN ro Tf in v to HH Tf f Tf Tf in in in •n m m m m in vo VO p VO VO V© VO v© VO VO t— t— t— t— C- r- r- r- t— r- 00 00 00

H Tf Tf Tf in 00 00 00 00 00 00 00 ON ON ON ON ON ON σ o tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf "t

CJ to Tf Tf Tf Tf oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo of Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf o oo OO oo oo OO OO OO oo oo oo •otf Tf Tf Tf o oo oo oo •otf Tf Tf Tf o 00 oo oo "otfo Tf Tf Tf Tf oo oo oo oo _"otf Tf Tf Tf Tf Tf Tf Tf T

£ o oo oo oo oo oo oo oo o

00 VO o o vo so vo vo vo vo vo SO vo vo VO SO vo vo VO o SO VO VO SO so VO SO VO VD s v© so SO vo SO v© SO s VO vo VO VO VO vo VO SO VO VO VO SO VO vo VO V© S

PH σs © CN CO Tf in vo t- 00 σs © CN co Tf in SO t— 00 σs © CN co Tf in vo t— 00 σs © CN co Tf in VO t— 00 ON o CN CO Tf in VO t— 00 σs © C rt PH in VO VO VO so VO VO vo vo VO vo r- t— t— t— t— t— t— t— t— oo 00 oo oo 00 oo oo oo oo OO σs ON ON σs σs σs σs ON ON ON © o © © © © © © © o tf CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN co O co CO co CO co co CO ro CO co c

5 to CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

CO co co CO CO CO co CO co CO co co co co co co o co co co co CO CO co co CO CO co CO CO CO CO co co CO co CO co CO CO CO CO co co co co co co CO CO CO ro co O c

Q vo co © ON σs CO o Tf Tf ON m Tf in co co Tf VO CN 00 Tf CN r- 00 CN Tf in vo t— 00 ON O 00 Tf CO ON ON CN VO CN Tf in CN t— 00 CN o VO t— o to in CN t— © in o © O ON VO CO ON in O © CN ro Tf in vo t— t— t— OO 00 oo 00 00 00 00 ON ON ON CO Tf "tf in VO VO t— r- t— 00 oo 00 in in vo O VO 0

VO t- t— t- tr- r- t— t— t- r- t- t- r- t- 00 O o O o o o © o O © © o © © © © © © © © O © © © © o © © © o o © o o O © © ©

O © © © © © © © © © © © © © © © © o O o o o o o o o © © © © © © © O O © © © O © O © © © o o o o o o © © © © ι-4 ω ϋϋϋϋϋϋϋϋϋϋϋϋϋϋϋOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO a CQ CQ PQ PQ PQ PQ PQ PQ PQ PQ PQ PQ PQ CQ CQ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ U ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ ϋ pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq w w w pq pq pq pq pq p

.3 Q CN CO Tf in vo t- oo ON © CN CO Tf in vo r- 00 ON © CN CO Tf m VO t- oo ON © CN CO Tf in V© r- 00 ON o CN CO Tf in so t— 00 ON © CN CO Tf to oo oo oo 00 oo 00 00 00 ON ON ON ON ON ON σs ON ON ON © © o © O © © o © © CN CN CN CN CN CN CN CN CN CN co co ro co co c o tf CO CO CO co co co co co ro CO CO co co CO co co co co Tf Tf Tf Tf Tf Tf Tf •tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf "tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf T ω vo VO V© vo VP VO V© vo VO vo VO vo VO VO vo VO VO vo VP VO VO VO VO VO vo V© VO V© vo VO vo VO vo VO SO vo SO vo VO VO VO O VO V© VO vo V© VO V© vo VO V© VO v

Pi 00 in in in in in in in in in in in in in in in in in in in in in in in in in in m in in in in in in in in in in in in in in in in in m in in in in in in in in i

00 ON © N ro Tf in vo t- 00 σs © N CO Tf in vo r- 00 σs © CN CO Tf in vo t— 00 ON © CN co Tf in vo t— 00 ON © CN CO Tf in SO t- oo ON o T-H rt C CN CN CO CO CO co CO CO co co CO CO Tf Tf f Tf Tf Tf "tf f Tf Tf in in tfH ON σs o © © © © © © © © © CN CN CN N CN CN CN N

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN g to © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © o © o o © © o © © © © © © © © © © © © © ©

00 CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

Q t— r- oo CN CN f in in CN in ON 00 CN CN CN © ON ON co in VO VO OO Tf in co Tf SO in VO t— VO O ON ON OO O co o ON O VO o t— OO t— t—

CO t— CN CO © VP © CO CO o 00 VO σs © in CO CN VO © in in t— co Tf in CN CO in 00 ON t— 00 00 CO CN Tf CN in VO in CN OO CO CO ON

3 r- VO 00 CO in VO OO σs in VO 00 CO m σs CO 00 00 CN t— CN CN © t— CO in in "tf m CO t— vo Tf VO Tf in CN © CO CO CN CO VO to CN

O o © © o © © o o o © © © © O © © O o © © © o O © © © © © © © © © © © © © © © © O © © © © © © © © © © © © © © ι-4 oo OO OO oo oo oo 00 OO 00 OO OO co co 00 OO 00 OO 00 OO oo 00 00 OO OO oo oo oo 00 00 00 00 00 00 00 00 00 00 00 00 oo 00 OO 00 oo 00 OO 00 CN 00 00 00 00 OO ω pppppppppppppppppppppppppppppppppppppppppppppppppppppp aω < < < < < ^ < < < < < < < <^ < < < <

CD xn 00 00 00 00 00 00 00 00 00 CO 00 00 00 00 00 00 00 xn 00 00 00 xn 00 00 00 00 00 00 00 00 00 00 00 00 00 CO 00 00 00 00 00 00 00 00 00 00 xn CO 00 00 00 O 00

CO so .3 Q © CN co -tf in V© c— oo ON © CN ro Tf in VO t— 00 σs © CN co Tf in VO t— 00 ON O CN co Tf m v© r- oo ON © CN CO Tf in vo t— oo ON o CN O

TH tυ CN CN CN CN CN CN CN CN CN CN CO CO CO CO CO CO CO CO CO CO Tf Tf Tf Tf Tf f Tf Tf Tf Tf in m in in m in m in in m vp VP vo VO v© vo VO VO VO VO t— r- t- t- r- O CO CO CO CO O CO CO CO CO CO CO O CO CO O CO O CO CO CO CO CO CO CO CO CO CO CO CO ro CO CO co CO r- o cf CO CO CO CO CO CO CO ro CO CO CO CO CO CO CO CO CO CO CO C ω Tf Tf Tf Tf f Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf f Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf •tf Tf Tf Tf Tf

<N

© o 0 vo r- 00 ON © CN ro Tf in VO t- 00 σs © CN O Tf in vo t— 00 ON © CN CO "tf in vo t— 00 ON © CN CO Tf in VO r- 00 σs © CN CO Tf in vo r- 00 ON z, tf CO co co co f Tf Tf Tf Tf Tf Tf Tf Tf Tf in in in in in in in in in in VO VO VO SO v© VO v© s© vo VO t— t— t— t— t— t— C- r- t- t— oo 00 00 oo oo 00 oo oo 00 oo

5 to O oo 00 00 00 00 00 00 00 00 00 CO 00 00 oo 00 00 00 00 00 00 00 00 00 00 00 00 OO 00 oo oo 00 00 00 00 oo 00 00 00 00 oo oo oo oo oo oo 00 00 oo 00 00 oo 00 00 O

ON C oo 00 00 OO ON ON ON

VO vo vo vo VO V© VO VO VO VO r

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C → H t-ι H h→ l-H h→ h→ h→ h→ h→ h→ h→ h→ h→ h→ l-H h→ h→ h

PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH P

CN CO Tf in VO t— 00 OS © CN CO Tf in

CN CN CN CN CN CN C

OO 00 OO 00 00 00 OO 00 00 00 00 00 oo 00 00 0 oo oo oo 00 oo 00 oo oo oo 00 oo oo o

SO VO vo VO VO vo VO VO vo vo V© vo VO VO VO vo V

ON o CN co Tf in VO I— oo ON o C

CN CN co ro ro co co co co co co co Tf Tf T o VO O VO o VO vo vo vo vo VO VO vo VD vo v

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

CO CO CO ro co CO CO CO CO co ro CO CO CO CO CO O CO CO CO r

CO oo o vo t— CN oo CO t— r— oo in r

CN CN Tf in in in in O VO 00 CO CO Tf i

V© VP vo vo vo VO VO vo V© t— t— t- t— t- t

CO CO ro CO O CO O CO O ro CO CO CO CO CO CO CO CO CO C

pq pq pq pq pq pq pq pq pq pq p

CO Tf in vo r- 00 ON o CN CO Tf i in in in in in in in in in vo VO VO VO vo v r- t— t— r- r- r- t— t— t— t— t- r vo o s© v© VO VO vo vo o vo vo V© VO VO vo vo vo VO V i - oo σs © N co in VO t- 00 σs © T- r- r- t— t— r- r- r- t— t— r- 00 0 in i

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C in VO CO © ro ON o ,_, m VO ON co ON

SO 00 00 σs © CO CO CO Tf Tf V t— r- r- r- t— t— t— 00 00 OO 00 00 00 00 00 oo O

r→ CN CO "tf in vo t- 00 σs © CN C σs ON ON σs σs σs © © ©

V© V© VO VO VO VO V© VO VO VO VO vo V© f - tr- t- r

T Tf Tf Tf Tf T

Tf Tf Tf f Tf T

OO σ

00 00 00 00 00 00 00 00 'OO 00 00 00 0

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

8631 44815 ABA101621 20693 56877 EFA200160 32754 68938 PRT103789

8632 44816 ABA101625 20694 56878 EFA200166 32755 68939 PRT103854

8633 44817 ABA101658 20695 56879 EFA200169 32756 68940 PRT103866

8634 44818 ABA101661 20696 56880 EFA200171 32757 68941 PRT103868

8635 44819 ABA101674 20697 56881 EFA200173 32758 68942 PRT103877

8636 44820 ABA101677 20698 56882 EFA200188 32759 68943 PRT103889

8637 44821 ABA101702 20699 56883 EFA200190 32760 68944 PRT103897

8638 44822 ABA101710 20700 56884 EFA200191 32761 68945 PRT103903

8639 44823 ABA101740 20701 56885 EFA200193 32762 68946 PRT103927

8640 44824 ABA101766 20702 56886 EFA200201 32763 68947 PRT103939

8641 44825 ABA101768 20703 56887 EFA200202 32764 68948 PRT103954

8642 44826 ABA101792 20704 56888 EFA200208 32765 68949 PRT103978

8643 44827 ABA101795 20705 56889 EFA200214 32766 68950 PRT103983

8644 44828 ABA101804 20706 56890 EFA200222 32767 68951 PRT103989

8645 44829 ABA101808 20707 56891 EFA200225 32768 68952 PRT104001

8646 44830 ABA101828 20708 56892 EFA200232 32769 68953 PRT104002

8647 44831 ABA101831 20709 56893 EFA200235 32770 68954 PRT104009

8648 44832 ABA101842 20710 56894 EFA200236 32771 68955 PRT104013

8649 44833 ABA101843 20711 56895 EFA200241 32772 68956 PRT104077

8650 44834 ABA101855 20712 56896 EFA200242 32773 68957 PRT104089

8651 44835 ABA101867 20713 56897 EFA200243 32774 68958 PRT104091

8652 44836 ABA101872 20714 56898 EFA200249 32775 68959 PRT104094

8653 44837 ABA101879 20715 56899 EFA200252 32776 68960 PRT104101

8654 44838 ABA101887 20716 56900 EFA200256 32777 68961 PRT104136

8655 44839 ABA101889 20717 56901 EFA200259 32778 68962 PRT104154

8656 44840 ABA101891 20718 56902 EFA200263 32779 68963 PRT104171

8657 44841 ABA101894 20719 56903 EFA200265 32780 68964 PRT104174

8658 44842 ABA101897 20720 56904 EFA200268 32781 68965 PRT104175

S659 44843 ABA101933 20721 56905 EFA200270 32782 68966 PRT104187

8660 44844 ABA101939 20722 56906 EFA200289 32783 68967 PRT104202

8661 44845 ABA101949 20723 56907 EFA200305 32784 68968 PRT104207

8662 44846 ABA101954 20724 56908 EFA200313 32785 68969 PRT104233

8663 44847 ABA101956 20725 56909 EFA200318 32786 68970 PRT104263

8664 44848 ABA101958 20726 56910 EFA200328 32787 68971 PRT104264

8665 44849 ABA101961 20727 56911 EFA200335 32788 68972 PRT104285

8666 44850 ABA101985 20728 56912 EFA200336 32789 68973 PRT104291

8667 44851 ABA102020 20729 56913 EFA200337 32790 68974 PRT104299

8668 44852 ABA102113 20730 56914 EFA200342 32791 68975 PRT104353

8669 44853 ABA102114 20731 56915 EFA200345 32792 68976 PRT104367

8670 44854 ABA102118 20732 56916 EFA200347 32793 68977 PRT104379

8671 44855 ABA102122 20733 56917 EFA200349 32794 68978 PRT104380

8672 44856 ABA102159 20734 56918 EFA200363 32795 68979 PRT104389

8673 44857 ABA102167 20735 56919 EFA200364 32796 68980 PRT104399

8674 44858 ABA102168 20736 56920 EFA200365 32797 68981 PRT104405

8675 44859 ABA102170 20737 56921 EFA200367 32798 68982 PRT104418

8676 44860 ABA102199 20738 56922 EFA200371 32799 68983 PRT104423

8677 44861 ABA102246 20739 56923 EFA200374 32800 68984 PRT104430

8678 44862 ABA102248 20740 56924 EFA200376 32801 68985 PRT104443

8679 44863 ABA102251 20741 56925 EFA200377 32802 68986 PRT104446

8680 44864 ABA102257 20742 56926 EFA200379 32803 68987 PRT104465

8681 44865 ABA102299 20743 56927 EFA200380 32804 68988 PRT104466

8682 44866 ABA102315 20744 56928 EFA200383 32805 68989 PRT104467

8683 44867 ABA102320 20745 56929 EFA200384 32806 68990 PRT104476

8684 44868 ABA102333 20746 56930 EFA200385 32807 68991 PRT104499

8685 44869 ABA102335 20747 56931 EFA200386 32808 68992 PRT104501 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

8686 44870 ABA102336 20748 56932 EFA200390 32809 68993 PRT104507

8687 44871 ABA102339 20749 56933 EFA200393 32810 68994 PRT104518

8688 44872 ABA102343 20750 56934 EFA200395 32811 68995 PRT104530

8689 44873 ABA102357 20751 56935 EFA200396 32812 68996 PRT104531

8690 44874 ABA102358 20752 56936 EFA200401 32813 68997 PRT104542

8691 44875 ABA102360 20753 56937 EFA200404 32814 68998 PRT104544

8692 44876 ABA102375 20754 56938 EFA200419 32815 68999 PRT104545

8693 44877 ABA102417 20755 56939 EFA200422 32816 69000 PRT104576

8694 44878 ABA102422 20756 56940 EFA200424 32817 69001 PRT104586

8695 44879 ABA102434 20757 56941 EFA200426 32818 69002 PRT104596

8696 44880 ABA102453 20758 56942 EFA200427 32819 69003 PRT104598

8697 44881 ABA102462 20759 56943 EFA200429 32820 69004 PRT104604

8698 44882 ABA102495 20760 56944 EFA200432 32821 69005 PRT104614

8699 44883 ABA102496 20761 56945 EFA200434 32822 69006 PRT104636

8700 44884 ABA102498 20762 56946 EFA200438 32823 69007 PRT104641

8701 44885 ABA102500 20763 56947 EFA200443 32824 69008 PRT104644

8702 44886 ABA102501 20764 56948 EFA200448 32825 69009 PRT104654

8703 44887 ABA102503 20765 56949 EFA200462 32826 69010 PRT104687

8704 44888 ABA102523 20766 56950 EFA200464 32827 69011 PRT104688

8705 44889 ABA102526 20767 56951 EFA200470 32828 69012 PRT104690

8706 44890 ABA102541 20768 56952 EFA200471 32829 69013 PRT104691

8707 44891 ABA102546 20769 56953 EFA200474 32830 69014 PRT104693

8708 44892 ABA102548 20770 56954 EFA200476 32831 69015 PRT104700

8709 44893 ABA102567 20771 56955 EFA200477 32832 69016 PRT104707

8710 44894 ABA102578 20772 56956 EFA200479 32833 69017 PRT104710

8711 44895 ABA102625 20773 56957 EFA200480 32834 69018 PRT104726

8712 44896 ABA102630 20774 56958 EFA200493 32835 69019 PRT104730

8713 44897 ABA102635 20775 56959 EFA200509 32836 69020 PRT104732

8714 44898 ABA102651 20776 56960 EFA200510 32837 69021 PRT104736

8715 44899 ABA102697 20777 56961 EFA200527 32838 69022 PRT104738

8716 44900 ABA102759 20778 56962 EFA200549 32839 69023 PRT104740

8717 44901 ABA102772 20779 56963 EFA200551 32840 69024 PRT104743

8718 44902 ABA102812 20780 56964 EFA200566 32841 69025 PRT104768

8719 44903 ABA102827 20781 56965 EFA200573 32842 69026 PRT104772

8720 44904 ABA102842 20782 56966 EFA200587 32843 69027 PRT104789

8721 44905 ABA102849 20783 56967 EFA200592 32844 69028 PRT104794

8722 44906 ABA102855 20784 56968 EFA200593 32845 69029 PRT104799

8723 44907 ABA102859 20785 56969 EFA200604 32846 69030 PRT104808

8724 44908 ABA102872 20786 56970 EFA200608 32847 69031 PRT104823

8725 44909 ABA102876 20787 56971 EFA200628 32848 69032 PRT104826

8726 44910 ABA102882 20788 56972 EFA200629 32849 69033 PRT104827

8727 44911 ABA102900 20789 56973 EFA200635 32850 69034 PRT104831

8728 44912 ABA102906 20790 56974 EFA200641 32851 69035 PRT104834

8729 44913 ABA102927 20791 56975 EFA200646 32852 69036 PRT104849

8730 44914 ABA102929 20792 56976 EFA200648 32853 69037 PRT104862

8731 44915 ABA102930 20793 56977 EFA200654 32854 69038 PRT104870

8732 44916 ABA102959 20794 56978 EFA200656 32855 69039 PRT104876

8733 44917 ABA102979 20795 56979 EFA200657 32856 69040 PRT104879

8734 44918 ABA103034 20796 56980 EFA200658 32857 69041 PRT104883

8735 44919 ABA103036 20797 56981 EFA200659 32858 69042 PRT104884

8736 44920 ABA103059 20798 56982 EFA200665 32859 69043 PRT104887

8737 44921 ABA103073 20799 56983 EFA200672 32860 69044 PRT104892

8738 44922 ABA103075 20800 56984 EFA200676 32861 69045 PRT104897

8739 44923 ABA103108 20801 56985 EFA200678 32862 69046 PRT104898

8740 44924 ABA103119 20802 56986 EFA200679 32863 69047 PRT104902

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

8796 44980 ABA103925 20858 57042 EFA200880 32919 69103 PRT105300

8797 44981 ABA103926 20859 57043 EFA200882 32920 69104 PRT105301

8798 44982 ABA103927 20860 57044 EFA200888 32921 69105 PRT105310

8799 44983 ABA103932 20861 57045 EFA200895 32922 69106 PRT105312

8800 44984 ABA103937 20862 57046 EFA200896 32923 69107 PRT105337

8801 44985 ABA103947 20863 57047 EFA200904 32924 69108 PRT105340

8802 44986 ABA103948 20864 57048 EFA200908 32925 69109 PRT105359

8803 44987 ABA103956 20865 57049 EFA200943 32926 69110 PRT105365

8804 44988 ABA103970 20866 57050 EFA200947 32927 69111 PRT105372

8805 44989 ABA103984 20867 57051 EFA200954 32928 69112 PRT105375

8806 44990 ABA103985 20868 57052 EFA200956 32929 69113 PRT105377

8807 44991 ABA103998 20869 57053 EFA200963 32930 69114 PRT105387

8808 44992 ABA104000 20870 57054 EFA200968 32931 69115 PRT105408

8809 44993 ABA104003 20871 57055 EFA200981 32932 69116 PRT105426

8810 44994 ABA104023 20872 57056 EFA200985 32933 69117 PRT105429

8811 44995 ABA104028 20873 57057 EFA200995 32934 69118 PRT105468

8812 44996 ABA104044 20874 57058 EFA201005 32935 69119 PRT105472

8813 44997 ABA104052 20875 57059 EFA201006 32936 69120 PRT105481

8814 44998 ABA104064 20876 57060 EFA201010 32937 69121 PRT105483

8815 44999 ABA104065 20877 57061 EFA201011 32938 69122 PRT105490

8816 45000 ABA104072 20878 57062 EFA201026 32939 69123 PRT105493

8817 45001 ABA104077 20879 57063 EFA201039 32940 69124 PRT105498

8818 45002 ABA104082 20880 57064 EFA201043 32941 69125 PRT105507

8819 45003 ABA104096 20881 57065 EFA201044 32942 69126 PRT105509

8820 45004 ABA104099 20882 57066 EFA201048 32943 69127 PRT105512

8821 45005 ABA104102 20883 57067 EFA201049 32944 69128 PRT105513

8822 45006 ABA104107 20884 57068 EFA201050 32945 69129 PRT105514

8823 45007 ABA104108 20885 57069 EFA201059 32946 69130 PRT105522

8824 45008 ABA104125 20886 57070 EFA201062 32947 69131 PRT105528

8825 45009 ABA104132 20887 57071 EFA201075 32948 69132 PRT105535

8826 45010 ABA104139 20888 57072 EFA201077 32949 69133 PRT105537

8827 45011 ABA104145 20889 57073 EFA201088 32950 69134 PRT105539

8828 45012 ABA104153 20890 57074 EFA201091 32951 69135 PRT105543

8829 45013 ABA104180 20891 57075 EFA201093 32952 69136 PRT105544

8830 45014 ABA104184 20892 57076 EFA201098 32953 69137 PRT105550

8831 45015 ABA104190 20893 57077 EFA201100 32954 69138 PRT105555

8832 45016 ABA104194 20894 57078 EFA201101 32955 69139 PRT105557

8833 45017 ABA104196 20895 57079 EFA201106 32956 69140 PRT105559

8834 45018 ABA104199 20896 57080 EFA201130 32957 69141 PRT105579

8835 45019 ABA104216 20897 57081 EFA201131 32958 69142 PRT105582

8836 45020 ABA104217 20898 57082 EFA201145 32959 69143 PRT105607

8837 45021 ABA104223 20899 57083 EFA201152 32960 69144 PRT105615

8838 45022 ABA104232 20900 57084 EFA201158 32961 69145 PRT105623

8839 45023 ABA104246 20901 57085 EFA201160 32962 69146 PRT105627

8840 45024 ABA104264 20902 57086 EFA201162 32963 69147 PRT105628

8841 45025 ABA104278 20903 57087 EFA201164 32964 69148 PRT105644

8842 45026 ABA104279 20904 57088 EFA201172 32965 69149 PRT105660

8843 45027 ABA104282 20905 57089 EFA201192 32966 69150 PRT105662

8844 45028 ABA104283 20906 57090 EFA201193 32967 69151 PRT105667

8845 45029 ABA104294 20907 57091 EFA201197 32968 69152 PRT105668

8846 45030 ABA104295 20908 57092 EFA201202 32969 69153 PRT105670

8847 45031 ABA104297 20909 57093 EFA201206 32970 69154 PRT105675

8848 45032 ABA104316 20910 57094 EFA201207 32971 69155 PRT105676

8849 45033 ABA104325 20911 57095 EFA201210 32972 69156 PRT105678

8850 45034 ABA104340 20912 57096 EFA201215 32973 69157 PRT105681

OO Kϊ _^-o

τf ιn ιn vo v© vo vD t— t— oo o cN co i © !— i t— i ^H SH SH ΪJH ^H SH SH SH SH. SH !JH SH SH SH SH SH SH SH SH SH S oo. xn xn xn xn xn xn xn xn xn x PH PH' PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH P oo σs © ι-H CN τ— 0 0 © © ©_ © _ © _ © _ o CN C CO CO CO OS OS OS OS OS OS ON ON OS ON ON OS ON OS OS OS OS OS OS O SO IO β iO φ SO ϊO - oo oN © r-H CN co Tf in vp t CN CN CN CN CN CN CO CO CO CO CO CO CO C

CN CN m O CN O Tf © co i t— σs ON ON O co co c CN CN CN CN CN CN CN CN CN CN CN CN

PH PH r PH rPH pq pq pq pq α CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C t— t— t— r- t— t— r- t- r- t— r- t— t— t— t— t— t— t— t— r- t in in in i

CN CN CN CN CN CN CN CN CN C^ t— oo ON in vo t— oo τ— I VO I— I C _ cN cN CN co co cO Tf in vo t— r in in in m in in in in in i

cnoi Tsrf i«nι viow ri-- owo owN o© iH ciNn _PcoI --rxjf- vmi tι—χ Ou σs σs σs σs σs σs o in in in τf "tf -χf τf "tf τf τ i cN co Tf ι— ι o © © © ON ON ON ON O

vo t— oo m in in

cN co τf in vo r- oo σs θ τ— ι cN co τf in vo © © © © O © O σσss σσss σσss σσss σσss σσNs^'' σσss σσss^'' σσss

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

9786 45970 BAN105583 21848 58032 EFM202599 33909 70093 PSY107923

9787 45971 BAN105591 21849 58033 EFM202602 33910 70094 PSY107951

9788 45972 BAN105594 21850 58034 EFM202604 33911 10095 PSY107961

9789 45973 BAN105601 21851 58035 EFM202614 33912 70096 PSY107996

9790 45974 BAN105602 21852 58036 EFM202615 33913 70097 PSY107999

9791 45975 BAN105613 21853 58037 EFM202619 33914 70098 PSY108012

9792 45976 BAN105614 21854 58038 EFM202621 33915 70099 PSY108013

9793 45977 BAN105621 21855 58039 EFM202622 33916 70100 PSY108019

9794 45978 BAN105638 21856 58040 EFM202624 33917 70101 PSY108021

9795 45979 BAN105647 21857 58041 EFM202626 33918 70102 PSY108023

9796 45980 BAN105656 21858 58042 EFM202627 33919 70103 PSY108044

9797 45981 BAN105678 21859 58043 EFM202632 33920 70104 PSY108061

9798 45982 BAN105693 21860 58044 EFM202633 33921 70105 PSY108064

9799 45983 BAN105697 21861 58045 EFM202637 33922 70106 PSY108075

9800 45984 BAN105708 21862 58046 EFM202638 33923 70107 PSY108079

9801 45985 BAN105723 21863 58047 EFM202652 33924 70108 PSY108092

9802 45986 BAN105732 21864 58048 EFM202675 33925 70109 PSY108097

9803 45987 BAN105734 21865 58049 HIN100001 33926 70110 PSY108098

9804 45988 BAN105739 21866 58050 HIN100003 33927 70111 PSY108115

9805 45989 BAN105743 21867 58051 HIN100008 33928 70112 PSY108132

9806 45990 BAN105748 21868 58052 HIN100011 33929 70113 PSY108146

9807 45991 BAN105755 21869 58053 HIN100012 33930 70114 PSY108150

9808 45992 BAN105757 21870 58054 HIN100014 33931 70115 PSY108154

9809 45993 BAN105758 21871 58055 HIN100021 33932 70116 PSY108183

9810 45994 BAN105760 21872 58056 HIN100022 33933 70117 PSY108238

9811 45995 BAN105768 21873 58057 HIN100025 33934 70118 PSY108243

9812 45996 BAN105770 21874 58058 HIN100032 33935 70119 PSY108250

9813 45997 BAN105775 21875 58059 HIN100035 33936 70120 PSY108276

9814 45998 BAN105778 21876 58060 HIN100036 33937 70121 PSY108279

9815 45999 BAN105779 21877 58061 HIN100052 33938 70122 PSY108282

9816 46000 BAN105784 21878 58062 HIN100053 33939 70123 PSY108284

9817 46001 BAN105787 21879 58063 HIN100059 33940 70124 PSY108294

9818 46002 BAN105788 21880 58064 HIN100061 33941 70125 PSY108313

9819 46003 BAN105794 21881 58065 HIN100062 33942 70126 PSY108357

9820 46004 BAN105795 21882 58066 HIN100063 33943 70127 PSY108358

9821 46005 BAN105811 21883 58067 HIN100065 33944 70128 PSY108373

9822 46006 BAN105813 21884 58068 HIN100066 33945 70129 PSY108380

9823 46007 BAN105843 21885 58069 HIN100070 33946 70130 PSY108387

9824 46008 BAN105856 21886 58070 HIN100077 33947 70131 PSY108388

9825 46009 BAN105857 21887 58071 HIN100085 33948 70132 PSY108390

9826 46010 BAN105862 21888 58072 HIN100086 33949 70133 PSY108408

9827 46011 BAN105878 21889 58073 HIN100087 33950 70134 PSY108481

9828 46012 BAN105883 21890 58074 HIN100088 33951 70135 PSY108491

9829 46013 BAN105885 21891 58075 HIN100089 33952 70136 PSY108507

9830 46014 BAN105886 21892 58076 HIN100092 33953 70137 PSY108510

9831 46015 BAN105904 21893 58077 HIN100103 33954 70138 PSY108533

9832 46016 BAN105909 21894 58078 HIN100105 33955 70139 PSY108566

9833 46017 BAN105931 21895 58079 HIN100109 33956 70140 PSY108622

9834 46018 BAN105947 21896 58080 HIN100119 33957 70141 PSY108633

9835 46019 BAN105948 21897 58081 HIN100123. 33958 70142 PSY108661

9836 46020 BAN105953 21898 58082 HIN100127 33959 70143 PSY108736

9837 46021 BAN105954 21899 58083 HIN100128 33960 70144 PSY108744

9838 46022 BAN105960 21900 58084 HIN100129 33961 70145 PSY108753

9839 46023 BAN105967 21901 58085 HIN100133 33962 70146 PSY108754

9840 46024 BAN105978 21902 58086 HIN100134 33963 70147 PSY108757 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

9841 46025 BAN105979 21903 58087 HIN100139 33964 70148 PSY108771

9842 46026 BAN105988 21904 58088 HIN100145 33965 70149 PSY108786

9843 46027 BAN105989 21905 58089 HIN100147 33966 70150 PSY108788

9844 46028 BAN106003 21906 58090 HIN100148 33967 70151 PSY108790

9845 46029 BAN106013 21907 58091 HIN100149 33968 70152 PSY108820

9846 46030 BAN106019 21908 58092 HIN100150 33969 70153 PSY108825

9847 46031 BAN106020 21909 58093 HIN100154 33970 70154 PSY108848

9848 46032 BAN106021 21910 58094 HIN100165 33971 70155 PSY108879

9849 46033 BAN106044 21911 58095 HIN100176 33972 70156 PSY108972

9850 46034 BAN106066 21912 58096 HIN100179 33973 70157 PSY108977

9851 46035 BAN106068 21913 58097 HIN100182 33974 70158 PSY108978

9852 46036 BAN106076 21914 58098 HIN100185 33975 70159 PSY109012

9853 46037 BAN106081 21915 58099 HIN100186 33976 70160 PSY109052

9854 46038 BAN106091 21916 58100 HIN100191 33977 70161 PSY109074

9855 46039 BAN106094 21917 58101 HIN100192 33978 70162 PSY109085

9856 46040 BAN106100 21918 58102 HIN100193 33979 70163 PSY109122

9857 46041 BAN106101 21919 58103 HIN100194 33980 70164 PSY109124

9858 46042 BAN106118 21920 58104 HIN100196 33981 70165 PSY109125

9859 46043 BAN106129 21921 58105 HIN100201 33982 70166 PSY109131

9860 46044 BAN106136 21922 58106 HIN100202 33983 70167 SAU101362

9861 46045 BAN106141 21923 58107 HIN100213 33984 70168 SAU101783

9862 46046 BAN106145 21924 58108 HIN100217 33985 70169 SAU103910

9863 46047 BAN106147 21925 58109 HIN100220 33986 70170 SAU103974

9864 46048 BAN106148 21926 58110 HIN100222 33987 70171 SAU200831

9865 46049 BAN106149 21927 58111 HIN100223 33988 70172 SAU202063

9866 46050 BAN106152 21928 58112 HIN100233 33989 70173 SAU300286

9867 46051 BAN106158 21929 58113 HIN100234 33990 70174 SAU300348

9868 46052 BAN106164 21930 58114 HIN100236 33991 70175 SAU300377

9869 46053 BAN106168 21931 58115 HIN100237 33992 70176 SAU301268

9870 46054 BAN106184 21932 58116 HINl00246 33993 70177 SAU301276

9871 46055 BAN106190 21933 58117 HIN100251 33994 70178 SAU301338

9872 46056 BAN106191 21934 58118 HIN100253 33995 70179 SAU301432

9873 46057 BAN106204 21935 58119 HIN100254 33996 70180 SAU301433

9874 46058 BAN106207 21936 58120 HIN100255 33997 70181 SAU302002

9875 46059 BAN106208 21937 58121 H1N100261 33998 70182 SAU302613

9876 46060 BAN106209 21938 58122 HIN100264 33999 70183 SAU302626

9877 46061 BAN106218 21939 58123 HIN100274 34000 70184 SAU302683

9878 46062 BAN106223 21940 58124 HIN100275 34001 70185 SAU302807

9879 46063 BAN106226 21941 58125 HIN100276 34002 70186 SAU302816

9880 46064 BAN106232 21942 58126 HINl00277 34003 70187 SAU302851

9881 46065 BAN106235 21943 58127 HINl00278 34004 70188 SAU302873

9882 46066 BAN106237 21944 58128 HIN100280 34005 70189 SAU302874

9883 46067 BAN106241 21945 58129 HIN100281 34006 70190 SAU401674

9884 46068 BAN106248 21946 58130 HIN100287 34007 70191 SAU401722

9885 46069 BAN106254 21947 58131 HIN100288 34008 70192 SAU402924

9886 46070 BAN106269 21948 58132 HIN100289 34009 70193 SAU500005

9887 46071 BAN106274 21949 58133 HIN100291 34010 70194 SAU500044

9888 46072 BAN106284 21950 58134 HIN100295 34011 70195 SAU500516

9889 46073 BAN106286 21951 58135 HIN100302 34012 70196 SAU501115

9890 46074 BAN106294 21952 58136 HIN100304 34013 70197 SAU501460

9891 46075 BAN106298 21953 58137 HIN100307 34014 70198 SAU501627

9892 46076 BAN106302 21954 58138 HIN100317 34015 70199 SAU502067

9893 46077 BAN106306 21955 58139 HIN100318 34016 70200 SAU502622

9894 46078 BAN106315 21956 58140 HIN100319 34017 70201 SAU502668

9895 46079 BAN106323 21957 58141 HIN100331 34018 70202 SAU502782

co oN in t— so cN t— τf © © cN vo vo vo vo t— t— oθ τ— i cN co Tf vo t— OO OO ∞ OO OO ∞ OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO CO CO CO OO CO OO CO CO CO OO CO CO

rro) roi rroi ro ro t— t— t— t— t— t— r- r- > rτ-—H t CrxNi ccoo Tf in vo r— OO OS © τ— i cN cO Tf in vo r— OO ON © ι— i cN t— t— t— t— t— r— oo oo oo

rO Tf tn VO 00 0N O T— i cN cO f in vo t— vo vo v© r- t— r- t— r- t— t— r- r- r- r- t— r- r- t— t— t— r- t—

θ© Hτ— ii ccNNN '-Ttf^Hf; iiiΛnn vv^|ooo H!— ii cc(NNsi (ccηoo TT^ff ιiinnn CN CN CN CN CN CN CN 00 00 00 00 00 00 00 00 00

τf tn vo t— oo σs © τ-ι © © © t— I t— I t— I t— I CN CN CN CN CN CN CN CN CN CN C^ CN CN CN CN CN CN CN CN CN M i i i<nn voo tr—— σs r- i— ιi ccNi imn oooo ccoo τTff tc—— 1— iι vsoo vsoo ccoo -τtfr iιnn τ— T-H OS VO r- OO CN CO vo vo vo r— _Tf Tf m in m vo vo in in in in in ii—— tt—— tr—- rr-- t— r- rr-- rr-- rt—- rr-- rt—- rr-- t— t— t— t- t— t— r- t—

ro Tf in vo t— oo σs O i— i CN CO ro cθ cO cθ rO cO τf τf τf τf ^' CN CN CN CN CN CN CN CN CN CN CN C

θN © r-H CN Cθ τf in vo t— oo σs ι . iΛ in iιi ©© ©©.. ©© ©© 00 ©© 00 ©© ©© 00 ©© 00

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

10116 46300 BAN108099 22178 58362 HINl00931 34239 70423 SAU802530

10117 46301 BAN108104 22179 58363 HIN100932 34240 70424 SAU802534

10118 46302 BAN108106 22180 58364 HIN100939 34241 70425 SAU802560

10119 46303 BAN108111 22181 58365 HIN100942 34242 70426 SAU802603

10120 46304 BAN108119 22182 58366 HIN100943 34243 70427 SAU802611

10121 46305 BAN108120 22183 58367 HINl00944 34244 70428 SAU802630

10122 46306 BAN108126 22184 58368 HIN100950 34245 70429 SAU802633

10123 46307 BAN108132 22185 58369 HIN100951 34246 70430 SAU802647

10124 46308 BAN108150 22186 58370 HIN100955 34247 70431 SAU802666

10125 46309 BAN108152 22187 58371 HIN100957 34248 70432 SAU802679

10126 46310 BAN108159 22188 58372 HIN100958 34249 70433 SAU802687

10127 46311 BAN108168 22189 58373 HIN100960 34250 70434 SAU802712

10128 46312 BAN108173 22190 58374 HINl00962 34251 70435 SEP100077

10129 46313 BAN108174 22191 58375 HIN100963 34252 70436 SEP100083

10130 46314 BAN108180 22192 58376 HINl00969 34253 70437 SEP100151

10131 46315 BAN108182 22193 58377 HIN100971 34254 70438 SEP100200

10132 46316 BAN108186 22194 58378 HIN100973 34255 70439 SEP100265

10133 46317 BAN108189 22195 58379 HIN100974 34256 70440 SEP100270

10134 46318 BAN108205 22196 58380 . HIN100979 34257 70441 SEP100573

10135 46319 BAN108206 22197 58381 HIN100980 34258 70442 SEP100701

10136 46320 BAN108214 22198 58382 HIN100982 34259 70443 SEP100718

10137 46321 BAN108234 22199 58383 HIN100983 34260 70444 SEP100719

10138 46322 BAN108237 22200 58384 HINl00985 34261 70445 SEP100915

10139 46323 BAN108238 22201 58385 HIN100992 34262 70446 SEP100950

10140 46324 BAN108248 22202 58386 HINl00998 34263 70447 SEP101087

10141 46325 BAN108260 22203 58387 HIN101001 34264 70448 SEP101306

10142 46326 BAN108269 22204 58388 HIN101002 34265 70449 SEP102450

10143 46327 BAN108271 22205 58389 HIN101007 34266 70450 SEP102493

10144 46328 BAN108277 22206 58390 HIN101025 34267 70451 SEP102632

10145 46329 BAN108284 22207 58391 HIN101030 34268 70452 SEP102883

10146 46330 BAN108287 22208 58392 HIN101036 34269 70453 SEP103164

10147 46331 BAN108290 22209 58393 HIN101037 34270 70454 SEP200018

10148 46332 BAN108298 22210 58394 HIN101039 34271 70455 SEP200020

10149 46333 BAN108299 22211 58395 HIN101041 34272 70456 SEP200029

10150 46334 BAN108345 22212 58396 HIN101042 34273 70457 SEP200039

10151 46335 BAN108361 22213 58397 HIN101051 34274 70458 SEP200040

10152 46336 BAN108367 22214 58398 HIN101052 34275 70459 SEP200043

10153 46337 BAN108403 22215 58399 HIN101054 34276 70460 SEP200047

10154 46338 BAN108409 • 22216 58400 HIN101057 34277 70461 SEP200050

^' 10155 46339 BAN108415 22217 58401 HIK101066 34278 70462 SEP200052

10156 46340 BAN108420 22218 58402 HIN101070 34279 70463 SEP200058'

10157 46341 BAN108425 22219 58403 HIK101074 34280 70464 SEP200059

10158 46342 BAN108451 22220 58404 HIN101075 34281 70465 SEP200060

10159 46343 BAN108458 22221 58405 HIK101077 34282 70466 SEP200061

10160 46344 BAN108463 22222 58406 HIN101078 34283 70467 SEP200070

10161 46345 BAN108468 22223 58407 HIN101084 34284 70468 SEP200071

10162 46346 BAN108476 22224 58408 HIN101085 34285 70469 SEP200072

10163 46347 BAN108506 22225 58409 HIN101086 34286 70470 SEP200076

10164 46348 BAN108518 22226 58410 HIK101089 34287 70471 SEP200080

10165 46349 BAN108519 22227 58411 HIN101094 34288 70472 SEP200082

10166 46350 BAN108522 22228 58412 HIN101098 34289 70473 SEP200083

10167 46351 BAN108525 22229 58413 HIN101100 34290 70474 SEP200084

10168 46352 BAN108531 22230 58414 HIN101103 34291 70475 SEP200085

10169 46353 BAN108534 22231 58415 HIN101104 34292 70476 SEP200090

10170 46354 BAN108536 22232 58416 HIN101106 34293 70477 SEP200091 t— oo σs © τ-H CN c^ c^ c c^ c^ ro e^ rO c^ "tf "tf τf "tf M co c^Hi co co co co c^ ττff ττff ττff "tf "tf τf "tf τf τf τf τf (T) m n t . C - n c t . (τi c . cη t (τj r . c . n m

^|iiΛnn vv^ooo rr-- oooooo σσ(^ss ©θO Hττ—— ii cNι rmo l!f lΛ ^o M a o H (l ^■vt ιn ^D ^ ι>o O H ! l c ^ ιn ,— i t— i t— i t— i t— i CN CN CN CN CN CN oo oo oo oo oo oo oo oo oo oo

VO t— t— oo 00 00 σs σs σs σs σs σs σs Os ON σs CN CN CN CN <N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

AH PH PH PH AH PH PH Pi AH PH PH PH PH PH PH PH AH PH AH pq.pq pq

00 00 co ©S- τT-—H i CCN cCoi τ-xfr iin vsoiJ tl—— o OoU σC_Js_S — cN co τf in vo t— oo σs © rt cN ro τf in vo 00 OS © T-^H τ T--HH tT —-H I iI—— ii ccNN CCNN CCNN CCNN CCNN CCNN CCNN CCNN CcNN CCNN co co ro ro ro co . . .. Tf Tf Tf Tf Tf Tf Tf "tf "tf in in tt—— tt—— tt—— tt—— t— r t—-^ t- t - t— - r- r^ r^- t— t— r- t— r- - t— r- t— t— r- t— t— τf in vo r- oo σN © τ— i cN co -tf in vo t— τχrf τχrf τχrf τχτf ττfr τχfr τχfr τff ττff τ-χff ττff "-^tf τf τf "tf "tf τf τf τf τf - f "tf τf -χf "tf τf τf co co co co c^ c^ σs oo co ιn oo ιn v© τr ιn vo σs σs θ τ— ^I T— I ,— ι cN cN "tf "tf τf CN CN CN C

OO ON © T— i cN co -tf in vo t— OO ON © oo oo oo oo oo oo σs SO VO VO IO VO O VO IO Φ W oo oo oo oo oo oo oo oo oo oo oo

co τf_ in vp t— o_o σs © τ-H cN co τf in vo O_s O_s O_N O_S ON O_N O__ _{0 0 0 0 0 0} ιn ιn ιn CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C^ i— T-H CO Γ- _T— i "tf vo _ι-H lΛ ^|n ι'l ^_' ^ 5^ O O O H H H l

ισσss ©o rt© c©N c©H-ι τ©f ©ιn v©o r©- o©o σ©s θ_τ-_H rt_τ-_{H τ}C-N_H c_τθ-_H '_τtf-_H- ι_τn-_H v_τo-_H r_^-_H o_τ-o_H σ_ιrtN ©^ τ^-H C^N c^ "^tf v^o r^- o^o O β O IO Ϊ) φ

in sp r- oo σs © τ-H CN co τf ιn vp r- oo σN © r-i cN co "tf in ^p r- oo σs © τ-H CN cθ "tf CN CN CN cN co ro co co co cO co cO co cO Tf

l rt ,— I T-H T— i t— I CN CN CN

O oo oo σs σs σs σs © o θ τ— I CN CN CN CN CN CN CN PH AH AH AH PH AH PH AH PH PH PH AH PH AH AH PH AH

0l 0S 0\ 0l 0\ 0\ ⁿ O^TS O^TS^{i r}O^ttS O^hN ⁿON^{i n}ON^{i rt}ON^{i n}ON ^rtOs^l ON r- t— t— r- in vo r— oo σs © τ— i cN co -xf in vo r- r- oo oo oo oo oo oo oo oo r-f • r T-f r T-f t T—f t T—f r-

t— t— r- r— oo oo oo oo oo

PH PH AH P^

co -tf in vo t— oo σs © ON ON O © O © O O © © O © T— i σs σs σs σs σs σs σs σs σs σs σs oo oo oo oo oo oo oo oo oo oo oo

r- oo σs © τ— i cN co -tf in vo CN CN t— t— r- t — c— - r — t — i — r— r — C-. <-N C-. CN e-N CN C-N c-xl -. CN c~N e-l e-N N <-N ON CN c~N c-N e) Cxt rN CN CN CN CN CN C^

vo t— oo σs © τ— i C.N. co Tf in v© t- 00 ro ro rO Tf Tf Tf ^• Tf Tf Tf Tf Tf "tf oo .oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo oo vo vo vo v© VO VO VO VO V© vo vo vo vo vo v© v© VO VO VO ^t vo vo vO VO

iO SO β ϊJ VO ^O β so W β iO

co τf vo σs © τ— I CN "tf τf τf τf τf in ιn ιn ιn ιn ιn ιn ιn vo vo vo vo vo vo vo t— t— r— r— t— t— oo oo oo 00 ₀0 0O O0 0O O0 0O O0 00 00 0O 00 0O 0O O0 0O OO 0O 0O 0O 0O 0O

!— ι cN co τf tn vo r- oo σs © ι— < cN co τf in vo r— oo σs © τ— i r- t— r- t— t— r- t— t— t— t— t— t— r- oυou σNs ©V— I τT— — i i c cN-l c Co) - TtfT i in v SoJ_J t I—— OO OO OS ON OS ON OS OS ON OS o-o- o-o- o-o- o0o0 o0o0 o0o0 o0o0 o0o0 o OOo o0o0 τf τf τf τf τf τf τf f τf τf co co co co co co co co co

PH PH PH PH PH PH PH PH PH PH PH H PH

σs © T— i cN cO Tf in vo t— 00 OS O o o o o © i— I i— I CN ©_ o_ ©_ o_ ©_ ©_ ©_ ©_ ©_ o © © © o o © o © _ o_ ©_ ©_ σs σs σs σs σ^

r- (a o^ o ^H (^ co '* ιn vo (fi n n tη oo oo oo oo oo oo oo oo oo oo oo oo oo CN CN CN CN CN CN CN CN CN CN C^ CN CN CN CN ^τH. vo o co ιn vo o o τf τf t

oo σs © τ-H CN co τf in vo r- oo Tf f Tf Tf Tf Tf in in in tn in in in in in σs σ^ * ^lO β \O SD VO ⁱO >0 *O O Tf Tf n * r- t— t— t— t— t— t— t— r- t— r- r-

cN co τf in vo t— oo O .O . OO OS . O_S O_N. O_N O-N OS O-N O-S O-S -\ o -s --i θ-\ (-Λ θ-\ CN CN CN CN CN CN CN CN CN CN CN

90 rH t- r-

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqDD

11381 47565 BCE104307 23443 59627 KPN302003 35504 71688 SHA101419

11382 47566 BCE104313 23444 59628 KPN302005 35505 71689 SHA101420

11383 47567 BCE104326 23445 59629 KPN302014 35506 71690 SHA101424

11384 47568 BCE104345 23446 59630 KPN302017 35507 71691 SHA101433

11385 47569 BCE104352 23447 59631 KPN302018 35508 71692 SHA101435

11386 47570 BCE104390 23448 59632 KPN302023 35509 71693 SHA101443

11387 47571 BCE104414 23449 59633 KPN302028 35510 71694 SHA101448

11388 47572 BCE104415 23450 59634 KPN302029 35511 71695 SHA101456

11389 47573 BCE104424 23451 59635 KPN302040 35512 71696 SHA101458

11390 47574 BCE104439 23452 59636 KPN302041 35513 71697 SHA101462

11391 47575 BCE104446 23453 59637 KPN302044 35514 71698 SHA101468

11392 47576 BCE104450 23454 59638 KPN302046 35515 71699 SHA101470

11393 47577 BCE104452 23455 59639 KPN302047 35516 71700 SHA101478

11394 47578 BCE104481 23456 59640 KPN302051 35517 71701 SHA101479

11395 47579 BCE104511 23457 59641 KPN302059 35518 71702 SHA101480

11396 47580 BCE104520 23458 59642 KPN302061 35519 71703 SHA101483

11397 47581 BCE104528 23459 59643 KPN302070 35520 71704 SHA101486

11398 47582 BCE104584 23460 59644 KPN302079 35521 71705 SHA101487

11399 47583 BCE 104632 23461 59645 KPN302083 35522 71706 SHA101488

11400 47584 BCE104650 23462 59646 KPN302084 35523 71707 SHA101489

11401 47585 BCE 104653 23463 59647 KPN302085 35524 71708 SHA101501

11402 47586 BCE104672 23464 59648 KPN302086 35525 71709 SHA101502

11403 47587 BCE104678 23465 59649 KPN302087 35526 71710 SHA101509

11404 47588 BCE104738 23466 59650 KPN302095 35527 71711 SHA101510

11405 47589 BCE104746 23467 59651 KPN302096 35528 71712 SHA101524

11406 47590 BCE104783 23468 59652 KPN302103 35529 71713 SHA101527

11407 47591 BCE104817 23469 59653 KPN302104 35530 71714 SHA101537

11408 47592 BCE104834 23470 59654 KPN302105 35531 71715 SHA101538

11409 47593 BCE104851 23471 59655 KPN302112 35532 71716 SHA101545

11410 47594 BCE 104852 23472 59656 KPN302113 35533 71717 SHA101546

11411 47595 BCE104877 23473 59657 KPN302118 35534 71718 SHA101547

11412 47596 BCE 104886 23474 59658 KPN302119 35535 71719 SHA101549

11413 47597 BCE104891 23475 59659 KPN302135 35536 71720 SHA101552

11414 47598 BCE104897 23476 59660 KPN302137 35537 71721 SHA101556

11415 47599 BCE104912 23477 59661 KPN302146 35538 71722 SHA101558

11416 47600 BCE104951 23478 59662 KPN302148 35539 71723 SHA101559

11417 47601 BCE104962 23479 59663 KPN302154 35540 71724 SHA101561

11418 47602 BCE104972 23480 59664 KPN302156 35541 71725 SHA101565

11419 47603 BCE105003 23481 59665 KPN302168 35542 71726 SHA101567

11420 47604 BCE105004 23482 59666 KPN302173 35543 71727 SHA101569

11421 47605 BCE105021 23483 59667 KPN302185 35544 71728 SHA101570

11422 47606 BCE105027 23484 59668 KPN302187 35545 71729 SHA101571

11423 47607 BCE 105039 23485 59669 KPN302190 35546 71730 SHA101572

11424 47608 BCE105055 23486 59670 KPN302196 35547 71731 SHA101576

11425 47609 BCE105068 23487 59671 KPN302203 35548 71732 SHA101579

11426 47610 BCE105100 23488 59672 KPN302207 35549 71733 SHA101580

11427 47611 BCE105183 23489 59673 KPN302210 35550 71734 SHA101581

11428 47612 BCE105218 23490 59674 KPN302213 35551 71735 SHA101582

11429 47613 BCE105254 23491 59675 KPN302215 35552 71736 SHA101585

11430 47614 BCE105273 23492 59676 KPN302217 35553 71737 SHA101588

11431 47615 BCE105292 23493 59677 KPN302220 35554 71738 SHA101591

11432 47616 BCE105311 23494 59678 KPN302225 35555 71739 SHA101593

11433 47617 BCE105319 23495 59679 KPN302228 35556 71740 SHA101595

11434 47618 BCE105322 23496 59680 KPN302230 35557 71741 SHA101596

11435 47619 BCE 105324 23497 59681 KPN302234 35558 71742 SHA101597

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqED SeqlD SeqlD SeqlD

11546 47730 BCE 107041 23608 59792 KPN302806 35669 71853 SHA102006

11547 47731 BCE107050 23609 59793 KPN302808 35670 71854 SHA102007

11548 47732 BCE107064 23610 59794 KPN302809 35671 71855 SHA102011

11549 47733 BCE1.07071 23611 59795 KPN302810 35672 71856 SHA102018

11550 47734 BCE107083 23612 59796 KPN302817 35673 71857 SHA102019

11551 47735 BCE107096 23613 59797 KPN302822 35674 71858 SHA102021

11552 47736 BCE107115 23614 59798 KPN302831 35675 71859 SHA102022

11553 47737 BCE107126 23615 59799 KPN302833 35676 71860 SHA102023

11554 47738 BCE107136 23616 59800 KPN302836 35677 71861 SHA102024

11555 47739 BCE107142 23617 59801 KPN302840 35678 71862 SHA102028

11556 47740 BCE 107211 23618 59802 KPN302841 35679 71863 SHA102031

11557 47741 BCE107218 23619 59803 KPN302863 35680 71864 SHA102033

11558 47742 BCE107273 23620 59804 KPN302864 35681 71865 SHA102036

11559 47743 BCE107277 23621 59805 KPN302865 35682 71866 SHA 102040

11560 47744 BCE107288 23622 59806 KPN302879 35683 71867 SHA102044

11561 47745 BCE107290 23623 59807 KPN302890 35684 71868 SHA102047

11562 47746 BCE 107302 23624 59808 KPN302908 35685 71869 SHA102048

11563 47747 BCE107311 23625 59809 KPN302911 35686 71870 SHA102049

11564 47748 BCE107325 23626 59810 KPN302916 35687 71871 SHA102072

11565 47749 BCE107342 23627 59811 KPN302924 35688 71872 SHA102078

11566 47750 BCE107345 23628 59812 KPN302939 35689 71873 SHA102088

11567 47751 BCE107353 23629 59813 KPN302944 35690 71874 SHA102089

11568 47752 BCE107363 23630 59814 KPN302949 35691 71875 SHA102097

11569 47753 BCE107366 23631 59815 KPN302952 35692 71876 SHA102099

11570 47754 BCE107415 23632 59816 KPN302957 35693 71877 SHA102124

11571 47755 BCE107416 23633 59817 KPN302967 35694 71878 SHA102128

11572 47756 BCE107431 23634 59818 KPN302968 35695 71879 SHA102129

11573 47757 BCE107448 23635 59819 KPN302981 35696 71880 SHA102130

11574 47758 BCE 107483 23636 59820 KPN302997 35697 71881 SHA102132

11575 47759 BCE107484 23637 59821 KPN303003 35698 71882 SHA102134

11576 47760 BCE107495 23638 59822 KPN303005 35699 71883 SHA102135

11577 47761 BCE107496 23639 59823 KPN303031 35700 71884 SHA102145

11578 47762 BCE107511 23640 59824 KPN303040 35701 71885 SHA102148

11579 47763 BCE107517 23641 59825 KPN303047 35702 71886 SHA102150

11580 47764 BCE107531 23642 59826 KPN303050 35703 71887 SHA102153

11581 47765 BCE107538 23643 59827 KPN303051 35704 71888 SHA102155

11582 47766 BCE107571 23644 59828 KPN303054 35705 71889 SHA102166

11583 47767 BCE107575 23645 59829 KPN303056 35706 71890 SHA102188

11584 47768 BCE 107576 23646 59830 KPN303058 35707 71891 SHA102191

11585 47769 BCE107587 23647 59831 KPN303060 35708 71892 SHA102193

11586 47770 BCE107605 23648 59832 KPN303068 35709 71893 SHA102199

11587 47771 BCE107623 23649 59833 KPN303070 35710 71894 SHA102201

11588 47772 BCE107626 23650 59834 KPN303072 35711 71895 SHA102213

11589 47773 BCE107637 23651 59835 KPN303075 35712 71896 SHA102214

11590 47774 BCE107642 23652 59836 KPN303078 35713 71897 SHA102216

11591 47775 BCE107667 23653 59837 KPN303095 35714 71898 SHA102217

11592 47776 BCE107676 23654 59838 KPN303098 35715 71899 SHA102218

11593 47777 BCE107682 23655 59839 KPN303099 35716 71900 SHA102220

11594 47778 BCE107689 23656 59840 KPN303110 35717 71901 SHA102221

11595 47779 BCE107697 23657 59841 KPN303112 35718 71902 SHA102223

11596 47780 BCE107702 23658 59842 KPN303124 35719 71903 SHA102232

11597 47781 BCE107711 23659 59843 KPN303125 35720 71904 SHA102241

11598 47782 BCE107747 23660 59844 KPN303133 35721 71905 SHA102245

11599 47783 BCE107754 23661 59845 KPN303134 35722 71906 SHA102248

11600 47784 BCE107762 23662 59846 KPN303135 35723 71907 SHA102255 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

11601 47785 BCE107805 23663 59847 KPN303137 35724 71908 SHA102256

11602 47786 BCE107836 23664 59848 KPN303138 35725 71909 SHA102259

11603 47787 BCE107845 23665 59849 KPN303140 35726 71910 SHA102260

11604 47788 BCE107846 23666 59850 KPN303149 35727 71911 SHA102263

11605 47789 BCE107847 23667 59851 KPN303155 35728 71912 SHA102268

11606 47790 BCE107854 23668 59852 KPN303170 35729 71913 SHA102269

11607 47791 BCE107881 23669 59853 KPN303175 35730 71914 SHA102270

11608 47792 BCE107896 23670 59854 KPN303186 35731 71915 SHA102271

11609 47793 BCE107905 23671 59855 KPN303187 35732 71916 SHA102287

11610 47794 BCE107987 23672 59856 KPN303215 35733 71917 SHA102289

11611 47795 BCE107990 23673 59857 KPN303224 35734 71918 SHA102295

11612 47796 BCE107994 23674 59858 KPN303236 35735 71919 SHA102314

11613 47797 BCE108020 23675 59859 KPN303238 35736 71920 SHA102331

11614 47798 BCE108025 23676 59860 KPN303260 35737 71921 SHA102341

11615 47799 BCE108028 23677 59861 KPN303262 35738 71922 SHA102342

11616 47800 BCE108051 23678 59862 KPN303263 35739 71923 SHA102361

11617 47801 BCE108053 23679 59863 KPN303268 35740 71924 SHA102365

11618 47802 BCE108067 23680 59864 KPN303278 35741 71925 SHA102369

11619 47803 BCE108070 23681 59865 KPN303293 35742 71926 SHA102370

11620 47804 BCE 108074 23682 59866 KPN303298 35743 71927 SHA102372

11621 47805 BCE108109 23683 59867 KPN303306 35744 71928 SHA102380

11622 47806 BCE108121 23684 59868 KPN303307 35745 71929 SHA102381

11623 4780? BCE108130 23685 59869 KPN303312 35746 71930 SHA102393

11624 47808 BCE108135 23686 59870 KPN303317 35747 71931 SHA102394

11625 47809 BCE108192 23687 59871 KPN303319 35748 71932 SHA102397

11626 47810 BCE108240 23688 59872 KPN303321 35749 71933 SHA102409

11627 47811 BCE108241 23689 59873 KPN303323 35750 71934 SHA102423

11628 47812 BCE108256 23690 59874 KPN303324 35751 71935 SHA102434

11629 47813 BCE108257 23691 59875 KPN303337 35752 71936 SHA102439

11630 47814 BCE108299 23692 59876 KPN303338 35753 71937 SHA102445

11631 47815 BCE108358 23693 59877 KPN303342 35754 71938 SHA102447

11632 47816 BCE108394 23694 59878 KPN303344 35755 71939 SHA102448

11633 47817 BCE 108487 23695 59879 KPN303346 35756 71940 SHA102491

11634 47818 BCE108504 23696 59880 KPN303348 35757 71941 SHA102495

11635 47819 BCE108518 23697 59881 KPN303362 35758 71942 SHA102497

11636 47820 BCE108533 23698 59882 KPN303365 35759 71943 SHA102499

11637 47821 BCE108544 23699 59883 KPN303367 35760 71944 SHA102504

11638 47822 BCE 108546 23700 59884 KPN303368 35761 71945 SHA102510

11639 47823 BCE108622 23701 59885 KPN303370 35762 71946 SHA102513

11640 47824 BCE108649 23702 59886 KPN303383 35763 71947 SHA102514

11641 47825 BCE108668 23703 59887 KPN303387 35764 71948 SHA102516

11642 47826 BCE108675 23704 59888 KPN303388 35765 71949 SHA102517

11643 47827 BCE108686 23705 59889 KPN303391 35766 71950 SHA102521

11644 47828 BCE108691 23706 59890 KPN303392 35767 71951 SHA102530

11645 47829 BCE108701 23707 59891 KPN303397 35768 71952 SHA102541

11646 47830 BCE108719 23708 59892 KPN303398 35769 71953 SHA102554

11647 47831 BCE 108732 23709 59893 KPN303402 35770 71954 SHA102568

11648 47832 BCE108743 23710 59894 KPN303405 35771 71955 SHA102575

11649 47833 BCE108751 23711 59895 KPN303410 35772 71956 SHA102595

11650 47834 BCE108786 23712 59896 KPN303418 35773 71957 SHA102644

11651 47835 BCE108792 23713 59897 KPN303419 35774 71958 SHA102651

11652 47836 BCE108815 23714 59898 KPN303422 35775 71959 SHA102654

11653 47837 BCE108826 23715 59899 KPN303429 35776 71960 SHA102676

11654 47838 BCE108874 23716 59900 KPN303432 35777 71961 SHA102684

11655 47839 BCE108880 23717 59901 KPN303442 35778 71962 SHA102688 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

11656 47840 BCE108881 23718 59902 KPN303443 35779 71963 SHA102705

11657 47841 BCE108906 23719 59903 KPN303447 35780 71964 SHA102710

11658 47842 BCE108946 23720 59904 KPN303448 35781 71965 SHA102720

11659 47843 BCE108968 23721 59905 KPN303462 35782 71966 SHA102731

11660 47844 BCE108969 23722 59906 KPN303463 35783 71967 SHA102750

11661 47845 BCE108996 23723 59907 KPN303464 35784 71968 SHA102754

11662 47846 BCE109011 23724 59908 KPN303469 35785 71969 SHA102755

11663 47847 BCE109015 23725 59909 KPN303475 35786 71970 SHA102778

11664 47848 BCE109039 23726 59910 KPN303478 35787 71971 SHA102781

11665 47849 BCE109062 23727 59911 KPN303481 35788 71972 SHA102804

11666 47850 BCE109097 23728 59912 KPN303484 35789 71973 SHA102806

11667 47851 BCE109104 23729 59913 KPN303485 35790 71974 SHA102814

11668 47852 BCE109138 23730 59914 KPN303487 35791 71975 SHA102823

11669 47853 BCE109200 23731 59915 KPN303489 35792 71976 SHA102824

11670 47854 BCE109201 23732 59916 KPN303490 35793 71977 SHA102842

11671 47855 BCE109231 23733 59917 KPN303509 35794 71978 SHA102843

11672 47856 BCE109235 23734 59918 KPN303511 35795 71979 SHA102846

11673 47857 BCE109237 23735 59919 KPN303513 35796 71980 SHA102869

11674 47858 BCE109252 23736 59920 KPN303514 35797 71981 SHA102882

11675 47859 BCE109254 23737 59921 KPN303516 35798 71982 SHA102890

11676 47860 BCE109277 23738 59922 KPN303520 35799 71983 SHA102895

11677 47861 BCE109299 23739 59923 KPN303521 35800 71984 SHA102902

11678 47862 BCE109316 23740 59924 KPN303530 35801 71985 SHA102912

11679 47863 BCE 109317 23741 59925 KPN303531 35802 71986 SHA102938

11680 47864 BCE109327 23742 59926 KPN303535 35803 71987 SHA102966

11681 47865 BCE109344 23743 59927 KPN303537 35804 71988 SHA102983

11682 47866 BCE109390 23744 59928 KPN303539 35805 71989 SHA102996

11683 47867 BCE109396 23745 59929 KPN303551 35806 71990 SHA102998

11684 47868 BCE109401 23746 59930 KPN303559 35807 71991 SHA103018

11685 47869 BCE109402 23747 59931 KPN303560 35808 71992 SHA103035

11686 47870 BCE109420 23748 59932 KPN303566 35809 71993 SHA103066

11687 47871 BCE109423 23749 59933 KPN303577 35810 71994 SHA103074

11688 47872 BCE109431 23750 59934 KPN303579 35811 71995 SHA103119

11689 47873 BCE 109436 23751 59935 KPN303581 35812 71996 SHA103167

11690 47874 BCE109463 23752 59936 KPN303589 35813 71997 SHA103168

11691 47875 BCE109468 23753 59937 KPN303592 35814 71998 SHA103188

11692 47876 BCE109471 23754 59938 KPN303595 35815 71999 SHA103189

11693 47877 BCE109489 23755 59939 KPN303596 35816 72000 SHA103193

11694 47878 BCE109504 23756 59940 KPN303620 35817 72001 SHA103204

11695 47879 BCE109512 23757 59941 KPN303632 35818 72002 SHA103206

11696 47880 BCE109516 23758 59942 KPN303648 35819 72003 SHA103208

11697 47881 BCE 109527 23759 59943 KPN303650 35820 72004 SHA103225

11698 47882 BCE109535 23760 59944 KPN303651 35821 72005 SHA103272

11699 47883 BCE109548 23761 59945 KPN303658 35822 72006 SHA103279

11700 47884 BCE109553 23762 59946 KPN303671 35823 72007 SHA103321

11701 47885 BCE109557 23763 59947 KPN303693 35824 72008 SHA103355

11702 47886 BCE109617 23764 59948 KPN303709 35825 72009 SHA103377

11703 47887 BCE109619 23765 59949 KPN303711 35826 72010 SHA103379

11704 47888 BCE109623 23766 59950 KPN303718 35827 72011 SMU100002

11705 47889 BCE109663 23767 59951 KPN303720 35828 72012 SMU100004

11706 47890 BCE109710 23768 59952 KPN303726 35829 72013 SMU100011

11707 47891 BCE109741 23769 59953 KPN303729 35830 72014 SMU100019

11708 47892 BCE109750 23770 59954 KPN303732 35831 72015 SMU100022

11709 47893 BCE109754 23771 59955 KPN303779 35832 72016 SMU100024

11710 47894 BCE109755 23772 59956 KPN303781 35833 72017 SMU100027 J o

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

11766 47950 BCE110581 23828 60012 KPN304182 35889 72073 SMU100170

11767 47951 BCE110592 23829 60013 KPN304185 35890 72074 SMU100171

11768 47952 BCE110599 23830 60014 KPN304195 35891 72075 SMU100172

11769 47953 BCE110600 23831 60015 KPN304202 35892 72076 SMU100176

11770 47954 BCE110602 23832 60016 KPN304206 35893 72077 SMU100179

11771 47955 BCE110618 23833 60017 KPN304208 35894 72078 SMU100183

11772 47956 BCE110619 23834 60018 KPN304210 35895 72079 SMU100190

11773 47957 BCE110623 23835 60019 KPN304212 35896 72080 SMU100191

11774 47958 BCE110631 23836 60020 KPN304213 35897 72081 SMU100200

11775 47959 BCE110636 23837 60021 KPN304221 35898 72082 SMU100210

11776 47960 BCE110660 23838 60022 KPN304223 35899 72083 SMU100212

11777 47961 BCE110669 23839 60023 KPN304247 35900 72084 SMU100213

11778 47962 BCE110670 23840 60024 KPN304250 35901 72085 SMU100215

11779 47963 BCE110691 23841 60025 KPN304258 35902 72086 SMU100219

11780 47964 BCE110714 23842 60026 KPN304259 35903 72087 SMU100221

11781 47965 BCE110744 23843 60027 KPN304271 35904 72088 SMU100226

11782 47966 BCE110764 23844 60028 KPN304272 35905 72089 SMU100230

11783 47967 BCE110777 23845 60029 KPN304278 35906 72090 SMU100238

11784 47968 BCE110810 23846 60030 KPN304291 35907 72091 SMU100239

11785 47969 BCE110834 23847 60031 KPN304293 35908 72092 SMU100247

11786 47970 BCE110873 23848 60032 KPN304355 35909 72093 SMU100253

11787 47971 BCE110975 23849 60033 KPN304370 35910 72094 SMU100254

11788 47972 BCE110976 23850 60034 KPN304382 35911 72095 SMU100255

11789 47973 BCE110991 23851 60035 KPN304386 35912 72096 SMU100257

11790 47974 BCE111009 23852 60036 KPN304388 35913 72097 SMU100269

11791 47975 BCE111018 23853 60037 KPN304389 35914 72098 SMU100271

11792 47976 BCE111047 23854 60038 KPN304402 35915 72099 SMU100284

11793 47977 BCE111053 23855 60039 KPN304405 35916 72100 SMU100292

11794 47978 BCE111066 23856 60040 KPN304418 35917 72101 SMU100294

11795 47979 BCE111071 23857 60041 KPN304419 35918 72102 SMU100295

11796 47980 BCE111090 23858 60042 KPN304430 35919 72103 SMU100298

11797 47981 BCE111113 23859 60043 KPN304436 35920 72104 SMU100300

11798 47982 BCE111148 23860 60044 KPN304448 35921 72105 SMU100302

11799 47983 BCE111154 23861 60045 KPN304450 35922 72106 SMU100303

11800 47984 BCE111163 23862 60046 KPN304452 35923 72107 SMU100305

11801 47985 BCE111166 23863 60047 KPN304473 35924 72108 SMU100307

11802 47986 BCE111202 23864 60048 KPN304474 35925 72109 SMU100308

11803 47987 BCE111221 23865 60049 KPN304482 35926 72110 SMU100310

11804 47988 BCE111238 23866 60050 KPN304484 35927 72111 SMU100311

11805 47989 BCE111259 23867 60051 KPN304485 35928 72112 SMU100315

11806 47990 BCE111262 23868 60052 KPN304492 35929 72113 SMU100316

11807 47991 BCE111281 23869 60053 KPN304497 35930 72114 SMU100318

11808 47992 BCE111288 23870 60054 KPN304517 35931 72115 SMU100319

11809 47993 BCE111292 23871 60055 KPN304521 35932 72116 SMU100320

11810 47994 BCE111297 23872 60056 KPN304528 35933 72117 SMU100321

11811 47995 BCE111308 23873 60057 KPN304537 35934 72118 SMU100322

11812 47996 BCE111312 23874 60058 KPN304546 35935 72119 SMU100325

11813 47997 BCE111317 23875 60059 KPN304553 35936 72120 SMU100328

11814 47998 BCE111319 23876 60060 KPN304564 35937 72121 SMU100332

11815 47999 BCE111329 23877 60061 KPN304595 35938 72122 SMU100333

11816 48000 BCE111382 23878 60062 KPN304604 35939 72123 SMU100344

11817 48001 BCE111388 23879 60063 KPN304631 35940 72124 SMU100347

11818 48002 BCE111406 23880 60064 KPN304657 35941 72125 SMU100348

11819 48003 BCE111412 23881 60065 KPN304658 35942 72126 SMU100349

11820 48004 BCE111433 23882 60066 KPN304660 35943 72127 SMU100354

Tf VO r- CO 00 t— ro Tf r- σs

Tf in in in ιn vo vo t— OO 00 00 00 0O r- t— r- r- r- t— r- r- r- t- t— r- r—

ON © CN CO Tf in vo r- 00 OS © T-H

OO oo oo 00 oo 00 00 00 00 σs ON

H CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

U CN CN CN N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

1— t— t— t—

PH r- r- t— t— t— r— t— t— r- t— t—

CN O Tf in VO t— 00 ON © CN CO Tf in VP t— σs ON ON ON σs σs ON © © © o © © © ©

V© o O VO SP vo vo VO VO VO VO O vp VO VP vo co O ro co CO ro CO O co CO co co CO co CO co

Tf © co CN CN

CN ro © CN vo VO t— OO OO o V© O VO vo co co P^H PzH zPH ^PH zPH

oo ON O CN co Tf in VO t— 00 ON

CN CN CN co

CN CN CN CN CN CN CN CN CN CN CN v© VO VO VO VO V© VO o vp VO V© VO V© V© VO VO VO VO

CN co Tf in VO r— 00 OS © CN co Tf in vo O co CO co co ro ro CO co CO Tf Tf f Tf Tf Tf Tf

Tf _"tf Tf Tf Tf

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN in σs ro Tf VO 00 in SO CO t— O r- ©

00 ON O CN ro "tf vp VO σs ON Tf m © CO ^■tf

CO Tf Tf Tf "tf Tf Tf Tf Tf Tf Tf Tf Tf Tf pq pq pq pq pq pq pq pq pq pq pq CJ CJ CJ CJ CJ CJ CJ

PQ Q PQ PQ PQ OQ PQ OQ OQ OQ OQ OQ CQ CQ CQ OQ OQ CQ OQ OQ OQ

CO

00 V© c- 00 σs- © CN CO in vo t- ∞ o vo vo vp r— r- 00 OO 00 OO 00 00 OO 00 OO 00 00 OO 00 00 00

ON σs ON σs ON ON OS ON ON OS ON σs σs σs σs OS ON ON σs

a ro in vo © CN co Tf o OS t— σs ro Tf V© 00 © Tf in 00 σs CN tn σs vo 00 © CO O © CN Tf VO OO Tf t— 00 © CN σs CO in t— 00 © CN co VO © zn OS σs ON σs © © © O © © CN CN Tf Tf Tf in in in in in VO v© so t— ON σs σs O © © CN co ro ro ro Tf Tf Tf Tf in

3 t— t— t— r- 00 00 00 00 00 00 OO 00 00 OO oo 00 00 oo 00 00 oo 00 00 00 00 00 0r0- t— OO OO 00 oo σs ON σs

00 0 oo o0 oo oo oo OO 00 00 00 00 σs ON σs OS σs OS σs σs OS ON ON σs OS σs σs ON to o © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © O © © © © © © © © © o o O O o © o © © o © © © © © © © o © o © © © © © © © © © o © © © © © © © © © © © © o ©

§ § § § § § § P p P p P P p P P p P P p P p P p p P p P P P p P P P P p P p P P p P p P p p p P p p p σs 8 s § s § rt s § -US § rt rt

00 oo 00 O cn 00 xn oo 00 oo CO co 00 00 oo 00 co CO 00 n 00 00 0 s § rt § S § § § § S § § rt N o 00 oo CO oo 00 0 00 00 o oo 00 00 00 00 00 00 CO CO 00 00 00 00 00 00 00 co CO CO oo o CO xn

CD n ON σs ON σs ON σs ON © © © © © o © © o © CN CN CN CN CN CN CN CN CN CN O co CO co CO CO CO CO CO ro Tf Tf Tf Tf Tf Tf Tf

H O c N tor C CN CN CN CN CN CN ro ro CO ro ro CO ro O ro O CO ro ro CO CO CO ro ro ro ro ro ro O CO ro ro CO O O O O CO ro co CO CO CO CO ro ro ro ro CO co ro co co

U CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN r— CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN t— t— t— C— t— t— C— t— r- r—

PH AH CO t— t— t— t— r- t— r- t— tr- t— t— t— t— t— t— t— t— t— r- t— t— t— t— IT- t— t— t— t— t— r— t— t— t— r— t— t— t— C— t— t— C— t— t—

__ ON © CN co Tf m VO t— 00 σs © CN O Tf in o r- 00 OS © CN ro Tf in V© r- 00 σs © CN CO Tf in V© t— OO σs o CN co _"tf in v© t- 00 OS © CN ^!-»^• →* © CN CN CN CN CN CN CN CN CN CN CO CO CO ro co ro ro CO CO CO Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf in in in ιn in in in m in in VO VO VO g to VO vo VO VO VO V© VO VO VP VO vp VO V© VO VO vo VO V© VO V© VO VO vp VO v© vo O VO p vo vo VO VO V© vp SO vo VO vo VO VO vo SO vo p vo VO vo VO VP p VO vo vp

00 ro ro ro ro co co co CO CO ro co ro CO co O ro co co ro CO CO co ro ro ro CO ro ro ro co CO ro co co O co CO CO co co co co CO CO co ro ro ro CO CO co CO CO CO a 00 "tf CN oo © 00 CN l— ON © 00 t— t— CN ro Tf VO 00 VO σs in ro σs vo CN ro σs oo O

VO © © Tf t— © r- t— © 00 r- CO m 00 CN Tf Tf 00 CN © © in SO © CN CN CN vo t— Tf cn Tf in ON CN vo 00 ON CN CN Tf Tf CO © vo t— in m CO Tf Tf tn CN in VO CO co in 00 CN Tf in t— ro t— in ON σs CN

3 oo 00 00 σs σs ON ON © © © © ro ro CO co Tf Tf "tf in in VO V© vp vo CN CO ro co CO Tf Tf Tf m - t— r- r- t— ON to V© σs ON σs

VO VO VO O VO VO t— r — t— tr- t- o © © CN CN CN

00 00 00 00 00 00 00 00 00 00 00 00 00 oo 00 00 00 00 00 o OO o © © © o © © o o O r ©- t— t— t—

© © © © © r ©- ©r- r- t o © © © © o © © © © © © o o © © © © o © © o © o © ni ro ro ro ro ro co CO CO ro ro ro ro CO CO ro ro O CO ro CO co CO ro o ro ro ro ro co co co ro CO co CO co CO co CO co CO co CO co CO ro CO ro co CO CO co CO co to a PHzAHzPHzPHzPHzPHzPHzAHzPHzPHzzzzAHzPHzAH.zPHzPHzPH.zPHzzzzzzzzzzzzzzzzzzzzzzz PHzPHzPHzPHzPHzPHzPHzPHzPHzPHzPHz ω PH

CD 3333333333 Ώ AH PH

333333333 Ώ H AH AH PH PH PH PH PH PH

3333 s PH AH PH PH PH PH P

333333333333333 333333333333

.g a CN ro Tf in VO t- 00 ON © CN ro Tf in VO t— oo σs © CN CO Tf in v© t— 00 ON © CN ro Tf in VP r- 00 ON O CN co Tf in VO ro ro ro ro ro ro CO co Tf Tf f Tf Tf Tf Tf Tf Tf Tf in in in in in in m in in in vo VO vo vo VO vo VO VO VO VO t—

CN CN CN CN N CN CN CN CN r- t— t— r- t— t— rr-- oo σs © CN CO Tf in to r- t— 00 00 oo 00 00 00 o cr CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN o CN ω © © o © O © © © O © © © © © © o © © © o © © © o © o © © o © © © © o © © © O © o © © © o © © o o © o © o ©

AH 00 vo vo o VO VO vo VO VO O VO VO VO V© VO VO VO VO v© VO VO VO s© VO vo SO o V© VO vo O VO V© Ό VO o O vo VO VO VO V© VO VO o V© vo VO VO vo vo VD SO vo VD

--H oo OS o CN ro Tf in VO t— 00 σs o CN ro Tf in vo tr00 ON © CN ro Tf in vo t— 00 ON © CN co Tf in VO t— oo ON © CN ro Tf in o t— 00 σs o i-H r n in in V© VO O vo VO vo VO io V© V© t— r- r- t— t— r- r- t— t— r- 00 00 OO oo oo oo oo oo oo 00 σs σs σs ON OS σs σs ON σs ON o ©

"ZS " Tf Tf in in in in in in in i cT © © © o © © o © o © o o © © © o © o o © © © o © o © © © © © © © © © © © © © © © © o © © © O o © o t © © o

5o Tf "tf "ft Tf Tf Tf Tf Tf f Tf f Tf _"tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf "tf Tf Tf Tf Tf Tf Tf Tf Tf O CN CN CN CN CN CN CN CN CN CN N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN t— vo σs ro σs OO vo VO oo r- , CN in CO Tf t— v© OO in ro in © t— O oo in CO oo CN in CO _"tf Tf VO Tf in t— in © VO 00 VO in C— in vo ©

V© 00 OS © o co VO ON o ro Tf in V© vo VO r- OO CN CN ro Tf in in s© VO co Tf in σs ©r- CN CN CN in VO VO t— t— oo 00 © co in in so © t— 00 co

CN N CN CO O CO CO co CO Tf "tf Tf Tf Tf Tf Tf Tf Tf Tf in in in in in in in in in VO VO VO V© s ON ON ©

Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf f Tf Tf Tf Tf Tf Tf Tf "tf r- t— t— r- r- t— r- t— t— t— 00 00 00 00 00 ON σs σ

"tf Tf Tf Tf "tf •tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf in pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq pq W pq pq pq pq pq q pq pq pq pq W pq pq pq pq pq pq pq pq m pq pq pq pq pq pq pq pq pq W pq pq pq pq pq pq ato ϋϋϋUϋϋϋUϋϋUϋUϋUϋϋϋϋUϋϋϋUUUUϋϋϋUUUϋUϋϋϋUϋϋϋϋUϋUϋϋϋϋϋϋϋϋ CD CQCQpqeQPQCQOQPQCQCQCQCQCQCQCQPQCQPQPQCQPQCQPQCQCQPQmeQOQOQm

CO

90 .g a © r- CN CO Tf - rin- VO r- 00 ON © CN co Tf in VO t— oo OS © CN co Tf in vo - 00 ON © CN co Tf in VO t— oo σs © CN CO rH < t— t— t— r t— r- t— t— 00 00 00 00 00 00 00 00 00 00 σs ON ON σs ON OS ON rσ- oo σs © CN co Tf ■n VO r s Os σs © © © o © o © © © © CN CN CN CN t- r- 8 xT CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN ω CN

00 00 00 OO 00 00 00 00 OO 00 OO 00 00 00 oo 00 00 00 00 oo 00 OO 00 00 OO 00 00 00 00 OO 00 OO 00 00 00 OO 00 oo 00 oo 00 00 00 00 OO OO 00 00 00 OO 00 00 oo 00

S z PH oo OO oo OO σs σs OS σs ON σs ON ON σs ON © © o © o © o ©r- oo σs © CN ro Tf in VO t— oo ON © CN ro f in VO r- 00 o © CN CN CN CN CN CN CN CN CN CN co ro CO ro co CO co CO CO co

Cf ON ON σs σs σs ON σs σs OS ON ON ON σs σs © © o © o © © o © © © © © O © © © © © o © © o © © © o © © © © © © O © © © o © o ©

5 t CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

00

^ tf tf in iΛ O CN CN C^

in vp t— oo ON C r-H CN co -xf in vo co cθ co co τf τf τf τf "tf τf τf "tf τf τf in ιn ιn ιn ιn ιn ιn τττfff ττ"*ff τττfff τττfff τχff ττff ττff ""tftf ττff ττff ττff ττff ττff ττff ""tftf ""tftf ττff ττff ττff ττff ττff ττff τf τf τf τf τf CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN t t—r- tt—— t t—— t r—- r r-- tt—— t— t— t— r- t— t— t— r- t— t— r- t— t— t— t— t— t— r- r- t— t— t— r- r- t— t— t— © ι— i cN co -tf in vo t— CN CN CN CN CN CN CN M SO W β vO Φ ^O β Φ ^O

CN CO OO © in OO m ro Tf σs CN in 1— ©

CN CO CO ro Tf in in in r— t— r- 00 00 N IN ΓN CN IN IN

i-l i-l t-l h-l t-J i-l

ΓN co Tf in o 1— 00 σs © __, CN ro Tf in

00 oo 00 00 00 oo ON ON ON ON ON ON ro CO cn CO ro ro ro ro ro CO o VO VO vo VO O vo VO V© p VO V© v© vp O VO

00 σs © CN ro Tf in VO t— OO σs ©

ON σs σs OS σs © © © © O © © O o ©

CN CN CN

Tf Tf

CN "tf Tf Tf Tf

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN 00 t— O oo σs -f

PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH PH OQ CQ OQ CQ OQ OQ OQ PQ OQ OQ OQ OQ CQ PQ CQ OQ OQ CQ PQ OQ OQ CQ OQ vo 00 ON ι cN co "tf- ιn vo r- oo σs © τ— ι cN cθ "tf in vo r- oo σs © τ— i cN co

oo σN © τ— i cN co -tf in vo c— oo ON rO Tf Tf Tf CN ■ CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

12206 48390 BFR101518 24268 60452 LMO 100551 36329 72513 SMU101439

12207 48391 BFR10152 24269 60453 LMO100556 36330 72514 SMU101446

12208 48392 BFR101549 24270 60454 LMO100570 36331 72515 SMU101447

12209 48393 BFR101559 24271 60455 LMO100571 36332 72516 SMU101449

12210 48394 BFR10157 24272 60456 LMO100572 36333 72517 SMU101450

12211 48395 BFR101582 24273 60457 LMO100576 36334 72518 SMU101451

12212 48396 BFR10160 24274 60458 LMO 100578 36335 72519 SMU101453

12213 48397 BFR101607 24275 60459 LMO100582 36336 72520 SMU101454

12214 48398 BFR101650 24276 60460 LMO 100583 36337 72521 SMU101455

12215 48399 BFR101675 24277 60461 LMO100585 36338 72522 SMU101464

12216 48400 BFR10168 24278 60462 LMO100586 36339 72523 SMU101465

12217 48401 BFR101716 24279 60463 LMO 100590 36340 72524 SMU101466

12218 48402 BFR101725 24280 60464 LMO100594 36341 72525 SMU101467

12219 48403 BFR101730 24281 60465 LMO 100596 36342 72526 SMU101468

12220 48404 BFR101740 24282 60466 LMO 100597 36343 72527 SMU101471

12221 48405 BFR101753 24283 60467 LMO 100599 36344 72528 SMU101474

12222 48406 BFR101754 24284 60468 LMO 100602 36345 72529 SMU101475

12223 48407 BFR101755 24285 60469 LMO100605 36346 72530 SMU101478

12224 48408 BFR10176 24286 60470 LMO 100609 36347 72531 SMU101479

12225 48409 BFR101776 24287 60471 LMO100611 36348 72532 SMU101480

12226 48410 BFR101778 24288 60472 LMO100614 36349 72533 SMU101483

12227 48411 BFR101794 24289 60473 LMO100615 36350 72534 SMU101487

12228 48412 BFR101806 24290 60474 LMO100624 36351 72535 SMU101490

12229 48413 BFR10181 24291 60475 LMO 100625 36352 72536 SMU101492

12230 48414 BFR10185 24292 60476 LMO 100629 36353 72537 SMU101495

12231 48415 BFR10188 24293 60477 LMO 100631 36354 72538 SMU101498

12232 48416 BFR10189 24294 60478 LMO100639 36355 72539 SMU101500

12233 48417 BFR101898 24295 60479 LMO100640 36356 72540 SMU101505

12234 48418 BFR101900 24296 60480 LMO 100643 36357 72541 SMU101506

12235 48419 BFR101904 24297 60481 LMO 100648 36358 72542 SMU101509

12236 48420 BFR101983 24298 60482 LMO100649 36359 72543 SMU101513

12237 48421 BFR10199 24299 60483 LMO 100657 36360 72544 SMU101518

12238 48422 BFR102018 24300 60484 LMO100662 36361 72545 SMU101520

12239 48423 BFR102042 24301 60485 LMO 100666 36362 72546 SMU101534

12240 48424 BFR102053 24302 60486 LMO100669 36363 72547 SMU101535

12241 48425 BFR10209 24303 60487 LMO 100672 36364 72548 SMU101536

12242 48426 BFR102096 24304 60488 LMO 100679 36365 72549 SMU101538

12243 48427 BFR102099 24305 60489 LMO 100680 36366 72550 SMU101539

12244 48428 BFR102108 24306 60490 LMO100689 36367 72551 SMU101540

12245 48429 BFR102113 24307 60491 LMO 100693 36368 72552 SMU101545

12246 48430 BFR102131 24308 60492 LMO100694 36369 72553 SMU101546

12247 48431 BFR102132 24309 60493 LMO100695 36370 72554 SMU101548

12248 48432 BFR102134 24310 60494 LMO 100703 36371 72555 SMU101550

12249 48433 BFR102146 24311 60495 LMO100716 36372 72556 SMU101553

12250 48434 BFR102176 24312 60496 LMO100718 36373 72557 SMU101554

12251 48435 BFR102180 24313 60497 LMO 100724 36374 72558 SMU101565

12252 48436 BFR10219 24314 60498 LMO100726 36375 72559 SMU101571

12253 48437 BFR102190 24315 60499 LMO 100731 36376 72560 SMU101576

12254 48438 BFR102200 24316 60500 LMO100732 36377 72561 SMU101599

12255 48439 BFR102217 24317 60501 LMO100736 36378 72562 SMU101640

12256 48440 BFR102219 24318 60502 LMO 100742 36379 72563 SMU101645

12257 48441 BFR102222 24319 60503 LMO100743 36380 72564 SMU101666

12258 48442 BFR102226 24320 60504 LMO 100749 36381 72565 SMU101683

12259 48443 BFR102236 24321 60505 LMO100756 36382 72566 SMU101698

12260 48444 BFR102256 24322 60506 LMO 100759 36383 72567 SMU101700

v vo CN

oo oo

ro oo 00 ON in t— oo Tf t— CO σs

00 σs CN N CN CN CO Tf in VO v© vo t— σs σs © © © © © © © © © © © ©

CO 00 n CO 00 xn CO 00 CO O 00 00 CO 00

00 σs © CN CO Tf in v© r- OO σs ©

CN CN CN CN CO CO CO CO CO CO CO CO CO CO Tf Tf

00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN t— t— r- t— t— t— C— r- C— r- t— t— t— t— t—

CO Tf in VO r- 00 σs © CN CO Tf tn VO t— co CO CO Tf Tf Tf Tf Tf Tf Tf Tf Tf in in in in m n tn in vo VO o V© VO vo vo VO vo VO V© VO vo v© vo VO vo vo VO

VO VO V© VO VO vo VO vo vo V© VO vo VO VO vo o VO vo

CO CO O co CO CO co O CO co CO CO co

VO © __, CN CO OS o in in 00 ON σs ON © o © © O o CN CN CN CN

00 oo oo 00 00 oo 00 00 OO 00 00 00

i-q t-q hi t-l hi t-l

ON o CN co Tf in VO r- oo σs © r- r- t— t— t— t— t— t— r- r- 00 t— r- t— t— r- t— r- t— t— t— t— t— vo vo VD VO V© vo vo v© vp VD VO vp vo vo vo o r- 00 OS o CN co Tf in VO

00 00 00 ON ON σs OS σs ON σs in

Tf Tf Tf Tf N CN CN CN CN CN CN CN CN CN N N CN CN CN CN CN CN CN CN CN

VO VO t—

00

PQ PQ PQ OQ OQ in VO r- 00 ON © CN CO Tf m vo r-

O © © © ι — 1 r- t— t— t— t— r- r- t— r- r- t— r- r- t- r- r- r-

00 OO 00 00 oo oo oo 00 00 00 oo 00 00 00

Tf Tf Tf Tf Tf Tf

CN CN CN CN CN CN CN CN CN CN CO CO CO CO CO tn in in

CN CN CN CN N CN CN CN CN CN CN N CN CN N CN CN CN CN N

CN CN CN CN CN cO tf tf tf tf in i

PH AH AH AH AH PH AH AH PH -PH AH PH PH PH PH PH PH PH P cn xn xn xn cn cn xn xn cn xn x oo θN © ι— i cN co tf in v - m t— t— t— t— r- t— t— t— r- r tf ιn vo t— r- r- r- t— t— r- r- r

τ-i r-ι cN cN cN c

PH PH PH P^

tf in vo t— oo σs θ τ-H CN co tf i CN CN CN CN CN CN C^ Φ β Φ O φ VO iO φ VO VO Φ O vO O

∞

PH PH PH PH P^ PH PH PH PH PH PH PH PH PH PH PH P m co tf in vo r- oo ON © T— i cN © © © © o ON ON ON Os ON O _N C_N C_N C_N C _N C_N C_N C_N C-N C _N C_N C_N C_N C_

i

AH PH PH PH AH AH AH PH AH AH AH AH AH AH AH AH AH AH A CO OO OO CO CO OO CO CO CO CO CO CO vo r- oo σs θ τ- oo oo oo σs σ -r- -t— - r- -r- -t— - r- -t— -t— - t— - r- -t— -r- -r- ^.t— -t— ^.r oo σs θ τ-ι cN ro tf in vo r ON © © © © © © © C t- t— r- r- r- r- r

tf oo o ι_HOo 00 00 0 oOoO cOloO OO OO O

σs © τ— ' CN co tf in vo t— oo σs O 'fl *O O O C O φ O VO >O V3 >O ⁱC O oo σs θ r-H cN co tf in v CO CO cO CO tf tf tf tf tf tf

cN in vo σs ro m τ— ι oo tf vp i

0 -0- © - tn tn v © © © o © © © © © n

oo os © τ— i cN co tf in vo t— o ιn ιn ιn . vo_ vD vo _ vo _ vo v© _ vo _ vo _ v _ CN CN CN CN

tf ιinι v *uo it—- woo uois O T— ι cN co tf in vo r- oo σs © r-H CN co oo oo oo oo o σ© o© o© ©© o© o© ©0 ©© o0 ©© ..©© o© © 0 t. CO CO C

r-

H U

PH

r- r-

©

© O

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

13746 49930 BFU115196 25808 61992 MAV103415 37869 74053 SPN401301

13747 49931 BFU115276 25809 61993 MAV103416 37870 74054 SPN401305

13748 49932 BFU115281 25810 61994 MAV103417 37871 74055 SPN401316

13749 49933 BFU115309 25811 61995 MAV103429 37872 74056 SPN401317

13750 49934 BFU115323 25812 61996 MAV103439 37873 74057 SPN401319

13751 49935 BFU115336 25813 61997 MAV103447 37874 74058 SPN401320

13752 49936 BFU115450 25814 61998 MAV103466 37875 74059 SPN401321

13753 49937 BFU115490 25815 61999 MAV103471 37876 74060 SPN401327

13754 49938 BFU115574 25816 62000 MAV103503 37877 74061 SPN401328

13755 49939 BFU115576 25817 62001 MAV103512 37878 74062 SPN401331

13756 49940 BFU115595 25818 62002 MAV103522 37879 74063 SPN401334

13757 49941 BFU115601 25819 62003 MAV103524 37880 74064 SPN401338

13758 49942 BFU115607 25820 62004 MAV103533 37881 74065 SPN401342

13759 49943 BFU115652 25821 62005 MAV103538 37882 74066 SPN401350

13760 49944 BFU115698 25822 62006 MAV103539 37883 74067 SPN401352

13761 49945 BFU115699 25823 62007 MAV103545 37884 74068 SPN401361

13762 49946 BFU115706 25824 62008 MAV103566 37885 74069 SPN401362

13763 49947 BFUl 15722 25825 62009 MAV103568 37886 74070 SPN401363

13764 49948 BFU115748 25826 62010 MAV103576 37887 74071 SPN401364

13765 49949 BFUl 15799 25827 62011 MAV103580 37888 74072 SPN401365

13766 49950 BFUl 15826 25828 62012 MAV103592 37889 74073 SPN401372

13767 49951 BFUl 15854 25829 62013 MAV103597 37890 74074 SPN401376

13768 49952 BFUl 15907 25830 62014 MAV103599 37891 74075 SPN401382

13769 49953 BFUl 15965 25831 62015 MAV103601 37892 74076 SPN401383

13770 49954 BFUl 15968 25832 62016 MAV103606 37893 74077 SPN401384

13771 49955 BFUl 16174 25833 62017 MAV103610 37894 74078 SPN401388

13772 49956 BFUl 16206 25834 62018 MAV103621 37895 74079 SPN401393

13773 49957 BFUl 16306 25835 62019 MAV103625 37896 74080 SPN401394

13774 49958 BFU116313 25836 62020 MAV103629 37897 74081 SPN401395

13775 49959 BMA100015 25837 62021 MAV103638 37898 74082 SPN401396

13776 49960 BMA100022 25838 62022 MAV103640 37899 74083 SPN401402

13777 49961 BMA100031 25839 62023 MAV103641 37900 74084 SPN401409

13778 49962 BMA100034 25840 62024 MAV103648 37901 74085 SPN401411

13779 49963 BMA100053 25841 62025 MAV103649 37902 74086 SPN401412

13780 49964 BMA100055 25842 62026 MAV103656 37903 74087 SPN401413

13781 49965 BMA100059 25843 62027 MAV103659 37904 74088 SPN401416

13782 49966 BMA100060 25844 62028 MAV103673 37905 74089 SPN401417

13783 49967 BMA100069 25845 62029 MAV103677 37906 74090 SPN401420

13784 49968 BMA100071 25846 62030 MAV103710 37907 74091 SPN401421

13785 49969 BMA100072 25847 62031 MAV103718 37908 74092 SPN401422

13786 49970 BMA100077 25848 62032 MAV103737 37909 74093 SPN401423

13787 49971 BMA100078 25849 62033 MAV103755 37910 74094 SPN401426

13788 49972 BMA100086 25850 62034 MAV103759 37911 74095 SPN401428

13789 49973 BMA100120 25851 62035 MAV103767 37912 74096 SPN401429

13790 49974 BMA100121 25852 62036 MAV103780 37913 74097 SPN401439

13791 49975 BMA100134 25853 62037 MAV103783 37914 74098 SPN401442

13792 49976 BMA100152 25854 62038 MAV103787 37915 74099 SPN401443

13793 49977 BMA100166 25855 62039 MAV103801 37916 74100 SPN401445

13794 49978 BMA100169 25856 62040 MAV103805 37917 74101 SPN401450

13795 49979 BMA100174 25857 62041 MAV103808 37918 74102 SPN401452

13796 49980 BMA100176 25858 62042 MAV103813 37919 74103 SPN401455

13797 49981 BMA100184 25859 62043 MAV103815 37920 74104 SPN401457

13798 49982 BMA100194 25860 62044 MAV103822 37921 74105 SPN401464

13799 49983 BMA100200 25861 62045 MAV103827 37922 74106 SPN401466

13800 49984 BMA100207 25862 62046 MAV103835 37923 74107 SPN401471

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

13856 50040 BMA100869 25918 62102 MAV104921 37979 74163 SPN401736

13857 50041 BMA100911 25919 62103 MAV104946 37980 74164 SPN401755

13858 50042 BMA100917 25920 62104 MAV104984 37981 74165 SPN401756

13859 50043 BMA100943 25921 62105 MAV104987 37982 74166 SPN401757

13860 50044 BMA100948 25922 62106 MAV105025 37983 74167 SPN401766

13861 50045 BMA100957 25923 62107 MAV105031 37984 74168 SPN401774

13862 50046 BMA100998 25924 62108 MAV105050 37985 74169 SPN401775

13863 50047 BMA101020 25925 62109 MAV105065 37986 74170 SPN401776

13864 50048 BMA101024 25926 62110 MAV105067 37987 74171 SPN401779

13865 50049 BMA101028 25927 62111 MAV105101 37988 74172 SPN401780

13866 50050 BMA101045 25928 62112 MAV105125 37989 74173 SPN401786

13867 50051 BMA101052 25929 62113 MAV105135 37990 74174 SPN401788

13868 50052 BMA101057 25930 62114 MAV105169 37991 74175 SPN401792

13869 50053 BMA101065 25931 62115 MAV105180 37992 74176 SPN401793

13870 50054 BMA101083 25932 62116 MAV105204 37993 74177 SPN401797

13871 50055 BMA101111 25933 62117 MAV105209 37994 74178 SPN401802

13872 50056 BMA101112 25934 62118 MAV105267 37995 74179 SPN401803

13873 50057 BMA101121 25935 62119 MAV105287 37996 74180 SPN401804

13874 50058 BMA101128 25936 62120 MAV105291 37997 74181 SPN401805

13875 50059 BMA101152 25937 62121 MAV105306 37998 74182 SPN401808

13876 50060 BMA101165 25938 62122 MAV105337 37999 74183 SPN401812

13877 50061 BMA101166 25939 62123 MAV105362 38000 74184 SPN401813

13878 50062 BMA101178 25940 62124 MAV105384 38001 74185 SPN401818

13879 50063 BMA101183 25941 62125 MAV105413 38002 74186 SPN401823

13880 50064 BMA101185 25942 62126 MAV105419 38003 74187 SPN401835

13881 50065 BMA101206 25943 62127 MAV105422 38004 74188 SPN401837

13882 50066 BMA101214 25944 62128 MAV105445 38005 74189 SPN401839

13883 50067 BMA101219 25945 62129 MAV105446 38006 74190 SPN401842

13884 50068 BMA101246 25946 62130 MAV105448 38007 74191 SPN401850

13885 50069 BMA101250 25947 62131 MAV105497 38008 74192 SPN401851

13886 50070 BMA101276 25948 62132 MAV105499 38009 74193 SPN401853

13887 50071 BMA101290 25949 62133 MAV105503 38010 74194 SPN401863

13888 50072 BMA101322 25950 62134 MAV105506 38011 74195 SPN401864

13889 50073 BMA101335 25951 62135 MAV105510 38012 74196 SPN401865

13890 50074 BMA101338 25952 62136 MAV105518 38013 74197 SPN401866

13891 50075 BMA101355 25953 62137 MAV105530 38014 74198 SPN401875

13892 50076 BMA101385 25954 62138 MAV105552 38015 74199 SPN401878

13893 50077 BMA101403 25955 62139 MAV105559 38016 74200 SPN401879

13894 50078 BMA101414 25956 62140 MAV105572 38017 74201 SPN401885

13895 50079 BMA101428 25957 62141 MAV105579 38018 74202 SPN401887

13896 50080 BMA101458 25958 62142 MAV105583 38019 74203 SPN401895

13897 50081 BMA101481 25959 62143 MAV105594 38020 74204 SPN401899

13898 50082 BMA101484 25960 62144 MAV105603 38021 74205 SPN401900

13899 50083 BMA101485 25961 62145 MAV105607 38022 74206 SPN401902

13900 50084 BMA101495 25962 62146 MAV105640 38023 74207 SPN401904

13901 50085 BMA101496 25963 62147 MAV105645 38024 74208 SPN401907

13902 50086 BMA101499 25964 62148 MAV105676 38025 74209 SPN401915

13903 50087 BMA101500 25965 62149 MAV105704 38026 74210 SPN401919

13904 50088 BMA101518 25966 62150 MAV105730 38027 74211 SPN401921

13905 50089 BMA101520 25967 62151 MAV105759 38028 74212 SPN401928

13906 50090 BMA101533 25968 62152 MAV105805 38029 74213 SPN401932

13907 50091 BMA101577 25969 62153 MAV105815 38030 74214 SPN401935

13908 50092 BMA101585 25970 62154 MAV105850 38031 74215 SPN401937

13909 50093 BMA101593 25971 62155 MAV105869 38032 74216 SPN401941

13910 50094 BMA101603 25972 62156 MAV105900 38033 74217 SPN401954 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

13911 50095 BMA101604 25973 62157 MAV105904 38034 74218 SPN401955

13912 50096 BMA101609 25974 62158 MAV105907 38035 74219 SPN401956

13913 50097 BMA101618 25975 62159 MAV105952 38036 74220 SPN401959

13914 50098 BMA101625 25976 62160 MAV105985 38037 74221 SPN401968

13915 50099 BMA101634 25977 62161 MAV106038 38038 74222 SPN401979

13916 50100 BMA101641 25978 62162 MAV106060 38039 74223 SPN401981

13917 50101 BMA101644 25979 62163 MAV106074 38040 74224 SPN401985

13918 50102 BMA101649 25980 62164 MAV106092 38041 74225 SPN401988

13919 50103 BMA101700 25981 62165 MAV106114 38042 74226 SPN401990

13920 50104 BMA101721 25982 62166 MAV106118 38043 74227 SPN401991

13921 50105 BMA101765 25983 62167 MAV106140 38044 74228 SPN401992

13922 50106 BMA101766 25984 62168 MAV106180 38045 74229 SPN401997

13923 50107 BMA101787 25985 62169 MAV106193 38046 74230 SPN402005

13924 50108 BMA101790 25986 62170 MAV106301 38047 74231 SPN402006

13925 50109 BMA101805 25987 62171 MAV106350 38048 74232 SPN402007

13926 50110 BMA101880 25988 62172 MAV106390 38049 74233 SPN402012

13927 50111 BMA101899 25989 62173 MAV106392 38050 74234 SPN402016

13928 50112 BMA101911 25990 62174 MAV106393 38051 74235 SPN402017

13929 50113 BMA101914 25991 62175 MAV106394 38052 74236 SPN402019

13930 50114 BMA101918 25992 62176 MAV106396 38053 74237 SPN402021

13931 50115 BMA101920 25993 62177 MAV106404 38054 74238 SPN402022

13932 50116 BMA101924 25994 62178 MAV106405 38055 74239 SPN402023

13933 50117 BMA101936 25995 62179 MAV106410 38056 74240 SPN402024

13934 50118 BMA101937 25996 62180 MAV106414 38057 74241 SPN402025

13935 50119 BMA101951 25997 62181 MAV106430 38058 74242 SPN402026

13936 50120 BMA101975 25998 62182 MAV106432 38059 74243 SPN402031

13937 50121 BMA101986 25999 62183 MAV106442 38060 74244 SPN402032

13938 50122 BMA101995 26000 62184 MAV106443 38061 74245 SPN402036

13939 50123 BMA101998 26001 62185 MAV106465 38062 74246 SPN402037

13940 50124 BMA102007 26002 62186 MAV106467 38063 74247 SPN402041

13941 50125 BMA102013 26003 62187 MAV106475 38064 74248 SPN402042

13942 50126 BMA102024 26004 62188 MAV106479 38065 74249 SPY100024

13943 50127 BMA102055 26005 62189 MAV106497 38066 74250 SPY100064

13944 50128 BMA102057 26006 62190 MAV106504 38067 74251 SPY100086

13945 50129 BMA102061 26007 62191 MAV106507 38068 74252 SPY100103

13946 50130 BMA102063 26008 62192 MAV106509 38069 74253 SPY100159

13947 50131 BMA102072 26009 62193 MAV106513 38070 74254 SPY100161

13948 50132 BMA102074 26010 62194 MAV106517 38071 74255 SPY100203

13949 50133 BMA102082 26011 62195 MAV106518 38072 74256 SPY100277

13950 50134 BMA102085 26012 62196 MAV106519 38073 74257 SPY100322

13951 50135 BMA102102 26013 62197 MAV106520 38074 74258 SPY100349

13952 50136 BMA102106 26014 62198 MAV106522 38075 74259 SPY100446

13953 50137 BMA102153 26015 62199 MAV106525 38076 74260 SPY100688

13954 50138 BMA102164 26016 62200 MAV106529 38077 74261 SPY100767

13955 50139 BMA102165 26017 62201 MAV106530 38078 74262 SPY100910

13956 50140 BMA102172 26018 62202 MAV106531 38079 74263 SPY100934

13957 50141 BMA102173 26019 62203 MAV106532 38080 74264 SPY100941

13958 50142 BMA102197 26020 62204 MAV106540 38081 74265 SPY100972

13959 50143 BMA102202 26021 62205 MAV106542 38082 74266 SPY100981

13960 50144 BMA102208 26022 62206 MAV106545 38083 74267 SPY101115

13961 50145 BMA102225 26023 62207 MAV106547 38084 74268 SPY101254

13962 50146 BMA102236 26024 62208 MAV106548 38085 74269 SPY101451

13963 50147 BMA102261 26025 62209 MAV106549 38086 74270 SPY101502

13964 50148 BMA102272 26026 62210 MAV106572 38087 74271 SPY101613

13965 50149 BMA102306 26027 62211 MAV106573 38088 74272 SPY101669

Os 00 ON © CN r- σs © CN CO in

ON ON OS σs σs o © © o o

CN C

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

PH PH AH AH AH AH AH AH AH PH AH AH AH PH

00 00 00 00 00 xn oo 00 CO 00 00 CO CO 00

ON © CN CO tf in O t— t— t— t— t— t— t— OO O ro CO CO CO O CO CO CO CO CO co CO CO ro CO CO C t— t— tr- r- t— r- t— t— t— t— r- r- t— r t— OO σs © CN ro tf in VO r oo 00 00 00 ON σs σs σs ON σs σs

00 00 00 00 00 00 00 00 00 00 00 00 ro CO co CO CO CO CO co CO CO ro ro CO CO CO CO C in r- σs CN ON σs CN CO tf t— ON 00 vp C

00 © © CN c

CO CO CO CO CO CO CO tf tf tf tf

OQ PQ OQ OQ PQ CQ CQ CQ PQ OQ CQ PQ PQ CQ OQ O^Q

t- oo σs © CN CO tf in vo t— oo ON

CN CNo CN CN CN CN CN v CN CN CN CN CN CN CN CN CN CN CN CN CN C

VO VO VO V© VO v© VO SO VO VO vo VO VO SO VO VO VO VO V tf tn VO r- oo ON © CN ro tf in v ro ro co co co c

V© V© VO V© VO VO VO VO VO VO VO vo vo o VO vo V

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

ON tf tf in VO 00 σs © © C tf tf in in in in in in VO VO VO VO V

CO co co co co co co co CO co ro ro ro co co c

<j << -j <; r

OQ PQ OQ PQ CQ CQ OQ PQ PQ OQ PQ PQ PQ PQ PQ OQ PQ OQ CQ PQ O in vo t— oo ON © CN ro tf in vo r- 0 tf tf tf tf tf tf tf tf tf tf in in in in in in in in i

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN N N CN C in i

CN O tf in vo t— 00 σs o CN co v© VO VO V© VO r- t— r- t— r

r-

H U

96 rH r r--

©

© O

a in CO in VP r- σs VO in VO σs © CO tf in VO t— 00 CO CN VO co tf m OO O © © ro tf in t— 00 Os ro tf VO CN tf CN tf in oo ON © CN ro zn tf t— 00 00 oo 00 vo t

00 OS o © CN £3 CN £3 CN CN CN CO tf tf tf in in m m vo r- r- 00 00 oo 00 00 oo 00 © tf tf tn in VO VO VO vo vo VO r— t— to σs σs ON σs σs ON σs © © o o © © © © © © r- t— t—

3 r- t

O © © © o © o © © o © © © © ©

© © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © © O © © © © © © © © t— h-l CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

© rH a 5- σs to AH AH PH AH PH PH AH AH AH PH PH AH AH AH Pi H AH AH AH AH AH Pi AH PH AH PH-PH AH AH PH PH PH H PH PH PH AH P AH AH AH AH AH AH PH AH PH AH AH Pi PH PH AH A © CO 00 00 oo 00 cn 00 cn CO oo xn 00 xn O O 00 O cn CO n oo 00 oo N α 00 00 xn xn oo CO 00 xn 00 00 00 00 CO 00 cn 00 00 00 oo cn 00 CO CO O O CO xn CO 00 00 C

H -_*D-» a co tf in P r- 00 ON

< CN CN CO co CO CO co co co co co co tf tf tf f tf tf tf tf tf tf in in •n in in in i cr VO VO vo Vp VO VO SO VO vp VO VO VO VO VO VO VO VO O VO v© VO VO vo VO VP VO SO VO o O VO v© VD vo VO VO VO VO vo V© vo vo O V© vo VO VO v© o vo vp vo U 8 vo V ω tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf r- tf tf tf tf tf tf tf tf tf ft tf tf tf tf tf tf tf tf tf tf tf tf tf Tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf t— t— t- t— t t— r- r- t— r- r— t— t— r- r- r- t— t— t— l— t— t— r- r- t— r- t— t—

PH AH co t— r— t- — r- t— t— t— t— r- t— r- t— t— r- t— t— r- r- r- r- r- t— t— r- t σs © CN CO tf in VO r- oo σs © _t CN co tf in v© t— oo σs © CN co tf tn vo r- 00 ON © CN CO tf m VO t— 00 ON o CN CO Tf in p r- 00 OS © C z ra CN CN CN CN CN CN CN CN CN CN co CO ro co CO CO co CO CO co tf tf tf tf tf tf tf tf tf tf in in in m in m in in in m V© VP VO vo vp vo VO V© VO vo r- t— t cr tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf δ ω 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 oo 00 00 00 00 00 00 oo oo oo OO 00 00 00 oo oo 00 oo oo oo 00 oo 00 oo 00 oo oo oo oo 00 oo oo oo 00 oo 00 o

CO CO CO ro CO CO ro ro CO CO co ro CO co co CO CO CO co CO co co O co CO CO co co CO co co CO co co co CO CO co co co CO CO ro CO co CO CO co CO CO ro ro ro ro c

CN CO ON ON t— σs CN oo © in tf in t— o CN co tf σs tf ■n CN in t— © tf © in © t— © CN CO tf in o CN in V© σs © ro ON CN 00 tf tf n t- t— © CN CO tf tf tf m in in ■n i VO vp t- oo 00 σs © co in V© 00 vo vo t— CN ro tf i tf i

CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C

> >>> >>>> >>> >> > > > > >>>>>>>>>>> >>>> >>>> > >>> s to CQ CQ CQ CQ CQ CQ CQ OQ PQ CQ CQ OQ PQ PQ PQ PQ PQ PQ CQ PQ PQ PQ OQ PQ PQ PQ PQ CQ CQ CQ CQ OQ CQ CQ CQ CQ PQ PQ CQ CQ CQ OQ OQ CQ OQ CQ CQ OQ OQ OQ GQ OQ OQ C o ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ rt T^

.a a CN co tf m V© t— OO σs © CN CO tf in VO t— oo ON © CN co tf in vo t— oo σs © CN CO tf in vo t— 00 ON © CN co tf in VO r- 00 ON © CN co tf i α tf tf tf tf tf tf tf tf in i in in in in in in tn in VO V© VO VO vo vo VO VO V© VO r- t— t— t— t— t— 00 oo OS ON ON OS ON σ a cr in in in in ιn tn in in in in in in in in ■n tn in in m in in in i in in in in in m in in in in ■n rm- t- ιn rin- r- 00 OO oo 00 oo oo oo CO m in m in in in ■n in in in in in ■n in •n in i ω CN CN CN CN CN N CN N CN N CN CN CN CN CN CN CN CN N CN N CN CN CN CN N CN CN CN CN CN N CN CN CN N CN N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C i co VO vo VO VP vo VO VO vo VP VO vo VO vo VO O vo vo v© vo VO v© so VO VO VO V© VO O VO VO vo VO VO VO V© VO VP vo vo vo VO vo O vo VD o vo vo o vo vp vo VO v

-a-¹< ^Q 00 σs © CN ro tf in V© t— 00 ON © CN CO tf in VO t— 00 ON © CN CO tf in VP m — oo r- 00 OS © CN CO tf in VO t— 00 ON © CN co Tf in v© r- 00 σs © H in VO VO o VO vo vo P P VO VO t— t— t— r- ir- t— t— t— t— t OO 00 oo 00 00 00 00 oo 00 ON σs ON ON ON ON σs OS ON OS © © © © o © © o o ©

§ cr ro ro ro CO co ro CO ro ro co ro CO ro CO CO co co CO CO co co O co CO co co co co CO co co CO co co co ro ro O ro CO CO ro tf tf tf tf tf tf tf tf tf tf tf ω vo vo v© VO o vo VO vo o V© VO VO v© O VO VO VO v© O VO v© s VO v© VP VO VD vo VO VO VO p VD vo VO VO so VO vo VO VO VO VO VO VO VO vo vo vo VO v© vo VO o CN CN CN CN CN CN CN CN CN CN CN CN CN CN <N CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN CN C a VO © 00 m © © o tf CN © VO ON CO ON in VO t— VO tf t i—1

00 r-f t— VO © © CN ON co t— tf o © CN © tf CN ON CO tf tf in ON •n 00 O σs ON © © CN oo ON σs © in in in in r- t— r- 00 00 00 ON VO V© r- 00 ON o CN VO t— r- oo 00 © r- σs © ro tf tn VO © CN co tf tf 00 ON O

3 CN CN CN co CO ro co CO CO tf tf tf tf tf tf tf tf tf tf tf tf tf in in tn in in VO VO VO VO P p v© VO t— OO oo oo ON σs OS OS σs ON OS σs O vo V© r- t— r- 00 00 oo

_ VO VO VO VO vo vo VO VO VO VO o SO VO v© so V© VO VO VO VO vo vo VO VO vo o VO VO vo VO SO VO VO V© vp VO vp vo VO vo O VO VP VO vo VO VO P P o o v o © o © © © © © © © o © © o © O O © © © O © © © © © © © © © © © © o © © © © o o © © © © © © o © © © © © t-q BMA^IO

Sω BMA^IO

O CQ OQ CQ CQ CQ PQ OQ CQ OQ CQ PQ PQ PQ PQ PQ PQ PQ PQ PQ PQ PQ PQ OQ CQ CQ CQ OQ CQ cq CQ CQ CQ eQ CQ CQ CQ pq CQ PQ CQ PQ PQ CQ CQ PQ CQ PQ PQ CQ PQ PQ e

CO

96 ;£to" a © CN ro tf in vo

00 00 00 00 00 oo CO r 00- 00 OS © CN CO tf in vo I— 00 ON © CN co tf in vo 1— 00 OS © CN CO tf in vp t— oo σs © CN co tf in VO t— oo OS © _, CN r rH 00 00 σs ON ON σs ON σs OS OS OS σs © © O © o © © © o © CN CN CN CN CN CN CN CN CN CN co CO ro C r- a cr tf tf tf Tf tf tf tf tf Tf tf tf tf tf tf tf tf tf tf tf tf tn i in in in in in ■n in in in in in in in in in in in m in m in in in in in in in m tn ■n in i r- to © © © © © © © o © © © © © © O © © © © o o © © O © © © © © © © © © © © © © © © © o © © © © © © © © © © © ©

S ra σs OS ON ON o cr © o © © © © © © © CN CN CN CN CN CN CN CN CN CN CO ro co CO CO CO CO ro O CO tf tf tf tf tf tf tf tf tf

CN CN CN CN CO CO co CO co co CO CO co CO CO CO CO CO CO CO CO CO CO CO CO co co CO CO CO CO co CO CO CO O CO O CO co CO CO O co CO CO ro CO CO to CO ro ro C

§ ω ft tf tf tf tf Tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf tf. tf tf- tf tf tf tf tf tf tf tf tf ft tf f tf tf tf tf tf tf tf tf tf tf tf tf tf tf-

00 tf tf

r-

H U

r r--

©

© O

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

14461 50645 BMA108445 26523 62707 MBV103792 38584 74768 SPY201510

14462 50646 BMA108446 26524 62708 MBV103797 38585 74769 SPY201512

14463 50647 BMA108469 26525 62709 MBV103820 38586 74770 SPY201513

14464 50648 BMA108472 26526 62710 MBV103842 38587 74771 SPY201517

14465 50649 BMA108476 26527 62711 MBV103852 38588 74772 SPY201519

14466 50650 BMA108485 26528 62712 MBV103890 38589 74773 SPY201522

14467 50651 BMA108492 26529 62713 MBV103898 38590 74774 SPY201526

14468 50652 BMA108518 26530 62714 MBV103903 38591 74775 SPY201527

14469 50653 BMA108528 26531 62715 MBV103911 38592 74776 SPY201530

14470 50654 BMA108532 26532 62716 MBV103927 38593 74777 SPY201532

14471 50655 BMA108540 26533 62717 MBV103935 38594 74778 SPY201537

14472 50656 BMA108546 26534 62718 MBV103944 38595 74779 SPY201539

14473 50657 BMA108557 26535 62719 MBV103969 38596 74780 SPY201542

14474 50658 BMA108572 26536 62720 MBV103988 38597 74781 SPY201545

14475 50659 BMA108578 26537 62721 MBV104007 38598 74782 SPY201569

14476 50660 BMA108586 26538 62722 MBV104023 38599 74783 SPY201573

14477 50661 BMA108589 26539 62723 MBV104034 38600 74784 SPY201576

14478 50662 BMA108591 26540 62724 MBV104087 38601 74785 SPY201582

14479 50663 BMA108596 26541 62725 MBV104099 38602 74786 SPY201584

14480 50664 BMA108603 26542 62726 MBV104110 38603 74787 SPY201587

14481 50665 BMA108604 26543 62727 MBV104142 38604 74788 SPY201589

14482 50666 BMA108610 26544 62728 MBV104175 38605 74789 SPY201590

14483 50667 BMA108617 26545 62729 MBV104176 38606 74790 SPY201593

14484 50668 BMA108642 26546 62730 MBV104192 38607 74791 SPY201596

14485 50669 BMA108656 26547 62731 MBV104256 38608 74792 SPY201597

14486 50670 BMA108659 26548 62732 MBV104268 38609 74793 SPY201599

14487 50671 BMA108673 26549 62733 MBV104272 38610 74794 SPY201600

14488 50672 BMA108675 26550 62734 MBV104294 38611 74795 SPY201604

14489 50673 BMA108677 26551 62735 MBV104295 38612 74796 SPY201605

14490 50674 BMA108689 26552 62736 MBV104303 38613 74797 SPY201607

14491 50675 BMA108695 26553 62737 MBV104310 38614 74798 SPY201609

14492 50676 BMA108699 26554 62738 MBV104380 38615 74799 SPY201612

14493 50677 BMA108730 26555 62739 MBV104384 38616 74800 SPY201613

14494 50678 BMA108732 26556 62740 MBV104392 38617 74801 SPY201614

14495 50679 BMA108753 26557 62741 MBV104403 38618 74802 SPY201616

14496 50680 BMA108770 26558 62742 MBV104411 38619 74803 SPY201621

14497 50681 BMA108791 26559 62743 MBV104414 38620 74804 SPY201637

14498 50682 BMA108797 26560 62744 MBV104423 38621 74805 SPY201640

14499 50683 BMA108816 26561 62745 MBV104427 38622 74806 SPY201643

14500 50684 BMA108842 26562 62746 MBV104430 38623 74807 SPY201648

14501 50685 BMA108844 26563 62747 MBV104431 38624 74808 SPY201649

14502 50686 BMA108868 26564 62748 MBV104432 38625 74809 SPY201651

14503 50687 BMA108899 26565 62749 MBV104444 38626 74810 SPY201653

14504 50688 BMA108903 26566 62750 MBV104448 38627 74811 SPY201658

14505 50689 BMA108919 26567 62751 MBV104450 38628 74812 SPY201660

14506 50690 BMA108930 26568 62752 MBV104453 38629 74813 SPY201662

14507 50691 BMA108958 26569 62753 MBV104454 38630 74814 SPY201664

14508 50692 BMA108966 26570 62754 MBV104457 38631 74815 SPY201667

14509 50693 BMA108967 26571 62755 MBV104498 38632 74816 SPY201668

14510 50694 BMA108973 26572 62756 MBV104527 38633 74817 SPY201669

14511 50695 BMA108976 26573 62757 MBV104554 38634 74818 SPY201670

14512 50696 BMA108987 26574 62758 MBV104557 38635 74819 SPY201672

14513 50697 BMA108998 26575 62759 MBV104571 38636 74820 SPY201676

14514 50698 BMA108999 26576 62760 MBV104576 38637 74821 SPY201677

14515 50699 BMA109015 26577 6?7*ι MBV104588 38638 74822 SPY201678

τ— i cN co tf in t— t— r- r- t— oo oo oo oo oo oo r- t— O W iO CN CN CN i CN CN CN CN CN CN CN CN CN CN CN C^

vo t— oo ov o - i cN H σs σs σN ON σs σ^

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

14846 51030 BPT101108 26908 63092 MCA100983 38969 75153 STM102722

14847 51031 BPT101109 26909 63093 MCA100984 38970 75154 STM102723

14848 51032 BPT101110 26910 63094 MCA100998 38971 75155 STM102724

14849 51033 BPT101111 26911 63095 MCA100999 38972 75156 STM102726

14850 51034 BPT101112 26912 63096 MCA101000 38973 75157 STM102728

14851 51035 BPT101113 26913 63097 MCA101001 38974 75158 STM102735

14852 51036 BPT101116 26914 63098 MCA101002 38975 75159 STM102737

14853 51037 BPT101117 26915 63099 MCA101003 38976 75160 STM102743

14854 51038 BPT101119 26916 63100 MCA101004 38977 75161 STM102752

14855 51039 BPT101121 26917 63101 MCA101005 38978 75162 STM102761

14856 51040 BPT101128 26918 63102 MCA101007 38979 75163 STM102772

14857 51041 BPT101129 26919 63103 MCA101008 38980 75164 STM102778

14858 51042 BPT101131 26920 63104 MCA101024 38981 75165 STM102779

14859 51043 BPT101141 26921 63105 MCA101028 38982 75166 STM102790

14860 51044 BPT101142 26922 63106 MCA101042 38983 75167 STM102797

14861 51045 BPT101143 26923 63107 MCA101046 38984 75168 STM102801

14862 51046 BPT101144 26924 63108 MCA101054 38985 75169 STM102807

14863 51047 BPT101145 26925 63109 MCA101061 38986 75170 STM102809

14864 51048 BPT101147 26926 63110 MCA101062 38987 75171 STM102815

14865 51049 BPT101149 26927 63111 MCA101063 38988 75172 STM102826

14866 51050 BPT101152 26928 63112 MCA101080 38989 75173 STM102828

14867 51051 BPT101155 26929 63113 MCA101084 38990 75174 STM102829

14868 51052 BPT101160 26930 63114 MCA101086 38991 75175 STM102832

14869 51053 BPT101163 26931 63115 MCA101090 38992 75176 STM102840

14870 51054 BPT101177 26932 63116 MCA101093 38993 75177 STM102843

14871 51055 BPT101183 26933 63117 MCA101097 38994 75178 STM102857

14872 51056 BPT101186 26934 63118 MCA101098 38995 75179 STM102859

14873 51057 BPT101189 26935 63119 MCA101099 38996 75180 STM102860

14874 51058 BPT101198 26936 63120 MCA101101 38997 75181 STM102862

14875 51059 BPT101199 26937 63121 MCA101104 38998 75182 STM102863

14876 51060 BPT101206 26938 63122 MCA101111 38999 75183 STM102864

14877 51061 BPT101209 26939 63123 MCA101113 39000 75184 STM102875

14878 51062 BPT101227 26940 63124 MCA101114 39001 75185 STM102876

14879 51063 BPT101248 26941 63125 MCA101119 39002 75186 STM102884

14880 51064 BPT101258 26942 63126 MCA101120 39003 75187 STM102886

14881 51065 BPT101280 26943 63127 MCA101122 39004 75188 STM102887

14882 51066 BPT101284 26944 63128 MCA101128 39005 75189 STM102888

14883 51067 BPT101286 26945 63129 MCA101135 39006 75190 STM102889

14884 51068 BPT101287 26946 63130 MCA101138 39007 75191 STM102890

14885 51069 BPT101291 26947 63131 MCA101145 39008 75192 STM102891

14886 51070 BPT101315 26948 63132 MCA101148 39009 75193 STM102892

14887 51071 BPT101318 26949 63133 MCA101150 39010 75194 STM102893

14888 51072 BPT101319 26950 63134 MCA101153 39011 75195 STM102894

14889 51073 BPT101320 26951 63135 MCA101156 39012 75196 STM102897

14890 51074 BPT101328 26952 63136 MCA101163 39013 75197 STM102899

14891 51075 BPT101335 26953 63137 MCA101166 39014 75198 STM102905

14892 51076 BPT101337 26954 63138 MCA101167 39015 75199 STM102920

14893 51077 BPT101343 26955 63139 MCA101168 39016 75200 STM102922

14894 51078 BPT101346 26956 63140 MCA101170 39017 75201 STM102926

14895 51079 BPT101355 26957 63141 MCA101178 39018 75202 STM102957

14896 51080 BPT101368 26958 63142 MCA101185 39019 75203 STM102972

14897 51081 BPT101374 26959 63143 MCA101187 39020 75204 STM102974

14898 51082 BPT101378 26960 63144 MCA101190 39021 75205 STM103004

14899 51083 BPT101379 26961 63145 MCA101196 39022 75206 STM103008

14900 51084 BPT101383 26962 63146 MCA101198 39023 75207 STM103011

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

15011 51195 BPT102001 27073 63257 MCA101968 39134 75318 STM103913

15012 51196 BPT102002 27074 63258 MCA101969 39135 75319 STM103916

15013 51197 BPT102003 27075 63259 MCA101980 39136 75320 STM103922

15014 51198 BPT102004 27076 63260 MCA101981 39137 75321 STM103926

15015 51199 BPT102027 27077 63261 MCA101987 39138 75322 STM103952

15016 51200 BPT102032 27078 63262 MCA101994 39139 75323 STM103969

15017 51201 BPT102034 27079 63263 MCA101998 39140 75324 STM104010

15018 51202 BPT102039 27080 63264 MCA102001 39141 75325 STM104011

15019 51203 BPT102040 27081 63265 MCA 102006 39142 75326 STM104015

15020 51204 BPT102042 27082 63266 MCA102056 39143 75327 STM104028

15021 51205 BPT102045 27083 63267 MCA102057 39144 75328 STM104044

15022 51206 BPT102059 27084 63268 MCA102058 39145 75329 STM104051

15023 51207 BPT102066 27085 63269 MCA 102065 39146 75330 STM104054

15024 51208 BPT102072 27086 63270 MCA102097 39147 75331 STM104067

15025 51209 BPT102076 27087 63271 MCA102101 39148 75332 STM104079

15026 51210 BPT102078 27088 63272 MCA102133 39149 75333 STM104099

15027 51211 BPT102081 27089 63273 MCA102141 39150 75334 STM104115

15028 51212 BPT102085 27090 63274 MCA102158 39151 75335 STM104132

15029 51213 BPT102093 27091 63275 MCA102161 39152 75336 STM104137

15030 51214 BPT102097 27092 63276 MCA102164 39153 75337 STM104138

15031 51215 BPT102100 27093 63277 MCA102165 39154 75338 STM104139

15032 51216 BPT102102 27094 63278 MCA102170 39155 75339 STM104147

15033 51217 BPT102103 27095 63279 MCA102171 39156 75340 STM104153

15034 51218 BPT102115 27096 63280 MCA102180 39157 75341 STM104155

15035 51219 BPT102118 27097 63281 MCA102208 39158 75342 STM104156

15036 51220 BPT102123 27098 63282 MCA102216 39159 75343 STM104158

15037 51221 BPT102136 27099 63283 MCA102218 39160 75344 STM104159

15038 51222 BPT102142 27100 63284 MCA102219 39161 75345 STM104165

15039 51223 BPT102145 27101 63285 MCA102220 39162 75346 STM104197

15040 51224 BPT102162 27102 63286 MCA102246 39163 75347 STM104200

15041 51225 BPT102166 27103 63287 MCA102257 39164 75348 STM104214

15042 51226 BPT102181 27104 63288 MCA102268 39165 75349 STM104218

15043 51227 BPT102188 27105 63289 MCA102273 39166 75350 STM104228

15044 51228 BPT102193 27106 63290 MCA102285 39167 75351 STM104238

15045 51229 BPT102211 27107 63291 MCA102320 39168 75352 STM104272

15046 51230 BPT102213 27108 63292 MCA 102321 39169 75353 STM104274

15047 51231 BPT102214 27109 63293 MCA102322 39170 75354 STM104294

15048 51232 BPT102215 27110 63294 MCA102336 39171 75355 STM104297

15049 51233 BPT102222 27111 63295 MCA102344 39172 75356 STM104306

15050 51234 BPT102223 27112 63296 MCA102350 39173 75357 STM104307

15051 51235 BPT102230 27113 63297 MCA102353 39174 75358 STM104320

15052 51236 BPT102239 27114 63298 MCA102378 39175 75359 STM104325

15053 51237 BPT102256 27115 63299 MCA102416 39176 75360 STM104343

15054 51238 BPT102265 27116 63300 MCA 102435 39177 75361 STM104345

15055 51239 BPT102269 27117 63301 MCA102436 39178 75362 STM104352

15056 51240 BPT102270 27118 63302 MCA102445 39179 75363 STM104358

15057 51241 BPT102294 27119 63303 MCA102471 39180 75364 STM104443

15058 51242 BPT102297 27120 63304 MCA 102484 39181 75365 STM104445

15059 51243 BPT102300 27121 63305 MCA102486 39182 75366 STM104529

15060 51244 BPT102310 27122 63306 MCA102664 39183 75367 STM104546

15061 51245 BPT102315 27123 63307 MCA102703 39184 75368 STM104609

15062 51246 BPT102318 27124 63308 MCA102709 39185 75369 STM104752

15063 51247 BPT102322 27125 63309 MCA102746 39186 75370 STM104793

15064 51248 BPT102324 27126 63310 MCA102758 39187 75371 STM104876

15065 51249 BPT102335 27127 63311 MCA102759 39188 75372 STM105235 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

15066 51250 BPT102346 27128 63312 MCA102793 39189 75373 STM106756

15067 51251 BPT102350 27129 63313 MCA102816 39190 75374 STM106921

15068 51252 BPT102354 27130 63314 MCA102830 39191 75375 STM107215

15069 51253 BPT102361 27131 63315 MCA102831 39192 75376 STY100087

15070 51254 BPT102363 27132 63316 MCA102847 39193 75377 STY100108

15071 51255 BPT102384 27133 63317 MCA102858 39194 75378 STY100327

15072 51256 BPT102386 27134 63318 MCA102862 39195 75379 STY100328

15073 51257 BPT102398 27135 63319 MCA102864 39196 75380 STY100333

15074 51258 BPT102402 27136 63320 MCA102901 39197 75381 STY100337

15075 51259 BPT102404 27137 63321 MCA102911 39198 75382 STY100339

15076 51260 BPT102405 27138 63322 MCA102916 39199 75383 STY100345

15077 51261 BPT102408 27139 63323 MCA102941 39200 75384 STY100347

15078 51262 BPT102422 27140 63324 MCA102956 39201 75385 STY100354

15079 51263 BPT102423 27141 63325 MCA102959 39202 75386 STY100355

15080 51264 BPT102427 27142 63326 MCA102969 39203 75387 STY100357

15081 51265 BPT102433 27143 63327 MCA102972 39204 75388 STY100358

15082 51266 BPT102439 27144 63328 MCA102985 39205 75389 STY100361

15083 51267 BPT102450 27145 63329 MCA103022 39206 75390 STY100363

15084 51268 BPT102451 27146 63330 MCA103023 39207 75391 STY100365

15085 51269 BPT102468 27147 63331 MCA103036 39208 75392 STY100368

15086 51270 BPT102469 27148 63332 MCA103062 39209 75393 STY100371

15087 51271 BPT102470 27149 63333 MCA103068 39210 75394 STY100375

15088 51272 BPT102473 27150 63334 MCA103082 39211 75395 STY100378

15089 51273 BPT102476 27151 63335 MCA103090 39212 75396 STY100380

15090 51274 BPT102482 27152 63336 MCA103094 39213 75397 STY/100383

15091 51275 BPT102486 27153 63337 MCA103113 39214 75398 STY100387

15092 51276 BPT102489 27154 63338 MCA103114 39215 75399 STY100388

15093 51277 BPT102493 27155 63339 MCA103117 39216 75400 STY100389

15094 51278 BPT102499 27156 63340 MCA103128 39217 75401 STY100390

15095 51279 BPT102505 27157 63341 MCA103134 39218 75402 STY100393

15096 51280 BPT102507 27158 63342 MCA103135 39219 75403 STY100394

15097 51281 BPT102508 27159 63343 MCA103136 39220 75404 STY100399

15098 51282 BPT102509 27160 63344 MCA103138 39221 75405 STY100404

15099 51283 BPT102519 27161 63345 MCA103142 39222 75406 STY100405

15100 51284 BPT102527 27162 63346 MCA103158 39223 75407 STY100406

15101 51285 BPT102537 27163 63347 MCA103163 39224 75408 STY100410

15102 51286 BPT102546 27164 63348 MCA103171 39225 75409 STY100416

15103 51287 BPT102555 27165 63349 MCA103178 39226 75410 STY100420

15104 51288 BPT102556 27166 63350 MCA103188 39227 75411 STY100423

15105 51289 BPT102557 27167 63351 MCA103209 39228 75412 STY100425

15106 51290 BPT102559 27168 63352 MCA103218 39229 75413 STY100427

15107 51291 BPT102560 27169 63353 MCA103235 39230 75414 STY100428

15108 51292 BPT102594 27170 63354 MCA103261 39231 75415 STY100430

15109 51293 BPT102602 27171 63355 MCA103333 39232 75416 . STY100431

15110 51294 BPT102603 27172 63356 MCA103356 39233 75417 STY100437

15111 51295 BPT102612 27173 63357 MCA103372 39234 75418 STY100439

15112 51296 BPT102614 27174 63358 MCA 103400 39235 75419 STY100442

15113 51297 BPT102616 27175 63359 MCA103444 39236 75420 STY100443

15114 51298 BPT102618 27176 63360 MCA103453 39237 75421 STY100457

15115 51299 BPT102619 27177 63361 MCA103455 39238 75422 STY100460

15116 51300 BPT102620 27178 63362 MCA103469 39239 75423 STY100490

15117 51301 BPT102621 27179 63363 MCA103470 39240 75424 STY100497

15118 51302 BPT102625 27180 63364 MCA103517 39241 75425 STY/100502

15119 51303 BPT102628 27181 63365 MCA103521 39242 75426 STY100510

15120 51304 BPT102642 27182 63366 MCA103523 39243 75427 STY100513

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

15231 51415 BPT103857 27293 63477 MGE100162 39354 75538 STY100997

15232 51416 BPT103974 27294 63478 MGE100163 39355 75539 STY100998

15233 51417 BPT103989 27295 63479 MGE100164 39356 75540 STY101003

15234 51418 BPT104008 27296 63480 MGE100165 39357 75541 STY101011

15235 51419 BPT104019 27297 63481 MGE100166 39358 75542 STY101017

15236 51420 BPT104043 27298 63482 MGE100167 39359 75543 STY101019

15237 51421 BPT104047 27299 63483 MGE100168 39360 75544 STY101028

15238 51422 BPT104048 27300 63484 MGE100169 39361 75545 STY101051

15239 51423 BPT104052 27301 63485 MGE100170 39362 75546 STY101052

15240 51424 BPT104060 27302 63486 MGE100171 39363 75547 STY101059

15241 51425 BPT104063 27303 63487 MGE100172 39364 75548 STY101068

15242 51426 BPT104067 27304 63488 MGE100173 39365 75549 STY101070

15243 51427 BPT104094 27305 63489 MGE100174 39366 75550 STY101071

15244 51428 BPT104100 27306 63490 MGE100176 39367 75551 STY101074

15245 51429 BPT104115 27307 63491 MGE100177 39368 75552 STY101075

15246 51430 BPT104160 27308 63492 MGE100178 39369 75553 STY101077

15247 51431 BPT104171 27309 63493 MGE100179 39370 75554 STY101078

15248 51432 BPT104317 27310 63494 MGE100180 39371 75555 STY101082

15249 51433 BPT104331 27311 63495 MGE100181 39372 75556 STY101087

15250 51434 BPT104383 27312 63496 MGE100182 39373 75557 STY101095

15251 51435 BPT104423 27313 63497 MGE100183 39374 75558 STY101099

15252 51436 BPT104464 27314 63498 MGE100184 39375 75559 STY101100

15253 51437 BPT104469 27315 63499 MGE100185 39376 75560 STY101101

15254 51438 BPT104503 27316 63500 MGE100195 39377 75561 STY101103

15255 51439 BPT104512 27317 63501 MGE100196 39378 75562 STY101110

15256 51440 BPT 104523 27318 63502 MGE100197 39379 75563 STY101114

15257 51441 BPT104540 27319 63503 MGE100198 39380 75564 STY101116

15258 51442 BPT104544 27320 63504 MGE100199 39381 75565 STY101117

15259 51443 BPT104548 27321 63505 MGE100200 39382 75566 STY101118

15260 51444 BPT104549 27322 63506 MGE100205 39383 75567 STY101126

15261 51445 BPT104633 27323 63507 MGE100206 39384 75568 STY101127

15262 51446 BPT104642 27324 63508 MGE100215 39385 75569 STY101128

15263 51447 BPT104646 27325 63509 MGE100216 39386 75570 STY101129

15264 51448 BPT104649 27326 63510 MGE100217 39387 75571 STY101132

15265 51449 BPT104652 27327 63511 MGE100219 39388 75572 STY101134

15266 51450 BPT104658 27328 63512 MGE100220 39389 75573 STY101139

15267 51451 BPT104697 27329 63513 MGE100222 39390 75574 STY101143

15268 51452 BPT104731 27330 63514 MGE100226 39391 75575 STY101151

15269 51453 BPT104764 27331 63515 MGE100227 39392 75576 STY101155

15270 51454 BPT104802 27332 63516 MGE100229 39393 75577 STY101157

15271 51455 BPT104814 27333 63517 MGE100231 39394 75578 STY101161

15272 51456 BPT104834 27334 63518 MGE100232 39395 75579 STY101163

15273 51457 BPT105047 27335 63519 MGE100233 39396 75580 STY101168

15274 51458 BPT105117 27336 63520 MGE100234 39397 75581 STY101178

15275 51459 BPT105268 27337 63521 MGE100235 39398 75582 STY101179

15276 51460 BPT105307 27338 63522 MGE100236 39399 75583 STY101185

15277 51461 BPT105316 27339 63523 MGE100237 39400 75584 STY101186

15278 51462 BPT105323 27340 63524 MGE100238 39401 75585 STY101188

15279 51463 BPT105409 27341 63525 MGE100239 39402 75586 STY101194

15280 51464 BPT105606 27342 63526 MGE100240 39403 75587 STY101195

15281 51465 BPT105636 27343 63527 MGE 100244 39404 75588 STY101200

15282 51466 BPT105648 27344 63528 MGE100245 39405 75589 STY101202

15283 51467 BPT105662 27345 63529 MGE100248 39406 75590 STY101206

15284 51468 BPT105733 27346 63530 MGE100249 39407 75591 STY101217

15285 51469 BPT105757 27347 63531 MGE100250 39408 75592 STY101223 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

15286 51470 BPT105763 27348 63532 MGE100251 39409 75593 STY101224

15287 51471 BPT105773 27349 63533 MGE100253 39410 75594 STY101241

15288 51472 BPT105804 27350 63534 MGE100254 39411 75595 STY101244

15289 51473 BPT105849 27351 63535 MGE100255 39412 75596 STY101256

15290 51474 BPT105862 27352 63536 MGE100257 39413 75597 STY101259

15291 51475 BPT105896 27353 63537 MGE100258 39414 75598 STY101261

15292 51476 BPT105932 27354 63538 MGE100262 39415 75599 STY101269

15293 51477 BPT105939 27355 63539 MGE100263 39416 75600 STY101273

15294 51478 BPT105948 27356 63540 MGE100266 39417 75601 STY101281

15295 51479 BPT106030 27357 63541 MGE100267 39418 75602 STY101284

15296 51480 BPT106501 27358 63542 MGE 100268 39419 75603 STY101288

15297 51481 BPT106864 27359 63543 MGE100271 39420 75604 STY101289

15298 51482 BPT106954 27360 63544 MGE100272 39421 75605 STY101290

15299 51483 CAC100010 27361 63545 MGE100277 39422 75606 STY101296

15300 51484 CAC100013 27362 63546 MGE100278 39423 75607 STY101297

15301 51485 CAC100015 27363 63547 MGE100279 39424 75608 STY101301

15302 51486 CAC 100045 27364 63548 MGE100280 39425 75609 STY101345

15303 51487 CAC100048 27365 63549 MGE100284 39426 75610 STY101350

15304 51488 CAC100049 27366 63550 MGE100286 39427 75611 STY101355

15305 51489 CAC100050 27367 63551 MGE100289 39428 75612 STY101358

15306 51490 CAC100060 27368 63552 MGE100293 39429 75613 STY101363

15307 51491 CAC 100065 27369 63553 MGE100298 39430 75614 STY101364

15308 51492 CAC100067 27370 63554 MGE100299 39431 75615 STY101367

15309 51493 CAC100074 27371 63555 MGE100300 39432 75616 STY101369

15310 51494 CAC100088 27372 63556 MGE100301 39433 75617 STY101372

15311 51495 CAC 100096 27373 63557 MGE 100303 39434 75618 STY101374

15312 51496 CAC100098 27374 63558 MGE100304 39435 75619 STY101380

15313 51497 CAC100105 27375 63559 MGE100305 39436 75620 STY101381

15314 51498 CAC100107 27376 63560 MGE100306 39437 75621 STY101382

15315 51499 CAC100112 27377 63561 MGE100307 39438 75622 STY101386

15316 51500 CAC100114 27378 63562 MGE100311 39439 75623 STY101387

15317 51501 CAC100116 27379 63563 MGE100317 39440 75624 STY101394

15318 51502 CAC100128 27380 63564 MGE100318 39441 75625 STY101396

15319 51503 CAC100135 27381 63565 MGE100319 39442 75626 STY101408

15320 51504 CAC100146 27382 63566 MGE100322 39443 75627 STY101409

15321 51505 CAC100153 27383 63567 MGE100323 39444 75628 STY101418

15322 51506 CAC100156 27384 63568 MGE100328 39445 75629 STY101423

15323 51507 CAC100165 27385 63569 MGE100333 39446 75630 STY101426

15324 51508 CAC100166 27386 63570 MGE100335 39447 75631 STY101427

15325 51509 CAC100169 27387 63571 MGE100337 39448 75632 STY101440

15326 51510 CAC100183 27388 63572 MGE100338 39449 75633 STY101449

15327 51511 CAC100186 27389 63573 MGE100341 39450 75634 STY101450

15328 51512 CAC 100193 27390 63574 MGE100346 39451 75635 STY101451

15329 51513 CAC100205 27391 63575 MGE100347 39452 75636 STY101458

15330 51514 CAC100215 27392 63576 MGE 100348 39453 75637 STY101466

15331 51515 CAC 100229 27393 63577 MGE100349 39454 75638 STY101470

15332 51516 CAC100242 27394 63578 MGE100350 39455 75639 STY10I471

15333 51517 CAC100251 27395 63579 MGE100354 39456 75640 STY101473

15334 51518 CAC100257 27396 63580 MGE100355 39457 75641 STY101474

15335 51519 CAC100263 27397 63581 MGE100365 39458 75642 STY101478

15336 51520 CAC100274 27398 63582 MGE100366 39459 75643 STY101479

15337 51521 CAC100277 27399 63583 MGE100371 39460 75644 STY101480

15338 51522 CAC100279 27400 63584 MGE100372 39461 75645 STY101484

15339 51523 CAC100280 27401 63585 MGE100374 39462 75646 STY101485

15340 51524 CAC100288 27402 63586 MGE100386 39463 75647 STY101487

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqED SeqED SeqED SeqlD SeqED SeqED

15836 52020 CAC102898 27898 64082 MPN100077 39959 76143 STY103845

15837 52021 CAC102900 27899 64083 MPN100080 39960 76144 STY103848

15838 52022 CAC102901 27900 64084 MPN100081 39961 76145 STY103850

15839 52023 CAC102906 27901 64085 MPN100082 39962 76146 STY103852

15840 52024 CAC102908 27902 64086 MPN100083 39963 76147 STY103853

15841 52025 CAC102909 27903 64087 MPN100084 39964 76148 STY103856

15842 52026 CAC102921 27904 64088 MPN100087 39965 76149 STY103858

15843 52027 CAC102924 27905 64089 MPN100088 39966 76150 STY103859

15844 52028 CAC102927 27906 64090 MPN100090 39967 76151 STY103862

15845 52029 CAC102930 27907 64091 MPN100091 39968 76152 STY103864

15846 52030 CAC102936 27908 64092 MPN100093 39969 76153 STY103870

15847 52031 CAC 102940 27909 64093 MPN100094 39970 76154 STY103871

15848 52032 CAC102941 27910 64094 MPN100095 39971 76155 STY103872

15849 52033 CAC 102945 27911 64095 MPN100096 39972 76156 STY103874

15850 52034 CAC102954 27912 64096 MPN100101 39973 76157 STY103875

15851 52035 CAC102955 27913 64097 MPN100104 39974 76158 STY103879

15852 52036 CAC102963 27914 64098 MPN100107 39975 76159 STY103886

15853 52037 CAC 102966 27915 64099 MPN100108 39976 76160 STY103893

15854 52038 CAC102975 27916 64100 MPN100109 39977 76161 STY103896

15855 52039 CAC102979 27917 64101 MPN100110 39978 76162 STY103897

15856 52040 CAC102981 27918 64102 MPN100111 39979 76163 STY103901

15857 52041 CAC 102986 27919 64103 MPN100120 39980 76164 STY103903

15858 52042 CAC102993 27920 64104 MPN100121 39981 76165 STY103908

15859 52043 CAC 102995 27921 64105 MPN100128 39982 76166 STY103909

15860 52044 CAC103000 27922 64106 MPN100129 39983 76167 STY103910

15861 52045 CAC103001 27923 64107 MPN100131 39984 76168 STY103912

15862 52046 CAC103017 27924 64108 MPN100135 39985 76169 STY103913

15863 52047 CAC 103020 27925 64109 MPN100138 39986 76170 STY103914

15864 52048 CAC 103024 27926 64110 MPN100145 39987 76171 STY103916

15865 52049 CAC103028 27927 64111 MPN100146 39988 76172 STY103920

15866 52050 CAC103030 27928 64112 MPN100148 39989 76173 STY103924

15867 52051 CAC103049 27929 64113 MPN100149 39990 76174 STY103932

15868 52052 CAC103052 27930 64114 MPN100150 39991 76175 STY103935

15869 52053 CAC103064 27931 64115 MPN100151 39992 76176 STY103939

15870 52054 CAC103068 27932 64116 MPN100153 39993 76177 STY103943

15871 52055 CAC 103083 27933 64117 MPN100154 39994 76178 STY 103946

15872 52056 CAC103086 27934 64118 MPN100156 39995 76179 STY103948

15873 52057 CAC103089 27935 64119 MPN100160 39996 76180 STY103952

15874 52058 CAC103091 27936 64120 MPN100162 39997 76181 STY103962

15875 52059 CAC103092 27937 64121 MPN100163 39998 76182 STY103966

15876 52060 CAC103101 27938 64122 MPN100164 39999 76183 STY103967

15877 52061 CAC103102 27939 64123 MPN100169 40000 76184 STY103968

15878 52062 CAC103106 27940 64124 MPN100171 40001 76185 STY103971

15879 52063 CAC103109 27941 64125 MPN100173 40002 76186 STY103973

15880 52064 CAC103116 27942 64126 MPN100175 40003 76187 STY103975

15881 52065 CAC103117 27943 64127 MPN100177 40004 76188 STY103981

15882 52066 CAC103125 27944 64128 MPN100179 40005 76189 STY103986

15883 52067 CAC103126 27945 64129 MPN100182 40006 76190 STY103987

15884 52068 CAC103127 27946 64130 MPN100183 40007 76191 STY103988

15885 52069 CAC103133 27947 64131 MPN100184 40008 76192 STY103989

15886 52070 CAC103138 27948 64132 MPN100186 40009 76193 STY103990

15887 52071 CAC103146 27949 64133 MPN100189 40010 76194 STY103991

15888 52072 CAC 103151 27950 64134 MPN100190 40011 76195 STY103993

15889 52073 CAC103154 27951 64135 MPN100205 40012 76196 STY103994

15890 52074 CAC103158 27952 64136 MPN100206 40013 76197 STY104006

CO tf C tf tf tf tf

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqED SeqlD SeqED SeqlD SeqlD SeqED

16331 52515 CBO101908 28393 64577 MTU201590 40454 76638 TPA100923

16332 52516 CBO101914 28394 64578 MTU201591 40455 76639 TPA100936

16333 52517 CBO101925 28395 64579 MTU201596 40456 76640 TPA100939

16334 52518 CBO101930 28396 64580 MTU201608 40457 76641 TPA100941

16335 52519 CBO101941 28397 64581 MTU201609 40458 76642 TPA100942

16336 52520 CBO101974 28398 64582 MTU201617 40459 76643 TPA100947

16337 52521 CBO101981 28399 64583 MTU201620 40460 76644 TPA100952

16338 52522 CBO101985 28400 64584 MTU201621 40461 76645 TPA100953

16339 52523 CBO101987 28401 64585 MTU201622 40462 76646 TPA100962

16340 52524 CBO101996 28402 64586 MTU201623 40463 76647 TPA100963

16341 52525 CBO102015 28403 64587 MTU201628 40464 76648 TPA100965

16342 52526 CBO102016 28404 64588 MTU201629 40465 76649 TPA100969

16343 52527 CBO102022 28405 64589 MTU201630 40466 76650 TPA100970

16344 52528 CBO102037 28406 64590 MTU201634 40467 76651 TPA100971

16345 52529 CBO102039 28407 64591 MTU201635 40468 76652 TPA100974

16346 52530 CBO102046 28408 64592 MTU201638 40469 76653 TPA100975

16347 52531 CBO102049 28409 64593 MTU201653 40470 76654 TPA100978

16348 52532 CBO102059 28410 64594 MTU201661 40471 76655 TPA100980

16349 52533 CBO102062 28411 64595 MTU201664 40472 76656 TPA100989

16350 52534 CBO102063 28412 64596 MTU201668 40473 76657 TPA100994

16351 52535 CBO102064 28413 64597 MTU201674 40474 76658 TPA100995

16352 52536 CBO102075 28414 64598 MTU201678 40475 76659 TPA100996

16353 52537 CBO102082 28415 64599 MTU201680 40476 76660 TPA100999

16354 52538 CBO102085 28416 64600 MTU201685 40477 76661 TPA101005

16355 52539 CBO102095 28417 64601 MTU201689 40478 76662 TPA101007

16356 52540 CBO102096 28418 64602 MTU201690 40479 76663 TPA101008

16357 52541 CBO102099 28419 64603 MTU201691 40480 76664 TPA101010

16358 52542 CBO102105 28420 64604 MTU201729 40481 76665 TPA101011

16359 52543 CBO102108 28421 64605 MTU201734 40482 76666 TPA101012

16360 52544 CBO102152 28422 64606 MTU201737 40483 76667 TPA101014

16361 52545 CBO102158 28423 64607 MTU201742 40484 76668 TPA101015

16362 52546 CBO102176 28424 64608 MTU201746 40485 76669 TPA101025

16363 52547 CBO102186 28425 64609 MTU201774 40486 76670 TPA101026

16364 52548 CBO102188 28426 64610 MTU201785 40487 76671 TPA101027

16365 52549 CBO102190 28427 64611 MTU201786 40488 76672 TPA101028

16366 52550 CBO102193 28428 64612 TU201799 40489 76673 TPA101030

16367 52551 CBO102194 28429 64613 MTU201807 40490 76674 UUR100001

16368 52552 CBO102195 28430 64614 MTU201808 40491 76675 UUR100003

16369 52553 CBO102204 28431 64615 MTU201811 40492 76676 UUR100004

16370 52554 CBO102206 28432 64616 MTU201815 40493 76677 UUR100007

16371 52555 CBO102219 28433 64617 MTU201817 40494 76678 UUR100008

16372 52556 CBO102220 28434 64618 MTU201818 40495 76679 UUR100009

16373 52557 CBO102223 28435 64619 MTU201819 40496 76680 UUR100012

16374 52558 CBO102232 28436 64620 MTU201828 40497 76681 UUR100015

16375 52559 CBO102235 28437 64621 MTU201839 40498 76682 UUR100016

16376 52560 CBO102241 28438 64622 MTU201862 40499 76683 UUR100018

16377 52561 CBO102253 28439 64623 MTU201866 40500 76684 UUR100019

16378 52562 CBO102259 28440 64624 MTU201875 40501 76685 UUR100022

16379 52563 CBO102260 28441 64625 MTU201904 40502 76686 UUR100024

16380 52564 CBO102268 28442 64626 MTU201908 40503 76687 UUR100027

16381 52565 CBO102281 28443 64627 MTU201948 40504 76688 UUR100028

16382 52566 CBO102295 28444 64628 MTU201952 40505 76689 UUR100029

16383 52567 CBO102303 28445 64629 MTU201964 40506 76690 UUR100037

16384 52568 CBO102312 28446 64630 MTU201966 40507 76691 UUR100038

16385 52569 CBO102313 28447 64631 MTU201973 40508 76692 UUR100048

90 t- r-

©

© O

-s σ_s σ_s _ _ .. . o wo w cO cO CO cO co rO cO co co 3 o wo w cO cO ro cO c^

t— oo ON © T-H rN co tf uo vo t— oo σs © r © © © © © !—I "—l i—^I i-H t— ' CN C VO©S VOOs VOOs VOOS VOON VOOs OV©N OV©S OV©S OV©N OVDS OVOs OV©N 0 © © © 0 © 0 © © © © © 0 0 © 0 0 © © 0 © t— r- r- r- t r- t— t— t— t— t— t— t— t— t— t— r- r— t— t— r- r

oo oo oo oo oo oo oo o © © © © © tf

i^ <tfjv σtfv otfs <tfjv otfs otfv otfv o s fv os θ\ ov ov ototfotf t o ofotfoftv o o s t— OO ON © !— I ro vo vo t— t— 1— tf uo v t— r-

oo © !— i cN co tf Os tf σs σs t— σs ro ro ro co uo uo vo t— r- c

co tf wo vo t— oo σs © τ-H CN co tf wo vo r- oo σs c_) τH CN co τr wo vo r- o oo oo σs σs σs σs σs σs σs σs σ OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OO OQ OO OO OO O CN CN CN CN CN CN CN C^ CN CN CN CN C uo uo wo wo wo wo wo wo wo uo uo uo wo wo wo w CN co tf tn vo t— OO ON © T— i cN co o © © © © © T-H rt rt T-H vo vo vo vo vo vo vo vo vo vo vo v

oo oo σs σv σs σs σs σs σ ON C^ OS Os O^ oo oo oo oo oo oo oo oo oo oo o CN CN CN CN CN CN CN

uo uo r- tf wo t— tf tf tf tf tf tf o wo t-

H co co co co co ro co O r- r- r- r— r- r- r- tf wo oo σs

tf oo r- o vo tf wo co tf tf tf tf uo o m o t— t— oo σ co co co co co co co co co co co co co co c

co tf uo o co co co ro r co co tf tf tf tf tf ro co co co co uo uo uo uo uo wo wo wo wo wo wo uo u o o v© vo vo v σs o co tf wo t— oo uo wo wo wo uo wo wo vo v σs σs σs σs σs σs

wo wo ro oo o © co o

Cw PH PH PH PH P

90 co tf o oo σs rH r- oo oo oo t- r- ro co ro co

O tf wo r- tf wo σs σs σs σs r- t— t— t— r- r

o ro tf tf tf tf uo wo wo r- oo ro co ro ro co ro co co co c

tf uo t— oo σs tf uo v vo r- r- r- t r- t co tf uo vp r- σs co ro co tf tf

uo σs co σ vo o tf tf tf o vo t— co ro o o o o

tf uo r- oo σs © tf w tf tf uo uo uo uo uo uo wo uo wo v© vo uo uo o uo uo uo uo wo uo o o wo wo uo uo w uo uo uo wo uo wo wo wo uo wo wo uo uo w o vo vo V co tf uo v© o t— t— t- t— tr- t— r- t— oo co co ro co co co co co c σs σs σs σs

co vo uo tf wo vo r- r- t— uo uo vo t uo uo wo vo co co co co co co co co co c

PH PH PH PH PH PH PH PH

ro tf wo oo σs σs σs σs σs σs o w ro co co co co r uo uo uo uo wo o wo wo wo wo o o uo w r- o wo co co co co ro co ro co co ro t— r- t— r- r- r- r- i

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

17486 53670 CDP100079 29548 65732 NME200487 41609 77793 YPS000357

17487 53671 CDP100080 29549 65733 NME200491 41610 77794 YPS000359

17488 53672 CDP100081 29550 65734 NME200494 41611 77795 YPS000365

17489 53673 CDP100085 29551 65735 NME200495 41612 77796 YPS000377

17490 53674 CDP100086 29552 65736 NME200496 41613 77797 YPS000392

17491 53675 CDP100087 29553 65737 NME200497 41614 77798 YPS000393

17492 53676 CDP100088 29554 65738 NME200499 41615 77799 YPS000400

17493 53677 CDP100089 29555 65739 NME200506 41616 77800 YPS000402

17494 53678 CDP100090 29556 65740 NME200508 41617 77801 YPS000405

17495 53679 CDP100092 29557 65741 NME200510 41618 77802 YPS000409

17496 53680 CDP100097 29558 65742 NME200511 41619 77803 YP.S000424

17497 53681 CDP100102 29559 65743 NME200512 41620 77804 YPS000434

17498 53682 CDP100105 29560 65744 NME200513 41621 77805 YPS000441

17499 53683 CDP100108 29561 65745 NME200518 41622 77806 YPS000444

17500 53684 CDP100111 29562 65746 NME200532 41623 77807 YPS000446

17501 53685 CDP100114 29563 65747 NME200544 41624 77808 YPS000449

17502 53686 CDP100115 29564 65748 NME200545 41625 77809 YPS000460

17503 53687 CDP100121 29565 65749 NME200546 41626 77810 YPS000463

17504 53688 CDP100127 29566 65750 NME200552 41627 77811 YPS000466

17505 53689 CDP100129 29567 65751 NME200553 41628 77812 YPS000478

17506 53690 CDP100131 29568 65752 NME200555 41629 77813 YPS000483

17507 53691 CDP100135 29569 65753 NME200558 41630 77814 YPS000489

17508 53692 CDP100137 29570 65754 NME200564 41631 77815 YPS000491

17509 53693 CDP100142 29571 65755 NME200574 41632 77816 YPS000494

17510 53694 CDP100143 ^" 29572 65756 NME200576 41633 77817 YPS000496

17511 53695 CDP100145 29573 65757 NME200577 41634 77818 YPS000498

17512 53696 CDP100146 29574 65758 NME200578 41635 77819 YPS000499

17513 53697 CDP100148 29575 65759 NME200581 41636 77820 YPS000502

17514 53698 CDP100150 29576 65760 NME200585 41637 77821 YPS000504

17515 53699 CDP100163 29577 65761 NME200589 41638 77822 YPS000510

17516 53700 CDP100164 29578 65762 NME200590 41639 77823 YPS000522

17517 53701 CDP100166 29579 65763 NME200591 41640 77824 YPS000524

17518 53702 CDP100167 29580 65764 NME200593 41641 77825 YPS000538

17519 53703 CDP100169 29581 65765 NME200596 41642 77826 YPS000541

17520 53704 CDP100170 29582 65766 NME200606 41643 77827 YPS000561

17521 53705 CDP100172 29583 65767 NME200608 41644 77828 YPS000566

17522 53706 CDP100176 29584 65768 NME200611 41645 77829 YPS000578

17523 53707 CDP100180 29585 65769 NME200613 41646 77830 YPS000580

17524 53708 CDP100182 29586 65770 NME200616 41647 77831 YPS000583

17525 53709 CDP100186 29587 65771 NME200622 41648 77832 YPS000584

17526 53710 CDP100193 29588 65772 NME200634 41649 77833 YPS000586

17527 53711 CDP100194 29589 65773 NME200638 41650 77834 YPS000590

17528 53712 CDP100196 29590 65774 NME200649 41651 77835 YPS000599

17529 53713 CDP100199 29591 65775 NME200652 41652 77836 YPS000606

17530 53714 CDP100202 29592 65776 NME200654 41653 77837 YPS000610

17531 53715 CDP100203 29593 65777 NME200657 41654 77838 YPS000612

17532 53716 CDP100213 29594 65778 NME200659 41655 77839 YPS000618

17533 53717 CDP100215 29595 65779 NME200661 41656 77840 YPS000626

17534 53718 CDP100223 29596 65780 NME200667 41657 77841 YPS000639

17535 53719 CDP100224 29597 65781 NME200668 41658 77842 YPS000675

17536 53720 CDP100230 29598 65782 NME200672 41659 77843 YPS000678

17537 53721 CDP100231 29599 65783 NME200676 41660 77844 YPS000682

17538 53722 CDP100242 29600 65784 NME200678 41661 77845 YPS000694

17539 53723 CDP100250 29601 65785 NME200684 41662 77846 YPS000696

17540 53724 CDP100257 29602 65786 NME200699 41663 77847 YPS000703 DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

17541 53725 CDP100258 29603 65787 NME200701 41664 77848 YPS000704

17542 53726 CDP100260 29604 65788 NME200703 41665 77849 YPS000708

17543 53727 CDP100261 29605 65789 NME200704 41666 77850 YPS000723

17544 53728 CDP100262 29606 65790 NME200707 41667 77851 YPS000724

17545 53729 CDP100263 29607 65791 NME200717 41668 77852 YPS000729

17546 53730 CDP100265 29608 65792 NME200732 41669 77853 YPS000732

17547 53731 CDP100269 29609 65793 NME200733 41670 77854 YPS000756

17548 53732 CDP100271 29610 65794 NME200734 41671 77855 YPS000760

17549 53733 CDP100277 29611 65795 NME200735 41672 77856 YPS000765

17550 53734 CDP100278 29612 65796 NME200748 41673 77857 YPS000769

17551 53735 CDP100279 29613 65797 NME200754 41674 77858 YPS000770

17552 53736 CDP100280 29614 65798 NME200757 41675 77859 YPS000771

17553 53737 CDP100282 29615 65799 NME200762 41676 77860 YPS000773

17554 53738 CDP100284 29616 65800 NME200764 41677 77861 YPS000774

17555 53739 CDP100290 29617 65801 NME200769 41678 77862 YPS000776

17556 53740 CDP100293 29618 65802 NME200772 41679 77863 YPS000779

17557 53741 CDP100296 29619 65803 NME200777 41680 77864 YPS000781

17558 53742 CDP100305 29620 65804 NME200783 41681 77865 YPS000784

17559 53743 CDP100306 29621 65805 NME200784 41682 77866 YPS000787

17560 53744 CDP100308 29622 65806 NME200785 41683 77867 YPS000790

17561 53745 CDP100309 29623 65807 NME200795 41684 77868 YPS000792

17562 53746 CDP100313 29624 65808 NME200800 41685 77869 YPS000797

17563 53747 CDP100317 29625 65809 NME200804 41686 77870 YPS000805

17564 53748 CDP100325 29626 65810 NME200815 41687 77871 YPS000806

17565 53749 CDP100338 29627 65811 NME200819 41688 77872 YPS000809

17566 53750 CDP100339 29628 65812 NME200820 41689 77873 YPS000810

17567 53751 CDP100341 29629 65813 NME200821 41690 77874 YPS000815

17568 53752 CDP100348 29630 65814 NME200824 41691 77875 YPS000834

17569 53753 CDP100349 29631 65815 NME200834 41692 77876 YPS000836

17570 53754 CDP100352 29632 65816 NME200836 41693 77877 YPS000842

17571 53755 CDP100360 29633 65817 NME200837 41694 77878 YPS000843

17572 53756 CDP100362 29634 65818 NME200847 41695 77879 YPS000845

17573 53757 CDP100363 29635 65819 NME200849 41696 77880 YPS000846

17574 53758 CDP100365 29636 65820 NME200853 41697 77881 YPS000851

17575 53759 CDP100371 29637 65821 NME200854 41698 77882 YPS000855

17576 53760 CDP100373 29638 65822 NME200855 41699 77883 YPS000857

17577 53761 CDP100375 29639 65823 NME200856 41700 77884 YPS000861

17578 53762 CDP100378 29640 65824 NME200857 41701 77885 YPS000863

17579 53763 CDP100379 29641 65825 NME200858 41702 77886 YPS000864

17580 53764 CDP100382 29642 65826 NME200861 41703 77887 YPS000868

17581 53765 CDP100383 29643 65827 NME200866 41704 77888 YPS000870

17582 53766 CDP100385 29644 65828 NME200870 41705 77889 YPS000871

17583 53767 CDP100387 29645 65829 NME200871 41706 77890 YPS000872

17584 53768 CDP100388 29646 65830 NME200872 41707 77891 YPS000874

17585 53769 CDP100396 29647 65831 NME200873 41708 77892 YPS000890

17586 53770 CDP100399 29648 65832 NME200879 41709 77893 YPS000894

17587 53771 CDP100400 29649 65833 NME200881 41710 77894 YPS000900

17588 53772 CDP100404 29650 65834 NME200882 41711 77895 YPS000901

17589 53773 CDP100408 29651 65835 NME200887 41712 77896 YPS000907

17590 53774 CDP100409 29652 65836 NME200892 41713 77897 YPS000909

17591 53775 CDP100410 29653 65837 NME200893 41714 77898 YPS000920

17592 53776 CDP100414 29654 65838 NME200897 41715 77899 YPS000925

17593 53777 CDP100417 29655 65839 NME200899 41716 77900 YPS000930

17594 53778 CDP100418 29656 65840 NME200901 41717 77901 YPS000931

17595 53779 CDP100421 29657 65841 NME200903 41718 77902 YPS000933

DNA Protein Gene LocusID DNA Protein Gene LocusID DNA Protein Gene LocusID

SeqlD SeqlD SeqlD SeqlD SeqlD SeqlD

17651 53835 CDP100633 29713 65897 NME201245 41774 77958 YPS001128

17652 53836 CDP 100635 29714 65898 NME201248 41775 77959 YPS001129

17653 53837 CDP100636 29715 65899 NME201254 41776 77960 YPS001131

17654 53838 CDP100638 29716 65900 NME201257 41777 77961 YPS001135

17655 53839 CDP100639 29717 65901 NME201261 41778 77962 YPS001136

17656 53840 CDP 100640 29718 65902 NME201265 41779 77963 YPS001137

17657 53841 CDP 100653 29719 65903 NME201276 41780 77964 YPS001140

17658 53842 CDP 100654 29720 65904 NME201277 41781 77965 YPS001142

17659 53843 CDP100658 29721 65905 NME201279 41782 77966 YPS001147

17660 53844 CDP 100666 29722 65906 NME201284 41783 77967 YPS001148

17661 53845 CDP 100671 29723 65907 NME201287 41784 77968 YPS001151

17662 53846 CDP100672 29724 65908 NME201288 41785 77969 YPS001153

17663 53847 CDP100674 29725 65909 NME201292 41786 77970 YPS001155

17664 53848 CDP 100675 29726 65910 NME201294 41787 77971 YPS001157

17665 53849 CDP100677 29727 65911 NME201296 41788 77972 YPS001160

17666 53850 CDP100684 29728 65912 NME201304 41789 77973 YPS001161

17667 53851 CDP 100695 29729 65913 NME201305 41790 77974 YPS001169

17668 53852 CDP100699 29730 65914 NME201309 41791 77975 YPS001170

17669 53853 CDP 100702 29731 65915 NME201311 41792 77976 YPS001173

17670 53854 CDP 100703 29732 65916 NME201319 41793 77977 YPS001177

17671 53855 CDP100704 29733 65917 NME201321 41794 77978 YPS001180

17672 53856 CDP 100706 29734 65918 NME201326 41795 77979 YPS001186

17673 53857 CDP100733 29735 65919 NME201332 41796 77980 YPS001188

17674 53858 CDP100735 29736 65920 NME201339 41797 77981 YPS001189

17675 53859 CDP100741 29737 65921 NME201346 41798 77982 YPS001192

17676 53860 CDP100744 29738 65922 NME201354 41799 77983 YPS001193

17677 53861 CDP100748 29739 65923 NME201357 41800 77984 YPS001199

17678 53862 CDP 100750 29740 65924 NME201359 41801 77985 YPS001209

17679 53863 CDP 100751 29741 65925 NME201361 41802 77986 YPS001211

17680 53864 CDP 100752 29742 65926 NME201364 41803 77987 YPS001216

17681 53865 CDP 100770 29743 65927 NME201367 41804 77988 YPS001221

17682 53866 CDP 100772 29744 65928 NME201370 41805 77989 YPS001224

17683 53867 CDP 100773 29745 65929 NME201373 41806 77990 YPS001225

17684 53868 CDP 100774 29746 65930 NME201374 41807 77991 YPS001228

17685 53869 CDP 100775 29747 65931 NME201375 41808 77992 YPS001229

17686 53870 CDP100776 29748 65932 NME201384 41809 77993 YPS001230

17687 53871 CDP 100778 29749 65933 NME201387 41810 77994 YPS001237

17688 53872 CDP 100780 29750 65934 NME201393 41811 77995 YPS001239

17689 53873 CDP 100781 29751 65935 NME201394 41812 77996 YPS001244

17690 53874 CDP 100782 29752 65936 NME201395 41813 77997 YPS001246

17691 53875 CDP100784 29753 65937 NME201396 41814 77998 YPS001247

17692 53876 CDP100789 29754 65938 NME201398 41815 77999 YPS001253

17693 53877 CDP100795 29755 65939 NME201410 41816 78000 YPS001257

17694 53878 CDP100799 29756 65940 NME201411 41817 78001 YPS001261

17695 53879 CDP 100802 29757 65941 NME201412 41818 78002 YPS001262

17696 53880 CDP 100805 29758 65942 NME201414 41819 78003 YPS001263

17697 53881 CDP 100811 29759 65943 NME201415 41820 78004 YPS001274

17698 53882 CDP 100814 29760 65944 NME201426 41821 78005 YPS001275

17699 53883 CDP100815 29761 65945 NME201427 41822 78006 YPS001277

17700 53884 CDP 100817 29762 65946 NME201429 41823 78007 YPS001278

17701 53885 CDP 100823 29763 65947 NME201430 41824 78008 YPS001281

17702 53886 CDP 100825 29764 65948 NME201432 41825 78009 YPS001282

17703 53887 CDP 100831 29765 65949 NME201434 41826 78010 YPS001285

17704 53888 CDP100836 29766 65950 NME201435 41827 78011 YPS001287

17705 53889 CDP100838 29767 65951 NME201436 41828 78012 YPS001307

oo oo oo oo oo oo oo oo oo σs σs σs σs σs σs σ

It will be appreciated that ORFs may also be identified using databases other than PathoSeq. For example, the ORFs may be identified using the methods described in U.S. Provisional Patent Application Serial Number 60/191,078, filed March 21, 2000.

EXAMPLE 4 Transfer of Exogenous Nucleic Acid Sequences to other Bacterial Species

The ability of an antisense molecule identified in a first organism to inhibit the proliferation of a second organism (thereby confirming that a gene in the second organism which is homologous to the gene from the first organism is required for proliferation of the second organism) was validated using antisense nucleic acids which inhibit the growth of E. coli which were identified using methods similar to those described above. Expression vectors which inhibited growth of E. coli upon induction of antisense RNA expression with IPTG were transformed directly into Enterobacter cloacae, Klebsiella pneumonia or Salmonella typhimurium. The transformed cells were then assayed for growth inhibition according to the method of Example 1. After growth in liquid culture, cells were plated at various serial dilutions and a score determined by calculating the log difference in growth for INDUCED vs. UNINDUCED antisense RNA expression as determined by the maximum 10 fold dilution at which a colony was observed. The results of these experiments are listed below in Table II. If there was no effect of antisense RNA expression in a microorganism, the clone is minus in Table II. In contrast, a positive in Table II means that at least 10 fold more cells were required to observe a colony on the induced plate than on the non-induced plate under the conditions used and in that microorganism.

Thus, the ability of an antisense nucleic acid which inhibits the proliferation of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis to inhibit the growth of other organims may be evaluated by transforming the antisense nucleic acid directly into species other than the organism from which they were obtained. In particular, the ability ofthe antisense nucleic acid to inhibit the growth of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yer ihia en^' te όcohfica, Yersinia pestis or any species falling within the genera of any of the above species may be evaluated. In some embodiments of the present invention, the ability of the antisense nucleic acid to inhibit the growth of an organism other than E. coli may be evaluated. In such embodiments, the antisense nucleic acids are inserted into expression vectors functional in the organisms in which the antisense nucleic acids are evaluated.

It will be appreciated that the above methods for evaluating the ability of an antisense nucleic acid to inhibit the proliferation of a heterologous organism may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids complementary to SEQ ID NOs.: 6214-42397, such as the antisense nucleic acids of SEQ ID NOs.: 1-6213) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids.

Those skilled in the art will appreciate that a negative result in a heterologous cell or microorganism does not mean that that cell or microorganism is missing that gene nor does it mean that the gene is unessential. However, a positive result means that the heterologous cell or microorganism contains a homologous gene which is required for proliferation of that cell or microorganism. The homologous gene may be obtained using the methods described herein. For example, the homologous gene may be isolated by performing a PCR procedure using primers based on the antisense sequence which reduced the level or activity of the gene product encoded by the homologous gene or by performing a Southern blot. Those cells that are inhibited by antisense may be used in cell-based assays as described herein for the identification and characterization of compounds in order to develop antibiotics effective in these cells or microorganisms. Those skilled in the art will appreciate that an antisense molecule which works in the microorganism from which it was obtained will not always work in a heterologous cell or microorganism. EXAMPLE 5 "^*"" " ^{'" '}"^"" " "^"•" "^{" '} ^ -"- ** *

Transfer of Exogenous Nucleic Acid Sequences to Other Bacterial Species Using the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa. Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum,

Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae. Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori. Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium. Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae. Neisseria meningitidis, Pasteurella multocida. Proteus mirabilis. Pseudomonas putida, Pseudomonas syringae. Salmonella paratyphi. Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae. Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum. Vibrio cholerae or Yersinia pestis Expression Vectors or Expression Vectors Functional in Bacterial Species Other Than the Foregoing Bacterial Species

The antisense nucleic acids that inhibit the growth of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, . Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae,

Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori,

Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi,

Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis, or portions thereof, may also be evaluated for their ability to inhibit the growth of cells or microorganisms other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae,

Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium ^"" tuberculosis,^*'^"'11 My^'cόptάfma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis. For example, the antisense nucleic acids that inhibit the growth of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus,- Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis may be evaluated for their ability to inhibit the growth of other organisms. In particular, the ability ofthe antisense nucleic acid to inhibit the growth of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species may be evaluated. In some embodiments of the present mvention, the ability of the antisense nucleic acid to inhibit the growth of an organism other than E. coli may be evaluated.

In such methods, expression vectors in which the expression of an antisense nucleic acid that inhibits the growth of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio choleraei or Yersinia pestisis under the control of an inducible promoter are introduced into the cells or microorganisms in which they are to be evaluated. In some embodiments, the antisense nucleic acids may be evaluated in cells or microorganisms which are closely related to Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis. The ability of these antisense nucleic acids to inhibit the growth of the related cells or microorganisms in the presence of the inducer is then measured.

EXAMPLE 6 Identification of Nucleic Acids Homologous to Nucleic Acids R^equ e ^'for^'tli'e^'I-oiiferation of '' Staphylococcus aureus in other Bacterial Species Nucleic acids homologous to proliferation-required nucleic acids from Staphylococcus aureus were identified as follows. For example, thirty-nine antisense nucleic acids which inhibited the growth of Staphylococcus aureus were identified using methods such as those described herein and were inserted into an expression vector such that their expression was under the control of a xylose- inducible Xyl-T5 promoter. A vector with a reporter gene under control of the Xyl-T5 promoter was used to show that expression from the Xyl-T5 promoter in Staphylococcus epidermidis was comparable to that in Staphylococcus aureus. The vectors were introduced into Staphylococcus epidermidis by electroporation as follows:

Staphylococcus epidermidis was grown in liquid culture to mid-log phase and then harvested by centrifugation. The cell pellet was resuspended in 1/3 culture volume of ice-cold EP buffer (0.625 M sucrose, 1 mM MgCl₂, pH=4.0), and then harvested again by centrifugation. The cell pellet was then resuspended with 1/40 volume EP buffer and allowed to incubate on ice for 1 hour. The cells were then frozen for storage at -80°C. For electroporation, 50 μl of thawed electrocompetent cells were combined with 0.5 μg plasmid DNA and then subjected to an electrical pulse of 10 kV/cm, 25 uFarads, 200 ohm using a biorad gene pulser electroporation device. The cells were immediately resuspended with 200 μl outgrowth medium and incubated for 2 hours prior to platmg on solid growth medium with drug selection to maintain the plasmid vector. Colonies resulting from overnight growth of these platings were selected, cultured in liquid medium with drug selection, and then subjected to dilution plating analysis as described for Staphylococcus aureus in Example 1 above to test growth sensitivity in the presence ofthe inducer xylose.

The results are shown in Table III below. The first column indicates the Molecule Number of the Staphylococcus aureus antisense nucleic acid which was introduced into Staphylococcus epidermidis. The second column indicates whether the antisense nucleic acid inhibited the growth of Staphylococcus epidermidis, with a "+" indicating that growth was inhibited. Of the 39

Staphylococcus aureus antisense nucleic acids evaluated, 20 inhibited the growth of Staphylococcus epidermidis.

TABLE HI Sensitivity of Other Microorganisms to Antisense Nucleic Acids That Inhibit Proliferation of

Although the results shown above were obtained^" using "a" subset^'" of

nucleic acids from Staphylococcus aureus, it will be appreciated that similar analyses may be performed using the nucleic acids of the present invention to determine whether they inhibit the proliferation of cells or microorganisms other than Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis.

Thus, it will be appreciated that the above methods for evaluating the ability of an antisense nucleic acid to inhibit the proliferation of a heterologous organism may be performed usμig antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis, (including antisense nucleic acids complementary to SEQ ID NOs.: 6214-42397, such as the antisense nucleic acids of SEQ ID NOs.: 1-6213) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids. EXAMPLE 7

Identification of Homologous Nucleic Acids by Functional Complementation Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows. Gene products whose activities may be complemented by a proliferation-required gene product from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Yersinia pestis or homologous polypeptides are identified using merodiploids, created by introducing a plasmid or Bacterial Artificial Chromosome into an organism having a mutation in the essential gene which reduces or eliminates the activity of the gene product. In some embodiments, the mutation may be a conditional mutation, such as a temperature sensitive mutation, such that the organism proliferates under permissive conditions but is unable to proliferate under non-permissive conditions in the absence of complementation by the gene on the plasmid or Bacterial Artificial Chromosome. Alternatively, duplications may be constructed as described in Roth et al. (1987) Biosynthesis of Aromatic Amino Acids in Escherichia coli and Salmonella typhimurium, F. C. Neidhardt, ed., American Society for Microbiology, publisher, pp. 2269-2270. Such methods are familiar to those skilled in the art. Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified by placing a gene required for proliferation or a nucleic acid complementary to at least a portion of a gene required for proliferation under the control of a regulatable promoter as described above, introducing a plasmid or Bacterial Artificial Chromosome into the cell, and identifying cells which are able to proliferate under conditions which would prevent or reduce proliferation in the absence of the plasmid or

Bacterial Artificial Chromosome. Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified using databases as follows. EXAMPLE S ^{" '}"^"" " ^{" ' ""™ '}- "— —^{■<• ■}"

Identification of Homologous Nucleic Acids by Database Analysis As a demonstration of the methodology required to find homologues to an essential gene, fifty-one prokaryotic organisms were analyzed and compared in detail. First, the most reliable source of gene sequences for each organism was assessed by conducting a survey ofthe public and private data sources. The fifty-one organisms studied are Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae and Yersinia pestis. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Escherichia coli, Haemophilus influenzae and Helicobacter pylori, gene sequences were adopted from the public sequencing projects, and derived from the GenPept 115 database (available from NCBI). For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com). Vox Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typhi, genomic sequences from PathoSeq v 4.1 (Mar 2000 release) were reanalyzed for ORFs using the gene finding software GeneMark v 2.4a, which was purchased from GenePro Inc. 451 Bishop St., N.W., Suite B, Atlanta, GA, 30318, USA. Similar analyses were conducted for the other organisms using publically available and proprietary databases.

Homologous coding nucleic acids and the homologous polypeptides which they encode may be identified using a "reciprocal" best-hit analysis. To facilitate the identification of homologous coding nucleic acids and homologous polypeptides, paralogous genes within each of 51 organisms were identified and clustered prior to comparison to other organisms. Briefly, the polypeptide sequence of each polypeptide encoded by each open reading frame (ORF) in a given organism was compared to the polypeptide sequence encoded by every other ORF for that organism for each of the 51 pathogenic organisms (PathoSeq Sept 2001 release) using BLASTP 2.09 algorithm without filtering. Simultaneously, the polypeptide sequence encoded by each ORF of an organism was compared to the polypeptide sequences encoded by each of the ORFs in the remaining 51 organisms. Those polypeptides within a single organism that shared a higher degree of sequence identity to one another than to polypeptide sequences obtained from any^"ot_ιer organisms were clustered as "paralog" sequences for "reciprocal" best-hit analysis.

For each reference organism, the 50 homologous coding nucleic acids (and the 50 homologous polypeptides which they encode) was determined by identifying the ORFs in each of the 50 comparison organisms which encode a polypeptide sharing the highest degree of amino acid sequence identity to the polypeptide encoded by the ORF from the reference organism. The accuracy of the identification of the predicted homologous coding nucleic acids (and the homologous polypeptides which they encode) was confirmed by a "reciprocal" BLAST analysis in which the polypeptide sequence ofthe predicted homologous polypeptide was compared against the polypeptides encoded by each of the ORFS in the reference organism using BLASTP 2.09 algorithm without filtering. Only those polypeptides that share the highest degree of amino acid sequence identity in each portion ofthe two-way comparison are retained for further analysis.

The best homolog for each of the fifty-one organisms, defined as the most significantly scoring match which also fulfilled the above criteria, was reported in Table IV. Table IN lists the best ORF identified as described above (column labeled Homolog

LocusID) that matches the query sequence (column labeled Query LocusID), % identity between the query sequence and the homolog, and the amount of each sequence that aligns together well (columns labeled Query Coverage and Homolog Coverage) for the gene identified in each of the fifty-one organisms evaluated as described above. As described in connection which Table IC, the Locus IDs (ie. both Query Locus ID and Homolog Locus ID) provided in Table IV each comprise a nine. igit alpha-numeric identifier that can be used to determine the organism from which the query and homolog sequences were obtained. Specifically, the first letter ofthe Locus ID corresponds to the first letter of the genus name of the organism described herein from which the Locus was identified and the second and third letters of the Locus ID correspond to the first two letters of the species name of this organism. For example, the identifier EFA205257 describes a gene locus identified from Enterococcus faecalis. In those instances where the three letter identifier is the same for different organisms, the exact identity ofthe organism which corresponds to the Locus ID can be determined by referring to the organism designation in the sequence listing for the coding nucleic acid or polypeptide SEQ ID NO. that corresponds to the particular Locus ID. l,„l> ll,.„. ,. Il,„|l ,ι» „.ι|. l|„,ll .I'

TABLE IV

iϊ if.,.- S „" '!.„ „.,|F ιr„,|i !,^•„,„ ,,' «,„if ^■;,-,'.-ι „„';„ I .V .

■■■>< _,,,» a„„ ,'^■ ιr,„ιe „,u„ π,„ιt .

;,„. ii„«, „^• i|.„ii :p ,„ii„ ιι,„ιι ,,ι-

,.!' limn lira,. ,.' H,„l! 'iii!' „,ll„ U,„ll .11'

...II II..J1 Jl„„, „' l|,„ll „. „,iι„ li,„|f il

«•!« !(,„„ ,. ii,„ii ;,. > ,„«,. jf„,|i .,.'

.,.!' li it ιι,„„ . ii,„if :;.^> ,„ii„ ui .ii*

...It lU„tr U„,„ ,.' I|,„iι -iiiii „,i ϋ,„. ..t"

».n n.„. ϋ;;; „^•' u„,it ^■•::;μ ,„ii„ ii„,ιs ,,ι^y

The data in Table IV demonstrates the methods described herein identified genes required for proliferation in several species which share homology.

EXAMPLE 9 Identification of Genes and their Corresponding Operons Affected by Antisense Inhibition Once the genes involved in Escherichia coli, Staphylococcus aureus, Enterococcus faecalis,

Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis proliferation are identified as described above, the operons in which these genes lie may be identified by comparison with known microbial genomes. Since bacterial genes are transcribed in a polycistronic manner, the antisense inhibition of a single gene in an operon might affect the expression of all the other genes on the operon or the genes downstream from the single gene identified. Accordingly, each ofthe genes contained within an operon may be analyzed for their effect on proliferation.

Operons are predicted by looking for all adjacent genes in a genomic region that lie in the same orientation with no large noncoding gaps in between. First, full-length ORFs complementary to the antisense molecules are identified as described above. Adjacent ORFs are then identified and their relative orientation determined either by directly analyzing the genomic sequences surrounding the ORFs complementary to the antisense clones or by extracting adjacent ORFs from the collection obtained through whole genome ORF analysis described above followed by ORF alignment. Operons predicted in this way may be confirmed by comparison to the arrangement of the homologous nucleic acids in the Bacillus subtilis complete genome sequence, as reported by the genome database compiled at Institut Pasteur Subtilist Release R15.1 (June 24, 1999) which can be found at http://bioweb.pasteur.fr/GenoList/SubtiList/. The Bacillus subtilis genome is the only fully sequenced and annotated genome from a Gram positive microorganism, and appears to have a high level of similarity to Staphylococcus aureus both at the level of conservation of gene sequence and genomic organization including operon structure. Operons for Salmonella typhimurium and Klebsiella pneumoniae may be identified by comparison with E. coli, Haemophilus, or Pseudomonas sequences. The Pseudomonas aeruginosa web site (http://www.pseudomonas.com) can also be used to help predict operon organization in this bacterium.

Extensive DNA sequences of Salmonella typhimurium are available through the Salmonella

Genome Center (Washington University, St. Louis, MO) the Sanger Centre (United Kingdom) and the PathoSeq database (Incyte ). Annotation of some of the DNA sequences in some of the aforementioned databases is lacking, but comparisons may be made to E. coli using tools such as

BLASTX.

Public or proprietary databases may be used to analyzed E. faecalis sequences as well as sequences from the organisms listed above. The analysis of the operons on which essential genes lie may be conducted for each of the sequences which are listed in Table IA which inhibit proliferation and the ORFs listed in Table IC. Once the full length ORFs and/or the operons containing them have been identified using the methods described above, they can be obtained from a genomic library by performing a PCR amplification using primers at each end of the desired sequence. Those skilled in the art will appreciate that a comparison of the ORFs to homologous sequences in other cells or microorganisms will facilitate confirmation ofthe start and stop codons at the ends ofthe ORFs.

In some embodiments, the primers may contain restriction sites which facilitate the insertion ofthe gene or operon into a desired vector. For example, the gene may be inserted into an expression vector and used to produce the proliferation-required protein as described below. Other methods for obtaining the full length ORFs and/or operons are familiar to those skilled in the art. For exmaple, natural restriction sites may be employed to insert the full length ORFs and/or operons into a desired vector.

EXAMPLE 10 Identification of Individual Genes within an Operon Required for Proliferation The following example illustrates a method for determining if a targeted gene within an operon is required for cell proliferation by replacing the targeted allele in the chromosome with an in-frame deletion ofthe coding region ofthe targeted gene.

Deletion inactivation of a chromosomal copy of a gene in Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis can be accomplished by integrative gene replacement. The principles of this method were described in Xia, M., et al. 1999 Plasmid 42:144- 149 and Hamilton, C. M., et al 1989. J. Bacteriol. 171: 4617-4622. A similar gene disruption method is available for Pseudomonas aeruginosa, except the counter selectable marker is sacB (Schweizer, H. P., Klassen, T. and Hoang, T. (1996) Mol. Biol. of Pseudomonas . ASM press, 229- 237. In this approach, a mutant allele of the targeted gene is constructed by way of an in-frame deletion and introduced into the chromosome using a suicide vector. This results in a tandem duplication comprising a deleted (null) allele and a wild type allele of the target gene. Cells in which the vector sequences have been deleted are isolated using a counter-selection technique. Removal of the vector sequence from the chromosomal insertion results in either restoration of the wild-type target sequence or replacement of the wild type sequence with the deletion (null) allele. E. faecalis genes can be disrupted using a suicide vector that contains an internal fragment to a gene of interest. With the appropriate selection this plasmid will homologously recombine into the chromosome (Nallapareddy, S. R., X. Qin, G. M. Weinstock, M. Hook, B. E. Murray. 2000. Infect. Immun. 68:5218-5224.

The resultant population of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis colonies can then be evaluated to determine whether the target sequence is required for proliferation by PCR amplification of the affected target sequence. If the targeted gene is not required for proliferation, then PCR analysis will show that roughly equal numbers of colonies have retained either the wild-type or the mutant allele. If the targeted gene is required for proliferation, then only wild-type alleles will be recovered in the PCR analysis.

The method of cross-over PCR is used to generate the mutant allele by amplification of nucleotide sequences flanking but not including the coding region of the gene of interest, using specifically designed primers such that overlap between the resulting two PCR amplification products allows them to hybridize. Further PCR amplification of this hybridization product using primers representing the extreme 5' and 3' ends can produce an amplification product containing an in-frame deletion ofthe coding region but retaining substantial flanking sequences.

For Staphylococcus aureus, this amplification product is subcloned into the suicide vector pSA3182 (Xia, M., et al. 1999 Plasmid 42:144-149, which is host-dependent for autonomous replication. This vector includes a tetC tetracycline-resistance marker and the origin of replication of the well-known Staphylococcus aureus plasmid pT181 (Mojumdar, M and Kahn, S.A., Characterisation of the Tetracycline Resistance Gene of Plasmid pT181, J. Bacteriol. 170: 5522 (1988). The vector lacks the repC gene which is required for autonomous replication ofthe vector at the pT181 origin. This vector can be propagated in a Staphylococcus aureus host strain such as SA3528, which expresses repC in trans. Once the amplified truncated target gene sequence is cloned and propagated in the pSA3182 vector, it can then be introduced into a repC minus strain such as RN4220 (Kreiswirth, B.N. et al., The Toxic Shock Syndrome Exotoxin Structural Gene is Not Detectably Transmitted by a Prophage, Nature 305:709-712 (1983), by electroporation with selection for tetracycline resistance. In this strain, the vector must integrate by homologous recombination at the targeted gene in the chromosome to impart drug resistance. This results in a inserted truncated copy of the allele, followed by pSA3182 vector sequence, and finally an intact and functional allele ofthe targeted gene.

Once a tetracycline resistant Staphylococcus aureus strain is isolated using the above technique and shown to include truncated and wild-type alleles of the targeted gene as described above, a second plasmid, pSA7592 (Xia, M., et al. 1999 Plasmid 42:144-149, is introduced into the strain by electroporation. This gene includes an erythromycin resistance gene and a repC gene that is expressed at high levels. Expression of repC in these transformants is toxic due to interference of normal chromosomal replication at the integrated pT181 origin of replication. This selects for strains that have removed the vector sequence by homologous recombination, resulting in either of two outcomes: The selected cells either possess a wild-type allele of the targeted gene or a gene in which the wild-type allele has been replaced by the engineered in-frame deletion of the truncated allele.

PCR amplification can be used to determine the genetic outcome of the above process in the resulting erythromycin resistant, tet sensitive transformant colonies. If the targeted gene is not required for cellular replication, then PCR evidence for both wild-type and mutant alleles will be found among the population of resultant transformants. However, if the targeted gene is required for cellular proliferation, then only the wild-type form of the gene will be evident among the resulting transformants. Similarly, for Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis the PCR products containing the mutant allele of the target sequence may be introduced into an appropriate knockout vector and cells in which the wild type target has been disrupted are selected using the appropriate methodology.

The above methods have the advantage that insertion of an in-frame deletion mutation is far less likely to cause downstream polar effects on genes in the same operon as the targeted gene. However, it will be appreciated that other methods for disrupting Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae,

Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium,

Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi,

Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis genes which are familiar to those skilled in the art may also be used. Each gene in the operon may be disrupted using the methodology above to determine whether it is required for proliferation.

EXAMPLE 11

Expression o the Proteins Encoded by Genes Identified as Required for Escherichia coli,

Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae. Pseudomonas aeruginosa. Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis,

Bordetella pertussis. Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum,

Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae. Chlamydia trachomatis,

Clostridium acetobutylicum. Clostridium botulinum. Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae. Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis. Pseudomonas putida. Pseudomonas syringae. Salmonella paratyphi.

Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus. Streptococcus mutans. Streptococcus pneumoniae. Streptococcus pyogenes. Treponema pallidum, Ureaplasma urealyticum. Vibrio cholerae. Yersinia pestis Proliferation

The following is provided as one exemplary method to express the proliferation-required proteins idenfied as described above. The proliferation-required proteins may be expressed using any of the bacterial, insect, yeast, or mammalian expression systems known in the art. In some embodiments, the proliferation-required proteins encoded by the identified nucleotide sequences described above (including the proteins of SEQ ID NOs.: 42398-78581 encoded by the nucleic acids of SEQ ID NOs.: 6214-42397 are expressed using expression systems designed either for E. coli or for Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis. First, the initiation and termination codons for the gene are identified. If desired, methods for improving translation or expression ofthe protein are well known in the art. For example, if the nucleic acid encoding the polypeptide to be expressed lacks a methionine codon to serve as the initiation site, a strong Shine-Delgarno sequence, or a stop codon, these nucleotide sequences can be added. Similarly, if the identified nucleic acid lacks a transcription termination signal, this nucleotide sequence can be added to the construct by, for example, splicing out such a sequence from an appropriate donor sequence. In addition, the coding sequence may be operably linked to a strong constitutive promoter or an inducible promoter if desired. The identified nucleic acid or portion thereof encoding the polypeptide to be expressed is obtained by, for example,

PCR from the bacterial expression vector or genome using oligonucleotide primers complementary to the identified nucleic acid or portion thereof and containing restriction endonuclease sequences appropriate for inserting the coding sequences into the vector such that the coding sequences can be expressed from the vector's promoter. Alternatively, other conventional cloning techniques may be used to place the coding sequence under the control of the promoter. In some embodiments, a termination signal may be located downstream of the coding sequence such that transcription of the coding sequence ends at an appropriate position. Several expression vector systems for protein expression in E. coli are well known and available to those knowledgeable in the art. The coding sequence may be inserted into any of these vectors and placed under the control of the promoter. The expression vector may then be transformed into DH5α or some other E. coli strain suitable for the over expression of proteins.

Alternatively, an expression vector encoding a protein required for proliferation of Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis may be introduced into Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis. Protocols for introducing nucleic acids into these organisms are well known in the art. For example, the protocols described in J.C.Lee "Electroporation of Staphylococci" from Methods in Molecular Biology vol 47: Electroporation Protocols for Microorganisms Edited by : J.A. Nickoloff Humana Press Inc., Totowa, NJ. pp209-216, may be used to introduce nucleic acids into Staphylococcus aureus. Nucleic acids may also be introduced into Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa ox Enterococcus faecalis using methods familiar to those skilled in the art. Positive transformants are selected after growing the transformed cells on plates containing an antibiotic to which the vector confers resistance. In one embodiment, Staphylococcus aureus is transformed with an expression vector in which the coding sequence is operably linked to the T5 promoter containing a xylose operator such that expression ofthe encoded protein is inducible with xylose.

In one embodiment, the protein is expressed and maintained in the cytoplasm as the native sequence. In an alternate embodiment, the expressed protein can be modified to include a protein tag that allows for differential cellular targeting, such as to the periplasmic space of Gram negative or Gram positive expression hosts or to the exterior of the cell (i.e., into the culture medium). In some embodiments, the osmotic shock cell lysis method described in Chapter 16 of Current Protocols in Molecular Biology, Vol. 2, (Ausubel, et al., Eds.) John Wiley & Sons, Inc. (1997) may be used to liberate the polypeptide from the cell. In still another embodiment, such a protein tag could also facilitate purification of the protein from either fractionated cells or from the culture medium by affinity chromatography. Each of these procedures can be used to express a proliferation- required protein.

Expressed proteins, whether in the culture medium or liberated from the periplasmic space or the cytoplasm, are then purified or enriched from the supernatant using conventional techniques such as ammonium sulfate precipitation, standard chromatography, immunoprecipitation, immunochromatography, size exclusion chromatography, ion exchange chromatography, and HPLC. Alternatively, the polypeptide may be secreted from the host cell in a sufficiently enriched or pure state in the supernatant or growth media of the host cell to permit it to be used for its intended purpose without further enrichment. The purity of the protein product obtained can be assessed using techniques such as SDS PAGE, which is a protein resolving technique well known to those skilled in the art. Coomassie, silver staining or staining with an antibody are typical methods used to visualize the protein of interest.

Antibodies capable of specifically recognizing the protein of interest can be generated using synthetic peptides using methods well known in the art. See, Antibodies: A Laboratory Manual, (Harlow and Lane, Eds.) Cold Spring Harbor Laboratory (1988). For example, 15-mer peptides having an amino acid sequence encoded by the appropriate identified gene sequence of interest or portion thereof can be chemically synthesized. The synthetic peptides are injected into mice to generate antibodies to the polypeptide encoded by the identified nucleic acid sequence of interest or portion thereof. Alternatively, samples ofthe protein expressed from the expression vectors discussed above can be purified and subjected to amino acid sequencing analysis to confirm the identity of the recombinantly expressed protein and subsequently used to raise antibodies. An Example describing in detail the generation of monoclonal and polyclonal antibodies appears in Example 12. The protein encoded by the identified nucleic acid of interest or portion thereof can be purified using standard immunochromatography techniques. In such procedures, a solution containing the secreted protein, such as the culture medium or a cell extract, is applied to a column having antibodies against the secreted protein attached to the chromatography matrix. The secreted protein is allowed to bind the immunochromatography column. Thereafter, the column is washed to remove non- specifically bound proteins. The specifically-bound secreted protein is then released from the column and recovered using standard techniques. These procedures are well known in the art.

In an alternative protein purification scheme, the identified nucleic acid of interest or portion thereof can be incorporated into expression vectors designed for use in purification schemes employing chimeric polypeptides. In such strategies the coding sequence ofthe identified nucleic acid of interest or portion thereof is inserted in-frame with the gene encoding the other half ofthe chimera. The other half of the chimera can be maltose binding protein (MBP) or a nickel binding polypeptide encoding sequence. A chromatography matrix having maltose or nickel attached thereto is then used to purify the chimeric protein. Protease cleavage sites can be engineered between the MBP gene or the nickel binding polypeptide and the identified expected gene of interest, or portion thereof. Thus, the two polypeptides ofthe chimera can be separated from one another by protease digestion.

One useful expression vector for generating maltose binding protein fusion proteins is pMAL

(New England Biolabs), which encodes the malE gene. In the pMal protein fusion system, the cloned gene is inserted into a pMal vector downstream from the malE gene. This results in the expression of an MBP-fusion protein. The fusion protein is purified by affinity chromatography. These techniques as described are well known to those skilled in the art of molecular biology.

EXAMPLE 12

Production of an Antibody to an isolated Escherichia coli. Staphylococcus aureus. Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis. Borrelia burgdorferi,

Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni,

Chlamydia pneumoniae. Chlamydia trachomatis, Clostridium. acetobutylicum, Clostridium botulinum. Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes. Moraxella catarrhalis. Mycobacterium avium. Mycobacterium bovis,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae. Salmonella paratyphi. Salmonella typhi,

Staphylococcus epidermidis, Staphylococcus haemolyticus. Streptococcus mutans. Streptococcus pneumoniae. Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum. Vibrio cholerae or Yersinia pestis Protein Substantially pure protein or polypeptide (including one ofthe polypeptides of SEQ ID NOs.: 42398-78581) is isolated from the transformed cells as described in Example 11. The concentration of protein in the final preparation is adjusted, for example, by concentration on a 10,000 molecular weight cut off AMICON filter device (Millipore, Bedford, MA), to the level of a few micrograms/ml. Monoclonal or polyclonal antibody to the protein can then be prepared as follows: Monoclonal Antibody Production by Hybridoma Fusion Monoclonal antibody to epitopes of any ofthe peptides identified and isolated as described can be prepared from murine hybridomas according to the classical method of Kohler, G. and Milstein, C, Nature 256:495 (1975) or any of the well-known derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein or peptides derived therefrom over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells are destroyed by growth of the system on selective medium comprising aminopterin (HAT medium). The successfully-fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as described by Engvall, E., "Enzyme immunoassay ELISA and EMIT," Meth. Enzymol. 70:419 (1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Davis, L. et al. Basic Methods in Molecular Biology Elsevier, New York. Section 21-2. Polyclonal Antibody Production by Immunization

Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein or a peptide can be prepared by immunizing suitable animals with the expressed protein or peptides derived therefrom described above, which can be unmodified or modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than larger molecules and can require the use of carriers and adjuvant. Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis, J. et al. J. Clin. Endocrinol. Metab. 33:988-991 (1971).

Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony, O. et al., Chap. 19 in: Handbook of Experimental Immunology D. Wier (ed) Blackwell (1973). Plateau concentration of antibody is usually in the range of 0.1 to 0.2 mg/ml of serum (about 12 μM). Affinity ofthe antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher, D., Chap. 42 in: Manual of Clinical Immunology, 2d Ed. (Rose and Friedman, Eds.) Amer. Soc. For Microbiol., Washington, D.C. (1980). Antibody preparations prepared according to either protocol are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample. The antibodies can also be used in therapeutic compositions for killing bacterial cells expressing the protein.

EXAMPLE 13 Construction of Strains Which Overexpress or Underexpress Gene Products Required for

Proliferation by Promoter Replacement

Strains which overexpress or underexpress gene products required for proliferation may also be constructed by replacing the promoters which naturally direct transcription of these gene products with promoters which provide the desired level of expression. As described above, such strains are useful in methods for identifying essential genes, in methods for identifying compounds which inhibit cellular proliferation, in methods for identifying the targets of compounds which inhibit proliferation, as well as in methods for identifying genes encoding gene products required for proliferation. Some embodiments of the present invention contemplate the use of a vector that comprises a regulatable fusion promoter selected from a suite of fusion promoters wherein the promoter suite is useful for modulating both the basal and maximal levels of transcription of a nucleic acid over a wide dynamic range thus allowing the desired level of production of a transcript which corresponds to a nucleic acid described herein. Such promoters are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001, the disclosure of which is incorported herein by reference in its entirety.

For example, in some embodiments, the natural promoter may be replaced using techniques which employ homologous recombination to exchange a promoter present on the chromosome of the cell with the desired promoter. In such methodology, a nucleic acid comprising a promoter replacement cassette is introduced into the cell. As illustrated in Figure IA, the promoter replacement cassette comprises a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3' region which is homologous to sequences 3' of the natural promoter in the chromosome. In some embodiments, the promoter replacement cassette may also include a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter. If desired, the promoter replacement cassette may also contain a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker, as illustrated in Figure IB. As illustrated in Figure IA and IB, homologous recombination is allowed to occur between the chromosomal region containing the natural promoter and the promoter replacement cassette. Cells in which the promoter replacement cassette has integrated into the chromosome are identified or selected. To confirm that homologous recombination has occurred, the chromosomal structure of the cells may be verified by Southern analysis or PCR. In some embodiments, the promoter replacement cassette may be introduced into the cell as a linear nucleic acid, such a PCR product or a restriction fragment. Alternatively, the promoter replacement may be introduced into the cell on a plasmid. Figures IA and IB illustrates the replacement of a chromosomal promoter with a desired promoter through homologous recombination.

In some embodiments, the cell into which the promoter replacement cassette is infroduced may carry mutations which enhance its ability to be transformed with linear DNA or which enhance the frequency of homologous recombination. For example, if the cell is an Escherichia coli cell it may have a mutation in the gene encoding Exonuclease V ofthe RecBCD recombination complex. If the cell is an Escherichia coli cell it may have a mutation that activates the RecET recombinase ofthe Rac prophage and/or a mutation that enhances recombination through the RecF pathway. For example, the Escherichia coli cells may be RecB or RecC mutants carrying an sbcA or sbcB mutation. Alternatively, the Escherichia coli cells may be recD mutants. In other embodiments the Escherichia coli cells may express the λ Red recombination genes. For example, Escherichia coli cells suitable for use in techniques employing homologous recombination have been described in Datsenko, K.A. and Warmer, B.L., PNAS 97:6640-6645 (2000); Murphy, K.C., J. Bact 180: 2053- 2071 (1998); Zhang, Y., et al., Nature Genetics 20: 123-128 (1998); and Muyrers, J.P.P. et al., Genes & Development 14: 1971-1982 (2000). It will be appreciated that cells carrying mutations in similar genes may be constructed in organisms other than Escherichia coli. In some embodiments, the methods described in U.S. Patent Application Serial Number

09/948,993, may be used to place the gene required for proliferation under the control of a regulatable promoter.

If the organism in which promoter replacement is to be performed is diploid, strains in which genes encoding gene products required for proliferation are under the control of a desired promoter may be constructed by inactivating one chromosomal copy of a gene encoding a gene product required for proliferation. For example, the gene may be inactivated by insertion of or replacement by a nucleotide sequence encoding a selectable or detectable gene product, such as a polypeptide which provides resistance to a drug or which allows growth under certain culture conditions. The other chromosomal copy of the gene encoding a gene product required for proliferation is placed under the control of a regulatable promoter, such as the tetracycline regulatable promoter similar to that described in Gari et al., (1997) Yeast 13:837-848 and Nagahashi et al., (1997) Mol. Gen. Genet. 255:372-375, by homologous recombination. The resultant strains may be used to identify genes which encode gene products required for proliferation and in the methods ofthe present invention. The method may also be applied to haploid organisms by modifying the single allele ofthe gene via recombination ofthe allele with a promoter replacement fragment comprising a nucleotide sequence encoding a heterologous promoter, such that the expression of the gene is conditionally regulated by the heterologous promoter. By repeating this process for a preferred subset of genes in a haploid pathogenic organism, or its entire genome, a collection or a complete set of conditional mutant strains can be obtained.

It will be appreciated that the means to achieve conditional expression are not restricted to the promoters discussed above and can be performed with other conditional promoters. Such conditional promoter may, for example, be regulated by a repressor which repress transcription from the promoter under particular condition or by a transactivator which increases transcription from the promoter, such as, when in the presence of an inducer.

Although not mandatory, performing the gene disruption first enables heterozygous strains to be constructed and separately collected as a heterozygote sfrain collection during the process of drug target validation. Heterozygous strains for a given gene express approximately half the normal diploid level of a particular gene product. Consequently, these strains provide constructions having a diminished level ofthe encoded gene product, and they may be used in the methods described herein. However, it is clear to those skilled in the art that the order of allele modification followed in this embodiment ofthe invention is not critical, and that it is feasible to perform these steps in a different order such that the conditional-expressing allele is constructed first and the disruption ofthe remaining wild type gene allele be performed subsequently. However, where the promoter replacement step is carried out first, it is preferable to delete sequences homologous to those employed in the gene disruption step.

Alternatively, conditional expression could be achieved by means other than the reliance of conditional promoters. For example, conditional expression could be achieved by the replacement ofthe wild type allele in haploid or heterozygous strains with temperature sensitive alleles derived in vitro, and their phenotype would then be analyzed at the nonpermissive temperature. In a related approach, in heterozygous strains, insertion of a ubiquitination signal into the remaining wild type allele to destabilize the gene product during activation conditions can be adopted to examine phenotypic effects resulting from gene inactivation.

In another alternative, a constitutive promoter regulated by an excisable transactivator can be used. The promoter is placed upstream to a target gene to repress expression to the basal level characteristic ofthe promoter. For example, if the strains are fungal organisms, a heterologous promoter containing lexA operator elements may be used in combination with a fusion protein composed ofthe lexA DNA binding domain and any transcriptional activator domain (e.g. GAL4, HAP4, VP16) to provide constitutive expression of a target gene. Counterselection mediated by 5- FOA can be used to select those cells which have excised the gene encoding the fusion protein. This procedure enables an examination ofthe phenotype associated with repression ofthe target gene to the basal level of expression provided by the lexA heterologous promoter in the absence of a functional transcription activator. The strains generated by this approach may be used in the present invention.

Alternatively, conditional expression of a target gene can be achieved without the use of a transactivator containing a DNA binding, transcriptional activator domain. A cassette could be assembled to contain a heterologous constitutive promoter downstream of, for example, the URA3 selectable marker, which is flanked with a direct repeat containing homologous sequences to the 5' portion ofthe target gene. Additional homologous sequences upstream ofthe target, when added to this cassette would facilitate homologous recombination and replacement of the native promoter with e above-described heterologous promoter cassette immediately upstream of the start codon of the target gene or open reading frame. Conditional expression is achieved by selecting strains, by using 5-FOA containing media, which have excised the heterologous constitutive promoter and URA3 marker (and consequently lack those regulatory sequences upstream of the target gene required for expression ofthe gene) and examining the growth of the resulting sfrain versus a wild type sfrain grown under identical conditions.

EXAMPLE 14 Promoter Replacement to Generate Cells Capable of Overexpressing or Underexpressing a Gene Encoding a Gene Product Required for Proliferation A target for promoter replacement is selected. A promoter replacement cassette is obtained by inserting a nucleic acid comprising the rrnBTlT2 transcriptional terminator followed by the lac promoter into pACYC 184 such that the rrnB terminator and lac promoter are positioned 3' of the CAT gene. The promoter replacement cassette (CAT-rrnBTlT2-plac) is amplified by PCR. The PCR product is used as the template for another round of PCR using primers with 60-80 bp of homology to a target promoter (i.e. a promoter which directs expression of a gene encoding a gene product required for proliferation) and 20 bp of homology to the CAT/ m_BTlT2/plac template as described above. The region of homology is chosen such that upon homologous recombination, the CAT/rrnBTlT2/plac cassette replaces the promoter ofthe target gene but leaves its Shine-Delgarno motif untouched.

The promoter replacement cassette is transformed into competent JC8679. JC8679 is available from the E. coli genetics stock center. JC8679 allows recombination of short linear DNAs and also contains a lacY mutation which allows titratable regulation of the lac promoter. The transformed cells are plated onto LB/chloramphenicol plates containing various levels of IPTG to assure that the correct level of expression is achieved to allow survival. The correct integration of the promoter replacement cassette is confirmed by colony PCR. If desired, proper regulation ofthe target gene by the inserted promoter may be confirmed by testing the integrants for growth defects when inducer is absent or present at levels lower than that at which the original colonies were obtained. The inability to grow in the absence of inducer (TPTG) or in the presence of lower levels ofthe inducer than were used to obtain the clones confirms that the target gene is properly regulated by the inserted promoter. It will be appreciated that although the lac promoter and the strain JC8679 are used as examples, the method may be performed using any suitable regulatable promoter and organism or strain to generate cells which are capable of overexpressing or underexpressing a gene encoding a gene product required for proliferation. Examples of promoters that are useful for the regulating the expression of gene products in Gram-positive organisms over a wide dynamic range are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001.

The following example describes one method for promoter replacement in a prokaryotic cell. It will be appreciated that promoter replacement can be used in a variety of organisms as previously indicated.

EXAMPLE 15 Operator Insertion to Generate Cells Capable of Overexpressing or Underexpressing a Gene Encoding a Gene Product Required for Proliferation An oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the target promoter is designed. The target promoter is the promoter which drives expression of a gene encoding a gene product required for proliferation, such as the yabB yabCftsL ftsl murE genes in an operon. The sequence of the oligonucleotide (SEQ ID NO. 78582) and locations of the regions homologous to the promoter are illustrated in Figure 6. The sequence of the promoter is also shown with the locations of the -10 and -35 regions indicated (SEQ ID NO. 78583). The single stranded oligonucleotide is transformed into a bacterium expressing the λ Beta and Gam proteins. The cells in the transformation mixture are diluted and plated on medium containing IPTG. Colonies in which the lac operator has integrated into the target promoter are identified by colony PCR. If desired, proper regulation of the target promoter by the inserted operator is confirmed by growing the identified colonies in medium containing or lacking IPTG. The colonies proliferate on medium containing IPTG but fail to grow on medium lacking IPTG, thereby confirming that the target promoter is properly regulated by the inserted operator. It will be appreciated that the preceding method may be performed with any target promoter and any operator to generate cells which overexpress or underexpress a gene encoding a gene product required for proliferation. EXAMPLE 16

Screening Chemical Libraries A. Protein-Based Assays

Having isolated and expressed bacterial proteins shown to be required for bacterial proliferation, the present invention further contemplates the use of these expressed target proteins in assays to screen libraries of compounds for potential drug candidates. The generation of chemical libraries is well known in the art. For example, combinatorial chemistry can be used to generate a library of compounds to be screened in the assays described herein. A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building block" reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining amino acids in every possible combination to yield peptides of a given length. Millions of chemical compounds theoretically can be synthesized through such combinatorial mixings of chemical building blocks. For example, one commentator observed that the systematic, combinatorial mixing of 100 interchangeable chemical building blocks results in the theoretical synthesis of 100 million tetrameric compounds or 10 billion pentameric compounds. (Gallop et al., "Applications of Combinatorial Technologies to Drug Discovery, Background and Peptide Combinatorial Libraries," Journal of Medicinal Chemistry, Vol. 37, No. 9, 1233-1250 (1994). Other chemical libraries known to those in the art may also be used, including natural product libraries.

Once generated, combinatorial libraries can be screened for compounds that possess desirable biological properties. For example, compounds which may be useful as drugs or to develop drugs would likely have the ability to bind to the target protein identified, expressed and purified as discussed above. Further, if the identified target protein is an enzyme, candidate compounds would likely interfere with the enzymatic properties ofthe target protein. For example, the enzymatic function of a target protein may be to serve as a protease, nuclease, phosphatase, dehydrogenase, transporter protein, transcriptional enzyme, and any other type of enzyme known or unknown. Thus, the present invention contemplates using the protein products described above to screen combinatorial chemical libraries. In one example, the target protein is a serine protease and the substrate of the enzyme is known. The present example is directed towards the analysis of libraries of compounds to identify compounds that function as inhibitors of the target enzyme. First, a library of small molecules is generated using methods of combinatorial library formation well known in the art. U.S. Patent Nos. 5,463,564 and 5,574, 656, to Agrafiotis, et al., entitled "System and Method of Automatically Generating Chemical Compounds with Desired Properties," are two such teachings. Then the library compounds are screened to identify those compounds that possess desired structural and functional properties. U.S. Patent No. 5,684,711, also discusses a method for screening libraries.

To illustrate the screening process, the target polypeptide and chemical compounds of the library are combined with one another and permitted to interact with one another. A labeled substrate is added to the incubation. The label on the substrate is such that a detectable signal is emitted from the products ofthe substrate molecules that result from the activity ofthe target polypeptide. The emission of this signal permits one to measure the effect of the combinatorial library compounds on the enzymatic activity of target enzymes by comparing it to the signal emitted in the absence of combinatorial library compounds. The characteristics of each library compound are encoded so that compounds demonstrating activity against the enzyme can be analyzed and features common to the various compounds identified can be isolated and combined into future iterations of libraries.

Once a library of compounds is screened, subsequent libraries are generated using those chemical building blocks that possess the features shown in the first round of screen to have activity against the target enzyme. Using this method, subsequent iterations of candidate compounds will possess more and more of those structural and functional features required to inhibit the function ofthe target enzyme, until a group of enzyme inhibitors with high specificity for the enzyme can be found. These compounds can then be further tested for their safety and efficacy as antibiotics for use in mammals. It will be readily appreciated that this particular screening methodology is exemplary only. Other methods are well known to those skilled in the art. For example, a wide variety of screening techniques are known for a large number of naturally-occurring targets when the biochemical function ofthe target protein is known. For example, some techniques involve the generation and use of small peptides to probe and analyze target proteins both biochemically and genetically in order to identify and develop drug leads. Such techniques include the methods described in PCT publications No. W09935494, WO9819162, WO9954728. Other techniques utilize natural product libraries or libraries of larger molecules such as proteins.

It will be appreciated that the above protein-based assays may be performed with any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581) or portions thereof. In addition, the above protein-based assays may be performed with homologous polypeptides or portions thereof. B. Cell-Based Assays

Current cell-based assays used to identify or to characterize compounds for drug discovery and development frequently depend on detecting the ability of a test compound to modulate the activity of a target molecule located within a cell or located on the surface of a cell. An advantage of cell-based assays is that they allow the effect of a compound on a target molecule's activity to be detected within the physiologically relevant environment of the cell as opposed to an in vitro environment. Most often such target molecules are proteins such as enzymes, receptors and the like. However, target molecules may also include other molecules such as DNAs, lipids, carbohydrates and RNAs including messenger RNAs, ribosomal RNAs, tRNAs, regulatory RNAs and the like. A number of highly sensitive cell-based assay methods are available to those of skill in the art to detect binding and interaction of test compounds with specific target molecules. However, these methods are generally not highly effective when the test compound binds to or otherwise interacts with its target molecule with moderate or low affinity. In addition, the target molecule may not be readily accessible to a test compound in solution, such as when the target molecule is located inside the cell or within a cellular compartment. Thus, current cell-based assay methods are limited in that they are not effective in identifying or characterizing compounds that interact with their targets with moderate to low affinity or compounds that interact with targets that are not readily accessible. The cell-based assay methods of the present invention have substantial advantages over current cell-based assays. These advantages derive from the use of sensitized cells in which the level or activity of at least one proliferation-required gene product (the target molecule) has been specifically reduced to the point where the presence or absence of its function becomes a rate- determining step for cellular proliferation. Bacterial, fungal, plant, or animal cells can all be used with the present method. Such sensitized cells become much more sensitive to compounds that are active against the affected target molecule. Thus, cell-based assays of the present invention are capable of detecting compounds exhibiting low or moderate potency against the target molecule of interest because such compounds are substantially more potent on sensitized cells than on nonsensitized cells. The effect may be such that a test compound may be two to several times more potent, at least 10 times more potent, at least 20 times more potent, at least 50 times more potent, at least 100 times more potent, at least 1000 times more potent, or even more than 1000 times more potent when tested on the sensitized cells as compared to the non-sensitized cells. The proliferation-required nucleic acids or polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis, or portions thereof, may be employed in any of the cell-based assays described herein. Similarly, homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides or portions of the homologous nucleic acids or homologous polypeptides, may be employed in any ofthe cell-based assays described herein. Due in part to the increased appearance of antibiotic resistance in pathogenic microorganisms and to the significant side-effects associated with some currently used antibiotics, novel antibiotics acting at new targets are highly sought after in the art. Yet, another limitation in the current art related to cell-based assays is the problem of repeatedly identifying hits against the same kinds of target molecules in the same limited set of biological pathways. This may occur when compounds acting at such new targets are discarded, ignored or fail to be detected because compounds acting at the "old" targets are encountered more frequently and are more potent than compounds acting at the new targets. As a result, the majority of antibiotics in use currently interact with a relatively small number of target molecules within an even more limited set of biological pathways.

The use of sensitized cells ofthe current invention provides a solution to the above problem in two ways. First, desired compounds acting at a target of interest, whether a new target or a previously known but poorly exploited target, can now be detected above the "noise" of compounds acting at the "old" targets due to the specific and substantial increase in potency of such desired compounds when tested on the sensitized cells of the current mvention. Second, the methods used to sensitize cells to compounds acting at a target of interest may also sensitize these cells to compounds acting at other target molecules within the same biological pathway. For example, expression of an antisense molecule to a gene encoding a ribosomal protein is expected to sensitize the cell to compounds acting at that ribosomal protein and may also sensitize the cells to compounds acting at any of the ribosomal components (proteins or rRNA) or even to compounds acting at any target which is part ofthe protein synthesis pathway. Thus an important advantage of the present invention is the ability to reveal new targets and pathways that were previously not readily accessible to drug discovery methods. Sensitized cells of the present invention are prepared by reducing the activity or level of a target molecule. The target molecule may be a gene product, such as an RNA or polypeptide produced from the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including a gene product produced from the nucleic acids of SEQ ID NOs.: 6214-42397, such as the polypeptides of SEQ ID NOs.: 42398- 78581) or from homologous nucleic acids. For example, the target molecule may be one of the polypeptides of SEQ ID NOs. 42398-78581 or a homologous polypeptide. Alternatively, the target may be a gene product such as an RNA or polypeptide which is produced from a sequence within the same operon as the proliferation-required nucleic acids Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or from homologous nucleic acids. In addition, the target may be an RNA or polypeptide in the same biological pathway as the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or from homologous nucleic acids. Such biological pathways include, but are not limited to, enzymatic, biochemical and metabolic pathways as well as pathways involved in the production of cellular structures such as the cell wall.

Current methods employed in the arts of medicinal and combinatorial chemistries are able to make use of structure-activity relationship information derived from testing compounds in various biological assays including direct binding assays and cell-based assays. Occasionally compounds are directly identified in such assays that are sufficiently potent to be developed as drugs. More often, initial hit compounds exhibit moderate or low potency. Once a hit compound is identified with low or moderate potency, directed libraries of compounds are synthesized and tested in order to identify more potent leads. Generally these directed libraries are combinatorial chemical libraries consisting of compounds with structures related to the hit compound but containing systematic variations including additions, subtractions and substitutions of various structural features. When tested for activity against the target molecule, structural features are identified that either alone or in combination with other features enhance or reduce activity. This information is used to design subsequent directed libraries containing compounds with enhanced activity against the target molecule. After one or several iterations of this process, compounds with substantially increased activity against the target molecule are identified and may be further developed as drugs. This process is facilitated by use of the sensitized cells of the present invention since compounds acting at the selected targets exhibit increased potency in such cell-based assays, thus; more compounds can now be characterized providing more useful information than would be obtained otherwise.

Thus, it is now possible using cell-based assays of the present invention to identify or characterize compounds that previously would not have been readily identified or characterized including compounds that act at targets that previously were not readily exploited using cell-based assays. The process of evolving potent drug leads from initial hit compounds is also substantially improved by the cell-based assays of the present invention because, for the same number of test compounds, more structure-function relationship information is likely to be revealed.

The method of sensitizing a cell entails selecting a suitable gene or operon. A suitable gene or operon is one whose transcription and/or expression is required for the proliferation of the cell to be sensitized. The next step is to introduce into the cells to be sensitized, an antisense RNA capable of hybridizing to the suitable gene or operon or to the RNA encoded by the suitable gene or operon. Introduction of the antisense RNA can be in the form of a vector in which antisense RNA is produced under the control of an inducible promoter. The amount of antisense RNA produced is modulated by varying an inducer concentration to which the cell is exposed and thereby varying the activity of the promoter driving transcription of the antisense RNA. Thus, cells are sensitized by exposing them to an inducer concentration that results in a sub-lethal level of antisense RNA expression. The requisite amount of inducer may be derived empiracally by one of skill in the art.

In one embodiment of the cell-based assays, antisense nucleic acids complementary to the identified Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis nucleotide sequences or portions thereof (including antisense nucleic acids comprising a nucleotide sequence complementary to one of SEQ ID NOs.: 6214-42397, and the antisense nucleic acids of SEQ ID NOs.: 1-6213 or antisense nucleic acids comprising a nucleotide sequence complementary to portions of the foregoing nucleic acids thereof), antisense nucleic complementary to homologous coding nucleic acids or portions thereof or homologous antisense nucleic acids are used to inhibit the production of a proliferation-required protein. Vectors producing antisense RNA complementary to identified genes required for proliferation, or portions thereof, are used to limit the concentration of a proliferation-required protein without severely inhibiting growth. The proliferation-required protein may be one of the proteins of SEQ ID NOs.: 42398-78581 or a homologous polypeptide. To achieve that goal, a growth inhibition dose curve of inducer is calculated by plotting various doses of inducer against the corresponding growth inhibition caused by the antisense expression. From this curve, the concentration of inducer needed to achieve various percentages of antisense induced growth inhibition, from 1 to 100% can be determined.

In some embodiments of the present invention, promoter replacement methods, such as those describe above and in U.S. Patent Application Serial Number 09/948,993, are used to express the proliferation-inhibiting nucleic acid. In other embodiments, the methods for the production of stabilized RNA in Gram-negative organisms, as described in U.S. Provisional Patent Application Serial Number 60/343,512, are used for the production of proliferation-inhibiting transcripts corresponding to the nucleic acid sequences described herein. Briefly, the stabilized antisense RNA may comprise an antisense RNA which was identified as inhibiting proliferation as described above which has been engineered to contain at least one stem loop flanking each end of the antisense nucleic acid. In some embodiments, the at least one stem-loop structure formed at the 5' end of the stabilized antisense nucleic acid comprises a flush, double stranded 5' end. In some embodiments, one or more of the stem loops comprises a rho independent terminator. In additional embodiments, the stabilized antisense RNA lacks a ribosome binding site. In further embodiments, the stabilized RNA lacks sites which are cleaved by one or more RNAses, such as RNAse E or RNAse HI. In some embodiments, the stabilized antisense RNA may be transcribed in a cell which the activity of at least one enzyme involved in RNA degradation has been reduced. For example, the activity of an enzyme such as RNase E, RNase π, RNase HI, polynucleotide phosphorylase, and poly(A) polymerase, RNA helicase, enolase or an enzyme having similar functions may be reduced in the cell.

A variety of different regulatable promoters may be used to produce the antisense nucleic acid. Transcription from the regulatable promoters may be modulated by controlling the activity of a transcription factor repressor which acts at the regulatable promoter. For example, if transcription is modulated by affecting the activity of a repressor, the choice of inducer to be used depends on the repressor/operator responsible for regulating transcription of the antisense nucleic acid. If the regulatable promoter comprises a T5 promoter fused to a xylO (xylose operator; e.g. derived from Staphylococcus xylosis (Schnappinger, D. et al., FEMS Microbiol. Let. 129: 126214-423978 (1995), then transcription of the antisense nucleic acid may be regulated by a xylose repressor. The xylose repressor may be provided by ectoptic expression within an S. aureus cell of an exogenous xylose repressor gene, e.g. derived from S. xylosis DNA. In such cases transcription of antisense RNA from the promoter is inducible by adding xylose to the medium and the promoter is thus "xylose inducible." Similarly, IPTG inducible promoters may be used. For example, the highest concentration of the inducer that does not reduce the growth rate significantly can be estimated from the curve. Cellular proliferation can be monitored by growth medium turbidity via OD measurements. In another example, the concentration of inducer that reduces growth by 25% can be predicted from the curve. In still another example, a concentration of inducer that reduces growth by 50% can be calculated. Additional parameters such as colony forming units (cfu) can be used to measure cellular viability. Some embodiments ofthe present invention contemplate the use of a vector that comprises a regulatable fusion promoter selected from a suite of fusion promoters wherein the promoter suite is useful for modulating both the basal and maximal levels of transcription of a nucleic acid over a wide dynamic range thus allowing the desired level of production of a transcript which corresponds to a nucleic acid described herein. Such promoters are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001, the disclosure of which is incorported herein by reference in its entirety.

Cells to be assayed are exposed to the above-determined concentrations of inducer. The presence of the inducer at this sub-lethal concentration reduces the amount of the proliferation required gene product to a sub-optimal amount in the cell that will still support growth. Cells grown in the presence of this concentration of inducer are therefore specifically more sensitive to inhibitors of the proliferation-required protein or RNA of interest or to inhibitors of proteins or RNAs in the same biological pathway as the proliferation-required protein or RNA of interest but not to inhibitors of unrelated proteins or RNAs.

Cells pretreated with sub-inhibitory concentrations of inducer and thus containing a reduced amount of proliferation-required target gene product are then used to screen for compounds that reduce cell growth. The sub-lethal concentration of inducer may be any concentration consistent with the intended use of the assay to identify candidate compounds to which the cells are more sensitive. For example, the sub-lethal concentration of the inducer may be such that growth inhibition is at least about 5%>, at least about 8%, at least about 10%), at least about 20%>, at least about 30%, at least about 40%>, at least about 50%, at least about 60% at least about 75%, or more. Cells which are pre-sensitized using the preceding method are more sensitive to inhibitors of the target protein because these cells contain less target protein to inhibit than do wild-type cells. It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids comprising a nucleotide sequence complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous polypeptides.

In another embodiment of the cell-based assays of the present invention, the level or activity of a proliferation required gene product is reduced using a mutation, such as a temperature sensitive mutation, in the gene encoding a gene product required for proliferation and an antisense nucleic acid comprising a nucleotide sequence complementary to the gene encoding the gene product required for proliferation or a portion thereof. Growing the cells at an intermediate temperature between the permissive and restrictive temperatures of the temperature sensitive mutant where the mutation is in a proliferation-required gene produces cells with reduced activity ofthe proliferation-required gene product. The antisense RNA complementary to the proliferation- required sequence further reduces the activity ofthe proliferation required gene product. Drugs that may not have been found using either the temperature sensitive mutation or the antisense nucleic acid alone may be identified by determining whether cells in which transcription of the antisense nucleic acid has been induced and which are grown at a temperature between the permissive temperature and the restrictive temperature are substantially more sensitive to a test compound than cells in which expression ofthe antisense nucleic acid has not been induced and which are grown at a permissive temperature. Also drugs found previously from either the antisense nucleic acid alone or the temperature sensitive mutation alone may have a different sensitivity profile when used in cells combining the two approaches, and that sensitivity profile may indicate a more specific action ofthe drug in inhibiting one or more activities ofthe gene product.

Temperature sensitive mutations may be located at different sites within the gene and correspond to different domains of the protein. For example, the dnaB gene of Escherichia coli encodes the replication fork DNA helicase. DnaB has several domains, including domains for oligomerization, ATP hydrolysis, DNA binding, interaction with primase, interaction with DnaC, and interaction with DnaA [(Biswas, E.E. and Biswas, S.B. 1999. Mechanism and DnaB helicase of Escherichia coli: structural domains involved in ATP hydrolysis, DNA binding, and oligomerization. Biochem. 38:10919-10928; Hiasa, H. and Marians, KJ. 1999. Initiation of bidirectional replication at the chromosomal origin is directed by the interaction between helicase and primase. J. Biol. Chem. 274:27244-27248; San Martin, C, Radermacher, M., Wolpensinger, B., Engel, A., Miles, C.S., Dixon, N.E., and Carazo, J.M. 1998. Three-dimensional reconstructions from cryoelecfron microscopy images reveal an intimate complex between helicase DnaB and its loading partner DnaC. Structure 6:501-9; Sutton, M.D., Carr, K.M., Vicente, M., and Kaguni, J.M. 1998. Escherichia coli DnaA protein. The N-terminal domain and loading of DnaB helicase at the E. coli chromosomal origin. J. Biol. Chem. 273:34255-62.). Temperature sensitive mutations in different domains of DnaB confer different phenotypes at the restrictive temperature, which include either an abrupt stop or slow stop in DNA replication with or without DNA breakdown (Wechsler, J.A. and Gross, J.D. 1971. Escherichia coli mutants temperature-sensitive for DNA synthesis. Mol. Gen. Genetics 113:273-284, and termination of growth or cell death. Combining the use of temperature sensitive mutations in the dnaB gene that cause cell death at the restrictive temperature with an antisense to the dnaB gene could lead to the discovery of very specific and effective inhibitors of one or a subset of activities exhibited by DnaB.

It will be appreciated that the above method may be performed with any mutation which reduces but does not eliminate the activity or level of the gene product which is required for proliferation.

It will be appreciated that the above cell-based assays may be performed using mutations in, such as temperature sensitive mutations, and antisense nucleic acids comprising a nucleotide sequence complementary to any of the genes encoding proliferation-required gene products from from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or portions thereof (including the nucleic acids of SEQ ID NOs.: 6214-42397), mutations in and antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any ofthe proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581), or homologous polypeptides may be reduced.

When screening for antimicrobial agents against a gene product required for proliferation, growth inhibition of cells containing a limiting amount of that proliferation-required gene product can be assayed. Growth inhibition can be measured by directly comparing the amount of growth, measured by the optical density of the growth medium, between an experimental sample and a control sample. Alternative methods for assaying cell proliferation include measuring the signal from a reporter construct, various enzymatic activity assays, and other methods well known in the art. It will be appreciated that the above method may be performed in solid phase, liquid phase or a combination ofthe two. For example, cells grown on nutrient agar containing the inducer ofthe antisense construct may be exposed to compounds spotted onto the agar surface. If desired, the cells may be grown on agar containing varying concentrations ofthe inducer. A compound's effect may be judged from the diameter of the resulting killing zone, the area around the compound application point in which cells do not grow. Multiple compounds may be transferred to agar plates and simultaneously tested using automated and semi-automated equipment including but not restricted to multi-channel pipettes (for example the Beckman Multimek) and multi-channel spotters (for example the Genomic Solutions Flexys). In this way multiple plates and thousands to millions of compounds may be tested per day.

The compounds may also be tested entirely in liquid phase using microtiter plates as described below. Liquid phase screening may be performed in microtiter plates containing 96, 384, 1536 or more wells per microtiter plate to screen multiple plates and thousands to millions of compounds per day. Automated and semi-automated equipment may be used for addition of reagents (for example cells and compounds) and determination of cell density.

EXAMPLE 17 Cell-Based Assay Using Antisense Complementary to Genes Encoding Ribosomal Proteins The effectiveness of the above cell-based assay was validated using constructs transribing antisense RNA to the proliferatioh required E. coli genes rplL, rpU, and rplW encoding ribosomal proteins L7/L12, L10 and L23 respectively. These proteins are essential components ofthe protein synthesis apparatus of the cell and as such are required for proliferation. These constructs were used to test the effect of antisense transcription on cell sensitivity to antibiotics known to bind to the ribosome and thereby inhibit protein synthesis. Constructs transcribing antisense RNA to several other genes (elaD, visC, yohH, and atpE/B), the products of which are not involved in protein synthesis were used for comparison.

First, pLex5BA (Krause et al., J. Mol. Biol. 274: 365 (1997), vectors containing antisense constructs to either rplW or to elaD were introduced into separate E. coli cell populations. Vector introduction is a technique well known to those of ordinary skill in the art. The vectors of this example contain IPTG inducible promoters that drive the transcription ofthe antisense RNA in the presence of the inducer. However, those skilled in the art will appreciate that other inducible promoters may also be used. Suitable vectors are also well known in the art. For example, a number of promoters useful for nucleic acid transcription (including the nucleic acids described herein) in Enterococcus faecalis, Staphylococcus areus as well as other Gram positive organisms are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001. Antisense clones to genes encoding different ribosomal proteins or to genes encoding proteins that are not involved in protein synthesis were utilized to test the effect of antisense transcription on cell sensitivity to the antibiotics known to bind to ribosomal proteins and inhibit protein synthesis. Antisense nucleic acids comprising a nucleotide sequence complementarty to the elaD, atpB&atpE, visC and yohH genes are referred to as AS-elaD, AS-atpB/E, AS-visC, AS-yohH respectively. These genes are not known to be involved in protein synthesis. Antisense nucleic acids to the rplL, rplL&rplJ and rplW genes are referred to as AS-rplL, AS-rplL/J, and AS-rplW respectively. These genes encode ribosomal proteins L7/L12 (rplL) L10 (rplJ) and L23 (rplW). Vectors containing these antisense nucleic acids were introduced into separate E. coli cell populations.

The cell populations containing vectors producing AS-elaD or AS-rplW were exposed to a range of IPTG concentrations in liquid medium to obtain the growth inhibitory dose curve for each clone (Figure 7). First, seed cultures were grown to a particular turbidity measured by the optical density (OD) of the growth solution. The OD of the solution is directly related to the number of bacterial cells contained therein. Subsequently, sixteen 200 μl liquid medium cultures were grown in a 96 well microtiter plate at 37° C with a range of IPTG concentrations in duplicate two-fold serial dilutions from 1600 uM to 12.5 μM (final concentration). Additionally, control cells were grown in duplicate without IPTG. These cultures were started from an inoculum of equal amounts of cells derived from the same initial seed culture of a clone of interest. The cells were grown for up to 15 hours and the extent of growth was determined by measuring the optical density of the cultures at 600 nm. When the control culture reached mid-log phase the percent growth (relative to the control culture) for each of the IPTG containing cultures was plotted against the log concentrations of IPTG to produce a growth inhibitory dose response curve for the IPTG. The concentration of IPTG that inhibits cell growth to 50% (IC₅₀) as compared to the 0 mM IPTG control (0% growth inhibition) was then calculated from the curve. Under these conditions, an amount of antisense RNA was produced that reduced the expression levels of rplW or elaD to a degree such that growth of cells containing their respective antisense vectors was inhibited by 50%>.

Alternative methods of measuring growth are also contemplated. Examples of these methods include measurements of proteins, the expression of which is engineered into the cells being tested and can readily be measured. Examples of such proteins include luciferase and various enzymes.

Cells were pretreated with the selected concentration of IPTG and then used to test the sensitivity of cell populations to tetracycline, erythromycin and other known protein synthesis inhibitors. Figure 7 is an IPTG dose response curve in E. coli transformed with an IPTG-inducible plasmid containing either an antisense clone to the E. coli rplW gene (AS-rplW) which encodes ribosomal protein L23 which is required for protein synthesis and essential for cell proliferation, or an antisense clone to the elaD (AS-elaD) gene which is not known to be involved in protein synthesis.

An example of a tetracycline dose response curve is shown in Figures 8A and 13B for the rplW and elaD genes, respectively. Cells were grown to log phase and then diluted into medium alone or medium containing IPTG at concentrations which give 20% and 50% growth inhibition as determined by IPTG dose response curves. After 2.5 hours, the cells were diluted to a final OD₆₀₀ of 0.002 into 96 well plates containing (1) +/- IPTG at the same concentrations used for the 2.5 hour pre-incubation; and (2) serial two-fold dilutions of tetracycline such that the final concentrations of tetracycline range from 1 μg/ml to 15.6 ng/ml and 0 μg/ml. The 96 well plates were incubated at 37°C and the OD₆₀₀ was read by a plate reader every 5 minutes for up to 15 hours. For each IPTG concentration and the no IPTG control, tetracycline dose response curves were determined when the control (absence of tetracycline) reached 0.1 OD₆₀o.

To compare tetracycline sensitivity with and without IPTG, tetracycline IC_50s were determined from the dose response curves (Figures 8A-B). Cells transcribing antisense nucleic acids AS-rplL or AS-rplW to genes encoding ribosomal proteins L7 L12 and L23 respectively showed increased sensitivity to tetracycline (Figure 8A) as compared to cells with reduced levels of the elaD gene product (AS-elaD) (Figure 8B). Figure 9 shows a summary bar chart in which the ratios of tetracycline IC_50s determined in the presence of IPTG which gives 50% growth inhibition versus tetracycline IC_50s determined without IPTG (fold increase in tetracycline sensitivity) were plotted. Cells with reduced levels of either L7/L12 (encoded by genes rplL, rplJ) or L23 (encoded by the rplW gene) showed increased sensitivity to tetracycline (Figure 9). Cells expressing antisense to genes not known to be involved in protein synthesis (AS-atpB/E, AS-visC, AS-elaD, AS-yohH) did not show the same increased sensitivity to tetracycline, validating the specificity of this assay (Figure 9).

In addition to the above, it has been observed in initial experiments that clones transcribing antisense RNA to genes involved in protein synthesis (including genes encoding ribosomal proteins L7/L12 & L10, L7/L12 alone, L22, and L18, as well as genes encoding rRNA and Elongation Factor G) have increased sensitivity to the macrolide, erythromycin, whereas clones transcribing antisense to the non-protein synthesis genes elaD, atpB/E and vis C do not. Furthermore, the clone transcribing antisense to rplL and rplJ (AS-rplL/J) does not show increased sensitivity to nalidixic acid and ofloxacin, antibiotics which do not inhibit protein synthesis. The results with the ribosomal protein genes rplL, rplJ, and rplW as well as the initial results using various other antisense clones and antibiotics show that limiting the concentration of an antibiotic target makes cells more sensitive to the antimicrobial agents that specifically interact with that protein. The results also show that these cells are sensitized to antimicrobial agents that inhibit the overall function in which the protein target is involved but are not sensitized to antimicrobial agents that inhibit other functions. It will be appreciated that the cell-based assays described above may be implemented using the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis antisense nucleotide sequences which inhibit the activity of genes required for proliferation described herein (including the antisense nucleic acids of SEQ ID NOs.: 1-6213) or antisense nucleic acids comprising nucleotide sequences which are complementary to the sequences of SEQ ID NOs.: 6214-42397 or portions thereof. It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous polypeptides may be reduced.

In some embodiments ofthe present invention, the methods for the production of stabilized RNA, as described in U.S. Provisional Patent Application Serial Number 60/343,512, can be used in the above cell-based assays in Gram-negative organisms to extend the lifetime of transcripts corresponding to the nucleic acids described herein.

The cell-based assay described above may also be used to identify the biological pathway in which a proliferation-required nucleic acid or its gene product lies. In such methods, cells transcribing a sub-lethal level of antisense to a target proliferation-required nucleic acid and confrol cells in which transcription of the antisense has not been induced are contacted with a panel of antibiotics known to act in various pathways. If the antibiotic acts in the pathway in which the target proliferation-required nucleic acid or its gene product lies, cells in which transcription of the antisense has been induced will be more sensitive to the antibiotic than cells in which expression of the antisense has not been induced. As a control, the results of the assay may be confirmed by contacting a panel of cells transcribing antisense nucleic acids to many different proliferation-required genes including the target proliferation-required gene. If the antibiotic is acting specifically, heightened sensitivity to the antibiotic will be observed only in the cells transcribing antisense to a target proliferation- required gene (or cells expressing antisense to other proliferation-required genes in the same pathway as the target proliferation-required gene) but will not be observed generally in all cells expressing antisense to proliferation-required genes.

It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids complementary to SEQ ID NOs: 6214-42397, or the antisense nucleic acids of SEQ ID NOs.: 1-6213) or portions thereof, antisense nucleic acids comprising nucleotide sequences complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581), or homologous polypeptides may be reduced.

Similarly, the above method may be used to determine the pathway on which a test compound, such as a test antibiotic acts. A panel of cells, each of which transcribes an antisense to a proliferation-required nucleic acid in a known pathway, is contacted with a compound for which it is desired to determine the pathway on which it acts. The sensitivity ofthe panel of cells to the test compound is determined in cells in which transcription of the antisense has been induced and in control cells in which expression of the antisense has not been induced. If the test compound acts on the pathway on which an antisense nucleic acid acts, cells in which expression of the antisense has been induced will be more sensitive to the compound than cells in which expression of the antisense has not been induced. In addition, control cells in which expression of antisense to proliferation-required genes in other pathways has been induced will not exhibit heightened sensitivity to the compound. In this way, the pathway on which the test compound acts may be determined.

It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids comprising nucleotide sequences complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids complementary to SEQ ID NOs: 6214-42397, such as the antisense nucleic acids of SEQ ID NOs.: 1-6213) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids In this way, the level or activity of a target, such as any of the proliferation- required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581) or homologous polypeptides may be reduced.

In some embodiments of the present invention, the methods for the production of stabilized RNA, as described in U.S. Provisional Patent Application Serial Number 60/343,512, can be used in the above cell-based assays in Gram-negative organisms to extend the lifetime of transcripts corresponding to the nucleic acids described herein.

The Example below provides one method for performing such assays.

EXAMPLE 18 Identification ofthe Pathway in which a Proliferation-Required

Gene Lies or the Pathway on which an Antibiotic Acts A. Preparation of Bacterial Stocks for Assay To provide a consistent source of cells to screen, frozen stocks of host bacteria containing the desired antisense construct are prepared using standard microbiological techniques. For example, a single clone of the microorganism can be isolated by streaking out a sample of the original stock onto an agar plate containing nutrients for cell growth and an antibiotic for which the antisense construct contains a selectable marker which confers resistance. After overnight growth an isolated colony is picked from the plate with a sterile needle and transferred to an appropriate liquid growth medium containing the antibiotic required for maintenance ofthe plasmid. The cells are incubated at 30°C to 37°C with vigorous shaking for 4 to 6 hours to yield a culture in exponential growth. Sterile glycerol is added to 15% (volume to volume) and lOOμL to 500 μL aliquots are distributed into sterile cryotubes, snap frozen in liquid nitrogen, and stored at -80°C for future assays. B. Growth of Bacteria for Use in the Assay

A day prior to an assay, a stock vial is removed from the freezer, rapidly thawed (37°C water bath) and a loop of culture is streaked out on an agar plate containing nutrients for cell growth and an antibiotic to which the selectable marker of the antisense construct confers resistance. After overnight growth at 37°C, ten randomly chosen, isolated colonies are transferred from the plate (sterile inoculum loop) to a sterile tube containing 5 mL of LB medium containing the antibiotic to which the antisense vector confers resistance. After vigorous mixing to form a homogeneous cell suspension, the optical density ofthe suspension is measured at 600 nm (OD₆oo) and if necessary an aliquot ofthe suspension is diluted into a second tube of 5 mL, sterile, LB medium plus antibiotic to achieve an OD₆₀o ≤ 0.02 absorbance units. The culture is then incubated at 37° C for 1-2 hrs with shaking until the OD₆oo reaches OD 0.2 - 0.3. At this point the cells are ready to be used in the assay.

C. Selection of Media to be Used in Assay

Two-fold dilution series of the inducer are generated in culture media containing the appropriate antibiotic for maintenance of the antisense construct. Several media are tested side by side and three to four wells are used to evaluate the effects of the inducer at each concentration in each media. For example, LB broth, TBD broth and Muller-Hinton media may be tested with the inducer xylose at the following concentrations, 5 mM, 10 mM, 20 mM, 40 mM, 80 mM, 120 mM and 160 mM. Equal volumes of test media-inducer and cells are added to the wells of a 384 well microtiter plate and mixed. The cells are prepared as described above and diluted 1:100 in the appropriate media containing the test antibiotic immediately prior to addition to the microtiter plate wells. For a control, cells are also added to several wells of each media that do not contain inducer, for example 0 mM xylose. Cell growth is monitored continuously by incubation at 37°C in a microtiter plate reader monitoring the OD_60. of the wells over an 18-hour period. The percent inhibition of growth produced by each concentration of inducer is calculated by comparing the rates of logarithmic growth against that exhibited by cells growing in medium without inducer. The medium yielding greatest sensitivity to inducer is selected for use in the assays described below.

D. Measurement of Test Antibiotic Sensitivity in the Absence of Antisense Construct Induction

Two-fold dilution series of antibiotics of known mechanism of action are generated in the culture medium selected for further assay development that has been supplemented with the antibiotic used to maintain the construct. A panel of test antibiotics known to act on different pathways is tested side by side with three to four wells being used to evaluate the effect of a test antibiotic on cell growth at each concentration. Equal volumes of test antibiotic and cells are added to the wells of a 384 well microtiter plate and mixed. Cells are prepared as described above using the medium selected for assay development supplemented with the antibiotic required to maintain the antisense construct and are diluted 1:100 in identical medium immediately prior to addition to the microtiter plate wells. For a control, cells are also added to several wells that lack antibiotic, but contain the solvent used to dissolve the antibiotics. Cell growth is monitored continuously by incubation at 37°C in a microtiter plate reader monitoring the OD₆oo of the wells over an 18-hour period. The percent inhibition of growth produced by each concentration of antibiotic is calculated by comparing the rates of logarithmic growth against that exhibited by cells growing in medium without antibiotic. A plot of percent inhibition against log[antibiotic concentration] allows extrapolation of an IC₅₀ value for each antibiotic.

E. Measurement of Test Antibiotic Sensitivity in the Presence of Antisense Construct Inducer

The culture medium selected for use in the assay is supplemented with inducer at concentrations shown to inhibit cell growth by 50% and 80% as described above, as well as the antibiotic used to maintain the construct. Two-fold dilution series of the panel of test antibiotics used above are generated in each of these media. Several antibiotics are tested side by side in each medium with three to four wells being used to evaluate the effects of an antibiotic on cell growth at each concentration. Equal volumes of test antibiotic and cells are added to the wells of a 384 well microtiter plate and mixed. Cells are prepared as described above using the medium selected for use in the assay supplemented with the antibiotic required to maintain the antisense construct. The cells are diluted 1:100 into two 50 mL aliquots of identical medium containing concentrations of inducer that have been shown to inhibit cell growth by 50% and 80 % respectively and incubated at 37°C with shaking for 2.5 hours. Immediately prior to addition to the microtiter plate wells, the cultures are adjusted to an appropriate OD₆₀₀ (typically 0.002) by dilution into warm (37°C) sterile medium supplemented with identical concentrations of the inducer and antibiotic used to maintain the antisense construct. For a control, cells are also added to several wells that contain solvent used to dissolve test antibiotics but which contain no antibiotic. Cell growth is monitored continuously by incubation at 37°C in a microtiter plate reader monitoring the OD₆₀_ of the wells over an 18-hour period. The percent inhibition of growth produced by each concentration of antibiotic is calculated by comparing the rates of logarithmic growth against that exhibited by cells growing in medium without antibiotic. A plot of percent inhibition against log[antibiotic concentration] allows extrapolation of an IC₅₀ value for each antibiotic. F. Determining the Specificity ofthe Test Antibiotics

A comparison of the IC₅₀s generated by antibiotics of known mechanism of action under antisense induced and non-induced conditions allows the pathway in which a proliferation-required nucleic acid lies to be identified. If cells expressing an antisense nucleic acid comprising a nucleotide sequence complementary to a proliferation-required gene are selectively sensitive to an antibiotic acting via a particular pathway, then the gene against which the antisense acts is involved in the pathway on which the antibiotic acts. G. Identification of Pathway in which a Test Antibiotic Acts

As discussed above, the cell-based assay may also be used to determine the pathway against which a test antibiotic acts. In such an analysis, the pathways against which each member of a panel of antisense nucleic acids acts are identified as described above. A panel of cells, each containing an inducible vector which transcribes an antisense nucleic acid comprising a nucleotide sequence complementary to a gene in a known proliferation-required pathway, is contacted with a test antibiotic for which it is desired to determine the pathway on which it acts under inducing and non-inducing conditions. If heightened sensitivity is observed in induced cells transcribing antisense complementary to a gene in a particular pathway but not in induced cells transcribing antisense nucleic acids comprising nucleotide sequences complementary to genes in other pathways, then the test antibiotic acts against the pathway for which heightened sensitivity was observed.

One skilled in the art will appreciate that further optimization of the assay conditions, such as the concentration of inducer used to induce antisense transcription and/or the growth conditions used for the assay (for example incubation temperature and medium components) may further increase the selectivity and/or magnitude ofthe antibiotic sensitization exhibited. It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids comprising nucleotide sequences complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids comprising nucleotide sequences complemenatary to SEQ ID NOs: 6214-42397, such as the antisense nucleic acids of SEQ ID NOs.: 1-6213) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581), or homologous polypeptides may be reduced. In some embodiments ofthe present invention, the methods for the production of stabilized

RNA, as described in U.S. Provisional Patent Application Serial Number 60/343,512, can be used in the above cell-based assays in Gram-negative organisms to extend the lifetime of transcripts corresponding to the nucleic acids described herein. The following example confirms the effectiveness ofthe methods described above.

EXAMPLE 19

Identification ofthe Biological Pathway in which a Proliferation-Required Gene Lies

The effectiveness ofthe above assays was validated using proliferation-required genes from E. coli which were identified using procedures similar to those described above. Antibiotics of various chemical classes and modes of action were purchased from Sigma Chemicals (St. Louis,

MO). Stock solutions were prepared by dissolving each antibiotic in an appropriate aqueous solution based on information provided by the manufacturer. The final working solution of each antibiotic contained no more than 0.2% (w/v) of any organic solvent. To determine their potency against a bacterial strain engineered for transcription of an antisense comprising a nucleotide sequence complementary to a proliferation-required 50S ribosomal protein, each antibiotic was serially diluted two- or three- fold in growth medium supplemented with the appropriate antibiotic for maintenance of the antisense construct. At least ten dilutions were prepared for each antibiotic. 25 μL aliquots of each dilution were transferred to discrete wells of a 384-well microplate (the assay plate) using a multi-channel pipette. Quadruplicate wells were used for each dilution of an antibiotic under each treatment condition (plus and minus inducer). Each assay plate contained twenty wells for cell growth controls (growth medium replacing antibiotic), ten wells for each treatment (plus and minus inducer, in this example IPTG). Assay plates were usually divided into the two treatments: half the plate containing induced cells and an appropriate concentrations of inducer (in this example IPTG) to maintain the state of induction, the other half containing non- induced cells in the absence of IPTG.

Cells for the assay were prepared as follows. Bacterial cells containing a construct, from which transcription of antisense nucleic acid comprising a nucleotide sequence complementary to rplL and rplJ (AS-rplL/J), which encode proliferation-required 50S ribosomal subunit proteins, is inducible in the presence of IPTG, were grown into exponential growth (OD₆₀o 0.2 to 0.3) and then diluted 1:100 into fresh medium containing either 400 μM or 0 μM inducer (IPTG). These cultures were incubated at 37° C for 2.5 hr. After a 2.5 hr incubation, induced and non-induced cells were respectively diluted into an assay medium at a final OD₆₀₀ value of 0.0004. The medium contained an appropriate concentration of the antibiotic for the maintenance of the antisense construct. In addition, the medium used to dilute induced cells was supplemented with 800 μM IPTG so that addition to the assay plate would result in a final IPTG concentration of 400 μM. Induced and non- induced cell suspensions were dispensed (25 μl/well) into the appropriate wells ofthe assay plate as discussed previously. The plate was then loaded into a plate reader, incubated at constant temperature, and cell growth was monitored in each well by the measurement of light scattering at 595 nm. Growth was monitored every 5 minutes until the cell culture attained a stationary growth phase. For each concentration of antibiotic, a percentage inhibition of growth was calculated at the time point corresponding to mid-exponential growth for the associated control wells (no antibiotic, plus or minus IPTG). For each antibiotii or minus IPTG), a plot of percent inhibition versus log of antibiotic concentration was generated and the IC₅₀ determined. A comparison of the IC₅₀ for each antibiotic in the presence and absence of IPTG revealed whether induction ofthe antisense construct sensitized the cell to the mechanism of action exhibited by the antibiotic. Cells which exhibited a statistically significant decrease in the IC₅₀ value in the presence of inducer were considered to have an increased sensitivity to the test antibiotic.

The results are provided in the table below, which lists the classes and names of the antibiotics used in the analysis, the targets of the antibiotics, the IC₅₀ in the absence of IPTG, the IC₅₀ in the presence of IPTG, the concentration units for the IC_50s, the fold increase in IC₅₀ in the presence of IPTG, and whether increased sensitivity was observed in the presence of IPTG.

TABLE V Effect of Expression of Antisense RNA to rplL and rpU on Antibiotic Sensitivity

Ul Ul oe

1 CCO

The above results demonstrate that induction of an antisense RNA complementary to genes encoding 50S ribosomal subunit proteins results in a selective and highly significant sensitization of cells to antibiotics that inhibit ribosomal function and protein synthesis. The above results further demonstrate that induction of an antisense to an essential gene sensitizes a cell or microorganism to compounds that interfere with that gene product's biological role. This sensitization is restricted to compounds that interfere with pathways associated with the targeted gene and its product.

It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae,

Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids complementary to SEQ ID NOs. 6214-42397, such as the antisense nucleic acids of SEQ ID NOs.: 1-6213) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581), or homologous polypeptides may be reduced.

Example 20 below describes an analysis performed in Staphylococcus aureus.

EXAMPLE 20 Identification ofthe Biological Pathway in which a Gene Required for Proliferation of Staphylococcus aureus Lies

Antibiotics of various chemical classes and modes of action were purchased from chemical suppliers, for example Sigma Chemicals (St. Louis, MO). Stock solutions were prepared by dissolving each antibiotic in an appropriate aqueous solution based on information provided by the manufacturer. The final working solution of each antibiotic contained no more than 0.2%, (w/v) of any organic solvent.

To determine its potency against a bacterial strain containing an antisense nucleic acid comprising a nucleotide sequence complementary to the nucleotide sequence encoding the Beta subunit of DNA gyrase (which is required for proliferation) under the control of a xylose inducible promoter, each antibiotic was serially diluted two- or three- fold in growth medium supplemented with the appropriate antibiotic for maintenance of the antisense construct. At least ten dilutions were prepared for each antibiotic.

Aliquots (25 μL) of each dilution were transferred to discrete wells of a 384-well microplate (the assay plate) using a multi-channel pipette. Quadruplicate wells were used for each dilution of an antibiotic under each treatment condition (plus and minus inducer). Each assay plate contained twenty wells for cell growth controls (growth medium, no antibiotic), ten wells for each treatment (plus and minus inducer, xylose, in this example). Half the assay plate contained induced cells (in this example Staphylococcus aureus cells) and appropriate concentrations of inducer ( xylose, in this example) to maintain the state of induction while the other half of the assay plate contained non-induced cells maintained in the absence of inducer. Preparation of Bacterial Cells

Cells of a bacterial clone containing a construct in which transcription of antisense comprising a nucleotide sequence complementary to the sequence encoding the Beta subunit of DNA gyrase under the control of the xylose inducible promoter (S1M10000001F08) were grown into exponential growth (OD₆₀o 0.2 to 0.3) and then diluted 1:100 into fresh medium containing either 12 mM or 0 mM inducer (xylose). These cultures were incubated at 37° C for 2.5 hr. The presence of inducer (xylose) in the medium initiates and maintains production of antisense RNA from the antisense construct. After a 2.5 hr incubation, induced and non- induced cells were respectively diluted into an assay medium containing an appropriate concentration of the antibiotic for the maintenance of the antisense construct. In addition, medium used to dilute induced cells was supplemented with 24 mM xylose so that addition to the assay plate would result in a final xylose concenfration of 12 mM. The cells were diluted to a final OD₆₀₀ value of 0.0004.

Induced and non-induced cell suspensions were dispensed (25 μl/well) into the appropriate wells of the assay plate as discussed previously. The plate was then loaded into a plate reader and incubated at constant temperature while cell growth was monitored in each well by the measurement of light scattering at 595 nm. Growth was monitored every 5 minutes until the cell culture attained a stationary growth phase. For each concentration of antibiotic, a percentage inhibition of growth was calculated at the time point corresponding to mid- exponential growth for the associated control wells (no antibiotic, plus or minus xylose). For each antibiotic and condition (plus or minus xylose), plots of percent inhibition versus Log of antibiotic concentration were generated and IC_50s determined.

A comparison of each antibiotic's IC₅₀ in the presence and absence of inducer (xylose, in this example) reveals whether induction of the antisense construct sensitized the cell to the antibiotic's mechanism of action. If the antibiotic acts against the β subunit of DNA gyrase, the

IC₅o of induced cells will be significantly lower than the IC₅₀ of uninduced cells.

Figure 10 lists the antibiotics tested, their targets, and their fold increase in potency between induced cells and uninduced cells. As illustrated in Figure 10, the potency of cefotaxime, cefoxitin, fusidic acid, lincomycin, tobramycin, frimethoprim and vancomycin, each of which act on targets other than the β subunit of gyrase, was not significantly different in induced cells as compared to uninduced cells. However, the potency of novobiocin, which is known to act against the Beta subunit of DNA gyrase, was significantly different between induced cells and uninduced cells.

Thus, induction of an antisense nucleic acid comprising a nucleotide sequence complementary to the sequence encoding the β subunit of gyrase results in a selective and significant sensitization of Staphylococcus aureus cells to an antibiotic which inhibits the activity of this protein. Furthermore, the results demonstrate that induction of an antisense construct to an essential gene sensitizes a cell or microorganism to compounds that interfere with that gene product's biological role. This sensitization is apparently restricted to compounds that interfere with the targeted gene and its product.

It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids complementary to SEQ ID NOs.: 6214-42397, such as the antisense nucleic acids of SEQ ID NOs. 1-6213), or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides . from

Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum,

Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous polypeptides may be reduced. In some embodiments of the present invention, the methods for the production of stabilized RNA, as described in U.S. Provisional Patent Application Serial Number 60/343,512, can be used in the above cell-based assays in Gram-negative organisms to extend the lifetime of transcripts corresponding to the nucleic acids described herein.

Assays utilizing antisense constructs to essential genes or portions thereof can be used to identify compounds that interfere with the activity of those gene products. Such assays could be used to identify drug leads, for example antibiotics.

Panels of cells transcribing different antisense nucleic acids can be used to characterize the point of intervention of a compound affecting an essential biochemical pathway including antibiotics with no known mechanism of action. Assays utilizing antisense constructs to essential genes can be used to identify compounds that specifically interfere with the activity of multiple targets in a pathway. Such constructs can be used to simultaneously screen a sample against multiple targets in one pathway in one reaction (Combinatorial HTS).

Furthermore, as discussed above, panels of antisense construct-containing cells may be used to characterize the point of intervention of any compound affecting an essential biological pathway including antibiotics with no known mechanism of action.

It will be appreciated that the above cell-based assays may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including antisense nucleic acids comprising nucleotide sequences complementary to SEQ ID NOs.: 6214-42397, such as the antisense nucleic acids of SEQ ID NOs. 1-6213), or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis,

Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous polypeptides may be reduced.

Another embodiment of the present invention is a method for determining the pathway against which a test antibiotic compound is active, in which the activity of target proteins or nucleic acids involved in proliferation-required pathways is reduced by contacting cells with a sub-lethal concentration of a known antibiotic which acts against the target protein or nucleic acid. In one embodiment, the target protein or nucleic acid corresponds to a proliferation- required nucleic acid identified using the methods described above, such as the polypeptides of SEQ ID NOs.: 42398-78581, or homologous polypeptides. The method is similar to those described above for determining which pathway a test antibiotic acts against, except that rather than reducing the activity or level of a proliferation-required gene product using a sub-lethal level of antisense to a proliferation-required nucleic acid, the sensitized cell is generated by reducing the activity or level of the proliferation-required gene product using a sub-lethal level of a known antibiotic which acts against the proliferation required gene product. Heightened sensitivity determines the pathway on which the test compound is active.

Interactions between drugs which affect the same biological pathway have been described in the literature. For example, Mecillinam (Amdinocillin) binds to and inactivates the penicillin binding protein 2 (PBP2, product of the rnrdA in E. coli). This antibiotic interacts with other antibiotics that inhibit PBP2 as well as antibiotics that inhibit other penicillin binding proteins such as PBP3 [(Gutmann, L., Vincent, S., Billot-Klein, D., Acar, J.F., Mrena, E., and Williamson, R. (1986) Involvement of penicillin-binding protein 2 with other penicillin-binding proteins in lysis of Escherichia coli by some beta-lactam antibiotics alone and in synergistic lytic effect of amdinocillin (mecillinam). Antimicrobial Agents & Chemotherapy, 30:906-912). Interactions between drugs could, therefore, involve two drugs that inhibit the same target protein or nucleic acid or inhibit different proteins or nucleic acids in the same pathway [(Fukuoka, T., Domon, H., Kakuta, M., Ishii, C, Hirasawa, A., Utsui, Y., Ohya, S., and Yasuda, H. (1997) Combination effect between panipenem and vancomycin on highly methicillin- resistant Staphylococcus aureus. Japan. J. Antibio. 50:411-419; Smith, C.E., Foleno, B.E., Barrett, J.F., and Frosc, M.B. (1997) Assessment of the synergistic interactions of levofioxacin and ampicillin against Enterococcus faecium by the checkerboard agar dilution and time-kill methods. Diagnos. Microbiol. Infect. Disease 27:85-92; den Hollander, J.G., Horrevorts, A.M., van Goor, M.L., Verbrugh, H.A., and Mouton, J.W. (1997) Synergism between tobramycin and ceftazidime against a resistant Pseudomonas aeruginosa strain, tested in an in vitro pharmacokinetic model. Antimicrobial Agents & Chemotherapy. 41:95-110).

Two drugs may interact even though they inhibit different targets. For example, the proton pump inhibitor, Omeprazole, and the antibiotic, Amoxycillin, two synergistic compounds acting together, can cure Helicobacter pylori infection [( Gabryelewicz, A.,

Laszewicz, W., Dzieniszewski, J., Ciok, J., Marlicz, K., Bielecki, D., Popiela, T., Legutko, J., Rnapik, Z., Poniewierka, E. (1997) Multicenter evaluation of dual-therapy (omeprazol and amoxycillin) for Helicobacter _jpy/oπ-associated duodenal and gastric ulcer (two years of the observation). J. Physiol. Pharmacol. 48 Suppl 4:93-105). The growth inhibition from the sub-lethal concentration of the known antibiotic may be at least about 5%, at least about 8%, at least about 10%, at least about 20%, at least about 30%, at least about 40%,, at least about 50%,, at least about 60%, or at least about 75%, or more.

Alternatively, the sub-lethal concentration of the known antibiotic may be determined by measuring the activity of the target proliferation-required gene product rather than by measuring growth inhibition. Cells are contacted with a combination of each member of a panel of known antibiotics at a sub-lethal level and varying concentrations of the test antibiotic. As a control, the cells are contacted with varying concentrations of the test antibiotic alone. The IC_Ϊ0 ofthe test antibiotic in the presence and absence of the known antibiotic is determined. If the IC₅₀s in the presence and absence of the known drug are substantially similar, then the test drug and the known drug act on different pathways. If the IC₅₀s are substantially different, then the test drug and the known drug act on the same pathway.

It will be appreciated that the above cell-based assays may be performed using a sublethal concenfration of a known antibiotic which acts against the product of any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus,

Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae,

Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the products of SEQ ID NOs: 6214-42397, or portions thereof, or the products of homologous coding nucleic acids or portions thereof . In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis (including the polypeptides of SEQ ID NOs.: 42398-78581), or homologous polypeptides may be reduced.

Another embodiment of the present invention is a method for identifying a candidate compound for use as an antibiotic in which the activity of target proteins or nucleic acids involved in proliferation-required pathways is reduced by contacting cells with a sub-lethal concentration of a known antibiotic which acts against the target protein or nucleic acid. In one embodiment, the target protein or nucleic acid is a target protein or nucleic acid corresponding to a proliferation-required nucleic acid identified using the methods described above. The method is similar to those described previously herein for identifying candidate compounds for use as antibiotics except that rather than reducing the activity or level of a proliferation-required gene product using a sub-lethal level of antisense to a proliferation-required nucleic acid, the activity or level ofthe proliferation-required gene product is reduced using a sub-lethal level of a known antibiotic which acts against the proliferation required gene product.

The growth inhibition from the sub-lethal concenfration ofthe known antibiotic may be at least about 5%, at least about 8%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or at least about 75%, or more. Alternatively, the sub-lethal concentration of the known antibiotic may be determined by measuring the activity of the target proliferation-required gene product rather than by measuring growth inhibition.

In order to characterize test compounds of interest, cells are contacted with a panel of known antibiotics at a sub-lethal level and one or more concentrations ofthe test compound. As a control, the cells are contacted with the same concentrations ofthe test compound alone. The

IC₅₀ ofthe test compound in the presence and absence ofthe known antibiotic is determined. If the IC₅0 ofthe test compound is substantially different in the presence and absence ofthe known drug then the test compound is a good candidate for use as an antibiotic. As discussed above, once a candidate compound is identified using the above methods its structure may be optimized using standard techniques such as combinatorial chemistry.

Representative known antibiotics which may be used in each of the above methods are provided in Table VI below. However, it will be appreciated that other antibiotics may also be used. TABLE VI Antibiotics and Their Targets

ANTIBIOTIC INHIBITS/TARGET RESISTANT

MUTANTS

Inhibitors of Transcription

Rifamycin, Rifampicin Inhibits initiation of transcription/ β- rpoB, crp, cyaA

Rifabutin Rifaximin subunit RNA polymerase, rpoB

Streptolydigin Accelerates transcription chain rpoB termination/β-subunit RNA polymerase

Streptovaricin an acyclic ansamycin, inhibits RNA rpoB polymerase

Actinomycin D+EDTA Intercalates between 2 successive G-C pldA pairs, rpoB, inhibits RNA synthesis

Inhibitors of Nucleic Acid Metabolism

Quinolones, α subunit gyrase and/or topoisomerase

Nalidixic acid Oxolinic TV, gyrA gyrAorB, icd, sloB acid

Fluoroquinolones a subunit gyrase, gyrA and/or gyrA

Ciprofloxacin, topoisomerase IV (probable target in nor A (efflux in

Norfloxacin Staph) Staph) hipQ

Coumerins Inhibits ATPase activity of β-subunit

Novobiocin gyrase, gyrB gyrB, cysB, cysE, nov, ompA

Coumermycin Inhibits ATPase activity of β-subunit gyrB, hisW gyrase, gyrB

Albicidin DNA synthesis tsx (nucleoside channel)

Metronidazole Causes single-strand breaks in DNA nar

Inhibitors of Metabolic Pathways

Sulfonamides, blocks synthesis of folP, gpt, pabA,

Sulfanilamide dihydrofolate,dihydro-pteroate pabB, pabC synthesis, /P

Trimethoprim, Inhibits dihydrofolate reductase, folA folA, thy A

Showdomycin Nucleoside analogue capable of nupC, pnp alkylating sulfhydryl groups, inhibitor of thymidylate synthetase

Thiolactomycin type II fatty acid synthase inhibitor emrB fadB, emrB due to gene dosage

Psicofuranine Adenosine glycoside antibiotic, target is guaA.B GMP synthetase

Triclosan Inhibits fatty acid synthesis fabl (envM)

Diazoborines Isoniazid, heterocyclic, contain boron, inhibit fatty fabl (envM)

Ethionamide acid synthesis, enoyl-ACP reductase, fabl Inhibitors of Translation

Phenylpropanoids Binds to ribosomal peptidyl transfer Chloramphenicol, center preventing peptide translocation/ rrn, cmlA, marA, binds to S6, L3, L6, L14, L16, L25, ompF, ompR

L26, L27, but preferentially to L16

Tetracyclines, type II Binding to 30S ribosomal subunit, "A" sil clmA (cmr), mar, polyketides on 30S subunit, blocks peptide ompF

Minocycline elongation, strongest binding to S7

Doxycycline Macrolides (type I Binding to 50 S ribosomal subunit, 23 S polyketides) rRNA, blocks peptide translocation,

Erythromycin, L15, L4, L12 rrn, rplC, rplD, rplV , Carbomycin, mac

Spiramycin etc

Aminoglycosides Irreversible binding to 30S ribosomal Streptomycin, subunit, prevents franslation or causes rpsL, strC,M, ubiF mistranslation of mRNA/16S rRNA atpA-E, ecfB,

Neomycin hemAC,D,E,G, topA, rpsC,D,E, rrn, spcB

Spectinomycin atpA-atpE, cpxA, Kanamycin ecfB, hemA,B,L, topA ksgA,B,C,D, rplB.K,

Kasugamycin rpsI,N,M,R ι_>w, u i

Gentamicin, cpxA

Amikacin rpsL

Paromycin

Lincosamides Binding to 50 S ribosomal subunit,

Lincomycin, blocks peptide translocation linB, rplN.i

Clindamycin

Sfreptogramins 2 components, Sfreptogramins A&B,

Virginiamycin, bind to the 50S ribosomal subunit

Pristinamycin blocking peptide translocation and

Synercid: quinupristin peptide bond formation

/dalfopristin

Fusidanes Inhibition of elongation factor G (EF-G) fusA

Fusidic Acid prevents peptide translocation

Kirromycin (Mocimycin) Inhibition of elongation factor TU (EF- tufA,B Tu), prevents peptide bond formation

Pulvomycin Binds to and inhibits EF-TU

Thiopeptin Sulfur-containing antibiotic, inhibits rplE protein synthesis,EF-G

Tiamulin Inhibits protein synthesis rplC, rplD

Negamycin Inhibits termination process of protein prβ synthesis

Oxazolidinones Linezolid 23S rRNA

Isoniazid pdx

Nifrofurantoin Inhibits protein synthesis, nfnA.B nitroreductases convert nifrofurantoin to highly reactive electrophilic intermediates which attack bacterial ribosomal proteins non-specifically

Pseudomonic Acids Inhibition of isoleucyl tRNA ileS Mupirocin (Bactroban) synthetase-used for Staph, topical cream, nasal spray

Indolmycin Inhibits tryptophanyl-tRNA synthetase trpS Viomycin rrmA (23 S rRNA methyltransferase; mutant has slow growth rate, slow chain elongation rate, and viomycin resistance)

Thiopeptides Binds to Ll 1-23S RNA complex

Thiostrepton Inhibits GTP hydrolysis by EF-G Stimulates GTP hydrolysis by EF-G

Micrococcin

Inhibitors of Cell Walls/Membranes β-lactams Inhibition of one or more cell wall

Penicillin, Ampicillin transpeptidases, endopeptidases, and glycosidases (PBPs), ofthe 12 PBPs ampC, ampD, ampE,

Methicillin, only 2 are essential: mrdA (PBP2) and envZ, galU, hipA, ftsI(pbpB, PBP3) hipQ, ompC, ompF, ompR, ptsl, rfa, tolD, tolE

Cephalosporins, tonB

Binds to and inactivates PBP2 (mrdA) alaS, argS, crp, cyaA, Mecillinam (amdinocillin) Inactivates PBP3 (ftsT) envB, mrdA.B, mreB,C,D

Aztreonam (Furazlocillin) Bacilysin, Tetaine Dipeptide, inhib glucosamine dppA synthase

Glycopeptides Vancomycin, Inhib G+ cell wall syn, binds to terminal D-ala-D-ala of pentapeptide,

Polypeptides Bacitracin Prevents dephosphorylation and regeneration of lipid carrier rfa

Cyclic lipopeptide Disrupts multiple aspects of Daptomycin, membrane function, including peptidoglycan synthesis, lipoteichoic acid synthesis, and the bacterial membrane potential

Cyclic polypeptides Surfactant action disrupts cell prnrA Polymixin, membrane lipids, binds lipid A ioety of LPS

Fosfomycin, Analogue of P-enolpyruvate, inhibits rnurA, crp, cyaA 1^st step in peptidoglycan synthesis - glpT, hipA, ptsl, UDP-N-acetylglucosamine uhpT enolpyruvyl transferase, murA. Also acts as Immunosuppressant Cycloserine Prevents formation of D-ala dimer, hipA, cycA inhibits D-ala ligase, ddlA,B Alafosfalin phosphonodipeptide, cell wall pepA, tpp synthesis inhibitor, potentiator of β- lactams

Inhibitors of Protein Processing/Transport

Globomycin Inhibits signal peptidase II (cleaves Ipp, dnaE prolipoproteins subsequent to lipid modification, IspA It will be appreciated that the above cell-based assays may be performed using a sublethal concentration of a known antibiotic which acts against the product of any of the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes,

Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or portions thereof, or homologous nucleic acids. In this way, the level or activity of a target, such as any of the proliferation-required polypeptides from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous polypeptides may be reduced.

EXAMPLE 21 Strains in which a Gene Encoding a Gene Product Required for Proliferation is Overexpressed are able to Grow at Elevated Antibiotic Concentrations To confirm that cells which overexpress a gene product required for proliferation are able to grow at elevated antibiotic concentrations, 11 such genes from Staphylococcus aureus which are the targets of known antibiotics were operably linked to the xylose inducible promoter XylT5 (described in U.S. Patent Application Serial Number 10/032,393. The genes and the antibiotics which target the products of these genes are listed in Table VII below.

PCR primer pairs were designed for each of the 11 genes encoding a gene product required for proliferation of Staphylococcus aureus as shown in Table VII. The upsfream primers for each gene included the native ribosomal binding sites (S-D sequences). In addition, restriction sites for appropriate restriction enzymes were designed into the primers to facilitate directional cloning of the genes. PCR reactions were carried out using Pfu DNA polymerase (Stratagene, San Diego) under the following conditions per 50 μl reaction: Pfu polymerase 2U, dNTP 200 μM, primers 400 nM each, S. aureus RN450 genomic DNA (template) 5-10 ng. The reaction involved an initial heating at 94°C for 5 min, followed by 25 cycles of 30 sec at 94°C/30 sec at 55°C/5 min at 72°C, and ending with 7 min of extension at 72°C.

The amplified genes were operably linked to the XylT5 promoter as follows. PCR products were cleaned using QIAGEN PCR Cleaning Kits and then were digested with the proper restriction enzymes. The resulting fragments were ligated overnight at 16°C with precut vector DNA containing the XylT5 promoter. Ligation mixtures were ethanol precipitated at - 80°C for 20 min in the presence of 0.3 M sodium acetate. The precipitated DNA was spun down at 14,000 rpm for 30 min at 4°C and washed with 1 ml of 70% EtoH. The DNA pellets were air-dried and dissolved in EB or sterile water. To transform Staphylococcus aureus cells, the precipitated DNA was mixed with 45 μl of electroporation competent cells and incubated at room temperature for 30 min. The DNA/cell mixtures were elecfroporated (settings: 2 volts, 25 μF, 200 Ω) in 2 mm cuvettes and mixed with 450 μl B2 medium containing 0.2 μg/ml chloramphenicol. The cells were incubated at 37°C with shaking for 90 min. Transformed cells were plated onto LB agar plates containing chloramphenicol (34 μg/ml) for the selection of plasmids. Several colonies for each cloning reaction were picked and streaked to obtain a pure culture. Colony PCR reactions using vector-specific primers were performed to verify the size and identity ofthe inserts.

Gene-walking sequencing was employed to completely sequence the entire insert for several clones of each cloned gene. This was carried out to avoid using a cloned gene whose DNA sequence was mutated during the PCR process.

To demonstrate that genes encoding gene products required for proliferation can confer resistance to their specific inhibitors upon induction at proper inducer levels, cells of each clone in which the genes were operably linked to the xylose inducible promoter were grown in LB medium with chloramphenicol (34 μg/ml) at a combination of differing antibiotic and inducer concentrations. This was accomplished by using microtitration plates (96 or 384 wells) which contained antibiotic and inducer at gradient concentrations in a matrix format in 10 times excess quantity (see Figure 11). Media containing inoculated cells (9 volume) was dispensed into the wells containing 1 volume of antibiotic/inducer for a final volume of 50 μl (for 384 well plates) or 200 μl (for 96 well plates). The plates were incubated at 37°C with periodic shaking and growth of cells was monitored by automatic measurement of optical density at OD600 using a

Ulframark reader. A clone over-expressing a particular gene was considered resistant to its specific antibiotic (inhibitor) if significant growth was observed at appropriate inducer concentrations in the presence of a particular concenfration of antibiotic but not in the absence of inducer at that concentration of antibiotic. The results are indicated in Figure 12 and Figure 13. As illustrated in Figure 12, at appropriate concentrations of inducer cells which overexpress the defB gene product were able to grow at elevated concentrations of the antibiotic actinonin, which acts on the defB gene product. Similarly, as illustrated in Figure 13, at appropriate concentrations of inducer cells which overexpress the folA gene product were able to grow at elevated concentrations of the antibiotic frimethoprim, which acts on the folA gene product.

Thus, elevated expression of a gene product required for proliferation enables cells to grow in the presence of antibiotic concentrations which inhibit or prevent growth of wild type cells. Table VH - Essential Genes/Proteins and Specific Inhibitors

Ul -4

antibiotics unavailable commercially

Ul -4 Ul

EXAMPLE 22

Overexpression of Genes Encoding Gene Products Required for Proliferation Confers Specific Resistance to Antibiotics which Target the Overexpressed Gene Product To demonstrate that cells which overexpress a gene encoding a gene product required for proliferation are specifically resistant to antibiotics which target that gene product, the following experiments were performed. Several identical compound plates were prepared as described above in which different antibiotics were present in different wells. Media containing cells overexpressing different genes were separately dispensed into each one of these plates. Plate incubation and growth measurement were the same as described in Example 21 above. Growth was deemed specific if cells overexpressing one particular gene only gained resistance to antibiotics which target the product of the overexpressed gene but not to other antibiotics which target the products of genes which were not overexpressed.

As indicated in Figure 14 overexpression of the fabl gene conferred resistance to triclosan, which acts on the gene product of ihe fabl gene, enoyl-acyl carrier protein reductase. However, overexpression of the fabl gene did not confer resistance to cerulenin, trimethoprim, or actinonin, each of which act on other gene products.

Similarly, as indicated in Figure 15 overexpression of the folA gene conferred resistance to trimethoprim, which acts on the gene product of the folA gene, dihydrofolate reductase. However, overexpression of the folA gene did not confer resistance to triclosan, cerulenin, or actinonin, each of which act on other gene products.

As indicated in Figure 16 overexpression of the defB gene conferred resistance to actinonin, which acts on the gene product of the defB gene, peptide deformylase. However, overexpression of the defB gene did not confer resistance to cerulenin, trimethoprim, or triclosan, each of which act on other gene products. As indicated in Figure 17 overexpression of the fabF gene conferred resistance to cerulenin, which acts on the gene product of the fabF gene, β keto-acyl carrier protein synthase II. However, overexpression of the fabF gene did not confer resistance to triclosan, trimethoprim, or actinonin, each of which act on other gene products.

Thus, overexpression of a gene encoding a gene product required for proliferation confers specific resistance to antibiotics which target the overexpressed gene product.

EXAMPLE 23 Selection of a Sfrain Overexpressing a Gene Encoding a Target Gene Product from a Mixture of Strains Overexpressing Genes Required for Proliferation To confirm that a strain expressing the gene product targeted by an antibiotic can be selected from a mixture of strains which each overexpress a different gene required for proliferation, the following experiment was performed. S. aureus sfrains overexpressing one of nine genes encoding a gene product required for proliferation were constructed as described above. The nine overexpressed genes were fabF, defB, folA, fabl, ileS.fusA, gyrB, murA, rpoB. A mixture ofthe nine strains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or trimethoprim to inhibit the growth of sfrains which do not overexpress the targets of these antibiotics.

Growth was observed in wells containing appropriate inducer concentrations and each one of the four antibiotics (See Figure 18). The cultures which grew in the presence of one of the antibiotics were analyzed as follows. The cultures were removed from the wells ofthe plate and single colonies were obtained by plating serial dilutions LB agar plates containing an appropriate antibiotic. Plasmids were isolated from at least 60 individual colonies for each culture and the genes which conferred antibiotic resistance were amplified by performing PCR reactions using vector-specific primers. The PCR products were then sequenced. All of the plasmids obtained from the culture which grew in the presence of cerulenin contained the fabF sequence. Similarly, all ofthe plasmids obtained from clones which grew in the presence of triclosan contained the fabl gene. All of the plasmid obtained from colonies which grew in the presence of actinonin contained the defB gene. In addition, 81% of the plasmids obtained from colonies which grew in the presence of trimethoprim contained the folA gene. Growth conditions could be further optimized to provide 100% recovery of plasmids containing the folA gene.

These results demonstrate that a sfrain expressing the gene product targeted by an antibiotic can be selected from a mixture of strains which each overexpress a different gene required for proliferation. EXAMPLE 24

Identification of Amplification Products Having Distinguishable Lengths The following genes were identified as being required for proliferation as previously described in U.S. Patent Application Serial Number 09/815,242, filed march 21, 2001. Plasmids in which antisense nucleic acids complementary to nucleotide sequences the essential pbpC, secA, ylaO(Bs), yphC(Bs),trpS, polC, fabl, rpsR (Bs), fabF(yjaY), ileS, murC, fmhB, murA (Bs), murF(Bs), ftsZ, tufA, gyrA, rpoB, grlA orfolA(dfrA) genes were franscribed from the XylT5 promoter in Staphylococcus aureus.

Amplification primers were designed which would yield amplification products of the following lengths if the plasmid encoding the corresponding antisense nucleic acid is present in a mixture of nucleic acids: yphC 260bp secA 267bp folA 230 bp tufA 243bp fabl 220bp gyrA 225bp trpS 208bp ileS 215bp fabF 189bp murF 203bp murA 176bp fmhB 181bp rpoB 159bp ylaO 169bp grlA 151bp pbpC 156bp murC 129bp polC 145bp rpsR 109bp ftsZ 117bp

The 5' primer of each pair was complementary to a nucleotide sequence within the xylT5 promoter while 3' primer was complementary to a nucleotide sequence within the antisense clone. The 5' primer of each pair was identical for each amplification reaction. The nucleotide sequence GTTTCTT was appended on the 5' end of the 3' primers. One primer in each pair was labeled with either VIC or 6FAM.

Two sets of ten plasmids containing the antisense nucleic acids complementary to the genes listed in each of the columns above were mixed in equal amounts in 11 tubes except that either the plasmid encoding antisense nucleic acids complementary to a nucleotide sequence in the grlA gene or the plasmid encoding antisense nucleic acids complementary to nucleotide sequences in ihe fmhB gene were serially diluted two fold in each of the 11 tubes (i.e. the first tube had lOOpg of the grlA plasmid or the fmhB plasmid while the last tube had 0.1 Opg of the grlA plasmid or the fmhB plasmid). Amplification reactions were conducted on the mixtures and the amplification products were separated on a 5% NuSieve 3:1 agarose gel (BioWhittaker Molecular Applications Rocldand, ME). The levels ofthe 151bp or 181 amplification products for the grlA or fmhB primer respectively were specifically reduced in a stepwise fashion with increasing dilutions while the levels of the undiluted products remained constant. The assay readily detected a 10-fold decrease in template concentration reflected in the amplification products corresponding to the grlA or fmhB plasmids.

Although this method has been described using examples of antisense nucleic acids to specific essential genes, it will be appreciated that this method can be used with any of the antisense nucleic acids described herein, such as an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, an antisense nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a nucleic acid complementary to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid complementary to a nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid complementary to a nucleic acid which encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID

NOs.: 42398-78581, a nucleic acid complementary to a nucleic acid which encodes at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a homologous antisense nucleic acid, an antisense nucleic acid comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a homologous nucleic acid, a nucleic acid complementary to a homologous coding nucleic acid, a nucleic acid complementary to at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of a homologous coding nucleic acid, a nucleic acid complementary to a nucleic acid which encodes a homologous polypeptide, or a nucleic acid complementary to a nucleic acid which encodes at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a homologous polypeptide. It will also be appreciated that promoters other than XlyT5 can be used to express the gene products described herein. For example, a number of promoters useful for nucleic acid expression (including antisense nucleic acid expression) in Enterococcus faecalis, Staphylococcus areus as well as other Gram positive organisms are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001.

Additionally, the above methods can be used with any organism including Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis,

Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any ofthe above species.

EXAMPLE 25 Selective Disappearance of Amplification Products Corresponding to Strains Underexpressing a

Gene Product on which a Compound which Inhibits Proliferation Acts

Strains of Staphylococcus aureus containing plasmids encoding antisense nucleic acids complementary to nucleotide sequences within the yphC, folA, fabl, trpS, fabF, murA, rpoB, grlA, murC or rpsR genes (described in Example 24 above) were mixed together in identical cultures such that the number of cells of each strain in the culture was identical. Each of the cultures containing the ten strains was contacted with one of the following antibiotics at one of the following concentrations: spectinomycin- 2.5, 5.0ug/ml mupriocin- 4.3, 8.6, 17.2ug/ml. cerulenin- 4.5, 9.0, 18.0ug/ml

Spectinomycin acts on the product of the rpsR gene, mupriocin acts on the product of the ileS gene and cerulenin acts on the product ofthe FabF gene. The middle concentration for each antibiotic is its IC50.

The culture containing the ten strains were grown in rich medium (L-Broth; for antisense LB + chloroamphenicol to maintain antisense plasmid) until the cells reached early log phase then contacted with of one of the above-stated compounds at one of the concentrations listed above (preferably near IC50). The cultures were grown for a sufficient length of time to permit the compounds to specifically inhibit the growth of sfrains underexpressing their targets. Preferably the cultures were grown at least 16 hr, more preferably between 24 and 48 hrs. It is desirable to avoid allowing the culture to grow for time periods which might places selective pressure on the sfrains which could lead to false positives.

The cells were harvested by centrifugation and plasmid DNA was isolated from the cultures. PCR amplifications were performed as described in Example 24. Amplification products were run on NuSieve agarose gels as described above. The amounts of the amplification products corresponding to each antisense nucleic acid were determined and compared to those in a control culture which was not contacted with the drug or to the amounts of the amplification products corresponding to the other antisense nucleic acids which were not complementary to nucleotide sequences in the genes encoding the gene products on which the compounds act. In each case, only the amplification product corresponding to the target on which the antibiotic acts was not detectable on the gel.

It is desirable, in embodiments in which the level or activity of gene products is regulated by franscribing antisense nucleic acids complementary to gene products required for proliferation or by replacing the native promoters of such genes with regulatable promoters, to perform dose-response curve for the inducer used to induce transcription of the antisense nucleic acids or induce transcription from the regulatable promoter. In such embodiments, it is desirable to use the lowest concenfration of inducer which provides optimal franscription levels for detecting the effects of a particular test compound while interfering as little as possible with the growth of strains which do not overexpress or underexpress the target on which the compound acts. It also desirable contact the cultures with varying amounts of test compounds to determine the optimal amounts for obtaining differential growth of strains which overexpress or underexpress the targets on which the compounds act. Preferably, if the strains overexpress gene products required for proliferation, the level of the compound is preferably about IC₉₀ or above . Preferably, if the strains underexpress gene products required for proliferation, the level ofthe compound is preferably about IC₅₀ or below . It will be appreciated that, if desired, the amplification products may be detected using the dyes described above. It will also be appreciated that amplification products may be detected using any desired amplification method including RT-PCR and PCR. Although this method has been described using examples of antisense nucleic acids to specific essential genes, it will be appreciated that this method can be used with any of the antisense nucleic acids described herein, such as an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a nucleic acid sequence complementary to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, a nucleic acid sequence complementary to a nucleic acid sequence which encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581, a homologous antisense nucleic acid, a nucleic acid sequence complementary to a homologous coding nucleic acid, or a nucleic acid complementary to a nucleic acid which encodes a homologous polypeptide. It will also be appreciated that promoters other than XlyT5 can be used to express the gene products described herein. For example, a number of promoters useful for nucleic acid expression (including antisense nucleic acid expression) in Enterococcus faecalis, Staphylococcus areus as well as other Gram positive organisms are described in U.S. Patent Application Serial Number 10/032,393, filed December 21, 2001.

Additionally, the above methods can be used with any organism including Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia,

Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,

Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae,

Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species.

EXAMPLE 26 Use of Identified Nucleic Acid Sequences as Probes The sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi,

Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis described herein, homologous coding nucleic acids, or homologous antisense nucleic acids can be used as probes to obtain the sequence of additional genes of interest from a second cell or microorganism. For example, probes to genes encoding potential bacterial target proteins may be hybridized to nucleic acids from other organisms including other bacteria and higher organisms, to identify homologous sequences in these other organisms. For example, the identified sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis, homologous coding nucleic acids, or homologous antisense nucleic acids may be used to identify homologous sequences in Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any ofthe above species. In some embodiments ofthe present invention, the nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans,

Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis described herein, homologous coding nucleic acids, or homologous antisense nucleic acids may be used to identify homologous nucleic acids from a heterologous organism other than E. coli. Hybridization between the nucleic acids from Escherichia coli, Staphylococcus aureus,

Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis described herein, homologous coding nucleic acids, or homologous antisense nucleic acids and nucleic acids from humans might indicate that the protein encoded by the gene to which the probe corresponds is found in humans and therefore not necessarily an optimal drug target. Alternatively, the gene can be conserved only in bacteria and therefore would be a good drug target for a broad spectrum antibiotic or antimicrobial. These probes can also be used in a known manner to isolate homologous nucleic acids from Staphylococcus, Salmonella, Klebsiella, Pseudomonas, Enterococcus or other cells or microorganisms, e.g. by screening a genomic or cDNA library.

Probes derived from the nucleic acid sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis described herein, homologous coding nucleic acids, or homologous antisense nucleic acids, or portions thereof, can be labeled with detectable labels familiar to those skilled in the art, including radioisotopes and non-radioactive labels, to provide a detectable probe. The detectable probe can be single stranded or double stranded and can be made using techniques known in the art, including in vitro transcription, nick translation, or kinase reactions. A nucleic acid sample containing a sequence capable of hybridizing to the labeled probe is contacted with the labeled probe. If the nucleic acid in the sample is double stranded, it can be denatured prior to contacting the probe. In some applications, the nucleic acid sample can be immobilized on a surface such as a nitrocellulose or nylon membrane. The nucleic acid sample can comprise nucleic acids obtained from a variety of sources, including genomic DNA, cDNA libraries, RNA, or tissue samples. Procedures used to detect the presence of nucleic acids capable of hybridizing to the detectable probe include well known techniques such as Southern blotting, Northern blotting, dot blotting, colony hybridization, and plaque hybridization. In some applications, the nucleic acid capable of hybridizing to the labeled probe can be cloned into vectors such as expression vectors, sequencing vectors, or in vitro transcription vectors to facilitate the characterization and expression ofthe hybridizing nucleic acids in the sample. For example, such techniques can be used to isolate, purify and clone sequences from a genomic library, made from a variety of bacterial species, which are capable of hybridizing to probes made from the sequences identified as decribed herein.

EXAMPLE 27 Preparation of PCR Primers and Amplification of DNA The identified Escherichia coli, Staphylococcus aureus, Enterococcus faecalis,

Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae,

Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis genes corresponding directly to or located within the operon of nucleic acid sequences required for proliferation, homologous coding nucleic acids, or homologous antisense nucleic acids or portions thereof can be used to prepare PCR primers for a variety of applications, including the identification or isolation of homologous sequences from other species. For example, the Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis genes may be used to prepare PCR primers to identify or isolate homologous sequences from Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Coiynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum,

Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any ofthe above species. In some embodiments ofthe present invention, the PCR primers may be used to identify or isolate homologous nucleic acids from an organism other than E. coli. The identified or isolated nucleic acids obtained using the PCR primers may contain part or all of the homologous nucleic acids. Because homologous nucleic acids are related but not identical in sequence, those skilled in the art will often employ degenerate sequence PCR primers. Such degenerate sequence primers are designed based on sequence regions that are either known to be conserved or suspected to be conserved such as conserved coding regions. The successful production of a PCR product using degenerate probes generated from the sequences identified herein would indicate the presence of a homologous gene sequence in the species being screened. The PCR primers are at least 10 nucleotides, and preferably at least 20 nucleotides in length. More preferably, the PCR primers are at least 20-30 nucleotides in length. In some embodiments, the PCR primers can be more than 30 nucleotides in length. It is preferred that the primer pairs have approximately the same G/C ratio, so that melting temperatures are approximately the same. A variety of PCR techniques are familiar to those skilled in the art. For a review of PCR technology, see Molecular Cloning to Genetic Engineering White, B.A. Ed. in Methods in Molecular Biology 67: Humana Press, Totowa 1997. When the entire coding sequence of the target gene is known, the 5' and 3' regions of the target gene can be used as the sequence source for PCR probe generation. In each of these PCR procedures, PCR primers on either side of the nucleic acid sequences to be amplified are added to a suitably prepared nucleic acid sample along with dNTPs and a thermostable polymerase such as Taq polymerase, Pfu polymerase, or Vent polymerase. The nucleic acid in the sample is denatured and the PCR primers are specifically hybridized to complementary nucleic acid sequences in the sample. The hybridized primers are extended.

Thereafter, another cycle of denaturation, hybridization, and extension is initiated. The cycles are repeated multiple times to produce an amplified fragment containing the nucleic acid sequence between the primer sites.

EXAMPLE 28 Inverse PCR

The technique of inverse polymerase chain reaction can be used to extend the known nucleic acid sequence identified as described herein. The inverse PCR reaction is described generally by Ochman et al., in Ch. 10 of PCR Technology: Principles and Applications for DNA Amplification, (Henry A. Erlich, Ed.) W.H. Freeman and Co. (1992). Traditional PCR requires two primers that are used to prime the synthesis of complementary strands of DNA. In inverse PCR, only a core sequence need be known.

Using the sequences identified as relevant from the techniques taught in Examples 10 and 11 and applied to other species of bacteria, a subset of nucleic sequences are identified that correspond to genes or operons that are required for bacterial proliferation. In species for which a genome sequence is not known, the technique of inverse PCR provides a method for obtaining the gene in order to determine the sequence or to place the probe sequences in full context to the target sequence to which the identified nucleic acid sequence binds.

To practice this technique, the genome of the target organism is digested with an appropriate restriction enzyme so as to create fragments of nucleic acid that contain the identified sequence as well as unknown sequences that flank the identified sequence. These fragments are then circularized and become the template for the PCR reaction. PCR primers are designed in accordance with the teachings of Example 27 and directed to the ends of the identified sequence.. The primers direct nucleic acid synthesis away from the known sequence and toward the unknown sequence contained within the circularized template. After the PCR reaction is complete, the resulting PCR products can be sequenced so as to extend the sequence of the identified gene past the core sequence ofthe identified exogenous nucleic acid sequence identified. In this manner, the full sequence of each novel gene can be identified. Additionally the sequences of adjacent coding and noncoding regions can be identified.

EXAMPLE 29 Identification of Genes Required for Escherichia coli Proliferation

Genes required for proliferation in Escherichia coli are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 30 Identification of Genes Required for Staphylococcus aureus Proliferation

Genes required for proliferation in Staphylococcus aureus are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 31 Identification of Genes Required for Enterococcus faecalis Proliferation

Genes required for proliferation in Enterococcus faecalis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 32 Identification of Genes Required for Klebsiella pneumoniae Proliferation

Genes required for proliferation in Klebsiella pneumoniae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 33

Identification of Genes Required for Pseudomonas aeruginosa Proliferation Genes required for proliferation in Pseudomonas aeruginosa are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 34 Identification of Genes Required for Salmonella typhimurium Proliferation Genes required for proliferation in Salmonella typhimurium are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 35 Identification of Genes Required for Acinetobacter baumannii Proliferation Genes required for proliferation in Acinetobacter baumannii are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 36 Identification of Genes Required for Bacillus anthracis Proliferation Genes required for proliferation in Bacillus anthracis are identified accordmg to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 37 Identification of Genes Required for Bordetella pertussis Proliferation Genes required for proliferation in Bordetella pertussis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 38 Identification of Genes Required for Borrelia burgdorferi Proliferation Genes required for proliferation in Borrelia burgdorferi are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 39 Identification of Genes Required for Burkholderia cepacia Proliferation Genes required for proliferation in Burkholderia cepacia are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 40

Identification of Genes Required for Burkholderia fungorum Proliferation Genes required for proliferation in Burkholderia fungorum are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 41 Identification of Genes Required f r Burkholderia mallei Proliferation Genes required for proliferation in Burkholderia mallei are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 42 Identification of Genes Required for Campylobacter jejuni Proliferation Genes required for proliferation in Campylobacter jejuni are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 43 Identification of Genes Required for Chlamydia pneumoniae Proliferation Genes required for proliferation in Chlamydia pneumoniae axe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 44 Identification of Genes Required for Chlamydia trachomatis Proliferation Genes required for proliferation in Chlamydia trachomatis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 45 Identification of Genes Required for Clostridium acetobutylicum Proliferation Genes required for proliferation in Clostridium acetobutylicum are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 46 Identification of Genes Required for Clostridium botulinum Proliferation Genes required for proliferation in Clostridium botulinum are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 47

Identification of Genes Required for Clostridium difficile Proliferation Genes required for proliferation in Clostridium difficile are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 48 Identification of Genes Required for Corynebacterium diptheriae Proliferation Genes required for proliferation in Corynebacterium diptheriae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 49 Identification of Genes Required for Enterobacter cloacae Proliferation Genes required for proliferation in Enterobacter cloacae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 50 Identification of Genes Required for Enterococcus faecium Proliferation Genes required for proliferation in Enterococcus faecium are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 51 Identification of Genes Required for Haemophilus influenzae Proliferation Genes required for proliferation in Haemophilus influenzae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 52 Identification of Genes Required for Helicobacter pylori Proliferation Genes required for proliferation in Helicobacter pylori are identified accordmg to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 53 Identification of Genes Required for Legionella pneumophila Proliferation Genes required for proliferation in Legionella pneumophila are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 54

Identification of Genes Required for Listeria monocytogenes Proliferation Genes required for proliferation in Listeria monocytogenes are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 55 Identification of Genes Required for Moraxella catarrhalis Proliferation Genes required for proliferation in Moraxella catarrhalis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 56 Identification of Genes Required fox Mycobacterium avium Proliferation Genes required for proliferation in Mycobacterium avium are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 57 Identification of Genes Required fox Mycobacterium bovis Proliferation Genes required for proliferation in Mycobacterium bovis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 58 Identification of Genes Required for Mycobacterium leprae Proliferation Genes required for proliferation in Mycobacterium leprae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 59 Identification of Genes Required for Mycobacterium tuberculosis Proliferation Genes required for proliferation in Mycobacterium tuberculosis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 60 Identification of Genes Required for Mycoplasma genitalium Proliferation Genes required for proliferation in Mycoplasma genitalium are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 61

Identification of Genes Required for Mycoplasma pneumoniae Proliferation Genes required for proliferation in Mycoplasma pneumoniae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 62 Identification of Genes Required fox Neisseria gonorrhoeae Proliferation Genes required for proliferation in Neisseria gonorrhoeae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 63 Identification of Genes Required for Neisseria meningitidis Proliferation Genes required for proliferation in Neisseria meningitidis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 64 Identification of Genes Required for Pasteurella multocida Proliferation Genes required for proliferation in Pasteurella multocida are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 65 Identification of Genes Required for Proteus mirabilis Proliferation Genes required for proliferation in Proteus mirabilis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 66 Identification of Genes Required for Pseudomonas putida Proliferation Genes required for proliferation in Pseudomonas putida are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 67 Identification of Genes Required for Pseudomonas syringae Proliferation Genes required for proliferation in Pseudomonas syringae are identified accordmg to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 68

Identification of Genes Required for Salmonella paratyphi Proliferation Genes required for proliferation in Salmonella paratyphi are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 69 Identification of Genes Required for Salmonella typhi Proliferation Genes required for proliferation in Salmonella typhi axe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 70 Identification of Genes Required for Staphylococcus epidermidis Proliferation Genes required for proliferation in Staphylococcus epidermidis axe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 71 Identification of Genes Required for Staphylococcus haemolyticus Proliferation Genes required for proliferation in Staphylococcus haemolyticus axe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 72 Identification of Genes Required for Streptococcus mutans Proliferation Genes required for proliferation in Streptococcus mutans axe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 73 Identification of Genes Required for Streptococcus pneumoniae Proliferation Genes required for proliferation in Streptococcus pneumoniae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 74 Identification of Genes Required for Streptococcus pyogenes Proliferation Genes required for proliferation in Streptococcus pyogenes are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 75

Identification of Genes Required for Treponema pallidum Proliferation Genes required for proliferation in Treponema pallidum xe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 76 Identification of Genes Required for Ureaplasma urealyticum Proliferation Genes required for proliferation in Ureaplasma urealyticum are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 77 Identification of Genes Required for Vibrio cholerae Proliferation Genes required for proliferation in Vibrio cholerae are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 78 Identification of Genes Required for Yersinia pestis Proliferation Genes required for proliferation in Yersinia pestis are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 79 Identification of Genes Required for Salmonella enterica Proliferation Genes required for proliferation in Salmonella enterica axe identified accordmg to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 80 Identification of Genes Required for Aspergillus fumigatus Proliferation Genes required for proliferation in Aspergillus fumigatus are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 81 Identification of Genes Required for Plasmodium ovale Proliferation Genes required for proliferation in Plasmodium ovale a e identified accordmg to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein. EXAMPLE 82

Identification of Genes Required for Entamoeba histolvtica Proliferation Genes required for proliferation in Entamoeba histolytica are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 83 Identification of Genes Required for Candida albicans Proliferation Genes required for proliferation in Candida albicans are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 84 Identification of Genes Required for Histoplasma capsulatum Proliferation Genes required for proliferation in Histoplasma capsulatum are identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

EXAMPLE 85 Identification of Genes Required for Salmonella cholerasuis Proliferation Genes required for proliferation in Salmonella cholerasuis axe identified according to the methods described above. For example, promoters and vectors described herein can be used to identify essential genes described herein.

Use of Isolated Exogenous Nucleic Acid Fragments as Antisense Antibiotics

In addition to using the identified sequences to enable screening of molecule libraries to identify compounds useful to identify antibiotics, antisense nucleic acids complementary to the proliferation-required sequences or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids, or homologous antisense nucleic acids can be used as therapeutic agents. Specifically, the proliferation-required sequences or homolgous coding nucleic acids, or portions therof, in an antisense orientation or homologous antisense nucleic acids can be provided to an individual to inhibit the translation of a bacterial target gene or the processing, folding, or assembly into a protein/RNA complex of a nontranslated RNA. EXAMPLE 86

Generation of Antisense Therapeutics from Identified Exogenous Sequences

Antisense nucleic acids complementary to the proliferation-required sequences described herein, or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids, or portions thereof, or homologous antisense nucleic acids or portions thereof can be used as antisense therapeutics for the treatment of bacterial infections or simply for inhibition of bacterial growth in vitro or in vivo. For example, the antisense therapeutics may be used to treat bacterial infections caused by Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis,

Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or to inhibit the growth of these organisms. The antisense therapeutics may also be used to treat infections caused by or to inhibit the growth of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata),

Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium,

Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica,

Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the antisense therapuetics may be used to treat infection by or inhibit the growth of an organism other than E. coli.

The therapy exploits the biological process in cells where genes are transcribed into messenger RNA (mRNA) that is then translated into proteins. Antisense RNA technology contemplates the use of antisense nucleic acids, including antisense oligonucleotides, complementary to a target gene that will bind to its target nucleic acid and decrease or inhibit the expression of the target gene. For example, the antisense nucleic acid may inhibit the translation or transcription of the target nucleic acid. In one embodiment, antisense oligonucleotides can be used to treat and control a bacterial infection of a cell culture containing a population of desired cells contaminated with bacteria. In another embodiment, the antisense oligonucleotides can be used to treat an organism with a bacterial infection.

Antisense oligonucleotides can be synthesized from any of the sequences of the present invention using methods well known in the art. In a preferred embodiment, antisense oligonucleotides are synthesized using artificial means. Uhlmann & Peymann, Chemical Rev. 90:543-584 (1990) review antisense oligonucleotide technology in detail. Modified or unmodified antisense oligonucleotides can be used as therapeutic agents. Modified antisense oligonucleotides are preferred. Modification of the phosphate backbones of the antisense oligonucleotides can be achieved by substituting the internucleotide phosphate residues with methylphosphonates, phosphorothioates, phosphoramidates, and phosphate esters. Nonphosphate internucleotide analogs such as siloxane bridges, carbonate brides, thioester bridges, as well as many others known in the art may also be used. The preparation of certain antisense oligonucleotides with modified internucleotide linkages is described in U.S. Patent No. 5,142,047.

Modifications to the nucleoside units of the antisense oligonucleotides are also contemplated. These modifications can increase the half-life and increase cellular rates of uptake for the oligonucleotides in vivo. For example, α-anomeric nucleotide units and modified nucleotides such as 1,2-dideoxy-d-ribofuranose, 1,2-dideoxy-l-phenylribofuranose, and N⁴, N⁴- ethano-5-methyl-cytosine are contemplated for use in the present invention.

An additional form of modified antisense molecules is found in peptide nucleic acids. Peptide nucleic acids (PNA) have been developed to hybridize to single and double stranded nucleic acids. PNA are nucleic acid analogs in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units. Unlike DNA, which is highly negatively charged, the PNA backbone is neutral. Therefore, there is much less repulsive energy between complementary strands in a PNA-DNA hybrid than in the comparable DNA-DNA hybrid, and consequently they are much more stable. PNA can hybridize to DNA in either a Watson/Crick or

Hoogsteen fashion (Demidov et al., Proc. Natl. Acad. Sci. U.S.A. 92:2637-2641, 1995; Egholm, Nature 365:566-568, 1993; Nielsen et al., Science 254:1497-1500, 1991; Dueholm et al., New J. Chem. 21:19-31, 1997).

Molecules called PNA "clamps" have been synthesized which have two identical PNA sequences joined by a flexible hairpin linker containing three 8-amino-3,6-dioxaoctanoic acid units.

When a PNA clamp is mixed with a complementary homopurine or homopyrimidine DNA target sequence, a PNA-DNA-PNA triplex hybrid can form which has been shown to be extremely stable (Bentin et al., Biochemistry 35:8863-8869, 1996; Egholm et al, Nucleic Acids Res. 23:217-222, 1995; Griffith et al.,J Am. Chem. Soc. 117:831-832, 1995). The sequence-specific and high affinity duplex and triplex binding of PNA have been extensively described (Nielsen et al., Science 254:1497-1500, 1991; Egholm et al, J. Am. Chem. Soc. 114:9677-9678, 1992; Egholm et al., Nature 365:566-568, 1993; Almarsson et al., Proc. Natl. Acad. Sci. U.S.A. 90:9542-9546, 1993; Demidov et al., Proc. Natl. Acad. Sci. U.S.A. 92:2637-2641, 1995). They have also been shown to be resistant to nuclease and protease digestion (Demidov et al., Biochem. Pharm. 48:1010-1313, 1994). PNA has been used to inhibit gene expression

(Hanvey et al., Science 258:1481-1485,1992; Nielsen et al., Nucl. Acids. Res., 21:197-200, 1993; Nielsen et al., Gene 149:139-145, 1994; Good & Nielsen, Science, 95: 2073-2076, 1998; to block restriction enzyme activity (Nielsen et al., supra., 1993), to act as an artificial transcription promoter (Mollegaard, Proc. Natl. Acad. Sci. U.S.A. 91:3892-3895, 1994) and as a pseudo restriction endonuclease (Demidov et al., Nucl. Acids. Res. 21:2103-2107, 1993). Recently, PNA has also been shown to have antiviral and antitumoral activity mediated through an antisense mechanism (Norton, Nature Biotechnol., 14:615-619, 1996; Hirschman et al., J. Investig. Med. 44:347-351, 1996). PNAs have been linked to various peptides in order to promote PNA entry into cells (Basu et al., Bioconj. Chem. 8:481-488, 1997; Pardridge et al., Proc. Natl. Acad. Sci. U.S.A. 92:5592-5596, 1995).

The antisense oligonucleotides contemplated by the present invention can be administered by direct application of oligonucleotides to a target using standard techniques well known in the art. The antisense oligonucleotides can be generated within the target using a plasmid, or a phage. Alternatively, the antisense nucleic acid may be expressed from a sequence in the chromosome ofthe target cell. For example, a promoter may be introduced into the chromosome of the target cell near the target gene such that the promoter directs the transcription ofthe antisense nucleic acid. Alternatively, a nucleic acid containing the antisense sequence operably linked to a promoter may be introduced into the chromosome of the target cell. It is further contemplated that the antisense oligonucleotides are incorporated in a ribozyme sequence to enable the antisense to specifically bind and cleave its target mRNA. For technical applications of ribozyme and antisense oligonucleotides see Rossi et al., Pharmacol. Ther. 50(2):245-254, (1991). The present invention also contemplates using a retron to introduce an antisense oligonucleotide to a cell. Retron technology is exemplified by U.S. Patent No. 5,405,775. Antisense oligonucleotides can also be delivered using liposomes or by electroporation techniques which are well known in the art.

The antisense nucleic acids described above can also be used to design antibiotic compounds comprising nucleic acids which function by intracellular triple helix formation. Triple helix oligonucleotides are used to inhibit transcription from a genome. The antisense nucleic acids can be used to inhibit cell or microorganism gene expression in individuals infected with such microorganisms or containing such cells. Traditionally, homopurine sequences were considered the most useful for triple helix strategies. However, homopyrimidine sequences can also inhibit gene expression. Such homopyrimidine oligonucleotides bind to the major groove at homopurine omopyrimidine sequences. Thus, both types of sequences based on the sequences from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans,

Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous nucleic acids that are required for proliferation are contemplated for use as antibiotic compound templates.

The antisense nucleic acids, such as antisense oligonucleotides, which are complementary to the proliferation-required nucleic acids from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile,

Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or to homologous coding nucleic acids, or portions thereof, may be used to induce bacterial cell death or at least bacterial stasis by inhibiting target nucleic acid franscription or translation. Antisense oligonucleotides complementary to about 8 to 40 nucleotides of the proliferation-required nucleic acids described herein or homologous coding nucleic acids have sufficient complementarity to form a duplex with the target sequence under physiological conditions. To kill bacterial cells or inhibit their growth, the antisense oligonucleotides are applied to the bacteria or to the target cells under conditions that facilitate their uptake. These conditions include sufficient incubation times of cells and oligonucleotides so that the antisense oligonucleotides are taken up by the cells. In one embodiment, an incubation period of 7-10 days is sufficient to kill bacteria in a sample. An optimum concenfration of antisense oligonucleotides is selected for use.

The concentration of antisense oligonucleotides to be used can vary depending on the type of bacteria sought to be controlled, the nature of the antisense oligonucleotide to be used, and the relative toxicity of the antisense oligonucleotide to the desired cells in the freated culture. Antisense oligonucleotides can be introduced to cell samples at a number of different concentrations preferably between lxl0^"10M to lxlO^M. Once the minimum concentration that can adequately control gene expression is identified, the optimized dose is translated into a dosage suitable for use in vivo. For example, an inhibiting concentration in culture of lxlO^"7 translates into a dose of approximately 0.6 mg/kg body weight. Levels of oligonucleotide approaching 100 mg kg body weight or higher may be possible after testing the toxicity ofthe oligonucleotide in laboratory animals. It is additionally contemplated that cells from the subject are removed, treated with the antisense oligonucleotide, and reintroduced into the subject. This range is merely illustrative and one of skill in the art are able to determine the optimal concentration to be used in a given case.

After the bacterial cells have been killed or controlled in a desired culture, the desired cell population may be used for other purposes. EXAMPLE 87

Use of Antisense Oligonucleotides to Treat Contaminated Cell Cultures The following example demonstrates the ability of an Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis,

Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis antisense oligonucleotide or an antisense oligonucleotide complementary to a homologous coding nucleic acid, or portions thereof, to act as a bacteriocidal or bacteriostatic agent to treat a contaminated cell culture system. The application of the antisense oligonucleotides of the present invention are thought to inhibit the translation of bacterial gene products required for proliferation. The antisense nucleic acids may also inhibit the transcription, folding or processing of the target

RNA.

In one embodiment of the present invention, the antisense oligonucleotide may comprise a phosphorothioate modified nucleic acid comprising at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, or more than 40 consecutive nucleotides of an antisense nucleic acid listed in Table IA (SEQ ID NOs.: 1-6213).

A sense oligodeoxynucleotide complementary to the antisense sequence is synthesized and used as a control. The oligonucleotides are synthesized and purified according to the procedures of Matsukura, et al., Gene 72:343 (1988). The test oligonucleotides are dissolved in a small volume of autoclaved water and added to culture medium to make a 100 micromolar stock solution. Human bone marrow cells are obtained from the peripheral blood of two patients and cultured according standard procedures well known in the art. The culture is contaminated with Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or an organism containing a homologous nucleic acid and incubated at 37°C overnight to establish bacterial infection.

The control and antisense oligonucleotide containing solutions are added to the contaminated cultures and monitored for bacterial growth. After a 10 hour incubation of culture and oligonucleotides, samples from the control and experimental cultures are drawn and analyzed for the franslation of the target bacterial gene using standard microbiological techniques well known in the art. The target Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis,

Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis gene or an organism containing the homologous coding nucleic acid is found to be translated in the confrol culture treated with the control oligonucleotide, however, translation of the target gene in the experimental culture treated with the antisense oligonucleotide of the present invention is not detected or reduced, indicating that the culture is no longer contaminated or is contaminated at a reduced level.

EXAMPLE 88 Use of Antisense Oligonucleotides to Treat Infections A subject suffering from a Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis,

Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes,

Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Yersinia pestis infection or an infection with an organism containing a homologous coding nucleic acid is treated with the antisense oligonucleotide preparation above. The antisense oligonucleotide is provided in a pharmaceutically acceptable carrier at a concentration effective to inhibit the transcription or translation of the target nucleic acid. The present subject is treated with a concentration of antisense oligonucleotide sufficient to achieve a blood concentration of about 0.1-100 micromolar. The patient receives daily injections of antisense oligonucleotide to maintain this concentration for a period of 1 week. At the end of the week a blood sample is drawn and analyzed for the presence or absence of the organism using standard techniques well known in the art. There is no detectable evidence of Escherichia coli, Staphylococcus aureus,

Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Yersinia pestis or an organim containing a homologous coding nucleic acid and the treatment is terminated. Antisense nucleic acids complementary to a homologous coding nucleic acid or a portion thereof may be used in the preceding method to treat individuals infected with an organism containing the homologous coding nucleic acid.

EXAMPLE 89 Preparation and Use of Triple Helix Forming Oligonucleotides The sequences of proliferation-required nucleic acids, homologous coding nucleic acids, or homologous antisense nucleic acids are scanned to identify 10-mer to 20-mer homopyrimidine or homopurine stretches that could be used in triple-helix based strategies for inhibiting gene expression. Following identification of candidate homopyrimidine or homopurine stretches, their efficiency in inhibiting gene expression is assessed by introducing varying amounts of oligonucleotides containing the candidate sequences into a population of bacterial cells that normally express the target gene. The oligonucleotides may be prepared on an oligonucleotide synthesizer or they may be purchased commercially from a company specializing in custom oligonucleotide synthesis.

The oligonucleotides can be introduced into the cells using a variety of methods known to those skilled in the art, including but not limited to calcium phosphate precipitation, DEAE-

Dextran, electroporation, liposome-mediated transfection or native uptake.

Treated cells are monitored for a reduction in proliferation using techniques such as monitoring growth levels as compared to untreated cells using optical density measurements. The oligonucleotides that are effective in inhibiting gene expression in cultured cells can then be introduced in vivo using the techniques well known in that art at a dosage level shown to be effective.

In some embodiments, the natural (beta) anomers of the oligonucleotide units can be replaced with alpha anomers to render the oligonucleotide more resistant to nucleases. Further, an intercalating agent such as ethidium bromide, or the like, can be attached to the 3' end ofthe alpha oligonucleotide to stabilize the triple helix. For information on the generation of oligonucleotides suitable for triple helix formation see Griffin et al. (Science 245:967-971 (1989), which is hereby incorporated by this reference).

EXAMPLE 90 Identification of Bacterial Strains from Isolated Specimens by PCR Classical bacteriological methods for the detection of various bacterial species are time consuming and costly. These methods include growing the bacteria isolated from a subject in specialized medium, cultivation on selective agar medium, followed by a set of confirmation assays that can take from 8 to 10 days or longer to complete. Use ofthe identified sequences of the present invention provides a method to dramatically reduce the time necessary to detect and identify specific bacterial species present in a sample.

In one exemplary method, bacteria are grown in enriched medium and DNA samples are isolated from specimens of, for example, blood, urine, stool, saliva or central nervous system fluid by conventional methods. A panel of PCR primers based on identified sequences unique to various species or types of cells or microorganisms are then utilized in accordance with Example 27 to amplify DNA of approximately 100-200 nucleotides in length from the specimen. A separate PCR reaction is set up for each pair of PCR primers and after the PCR reaction is complete, the reaction mixtures are assayed for the presence of PCR product. The presence or absence of bacteria from the species to which the PCR primer pairs belong is determined by the presence or absence of a PCR product in the various test PCR reaction tubes. Although the PCR reaction is used to assay the isolated sample for the presence of various bacterial species, other assays such as the Southern blot hybridization are also contemplated.

Compounds which inhibit the activity or reduce the amount of gene products required for proliferation may be identified using rational drug design. These methods may be used with the proliferation-required polypeptides described herein or homologous polypeptides. In such methods, the structure of the gene product is determined using methods such as x-ray crystallography, NMR, or computer modelling. Compounds are screened to identify those which have a structure which allows them to interact with the gene product. In some embodiments, the compounds are screened to identify those which have structures which allow them to interact with regions ofthe gene product which are important for its activity. For example, the compounds may be screened to identify those which have structures which allow them to bind to the active site of the gene product to inhibit its activity. For example, the compound may be a suicide substrate which binds to the active site with high affinity, thereby preventing the gene product from acting on its natural substrate. Alternatively, the compound may bind to a region ofthe gene product which is involved in complex formation with other biomolecules. In such instances, the activity of the gene product is inhibited by blocking the interaction between the gene product and other members ofthe complex.

Thus, one embodiment of the present invention comprises a method of using a crystal ofthe gene products ofthe present invention and/or a dataset comprising the three-dimensional coordinates obtained from the crystal in a drug-screening assay. The present invention also includes agents (modulators or drugs) that are identified by the methods of the present invention, along with the method of using agents (modulators or drugs) identified by a method ofthe present invention, for inhibiting the activity of or modulating the amount of an essential gene product. The present invention also includes crystals comprising the gene products of the present invention or portions thereof.

In some embodiments of the present invention, the three-dimensional structure of the polypeptides required for proliferation is determined using X-ray crystallography or NMR. The coordinates of the determined structure are used in computer-assisted modeling programs to identify compounds that bind to and/or modulate the activity or amount of the encoded polypeptide. The method may include the following steps: 1) the generation of high-purity crystals ofthe encoded recombinant (or endogenous) polypeptide for analysis; 2) determination of the three-dimensional structure of the polypeptide; and, 3) the use of computer-assisted "docking" programs to analyze the molecular interaction of compound structure and the polypeptide (i.e., drug screening). General methods for performing each of the above steps are described below and are also well known to those of skill in the art. Any method known to those of skill in the art, including those described herein, may be employed for generating the three-dimensional structure for each identified essential gene product and its use in the drug-screening assays.

Crystals of the gene products required for proliferation may be obtained as follows. Under certain conditions, molecules condense from solution into a highly-ordered crystalline lattice, which is defined by a unit cell, the smallest repeating volume of the crystalline array. The contents of such a cell can interact with and diffract certain electromagnetic and particle waves (e.g., X-rays, neutron beams, electron beams etc.). Due to the symmetry ofthe lattice, the diffracted waves interact to create a diffraction pattern. By measuring the diffraction pattern, crystallographers are able to reconstruct the three-dimensional structure of the atoms in the crystal.

Any method known to those of skill in the art, including those set forth below, may be employed to prepare high-purity crystals. For example, crystals ofthe product of the identified essential gene can be grown by a number of techniques including batch crystallization, vapor diffusion (either by sitting drop or hanging drop) and by microdialysis. Seeding of the crystals in some instances is required to obtain X-ray quality crystals. Standard micro and/or macro seeding of crystals may therefore be used. Exemplified below is the hanging-drop vapor diffusion procedure. Hanging drops of an essential gene product (2.5 μl, 10 mg/ml) in 20 mM Tris, pH=8.0, 100 mM NaCl are mixed with an equal amount of reservoir buffer containing 2.7- 3.2 M sodium formate and 100 mM Tris buffer, pH=8.0, and kept at 4°C. Crystal showers may appear after 1-2 days with large single crystals growing to full size (0.3 X 0.3 X 0.15 mm³) within 2-3 weeks. Crystals are harvested in 3.5 M sodium formate and 100 mM Tris buffer, pH=8.0 and cryoprotected in 3.5 M sodium formate, 100 mM Tris buffer, pH=8.0, 10%, (w/v) sucrose, and 10% (v/v) ethylene glycol before flash freezing in liquid propane. In some embodiments, the crystal may be obtained using the methods described in U.S. Patent No.

5,869,604. The method involves (a) contacting a mixture containing uncrystallized polypeptides with an exogenous nucleating agent that has an areal lattice match of at least 90.4% to the polypeptide,(b) crystallizing the polypeptides, thereby forming at least one crystal of the polypeptide attached to the nucleating agent, the attached crystal being of a high purity, and at least one polypeptide crystal unattached to the nucleating agent, the unattached crystal being of a lower purity than the attached crystal, and (c) separating the crystal attached to the nucleating agent from the crystal unattached to the nucleating agent. The crystallized polypeptide may also be purified from contaminants by (a) contacting a mixture containing uncrystallized polypeptides and a contaminant with an exogenous nucleating agent that has an areal lattice match of at least 90.4% to the polypeptide, (b) crystallizing the polypeptides, thereby forming at least one crystal of the polypeptide attached to the nucleating agent, the attached crystal being of a high purity and produced in a high yield, and at least one crystal unattached to the nucleating agent, the unattached crystal being of a lower purity than the attached crystal, and (c) separating the crystal attached to the nucleating agent from the crystal unattached to the nucleating agent.

Once a crystal ofthe present invention is grown, X-ray diffraction data can be collected using methods familiar to those skilled in the art. Therefore, any person with skill in the art of protein crystallization having the present teachings and without undue experimentation can crystallize a large number of alternative forms of the essential gene products from a variety of different organisms, or polypeptides having conservative substitutions in their amino acid sequence.

A crystal lattice is defined by the symmetry of its unit cell and any structural motifs the unit cell contains. For example, there are 230 possible symmetry groups for an arbitrary crystal lattice, while the unit cell of the crystal lattice group may have an arbitrary dimension that depends on the molecules making up the lattice. Biological macromolecules, however, have asymmetric centers and are limited to 65 of the 230 symmetry groups. See Cantor et al., Biophysical Chemistry, Vol. HI, W. H. Freeman & Company (1980).

A crystal lattice interacts with electromagnetic or particle waves, such as X-rays or electron beams respectively, that have a wavelength with the same order of magnitude as the spacing between atoms in the unit cell. The diffracted waves are measured as an array of spots on a detection surface positioned adjacent to the crystal. Each spot has a three-dimensional position, hkl, and an intensity, I(hkl), both of which are used to reconstruct the three- dimensional electron density of the crystal with the so-called Electron Density Equation. The Electron Density Equation states that the three-dimensional electron density of the unit cell is the Fourier transform ofthe structure factors. Thus, in theory, if the structure factors are known for a sufficient number of spots in the detection space, then the three-dimensional electron density ofthe unit cell could be calculated using the Electron Density Equation.

In some embodiments ofthe present invention, an image of a crystal of a gene product required for proliferation or a portion thereof is obtained with the aid of a digital computer and the crystal's diffraction pattern as described in U.S. Patent No. 5,353,236. The diffraction pattern contains a plurality of reflections, each having an associated resolution. The image is obtained by (a) converting the diffraction pattern ofthe crystal into computer usable normalized amplitudes, the pattern being produced with a diffractometer; (b) determining from the diffraction pattern a dimension of a unit cell of the crystal; (c) providing an envelope defining the region of the unit cell occupied by the gene product or portion thereof in the crystal; (d) distributing a collection of scattering bodies within said envelope, the collection of scattering bodies having various arrangements, each of which has an associated pattern of Fourier amplitudes; (e) condensing the collection of scattering bodies to a condensed arrangement that results in a high correlation between a diffraction pattern and the pattern of Fourier amplitudes for said collection of scattering bodies; (f) determining the phase associated with at least one of the reflections of said diffraction pattern from the condensed arrangement of scattering bodies; (g) calculating an electron density distribution of the gene product or portion thereof within the unit cell from the phase determined in procedure f; and (h) displaying a graphical image of the gene product or portion thereof constructed from said electron density distribution. The crystals of the gene products required for proliferation may be used in drug screening methods such as those described in U.S. Patent Number 6,156,526. Briefly, in such methods, a compound which inhibits the formation of a complex comprising the gene product or a portion thereof is identified as follows. A set of atomic coordinates defining the three- dimensional structure of a complex including the gene product of interest or a portion thereof are determined. A potential compound that binds to the gene product or a portion thereof involved in complex formation is selected using the atomic coordinates obtained above. The compound is contacted with the gene product or portion thereof and its binding partner(s) in the complex under conditions which would permit the complex to form in the absence of the potential compound. The binding affinity ofthe gene product or portion thereof for its binding partner(s) is determined and a potential compound is identified as a compound that inhibits the formation ofthe complex when there is a decrease in the binding affinity ofthe gene product or portion thereof for its binding partner(s).

In some embodiments of the present invention, the three dimensional structure of the essential gene product is determined and potential agonists and/or potential antagonists are designed with the aid of computer modeling [Bugg et al., Scientific American, Dec.:92-98

(1993); West et al., TIPS, 16:67-74 (1995); Dunbrack et al., Folding & Design, 2:27-42 (1997).

Computer analysis may be performed with one or more of the computer programs including: QUANTA, CHARMM, INSIGHT, SYBYL, MACROMODEL and ICM [Dunbrack et al., Folding & Design, 2:27-42 (1997)]. . In a further embodiment of this aspect of the invention, an initial drug-screening assay is performed using the three-dimensional structure so obtained, preferably along with a docking computer program. Such computer modeling can be performed with one or more Docking programs such as FlexX, DOC, GRAM and AUTO DOCK [Dunbrack et al., Folding & Design, 2:27-42 (1997)].

It should be understood that for each drug screening assay provided herein, a number of iterative cycles of any or all ofthe steps may be performed to optimize the selection. The drug screening assays ofthe present invention may use any of a number of means for determining the interaction between an agent or drug and an essential gene product.

In some embodiments of the present invention, a drug can be specifically designed to bind to an essential gene product of the present invention through NMR based methodology. [Shuker et al., pi Science 274:1531-1534 (1996)]. NMR spectra may be recorded using devices familiar to those skilled in the art, such as the Varian Unity Plus 500 and unity 600 spectrometers, each equipped with a pulsed-field gradient triple resonance probe as analyzed as described in Bagby et al., [Cell 82:857-867 (1995)]. Sequential resonance assignments of backbone Η, .'⁵ N, and J³ C atoms may be made using a combination of triple resonance experiments similar to those previously described [Bagby et al., Biochemistry, 33:2409-2421

(1994a), except with enhanced sensitivity [Muhandiram and Kay, J. Magn. Reson., 103: 203- 216 (1994), and minimal H₂0 saturation [Kay et al., J. Magn. Reson., 109:129-133 (1994)]. Side chain ^!H and ¹³ C assignments may be made using HCCH-TOCSY [Bax et al., J. Magn. Reson., 87:620-627 (1990)] experiments with mixing times of 8 ms and 16 ms.in solution but need not be included in structure calculations. Nuclear Overhauser effect (NOE) cross peaks in two-dimensional 'H- H NOE spectroscopy (NOESY), three-dimensional ¹⁵N-edited NOESY- HSQC [Zhang et al., J. Biomol, NMR, 4:845-858 (1994)] and three-dimensional simultaneous acquisition ¹⁵ N/¹³C-edited NOE [Pascal et al., J. Magn. Reson., 103:197-201 (1994)], spectra may be obtained with 100 ms NOE mixing times. Standard pseudo-atom distance corrections [Wuthrich et al., J. Mol. Biol., 169:949-961 (1983)], may be incorporated to account for center averaging. An additional 0.5 .ANG. may be added to the upper limits for distances involving methyl groups [Wagner et al., J. Mol. Biol., 196:611-639 (1987); Clore et al., Biochemistry, 26:8012-8023 (1987)].

The structures can be calculated using a simulated annealing protocol [Nilges et al., In computational Aspects of the Study of Biological Macromolecules by Nuclear Magnetic

Resonance Spectroscopy, J. C. Hoch, F. M. Poulsen, and C. Redfield, eds., New York: Plenum Press, pp. 451-455 (1991)], within X-PLOR [Brunger, X-PLOR Manual, Version 3.1, New Haven, Conn.: Department of Molecular Biophysics and Biochemistry, Yale University (1993)], using the previously described strategy [Bagby et al., Structure, 2:107-122 (1994b)]. Interhelical anges may be calculated using a program written by K. Yap. Accessible surface areas were calculated using the program Naccess, available from Prof. J. Thornton, University College, London.

Compounds capable of reducing the activity or amount of gene products required for cellular proliferation may be identified using the methods described in US Pat. No. 6,077,682. Briefly, the three-dimensional structure ofthe gene product or portion thereof may be used in a drug screening assay by (a) selecting a potential drug by performing rational drug design with the three-dimensional structure determined from one or more sets of atomic coordinates of the gene product or portion thereof in conjunction with computer modeling; (b) contacting the potential drug with a polypeptide comprising the gene product or portion thereof and (c) detecting the binding of the potential drug with said polypeptide; wherein a potential drug is selected as a drug if the potential drug binds to the polypeptide. In some methods, the three- dimensional structure of the gene product or portion thereof is used in a drug screening assay involving (a) selecting a potential drug by performing structural based rotational drug design with the three-dimensional structure of the gene product or portion thereof; wherein said selecting is performed in conjunction with computer modeling; (b) contacting the potential drug with a polypeptide comprising the gene product or portion thereof in the presence of a substrate ofthe gene product; wherein in the absence of the potential drug the substrate is acted upon by the gene product; and (c) determining the extent to which the gene product acted upon the substrate; wherein a drug is selected when a decrease in the action of the gene product on the substrate is determined in the presence of the potential drug relative to in its absence. In some embodiments, the preceding method further involves(d) contacting the potential drug with the gene product or portion thereof for NMR analysis; wherein a binding complex forms between the potential drug and said gene product or portion thereof for NMR analysis; wherein the gene product or portion thereof for NMR analysis comprises a conservative amino acid substitution; (e) determining the three-dimensional structure of the binding complex by NMR; and (f) selecting a candidate drug by performing structural based rational drug design with the three- dimensional structure determined for the binding complex; wherein said selecting is performed in conjunction with computer modeling; (g) contacting the candidate drug with a second polypeptide comprising the gene product or portion thereof in the presence of a substrate of the gene product or portion thereof; wherein in the absence of the candidate drug the substrate is acted upon by the second polypeptide; and (h) determining the amount of action of the second polypeptide on the substrate; wherein a drug is selected when a decrease in the amount of action of the second polypeptide is determined in the presence of the candidate drug relative to in its absence. Once the three-dimensional structure of a crystal comprising an essential gene product is determined, a potential modulator of its activity, can be examined through the use of computer modeling using a docking program such as FlexX, GRAM, DOCK, or AUTODOCK [Dunbrack et al., 1997, supra], to identify potential modulators. This procedure can include computer fitting of potential modulators to the polypeptide or fragments thereof to ascertain how well the shape and the chemical structure of the potential modulator will bind. Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance ofthe two binding partners (e.g., the essential gene product and a potential modulator). Generally the tighter the fit, the lower the steric hindrances, and the greater the attractive forces, the more potent the potential modulator since these properties are consistent with a tighter binding constant. Furthermore, the more specificity in the design of a potential drug the more likely that the drug will not interact as well with other proteins. This will minimize potential side-effects due to unwanted interactions with other proteins.

Compound and compound analogs can be systematically modified by computer modeling programs until one or more promising potential analogs is identified. In addition systematic modification of selected analogs can then be systematically modified by computer modeling programs until one or more potential analogs are identified. Such analysis has been shown to be effective in the development of HIV protease inhibitors [Lam et al., Science 263:380-384 (1994); Wlodawer et al, Ann. Rev. Biochem. 62:543-585 (1993); Appelt, Perspectives in Drug Discovery and Design 1:23-48 (1993); Erickson, Perspectives in Drug Discovery and Design 1:109-128 (1993)]. Alternatively a potential modulator could be obtained by initially screening a random peptide library produced by recombinant bacteriophage for example, [Scott and Smith, Science, 249:386-390 (1990); Cwirla et al., Proc. Natl. Acad. Sci, 87:6378-6382 (1990); Devlin et al. Science, 249:404-406 (1990)]. A peptide selected in this manner would then be systematically modified by computer modeling programs as described above, and then treated analogously to a structural analog.

Example 91 describes computer modelling of the structures of gene products required for proliferation.

EXAMPLE 91 Determination ofthe Structure of Gene Products Required for Proliferation Using Computer Modelling

Three dimensional models were built by applying computer modelling methods to some of the gene products required for proliferation of Staphylococcus aureus using the amino acid sequences of the encoded proteins as follows. Sir Tom Blundell's program COMPOSER as provided by Tripos Associates in their BIOPOLYMER module to SYBYL was used to build the models. Skolnik's method of topology fingerprinting as implemented in Matchmaker was used to score the average mutation free energy. This number is in Boltzmans (units of kT) and should be negative (the more negative, the better the model.

Composer uses a Needleman Wunsch alignment with jumbling to find significant alignments. The reported parameters are percent identity and significance as measured from the jumbling. Those matches which were 30% identical and had a significance greater that 4 on the scale were judged to be good candidates for model building templates. If no three dimensional structures met these criteria, then a BLAST search was conducted against the most recent PDB sequence database. Any significant hits discovered in this manner were then added to the binary protein structure database and the candidate search was repeated in the manner discussed above.

In the next phase, Composer assigned structurally conserved and structurally variable regions and built the backbone structure and then searched the database for structures of the variable loops. These were then spliced in and a model of the protein resulted. Any loops

(variable regions) which were unassignable were manually built and refined with a combination of dynamics.

The structure was then refined. Hydrogen atoms were added and a non-active aggregate was defined. lOOOpS of dynamics using AMBER ALL- ATOM and Kollman charges are performed. Next a minimization cycle of up 5000 steepest decent steps were performed and then the aggregate was thawed and the process was repeated on the entire protein. The resulting structure was then validated in MATCHMAKER. The topologicaly scanned free energy determined from empirically derived protein topologies was computed and the average energy/residue is reported in Boltzamans was reported. As this number represents a free energy the more negative it is the more favorable it is.

Sixty six proteins required for the proliferation of Staphylococcus aureus were modelled as described above. MATCHMAKER energies were computed for these. The distribution ofthe models built by class is shown in Table VHI below.

Table VHI: Distribution of models built with their MATCHMAKER energies in kT

The validity of the above method was confirmed using FtsZ. In the case of FtsZ, a crystal structure from M. Janeschi was available. Examination of the gross structural features determined using the above modelling showed all of the folds in the correct place, although there were some minor differences from the structure determined by x-ray crystallography.

EXAMPLE 92 Functional Complementation In another embodiment, gene products whose activities may be complemented by a proliferation-required gene product* from Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella typhimurium, Acinetobacter baumannii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Corynebacterium diptheriae, Enterobacter cloacae, Enterococcus faecium, Haemophilus influenzae, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Proteus mirabilis, Pseudomonas putida, Pseudomonas syringae, Salmonella paratyphi, Salmonella typhi, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae or Yersinia pestis or homologous polypeptides are identified using merodiploids, created by introducing a plasmid or Bacterial Artificial Chromosome into an organism having a mutation in the essential gene which reduces or eliminates the activity of the gene product. In some embodiments, the mutation may be a conditional mutation, such as a temperature sensitive mutation, such that the organism proliferates under permissive conditions but is unable to proliferate under non- permissive conditions in the absence of complementation by the gene on the plasmid or Bacterial Artificial Chromosome. Alternatively, duplications may be constructed as described in Roth et al. (1987) Biosynthesis of Aromatic Amino Acids in Escherichia coli and Salmonella typhimurium, F. C. Neidhardt, ed, American Society for Microbiology, publisher, pp. 2269- 2270. Such methods are familiar to those skilled in the art.

It will be appreciated that no matter how detailed the foregoing appears in text, the mvention can be practiced in many ways. As is also stated above, it should further be noted that the use of particular terminology when describing certain features or aspects of the present invention should not be taken to imply that the broadest reasonable meaning of such terminology is not intended, or that the terminology is being re-defined herein to be restricted to including any specific characteristics of the features or aspects of the invention with which that terminology is associated. Thus, although this invention has been described in terms of certain preferred embodiments, other embodiments which will be apparent to those of ordinary skill in the art in view ofthe disclosure herein are also within the scope of this invention. Accordingly, the scope of the invention is intended to be defined only by reference to the appended claims and any equivalents thereof.

Claims

WHAT IS CLAIMED IS:

2. The nucleic acid sequence of Claim 1, wherein said nucleotide sequence is complementary to at least a portion of a coding sequence of a gene whose expression is required for proliferation of a cell.

3. The nucleic acid of Claim 1, wherein said nucleic acid sequence is complementary to at least a portion of a nucleotide sequence of an RNA required for proliferation of a cell.

4. The nucleic acid of Claim 3, wherein said RNA is an RNA comprising a sequence of nucleotides encoding more than one gene product.

5. A purified or isolated nucleic acid comprising a fragment of one of SEQ ID NOs.: 1-6213, said fragment selected from the group consisting of fragments comprising at least 10, at least 20, at least 25, at least 30, at least 50 and more than 50 consecutive nucleotides of one of SEQ ID NOs: 1-6213.

6. The fragment of Claim 5, wherein said fragment is included in a nucleic acid obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum,

Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis,

Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

7. The fragment of Claim 5, wherein said fragment is included in a nucleic acid obtained from an organism other than Escherichia coli.

8. A vector comprising a promoter operably linked to the nucleic acid of any one of Claims 1-7.

9. The vector of Claim 8, wherein said promoter is active in a microorganism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum,

Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

10. A host cell containing the vector of Claim 8 or Claim 9.

11. A purified or isolated antisense nucleic acid comprising a nucleotide sequence complementary to at least a portion of an intragenic sequence, intergenic sequence, sequences spanning at least a portion of two or more genes, 5' noncoding region, or 3' noncoding region within an operon comprising a proliferation-required gene whose activity or expression is inhibited by an antisense nucleic acid comprising the nucleotide sequence of one of SEQ ID

NOs.: 1-6213.

12. The purified or isolated antisense nucleic acid of Claim 11, wherein said antisense nucleic acid is complementary to a nucleic acid from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi,

Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile,

Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species.

13. The purified or isolated antisense nucleic acid of Claim 11, wherein said nucleotide sequence is complementary to a nucleotide sequence of a nucleic acid from an organism other than E. coli.

14. The purified or isolated antisense nucleic acid of Claim 11, wherein said proliferation-required gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

15. A purified or isolated nucleic acid comprising a nucleotide sequence having at least 70% identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

1-6213, fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 1-6213, the nucleotide sequences complementary to SEQ ID NOs.: 1-6213 and the sequences complementary to fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 1- 6213 as determined using BLASTN version 2.0 with the default parameters.

16. The purified or isolated nucleic acid of Claim 15, wherein said nucleic acid is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii,

Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris,

Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

17. The nucleic acid of Claim 15, wherein said nucleic acid is obtained from an organism other than E. coli.

18. A vector comprising a promoter operably linked to a nucleic acid encoding a polypeptide whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of any one of SEQ ID NOs.: 1-6213.

19. The vector of Claim 18, wherein said nucleic acid encoding said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii,

Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis,

Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori,

Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

20. The vector of Claim 18, wherein said nucleotide sequence encoding said polypeptide is obtained from an organism other than E. coli.

21. A host cell containing the vector of Claim 18.

22. The vector of Claim 18, wherein said polypeptide comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 42398- 78581.

23. The vector of Claim 18, wherein said promoter is operably linked to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

24. A purified or isolated polypeptide comprising a polypeptide whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of any one of SEQ

ID NOs.: 1-6213, or a fragment selected from the group consisting of fragments comprising at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of one ofthe said polypeptides.

25. The polypeptide of Claim 24, wherein said polypeptide comprises an amino acid sequence of any one of SEQ ID NOs.: 42398-78581 or a fragment comprising at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

26. The polypeptide of Claim 24, wherein said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae,

Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

27. The polypeptide of Claim 24, wherein said polypeptide is obtained from an organism other than E. coli.

28. A purified or isolated polypeptide comprising a polypeptide having at least

25% amino acid identity to a polypeptide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or at least 25% amino acid identity to a fragment comprising at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of a polypeptide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 as determined using FASTA version 3.0t78 with the default parameters.

29. The polypeptide of Claim 28, wherein said polypeptide has at least 25% identity to a polypeptide comprising one of SEQ ID NOs: 42398-78581 or at least 25% identity to a fragment comprising at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60 or more than 60 consecutive amino acids of a polypeptide comprising one of SEQ ID NOs.: 42398-78581 as determined using FASTA version 3.0t78 with the default parameters.

30. The polypeptide of Claim 28, wherein said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis,

Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae,

Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

31. The polypeptide of Claim 28, wherein said polypeptide is obtained from an organism other than E. coli.

32. An antibody capable of specifically binding the polypeptide of one of Claims 28-31.

34. The method of Claim 33, further comprising the step of isolating said polypeptide.

35. The method of Claim 33, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

36. The method of Claim 33, wherein said nucleic acid encoding said polypeptide is obtained from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis,

Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

37. The method of Claim 33, wherein said nucleic acid encoding said polypeptide is obtained from an organism other than E. coli.

38. The method of Claim 33, wherein said promoter is operably linked to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.:

6214-42397.

39. A method of inhibiting proliferation of a cell in an individual comprising inhibiting the activity or reducing the amount of a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product.

40. The method of Claim 39, wherein said method comprises inhibiting said activity or reducing said amount of a gene product in an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis,

Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species.

41. The method of Claim 39, wherein said method comprises inhibiting said activity or reducing said amount of a gene product in an organism other than E. coli.

42. The method of Claim 39, wherein said gene product is present in an organism other than E. coli.

43. The method of Claim 39, wherein said gene product comprises a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

44. A method for identifying a compound which influences the activity of a gene product required for proliferation, said gene product comprising a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising: contacting said gene product with a candidate compound; and determining whether said compound influences the activity of said gene product.

45. The method of Claim 44, wherein said gene product is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale,

Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae,

46. The method of Claim 44, wherein said gene product is from an organism other thanE. coli.

47. The method of Claim 44, wherein said gene product is a polypeptide and said activity is an enzymatic activity.

48. The method of Claim 44, wherein said gene product is a polypeptide and said activity is a carbon compound catabolism activity.

49. The method of Claim 44, wherein said gene product is a polypeptide and said activity is a biosynthetic activity.

50. The method of Claim 44, wherein said gene product is a polypeptide and said activity is a transporter activity.

51. The method of Claim 44, wherem said gene product is a polypeptide and said activity is a transcriptional activity.

52. The method of Claim 44, wherein said gene product is a polypeptide and said activity is a DNA replication activity.

53. The method of Claim 44, wherein said gene product is a polypeptide and said activity is a cell division activity.

54. The method of Claim 44, wherein said gene product is an RNA.

55. The method of Claim 44, wherein said gene product is a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-

78581.

56. A compoimd identified using the method of Claim 44.

(a) contacting a target gene or RNA encoding said gene product with a candidate compound or nucleic acid; and (b) measuring an activity of said target.

58. The method of Claim 57, wherein said target gene or RNA is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata),

Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae,

Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

59. The method of Claim 57, wherein said target gene or RNA is from an organism other than E. coli.

60. The method of Claim 57, wherein said gene product is from an organism other than E. coli.

61. The method of Claim 57, wherein said target is a messenger RNA molecule and said activity is franslation of said messenger RNA.

62. The method of Claim 57, wherein said target is a messenger RNA molecule and said activity is transcription of a gene encoding said messenger RNA.

63. The method of Claim 57, wherein said target is a gene and said activity is franscription of said gene.

64. The method of Claim 57, wherein said target is a nontranslated RNA and said activity is processing or folding of said nontranslated RNA or assembly of said nontranslated RNA into a protein/RNA complex.

65. The method of Claim 57, wherein said target is a messenger RNA molecule encoding a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 42398-78581.

66. The method of Claim 57, wherein said target comprises a nucleic acid selected from the group consisting of SEQ ID NOS.: 6214-42397.

67. A compound or nucleic acid identified using the method of Claim 57.

68. A method for identifying a compound which reduces the activity or level of a gene product required for proliferation of a cell, wherein the activity or expression of said gene product is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising the steps of:

(b) contacting said sensitized cell with a compoimd; and

69. The method of Claim 68, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

70. The method of Claim 68, wherein said cell is a Gram positive bacterium.

71. The method of Claim 68, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

72. The method of Claim 68, wherein said bacterium is Staphylococcus aureus.

73. The method of Claim 72, wherein said Staphylococcus species is coagulase negative.

74. The method of Claim 72, wherein said bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

75. The method of Claim 68, wherein said cell is an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,

Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

76. The method of Claim 68, wherein said cell is not an E. coli cell.

77. The method of Claim 68, wherein said gene product is from an organism other thanE. coli.

78. The method of Claim 68, wherein said antisense nucleic acid is transcribed from an inducible promoter.

79. The method of Claim 68, further comprising the step of contacting said cell with a concenfration of inducer which induces transcription of said antisense nucleic acid to a sublethal level.

80. The method of Claim 68, wherein growth inhibition is measured by monitoring optical density of a culture growth solution.

81. The method of Claim 68, wherein said gene product is a polypeptide.

82. The method of Claim 81, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

83. The method of Claim 68, wherein said gene product is an RNA.

84. The method of Claim 68, wherein nucleic acid encoding said gene product comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397.

85. A compound identified using the method of Claim 68.

86. A method for inhibiting cellular proliferation comprising introducing an effective amount of a compound with activity against a gene whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a compound with activity against the product of said gene into a population of cells expressing said gene.

87. The method of Claim 86, wherein said compoimd is an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or a proliferation-inhibiting portion thereof.

88. The method of Claim 86, wherein said proliferation inhibiting portion of one of SEQ ID NOs.: 1-6213 is a fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 51 consecutive nucleotides of one of SEQ ID NOs. : 1 -6213.

89. The method of Claim 86, wherein said population is a population of Gram positive bacteria.

90. The method of Claim 89, wherein said population of Gram positive bacteria is selected from the group consisting of a population of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

91. The method of Claim 86, wherein said population is a population of Staphylococcus aureus.

92. The method of Claim 91, wherein said population is a population of a bacterium selected from the group consisting of Staphylococcus aureus RN450 and

Staphylococcus aureus RN4220.

93. The method of Claim 86, wherein said population is a population of a bacterium selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei,

Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus,

Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

94. The method of Claim 86, wherein said population is a population of an organism other than __. coli.

95. The method of Claim 86, wherein said product of said gene is from an organism other than E. coli.

96. The method of Claim 86, wherein said gene encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

97. The method of Claim 86, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

98. A composition comprising an effective concentration of an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1- 6213 , or a proliferation-inhibiting portion thereof in a pharmaceutically acceptable carrier.

99. The composition of Claim 98, wherein said proliferation-inhibiting portion of one of SEQ ID NOs.: 1-6213 comprises at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs.: 1-6213.

100. A method for inhibiting the activity or expression of a gene in an operon required for proliferation wherein the activity or expression of at least one gene in said operon is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213, said method comprising contacting a cell in a cell population with an antisense nucleic acid complementary to at least a portion of said operon.

101. The method of Claim 100, wherein said antisense nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a proliferation-inhibiting portion thereof.

102. The method of Claim 100, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi,

Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

103. The method of Claim 100, wherein said cell is not an E. coli cell.

104. The method of Claim 100, wherein said gene is from an organism other than E. coli.

105. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by introducing a plasmid which expresses said antisense nucleic acid into said cell population.

106. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by introducing a phage which encodes said antisense nucleic acid into said cell population.

107. The method of Claim 100, wherem said cell is contacted with said antisense nucleic acid by expressing said antisense nucleic acid from the chromosome of cells in said cell population.

108. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by introducing a promoter adjacent to a chromosomal copy of said antisense nucleic acid such that said promoter directs the transcription of said antisense nucleic acid.

109. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by introducing a retron which expresses said antisense nucleic acid into said cell population.

110. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by introducing a ribozyme into said cell-population, wherein a binding portion of said ribozyme comprises said antisense nucleic acid.

111. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by introducing a liposome comprising said antisense nucleic acid into said cell.

112. The method of Claim 100, wherein said cell is contacted with said antisense nucleic acid by electroporation of said antisense nucleic acid into said cell.

113. The method of Claim 100, wherein said antisense nucleic acid is a fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs. : 1 -6213.

114. The method of Claim 100 wherein said antisense nucleic acid is a synthetic oligonucleotide.

115. The method of Claim 100, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

116. A method for identifying a gene which is required for proliferation of a cell comprising:

(a) contacting a cell with an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, wherein said cell is a cell other than the organism from which said nucleic acid was obtained;

(b) determining whether said nucleic acid inhibits proliferation of said cell; and (c) identifying the gene in said cell which encodes the mRNA which is complementary to said antisense nucleic acid or a portion thereof.

117. The method of Claim 116, wherein said cell is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

118. The method of Claim 116 wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

119. The method of Claim 116, wherein said cell is not E. coli.

120. The method of Claim 116, further comprising operably linking said antisense nucleic acid to a promoter which is functional in said cell, said promoter being included in a vector, and infroducing said vector into said cell.

121. A method for identifying a compound having the ability to inhibit proliferation of a cell comprising: (a) identifying a homolog of a gene or gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 in a test cell, wherein said test cell is not the cell from which said nucleic acid was obtained;

(b) identifying an inhibitory nucleic acid sequence which inhibits the activity of said homolog in said test cell; (c) contacting said test cell with a sublethal level of said inhibitory nucleic acid, thus sensitizing said cell;

(d) contacting the sensitized cell of step (c) with a compound; and

122. The method of Claim 121, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

123. The method of Claim 121, wherein step (a) comprises identifying a nucleic acid homologous to a gene or gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 or a nucleic acid encoding a homologous polypeptide to a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 by using an algorithm selected from the group consisting of BLASTN version 2.0 with the default parameters and FASTA version 3.0t78 algorithm with the default parameters to identify said homologous nucleic acid or said nucleic acid encoding a homologous polypeptide in a database.

124. The method of Claim 121 wherein said step (a) comprises identifying a homologous nucleic acid or a nucleic acid comprising a sequence of nucleotides encoding a homologous polypeptide by identifying nucleic acids which hybridize to said nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 or the complement of said nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213.

125. The method of Claim 121 wherein step (a) comprises expressing a nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213 in said test cell.

126. The method of Claim 121, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in a test cell selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

127. The method of Claim 121, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in a test cell other than E. coli.

128. The method of Claim 121, wherein said inhibitory nucleic acid is an antisense nucleic acid.

129. The method of Claim 121, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion of said homolog.

130. The method of Claim 121, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion ofthe operon encoding said homolog.

131. The method of Claim 121, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises directly contacting the surface of said cell with said inhibitory nucleic acid.

132. The method of Claim 121, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises franscribing an antisense nucleic acid complementary to at least a portion ofthe RNA franscribed from said homolog in said cell.

133. The method of Claim 121, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 42398-

78581.

134. The method of Claim 121, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

135. A compound identified using the method of Claim 121.

136. A method of identifying a compound having the ability to inhibit proliferation comprising:

(a) contacting a test cell with a sublethal level of a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 or a portion thereof which inhibits the proliferation ofthe cell from which said nucleic acid was obtained, thus sensitizing said test cell;

(b) contacting the sensitized test cell of step (a) with a compound; and

(c) determining the degree to which said compound inhibits proliferation of said sensitized test cell relative to a cell which does not contain said nucleic acid.

137. The method of Claim 136, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

138. A compound identified using the method of Claim 136.

139. The method of Claim 136, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

140. The method of Claim 136, wherein the test cell is notE. coli.

141. A method for identifying a compound having activity against a biological pathway required for proliferation comprising:

(a) sensitizing a cell by providing a sublethal level of an antisense nucleic acid complementary to a nucleic acid encoding a gene product required for proliferation, wherein the activity or expression of said gene product is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, in said cell to reduce the activity or amount of said gene product;

(b) contacting the sensitized cell with a compound; and

142. The method of Claim 141, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

143. The method of Claim 141, wherein said cell is selected from the group consisting of bacterial cells, fungal cells, plant cells, and animal cells.

144. The method of Claim 141 , wherein said cell is a Gram positive bacterium.

145. The method of Claim 144, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

146. The method of Claim 145, wherein said Gram positive bacterium is Staphylococcus aureus.

147. The method of Claim 146, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

148. The method of Claim 141, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis,

149. The method of Claim 141, wherein said cell is not an E. coli cell.

150. The method of Claim 141, wherein said gene product is from an organism other thanE. coli.

151. The method of Claim 141, wherein said antisense nucleic acid is franscribed from an inducible promoter.

152. The method of Claim 141, further comprising contacting the cell with an agent which induces transcription of said antisense nucleic acid from said inducible promoter, wherein said antisense nucleic acid is transcribed at a sublethal level.

153. The method of Claim 141, wherein inhibition of proliferation is measured by monitoring the optical density of a liquid culture.

154. The method of Claim 141, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-

78581.

155. The method of Claim 141, wherem said nucleic acid encoding said gene product comprises a nucleotide sequence selected from the group consisting of SEQ ED NOS.:

6214-42397.

156. A compound identified using the method of Claim 141.

157. A method for identifying a compound having the ability to inhibit cellular proliferation comprising: (a) contacting a cell with an agent which reduces the activity or level of a gene product required for proliferation of said cell, wherein said gene product is a gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213;

(b) contacting said cell with a compound; and

(c) determining whether said compound reduces proliferation of said contacted cell by acting on said gene product.

158. The method of Claim 157, wherein said determining step comprises determining whether said compound reduces proliferation of said contacted cell to a greater extent than said compound reduces proliferation of cells which have not been contacted with said agent.

159. The method of Claim 157, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia,

Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis,

160. The method of Claim 157, wherein said cell is not an E. coli cell.

161. The method of Claim 157, wherein said gene product is from an organism other thanE. coli.

162. The method of Claim 157, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises an antisense nucleic acid to a gene or operon required for proliferation.

163. The method of Claim 157, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises a compound known to inhibit growth or proliferation of a cell.

164. The method of Claim 157, wherein said cell contains a mutation which reduces the activity or level of said gene product required for proliferation of said cell.

165. The method of Claim 157, wherein said mutation is a temperature sensitive mutation.

166. The method of Claim 157, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-

78581.

167. A compound identified using the method of Claim 157.

168. A method for identifying the biological pathway in which a proliferation- required gene or its gene product lies, wherein said gene or gene product comprises a gene or gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ED NOs.: 1-6213, said method comprising:

(a) providing a sublethal level of an antisense nucleic acid which inhibits the activity of said proliferation-required gene or gene product in a test cell;

(b) contacting said test cell with a compound known to inhibit growth or proliferation of a cell, wherein the biological pathway on which said compound acts is known; and

(c) determining the degree to which said proliferation of said test cell is inhibited relative to a cell which was not contacted with said compound.

169. The method of Claim 168, wherein said determining step comprises determining whether said test cell has a substantially greater sensitivity to said compound than a cell which does not express said sublethal level of said antisense nucleic acid.

170. The method of Claim 168, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

171. The method of Claim 168, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

172. The method of Claim 168, wherein said test cell is not an __. coli cell.

173. The method of Claim 168, wherein said gene product is from an organism other than E. coli.

174. A method for determining the biological pathway on which a test compound acts comprising:

(a) providing a sublethal level of an antisense nucleic acid complementary to a proliferation-required nucleic acid in a first cell, wherein the activity or expression of said proliferation-required nucleic acid is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ID NOs.: 1-6213 and wherem the biological pathway in which said proliferation-required nucleic acid or a protein encoded by said proliferation-required nucleic acid lies is known, (b) contacting said first cell with said test compound; and (c) determining the degree to which said test compound inhibits proliferation of said first cell relative to a cell which does not contain said antisense nucleic acid.

175. The method of Claim 174, wherein said determining step comprises determining whether said first cell has a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said antisense nucleic acid.

176. The method of Claim 174, further comprising:

177. The method of Claim 174, wherein said first cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

178. The method of Claim 174, wherein said first cell is not an E. coli cell.

179. The method of Claim 174, wherein said proliferation-required nucleic acid is from an organism other than E. coli.

181. A compound which interacts with a gene or gene product whose activity or expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of one of

SEQ ID NOs.: 1-6213 to inhibit proliferation.

182. The compound of Claim 181, wherein said gene product is a polypeptide comprising one of SEQ ID NOs.: 42398-78581.

183. The compound of Claim 181, wherein said gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397.

184. A compound which interacts with a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence of one of SEQ ED NOs.: 1-6213 to inhibit proliferation.

186. The method of Claim 185, wherein said screening step comprises performing any one ofthe methods of Claims 44, 68, 121, 136, 141, and 157.

187. The method of Claim 185, wherein said gene product is a polypeptide comprising one of SEQ ID NOs:42398-78581.

189. The method of Claim 188 wherein said subject is selected from the group consisting of vertebrates, mammals, avians, and human beings.

190. The method of Claim 188, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398- 78581.

191. The method of Claim 188, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi,

192. The method of Claim 188, wherein said cell is not E. coli.

193. The method of Claim 188, wherein said gene product is from an organism other thanE. coli.

194. A purified or isolated nucleic acid consisting essentially ofthe coding sequence of one of SEQ ED NOs: 6214-42397.

195. A fragment ofthe nucleic acid of Claim 8, said fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ID NOs: 6214-42397.

196. A purified or isolated nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397, fragments comprising at least 25 consecutive nucleotides of SEQ ID NOs.: 6214-42397, the nucleotide sequences complementary to SEQ ID NOs.:6214- 42397, and the nucleotide sequences complementary to fragments comprising at least 25 consecutive nucleotides of SEQ ED NOs.: 6214-42397 as determined using BLASTN version 2.0 with the default parameters.

197. The nucleic acid of Claim 196, wherein said nucleic acid is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae,

Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

198. The nucleic acid of Claim 196, wherein said nucleic acid is from an organism other than E. coli.

199. A method of inhibiting proliferation of a cell comprising inhibiting the activity or reducing the amount of a gene product in said cell or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product in said cell, wherein said gene product is selected from the group consisting of a gene product having having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using

BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs:l-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213.

200. The method of Claim 199, wherein said method comprises inhibiting said activity or reducing said amount of said gene product or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product in an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli,

Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae,

201. The method of Claim 199, wherein said method comprises inhibiting said activity or reducing said amount of said gene product or inhibiting the activity or reducing the amount of a nucleic acid encoding said gene product in an organism other than E. coli.

202. The method of Claim 199, wherein said gene product is from an organism other than __. coli.

203. The method of Claim 199, wherein said gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

204. The method of Claim 199, wherein said gene product is encoded by a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucloetide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate condtions.

205. A method for identifying a compound which influences the activity of a gene product required for proliferation comprising: contacting a candidate compound with a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:l- 6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ED NOs: 1-6213; and determining whether said candidate compound influences the activity of said gene product.

206. The method of Claim 205, wherein said gene product is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale,

Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei,

Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata),

Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae,

Chlamydia frachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae,

Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium,

Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum,

Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa,

Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis,

Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

207. The method of Claim 205, wherein said gene product is from an organism other than E. coli.

208. The method of Claim 205, wherein said gene product is a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

209. The method of Claim 205, wherein said gene product is encoded by a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID

NOS.: 6214-42397, a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under stringent conditions, and a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

210. A compound identified using the method of Claim 205.

(a) providing a target that is a gene or RNA, wherein said target comprises a nucleic acid that encodes a gene product selected from the group consisting of a gene product having having at least 70% nucleotide sequence identity as determined using

BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 -6213 , a gene product having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ED NOs: 1-6213;

(b) contacting said target with a candidate compound or nucleic acid; and

(c) measuring an activity of said target.

212. The method of Claim 211, wherein said target gene or RNA is from an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum,

Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum,

Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

213. The method of Claim 211, wherein said target gene or RNA is from an organism other than E. coli.

214. The method of Claim 211, wherein said gene product is from an organism other than E. coli.

215. The method of Claim 211, wherein said target is a messenger RNA molecule and said activity is translation of said messenger RNA.

216. The method of Claim 211, wherein said compound is a nucleic acid and said activity is translation of said gene product.

217. The method of Claim 211, wherein said target is a gene and said activity is franscription of said gene.

218. The method of Claim 211, wherein said target is a nontranslated RNA and said activity is processing or folding of said nontranslated RNA or assembly of said nontranslated

RNA into a protein/RNA complex.

219. The method of Claim 211, wherein said target gene is a messenger RNA molecule encoding a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

220. The method of Claim 11, wherein said target gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214- 42397, a nucleic acid wliich hybridizes to a sequence selected from the group consisting of SEQ D NOS.: 6214-42397 under stringent conditions, and a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

221. A compound or nucleic acid identified using the method of Claim 211.

222. A method for identifying a compound which reduces the activity or level of a gene product required for proliferation of a cell comprising:

(a) providing a sublethal level of an antisense nucleic acid complementary to a nucleic acid encoding said gene product in a cell to reduce the activity or amount of said gene product in said cell, thereby producing a sensitized cell, wherein said gene product is selected from the group consisting of a gene product having having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs. : 1 -6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213;

(b) contacting said sensitized cell with a compound; and

(c) determining the degree to wliich said compound inhibits the growth of said sensitized cell relative to a cell which does not contain said antisense nucleic acid.

223. The method of Claim 222, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

224. The method of Claim 222, wherein said sensitized cell is a Gram positive bacterium.

225. The method of Claim 224, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

226. The method of Claim 225, wherein said bacterium is Staphylococcus aureus.

227. The method of Claim 224, wherein said Staphylococcus species is coagulase negative.

228. The method of Claim 226, wherein said bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

229. The method of Claim 222, wherein said sensitized cell is an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae,

Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus,

230. The method of Claim 222, wherem said cell is an organism other than E. coli.

231. The method of Claim 222, wherein said gene product is from an organism other than E. coli.

232. The method of Claim 222, wherein said antisense nucleic acid is transcribed from an inducible promoter.

233. The method of Claim 222, further comprising the step of contacting said cell with a concentration of inducer which induces transcription of said antisense nucleic acid to a sublethal level.

234. The method of Claim 222, wherein growth inhibition is measured by monitoring optical density of a culture medium.

235. The method of Claim 222, wherein said gene product is a polypeptide.

236. The method of Claim 235, wherein said polypeptide comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

237. The method of Claim 222, wherein said gene product is an RNA.

238. The method of Claim 222, wherein said nucleic acid encoding said gene product comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

239. A compound identified using the method of Claim 222.

240. A method for inhibiting cellular proliferation comprising introducing a compound with activity against a gene product or a compound with activity against a gene encoding said gene product into a population of cells expressing said gene product, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ

ID NOs: 1-6213.

241. The method of Claim 240, wherein said compound is an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, or a proliferation-inhibiting portion thereof.

242. The method of Claim 240, wherein said proliferation inhibiting portion of one of SEQ ID NOs.: 1-6213 is a fragment comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 51 consecutive nucleotides of one of SEQ ID NOs.: 1-6213.

243. The method of Claim 240, wherein said population is a population of Gram positive bacteria.

244. The method of Claim 243, wherein said population of Gram positive bacteria is selected from the group consisting of a population of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

245. The method of Claim 243, wherein said population is a population of

Staphylococcus aureus.

246. The method of Claim 245, wherein said population is a population of a bacterium selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

247. The method of Claim 240, wherein said population is a population of a bacterium selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum,

Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa,

Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

248. The method of Claim 240, wherein said population is a population of an organism other than E. coli.

249. The method of Claim 240, wherein said product of said gene is from an organism other than E. coli.

250. The method of Claim 240, wherein said gene product is selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42398- 78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42398-78581.

251. The method of Claim 240, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-

42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

252. A preparation comprising an effective concentration of an antisense nucleic acid in a pharmaceutically acceptable carrier wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid comprising a sequence having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-

6213 or a proliferation-inhibiting portion thereof, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ DD NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions.

253. The preparation of Claim 252, wherein said proliferation-inhibiting portion of one of SEQ ED NOs.: 1-6213 comprises at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ED NOs.: 1-6213.

254. A method for inhibiting the activity or expression of a gene in an operon which encodes a gene product required for proliferation comprising contacting a cell in a cell population with an antisense nucleic acid comprising at least a proliferation-inhibiting portion of said operon in an antisense orientation, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213.

255. The method of Claim 254, wherein said antisense nucleic acid comprises a nucleotide sequence having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide seqence selected from the group consisting of SEQ ID NOs.: 1-6213, a proliferation inhibiting portion thereof, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, and a nucleic acid which comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions.

256. The method of Claim 254, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia,

Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species .

257. The method of Claim 254, wherein said cell is not an E. coli cell.

258. The method of Claim 254, wherein said gene is from an organism other than E. coli.

259. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by introducing a plasmid which transcribes said antisense nucleic acid into said cell population.

260. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by introducing a phage which transcribes said antisense nucleic acid into said cell population.

261. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by franscribing said antisense nucleic acid from the chromosome of cells in said cell population.

262. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by introducing a promoter adjacent to a chromosomal copy of said antisense nucleic acid such that said promoter directs the synthesis of said antisense nucleic acid.

263. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by introducing a retron which expresses said antisense nucleic acid into said cell population.

264. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by introducing a ribozyme into said cell-population, wherein a binding portion of said ribozyme is complementary to said antisense oligonucleotide.

265. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by infroducing a liposome comprising said antisense oligonucleotide into said cell.

266. The method of Claim 254, wherein said cell is contacted with said antisense nucleic acid by electroporation of said antisense nucleic acid into said cell.

267. The method of Claim 254, wherein said antisense nucleic acid has at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence comprising at least 10, at least 20, at least 25, at least 30, at least 50 or more than 50 consecutive nucleotides of one of SEQ ED NOs.: 1-6213.

268. The method of Claim 254 wherein said antisense nucleic acid is a synthetic oligonucleotide.

269. The method of Claim 254, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214- 42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate condtions.

270. A method for identifying a gene which is required for proliferation of a cell comprising:

(a) contacting a cell with an antisense nucleic acid selected from the group consisting of a nucleic acid at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 or a proliferation-inhibiting portion thereof, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, wherein said cell is a cell other than the organism from which said nucleic acid was obtained;

271. The method of Claim 270, wherein said cell is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

272. The method of Claim 270 wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia frachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris,

273. The method of Claim 270, wherein said cell is not E. coli.

274. The method of Claim 270, further comprising operably linking said antisense nucleic acid to a promoter which is functional in said cell, said promoter being included in a vector, and infroducing said vector into said cell.

275. A method for identifying a compound having the ability to inhibit proliferation of a cell comprising: (a) identifying a homolog of a gene or gene product whose activity or level is inhibited by an antisense nucleic acid in a test cell, wherein said test cell is not the microorgaism from which the antisense nucleic acid was obtained, wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOs. 1-6213, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions;

(d) contacting the sensitized cell of step (c) with a compound; and

276. The method of Claim 275, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

277. The method of Claim 275, wherein step (a) comprises identifying a homologous nucleic acid to a gene or gene product whose activity or level is inhibited by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOs. 1-6213 or a nucleic acid encoding a homologous polypeptide to a polypeptide whose activity or level is inhibited by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs. 1-6213 by using an algorithm selected from the group consisting of BLASTN version 2.0 with the default parameters and FASTA version 3.0t78 algorithm with the default parameters to identify said homologous nucleic acid or said nucleic acid encoding a homologous polypeptide in a database.

278. The method of Claim 275 wherein said step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide by identifying nucleic acids comprising nucleotide sequences which hybridize to said nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOs. 1-6213 or the complement of the nucleotide sequence of said nucleic acid selected from the group consisting of SEQ ID NOs. 1-6213.

279. The method of Claim 275 wherein step (a) comprises expressing a nucleic acid having at least 70% nucleic acid identity as determined using BLASTN version 2.0 with the default parameters to a sequence selected from the group consisting of SEQ ID NOs. 1-6213 in said test cell.

280. The method of Claim 275, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in an test cell selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum,

281. The method of Claim 275, wherein step (a) comprises identifying a homologous nucleic acid or a nucleic acid encoding a homologous polypeptide in a test cell other than E. coli.

282. The method of Claim 275, wherein said inhibitory nucleic acid is an antisense nucleic acid.

283. The method of Claim 275, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion of said homolog.

284. The method of Claim 275, wherein said inhibitory nucleic acid comprises an antisense nucleic acid to a portion ofthe operon encoding said homolog.

285. The method of Claim 275, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises directly contacting said cell with said inhibitory nucleic acid.

286. The method of Claim 275, wherein the step of contacting the cell with a sublethal level of said inhibitory nucleic acid comprises expressing an antisense nucleic acid to said homolog in said cell.

287. The method of Claim 275, wherein said gene product comprises a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 42398- 78581.

288. The method of Claim 275, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate condtions.

289. A compound identified using the method of Claim 275.

290. A method of identifying a compound having the ability to inhibit proliferation comprising: (a) sensitizing a test cell by contacting said test cell with a sublethal level of an antisense nucleic acid, wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOs. 1-6213 or a portion thereof which inhibits the proliferation ofthe cell from which said nucleic acid was obtained, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditionst;

(b) contacting the sensitized test cell of step (a) with a compound; and

(c) determining the degree to which said compound inhibits proliferation of said sensitized test cell relative to a cell which does not contain said antisense nucleic acid.

291. The method of Claim 290, wherein said determining step comprises determining whether said compound inhibits proliferation of said sensitized test cell to a greater extent than said compound inhibits proliferation of a nonsensitized test cell.

292. A compound identified using the method of Claim 290.

293. The method of Claim 290, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis,

294. The method of Claim 290, wherein the test cell is not E. coli.

295. A method for identifying a compound having activity against a biological pathway required for proliferation comprising:

(a) sensitizing a cell by providing a sublethal level of an antisense nucleic acid complementary to a nucleic acid encoding a gene product required for proliferation, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 -6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213;

(b) contacting the sensitized cell with a compound; and

(c) determining the extent to which said compound inhibits the growth of said sensitized cell relative to a cell which does not contain said antisense nucleic acid.

296. The method of Claim 295, wherein said determining step comprises determining whether said compound inhibits the growth of said sensitized cell to a greater extent than said compound inhibits the growth of a nonsensitized cell.

297. The method of Claim 295, wherein said cell is selected from the group consisting of bacterial cells, fungal cells, plant cells, and animal cells.

298. The method of Claim 295, wherein said cell is a Gram positive bacterium.

299. The method of Claim 298, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus species, Streptococcus species, Enterococcus species, Mycobacterium species, Clostridium species, and Bacillus species.

300. The method of Claim 299, wherein said Gram positive bacterium is Staphylococcus aureus.

301. The method of Claim 298, wherein said Gram positive bacterium is selected from the group consisting of Staphylococcus aureus RN450 and Staphylococcus aureus RN4220.

302. The method of Claim 295, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

303. The method of Claim 295, wherein said cell is not an E. coli cell.

304. The method of Claim 295, wherein said gene product is from an organism other thanE. coli.

305. The method of Claim 295, wherein said antisense nucleic acid is transcribed from an inducible promoter.

306. The method of Claim 305, further comprising contacting the cell with an agent which induces expression of said antisense nucleic acid from said inducible promoter, wherem said antisense nucleic acid is expressed at a sublethal level.

307. The method of Claim 295, wherein inhibition of proliferation is measured by monitoring the optical density of a liquid culture.

308. The method of Claim 295, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a sequence selected from the group consisting of SEQ ED NOs.: 42398-

78581.

309. The method of Claim 295, wherein said nucleic acid encoding said gene product comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate condtions.

310. A compound identified using the method of Claim 295.

311. A method for identifying a compound having the ability to inhibit cellular proliferation comprising:

(a) contacting a cell with an agent which reduces the activity or level of a gene product required for proliferation of said cell, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:l-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213; (b) contacting said cell with a compound; and

(c) determining the degree to which said compound reduces proliferation of said contacted cell relative to a cell which was not contacted with said agent.

312. The method of Claim 311, wherein said determining step comprises determining whether said compound reduces proliferation of said contacted cell to a greater extent than said compound reduces proliferation of cells which have not been contacted with said agent.

313. The method of Claim 311, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersmia enterocolitica, Yersinia pestis and any species falling -within the genera of any ofthe above species.

314. The method of Claim 311, wherein said cell is not an E. coli cell.

315. The method of Claim 311, wherein said gene product is from an organism other than ?. coli.

316. The method of Claim 311, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises an antisense nucleic acid to a gene or operon required for proliferation.

317. The method of Claim 311, wherein said agent which reduces the activity or level of a gene product required for proliferation of said cell comprises a compound known to inhibit growth or proliferation of a cell.

318. The method of Claim 311, wherein said cell contains a mutation which reduces the activity or level of said gene product required for proliferation of said cell.

319. The method of Claim 311, wherem said mutation is a temperature sensitive mutation.

320. The method of Claim 311, wherein said gene product comprises a gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ED NOs.: 42398-78581.

321. A compound identified using the method of Claim 311.

322. A method for identifying the biological pathway in which a proliferation- required gene product or a gene encoding a proliferation-required gene product lies comprising: (a) providing a sublethal level of an antisense nucleic acid which inhibits the activity or reduces the level of said gene encoding a proliferation-required gene product or said said proliferation-required gene product in a test cell, wherein said proliferation- required gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213;

(b) contacting said test cell with a compound known to inhibit growth or proliferation of a cell, wherein the biological pathway on which said compound acts is known; and (c) determining the degree to which said compound inhibits proliferation of said test cell relative to a cell which does not contain said antisense nucleic acid.

323. The method of Claim 322, wherein said determining step comprises determining whether said test cell has a substantially greater sensitivity to said compound than a cell which does not express said sublethal level of said antisense nucleic acid.

324. The method of Claim 322, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

325. The method of Claim 322, wherein said test cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia,

Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi,

326. The method of Claim 322, wherein said test cell is not an E. coli cell.

327. The method of Claim 322, wherein said gene product is from an organism other than E. coli.

(a) providing a sublethal level of an antisense nucleic acid complementary to a proliferation-required nucleic acid in a cell, thereby producing a sensitized cell, wherein said antisense nucleic acid is selected from the group consisting of a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 or a proliferation-inhibiting portion thereof,a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions and wherein the biological pathway in which said proliferation-required nucleic acid or a protein encoded by said proliferation-required polypeptide lies is known,

(b) contacting said cell with said test compound; and (c) determining the degree to which said compound inhibits proliferation of said sensitized cell relative to a cell which does not contain said antisense nucleic acid.

329. The method of Claim 328, wherein said determining step comprises determining whether said sensitized cell has a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said antisense nucleic acid.

330. The method of Claim 328, further comprising: (d) providing a sublethal level of a second antisense nucleic acid complementary to a second proliferation-required nucleic acid in a second cell, wherein said second proliferation-required nucleic acid is in a different biological pathway than said proliferation-required nucleic acid in step (a); and (e) determining whether said second cell does not have a substantially greater sensitivity to said test compound than a cell which does not express said sublethal level of said second antisense nucleic acid, wherein said test compound is specific for the biological pathway against which the antisense nucleic acid of step (a) acts if said sensitized cell has substantially greater sensitivity to said test compound than said second cell.

331. The method of Claim 328, wherein said sensitized cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis,

Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia frachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, , Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella cataπhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

332. The method of Claim 328, wherein said sensitized cell is not an E. coli cell.

333. The method of Claim 328, wherein said proliferation-required nucleic acid is from an organism other than E. coli.

334. A compound which inhibits proliferation by interacting with a gene encoding a gene product required for proliferation or with a gene product required for proliferation, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-6213.

335. The compound of Claim 334, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a sequence selected from the group consisting of SEQ ID NOs.:

42398-78581.

336. The compound of Claim 334, wherein said gene comprises a nucleic acid selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-

337. A method for manufacturing an antibiotic comprising the steps of: screening one or more candidate compounds to identify a compound that reduces the activity or level of a gene product required for proliferation wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ED NOs: 1 -6213 ; and manufacturing the compound so identified.

338. The method of Claim 337, wherein said screening step comprises performing any one ofthe methods of Claims 205, 211, 222, 275, 290, 295, 311.

339. The method of Claim 337, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42398-78581.

340. A method for inhibiting proliferation of a cell in a subject comprising administering an effective amount of a compound that reduces the activity or level of a gene product required for proliferation of said cell, wherein said gene product is selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25%, amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleic acid selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid selected from the group consisting of SEQ ED NOs: 1-6213.

341. The method of Claim 340 wherem said subject is selected from the group consisting of vertebrates, mammals, avians, and human beings.

342. The method of Claim 340, wherein said gene product comprises a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to an amino acid sequence selected from the group consisting of SEQ D NOs.: 42398-78581.

343. The method of Claim 340, wherein said cell is selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Boπelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum,

Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonoπhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Sfreptococcus pneumoniae, Streptococcus mutans, Sfreptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any ofthe above species.

344. The method of Claim 340, wherein said cell is not E. coli.

345. The method of Claim 340, wherem said gene product is from an organism other than E. coli.

346. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

347. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 6214-42397 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

348. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

349. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:

1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

350. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture.

351. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

352. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.

353. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said strains which overexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

354. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said strains which overexpress said gene products a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

355. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said culture.

356. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.

357. The method of Claim 356, wherein the products of said amplification reaction are labeled with a detectable dye.

358. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said identification step comprises performing a hybridization procedure.

359. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said identification step comprises contacting a nucleic acid anay with a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.

360. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

361. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said culture is a culture of an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis,

362. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said compound is obtained from a library of natural compounds.

363. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said compound is obtained from a library of synthetic compounds.

364. The method of Claim 346, 347, 348, 349, 350 or 351, wherein said compound is present in a crude or partially purified state.

365. The method of Claim 346, 347, 348, 349, 350 or 351, further comprising determining whether said gene product in said strain which proliferated more rapidly in said culture has a counterpart in at least one other organism.

366. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting said anay of strains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly on said solid medium.

367. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of

SEQ ID NOs.: 6214-42397 is overexpressed; contacting said anay of sfrains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

368. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 42938-

78581 is overexpressed; contacting said anay of strains with a sufficient concenfration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

369. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of sfrains on a solid growth medium wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed; contacting said anay of sfrains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

370. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of sfrains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting said anay of strains with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

371. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an anay of strains on a solid growth medium wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ED NOs: 42938-78581 is overexpressed; contacting said anay of sfrains with a sufficient concenfration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly on said solid medium.

372. The method of Claim 366, 367, 368, 369, 370 or 371, wherem at least one strain in said anay does not overexpresses a gene product which is essential for proliferation of said organism.

373. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

374. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed; contacting each of said cultures with a different concenfration of said compound; and identifying the gene product which is overexpressed in a sfrain whose proliferation is inhibited by said compound.

375. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ

ID NOs.: 42938-78581 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a sfrain whose proliferation is inhibited by said compound.

376. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of

SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed; contacting each of said cultures with a different concenfration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

377. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a sfrain whose proliferation is inhibited by said compound.

378. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%, amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

379. The method of Claim 373, 374, 375, 376, 377 or 378, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.

380. A method of profiling a compound' s activity comprising: performing the method of Claim 346 on a first culture using a first compound; performing the method of Claim 346 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

381. A method of profiling a compound' s activity comprising: performing the method of Claim 347 on a first culture using a first compound; performing the method of Claim 347 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

382. A method of profiling a compound's activity comprising: performing the method of Claim 348 on a first culture using a first compound; performing the method of Claim 348 on a second culture using a second compound; and comparing the strains identified in said first culture to the sfrains identified in said second culture.

383. A method of profiling a compound's activity comprising: performing the method of Claim 349 on a first culture using a first compound; performing the method of Claim 349 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

384. A method of profiling a compound's activity comprising: performing the method of Claim 350 on a first culture using a first compound; performing the method of Claim 350 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture.

385. A method of profiling a compound' s activity comprising: performing the method of Claim 351 on a first culture using a first compound; performing the method of Claim 351 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture.

386. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

387. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

388. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

389. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of

SEQ ED NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of sfrains wliich grow on said second solid medium.

390. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherem each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

391. A method of profiling a first compound ' s activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each sfrain in said anay overexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0f78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ED NOs: 42938-78581 is overexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

392. The method of any one of Claims 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390 or 391, wherein said first compound is present in a crude or partially purified state.

393. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

394. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of

SEQ ID NOs.: 6214-42397 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

395. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938- 78581 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compoxmd acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

396. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sframs wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70%, nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide, sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compoimd acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

397. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate conditions is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

398. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherem each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture.

399. The method of Claim 393, 394, 395, 396, 397 or 398, wherein at least one sfrain in said culture does not underexpresses a gene product which is essential for proliferation of said organism.

400. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said strains which underexpresess said gehe products comprise a nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

401. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said strains which underexpress said gene products express an antisense nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism, wherein expression of said antisense nucleic acid reduces expression of said gene product in said sfrain.

402. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said sfrain which proliferated more slowly.

403. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more slowly.

404. The method of Claim 393, 394, 395, 396, 397 or 398, wherein the products of said amplification reaction are labeled with a detectable dye.

405. The method of Claim 404, wherein said identification step comprises performing a hybridization procedure.

406. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said identification step comprises contacting a nucleic acid anay with a nucleic acid encoding said gene product in said cell which proliferated more slowly.

407. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said organism is selected from the group consisting of bacteria, fungi, protozoa.

408. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said culture is a culture of an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis,

409. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said compound is obtained from a library of natural compounds.

410. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said compound is obtained from a library of synthetic compounds.

411. The method of Claim 393, 394, 395, 396, 397 or 398, wherein said compound is present in a crude or partially purified state.

412. The method of Claim 393, 394, 395, 396, 397 or 398, further comprising determining whether said gene product in said sfrain which proliferated more slowly in said culture has a counterpart in at least one other organism.

413. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

414. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed; contacting each of said cultures with a different concenfration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

415. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ED NOs. : 42938-78581 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

416. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

417. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

418. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0x78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed; contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

419. A method of profiling a compound's activity comprising: performing the method of Claim 393 on a first culture using a first compound; performing the method of Claim 393 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture.

420. A method of profiling a compound's activity comprising: performing the method of Claim 394 on a first culture using a first compound; performing the method of Claim 394 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture.

421. A method of profiling a compound ' s activity comprising: performing the method of Claim 395 on a first culture using a first compound; performing the method of Claim 395 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

422. A method of profiling a compound's activity comprising performing the method of Claim 396 on a first culture using a first compound; performing the method of Claim 396 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

423. A method of profiling a compound' s activity comprising performing the method of Claim 397 on a first culture using a first compound; performing the method of Claim 397 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the strains identified in said second culture.

424. A method of profiling a compound's activity comprising performing the method of Claim 398 on a first culture using a first compound; performing the method of Claim 398 on a second culture using a second compound; and comparing the sfrains identified in said first culture to the sfrains identified in said second culture.

425. A method of profiling a first compound' s activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

426. A method of profiling a first compound's activity comprising: growing an anay of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

427. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherem said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ DD NOs.: 42938-78581 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

428. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs:

1-6213 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

429. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of an organism , wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under sfringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate conditions is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains wliich grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

430. A method of profiling a first compound's activity comprising: growing an anay of sfrains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said anay comprises a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of an organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of

SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed, and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of sfrains which grow on said first solid medium with the pattern of sfrains which grow on said second solid medium.

431. The method of any one of Claims 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429 or 430, wherein said first compound is present in a crude or partially purified state.

432. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs. : 1 -6213 is underexpressed; contacting each of said plurality of cultures with a varying concenfration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

433. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed; contacting each of said plurality of cultures with a varying concenfration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

434. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938- 78581 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

435. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25%, amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is underexpressed; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

436. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate conditions is underexpressed; contacting each of said plurality of cultures with a varying concenfration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

437. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25 Vo amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ED NOs: 42938-78581 is underexpressed; contacting each of said plurality of cultures with a varying concenfration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism; and identifying the gene product which is underexpressed in a sfrain whose rate of proliferation is reduced by said compound.

438. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed.

439. A culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed.

440. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from . the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed.

441. A culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70%, nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1- 6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213 is overexpressed.

442. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is overexpressed.

443. A culture comprising a plurality of sfrains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938- 78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed.

444. The culture of Claim 438, 439, 440, 441, 442 or 443, wherein said sfrains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

445. The culture of Claim 438, 439, 440, 441, 442 or 443, wherein said sfrains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

446. The culture of Claim 438, 439, 440, 441, 442 or 443, wherein said culture is a culture of an organism selected from the group consisting of Acinetobacter baumannii,

447. A culture comprising a a plurality of sfrains wherem each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed.

448. A culture comprising a a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is underexpressed.

449. A culture comprising a a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 42938-78581 is underexpressed.

450. A culture comprising a a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version

2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1- 6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213 is underexpressed.

451. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed.

452. A culture comprising a a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0x78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is underexpressed.

453. The culture of Claim 447, 448, 449, 450, 451 or 452, wherein said sfrains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

454. The culture of Claim 447, 448, 449, 450, 451 or 452, wherein said sfrains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

455. The culture of Claim 447, 448, 449, 450, 451 or 452, wherein said culture is a culture of an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum,

Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Legionella pneumophila, Listeria monocytogenes, Moraxella catarrhalis, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas syringae, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificans, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species.

456. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

457. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

458. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each ofthe overexpressed genes, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ DD NOs.: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

459. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sframs of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

460. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each ofthe overexpressed genes, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under moderate conditions is overexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that sfrains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

461. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain overexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the overexpressed genes, wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%, amino acid identity as determined using FASTA version 3.0x78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which do not overexpress said gene product on which said compound acts, such that sframs which overexpress said gene product on which said compound acts proliferate more rapidly than sfrains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

462. The method of Claim 456, 457, 458, 459, 460 or 461, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate overexpression of said gene products.

463. The method of Claim 456, 457, 458, 459, 460 or 461, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates overexpression of said gene products.

464. The method of Claim 463, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a franscriptional activator, a franscriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upsfream activating sequence.

465. The method of Claim 456, 457, 458, 459, 460 or 461, wherein the step of identifying the gene product which is overexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene comprises performing an amplification reaction and detecting a unique amplification product conesponding to said gene.

466. The method of Claim 462, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

467. The method of Claim 462, wherein the native promoters ofthe genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

468. The method of Claim 462, wherein said promoters which replaced the native promoters in each sfrain comprise regulatable promoters.

469. The method of Claim 462, wherein said promoters which replaced the native promoters in each sfrain each strain comprise constitutive promoters.

470. The method of Claim 456, 457, 458, 459, 460 or 461, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

471. The method of Claim 456, 457, 458, 459, 460 or 461, wherem said culture is a culture of an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium acetobutylicum, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidioides immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori,

472. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each ofthe underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes and wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

473. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each ofthe underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes and wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 6214-42397 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

474. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each ofthe underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each ofthe underexpressed genes, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

475. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each ofthe underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each ofthe underexpressed genes, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ D NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs: 1 -6213 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

476. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each sfrain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each ofthe underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ DD NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under sfringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397 under moderate conditions is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

477. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of sfrains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each ofthe underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product conesponding to each of the underexpressed genes , wherein said culture comprises a sfrain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ D NOs:

42938-78581 is underexpressed; contacting said culture with a sufficient concenfration of said compound to inhibit the proliferation of sfrains of said organism which underexpress said gene product on which said compound acts, such that sfrains which underexpress said gene product on which said compound acts proliferate more slowly than sfrains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a sfrain which proliferated more rapidly in said culture by detecting the unique product conesponding to said gene.

478. The method of Claim 472, 473, 474, 475, 476 or 477, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate underexpression of said gene products.

479. The method of Claim 472, 473, 474, 475, 476 or 477, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates underexpression of said gene products.

480. The method of Claim 479, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a franscriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upsfream activating sequence.

481. The method of Claim 472, 473, 474, 475, 476 or 477, wherein the step of identifying the gene product which is underexpressed in a sfrain which proliferated more slowly in said culture by detecting the unique product conesponding to said gene comprises performing an amplification reaction and detecting a unique amplification product conesponding to said gene.

482. The method of Claim 478, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

483. The method of Claim 478, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

484. The method of Claim 478, wherein said promoters which replaced the native promoters in each sfrain comprise regulatable promoters.

485. The method of Claim 478, wherein said promoters which replaced the native promoters in each sfrain each sfrain comprise constitutive promoters.

486. The method of Claim 472, 473, 474, 475, 476 or 477, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

487. The method of Claim 472, 473, 474, 475, 476 or 477, wherein said culture is a culture of an organism selected from the group consisting of Acinetobacter baumannii, Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia burgdorferi, Burkholderia cepacia, Burkholderia fungorum, Burkholderia mallei, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii,

488. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of sframs wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction.

489. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sframs comprises a plurality of sframs wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 6214-42397 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction.

490. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism, wherein said culture comprises a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

491. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version

2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ D NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs: 1-6213 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction.

492. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ DD NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction.

493. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using

FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ DD NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 42938-78581 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

494. The method of Claim 488, 489, 490, 491, 492 or 493, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

495. The method of Claim 488, 489, 490, 491, 492 or 493, wherein: said nucleic acid sample is divided into N aliquots; and said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherem one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

496. The method of Claim 494, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

497. The method of Claim 488, 489, 490, 491, 492 or 493, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one ofthe primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

498. The method of Claim 496, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

499. The method of Claim 496, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.

500. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherem said culture or collection of strains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherem said culture or collection of sfrains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of sfrains comprises the same sfrains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 is overexpressed or underexpressed.

501. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of sfrains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of strains comprises the same strains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 6214-42397 is overexpressed or underexpressed.

502. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of sfrains comprises the same strains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a sfrain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 42938-78581 is overexpressed or underexpressed.

503. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of sfrains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version

2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs: 1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs: 1-6213 is overexpressed or underexpressed.

504. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of sfrains wherein said culture or collection of sfrains comprises the same sfrains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second cultures or collection of sfrains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed.

505. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains wherein each sfrain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of sfrains comprises the same strains as said first culture or collection of sfrains wherein said second culture or collection of sfrains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product conesponding to said amplification product is the target of said compound if said culture or sfrain overexpresses said gene products, wherein said first and second culture or collection of sfrains comprise a sfrain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ DD NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ DD NOs:

42938-78581 is overexpressed or underexpressed.

506. The method of Claim 500, 501, 502, 503, 504 or 505, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

507. The method of Claim 500, 501, 502, 503, 504 or 505, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one ofthe primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

508. The method of Claim 500, 501, 502, 503, 504 or 505, wherem the native promoters for each of said genes were replaced with the same regulatable promoter.

509. The method of Claim 500, 501, 502, 503, 504 or 505, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the confrol of a different regulatable promoter.

510. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 is overexpressed or underexpressed.

511. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 6214-42397 is overexpressed or underexpressed.

512. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sframs; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ DD

NOs.: 42938-78581 is overexpressed or underexpressed.

513. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213, a gene product having at least 25%, amino acid identity as determined using FASTA version 3.0x78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.:

1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6213 is overexpressed or underexpressed.

514. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 6214- 42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed.

515. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sframs wherein said culture or collection of sfrains comprises a plurality of sfrains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ED NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ DD NOs: 42938-78581 is overexpressed or underexpressed.

516. The method of Claim 510, 511, 512, 513, 514 or 515, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

517. The method of Claim 510, 511, 512, 513, 514 or 515, wherein: said nucleic acid sample is divided into N aliquots; and said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

518. The method of Claim 517, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

519. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213 is overexpressed or underexpressed.

520. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 6214-42397 is overexpressed or underexpressed.

521. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ D NOs.: 42938-78581 is overexpressed or underexpressed.

522. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:

1-6213, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ DD NOs.: 1-6213, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 1-6213 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 1-6213 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 1-6213 is overexpressed or underexpressed.

523. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of sfrains comprises a plurality of sfrains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a sfrain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 6214-42397, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ DD NOS.: 6214-42397 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ D NOS.: 6214-42397 under moderate conditions is overexpressed or underexpressed.

524. A method for determining the extent to which each of a plurality of sfrains are present in a culture or collection of sfrains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of sfrains wherein said culture or collection of sfrains comprises a plurality of sfrains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of sfrains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a sfrain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0x78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 42938-78581 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ DD NOs: 42938-78581 is overexpressed or underexpressed.

525. The method of Claim 519, 520, 521 , 522, 523 or 524, wherein said primer pairs are divided into at least two sets, each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs.

526. The method of Claim 519, 520, 521 , 522, 523 or 524, wherein: said nucleic acid sample is divided into N aliquots; and said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

527. The method of Claim 526, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

528. The method of Claim 519, 520, 521, 522, 523 or 524, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one ofthe primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

529. The method of Claim 528, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

530. The method of Claim 528, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the confrol of a different regulatable promoter.