WO2002068639A1 - CELL PROLIFERATION FACTOR Fwap10576 - Google Patents

Abstract

The application disclosed a cell proliferation factor-Fwap10576 polypeptide and the polynucleotide encoding the polypeptide and a process for producing the polypeptide by recombinant method, the antibody and antagonist against the polypeptide and a composition comprising Fwap10576 polypeptide and its usage in the treatment of angiocardiopathy are also disclosed. The application further disclosed a diagnostic method by detecting the mutation in the nucleic acid sequence encoding Fwap10576 or the amount of Fwap10576 in the sample or the changes of autoantibody of Fwap10576 gene product. The cell proliferation factor of the present application is of human resource.

Description

 Cell proliferation factor Fwapl0576

Field of invention

The present invention relates to newly identified polynucleotides and polypeptides encoded thereby, methods for producing such polynucleotides and polypeptides, and uses of these polynucleotides and polypeptides. The polypeptide of the present invention has been identified as a cell proliferation factor, and is hereinafter sometimes referred to as "F _wa p'10576". The polynucleotides and polypeptides of the invention are of human origin. Background of the invention

 Cardio-cerebrovascular disease is one of the major diseases that threaten human health. According to statistics, about 2.6 million Chinese die each year from the disease, and on average every 12 seconds a compatriot is killed by the disease. In China, the ratio of cardiovascular deaths to total deaths increased from 12.1% in 1957 to 35.8% in 1990, an increase of 2.9 times. According to the prediction of the World Bank: By 2020, the proportion of deaths from cardiovascular and cerebrovascular diseases in the world will increase from 28.9% in 1990 to 36.3%, of which 70% of cardiovascular and cerebrovascular diseases occur China. There are more than 100 million people with hypertension in China, and it is increasing at an annual rate of 3.5 million; 6 million people with stroke are disabled, and it is increasing at an annual rate of 1.5 million; 1 million people with coronary heart disease, and at an annual rate of 50 The rate of increase is 10 million; In addition, there are 3 million patients with cardiomyopathy. Therefore, the prevention and treatment of cardiovascular and cerebrovascular diseases is of great significance to reduce human economic burden and ensure human health.

 The treatment of cardio-cerebral vascular disease has gone through four major stages: In the 1920s, the study of circulatory dynamics revealed that the heart is a "pump", which laid the foundation for the treatment of heart failure; in the 1960s and 1970s, cardiovascular diseases The understanding and treatment of risk factors have reduced the incidence of heart disease in western countries by nearly 40%. In 1970, the study of the electrophysiology of myocardial cells provided new methods for antiarrhythmia, electrophysiology examination and treatment; in the late 1980s By the early 1990s, knowledge of vascular biology had led to new approaches to cardiac interventional therapy.

 Heart failure, antiarrhythmia, and interventional treatment have played a positive role in saving the lives and improving the quality of life of patients with cardiovascular and cerebrovascular diseases. However, because these methods only treat the symptoms and do not fundamentally touch the cause, the treatment is not targeted. Although the patient's life was prolonged, the purpose of prevention and cure was not really achieved. Therefore, research at the level of molecular biology to find out the causative factors and pathogenesis of cardio-cerebrovascular disease is expected to make breakthrough progress in the treatment of the disease and achieve the goal of fundamentally curbing cardio-cerebrovascular disease.

 cDNA library is one of the important research tools in the field of biological engineering. MRNA is usually extracted from cells and a DNA copy of the mRNA (ie, cDNA, Complementary DNA) is synthesized by reverse transcriptase. Single-stranded cDNA molecules are transformed into double-stranded DNA molecules by the action of DNA polymerase, and then inserted into a vector, transformed into host bacteria and grown into clones. Each such clone contains only specific mRNA information, and such a set of clones is called a cDNA library.

Since the cDNA does not contain introns, the corresponding expressed genes can be directly selected from the cDNA library. Therefore, compared with the gene library, the cDNA library has the advantages of simple operation and convenient use. Differences in genes expressed in different human cells determine differences in tissue and organ phenotypes. Isolate and identify specific tables from human aortic cDNA libraries Gene, especially disease-related genes, is one of the effective methods for studying hereditary cardiovascular and cerebrovascular diseases

 According to one aspect of the present invention, a novel mature polypeptide Fwapl0576 and fragments, analogs, and derivatives of Fwapl0576 that are biologically active and useful in diagnostic or therapeutic applications are provided. The polypeptide of the invention is of human origin.

 According to another aspect of the present invention, there is provided an isolated nucleic acid molecule encoding a polypeptide of the present invention, including mRNA, DNA, cDNA, genomic DNA, and the nucleic acid molecule having biological activity and useful in diagnostics or therapeutics. Fragments, analogs and derivatives.

 According to another aspect of the present invention, there is provided a method for producing a Fwapl0576 polypeptide by recombinant technology, which method comprises culturing a recombinant prokaryotic and / or eukaryotic host cell containing a nucleic acid sequence encoding a polypeptide of the present invention.

 According to another aspect of the present invention, there is provided a method for treating a Fwapl0576 polypeptide or a polynucleotide encoding a Fwapl0576 polypeptide. For example, treating cardiovascular and cerebrovascular proliferative diseases and inhibiting tumor formation.

 According to another aspect of the invention, antibodies to these polypeptides are provided.

 According to another aspect of the invention, there are provided antagonists of said polypeptides, which can be used to inhibit the effects of these polypeptides.

 According to another aspect of the present invention, there is provided a method for diagnosing a disease or disease susceptibility related to mutations in a nucleic acid sequence of the present invention and abnormal expression of a polypeptide of the present invention.

 According to another aspect of the present invention, there is provided a method for using a polypeptide of the present invention or a polynucleotide encoding such a polypeptide for scientific research in vitro, DNA synthesis, and artificially constructing a DNA vector.

 The above aspects and related aspects will be apparent to those skilled in the art from the teachings herein. The present invention is achieved through the following technical solutions. MRNA was extracted and transcribed into cDNA to construct an adult active vein cDNA library. Fwapl0576 gene fragment was obtained from the library, and the full-length cDNA sequence of Fwapl0576 was obtained by EST splicing. Further study the expression and distribution of Fwapl0576 gene in different tissues, and study the activity and function of Fwapl0576 peptide. Detailed description of the invention

 According to one aspect of the present invention, the present invention provides an isolated nucleic acid (polynucleotide) sequence which encodes a mature polypeptide having a putative amino acid sequence as shown in SEQ ID NO: 2. The polynucleotide of the present invention is found from a cDNA library of an adult aorta. It is located on chromosome 16 in human cells. It contains an open reading frame that encodes a polypeptide with 156 amino acid residues. Homology analysis showed that the Fwapl0576 polypeptide has no sequence homology with currently known proteins.

The putative Fwap 10576 polypeptide consists of 156 amino acids. Its sequence characteristics are: (A) 1 to 34 Aa is a signal peptide; (B) 2 to 7 Aa (GSTWGS), 19 to 24 Aa (GLVLSL), 46 to 51 Aa (GTAISC), 96 To 101 Aa (GVSPCC), 118 to 123 Aa (GGLQAL) are N-myristoylation sites: (C) 33 to 39 Aa (RARDRDY) is a tyrosine kinase phosphorylation site; (D) 56 to 58 Aa (SSR) is a protein kinase C phosphorylation site; (E) 77 to 80 Aa (NQSN) is an N-glycosylation site. The analysis showed that the molecular weight of the Fwapl0576 polypeptide was 16700. 5 Daltons and the isoelectric point was 8. 11 (http: // www, expasy. Ch / tools / protpm> Tm. Html). 33.3% of the volume (http: 〃 psort. Nibb. Ac. .Ip / fo: nn2. Html).

The polynucleotide of the present invention may be in the form of RNA or DNA, wherein DNA includes _C DNA, genomic DNA, and synthetic DNA. DNA can be double-stranded or single-stranded. If it is single-stranded, it can be a coding or non-coding (antisense) strand. The coding sequence encoding the mature polypeptide may be the same as the coding sequence (nucleotides 213 to 683) shown in SIQ ID NO: 1 (1083 nucleotides in total length); or, due to the redundancy or degeneracy of the genetic code The coding sequence may be different from the coding sequence shown in SIQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide shown by SIQ ID NO: 2 may include: the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and additional coding sequences, such as the polynucleotide encoding the leader or secretion sequence of the polypeptide; Coding sequences (and optionally additional coding sequences) and non-coding sequences, such as non-coding sequences at the 5 'and / or 3' end of the intron or mature polypeptide coding sequence.

 Accordingly, the term "polynucleotide encoding a polypeptide" includes polynucleotides containing only polypeptide coding sequences and polynucleotides containing additional coding and / or non-coding sequences.

 The present invention also relates to a variant of the above-mentioned polynucleotide, which encodes a putative polypeptide fragment, analog, and derivative having the amino acid sequence shown in SIQ ID NO: 2. The variant may be a naturally occurring allelic variant of the polynucleotide, or a non-naturally occurring variant. As known in the art, an allelic variant is another form of a polynucleotide that can carry substitutions, deletions, or additions of one or more nucleotides without substantially altering the encoding of the polypeptide. Features.

 Therefore, the present invention includes a polynucleotide capable of encoding the same amino acid sequence as the mature polypeptide shown by SIQ ID NO: 2, and also includes a polynucleoside capable of encoding fragments, derivatives, and analogs of the mature polypeptide shown by SIQ ID NO: 2. Acid variant. These variants include deletions, substitutions, additions or insertions.

 The present invention also includes a polynucleotide in which the coding sequence of a mature polypeptide can be in the same reading frame as a polynucleotide that facilitates expression and secretion of the polypeptide from a host cell (such as a polynucleotide that produces a leader sequence) Integration. The leader sequence acts as a secretory sequence to control the transport of the polypeptide from the cell. A polypeptide having a leader sequence is a preprotein, and a mature cell can be produced by cleavage of the leader sequence by a host cell. The polynucleotide of the present invention may also encode a proprotein, which is a mature protein with a prosequence, a mature protein with an amino acid residue added at the 5 'end, and is an inactive form. After excision of the original sequence, an active mature protein can be produced.

 Therefore, the polynucleotide of the present invention can encode a mature protein, can also encode a protein with an original sequence, and can also encode a protein having both a prosequence and a leader sequence.

The polynucleotide of the present invention also includes a coding sequence fused to a marker sequence in the same reading frame, and the marker sequence can be used for purifying the polypeptide of the present invention. For example, when the host cell is a bacterium, the marker sequence can be a pQE-9 vector Hexahistidine provided for purification of fusion products. Alternatively, when the host is a mammalian cell (such as a COS-7 cell), the marker sequence may be hemagglutinin (HA), and the HA tag corresponds to an epitope derived from influenza hemagglutinin (Wilson, I., etc. Cell, 37: 767 (1984)).

 The term "gene" refers to a DNA fragment related to the production of a polypeptide, which includes regions before and after the coding region, and intervening sequences (introns) between individual coding segments (exons).

 The fragment of the full-length gene of the present invention can be used as a hybridization probe for a cDNA library to isolate the full-length gene and other genes with high homology or similar biological activity to the gene. The probe preferably has at least 30 bases, and may contain 50 or more bases. The probes can also be used to identify cDNA clones corresponding to full-length transcripts and one or more genomic clones containing complete genes. Among them, the complete gene includes regulatory sequences, promoter sequences, exons and introns. For example, oligonucleotide probes can be synthesized based on known DNA sequences, and the coding portion of the gene can be isolated. A labeled oligonucleotide probe that is complementary to the gene sequence of the present invention can be used to screen a library member for hybridization from a human cDNA, genomic DNA, or mRNA library.

 The invention also relates to a nucleic acid sequence that hybridizes to a polynucleotide of the invention. Provided that the two sequences have at least 85% homology, preferably at least 90%, and more preferably at least 95%. The invention particularly relates to polynucleotides that hybridize to the polynucleotides of the invention under stringent conditions. As used herein, the term "stringent conditions" means that hybridization occurs only when there is at least 95%, preferably at least 97% homology between sequences. A polynucleotide that hybridizes to the above sequence can encode a polypeptide having the same biological function or activity as the mature polypeptide of the present invention.

 In addition, a polynucleotide having homology to the polynucleotide of the present invention and capable of hybridizing may have at least 20 bases, preferably at least 30 bases, more preferably at least 50 bases, which may or may not retain activity . Such a polynucleotide can be used as a probe of SEQ ID NO: 1 for recovering the polynucleotide, as a diagnostic probe, or as a PCR primer.

 Therefore, the present invention relates to a polynucleotide having at least 85%, preferably at least 90%, and more preferably at least 95% homology with a polynucleotide encoding the polypeptide represented by SEQ ID NO: 2 (the fragment has at least 30 bases, preferably at least 50 bases), and polypeptides encoded by these polynucleotides.

 According to another invention of the present invention, the present invention relates to a putative polypeptide having an amino acid sequence shown in SIQ ID NO: 2 and fragments, analogs and derivatives thereof.

 The terms "fragment", "derivative" and "analog" when referring to a polypeptide encoded by SIQ ID NO: 1 or a polypeptide having an amino acid sequence as shown in SIQ ID NO: 2 mean that the said substance is substantially retained A polypeptide that has a biological function or activity. The analog may include proteinogen, which can produce an active mature polypeptide after partial excision.

 The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The polypeptide (SIQ ID NO: 2) and fragments, derivatives or analogs thereof may be: (i) a polypeptide in which one or more amino acid residues are conservative or non-conservative amino acid residues (preferably conservative) Amino acid residues), and the substituted amino acid residue may or may not be encoded by a genetic codon, or (ii) a polypeptide in which one or more amino acid residues contain a substituent, or (ii i) A polypeptide in which a mature polypeptide is related to another Fusion of a compound, such as a compound that increases the half-life of a polypeptide (such as polyethylene glycol), or (iv) a polypeptide in which a mature polypeptide is fused to an additional amino acid residue, such as to a leader or secretory sequence, and as Sequence fusions for purification of mature polypeptides. With the teachings herein, such fragments, derivatives, and the like can be considered to be within the knowledge of those skilled in the art.

 The polypeptides and polynucleotides of the invention are preferably provided in isolated form, and are preferably purified into homogeneous (homogeneous) materials.

 The term "isolated" means that the substance is removed from the original environment (for example, the natural environment if the substance is naturally occurring). For example, a polynucleotide or polypeptide naturally occurring in a living animal is not isolated, but the same polynucleotide or polypeptide is isolated from some or all of the coexisting substances in the natural system. Such a polynucleotide may be part of a vector, and such a polynucleotide or polypeptide may be part of a composition as long as the vector or composition is not part of its natural environment.

 The polypeptide of the present invention includes a polypeptide (especially a mature polypeptide) represented by SEQ ID NO: 2 and a homology of at least 85%, more preferably 90%, and most preferably 95% with the polypeptide of SEQ ID NO: 2 % Of homologous polypeptide. The invention also includes fragments of the above-mentioned polypeptides, which generally comprise at least 30, preferably at least 50 amino acids.

 As is well known in the art, "homology" between two polypeptides is determined by comparing the amino acid sequence of one polypeptide and its conservative amino acid substitutions to another polypeptide.

 Through polypeptide synthesis, the polypeptide fragments (or partial polypeptides) of the present invention can be used to produce full-length polypeptides. This fragment can be used as an intermediate to produce a full-length polypeptide. Similarly, the polynucleotide fragments of the present invention can be used to synthesize full-length polynucleotides of the present invention.

 According to another aspect of the present invention, it relates to a vector containing a polynucleotide of the present invention, a host cell engineered with the vector gene of the present invention, and a method for producing a polypeptide of the present invention by recombinant technology.

 Host cells are produced using the vectors of the present invention by genetic engineering (transduction, transformation or transfection). The vector may be a cloning or expression vector. Vectors can be in the form of plasmids, virus particles, and phages. Engineering host cells can be cultured in conventional nutrient media modified to activate promoters, screen transformants, or amplify the Fwapl0576 gene of the invention. Culture conditions (such as temperature and pH) are determined by different host cells, and these will be apparent to those skilled in the art.

 By recombinant techniques, the polynucleotides of the invention can be used to produce polypeptides. The polynucleotide may be contained in any vector suitable for expressing a polypeptide. Such vectors include chromosomal-derived, non-chromosomal-derived and synthetic DNA sequences. Examples include SV40 derivatives, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors obtained by combining plasmid and phage DNA, and viral DNA (such as vaccinia, adenovirus, poultry pox virus, and pseudorabies virus). In addition, other vectors can be used as long as they can replicate and survive in the host.

 Various methods can be used to insert the appropriate DNA sequence into the vector. Generally, DNA sequences are inserted into appropriate restriction endonuclease sites using methods known in the art.

The DNA sequence in the expression vector can be linked to an appropriate expression control sequence (promoter) to guide mRNA synthesis. Examples of promoters are: LTR or SV 40 promoter, lac or trp of E. coli, phage λ P _L Promoters, as well as other promoters known to control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site and a transcription terminator that directs the initiation of translation. The vector may also contain suitable sequences for amplified expression.

 In addition, preferred expression vectors contain one or more selectable marker genes to provide phenotypic characteristics for selection of transformed host cells. For example dihydrofolate reductase or neomycin resistance for eukaryotic cell cultures, or for example tetracycline and ampicillin resistance for E. coli.

 A vector containing the above-mentioned suitable DNA sequence and a suitable promoter or control sequence can be used to transform an appropriate host so that it can express a protein.

 Representative examples of suitable hosts are: bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells such as yeast; insect cells such as DrosorpHila and Spodoptera Sf9; animal cells such as CH0, COS or Bowes melanoma; glands Viruses; plant cells, etc. With the teachings herein, selecting the appropriate host can be considered to be within the knowledge of those skilled in the art.

More specifically, the invention also includes recombinant constructs containing one or more sequences as broadly described above. The construct includes a vector, such as a plasmid or a viral vector, into which the nucleic acid sequence of the present invention has been inserted in the forward or reverse direction. In a more desirable embodiment, the construct further comprises a regulatory sequence, such as a promoter, operably linked to the sequence. Many suitable vectors and promoters are well known to those skilled in the art and are commercially available. For example, bacterial vectors: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, pHagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, _P DR540 ^ pRITS (pHarmaca); eukaryotic vectors: pWLNEO, pSV2CAT pOG44, pXT pSG (Stratagene), pSV, pBPV, pMSG, pSVL (Parmacia) „In addition, other plasmids or vectors can be used as long as they can be hosted in the host Copy and survive.

Promoter regions can be selected from genes using vectors bearing CAT (chloramphenicol transferase) or other selectable markers. Two suitable vectors are PKK232-8 and PCM7. Particularly mentioned bacterial promoters include lacl, lacZ, T3, T7, gpt, λP _κ , P and trp. Eukaryotic promoters include CMV immediate early, SV thymidine kinase, early and late SV40, LTRs from retroviruses, and mouse metallothionein-1. Selection of appropriate vectors and promoters can be considered as within the knowledge of those skilled in the art.

 In another embodiment, the invention relates to a host cell comprising a construct as described above. Host cells can be higher eukaryotic cells (such as mammalian cells), lower eukaryotic cells (such as yeast cells), or prokaryotic cells (such as bacterial cells). The introduction of constructs into host cells can be achieved by calcium phosphate transfection, DEAE-dextran-mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Molecular Biology Basic Methods, (1986)).

 The construct in the host cell can produce the product encoded by the recombinant sequence via conventional means. Moreover, the polypeptide of the present invention can be synthesized using a conventional peptide synthesizer.

Under the control of a suitable promoter, the mature protein can be expressed in mammalian cells, yeast cells, bacterial cells, or other cells. The RNA derived from the DNA construct of the present invention can also be produced by a cell-free translation system. Health target protein. Sambrook et al., Molecular Cloning Laboratory Handbook (1989, Second Edition, Cold Spring Harbor Laboratory, New York) describe suitable cloning and expression vectors that can be used in prokaryotic and eukaryotic hosts.

 By inserting the enhancer sequence into the vector, the transcription of the DNA encoding the polypeptide of the present invention by higher eukaryotic cells can be improved. Enhancers are cis-acting elements of DNA, typically about 10 to 300 bp. They act on promoters to enhance their transcription. Examples of enhancers are: SV40 enhancer 100 to 270 bp upstream of the origin of replication, polymorphoma enhancer, and adenovirus enhancer.

 Generally, a recombinant expression vector includes an origin of replication and a selection marker gene (such as the ampicillin resistance gene of E. coli and the TRP1 gene of Saccharomyces cerevisiae), and a promoter obtained from a highly expressed gene capable of directing transcription of downstream structural genes . Such promoters can be obtained from operons encoding glycolytic enzymes (such as 3-phosphoglycerate kinase (PGK)), α-factors, acid phosphatases, or heat shock proteins. Heterologous sequences are assembled with translation initiation and termination sequences in an appropriate manner. Preferably, it is assembled with a leader sequence capable of directing the secretion of the protein to the periplasm or extracellular medium. The heterologous sequence can encode a fusion protein containing an N-terminal recognition peptide, which has ideal characteristics, such as a stable expressed recombinant product or simplified purification steps.

 By inserting the structural gene encoding the protein of interest, appropriate translation initiation and termination signals, and a functional promoter together, an expression vector suitable for bacteria can be constructed. The vector contains one or more selectable markers and an origin of replication to maintain the vector and, if necessary, amplify the vector in the host. Suitable prokaryotic hosts for transformation include multiple species of E. coli, Bacillus subtilis, Salmonella typhimurium, Pseudomonas, Streptomyces and Staphylococcus.

 As a representative but non-limiting example, expression vectors for bacteria may contain selectable markers and origins of replication derived from commercially available vectors containing genetic elements of the well-known cloning vector pBR322 (ATCC37017). Such commercially available carriers include pKK223-3 (pHarmacia Fine Chemicals, Uppsala, Sweden) and GE 1 (Promega Biotec, Madison, WI, USA). These "backbone" portions of pB 322 are combined with appropriate promoters and structural sequences to be expressed.

 After transforming a suitable host strain, after it has grown to a suitable cell density, induce the selected promoter by a suitable method (such as temperature conversion or chemical induction), and continue to culture the cells for a period of time. Cells are usually harvested by centrifugation, and the cells are disrupted by physical or chemical methods. The crude product obtained is retained for further purification. The microbial cells can be disrupted by any conventional method, including freeze-thaw methods, sonication, mechanical disruption, or the use of cell lysing agents, which methods are well known to those skilled in the art.

Various mammalian cell culture systems can also be used to express recombinant proteins. Examples of mammalian expression systems are the monkey kidney fibroblast COS-7 cell line described by Gluzman (Cell, 23: 175 (1981)) and other cell lines capable of expressing compatible vectors, for example, C127, 3T3, CH0, HeLa and BHK cell lines. Mammalian expression vectors contain origins of replication, suitable promoters and enhancers, and any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5 'flanking non- Transcribed sequence. DNA sequences derived from the SV40 virus genome, such as the SV40 origin of replication, early promoters, enhancers, splicing and polyadenylation sites, can be used to provide the required non-transcribed genetic elements. The polypeptides of the present invention can be recovered and purified from recombinant cell cultures by a variety of methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphate cellulose chromatography, hydrophobic interaction chromatography, Affinity chromatography, hydroxyapatite chromatography, lectin chromatography, and high performance liquid chromatography (HPLC).

 The polypeptides of the present invention may be naturally purified, or chemically synthesized, or prepared by recombinant techniques from prokaryotic or eukaryotic hosts (such as bacteria, yeast, higher plants, cultured insects, and mammalian cells). Depending on the host used in the recombinant method, the polypeptide of the invention may be glycosylated or non-glycosylated. The polypeptide of the invention may also contain a starting methionine residue.

 The polynucleotides and polypeptides of the present invention can be used as research reagents and materials for the treatment and diagnosis of human diseases. Fwapl0576 has the effect of promoting cell proliferation and may be used in the treatment of cardiovascular and cerebrovascular diseases.

 According to another aspect of the invention, there is provided a method for identifying an activator or antagonist of a polypeptide of the invention. One method is to culture mammalian cells or membrane preparations that express the Fwapl0576 receptor with Fwapl0576 polypeptide in the presence of a certain compound, and detect that the compound enhances or blocks the interaction of Fwapl0576 polypeptide with the receptor to generate a second messenger Ability. Second messenger systems include, but are not limited to: protein tyrosine kinase system (PTK), cAMP guanylate cyclase, ion channels, or phosphoinositide hydrolysis. Another method for identifying polypeptide antagonists is competition inhibition. This method sets the number of Fwapl0576 polypeptide molecules bound to the receptor as a control in the absence of a compound, and determines potential antagonists by detecting changes in the number of Fwapl0576 polypeptide molecules bound to the receptor in the presence of the compound.

 Potential antagonists include antibodies, or in some cases oligopeptides that bind to a polypeptide of the invention, which bind to the polypeptide and effectively eliminate its function. .

 Another potential antagonist compound is an antisense construct made using antisense technology. Antisense DNA or RNA is formed by triple helix to control gene expression. The above methods are all based on the combination of polynucleotide and DNA or RNA. For example, an antisense RNA of about 10 to 40 base pairs in length can be designed based on the 5 'end of a nucleic acid sequence encoding a mature polypeptide of the present invention. Another example is to design a DNA that is complementary to the gene region involved in transcription (triple helix-see Lee et al., Nucleic Acid Research, 6: 3073 (1979); Cooney et al., Science, 241: 456, (1988); and Dervan et al., Science 251: 1360 (1991)), thereby preventing transcription and the production of the polypeptide of the present invention. Antisense RNA hybridizes with mRNA in vivo and blocks translation of the mRNA molecule into the polypeptide of the present invention (Antisense_0kano, J. Neurochemical Journal, 56: 560 (1991); Deoxyoligonucleotides as antisense inhibitors of gene expression Glycolic acid (CRC Press, Boca Raton, FL (1988)) o The aforementioned oligonucleotides can be delivered to cells to express antisense and DNA in vivo to inhibit the production of the polypeptide of the invention.

 Antagonists also include small molecules that, by binding to the polypeptide of the invention, prevent the polypeptide from interacting with its receptor, thereby blocking its normal biological activity. Small molecules include, but are not limited to, small peptides or peptoid molecules.

The polypeptides of the present invention, their activators and antagonists can be combined with a suitable carrier to form a pharmaceutical composition. Such a composition comprises a therapeutically effective amount of a polypeptide and a pharmaceutically acceptable carrier or excipient. Carriers include, but are not limited to, saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The formulation should be appropriate to the mode of administration. The present invention also provides a pharmaceutical package or kit containing one or more containers therein, the container containing one or more components of the pharmaceutical composition of the present invention. At the same time, it can provide information about the manufacture, use, and sale of drugs or biological products that has been reviewed by government drug regulatory agencies. The pharmaceutical composition of the present invention can also be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a conventional manner, such as by oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route. The pharmaceutical composition is administered in a dose effective to treat and / or prevent a particular disease. It is usually administered in an amount of at least about 10 micrograms per kilogram of body weight. In most cases, it is administered in an amount not exceeding about 8 mg / kg body weight per day. In most cases, taking into account the route of administration and symptoms, the dosage is from about 10 μg / kg to 1 mg / kg body weight per day.

 According to another aspect of the present invention, the polypeptide of the present invention and its activators and antagonists can be used by expression in vivo, which is often referred to as "gene therapy".

 Therefore, a patient's cells can be genetically engineered with a nucleic acid (DNA or RNA) encoding a polypeptide of the present invention in vitro, and the engineered cells can be provided to a patient in need of treatment. The methods described above are well known in the art. For example, cells can be genetically engineered with a retrovirus containing RNA encoding a polypeptide of the invention.

 Similarly, cells can be genetically engineered in vivo by methods known in the art to express a polypeptide in vivo. For example, a packaging cell is transduced with a retrovirus containing RNA encoding a polypeptide of the present invention so that it can produce an infectious virus particle containing the gene of interest. This production cell is used in a patient to engineer the cell in vivo and express the polypeptide. It will be apparent to those skilled in the art that the polypeptides of the present invention are administered by the methods described above or otherwise in accordance with the teachings of the present invention.

 Retroviruses from which retroviral plasmid vectors can be obtained include, but are not limited to: Moloney murine leukemia virus, spleen necrosis virus, retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia Viruses, gibbon leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus, and breast tumor virus.

 The vector contains one or more promoters. Suitable promoters that can be used include, but are not limited to: retrovirus LTR; SV 40 promoter; human cytomegalovirus (CMV) promoter (Miller et al., Biotechnology, Vol. 7, No. 9, 980- 990 (1989)); or other promoters (such as eukaryotic cell promoters, including but not limited to the histone, pol III, and β-actin promoters). Other viral promoters that can be used include, but are not limited to, an adenovirus promoter, a thymidine kinase (TK) promoter, and a B19 parvovirus promoter. With the teachings herein, selecting a suitable promoter on the vector will be apparent to those skilled in the art.

The nucleic acid sequence encoding a polypeptide of the invention should be controlled by a suitable promoter. Suitable promoters that can be used include, but are not limited to: an adenovirus promoter (such as an adenovirus major late promoter); or a heterologous promoter (such as a cytomegalovirus (CMV) promoter); a respiratory syncytial virus (RSV) Promoter; Inducible promoter (such as MMT promoter, metallothionein promoter); heat shock promoter; albumin promoter; ΑροΑΙ promoter; human globin promoter; viral thymidine kinase promoter (such as pure Herpes thymidine kinase promoter); retrovirus LTRs (including modified retrovirus LTRs described above); β-actin promoter and human growth hormone promoter. Promoter It may be a natural promoter of a gene encoding the polypeptide.

 Packaging cells can be transduced with a retroviral plasmid vector to produce producing cells. Packaging cells that can be transfected include, but are not limited to: PE50 PAC317, ψ_2, ψ- ΑΜ, ΡΑ12, T19-14X, VT-19-19-17- Η2, CRE, v | / CRIP, GP + E- 86, GP + envAml2 and the DNA cell line (described by Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety). The vector can be used to transduce packaging cells by any method known in the art. These methods include, but are not limited to, electroporation, the use of liposomes, and precipitation with CaP (. In addition, retroviral plasmid vectors can be embedded in liposomes, or coupled to lipids, and then introduced into a host.

 The production cell line produces an infectious retroviral vector particle comprising a nucleic acid sequence capable of encoding the polypeptide. These retroviral vectors can be used to transduce eukaryotic cells in vivo or in vitro. The transduced eukaryotic cell will express a nucleic acid sequence encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic cancer cells, and hematopoietic stem cells, liver cells, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

 According to another aspect of the present invention, the present invention relates to the use of the Fwapl0576 gene in diagnosis or detection. By detecting mutations in the Fwapl0576 nucleic acid sequence, a related disease or susceptibility to the disease can be diagnosed.

 Individuals carrying mutations in the Fwapl0576 gene can be detected at the DNA level using a variety of techniques. Can be obtained from patient's cells, such as cells from blood, urine, saliva, biopsies and autopsies. Genomic DNA can be used directly for detection, or it can be amplified by PCR before analysis (Saiki et al., Nature, 324: 163-166 (1986)). RNA or cDNA can also be used for the same purpose. For example, PCR primers complementary to the polynucleotides of the present invention can be used to identify and analyze mutations. Detect deletions and insertions based on changes in the size of the amplified product, as compared to normal genotypes. Point mutations can be identified by hybridizing to amplified nucleic acid sequences with radioactively labeled RNA or antisense DNA. Digestion with RNaseA or by differences in melting temperature can discriminate between perfectly matched sequences and mismatched double strands.

 DNA sequencing can directly reveal the sequence difference between the control gene and the gene carrying the mutation. In addition, cloned DNA fragments can be used as probes to detect specific DNA segments. When used in combination with PCR, the sensitivity of this method is greatly improved, for example, using sequencing primers and double-stranded PCR products, or single-stranded template molecules produced by a modified PCR method. Conventional automated sequencing methods use radioactive or fluorescent labels to determine nucleic acid sequences.

 Genetic tests based on DNA sequence differences can be achieved by detecting changes in the electrophoretic mobility of DNA fragments in gels with or without denaturants. Small sequence deletions and insertions can be displayed by high-resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels. Depending on their specific melting point or partial melting temperature, different DNA fragments will stagnate at different positions on the gel (see Myers et al., Science, 230: 1242 (1985)) o

 RNase and S1 protected nuclease protection assays or chemical cleavage methods can also detect sequence changes at specific locations (eg Cotton et al., PNAS, USA, 85: 4397-4401 (1985)).

Therefore, hybridization, ribonuclease protection, chemical cleavage, direct DNA sequencing, or Southern blotting using restriction enzymes (such as restriction fragment length polymorphism (RFLP)) and genomic DNA can be used to detect DNA sequences. Difference.

 In addition to more conventional gel electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

 According to another aspect of the present invention, the present invention relates to a diagnostic analysis method by detecting changes in the content of Fwapl0576 peptide in different tissues. This is based on the fact that over-expression of the polypeptide in a tissue compared to normal control tissue can detect the presence of disease or disease susceptibility. Analytical methods for detecting the content of the polypeptide of the present invention in a sample taken from a host are well known to those skilled in the art. Methods include radioimmunoassay, competitive binding assay, Western blot analysis, enzyme-linked immunosorbent assay (ELISA) assay and "sandwich" assay. , ELISA detection is preferred. The ELISA assay involves first preparing a specific antibody, preferably a monoclonal antibody, of a polypeptide of the invention. A reporter antibody to the monoclonal antibody is then prepared. The reporter antibody is combined with a detectable reagent such as a radioactive, fluorescent or horseradish peroxidase. A sample is taken from the host and incubated in a solid support (such as a polystyrene dish) that binds to the protein in the sample. By incubating with non-specific proteins (such as bovine serum albumin), any free protein binding site in the dish will be covered. Next, the monoclonal antibody is incubated in the dish during the binding of the monoclonal antibody to any of the polypeptides of the invention bound to a polystyrene dish. Wash all unbound monoclonal antibodies with buffer. At this time, the receptor antibody linked to horseradish peroxidase is placed in a dish, and as a result, the receptor antibody is bound to any monoclonal antibody bound to the polypeptide of the present invention. Unbound monoclonal antibodies were then washed away. Then add the peroxidase substrate to the dish, and compared with the standard curve, the amount of color produced in a given time is the amount of protein present in a given volume of patient sample.

 Polypeptide content can also be measured using competitive assays. The method includes binding a specific antibody of the Fwapl0576 polypeptide to a solid phase support, and then labeling (such as radioactive labeling) the polypeptide of the present invention, passing a sample taken from the host through the solid phase support, and then detecting the amount of the label to determine sample competition. The amount of sexually bound antibody, thereby determining the content of the polypeptide of the present invention in the sample.

 The polynucleotide sequence of the present invention is also extremely valuable for the identification of chromosomes. This sequence specifically targets and hybridizes to specific positions of the human chromosome. Currently, only a few chromosome identification reagents based on actual sequence data (repeating polymorphisms) can be used to mark stained body positions. Mapping chromosomes based on the DNA of the present invention is the first step in correlating these sequences with disease-related genes.

 In short, chromosomal localization of the sequence can be performed by preparing PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of the 3 'untranslated region of the gene allows rapid selection of primers. Primers should not span the first exon of genomic DNA, or they will complicate amplification. Primers were then used in PCR to screen for somatic hybrids containing a single human chromosome. Only the hybrids containing the gene corresponding to the primer will produce amplified fragments.

 PCR mapping of somatic hybrids is a quick way to locate specific DNA on specific chromosomes. According to the present invention, sublocalization can be accomplished in a similar manner using the same oligonucleotide primers and a set of fragments from a specific chromosome or large genome clone. Other mapping methods that can be used for chromosome mapping include in situ hybridization, pre-screening with labeled, flow-sorted chromosomes, and pre-screening with hybridization to construct a chromosome-specific cDNA library.

Fluorescent in situ hybridization (FISH) of cDNA clones and metaphase chromosome smears for more precise chromosomal positions Home. This technique can use cDNAs that are 50 or 60 bases long. See a review by Verma et al., Human Chromosomes: A Handbook of Basic Techniques, Pergamon Press, New York (1988).

 Once the precise location of the gene on the chromosome is completed, the physical location of the gene on the chromosome can be linked to genetic map data. These data can be found in, for example, V. Mcusick, Human Mendelian Genetics (available on the Internet at the Welch Medical Library at Johns Hopkins University). Linkage analysis (co-heritance of physically adjacent genes) is then used to determine the relationship between genes and diseases that have been mapped to the same region of the chromosome.

 Differences in the cDNA or genomic sequence between the affected individual and the normal individual then need to be determined. If mutations are observed in some or all of the affected individuals but not in normal individuals, the mutations may be the cause of the disease.

 Said polypeptide, a fragment thereof, a derivative thereof or the like, or a cell expressing the above substance can be used as an immunogen to produce an antibody. The antibody can be a polyclonal or monoclonal antibody. The invention also includes chimeric, single-chain and humanized antibodies, as well as products of Fab fragments or Fab expression libraries. Various methods known in the art can be used to produce these antibodies and fragments.

 Corresponding antibodies can be obtained by directly injecting or administering the polypeptide of the present invention to an animal body, preferably a non-human body. The antibody thus obtained will bind to the polypeptide. In this way, even sequences that encode polypeptide fragments can produce antibodies capable of binding the entire natural polypeptide. This antibody is then used to isolate the polypeptide from the tissue in which the polypeptide is expressed.

 For the production of monoclonal antibodies, any technique for producing antibodies by continuous cell line culture can be used. Examples include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trisomy hybridoma technology, human B-cell hybridoma technology (Kozbor et al., 1983, Immunology Today, 4: 72) and £ 8 ¥ -Hybridoma Technology (Cole, et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

 The technology for producing single-chain antibodies (U.S. Patent No. 4,946,778) can be improved to produce single-chain antibodies against the polypeptide (immunogenic) of the present invention. Transgenic mice can also be used to express humanized antibodies against the polypeptides (immunogenic) of the invention.

 For a clearer understanding of the essence of the present invention, it will now be explained with reference to the following drawings and embodiments. The drawings and examples are for illustration purposes and do not limit the invention in any way.

 Many improvements and variations of the present invention are possible under the teachings described above, and thus, within the scope of the appended claims, the present invention may be implemented in a manner different from the one specifically described above. Brief description of the drawings

 Figure 1 shows the distribution of Fwapl0576 in normal tissues.

 Figure 2 shows the distribution of Fwapl0576 in different tumor cell lines.

 Figure 3 shows the expression of Fwapl0576 in normal adult and fetal myocardial tissues, and in ventricular aneurysm tissue in patients with old myocardial infarction.

Figure 4 shows the expression of Fwapl0576 in brain tissue of normal animal models by in situ hybridization. Figure 5 shows the optimization of the expression conditions of the recombinant protein TRXSX576. among them,

 A shows the effect of different activation time on the expression of recombinant protein TRXSX576; B shows the effect of different induction time on the expression of recombinant protein TRXSX576.

 Figure 6 shows the expression of Fwapl0576 in normal animal brain tissue by in situ hybridization.

 Figure 7 shows the expression of Fwapl0576 in brain tissue of stroke animals by in situ hybridization.

Figure 8 shows the results of immunohistochemical analysis (light microscope x 100). A. Brain tissue sections of non-stroke patients, I antibody is Fwapl0576-SE3McAb _; B. Brain tissue sections of stroke patients, I antibody is Fwapl0576-SE3McAb; C. Brain tissue sections of non-stroke patients, I antibody is F _wa pl0576-SE3McAb; D. brain tissue section of stroke patients, I antibody is Fwap 10576-SE3McAb; E. brain tissue section of stroke patients, I antibody is Fwapl0576- 6H10 cAb _; F. brain tissue section of stroke patients The I antibody is Fwapl0576_ 6Bl lMcAb.

 Figure 9 shows the cell proliferation induced by high expression of Fwapl0576. Examples

Example 1 Construction of Adult Aortic cDNA Library

1.1 RNA extraction

 RNA gents® Total RNA Isolation System kit was purchased from Promega Corporation (Cat NO. Z5110). The operation is as follows: Weigh adult aortic tissue stored in 0.3g of liquid nitrogen, add 10ml of denaturing solution (4M guanidine isothiocyanate, 25mM trisodium citrate) and 1ml 2M sodium acetate (pH4.0) and uniformly paddle. Add equal volume of water-saturated phenol and 0.2 times volume of chloroform, shake vigorously for 15 seconds, and leave on ice for 15 minutes. Centrifuge at 10,000 rpm, 4 ° C for 20 minutes. Take the supernatant, add an equal volume of isopropanol, and leave it at -20Ό for 2 hours, then centrifuge. Suspend the pellet with 5ml of denaturing solution and repeat the above steps. Wash the precipitate with 1 ml of ice-cold 75% ethanol, evaporate the trace ethanol for 5-10 minutes at room temperature, and dissolve the RNA with diethyl pyrocarbonate (DEPC) treated with deionized water.

1.2 Isolation of mRNA

 At the 3 'end of the mature m A, there is a Poly (A) consisting of 20-250 adenylates. Based on this feature, mRNA and other RNAs can be separated by affinity chromatography. The oligo (dT) cellulose used in this experiment contains 12-18 nucleotides (T) of polymer chains. Under multi-salt conditions, the mRNA with oligo (A) tail binds to oHgo (dT) and remains on the column, while the rRNA and tRNA without oligo (A) tail are washed off, and then suspended with low salt solution. MRNA on the column.

Quick prep ® micro mRNA purification kit was purchased from pHarmacia, Sweden. Add 1ml oligo (dT) cellulose suspension to 1.5ml RNase-free centrifuge tube 1 ^# ; take another 1.5ml centrifuge tube 2 ^# and add 1ml of total RNA diluted with loading buffer; tube 2 ^# and tube 2 ^# centrifugation for 1 min at room temperature, 12000 _rpm; the supernatant removed by aspiration tube ^# 1, ^# 2 of the tube 1 ^# tube was added the supernatant, rocked 5-10 min; microfuge for 10 seconds at room temperature, 12000 rpm; lml with high salt buffer (10mM Tris-HCl pH7.5, ImM EDTA, 0.5M NaCl), washed 5 times, and centrifuged; Wash with 1ml low salt buffer (10mM Tris-HCl pH7.5, ImM EDTA, 0.1M NaCl), 5 times, centrifuged; 0.3ml The oligo (dT) pellet was suspended in a low-salt buffer and transferred to a micro-spin column, centrifuged at 12,000 rpm for 5 seconds; washed with 0.5 ml of low-salt buffer Centrifuge 3 times; collect mRNA with 2X0.2ml eluent; measure optical density with spectrophotometer and calculate OD260 / 280 ratio; get 300yl mRNA, add 7.5 μΐ glycogen, 30 μ 12.5M potassium acetate (ρΗ5.0) , 750μ1 absolute ethanol at -70. C was stored for future use; centrifuged for 5 minutes before use, washed with 75% ethanol, and dissolved in mR A by DEPC water.

1.3 cDNA Synthesis

For synthesis steps, refer to ZAP Express ^Tm cDNA Synthesis Kit * and ZAP Express ^Tm cDNA

Gigapack® II Gold Cloning Kit * (Stregene, Inc., Catalog No. 200403 and 200404).

In a 0.5ml centrifuge tube, add 5 μ 110X first-strand buffer, 3 μ 1 methylated dNTP mixture, 2 μ1 1101 linker 0 ^ 0 ( ₍ 1butyl) 18 primers (1.4 _§ ^ 1), 32.5 μ 1 DEPC-treated deionized water, lwl RNase inhibitor (40υ / μ1), 5ug mRNA, and set to room temperature for 10 minutes. Then add 1.5 μΐ Moloney murine leukemia virus (MMLV) reverse transcriptase (50ιι / μ1) ), The total reaction volume is 50μ1. Take 5μ1 from it and transfer it to another centrifuge tube, add 0.5μ1 α- ^32- P-deoxyadenosine (dATP) (800ci / mmol) to identify the quality of the first chain synthesis. Performed at 37 ° C.

Under the action of DNA polymerase I, the obtained DNA / NA hybrid molecule uses the first strand as a template to synthesize a second strand. Add 45 μ1 first strand cDNA, 20 μ110X second strand buffer, 6yldNTP mixture, 114 μ 1 deionized water, 2 μ 1 [a- ³² p] dATP (800ci / mmol), 2 μ 1R A enzyme in an ice bath in order. Η (1.5 μm / μ 1), 1 μ 1 DNA polymerase I (9.0 u / μΐ), total volume 200 μ1. Mix and incubate at 16 ° C for 2.5 hours. After the reaction was completed, extraction was performed with phenol: chloroform (1: 1), and ethanol was precipitated.

 1.4 Ligation of cDNA and Vector

 Remove the 9 U lEcoRI linker from the kit (sequences are 5 '-AATTCGGCACGAG-3' and 3 '

-GCCGTGCTC-5 ') dissolves the precipitate. Take 1 μΐ electrophoresis to identify the quality of the first and second strand synthesis. Add 1 μ 110 X ligase buffer, 1 μ 110 mmol / L Υ-adenosine triphosphate (Y-ATP), 11 T4 DNA ligase (4 ι / μ1), and 8 ° C water bath to the remaining 8 1 second-strand cDNA. After hours, incubate at 70 ° C for 30 minutes. Digest with restriction enzyme Xhol for 1.5 hours. Sepharose Cl-2B was separated by column to remove nucleotides less than 400 bases to increase the proportion of full-length cDNA in the cDNA library.

 1.5 cDNA cloned into ZAP phage vector

The multiple cloning site on the ZAP phage vector (Stratagene, USA) allows insertion of nucleic acid fragments up to 10Kb. After entering the host, the plasmid portion can be cut from the vector to form the plasmid vector Bl _{UeS cript} . Multiple cloning site of the vector points on both sides and have small T _{3 7} phage promoters, can be used for probe synthesis and sequence analysis. The cDNA fragment inserted into the vector can express an antigenic and biologically active fusion protein. The experiment details are as follows-add 100ng cDNA, 0.5 μ 110X ligase buffer, 0.5 μ 110mmol / L y-ATP (pH7.5), lul ZAP phage vector (lug / ul), o.5ul T4 DNA ligase into the centrifuge tube (4u / ul), add deionized water to a total volume of 5μ1. Connect at 12 ° C for 16 hours.

The ligation product requires packaging of the coat protein to produce a recombinant phage with transfection activity. Quickly remove the packaged protein from -70 ° C. After dissolving, add 1ul of the reaction reagent to the 25ul packaged protein, mix the hooks, and react at 22 ° C for 2 hours. Add 500ul SM buffer (0.1M NaCl, 0.08M MgS0 ₄ .7H ₂ 0, 0.05M Tris-HCl, 0.01% gelatin), 20ul chloroform. This mixture is the original cDNA library.

1.6 Calculating the titer of positive clones

Take 5ul of the original cDNA library and dilute it with 45ul SM buffer. 10 ul of the diluted solution was added to 200 ul of competent XLl-Blue MRF host bacteria (OD600 = 0.5). 37 ° C water bath for 20-30 minutes, add 3ml upper agarose, mix well, spread on NZY (0.09M NaCl, 0.08M MgS0 ₄ .7H ₂ 0, 0.5% yeast extract, 1% NZamine A) plate, Invert and incubate at 37 ° C overnight and count the number of clones on the plate.

The titer of the cDNA library is expressed as the number of plaque plaques (pfli / ml). pf / ml = (number of plaques x dilution factor) X 1000 / dilution amount (ul). A cDNA library with a capacity of more than 1 × 10 ⁶ clones can ensure that it contains each single copy of the mRNA. The library capacity of the adult aortic cDNA library of the present invention is 2.4 × 10 ⁶ independent recombinant clones.

 Amplification and preservation of L7 cDNA library

The constructed cDNA library can be used directly for screening, but it is not stable. Because non-wild-type phage are susceptible to inactivation, they need to be amplified to facilitate multiple screenings. Take 5 × 10 ⁴ phages to transfect the XLl-Blue MRF host bacteria, plate, incubate at 37 ° C for 8-10 hours, and then add 8 ml SM buffer to a 150mm dish, and incubate at 4 ° C overnight. Centrifuge and collect the supernatant to obtain an amplified cDNA library. Add 0.3% chloroform and store at 4 ° C. Long-term storage requires adding 7% dimethyl sulfoxide (DMSO) and freezing at -70 ° C. Example 2 Cloning of a New Full-length cDNA

2.1 Random cloned polymerase chain reaction (PCR) amplification

 cDNA library is plated, and the plaque density is 200-500 clones / dish (150mm). Pick a single clear plaque and transfer it into a sterile centrifuge tube containing 75ul SM buffer and 5ul chloroform. ° C. Mix and centrifuge before use, take 5ul of the supernatant, and use the 3 'end primer (5' CCAAGCTCGAAATTAACCCTCAC 3 ') and 5' end primer (5 'CAGTCAATTGTAATACGACTCACT 3') of ZAP phage vector for PCR amplification. The total reaction volume is 50ul. The amplification parameters were pre-denatured at 94 ° C for 3 minutes; then 94Ό45 seconds, 55 ° C for 30 seconds, and 72 ° C for 3 minutes, a total of 30 cycles; 72Ό extended for 5-10 minutes. Estimate the production of PCR products based on the brightness of the electrophoretic bands on a 1% agarose gel

2.2 Sequence determination of expressed sequence tags (EST)

 AJBI377 automatic sequencer (ABI PRISM ™ 377 DNA sequencer) and automatic sequencing kit (BigDye ™ Terminator Ready Reaction Mix) were purchased from the company P £ 美国. Sequencing using dideoxy chain termination according to recommended conditions of use.

Using non-radioactive CY5-fluoroscein as a marker, universal sequencing primers T ₃ (5 'ATT AAC CCT CAC TAA AGG GA 3') and T ₇ (5 'TAA TAC GAC TCA CTA TAG GG3') for sequencing The amount of primer in each sample is 5 pmol/ul. The sequencing template is a PCR product in an amount of about 30-100 ng. The PCR amplification parameters are 94 ° C for 3-5 minutes; 94 ° C for 30 seconds, 50 ° C for 15 seconds, 72 ° C for 1 minute, 20 cycles; 94 ° C 30 Second, 72 ° C for 1 minute, 15 cycles; 72 再 for 5 minutes. The DNA product was electrophoresed on 8 mol / L urea, 6% polyacrylamide gel plate. Voltage 1500V, power 34W, electrophoresis 250-300 minutes (ALF Express ™ DNA sequence, pHarmacia, Sweden).

2.3 Bioinformatics analysis of EST

 The BEST (Basic Local Alignment Search Tool) software of the American Bioinformatics Center was used to compare the EST of each cDNA clone with the GenBank / EMBL DDBJ database for homology (http://www.ncbi.nlm.nih.gov). According to the BLAST judgment standard (common standard for most laboratories at home and abroad): A sequence with a homologous sequence less than 100-200 bases and a score less than 100 is the new EST. The EST of Fwap 10576 of the present invention is a new EST. '' 2.4 EST Primer Sequencing

 2.4.1 ZAP phage in vivo cyclization

The ZAP phage vector can directly transfer the target fragment from the lambda phage vector to the plasmid in the host, and circularize it into a PBK-CMV (with CMV virus early promoter) phagemid. For cyclization steps, refer to the instructions (ZAP Express cDNA Synthesis kit and ZAP Express cDNA Gigapack ^tm Gold Doning kit).

 Cotransfection with 3 ul of phage carrying the new EST and 1 ul of helper phage (a type of phage mutant with very low self-replication ability, which can provide proteases and coat proteins for the replication and packaging of plasmid DNA in host cells) 300ul E. coli XLl-Blue MRF strain (OD600 = 1.0). After obtaining single-stranded DNA, transfect E. coli XLOLR strain (provided in the kit), add 5 ml LB culture solution, 25 ul kanamycin, and incubate at 37 ° C for 12-16 hours.

2.4.2 Extraction and identification of plasmids

 The plasmid was extracted with "QIAPrep Spin Miniprep kit" from Germany QIAGEN. Centrifuge at 2400 rpm and 4 ° C for 10 minutes. Collect overnight cultured bacteria. Discard the supernatant, add 25ul buffer Pl (100ul / ml RNaseA, 50mM Tris / HCl, 10mM EDTA, pH8.0) to suspend the bacteria, and transfer to a sterile 1.5ml centrifuge tube. Try to add 250ul buffer P2 (200mM NaOH, 1% SDS), invert the supernatant several times, and mix thoroughly. Add 350ul of buffer solution P3 (3.0M KAc, pH 5.5) and immediately shake the tube 4-6 times. Centrifuge at 12,000 rpm for 10 minutes (SORVALL® Mc l2V benchtop centrifuge). The supernatant was collected and transferred to a mini purification column (QIA prep Spin Miniprep) with a collection tube at the bottom, and centrifuged at 12000 rpm for 30-60 seconds. Add 0.75ul buffer TE (10mM Tris / HCL, 1mM EDTA, pH8.0) and centrifuge for 30-60 seconds. Remove the collection tube, put a sterilized centrifuge tube on the bottom of the QLAprep micro purification column, add 50ul buffer EB (10mM Tris-HCL pH8.5) or deionized water, leave it in the column bed for 1 minute, and centrifuge for 1 minute to collect Purified DNA.

 Add 3ul of digestion buffer (10X), lul of Notl endonuclease (15u / ul), lul of ECoRI endonuclease (15u / ul), lulBSA, 2ul DNA, 22ul deionized water, and a total volume of 30ul to the centrifuge tube. Incubate at 37 ° C for 4-6 hours. The size of the plasmid was identified after digestion.

2.4.3 Determination of new full-length cDNA

Using ABD77 Auto Sequencer and Sequencing Kit BigDye ™ Terminator Ready from PE Company Reaction Mix determined the sequence of PBK-CMV positive clones.

The reaction solution contains BD 4ul, BOB 2ul (400mM Tris-HCl, pH9.0, 10mM Mg Cl ₂ ), primers 2 ul (5 pmol/ul), DNA template 30-100 ng, and supplemented with H ₂ 0 to a final volume of 20ul . The full-length cDNA sequence was determined by the step-by-step method (sequential primer method), that is, the next round of sequencing primers was determined by the terminal bases of the products obtained from the previous round of sequencing. PCR primers were designed with oligo 14.0 software.

 Results:

 As shown in SEQ ID NO: 1, the Fwapl0576 cDNA is 1083 base pairs in length. It is speculated that the start codon is 213 to 215 nucleotides (ATG) and the stop codon is 681 to 683 nucleotides. The open reading frame is 213 to 683 nucleotides and encodes a polypeptide consisting of 156 amino acid residues. BLAST analysis showed that the gene was located on chromosome 16.

 Protein homology analysis showed that: Fwapl0576 protein has no sequence homology with the currently inhibited protein. Its protein sequence is characterized by: (A) 1 to 34 Aa is a signal peptide. (B) 2 to 7 Aa (GSTWGS), 19 to 24 Aa (GLVLSL), 46 to 51 Aa (GTAISC), 96 to 101 Aa (GVSPCC), 118 to 123 Aa (GGLQAL) are N-myristoylation sites . (C) 33 to 39 Aa (RARDRDY) is a tyrosine kinase phosphorylation site. (D) 56 to 58 Aa (SSR) are protein kinase C phosphorylation sites. (E) 77 to 80 Aa (NQSN) are N-glycosylation sites. Example 3 Distribution of Fwapl0576 in Normal Tissue

3.1 Experimental materials

 A multi-tissue membrane (MTN membrane) containing mRNA from 12 tissues was purchased from Clontech, USA, and used to detect the distribution of Fwapl0576 gene in normal tissues. β-actin is a housekeeping gene that is expressed uniformly in a variety of tissues and was used as a control in this experiment.

3. 2 Northern hybridization

 Methods Refer to "Modern Molecular Biology Experimental Technology" (Editor Lu Shengdong, China Union Medical College Press, Second Edition, 1999) 147-149, 202-205, 207-213. Details are as follows:

3.2.1 Total RNA extraction

 Weigh 0.5g (adult heart, fetal heart, ventricular tumor tissue) of tissue into a 50ml centrifuge tube, add 10ml GTC, and homogenize. Add equal volume of water-saturated phenol and 0.2 volume of chloroform, shake vigorously for 15 seconds, and leave on ice for 20 minutes. Centrifuge at 12, ° C for 25 minutes at 4 ° C. Take the supernatant and place it in another centrifuge tube, add an equal volume of isopropanol, and precipitate at -2 (TC for 1 hour. Centrifuge at 4 ° C 12, OOOrpm for 25 minutes, discard the supernatant. After re-dissolving the pellet with 5 ml GTC, repeat the other operations. Wash with 1 ml of pre-chilled 75% ethanol, dry, and dissolve with DEPC-treated water. Measure 0D (optical density) 260 and 0D280.

 3. 2. 2 formaldehyde denaturing gel electrophoresis

0.6g of agarose gel was weighed and added to 52.2ml of DEPC-treated water, heated to dissolve, and the gel was cooled to 65 V, 6.0ml 10 X MOPS, 1.8ml formaldehyde was added, and the gel was poured. Take 4.5ul (40-60ug) total RNA, add 2. Oul lO X MOPS, 3. 5ul formaldehyde, lOul formamide, mix well, denature at 65 ° C for 15 minutes, and cool on ice for 2 minutes. Join Mix 2.0ul loading buffer. Load at 50 volts for 5 minutes. After all the dye enters the gel, the voltage drop is 40 volts, and the electrophoresis buffer is mixed once every 10 minutes.

3.2.3 Transfer film

 After the bromophenol blue swims to the bottom of the gel, stop electrophoresis and take a picture. The gel was washed several times with DEPC-treated water, treated with 50 mM NaOH for 45 minutes, and treated with 20XSSC for 45 minutes. The nylon membrane was first wetted with deionized water and then treated with 20XSSC for 45 minutes. Lay a layer of filter paper on the rubber tray, soak it with 20XSSC to remove air bubbles; place the glue on the rubber tray, and place a plastic sheet hollowed out on it. Carefully place the membrane on the gel to remove air bubbles, and spread two 20XSSC-soaked filter paper on the membrane to remove air bubbles. Place a 10 cm high absorbent paper on the filter paper and press a 500 g weight. Turn the film for 16 hours, and change the absorbent paper 2-3 times. Carefully remove the membrane, take a picture, and bubble the membrane with 6XSSC for 5 minutes. UV cross-linked, 8 (TC baking film for 1 hour, 4 ° C stored for future use.

3.2.4 Preparation of hybridization templates

 Upstream primer: 5 '-CC GAATTC ATGCACCGGCTCATCTTTGTC- 3'. Protected bases are shown in italics, EcoRI digestion sites are shown in bold. The underlined parts are complementary to positions 107-127 of the Fwapl0576 nucleic acid sequence. Downstream primers: 5 '- GC CTCGAG TCTTATCGAGGTGGTCTTGAGCTG_3 ,, in italics are protective bases, in bold are Xhol restriction sites, and the underlined part is complementary to positions 1198-1221 of the Fwapl0576 nucleic acid sequence.

 PCR reaction system: 5.0-fold buffer 5.0ul, 2.0ul DNA, 3.0ul upstream and downstream primers, Taq enzyme l.Oul, Fwapl0576 sequencing plasmid (template) 2.0ul, sterile water 34ul. PCR parameters: 94 ° C for 3 minutes; 94 ° C for 3 minutes, 94 ° C for 20 seconds, 6CTC for 30 seconds, 72 ° C for 80 seconds, 30 cycles. 72 ° C for 7 minutes. The PCR product was purified with ammonium acetate / ethanol (1: 5), dissolved in 50ulTE, quantified with agarose, and diluted to 25ng / μ1.

 3.2.5 Crossing

 Labeled probe: Add the PCR product to a 0.5ml centrifuge tube (denatured by heating at 98 ° C for 4 minutes and cooled on ice for 2 minutes) 25ng, 5ul of 5X labeling buffer, dNTP (no dCTP) 2.0ul, BSA 2.0ul, Klenow Enzyme l.Oul, [a-32P] dCTP 5.0ul, make up to a total volume of 50ul with nuclease-free water. Reaction at room temperature for 1-3 hours.

 Pre-hybridization: Soak the membrane with 6 X SSC for 5 minutes, and stick it to the wall of the hybridization tube to remove air bubbles. Add 6 ml of hybridization solution purchased from Clontech, 68 ° C for 1 hour.

 Hybridization: Discard the hybridization solution, add 6ml of pre-warmed hybridization solution, and add the probe (the probe needs to be denatured by heating at 98 ° C for 4 minutes, and cooled on ice for 2 minutes), 68 for 3 hours.

 Washing the membrane: First wash the membrane with 200ml of Washing Solution I (2XSSC, 0.05% SDS) four times at room temperature for 10 minutes each. Then, wash with 200 ml of washing solution 11 (0.1 IX SSC; 0.1% SDS) at 50 ° C for 20 minutes and 56 ° C for 20 minutes.

 Tableting: Absorb the liquid with filter paper, wrap it with cling film, and paste it on a piece of filter paper of the same size as the X-ray film. -70Ό exposure time. Wash the tablets.

Results: As shown in Figure 1: β-actin expression level in various tissues was one (Figure 1A); Fwapl0576 was selectively expressed in liver, kidney, and heart, and the expression level decreased in turn (Figure 1B). Example 4 Expression of Fwapl0576 Gene in Tumor Cell Lines

 4. 1 Experimental materials

 Hybrid membranes containing 8 tumor cell lines were purchased from Clontech, USA, and used to detect the distribution of Fwapl0576 gene in different tumor cell lines. β-actin served as a control for this experiment.

4. 2 Northern Hybridization

 See Example 3.2.

 Results: As shown in Figure 2, among the 8 tumor cell lines examined, the following tissues expressed the Fwapl0576 gene: lung cancer A549 cell line, Burkitt's lymphoma, melanoma G-361 cell line, and lymphocytic leukemia MDL-4 cell line The expression level of chronic myelogenous leukemia K-562 cell line decreased in turn. The structural rectal adenocarcinoma SW480 cell line does not express the Fwapl0576 gene. Example 5: Differences in the expression of Fwapl0576 gene in different cardiomyocytes

 5. 1 Experimental materials

 Cardiomyocytes from Adults, Fetuses, and Old Patients with Myocardial Infarction and Ventricular Tumors

5. 2 Northern Hybridization

 See Example 3.2.

Results: Fwapl0576 was scarcely expressed in normal adult hearts, Fwapl0576 was expressed in fetal hearts, and ventricular aneurysm tissue in adults showed 20-fold higher expression of Fwapl0576. The results suggest that Fwapl0576 is related to cardiac development. After birth, because cardiac muscle cells become resting cells in the _GD phase, many genes related to the heart are not expressed during the fetal phase. When the heart is apoptotic and necrotic due to ischemia, the heart is repaired and the genes expressed during the embryonic phase are expressed again. Example 6 Expression of Fwa _P 10576 Gene in Hearts of Normal, Chronic Heart Failure and Subacute Heart Failure Animals

 6. 1 Establishment of chronic heart failure model

 Fifty male Sprague-Dawley (SD) rats (250-300 g / head) were purchased from the animal room of the hospital. The standard blocks were provided by the Beijing Animal Center. Drinking water was tap water, and water and feed were ingested at will by the animals.

 Weigh the rats by intraperitoneal injection of general anesthesia with ketamine and diazepam according to body weight. Intubate the trachea and connect a small animal ventilator. Under the monitoring of the ECG monitor, open the left chest, ligate the left descending coronary artery with 6-10 surgical sutures, and close the chest. A marked ST segment elevation on the ECG monitor is a sign of successful ligation. Remove the ventilator after he wakes up. Postoperative feeding conditions were the same as before, and the model was built after 50 days.

6.2 Establishment of a Subacute Heart Failure Model

 Ten male Wistar rats (250 g / head) were purchased from the 301 Hospital of the Chinese People's Liberation Army. The feeding conditions were the same as those of the chronic heart failure model.

 Intraperitoneal injection of norepinephrine 30mg / day / head, continuous injection for 4 days, the model can be used on the 5th day.

6. 3 RNA-RNA in situ hybridization

In situ hybridization is based on the principle of base complementarity, and specifically probes into specific mRNA or The DNA hybridizes to reveal genes and expression products in the cell. The response is extremely sensitive, and genes that are expressed only transiently during tissue differentiation can be detected. The hybridization kit DIG RNA Labeling kit (Cat. No.1175025) was purchased from Boehringer Mannheim, Germany.

6.3.1 Probe Preparation

 Specific primer PCR, 200-300 bp Fwapl0576 nucleic acid fragment (nucleotides 248 to 508) was cloned into T Vector; recombinant plasmid amplification and purification; PCR amplification using T7 and SP6 primers; specific primers and vector T7 The gene insertion direction was determined by PCR with SP6 primers and sequenced (mRNA and Anti_mRNA). Add T7RNA polymerase antisense probe and SP6 RNA polymerase sense probe (check the reliability of the hybridization system).

6.3.2 Probe labeling

 The transcribed linear DNA was extracted with phenol / chloroform and then precipitated with alcohol. Place the RNase-free centrifuge tube on ice, and add 1 μΐ of purified linear DNA, 2 μ1 NTP labeling mixture, 2 μ110 × transcription buffer, 1 μΐ RNase inhibitor, 2 l (40u) SP6 or T7 TNA polymerase to the tube. 20μ 1. Mix well, centrifuge slightly, add 20 u of DNase I without RNA, 37 ° C for 15 minutes. 2 μ1 of 0.2 mol / L EDTA (pH 8.0) was added to terminate the polymerization reaction.

 Add 2 to the above. Mix thoroughly with 5 l 4mol / L Licl, and 75 μ alcohol (_20 ° C), and leave at -70 ° C for at least 30 minutes (or -20 ° C for at least 2 hours). Centrifuge at 12,000 rpm, wash with 70% cold ethanol, and dry. Add ΙΟΟμΙ DEPC water and 20u RNase, leave at 37 ° C for 30 minutes, aliquot, and store at -20 ° C.

6.3.3 Slide processing and specimen preparation

 Wash the slides thoroughly and autoclave for 30 minutes. Dip the slides in a solution containing polylysine (0.01%) for a few times, dry, and store at 4 ° C until use.

 Fresh specimens (rat frozen sections) 0.4cmX0.4cm, rinsed twice with 1XPBS, and placed on the fixed head of the frozen microtome. Sections of 8-10 μηι were placed on a glass slide with 1 mg / ml polylysine and allowed to dry, and fixed with 4% paraformaldehyde for 15-20 minutes. Rinse 1 X PBS 2 times for 5 minutes each.

6.3.4 Pre-hybridization

 Immerse in 0.2N HC1 for 25 minutes. 0.3% Triton X-100 for 5 minutes. Wash twice with 1 XPBS for 5 minutes each. After 4% paraformaldehyde fixation for 6 minutes. Wash twice with 1 XPBS for 5 minutes each. 5 ml of acetic anhydride was added to 1000 ml of a 0.1 mol / L triethanolamine (pH 8.0) solution, and the sections were left to stand for 10 minutes after they were completely dissolved. The above reactions are all performed at room temperature.

6.3.5 Hybridization reactions

 The hybridization solution contains 5ml deionized formamide, 2.5ml 20XSSC, 500 μΐ lOOXDenhardt's solution (10g polysucrose, 10g polyvinylpyrrolidone, 10g bovine serum albumin, 500ml sterilized double distilled water), 500 ul 10% SDS, 100 μl 10mg / ml denatured salmon sperm DNA, 400 ΐ DEPC water.

 Remove the section from the acetylation solution, blot the liquid around the specimen with filter paper, and draw a small circle around the specimen. Add 30ul of pre-hybridization solution in a small circle, and incubate at 42 ° C in a wet box for 2 hours. Shake off the prehybridization solution, cover the Parafilm membrane with 25ul of hybridization solution, and incubate in a wet box at 42 ° C for 16 hours. Close the wet box.

6.3.6 Post-hybridization Remove the slide from the thermostat and remove the Parafilm film. Rinse 2 X SSC three times at room temperature for 10 minutes each. 1

X SSC was rinsed three times at room temperature for 10 minutes each. 0. 1 X SSC Rinse twice at 50 ° C for 15 minutes each.

 If the background is too high, place the slides in a 20 w g / ml RNase solution (0.5 mol / L Nacl, 10 mmol / L Tris-Cl, pH 8.0) and digest at 37 ° C for 30 minutes. Then wash the solution with RNase-free solution at 37 ° C for 30 minutes, and wash the membrane.

 6. 3. 7 color reaction

 The slide was immersed in a washing solution (1M maleic acid, 0.15M NaCl; 0.3% (V / V) Tween-20). In 100ml blocking solution (blocking agent in the kit is added at 10% (W / V) maleic acid buffer solution (0.1 lrnol / L maleic acid, 0. 15mol / L NaCl), when using 1:10 dilution) and incubate for 30 minutes. Add 20 ml of antibody solution and incubate for 30 minutes. Wash twice with 100ml of washing solution for 15 minutes each. Add 20ml of detection solution (0.1M Tris-HC1, 0.1M NaCl, pH 9.5) and equilibrate for 2-5 minutes. Incubate in 10 ml of newly prepared coloring solution (200 ml of NBT / BCIP in 10 ml of detection solution), protect from light, and do not shake. Rinse with sterile double distilled water or TE.

 Results: It was positively expressed in the cytoplasm of rat glial cells, especially in the stroke model, which indicates that the gene is not only conservative in evolution, but also important to the body's important organs (liver, liver, Kidney and brain) have important functional roles. It is suggested that this gene may be related to the inflammatory response of cardiovascular and cerebrovascular cells and the differentiation and proliferation of tumors. Example 7: Immunohistochemical analysis

 7.1 Murine tumor tissue of myocardial infarction complications

7. 1. 1 Experimental materials

 Murine Tissue from Human Myocardial Infarction Complications

7.1.2 Immunohistochemical analysis

 A recombinant correct prokaryotic expression (ptrxfus) plasmid was used to extract and express the fusion protein from the supernatant, and the target gene band was determined by 10% denaturing polyacrylamide electrophoresis. Western blot was used to identify the target protein and the serum obtained from the animals was immunized.

Paraffin sections were 5 μm and attached to APES slides coated with polylysine, and baked at 75 ° C for 2 hours. After dewaxing xylene, it was sliced into water after gradient alcohol. 3% H ₂ 0 ₂ within 10 minutes. Wash three times with distilled water, put it into the EDTA antigen retrieval solution (pH 8. 0), and bake in a microwave oven (96 ° C-98 ° C) for 10 minutes. Cool at room temperature for 20-30 minutes and wash three times with distilled water. Add 1X PBS buffer for 5 minutes. 10% normal rabbit serum for 20 minutes. Add appropriately diluted primary antibody and incubate overnight at 4 ° C. After washing three times with lxPBS, add biotin-labeled goat anti-rabbit secondary antibody for 10 minutes at room temperature. Wash three times in lxPBS, add enzyme-linked streptavidin tertiary antibody, and let it stand at room temperature for 10 minutes. Wash three times with lxPBS and develop color with DAB. Distilled water three times, hematoxylin lightly stained nucleus, dehydrated, and mounted.

Results: Fwa _P 10576 gene was highly expressed in ventricular aneurysm.

7.2 Brain tissue of stroke patients and non-stroke patients

7. 2.1 Source of organization: Brain tissue in stroke patients and non-stroke patients. Brain tissue sections were soaked in formalin for 7 days, then dehydrated to make paraffin sections.

 7.2.2 Immunohistochemical analysis

 Refer to 7.1.2 immunohistochemical analysis method. As shown in Figure 8. Immunohistochemistry using 3 strains of Fwapl0576 gene monoclonal antibody (McAb) as the I antibody, the I antibodies for A, B, C, and D were Fwapl0576-SE3McAb, the I antibodies for E were Fwapl0576- 6H10McAb, and the F antibody was Fwapl0576- 6BllMcAb. From Figures B, D, E, and F, it can be seen that the gene is clearly expressed in the nucleus of nerve cells in patients with stroke. Example 8: Recombination and protein expression of Fwapl0576 gene in vitro

 8.1 Constructing a Recombinant Vector

 Vector pTrxFus (available from Invitrogen). Take 20ul pTrxFus vector, 10X buffer 4.0ul, l.Oul Xhol, l.Oul Smal, 14ul sterile water, and digest with 37 ° C for 16 hours. Purify the digested product.

PCR primers were synthesized by Shanghai Shenggong Biological Company, and purified by polyacrylamide gel electrophoresis, 0D _2M = 5). Forward primer: 5'CGG GAC CGG GAT TAC C 3 ', reverse primer 5, ATG TCT AGA TCA TAG AGC ACG AA 3'.

 Take 10 ul of the purified PCR product, 2.0ul of 10X buffer, l.Oul Xhol, 7ul of sterile water, and digest with 37 ° C for 16 hours. Purify the digested product.

 8.1.2 Connection

 l.Oul pTrxFus digestion product, 3. Oul PCR digestion product, l.Oul 10X buffer solution, l.Oul T4 ligase, 4ul sterile water, 16 ligation for 6 hours.

 8.1.3 Conversion

 Take 5ul of the above ligation product and add 100ul of GI724 competent cells. Mix well and place on ice for 30 minutes. 60 seconds at 42 ° C, 2 minutes on ice. Add 800ul S0C medium and shake at 37 ° C (less than 225RPM) for 45 minutes. 100 μl was applied to LB plates containing Amp (ampicillin) resistance. Incubate at 30 ° C for 16 hours. Pick single clones and place them in 5ml LB medium containing 50ug Amp and shake at 37 ° C for 16 hours.

 8.1.4 Plasmid extraction

Pick out monoclonal colonies and inoculate 5ml RM-Amp medium (rich medium containing ampicillin, consisting of 6gN HP0 ₄ (anhydrous), 3gKH ₂ PO ₄ , 0.5gNaCl, lgNH ₄ Cl, 20g Casamino Acids (acid _{casamino), 0.095gMgCl 2), 30 °} C shaking (220_250rpm) overnight.

Take the bacterial solution, centrifuge at 2,000 RPM for 10 minutes, and discard the supernatant. Pre-cooled solution I (25mM Tris-HCl, pH8.0, 2. OmM EDTA, 50mM glucose) 140ul was added to the pellet, and the bacteria were suspended. Bacteria were lysed with 280ul of freshly prepared solution II (0.2M NaOH, 1% SDS). Add 450ul of pre-chilled solution (II · OM Potassium acatate) and mix. Centrifuge at 4,000 RPM for 10 minutes and 12,000 RPM for 10 minutes. Take the supernatant and add 0.6 times the volume of Isopropanol, centrifuged as above. Dissolve the pellet with ul TE (10 mM Tris-HCl, 0.1 Im EDTA, pH 8.0) and 20 ug / ml RNase, 37 ° C for 30 minutes. Add 600ul of ammonium acetate / ethanol (1: 5) and leave at -70 ° C for 30 minutes. After centrifugation, it was washed with 75% ethanol. TE 100ul was used to dissolve the extracted plasmid, and the OD260 / 280 was measured.

8.1.5 Selecting positive clones

 Positive clones were identified by PCR.

 8.1.6 Sequence determination

Sequencing clones that were positive for restriction enzyme cleavage and PCR. The primers were synthesized by Shanghai Shenggong Biological Company, purified by polyacrylamide gel electrophoresis,

pTRXFUS forward sequencing primer: 5 '-TTC CTC GAC GCT AAC CTG-3', pTRXFUS reverse sequencing primer: 5 '-TGT AAA ACG ACG GCC AGT GC-3'. The final primer concentration was 5 uM.

The clones identified as positive by sequencing ( _P TrxSX576) were stored in 15% glycerol and stored at _20C.

8.2 Induced expression of recombinant proteins

Inoculate 50ul of bacterial solution ( _P TrxSX576) in 5ml RM-Amp medium, shake (220-250rpm) at 30 ° C overnight. Take 250ul of overnight bacteria and inoculate 5ml IM induction medium (6g anhydrous N HP0 ₄ , 3g KH ₂ PO ₄ .0.5gNaCl, lg NH ₄ C1, 2g acid hydrolyzed casein, 0.095g MgCl ₂ ), shake at 30 ° C (220- 250 rpm) for 3 hours, take it out, and measure 0D550 to about 0.5. Add 900ml deionized water to dissolve, add water to make the final volume 1 liter, high pressure for 20 minutes (15 psi, 121 ° C), cool to room temperature, lml 100mg / ml ampicillin, 25ml 20% sterile glucose, 20 ° C-25 . C adjust pH = 7.0 ± 0.2, store at + 4 ° C. Add tryptophan (Trp) to a final concentration of 100 ug / ml, 37. C shake (220-250rpm) for 4 hours, add 10mg / ml tryptophan (Trp), heat 500ml glass distilled water to 80 ° C, add 5g L-tryptophan, stir until completely dissolved, filter solution with 0.45 _Um filter membrane Sterilize and store at 4 ° C in the dark for a maximum of 6 months. Remove the bacterial solution and measure 0D550. Centrifuge at 4300 g to harvest the bacterial cells and immediately release the protein by ultrasound or store at -20 ° C.

8.3 Ultrasound release of fusion protein

 Induced expression of the fusion protein, centrifuged at 4300 g at + 4 ° C for 10 minutes, discarded the supernatant, and retained the pellet. The cells were resuspended in solution II (20 mM Tris-HCl, pH 8, 2.5 mM EDTA) to an OD550 of 100, and placed on ice. The bacterial solution was placed on ice, pulsed for 3X10 seconds, immediately frozen in liquid nitrogen, and then quickly dissolved in a 37 ° C water bath. Repeat twice; centrifuge at 4 ° C, 4300 g for 10 minutes, and transfer the supernatant to a new tube. Medium, save on ice.

8.4 Polyacrylamide Gel Electrophoresis and Western Blotting

8.4.1 Polyacrylamide gel electrophoresis

 Take 20ul of ultrasonically released fusion protein solution and add an appropriate amount of protein loading buffer, boil in a boiling water bath for 5 minutes, centrifuge at 5000rpm for 5 minutes, and take 20ul of the supernatant to load. 60V constant pressure into concentrated gel (5%), 120V constant pressure Into 15% separation gel; unload the gel, Coomassie bright blue staining 1-2 hours, decolorization analysis results.

8.4.2 Western Blot

Semi-dry system (Bio-Rad product) Transfer membrane for 1 hour, transfer buffer: (see "Experimental Guide for Fine-Grade Molecular Biology"). Remove the nitrocellulose membrane, 10 ml of blocking solution (20 mM Tris-Cl, 500 mM NaCl, pH = 7.5, 3% BSA), and shake at room temperature for 1 hour. 20mlTBST (20mM Tris-Cl, 500mM NaCl, pH = 7.5, 0.05% Tween-20 (w / v)) Wash the membrane for 5 minutes, and shake gently at room temperature. Repeat once. Transfer the membrane to 1: 20,000 diluted primary antibody buffer and incubate at room temperature for 1-2 hours. Wash the membrane with 20ml TBST for 5 minutes at room temperature. Repeat 1 time; infiltrate for 1 hour at room temperature in 10ml 1: 5000 diluted secondary antibody buffer; wash the membrane with 20ml TBST twice at room temperature for 5 minutes each; times for 5 min; prepare fresh substrate solution: 66ul NBT (nitro- blue tetrazolium, tetrazolium, Promega) + 10ml of alkaline phosphatase buffer (lOOmM Tris-Cl, lOOmM NaCl , 5mM MgCl 2, pH = 9.5 ) Mix and add 33ul BCIP. (5-bromo- 4- chloro-3- indolyl- pHospHate, 5-bromo- 4-chloro- 3-indole-phosphate, Promega) and mix (use within 1 hour) Reserve; 20ml alkaline phosphatase buffer was washed twice at room temperature for 5 minutes each time; 10ml substrate solution was gently shaken at room temperature for 10-30 minutes; color development was stopped: 20ml high pressure water for 5 minutes.

8.5 Optimization of Expression Conditions for Recombinant Protein TRXSX576

 8.5.1 Changes in the expression of recombinant protein TRXSX576 at different activation times

 TRXSX576-expressing strains were activated at 220-250 rpm at 30 ° C for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, and 6 hours, respectively, and then tryptophan was added to a final concentration of 100 ug / ml. After 4 hours of induction, the expression of recombinant protein was detected by polyacrylamide gel electrophoresis. The results are shown in FIG. 5A.

8.5.2 Changes in the expression of recombinant protein TRXSX576 at different induction times

 Based on the above, the optimal activation time was used to activate the TRXSX576 expressing strain, and then tryptophan was added to a final concentration of 100ug / ml, 37. C 220-250rpm induced 0 hours, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours. Polyacrylamide gel electrophoresis was used to detect the expression of recombinant protein TRXSX576. The results are shown in Figure 5B.

8.6 Purification of Fusion Protein TRXSX576 by Affinity Chromatography

 Fusion protein release: Under the optimal activation time and induction time, express the fusion protein, release it by ultrasound, measure

0D280, rough calculation of protein concentration.

 Equilibrium resin: take 2ml Resin (total ethanol plus ½1) for natural precipitation, discard ethanol; resuspend with 4-8ml RB (20mM βΜΕ, βmercaptoethanol), leave it to settle naturally, discard the buffer carefully; add 4 8ml RB (20mM resuspended, gently shake at room temperature for 30-60 minutes, carefully discard the supernatant; resuspend with 4-8ml RB (without β ME), leave it to settle naturally, discard the buffer carefully; repeat The above steps.

 Pack the column: Add 2ml of RB to the column; resuspend Resin with RB, carefully add to the column; wait for Resin to deposit naturally, open the control valve and let the buffer flow down at a rate of about 1 drop / 7 seconds.

 Purification: Loading: Approximately 2ml of fusion protein solution, collected in 2ml / 12X75 test tubes, dilute 5ul to 500ul to measure 0D280, wash the column: 8ml RB (lmMPME), abbreviated ΙηΜβΜΕ, elution: 6ml 5πιΜβ ME, ΙΟπιΜβΜΕ , 50 mM β ME, 100 μM βΜΕ, 200 mM β ME, 500 mM β ME, 100 μM βΜΕ. In most cases, the target protein is eluted between 10-200 mMPME.

 Polyacrylamide gel electrophoresis identification: Take 20ul of polyacrylamide gel electrophoresis to identify each tube (the method is the same as above). 8.7 Dialysis and Concentration of Fusion Proteins

lXEK (enterokinase, enterokinase) buffer, + 4 ° C, dialysis with magnetic stirring, change the dialysate once every 4 hours, change the dialysate at least 4 times; concentrate with PEG to 1ml, and store at 4 ° C. Example IX: High expression of Fwapl0576 induces cell proliferation

9.1 Construction of expression vectors

Antisense recombinant expression vectors of p _C DNA-Fwapl0576 sense and pcDNA-Fwapl0576 were constructed using molecular cloning technology and with reference to the methods of the previous examples. PcDNA3. IB vector was purchased from CLONTECH. 9.2 Obtaining stable expression clones

 Select Lipfectintm kit from CL0NTECH. Take lul DNA plasmid and lug liposomes to transfect human lung cancer A549 cells (purchased from the Cell Center of the Institute of Basic Medical Sciences). G418 (20 (^ g / ml)) was selected and cultured 24 hours after transfection. Stably expressed cell line.

9.3 Observing the biological effects of cells by cell counting and MTT staining

9. 3. 1 Trypsin digestion method:

Discard the cell culture solution, wash the cells twice with 1XPBS (0.5 ml / cm ² culture dish), add 1XPBS containing 0.125% trypsin to digest the cells for 5 minutes, and repeatedly pipette with a pipette to mix. It was then counted with a hemocytometer. 9. 3.2 Cell count:

 The cells are dropped into a blood cell counting plate and placed on an optical microscope (Nikon Japan) to count the cells. The calculation formula of the cell number is: The calculation formula of the cell number is:

 Cells / ml = 4 large cells / 4 X 10,000 X dilution

Results:

 It can be seen from FIG. 9 that the pcDNA3.1-pl0576 sense vector stimulates cell proliferation, while its antisense vector significantly inhibits cell proliferation. The results of MTT live cell staining were the same as the cell count.

 The present invention is not limited to the specific embodiments described above, and the embodiments are only used to illustrate certain aspects of the present invention. Functionally equivalent methods and materials are included within the scope of this invention. In fact, various changes based on the invention will be apparent to those skilled in the art from the description herein and the accompanying drawings. Such changes are included in the scope of the claims of the present invention.

Claims

Claim

1. An isolated polynucleotide comprising a member selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide as shown in SEQ ID NO: 2;

 (b) a polynucleotide, which is (a) a naturally occurring polynucleotide variant;

 (c) A polynucleotide capable of hybridizing to (a) and having at least 85% homology with (a).

 2. The polynucleotide of claim 1, wherein said polynucleotide is DNA.

 3. The polynucleotide of claim 1, wherein said polynucleotide is RNA.

 4. The polynucleotide of claim 1, wherein said polynucleotide is genomic DNA.

 5. The polynucleotide of claim 1, said polynucleotide having a sequence as shown in SEQ ID NO: 1.

6. The polynucleotide of claim 1, said polynucleotide comprising nucleotides 213 to 683 as shown in SEQ ID NO: 1.

 7. The polynucleotide of claim 2, which encodes a polypeptide as set forth in SEQ ID NO: 2.

 A vector comprising the DNA of claim 2.

 9. A host cell, said host cell being transformed or transfected with a vector according to claim 8.

 10. A method for producing a polypeptide, said method comprising expressing a polypeptide encoded by said DNA in a host cell according to claim 9.

 11. A polypeptide comprising a member selected from the group consisting of:

 (a) a polypeptide having a deduced amino acid sequence as shown in SEQ ID NO: 2;

 (b) a polypeptide which is an active fragment, analog or derivative of (a);

 (c) a polypeptide having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2.

 12. An antibody to the polypeptide of claim 11.

 13. A compound which inhibits the activation of the polypeptide of claim 11.

 A pharmaceutical composition, said pharmaceutical composition comprising an effective amount of the polypeptide of claim 11 or an active fragment thereof, and one or more pharmaceutically acceptable carriers or excipients.

 15. Use of the polypeptide of claim 11 in the preparation of a pharmaceutical composition for the treatment of cardiovascular and cerebrovascular diseases.

 16. A method of treating a patient in need of Fwapl0576, said method comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 11.

 17. The method of claim 16, said method comprising: providing a patient with DNA encoding said polypeptide, and expressing said polypeptide in the patient.

 18. A method for diagnosing or susceptibility to a disease, said method comprising: determining a mutation in a polynucleotide of claim 1.

 19. A diagnostic method, said method comprising: analyzing whether a polypeptide according to claim 11 is present in a sample derived from a host cell and an autoantibody.