WO2002068600A2

WO2002068600A2 - Endogenous and non-endogenous versions of human g protein-coupled receptors

Info

Publication number: WO2002068600A2
Application number: PCT/US2002/005625
Authority: WO
Inventors: Chen W. Liaw; Derek T. Chalmers; Dominic P. Behan; Dominique Maciejewski-Lenior; James N. Leonard; I-Lin Lin; Daniel Ortuno
Original assignee: Arena Pharmaceuticals, Inc.
Priority date: 2001-02-26
Filing date: 2002-02-26
Publication date: 2002-09-06
Also published as: EP1412372A4; EP1412372A2; JP2004526441A; CA2439383A1; CN1516706A; WO2002068600A3

Abstract

The invention disclosed in this patent docuemnt relates to transmembrane receptors, more particularly to a human G protein-coupled receptor and to mutated (non-endogenous) versions of the human GPCRs for evidence activity.

Description

ENDOGENOUS AND NON-ENDOGENOUS VERSIONS OF HUMAN G PROTEIN-COUPLED RECEPTORS

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation-in-part of U.S. Serial Number 09/170,496, filed on October 13, 1998 and its corresponding PCT application number PCT/US99/23938, published as WO 00/22129 on April 20, 2000. This application also is a continuation in part of U.S. Ser. No. 09/060,188, filed April 14, 1998, which is a continuation in part of U.S. Ser. No. 08/839,449, filed April 14, 1997 (abandoned). The priority benefit of each of the foregoing is claimed herein, and the disclosures of each of the foregoing is incorporated by reference herein in its entirety. This application also claims the benefit of U.S. Provisional Number 60/271,913, filed February 26, 2001, also incorporated herein by reference in its entirety. This document is related to the following applications: U.S. Provisional Number 60/250,881, filed December 1, 2000; U.S. Provisional Number 60/253,428, filed November 27, 2000; U.S. Provisional Number 60/234,317, filed September 20, 2000; U.S. Provisional Number 60/245,853, filed November 3, 2000; U.S. Provisional Number 60/234,045, filed September 20, 2000; U.S. Provisional Number 60/200,568, filed April 28, 2000; U.S. Provisional Number 60/198,518, filed April 19, 2000; U.S. Provisional Number 60/189,353, filed March 14, 2000; U.S. Provisional Number 60/166,084, filed November 17, 1999; and U.S. Provisional Number 60/106,451, filed October 30, 1998, the disclosures of each of which are incorporated herein by reference in their entirety. FIELD OF THE INVENTION

The present invention relates to transmembrane receptors, in some embodiments to G protein-coupled receptors and, in some preferred embodiments, to endogenous GPCRs that are altered to estabhsh or enhance constitutive activity of the receptor. In some embodiments, the constitutively activated GPCRs will be used for the direct identification of candidate compounds as receptor agonists or inverse agonists having applicability as therapeutic agents.

BACKGROUND OF THE INVENTION

Although a number of receptor classes exist in humans, by far the most abundant and therapeutically relevant is represented by the G protein-coupled receptor (GPCR) class. It is estimated that there are some 30,000-40,000 genes within the human genome, and of these, approximately 2% are estimated to code for GPCRs. Receptors, including GPCRs, for which the endogenous ligand has been identified, are referred to as "known" receptors, while receptors for which the endogenous ligand has not been identified are referred to as "orphan" receptors.

GPCRs represent an important area for the development of pharmaceutical products: from approximately 20 of the 100 known GPCRs, approximately 60% of all prescription pharmaceuticals have been developed. For example, in 1999, of the top 100 brand name prescription drugs, the following drugs interact with GPCRs (diseases and/or disorders treated are indicated in parentheses):

Claritin® (allergies) Prozac® (depression) Vasotec® (hypertension) Paxil® (depression) Zoloft® (depression) Zyprexa ® (psychotic disorder)

Cozaar® (hypertension) ϊmitrex® (migraine) Zantac® (reflux)

Propulsid® (reflux disease) Risperdal® (schizophrenia) Serevent® (asthma)

Pepcid® (reflux) Gaster® (ulcers) Atrovent® (bronchospasm) Effexor® (depression) Depakote® (epilepsy) Cardura® (prostatic hypertrophy) Allegra® (allergies) Lupron® (prostate cancer) Zoladex® (prostate cancer) Diprivan® (anesthesia) BuSpar® (anxiety) Ventolin® (bronchospasm) Hytrin® (hypertension) Wellbutrin® (depression) Zyrtec® (rhinitis) Plavix® (Ml/stroke) Toprol-XL® (hypertension) Tenormin® (angina) Xalatan® (glaucoma) Singulair® (asthma) Diovan® (hypertension) Harnal® (prostatic hyperplasia) (Med Ad News 1999 Data).

GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane- 1 (TM-1), transmebrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively). The transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and IC-3), respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" ("N") terminus of the receptor lies in the extracellular space outside of the cell.

Generally, when an endogenous ligand binds with the receptor (often referred to as "activation" of the receptor), there is a change in the conformation of the intracellular region that allows for coupling between the intracellular region and an intracellular "G-protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, G_q, G_s, Gj, G_z and G₀ are G proteins that have been identified. Ligand-activated GPCR coupling with the G-protein initiates a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition. Although not wishing to be bound to theory, it is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with the G protein.

Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active" state. A receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response. Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G- protein) and produces a biological response. A receptor may be stabilized in an active state by a ligand or a compound such as a drug. Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor, provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of a ligand binding to the receptor. Stabihzation by such ligand-independent means is termed "constitutive receptor activation."

SUMMARY OF THE INVENTION

Disclosed herein are endogenous and non-endogenous versions of human GPCRs and uses thereof. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:2, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:63, and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:62 and host cells comprising the same.

Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:4, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:65, and host cells comprising the same.

Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:64 and host cells comprising the same.

Some embodiments of the present invention relate to G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:6, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.

Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:5 and host cells comprising the same.

Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.DD.NO.:8, non-endogenous, constitutively activated versions of the same encoded by an amino acid of

SEQ.ID.NO.:67, SEQ.ID.NO.:69, SEQ.ID.NO.:71, and SEQ.ID.NO.:73, and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:66, SEQ.ID.NO.:68, SEQ.ID.NO.:70, and SEQ.ID.NO.:72, and host cells comprising the same.

Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:10, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:75 and SEQ.ID.NO.:77, and host cells comprising the same.

Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:74 and SEQ.ID.NO.:76, and host cells comprising the same.

Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:12, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:79 and SEQ.ID.NO.:81, and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:78 and SEQ.ID.NO.:80, and host cells comprising the same.

Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:14, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:83, and host cells comprising the same.

Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:82 and host cells comprising the same. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:16, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:85, and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:84 and host cells comprising the same.

Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:18, constitutively activated versions of the same encoded by an amino acid of SEQ. ID .NO.: 87, and host cells comprising the same.

Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:86 and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:84 and host cells comprising the same. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:98, non-endogenous, constitutively activated versions of the same and host cells comprising the same.

Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:97 and host cells comprising the same.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a graphic representation of the results of a second messenger cell-based cyclic AMP assay providing comparative results for constitutive signaling of endogenous, constitutively active FPRL-2 ("FPRL-2 wt"), non-endogenous, constitutively activated version of FPRL_:2 ("FPRL-2 (L240K)") fused with a Gs/Gi Fusion Protein Construct and a control ("Gs/Gi").

Figure 2 provides graphic results of comparative analysis of endogenous STRL33 against non-endogenous, constitutively activated STRL33 ("STRL33(L230K)") utilizing an 8XCRE-Luc Reporter assay in 293T cells as compared with the control ("CMV").

Figure 3 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR(A623I) ("signal enhancer") with an endogenous target receptor, in this case GPR45 ("GPR45 wt"), versus a control ("CMN"), utilizing a cell-based adenylyl cyclase assay in 293 cells. This assay involved the addition of TSH, the endogenous ligand for TSHR.

Figure 4 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR(A623I) ("signal enhancer") and an endogenous target receptor, in this case mGluR7 ("mGluR7 wt"), versus non-endogenous, constitutively activated versions of the target receptor mGluR7 ("W590S," "R659H" "T771C" and "I790K") co-transfected with non-endogenous TSHR(A623I), utilizing a cell-based adenylyl cyclase assay in 293 cells. This assay involved the addition of TSH, the endogenous ligand for TSHR.

Figure 5 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR(A623I) ("signal enhancer") and an endogenous target receptor, in this case mGluR7 ("mGluR7 wt"), versus non-endogenous, constitutively activated versions of the target receptor mGluR7 ("W590S," "R659H" "T771C" and "I790K") co-transfected with non-endogenous TSHR(A623I), utilizing a cell-based adenylyl cyclase assay in RGT cells. This assay involved the addition of TSH, the endogenous ligand for TSHR.

Figure 6 provides an illustration of second messenger IP production of non- endogenous mGluR7, "T771C", co-transfected with non-endogenous versions of Gq protein, "Gq(del)" and "Gq(del)/Gi" compared with "Gq(del)" and "Gq(del)/Gi" in the presence and absence of glutamate.

Figure 7 is a comparative analysis of endogenous, non-constitutively active GPR37 ("wt") and non-endogenous, constitutively activated versions of GPR37 ("C543Y" and "L352R") in an SRE Reporter assay, where the control is expression vector ("CMV").

Figure 8 is comparative analysis of a co-transfection of Gs/Gi Fusion Construct and an endogenous target receptor, in this case GPR37 ("GPR37 wt"), versus non-endogenous, constitutively activated versions of the target receptor GPR37 ("C543Y" and "L352R") co- transfected with Gs/Gi Fusion Construct utilizing a whole cell second messenger cAMP assay.

Figure 9 is a representation of a Northern Analysis of GPR37 expressed in forskolin treated rat Schwann cells. Cell differentiation was maintained at 20uM of forskolin.

Figure 10 is a representation of a Northern Analysis of GPR37 expressed in crushed rat sciatic nerve. GPR37 was highly up-regulated seven (7) days post crush. Figure 11 is a comparative analysis of endogenous, non-constitutively active

HF1948 Cwt") and non-endogenous, constitutively activated version of HF1948 ("I281F") in an IP3 assay, where the control is expression vector ("pCMV").

Figure 12 is comparative analysis of a co-transfection of non-endogenous TSHR- A623I ("signal enhancer") and an endogenous target receptor, in this case HF1948 ("HF1948 wt"), versus non-endogenous, constitutively activated versions of the target receptor HF1948 ("I281F" and "E135N') co-transfected with non-endogenous TSHR- A623I, utilizing a whole cell adenylyl cyclase assay. This assay involved the addition of TSH, the endogenous ligand for TSHR. Figure 13 a reproduction of a photograph of the results for the Northern Blot of GPR66 using multiple pancreatic cell lines.

Figure 14 provides graphic results of comparative analysis of endogenous GPR35 against non-endogenous, constitutively activated GPR35 ("GPR35(A216K)") utilizing an E2F-Luc Reporter assay in 293A cells.

Figure 15 is a reproduction of a photograph of the results for the Northern Blot of GPR35 using multiple tissue (human) cDNA.

Figures 16 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR-A623I ("TSHR-A623I") (with and without TSH) and endogenous ETBR-LP2 ("WT"), versus non-endogenous, constitutively activated ETBR-LP2

("N358K") co-transfected with mutated TSHR-A623I (with and without TSH) utilizing an adenylyl cyclase assay.

Figure 17 provides a graphic result comparative analysis of endogenous ETBR-LP2 ("WT") and non-endogenous, constitutively activated ETBR-LP2 ("N358K") utilizing an AP 1 reporter assay system.

Figure 18 is a representation of a Northern Analysis of ETBR-LP2 expressed in forskolin treated rat Schwann cells. Cell differentiation was maintained at 20uM of forskolin.

Figure 19 is a representation of a Northern Analysis of ETBR-LP2 expressed in crushed rat sciatic nerve. ETBR-LP2 was highly up-regulated seven (7) days post crush.

Figures 20A and 20B provides an alignment report between the putative amino acid sequence of the human ETBR-LP2 ("hETBRLP2p") and the reported amino acid sequence of human GPR37 ("hGPR37p"). DETAILED DESCRIPTION

The scientific literature that has evolved around receptors has adopted a number of terms to refer to ligands having various effects on receptors. For clarity and consistency, the following definitions will be used throughout this patent document. To the extent that these definitions conflict with other definitions for these terms, the following definitions shall control:

AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor, or enhance GTP binding to membranes. In some embodiments, AGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.

AMINO ACID ABBREVIATIONS used herein are set out in Table A:

TABLE A

ANTAGONIST shall mean materials (e.g., ligands, candidate compounds) that competitively bind to the receptor at the same site as the agonists but which do not activate the intracellular response initiated by the active form of the receptor, and can thereby inhibit the intracellular responses by agonists. ANTAGONISTS do not diminish the baseline intracellular response in the absence of an agonist. In some embodiments, ANTAGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.

CANDDDATE COMPOUND shall mean a molecule (for example, and not limitation, a chemical compound) that is amenable to a screening technique. Preferably, the phrase "candidate compound" does not include compounds which were publicly known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound"); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified compound which has previously been determined to have therapeutic utility in humans. COMPOSITION means a material comprising at least one component; a "pharmaceutical composition" is an example of a composition.

COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality; i.e. the ability to activate/inhibit a signal transduction pathway, as opposed to receptor binding affinity. Exemplary means of detecting compound efficacy are disclosed in the Example section of this patent document.

CODON shall mean a grouping of three nucleotides (or equivalents to nucleotides) which generally comprise a nucleoside (adenosine (A), guanosine (G), cytidine (C), uridine (U) and thymidine (T)) coupled to a phosphate group and which, when translated, encodes an amino acid.

CONSTITUTIVELY ACTIVATED RECEPTOR shall mean a receptor subjected to constitutive receptor activation. A constitutively activated receptor can be endogenous or non-endogenous.

CONSTITUTIVE RECEPTOR ACTIVATION shall mean stabilization of a receptor in the active state by means other than binding of the receptor with its ligand or a chemical equivalent thereof.

CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system.

DIRECTLY IDENTIFYING or DIRECTLY IDENTIFIED, in relationship to the phrase "candidate compound", shall mean the screening of a candidate compound against a constitutively activated receptor, preferably a constitutively activated orphan receptor, and most preferably against a constitutively activated G protein-coupled cell surface orphan receptor, and assessing the compound efficacy of such compound. This phrase is, under no circumstances, to be interpreted or understood to be encompassed by or to encompass the phrase "indirectly identifying" or "indirectly identified."

ENDOGENOUS shall mean a material that a mammal naturally produces.

ENDOGENOUS in reference to, for example and not limitation, the term "receptor," shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus. By contrast, the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus. For example, and not limitation, a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active, is most preferably referred to herein as a "non-endogenous, constitutively activated receptor." Both terms can be utilized to describe both "in vivo" and "in vitro" systems. For example, and not limitation, in a screening approach, the endogenous or non-endogenous receptor may be in reference to an in vitro screening system. As a further example and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous constitutively activated receptor, screening of a candidate compound by means of an in vivo system is viable.

G PROTEIN COUPLED RECEPTOR FUSION PROTEIN and GPCR FUSION PROTEIN, in the context of the invention disclosed herein, each mean a non- endogenous protein comprising an endogenous, constitutively activate GPCR or a non- endogenous, constitutively activated GPCR fused to at least one G protein, most preferably

the alpha (α) subunit of such G protein (this being the subunit that binds GTP), with the G

protein preferably being of the same type as the G protein that naturally couples with endogenous orphan GPCR. For example, and not limitation, in an endogenous state, if the

G protein "G_s " is the predominate G protein that couples with the GPCR, a GPCR Fusion Protein based upon the specific GPCR would be a non-endogenous protein comprising the

GPCR fused to G_s ; in some circumstances, as will be set forth below, a non-predominant

G protein can be fused to the GPCR. The G protein can be fused directly to the C-terminus of the constitutively active GPCR or there may be spacers between the two. HOST CELL shall mean a cell capable of having a Plasmid and/or Vector incorporated therein, i the case of a prokaryotic Host Cell, a Plasmid is typically replicated as a autonomous molecule as the Host Cell rephcates (generally, the Plasmid is thereafter isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell, a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic Host Cell replicates, the Plasmid replicates. In some embodiments the Host Cell is eukaryotic, more preferably, mammalian, and most preferably selected from the group consisting of 293, 293T and COS-7 cells.

INDIRECTLY IDENTIFYING or INDERECTLY IDENTIFIED means the traditional approach to the drug discovery process involving identification of an endogenous ligand specific for an endogenous receptor, screening of candidate compounds against the receptor for determination of those which interfere and/or compete with the ligand-receptor interaction, and assessing the efficacy of the compound for affecting at least one second messenger pathway associated with the activated receptor.

INHIBIT or INHIBITING, in relationship to the term "response" shall mean that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.

INVERSE AGONISTS shall mean materials (e.g., ligand, candidate compound) which bind to either the endogenous form of the receptor or to the constitutively activated form of the receptor, and which inhibit the baseline intracellular response initiated by the active form of the receptor below the normal base level of activity which is observed in the absence of agonists, or decrease GTP binding to membranes. Preferably, the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% as compared with the baseline response in the absence of the inverse agonist.

KNOWN RECEPTOR shall mean an endogenous receptor for which the endogenous ligand specific for that receptor has been identified. LIGAND shall mean a molecule specific for a naturally occurring receptor.

MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid and/or amino acid sequence shall mean a specified change or changes to such endogenous sequences such that a mutated form of an endogenous, non-constitutively activated receptor evidences constitutive activation of the receptor. In terms of equivalents to specific sequences, a subsequent mutated form of a human receptor is considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the subsequent mutated form of a human receptor is substantially the same as that evidenced by the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic acid) homology between the subsequent mutated form of the receptor and the first mutation of the receptor is at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99%. In some embodiments, owing to the fact that some preferred cassettes disclosed herein for achieving constitutive activation include a single amino acid and/or codon change between the endogenous and the non-endogenous forms of the GPCR, it is preferred that the percent sequence homology should be at least 98%.

NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring molecule specific for an identified ligand wherein the binding of a ligand to a receptor activates an intracellular signaling pathway.

ORPHAN RECEPTOR shall mean an endogenous receptor for which the ligand specific for that receptor has not been identified or is not known.

PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, and not limitation, a human). Those of ordinary skill in the art will understand and appreciate the techniques appropriate for determining whether an active ingredient has a desired efficacious outcome based upon the needs of the artisan.

PLASMID shall mean the combination of a Vector and cDNA. Generally, a Plasmid is introduced into a Host Cell for the piuposes of repUcation and/or expression of the cDNA as a protein.

SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation. A second messenger can include, for example, inositol triphosphate (IP₃), diacycglycerol (DAG), cyclic AMP (cAMP), and cyclic GMP (cGMP). Second messenger response can be measured for a determination of receptor activation. In addition, second messenger response can be measured for the direct identification of candidate compounds, including for example, inverse agonists, agonists, and antagonists. SIGNAL TO NOISE RATIO shall mean the signal generated in response to activation, amplification, or stimulation wherein the signal is above the background noise or the basal level in response to non-activation, non-amplification, or non-stimulation.

SPACER shall mean a translated number of amino acids that are located after the last codon or last amino acid of a gene, for example a GPCR of interest, but before the start codon or beginning regions of the G protein of interest, wherein the translated number amino acids are placed in-frame with the beginnings regions of the G protein of interest. The number of translated amino acids can be tailored according to the needs of the skilled artisan and is generally from about one amino acid, preferably two amino acids, more preferably three amino acids, more preferably four amino acids, more preferably five amino acids, more preferably six amino acids, more preferably seven amino acids, more preferably eight amino acids, more preferably nine amino acids, more preferably ten amino acids, more preferably eleven amino acids, and even more preferably twelve amino acids.

STIMULATE or STIMULATING, in relationship to the term "response" shall mean that a response is increased in the presence of a compound as opposed to in the absence of the compound.

SUBSTANTIALLY shall refer to a result which is within 40% of a control result, preferably within 35%, more preferably within 30%, more preferably within 25%, more preferably within 20%, more preferably within 15%, more preferably within 10%, more preferably within 5%, more preferably within 2%, and most preferably within 1% of a control result. For example, in the context of receptor functionality, a test receptor may exhibit substantially similar results to a control receptor if the transduced signal, measured using a method taught herein or similar method known to the art-skilled, if within 40% of the signal produced by a control signal. VECTOR in reference to cDNA shall mean a circular DNA capable of incorporating at least one cDNA and capable of incorporation into a Host Cell.

The order of the following sections is set forth for presentational efficiency and is not intended, nor should be construed, as a limitation on the disclosure or the claims to follow.

A. Introduction

The traditional study of receptors has typically proceeded from the a priori assumption (historically based) that the endogenous ligand must first be identified before discovery could proceed to find antagonists and other molecules that could affect the receptor. Even in cases where an antagonist might have been known first, the search immediately extended to looking for the endogenous ligand. This mode of thinking has persisted in receptor research even after the discovery of constitutively activated receptors. What has not been heretofore recognized is that it is the active state of the receptor that is most useful for discovering agonists and inverse agonists of the receptor. For those diseases which result from an overly active receptor or an under-active receptor, what is desired in a therapeutic drug is a compound which acts to diminish the active state of a receptor or enhance the activity of the receptor, respectively, not necessarily a drug which is an antagonist to the endogenous ligand. This is because a compound that reduces or enhances the activity of the active receptor state need not bind at the same site as the endogenous ligand. Thus, as taught by a method of this invention, any search for therapeutic compounds should start by screening compounds against the ligand-independent active state.

B. Identification of Human GPCRs The efforts of the Human Genome project have led to the identification of a plethora of information regarding nucleic acid sequences located within the human genome; it has been the case in this endeavor that genetic sequence information has been made available without an understanding or recognition as to whether or not any particular genomic sequence does or may contain open-reading frame information that translate human proteins. Several methods of identifying nucleic acid sequences within the human genome are within the purview of those having ordinary skill in the art.

Receptor homology is useful in terms of gaining an appreciation of a role of the receptors within the human body. As the patent document progresses, techniques for mutating these receptors to establish non-endogenous, constitutively activated versions of these receptors will be discussed.

The techniques disclosed herein are also applicable to other human GPCRs known to the art, as will be apparent to those skilled in the art. C. Receptor Screening Screening candidate compounds against a non-endogenous, constitutively activated version of the GPCRs disclosed herein allows for the direct identification of candidate compounds which act at the cell surface receptor, without requiring use of the receptor's endogenous ligand. Using routine, and often commercially available techniques, one can determine areas within the body where the endogenous version of human GPCRs disclosed herein is expressed and/or over-expressed. The expression location of a receptor in a specific tissue provides a scientist with the ability to assign a physiological functional role of the receptor. It is also possible using these techniques to determine related disease/disorder states which are associated with the expression and/or over-expression of the receptor; such an approach is disclosed in this patent document. Furthermore, expression of a receptor in diseased organs can assist one in determining the magnitude of the clinical relevance of the receptor.

Constitutive activation of the GPCRs disclosed herein is based upon the distance from the proline residue at which is presumed to be located within TM6 of the GPCR; this algorithmic technique is disclosed in co-pending and commonly assigned patent document PCT Application Number PCT/US99/23938, published as WO 00/22129 on April 20, 2000, which, along with the other patent documents listed herein, is incorporated herein by reference in its entirety. The algorithmic technique is not predicated upon traditional sequence "alignment" but rather a specified distance from the aforementioned TM6 proline residue (or, of course, endogenous constitutive substitution for such proline residue). By mutating an amino acid of residue located 16 amino acid residues from this residue (presumably located in the IC3 region of the receptor) to, most preferably, a lysine residue, constitutive activation of the receptor may be obtained. Other amino acid residues may be useful in the mutation at this position to achieve this objective. D. Disease/Disorder Identification and/or Selection

As will be set forth in greater detail below, inverse agonists and agonists to the non- endogenous, constitutively activated GPCR can be identified by the methodologies of this invention. Such inverse agonists and agonists are ideal candidates as lead compounds in drug discovery programs for treating diseases related to this receptor. Because of the ability to directly identify inverse agonists to the GPCR, thereby allowing for the development of pharmaceutical compositions, a search for diseases and disorders associated with the GPCR is relevant. The expression location of a receptor in a specific tissue provides a scientist with the ability to assign a physiological function to the receptor. For example, scanning both diseased and normal tissue samples for the presence of the GPCR now becomes more than an academic exercise or one which might be pursued along the path of identifying an endogenous ligand to the specific GPCR. Tissue scans can be conducted across a broad range of healthy and diseased tissues. Such tissue scans provide a potential first step in associating a specific receptor with a disease and/or disorder. Furthermore, expression of a receptor in diseased organs can assist one in determining the magnitude of clinical relevance of the receptor. Skilled artisans, armed with the present specification, are credited with the ability to infer the function of a GPCR once the receptor is localized to a certain tissue or region.

The DNA sequence of the GPCR can be used to make a probe/primer. In some preferred embodiments the DNA sequence is used to make a probe for (a) dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression of the receptor in tissue samples. The presence of a receptor in a tissue source, or a diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue compared to a normal tissue, can be used to correlate location to function and indicate the receptor's physiological role/function and create a treatment regimen, including but not limited to, a disease associated with that function/role. Receptors can also be locahzed to regions of organs by this technique. Based on the known or assumed roles/functions of the specific tissues to which the receptor is localized, the putative physiological function of the receptor can be deduced. For example and not limitation, proteins located/expressed in areas of the thalamus are associated with sensorimotor processing and arousal (.see, Goodman & Oilman's, The Pharmacological Basis of Therapeutics, 9^th Edition, page 465 (1996)). Proteins expressed in the hippocampus or in Schwann cells are associated with learning and memory, and myelination of peripheral nerves, respectively (see, Kandel, E. et al., Essentials of Neural Science and Behavior pages 657, 680 and 28, respectively (1995)). In some embodiments, the probes and/or primers may be used to detgect and or diagnose diseases and/or disorders, including but not limited to, those diseases and disorders identified in Example 6, infra. Methods of generating such primers and/or probes are well known to those of skill in the art as well as methods of using primers and or probes to detect diseases and or disorders.

E. Screening of Candidate Compounds

1. Generic GPCR screening assay techniques

When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., G_q, G_s, Gj, G_z, Go) and stimulates the binding of GTP to the G protein. The G protein then acts as a GTPase and hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. However, constitutively activated receptors continue to

exchange GDP to GTP. A non-hydrolyzable analog of GTP, [³⁵S]GTPγS, can be used to monitor enhanced binding to membranes which express constitutively activated receptors.

It is reported that [³⁵S]GTPγS can be used to monitor G protein coupling to membranes in the absence and presence of ligand. An example of this monitoring, among other examples well-known and available to those in the art, was reported by Traynor and Nahorski in

1995. The use of this assay system is typically for initial screening of candidate compounds because the system is genetically applicable to all G protein-coupled receptors regardless of the particular G protein that interacts with the intracellular domain of the receptor.

2. Specific GPCR screening assay techniques

Once candidate compounds are identified using the "generic" G protein-coupled receptor assay (i.e., an assay to select compounds that are agonists or inverse agonists), further screening to confirm that the compounds have interacted at the receptor site is preferred. For example, a compound identified by the "generic" assay may not bind to the receptor, but may instead merely "uncouple" the G protein from the intracellular domain. a. G_s, G_z and (7,-.

G_s stimulates the enzyme adenylyl cyclase. Gj (and G_z and Go), on the other hand, inhibits adenylyl cyclase. Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the G_s protein are associated with increased cellular levels of cAMP. On the other hand, constitutively activated GPCRs that couple G; (or G_z, Go) protein are associated with decreased cellular levels of cAMP. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3^rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP can be utihzed to determine if a candidate compound is, e.g., an inverse agonist to the receptor (t^'.e., such a compound would decrease the levels of cAMP). A variety of approaches known in the art for measuring cAMP can be utilized; a most preferred approach relies upon the use of anti-cAMP antibodies in an ELISA-based format. Another type of assay that can be utihzed is a whole cell second messenger reporter system assay. Promoters on genes drive the expression of the proteins that a particular gene encodes. Cyclic AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) that then binds to the promoter at specific sites (cAMP response elements) and drives the expression of the gene. Reporter systems can be constructed which have a promoter containing multiple cAMP

response elements before the reporter gene, e.g., β-galactosidase or luciferase. Thus, a

constitutively activated G_s-linked receptor causes the accumulation of cAMP that then activates the gene and leads to the expression of the reporter protein. The reporter protein such as β-galactosidase or luciferase can then be detected using standard biochemical

assays (Chen et al. 1995). b. G₀ and G_q. G_q and G₀ are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP₂, releasing two intracellular messengers: diacycloglycerol (DAG) and inositol 1,4,5-triphoisphate (D?₃). Increased accumulation of IP₃ is associated with activation of G_q- and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3^rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Assays that detect IP₃ accumulation can be utihzed to determine if a candidate compound is, e.g., an inverse agonist to a G_q- or Go-associated receptor (i.e., such a compound would decrease the levels of IP₃). G_q- associated receptors can also be examined using an API reporter assay wherein G_q- dependent phosphohpase C causes activation of genes containing API elements; thus, activated G_q-associated receptors will evidence an increase in the expression of such genes, whereby inverse agonists thereto will evidence a decrease in such expression, and agonists will evidence an increase in such expression. Commercially available assays for such detection are available.

3. GPCR Fusion Protein The use of an endogenous, constitutively activated GPCR or a non-endogenous, constitutively activated GPCR, for use in screening of candidate compounds for the direct identification of inverse agonists, agonists provide an interesting screening challenge in that, by definition, the receptor is active even in the absence of an endogenous ligand bound thereto. Thus, in order to differentiate between, e.g., the non-endogenous receptor in the presence of a candidate compound and the non-endogenous receptor in the absence of that compound, with an aim of such a differentiation to allow for an understanding as to whether such compound may be an inverse agonist or agonist or have no affect on such a receptor, it is preferred that an approach be utilized that can enhance such differentiation. A preferred approach is the use of a GPCR Fusion Protein. Generally, once it is determined that a non-endogenous GPCR has been constitutively activated using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. In some embodiments it is preferred that screening take place using a mammalian expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the non-endogenous, constitutively activated GPCR will continuously signal. In some embodiments it is preferred that this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is contacted with the inverse agonist.

The GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the non-endogenous GPCR. The GPCR Fusion Protein is preferred for screening with either an endogenous, constitutively active GPCR or a non-endogenous, constitutively activated GPCR because such an approach increases the signal that is utilized in such screening techniques. This is important in facilitating a significant "signal to noise" ratio; such a significant ratio is preferred for the screening of candidate compounds as disclosed herein.

The construction of a construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art. Commercially available expression vectors and systems offer a variety of approaches that can fit the particular needs of an investigator. Important criteria on the construction of such a GPCR Fusion Protein construct include but are not limited to, that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence), and that the "stop" codon of the GPCR be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed. Other embodiments include constructs wherein the endogenous GPCR sequence and the G protein sequence are not in-frame and or the "stop" codon is not deleted or replaced. The GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably, no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art). Based upon convenience it is preferred to use a spacer. Preferably, the G protein that couples to the non-endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct (see Examples)) be available for insertion of an endogenous GPCR sequence therein; this provides for further efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences.

As noted above, constitutively activated GPCRs that couple to Gi, G_z and G₀ are expected to inhibit the formation of cAMP making assays based upon these types of GPCRs challenging (i.e., the cAMP signal decreases upon activation thus making the direct identification of, e.g., inverse agonists (which would further decrease this signal), challenging. As will be disclosed herein, we have ascertained that for these types of receptors, it is possible to create a GPCR Fusion Protein that is not based upon the GPCRs endogenous G protein, in an effort to estabhsh a viable cyclase-based assay. Thus, for example, an endogenous Gi coupled receptor can be fused to a G_s protein -such a fusion construct, upon expression, "drives" or "forces" the endogenous GPCR to couple with, e.g., G_s rather than the "natural" G; protein, such that a cyclase-based assay can be established. Thus, for Gj, G_z and G₀ coupled receptors, in some embodiments it is preferred that when a GPCR Fusion Protein is used and the assay is based upon detection of adenylyl cyclase activity, that the fusion construct be established with G_s (or an equivalent G protein that stimulates the formation of the enzyme adenylyl cyclase).

Equally effective is a G Protein Fusion construct that utilizes a G_q Protein fused with a G_s, Gj, G_z or G₀ Protein. In some embodiments a preferred fusion construct can be accomplished with a G Protein wherein the first six (6) amino acids of the G-protein α-

subunit ("Gαq") is deleted and the last five (5) amino acids at the C-terminal end of Gαq is

replaced with the corresponding amino acids of the Gα of the G protein of interest. For example, a fusion construct can have a G_q (6 amino acid deletion) fused with a G; Protein, resulting in a "G_q/Gi Fusion Construct". This fusion construct will forces the endogenous Gj coupled receptor to couple to its non-endogenous G protein, G_q, such that the second messenger, for example, inositol triphosphate or diacylgycerol, can be measured in lieu of cAMP production.

4. Co-transfection of a Target Gi Coupled GPCR with a Signal- Enhancer G_s Coupled GPCR (cAMP Based Assays)

A Gi coupled receptor is known to inhibit adenylyl cyclase, and, therefore, decreases the level of cAMP production, which can make assessment of cAMP levels challenging. An effective technique in measuring the decrease in production of cAMP as an indication of constitutive activation of a receptor that predominantly couples Gi upon activation can be accomplished by co-transfecting a signal enhancer, e.g., a non-endogenous, constitutively activated receptor that predominantly couples with G_s upon activation (e.g., TSHR-A623I, disclosed below), with the G; linked GPCR. As is apparent, constitutive activation of a G_s coupled receptor can be determined based upon an increase in production of cAMP. Constitutive activation of a Gi coupled receptor leads to a decrease in production cAMP. Thus, the co-transfection approach is intended to advantageously exploit these "opposite" affects. For example, co-transfection of a non-endogenous, constitutively activated G_s coupled receptor (the "signal enhancer") with the endogenous Gj coupled receptor (the "target receptor") provides a baseline cAMP signal (i.e., although the Gj coupled receptor will decrease cAMP levels, this "decrease" will be relative to the substantial increase in cAMP levels established by constitutively activated G_s coupled signal enhancer). By then co-transfecting the signal enhancer with a constitutively activated version of the target receptor, cAMP would be expected to further decrease (relative to base line) due to the increased functional activity of the Gi target (i.e., which decreases cAMP).

Screening of candidate compounds using a cAMP based assay can then be accomplished, with two 'changes' relative to the use of the endogenous receptor/G-protein fusion: first, relative to the G; coupled target receptor, "opposite" effects will result, i.e., an inverse agonist of the Gi coupled target receptor will increase the measured cAMP signal, while an agonist of the G; coupled target receptor will decrease this signal; second, as would be apparent, candidate compounds that are directly identified using this approach should be assessed independently to ensure that these do not target the signal enhancing receptor (this can be done prior to or after screening against the co-transfected receptors).

F. Medicinal Chemistry

Generally, but not always, direct identification of candidate compounds is conducted in conjunction with compounds generated via combinatorial chemistry techniques, whereby thousands of compounds are randomly prepared for such analysis. Generally, the results of such screening will be compounds having unique core structures; thereafter, these compounds may be subjected to additional chemical modification around a preferred core structure(s) to further enhance the medicinal properties thereof. Such techniques are known to those in the art and will not be addressed in detail in this patent document.

G. Pharmaceutical compositions

Candidate compounds selected for further development can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers are available to those in the art; for example, see

Remington's Pharmaceutical Sciences, 16 Edition, 1980, Mack Publishing Co., (Osol et al., eds.).

H. Other Utilities Although a preferred use of the non-endogenous versions of the GPCRs disclosed herein may be for the direct identification of candidate compounds as inverse agonists or agonists (preferably for use as pharmaceutical agents), other uses of these versions of GPCRs exist. For example, in vitro and in vivo systems incorporating GPCRs can be utilized to further elucidate and understand the roles these receptors play in the human condition, both normal and diseased, as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade. In some embodiments it is preferred that the endogenous receptors be "orphan receptors", i.e., the endogenous ligand for the receptor has not been identified. In some embodiments, therefore, the modified, non-endogenous GPCRs can be used to understand the role of endogenous receptors in the human body before the endogenous ligand therefore is identified. Such receptors can also be used to further elucidate known receptors and the pathways through which they transduce a signal. Other uses of the disclosed receptors will become apparent to those in the art based upon, inter alia, a review of this patent document.

EXAMPLES The following examples are presented for purposes of elucidation, and not limitation, of the present invention. While specific nucleic acid and amino acid sequences are disclosed herein, those of ordinary skill in the art are credited with the ability to make minor modifications to these sequences while achieving the same or substantially similar results reported below. The traditional approach to application or understanding of sequence cassettes from one sequence to another (e.g. from rat receptor to human receptor or from human receptor A to human receptor B) is generally predicated upon sequence alignment techniques whereby the sequences are aligned in an effort to determine areas of commonahty. The mutational approach disclosed herein does not rely upon this approach but is instead based upon an algorithmic approach and a positional distance from a conserved proline residue located within the TM6 region of human GPCRs. Once this approach is secured, those in the art are credited with the ability to make minor modifications thereto to achieve substantially the same results (i.e., constitutive activation) disclosed herein. Such modified approaches are considered within the purview of this disclosure.

Example 1

ENDOGENOUS HUMAN GPCRS

The following cDNA receptors were cloned by utilizing the techniques in this

Section, see below. Table B lists the receptors disclosed throughout this patent applications, the open reading frame, the nucleic acid and the amino acid sequences for the endogenous GPCR (Table B).

TABLE B

2. Full Length Cloning Protocol a. FPRL-2 (Seq. Id. Nos.1 & 2)

FPRL-2 was cloned and sequenced in 1992. Bao, L. et al., 13(2) Genomics 437-40 (1992). FPRL-2 has been reported to be located on chromosome 19 having a sequence similarity to N-formy peptide receptor like-1 (FPRL-1) both of which share significant similarity with the N-formyl peptide receptor (FPR). The endogenous ligand for FPR is formyl peptide, however, the two homologues of FPR, FPRL-1 and FPRL-2, do not bind to the same ligand but are likely chemotactic receptors. 13(2) Genomics 437-40 (1992). Chemotactic receptors are reported to be involved in inflammation. FPRL-2 is a GPCR having an open reading frame of 1062 bp encoding a 353 amino acid protein. PCR was performed using genomic cDNA as template and rTth polymerase

(Perkin Elmer) with the buffer system provided by the manufacturer, 0.25 μM of each

primer, and 0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C

for 1 min, 64°C for 1 min 20 sec and 72 C for 2 min. The 5' PCR contained an EcoRI

site with the following sequence 5'-AAAGATTCAGGTGTGGGAAGATGGAAACC-3' (SEQ.ID.NO.:19) and the 3' primer contained an Apal site with the following sequence:

5'-AAAGGATCCCCGACCTCACATTGCTTGTA -3' (SEQ.ID.NO.:20).

The PCR fragment was digested with EcoRI and Apal and cloned into an EcoRI-

Apal site of CMN expression vector. Nucleic acid (SEQ.ID.NO.:l) and amino acid (SEQ.ID.NO.:2) sequences for human FPRL-2 were thereafter determined and verified. b. STLR33 (Seq. Id. Nos. 3 & 4)

PCR was performed using genomic cDNA as template and rTth polymerase

primer, and 0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C for 1 min, 62°C for 1 min 20 sec and 72°C for 2 min. The 5' PCR contained an EcoRI

site with the following sequence

5'-CAGGAATTCATCAGAACAGACACCATGGCA-3' (SEQ.ID.NO.:21) and the 3' primer contained a BamHI site with the following sequence: 5'-GCAGGATCCAGAGCAGTrTTTTCGAAACCCT -3' (SEQ.ID.NO.:22).

The PCR fragment was digested with EcoRI and BamHI and cloned into an EcoRI-BamHI site of CMN expression vector. Nucleic acid (SEQ.ID.NO.:3) and amino acid (SEQ.ID.NO.:4) sequences for human STRL33 were thereafter determined and verified. c. GPR45 (Seq. Id. Nos. 5 & 6)

PCR was performed using genomic cDNA as template and rTth polymerase

primer, and 0.2 mM of each 4 nucleotides. The cycle condition was as follows with o cylces 2 through four repeated 35 times: 96°C for 2 min, 96°C for 30 sec, 55 C for 20

sec. 72°C for 1 min and 20 sec, and 72°C for 5 min. The 5' PCR contained a Hindlll site

with the following sequence

5'-TCCAAGCTTCAAGGGTCTCTCCACGATGGCCTG-3' (SEQ.ID.NO.:23) and the 3' primer contained an EcoRI site with the following sequence: 5*-TGCGAATTCTCTGTGGCCCCCTGACCCCCTAAA -3' (SEQ.ID.NO.:24). The PCR fragment was digested with HindlTI and EcoRI and cloned into a

Hindlll-EcoRI site of CMN expression vector. Nucleic acid (SEQ.ID.NO.:5) and amino acid (SEQ.3D.NO.-.6) sequences for human GPR45 were thereafter determined and verified. The cDNA was then tagged with V5 by resubcloning into V5-His vector using pfu PCR and the following two primers utilized had the following sequence: S'-GGTAAGCTTACCATGGCCTGCAACAGCACGTCCCTT-S' (SEQ.ID.NO.:25) and 5'-GACGAATTCAACCGCAGACTGGTTTTCATTGCA-3' (SEQ.ID.NO.:26).

The cycle condition was 30 cycles of 94°C for 1 min, 60 C for 2min and 72°C

for 2 min. d. mGLUR7 (Seq. Id. Nos. 7 & 8)

Glutamate is an excitatory neurotransmitter which is abundantly found in the mammalian brain. See, Dingledine, R. et al., 130(4S Suppl) J Nutr. 1039S (2000). There are two classes of glutamate receptor, the ionotropic (ligand-gated ion channels) and the metabotropic (GPCRs). Metabotropic glutamate receptors are a heterogenous family of GPCRs that are linked to several second messenger pathways to regulate neuronal excitability and synaptic transmission. (See, Phillips, T. et al., 57(1) Brain Res Mol Brain Res 132 (1998)). Metabotropic glutamate receptor type 7 (mGluR7) has been reported to be expressed in the brain, with highest levels of expression found in the hippocampus, cerebral cortex and cerebellum. See, Makoff, A. et al, 40(1) Brain Res Mol Brain Res 165 (1996). Based on the areas of the brain in which the receptor is locahzed, the putative functional role of the receptor can be deduced. For example, and while not wishing to be bound by any particular theory, mGluR7 is thought to play a role in depression, anxiety, obesity, Alzheimer's Disease, pain and stroke. mGluR7 cDNA was generously supphed by Elizabeth Hoffman, Ph.D. The vector utilized for mGluR7 was pRcCMV (the coding region for mGluRJ was subcloned into pCMV vector at an EcoRI-Clal site). See, SEQ.ID.NO.:7 for nucleic acid sequence and SEQ.ID.NO.:8 for the deduced amino acid sequence of mGluR7. e. GPR37 (Seq. Id. Nos. 9 & 10)

The present invention also relates to the human GPR37. GPR37 was cloned and sequenced in 1997. Marazziti, D. et al., 45 (1) Genomics 68-11 (1997). GPR37 is an orphan GPCR having an open reading frame of 1839 bp encoding a 613 amino acid protein. GPR37 has been reported to share homology with the endothelin type B-like receptor and expressed in the human brain tissues, particularly in corpus callosum, medulla, putamen, and caudate nucleus.

PCR was performed using brain cDNA as template and rTth polymerase (Perkin

Elmer) with the buffer system provided by the manufacturer, 0.25 μM of each primer,

and 0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C for 1 min,

62 C for lmin and 72°C for 2 min. The 5' PCR contained a Hindlll site with the

following sequence

5^,-GCAAGCTTGTGCCCTCACCAAGCCATGCGAGCC-3^, (SEQ.ID.NO.:27) and the 3' primer contained an EcoRI site with the following sequence: 5'-CGGAATTCAGCAATGAGTTCCGACAGAAGC -3' (SEQ.ID.NO.:28).

The 1.9 kb PCR fragment was digested with Hindlll and EcoRI and cloned into a Hindlll-EcoRI site of CMVp expression vector. Nucleic acid (SEQ. ID .NO.: 9) and amino acid (SEQ.ID.NO.:10) sequences for human GPR37 were thereafter determined and verified. f. HF1948 (Seq. Id. Nos. 11 & 12)

HF1948 cDNA was generously supplied by Elizabeth Hoffman, Ph.D. The vector utilized for HF1948 was pRcCMV (the coding region for HF1948 was subcloned into pCMN vector at an HindlH-BamHI site). See, SEQ.ID.NO.:ll for nucleic acid sequence and SEQ.ID.NO.:12 for the deduced amino acid sequence of HF1948. g. GPR66 (Seq. Id. Nos. 13 & 14)

The cDNA for human GPR66 (GenBank Accession Numbers AF044600 and AF044601) was generated and cloned into pCMV expression vector as follows: PCR was performed using genomic DNA as template and TaqPlus Precision polymerase (Stratagene) for first round PCR or pfu polymerase (Stratagene) for second round PCR with the buffer

system provided by the manufacturer, 0.25 μM of each primer, and 0.2 mM (TaqPlus

Precision) or 0.5 mM (pfu) of each of the 4 nucleotides. When pfu was used, 10% DMSO

was included in the buffer. The cycle condition was 30 cycles of: 94°C for 1 min; 65 °C for

lrnin; and 72°C for: (a) 1 min for first round PCR; and (b) 2 min for second round PCR.

Because there is an intron in the coding region, two sets of primers were separately used to generate overlapping 5' and 3' fragments. The 5' fragment PCR primers were: 5'-ACCATGGCTTGCAATGGCAGTGCGGCCAGGGGGCACT-3' (external sense) (SEQ.ID.NO.:29) and 5'-CGACCAGGACAAACAGCATCTTGGTCACTTGTCTCCGGC-3'(intemal antisense) (SEQ.ID.NO.:30).

The 3' fragment PCR primers were:

5'-GACCAAGATGCTGTTTGTCCTGGTCGTGGTGTTTGGCAT-3' (internal sense) (SEQ.ID.NO.:31) and 5'-CGGAATTCAGGATGGATCGGTCTCTTGCTGCGCCT-3' (external antisense with an EcoRI site) (SEQ.ID.NO.:32).

The 5' and 3' fragments were ligated together by using the first round PCR as template and the kinased external sense primer and external antisense primer to perform second round PCR. The 1.2 kb PCR fragment was digested with EcoRI and cloned into the blunt-EcoRI site of pCMV expression vector. Nucleic acid (SEQ.ID.NO.:13) and amino acid (SEQ.lD.NO.:14) sequences for human GPR66 were thereafter determined and verified. h. GPR35 (Seq. Id. Nos. l5 & 16)

GPR35 is a 309 amino acid sequence whereby the endogenous ligand for GPR35 is unknown (O'Dowd B. et al., 47(2) Genomics 310 (1998)). GPR35 was determined to interact with a specific transcription factor, known as E2F, which is necessary for initiating DNA replication and, ultimately, cell proliferation. Within a cell, E2F couples to a tumor suppressor gene, known as retino-blastoma ("Rb"). Upon phosphorylation of this transcription factor construct, E2F is liberated from the Rb gene and then enters the nucleus of the cell. Inside the nucleus, E2F binds to genes, such as DNA polymerase, to initiate DNA replication, which results in proliferation of the cell.

PCR was performed using genomic DNA as template and rTth polymerase (Perkin

Elmer) with the buffer system provided by the manufacturer, 0.25 μM of each primer, and

0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C for 1 min, 62°C for lrnin and 72 °C for 1 min and 20 sec. The 5' PCR primer was kinased with the following sequence:

5'-GCGAATTCCGGCTCCCTGTGCTGCCCCAGG-3' (SEQ.ID.NO.:33) and the 3' primer contains a BamHI site with the following sequence: 5'-GCGGATCCCGGAGCCCCCGAGACCTGGCCC -3' (SEQ.ID.NO.:34). The 1 kb PCR fragment was digested with BamHI and cloned into EcoRV-BamHJ site of CMVp expression vector. All 6 clones sequenced contain a potential polymorphism involving change of amino acid 294 from Arg to Ser. Nucleic acid (SEQ.ID.NO.:15) and amino acid (SEQ.ID.NO.:16) sequences for human GPR35 were thereafter determined and verified. i. ETBR-LP2 (Seq. Id. Nos. 17 & 18)

ETBR-LP2 was cloned and sequenced in 1998. Valdenaire O. et al., 424(3) EEES Eett. 193 (1998); see Figure 1 of Valdenaire for deduced nucleic and amino acid sequences. ΕTBR-LP2 has an open reading frame of 1839 bp encoding a 613 amino acid protein. ETBR-LP2 has been reported to share homology with the endothelin type B receptor (ETBR-LP). Further, ETBR-LP2 evidences about a 47% amino acid sequence homology with human GPR37. ETBR-LP2 has been reported to be expressed in the human central nervous system (e.g., cerebral cortex, internal capsule fibers and Bergmann gha (424 EEES Lett at 196). PCR was performed using brain cDNA as template and rTth polymerase (Perkin

0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C for 1 min, 65°C for lrnin and 72 °C for 1.5 min. The 5' PCR contained an EcoRI site with the sequence: 5'-CTGGAATTCTCCTGCTCATCCAGCCATGCGG -3' (SEQ.ID.NO.:35) and the 3 ' primer contained a BamHI site with the sequence:

5'-CCTGGATCCCCACCCCTACTGGGGCCTCAG -3' (SEQ.ID.NO.:36).

The resulting 1.5 kb PCR fragment was digested with EcoRI and BamHI and cloned into EcoRI-BamHJ site of pCMV expression vector. Nucleic acid (SEQ.ID.NO.:17) and amino acid (SEQ.ID.NO.:18) sequences for human ETBR-LP2 were thereafter determined and verified. j. GPR26 (Seq. Id. Nos.97 & 98) EST clone HIBB055, a 3' 400bp PCR fragment used to screen the Human Genomic lambda Dash π Library (Stratagene catalog special order). The screening conditions were

as follows: filters were hybridize overnight at 55°C in a formamide based hybridization solution. The washing conditions were 2X SSC/1%SDS twice at 65° and .2X SSC/.1%SDS

twice at 65 °C for 20min at each wash. The filters were placed on film exposed overnight at

-80°C and developed the next day. The positive plaques were further characterized by a second round of phage screening from the primary plugs under the same conditions. Human Fetal Brain cDNA library Uni-ZAP XR Vector (catalog#937227,

Stratagene) was then probed with a 250bp probe generated from new sequence from the genomic library screening. The 250bp probe was generated by PCR with Taqplus Precision PCR system (Stratagene #600210) with manufacturer supplied buffer system. The cycling parameters were as follows: 30 cycles with 95°C for 45sec, 55°C for 40sec, 72°C for lrnin and final extension for 10 min. The primers utilized were as follows: 5'-CGAGAAGGTGCTCAAGGTGGC-3' (SEQ.ID.NO.: 99) and 5'-GAGAAGAGCTCCACTAGCCTGGTGATCACA-3' (SEQ. E>.NO.:100).

The Human Fetal Brain cDNA library was probed with the same 250bp PCR fragment under the same conditions as the genomic library except the hybridization temp

was 42°C. The positive primary plugs were further characterized by a second round of

screening under the same conditions with a hybridization temp, of 55°C. Positive plaques were analyzed by sequence via Sanger method and the start codon was obtained from one of the positive clones

The human GPR26 full length clone was then generated by PCR using PfuTurbo DNA Polymerase ( Stratagene #600250) with the following parameters:

40 cycles of 95°C for 45 sec, 62°C for 1 min. and 72°C for 1.2 min. and a final extension

of 10 min. at 72°C. The template used was Human Fetal Brain cDNA (Clonetech# 7402-1) and the primers were as follows: 5'-GAATTCATGAACTCGTGGGACGCGGGCCTGGCGGGC-3' (SEQ.ID.NO.:101) and

5'-CTCGAGTCACTCAGACACCGGCAGAATGTTCT-3' (SEQ.ID.NO.:102).

The fragment generated had a 5' EcoRI linker and a 3' Xhol linker. The PCR product was digested using the given linker enzymes and subcloned into the expression vector ρcDNA3.1(+) (frιvitrogen#V790-20) at the EcoRl/Xhol sites using the Rapid

Ligation Kit (Roche#1635 379). Nucleic acid (SEQ.ID.NO.:97) and amino acid

(SEQ.ID.NO.:98) sequences for human GPR26 were thereafter determined and verified.

Example 2 PREPARATION OF NON-ENDOGENOUS, CONSTITUTIVELY ACTIVATED GPCRS

Those skilled in the art are credited with the ability to select techniques for mutation of a nucleic acid sequence. Presented below are approaches utilized to create non-endogenous versions of several of the human GPCRs disclosed above. The mutations disclosed below are based upon an algorithmic approach whereby the 16^th amino acid (located in the IC3 region of the GPCR) from a conserved proline (or an endogenous, conservative substitution therefore) residue (located in the TM6 region of the GPCR, near the TM6/IC3 interface) is mutated, preferably to an alanine, histimine, arginine or lysine amino acid residue, most preferably to a lysine amino acid residue. 1. Site-Directed Mutagenesis Preparation of non-endogenous human GPCRs was accomplished on human

GPCRs using, inter alia, Transformer Site-Directed™ Mutagenesis Kit (Clontech) according to the manufacturer instructions or QuikChange™ Site-Directed™ Mutagenesis Kit (Stratagene, according to manufacturer's instructions). The following GPCRs were mutated according with the above method using the designated sequence primers (Table C). For convenience, the codon mutation to be incoφorated into the human GPCR is also noted, in standard form (Table C):

TABLE C

1. Alternative Approaches For Creation of Non-Endogenous Human GPCRs Preparation of the non-endogenous, constitutively activated human GPR35 receptor was accomplished by creating a A216K mutation. Mutagenesis was performed using Transformer Site-Directed™ Mutagenesis Kit (Clontech) according to manufacturer's instructions, (see, SEQ.ID.NO.:84 for nucleic acid sequence, SEQ.ID.NO.:85 for amino acid sequence). The two mutagenesis primers were utihzed, a lysine mutagenesis oligonucleotide and a selection marker oligonucleotide, which had the following sequences: 5'- GCCACCCGCAAGGCTAAACGCATGGTCTGG -3' (SEQ.ID.NO.:60 sense) and 5'- CTCCTTCGGTCCTCCTATCGTTGTCAGAAGT -3' (SEQ.ID.NO.:61; antisense), respectively.

For first round PCR, SEQ.ID.NO.:33 and SEQ.ID.NO.:61 were used to generate the 5' 700 bp fragment, while SEQ.ID.NO.:34 and SEQ.ID.NO. :60 were used to generate the 3' 350 bp fragment. PCR was performed using endogenous GPR35 cDNA as template and pfu polymerase (Stratagene) with the buffer system provided by the manufacturer supplemented with 10% DMSO, 0.25 μM of each primer, and 0.5 mM of each 4 nucleotides. The cycle condition was 25 cycles of 94°C for 30 sec, 65°C for lrnin and 72 °C for 2 min and 20 sec. The 5' and 3 ' PCR fragment from first round PCR were then used as cotemplate to perform second round PCR using oligo 1 and 2 as primers and pfu polymerase as described above except the annealing temperature was 55 °C, and the extention time was 2 min. The resulting PCR fragment was then digested and subcloned into pCMV as described for the endogenous cDNA.

The non-endogenous human GPCRs were then sequenced and the derived and verified nucleic acid and amino acid sequences are listed in the accompanying "Sequence Listing" appendix to this patent document, as summarized in Table D below: TABLE D

Example 3 RECEPTOR EXPRESSION

Although a variety of cells are available to the art-skilled for the expression of proteins, it is preferred that mammalian cells be utilized. The primary reason for this is predicated upon practicalities, t.e., utilization of, e.g., yeast cells for the expression of a

GPCR, while possible, introduces into the protocol a non-mammalian cell wliich may not

(indeed, in the case of yeast, does not) include the receptor-coupling, genetic-mechanism and secretary pathways that have evolved for mammalian systems - thus, results obtained in non-mammalian cells, while of potential use, are not as preferred as those obtained using mammalian cells. Of the mammalian cells, COS-7, 293 and 293T cells are particularly preferred, although the specific mammalian cell utilized can be predicated upon the particular needs of the artisan. a. Transient Transfection of 293 Cells

On day one, 6xl0⁶ cells/10 cm dish of 293 cells well were plated out. On day two, two reaction tubes were prepared (the proportions to follow for each tube are per plate): tube A was prepared by mixing 4μg DNA (e.g., pCMV vector; pCMV vector with receptor cDNA, etc.) in 0.5 ml serum free DMEM (Gibco BRL); tube B was prepared by mixing

24μl hpofectamine (Gibco BRL) in 0.5ml serum free DMEM. Tubes A and B were admixed by inversion (several times), followed by incubation at room temperature for 30- 45min. The admixture is referred to as the "transfection mixture". Plated 293 cells were washed with 1XPBS, followed by addition of 5 ml serum free DMEM. One ml of the

transfection mixture were added to the cells, followed by incubation for 4hrs at 37°C/5% CO₂. The transfection mixture was removed by aspiration, followed by the addition of 10ml of DMEM/10% Fetal Bovine Serum. Cells were incubated at 37°C/5% CO₂. After 48hr incubation, cells were harvested and utihzed for analysis. b. Stable 293 Cell Lines Approximately 12xl0⁶293 cells will be plated on a 15cm tissue culture plate, and grown in DME High Glucose Medium containing 10% fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics. Twenty-four hours following plating of 293 cells (to approximately -80% confluency), the cells will be transfected using 12μg of DNA. The 12μg of DNA is combined with 60μl of hpofectamine and 2mL of DME High Glucose Medium without serum. The medium will be aspirated from the plates and the cells washed once with medium without serum. The DNA, Hpofectamine, and medium mixture will be added to the plate along with lOmL of medium without serum. Following incubation at 37°C for four to five hours, the medium will be aspirated and 25ml of medium containing serum will be added. Twenty-four hours following transfection, the medium will be aspirated again, and fresh medium with serum will be added. Forty-eight hours following transfection, the medium will be aspirated and medium with serum will be added containing geneticin (G418 drug) at a final concentration of 500μg/mL. The transfected cells will then undergo selection for positively transfected cells containing the G418 resistant gene. The medium will be replaced every four to five days as selection occurs. During selection, cells will be grown to create stable pools, or split for stable clonal selection. c. RGT CELLS (USED FOR MGLUR7)

RGT cells were derived from an adenovirus transformed Syrian hamster cell line (AN 12-664) into which a glutamate-aspartate transporter was stably transfected.

On day one, 5xl0⁶/ 10 cm dish of RGT cells were plated out. On day two, 91μl

of serumfree media was added to a tube, followed by the addition of 9μl of Fugene 6

(Roche). To the same mix 3 ug of DΝA was added (at 0.5 ug/ul). The mixture was gently mixed and incubated at room temperature for 15 min, then this mixture was added dropwise to the cells growing in DMEM/10% FBS and incubated for 48 hours at

37°C/5% CO . After 48hr incubation, cells were harvested and utilized for analysis.

Example 4

ASSAYS FOR DETERMINATION OF CONSTITUTIVE ACTIVITY

OF NON-ENDOGENOUS GPCRS

A variety of approaches are available for assessment of constitutive activity of the non-endogenous human GPCRs. The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan.

1. Membrane Binding Assays: [³⁵S]GTPγS Assay

When a G protein-coupled receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein. The alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Constitutively activated receptors continue to exchange GDP for GTP. The non-hydrolyzable GTP analog, [³⁵S]GTPγS, can

be utilized to demonstrate enhanced binding of [ S]GTPγS to membranes expressing

constitutively activated receptors. Advantages of usmg [ SjGTPγS binding to measure constitutive activation include but are not limited to the following: (a) it is generically applicable to all G protein-coupled receptors; (b) it is proximal at the membrane surface making it less likely to pick-up molecules which affect the intracellular cascade. The assay takes advantage of the ability of G protein coupled receptors to stimulate

[³⁵S]GTPγS binding to membranes expressing the relevant receptors. The assay can,

therefore, be used in the direct identification method to screen candidate compounds to constitutively activated G protein-coupled receptors. The assay is generic and has application to drug discovery at all G protein-coupled receptors.

The [³⁵S]GTPγS assay is incubated in 20 mM HEPES and between 1 and about

20mM MgCl₂ (this amount can be adjusted for optimization of results, although 20mM is preferred) pH 7.4, binding buffer with between about 0.3 and about 1.2 nM [³⁵S]GTPγS (this amount can be adjusted for optimization of results, although 1.2 is preferred ) and 12.5 to 75 μg membrane protein (e.g., 293 cells expressing the G_s Fusion Protein; this amount

can be adjusted for optimization) and 10 μM GDP (this amount can be changed for

optimization) for 1 hour. Wheatgerm agglutinin beads (25 μl; Amersham) will then be added and the mixture incubated for another 30 minutes at room temperature. The tubes will be then centrifuged at 1500 x g for 5 minutes at room temperature and then counted in a scintillation counter. 2. Cell-based cAMP Detection Assay

A Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes. The Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.

Transfected cells were harvested approximately twenty four hours after transient transfection. Media was carefully aspirated and discarded. Ten ml of PBS was gently added to each dish of cells followed by careful aspiration. One ml of Sigma cell dissociation buffer and 3ml of PBS was added to each plate. Cells were pipetted off the plate and the cell suspension collected into a 50ml conical centrifuge tube. Cells were centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet was carefully re- suspended into an appropriate volume of PBS (about 3ml/plate). The cells were then counted using a hemocytometer and additional PBS was added to give the appropriate number of cells (to a final volume of about 50μl/well). cAMP standards and Detection Buffer (comprising 1 μCi of tracer [^{1 5}I cAMP (50 μl] to 11 ml Detection Buffer) was prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer was prepared fresh for screening and contained 50μl of Stimulation Buffer, 3μl of test compound (12μM final assay concentration) and 50μl cells, Assay Buffer was be stored on ice until utilized. The assay was initiated by addition of 50μl of cAMP standards to appropriate wells followed by addition of 50μl of PBSA to wells H-ll and H12. Fifty μl of Stimulation Buffer was added to all wells. DMSO (or selected candidate compounds) was added to appropriate wells using a pin tool capable of dispensing 3μl of compound solution, with a final assay concentration of 12μM test compound and lOOμl total assay volume. The cells were then added to the wells and incubated for 60 min at room temperature. One hundred μl of Detection Mix containing tracer cAMP was then added to the wells. Plates were incubated for an additional 2 hours followed by counting in a Wallac MicroBeta™ scintillation counter. Values of cAMP/well were then extrapolated from a standard cAMP curve which were contained within each assay plate.

3. Co-Transfection of Gi Coupled FPRL-2 with a Gs/Gi Fusion Protein Construct

The transfection mixture (from Example 3A) containing FPRL-2 and Gs/Gi

Fusion Protein Construct was removed by aspiration, followed by the addition of 10ml of

DMEM/10% Fetal Bovine Serum. Cells were then incubated at 37°C/5% CO₂. After 48hr incubation, cells were harvested and utilized for analysis. Cell-based cAMP detection assay was then performed according to the protocol in Example 4(2) above.

Because endogenous FPRL-2 is believed to predominantly couple with the Gi protein in its active state, a decrease in cAMP production signifies that the disclosed non- endogenous version of FPRL-2 is constitutively active. Thus, a candidate compound which impacts the FPRL-2 receptor by increasing the cAMP signal is an inverse agonist, while a FPRL-2 agonist will decrease the cAMP signal. See, Figure 1.

Figure 1 evidence about a 4 fold increase in activity of FPRL-2 when compared to the Gs/Gi. When comparing the endogenous version of FPRL-2 with that of the non- endogenous version, the non-endogenous FPRL-2 ("FPRL-2(L240K)")) evidence about a 3 fold increase in receptor activity when compared to the control, Gs/Gi. Therefore, this data suggests that both the endogenous and non-endogenous versions of FPRL-2 are constitutively active.

Reference is made to Figure 9. In Figure 9, non-endogenous GPR37(L352R) produced about a 354% increase in cAMP when compared with the endogenous version of GPR37 ("GPR37 wt"), while GPR37(C543Y) produced about a 189% increase in cAMP when compared with GPR37 wt. This data suggests that both non-endogenous L352R and

C543Y versions of GPR37 are constitutively activated.

4. Cell-Based cAMP for Gj Coupled Target GPCRs

TSHR is a G_s coupled GPCR that causes the accumulation of cAMP upon activation. TSHR will be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue). A Gj coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging. An effective technique for measuring the decrease in production of cAMP as an indication of constitutive activation of a Gj coupled receptor can be accomphshed by co-transfecting, most preferably, non-endogenous, constitutively activated TSHR (TSHR-A623I) (or an endogenous, constitutively active G_s coupled receptor) as a "signal enhancer" with a Gi linked target GPCR to estabhsh a baseline level of cAMP. Upon creating a non-endogenous version of the Gj coupled receptor, this non-endogenous version of the target GPCR is then co-transfected with the signal enhancer, and it is this material that can be used for screening. This approach will be utilized to effectively generate a signal when a cAMP assay is used; this approach is preferably used in the direct identification of candidate compounds against G; coupled receptors. It is noted that for a Gj coupled GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal.

Cells were transfected according to Example 3A above. The transfected cells were then transfected cells will be harvested approximately twenty four hours after transient transfection. Cell-based cAMP detection assay was then performed according to the protocol in Example 4(2) above.

Preferably, and as noted previously, to ensure that a small molecule candidate compound is targeting the Gi coupled target receptor and not, for example, the TSHR(A623I), the directly identified candidate compound is preferably screened against the signal enhancer in the absence of the target receptor.

Reference is made to Figure 3. Figure 3 is a comparative analysis of endogenous GPR45 ("GPR45 wt") versus a control ("CMV") in 293 cells. Endogenous target receptor GPR45 was co-transfected with a signal enhancer, TSHR(A623I). In the absence of TSH, the endogenous ligand for TSH receptor, co-transfection of TSHR(A623I) with endogenous GPR45 evidence about a 96% decrease in production of cAMP when compared with the control (CMV). In the presence of TSH, endogenous GPR45 ("GPR45 wt") evidence about a 73% decrease in cAMP production when compared to the control ("CMV"). This data indicates that GPR45 is endogenously constitutively active and couples through the Gi protein. Reference is made to Figure 4 and Table E. Table E is a summary of Figure 4, which is a comparative analysis of endogenous mGluR7 ("mGluR7 wt") with several non- endogenous versions of mGluR7 ("W590S," "R659H," "T771C" and "I790K") and the control ("pCMV") in 293 cells. Table E summarizes the cAMP production of the vector containing the signal enhancer receptor (Le., TSHR(A623I)) with the target receptor (mGluR7) in the absence of its endogenous ligand (i.e., TSH); the cAMP production of the co-transfection of the signal enhancer with the target receptor in the presence of TSH percent (%) decrease, in cAMP production, between the endogenous version of mGluR7 and the non-endogenous versions of mGluR7, co-transfected with TSHR(A623I) in the presence of TSH. This data evidences that the non-endogenous versions of mGluR7 ("W590S," "R659H," "T771C" and "I790K") reduce the production of cAMP when compared to the endogenous mGluR7, and thus has been constitutively activated by the methods disclosed above.

TABLE E

Versions of mGluR7 transfected in RGT cells support the data of above. Reference is made to Figure 5. In Figure 5, W590S evidenced about a 52% decrease in cAMP production; R659H evidenced about a 43% reduction; T771C evidenced about a 5% reduction; and I790K evidenced about a 28% reduction in the production of cAMP when compared to the endogenous version of mGluR7 receptor. Because mGluR7 predominantly couples with Gi in its active state, a decrease in cAMP production signifies that the disclosed non-endogenous versions of mGluR7 are constitutively active. Thus, a candidate compound which impacts the mGluR7 receptor by increasing the cAMP signal is an inverse agonist, while a mGluR7 agonist will decrease the cAMP signal. Based upon the data generated for Figures 5 and 6, "W590S," "R659H," "T771C" and "I790K"are preferred non-endogenous versions of mGluR7, most preferably is "W590S" when used in a TSHR constitutively activated co-transfection approach using a cAMP assay in both 293 and RGT cells.

Reference is made to Figure 12. In Figure 12, non-endogenous versions of HF1948 ("I281F" and "E135N") evidenced a reduction in cAMP production, about an 18% and about a 39% reduction, respectively, when compared to the endogenous version of HF 1948 ('wt"). This data suggests that both non-endogenous I281F and E135N versions of HF1948 are constitutively activated. This decrease in cAMP further suggests that these versions may be Gi-coupled. hi addition to being Gi-coupled, Figure 11 suggests that non- endogenous I281F version of HF1948 may also couple to Gq G protein. (See, Example 4(5)(f) below).

Reference is made to Figure 16. Figure 16 evidences about a 36% decrease in cAMP production of cells co-transfected with TSHR-A623I ("TSHR-A623I") (in the presence of TSH) and non-endogenous, constitutively activated ETBR-LP2 ("N358K") (65.96 pmole cAMP/well) compared to TSHR-A623I with endogenous ETBR-LP2 ("WT") (102.59 pmol cAMP/well). About a 77% and about a 65% decrease in production of cAMP was evidenced when comparing TSHR-A623I co-transfected with ETBR-LP2("N358K") and TSHR-A623I co-transfected with ETBR-LP2("WT") against TSHR-A623I co- transfected with pCMV (290.75 pmol cAMP/well), respectively. Preferably, this approach is used for screening an inverse agonist, which would increase the signal, whereas an agonist should decrease the signal. To confirm that a small molecule binds ETBR-LP2 and not to the TSHR-A623I construct, the small molecule is preferably screened against the construct in the absence of ETBR-LP2. 5. Reporter-Based Assays a. CRE-LUC Reporter Assay (G_s -associated receptors) 293 and 293T cells were plated-out on 96 well plates at a density of 2 x 10⁴ cells per well and were transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions. A DNA/lipid mixture was prepared for each 6-

well transfection as follows: 260ng of plasmid DNA in lOOμl of DMEM are gently

mixed with 2μl of lipid in lOOμl of DMEM (the 260ng of plasmid DNA consisted of

200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising endogenous receptor or non-endogenous receptor or pCMV alone, and lOng of a GPRS expression plasmid (GPRS in pcDNA3 (Invitrogen)). The 8XCRE-Luc reporter plasmid is prepared

as follows: vector SRIF-β-gal was obtained by cloning the rat somatostatin promoter (-

71/+51) at BglN-Hindlll site in the pβgal-Basic Vector (Clontech). Eight (8) copies of

cAMP response element were obtained by PCR from an adenovirus template AdpCF126CCRE8 (see, 1 Human Gene Therapy 1883 (1996)) and cloned into the SRIF-

β-gal vector at the Kpn-BglV site, resulting in the 8xCRE-β-gal reporter vector. The

8xCRE-Luc reporter plasmid was generated by replacing the beta-galactosidase gene in

the 8xCRE-β-gal reporter vector with the luciferase gene obtained from the pGL3-basic

vector (Promega) at the Hindffl-BamHI site. Following 30 min. incubation at room

temperature, the DΝA/lipid mixture was diluted with 400 μl of DMEM and lOOμl of the

diluted mixture was added to each well. One hundred μl of DMEM with 10% FCS was added to each well after a 4hr incubation in a cell culture incubator. The following day

the transfected cells were changed with 200 μl/well of DMEM with 10% FCS. Eight

hours later, the wells were changed to 100 μl /well of DMEM without phenol red, after

one wash with PBS. Luciferase activity was measured the next day using the LucLite™

reporter gene assay kit (Packard) following manufacturer's instructions and read on a

1450 MicroBeta™ scintillation and luminescence counter (Wallac).

Reference is made to Figure 2. Figure 2 evidences about a 50% decrease in activity of STRL33 when compared to the control (CMV) at 12.5ng of STRL33 receptor. When comparing the endogenous version of STRL33 with that of the non-endogenous version, the non-endogenous STRL33 ("STRL33(L230K)")) evidence about a 30% decrease in receptor activity when comparing at 12.5ng of protein, and about a 40% decrease in activity at 25 ng of protein. This data suggests that non-endogenous version of STRL33 receptor is constitutively active and may couple to the G protein, Gi. b. API reporter assay (G_q-associated receptors)

A method to detect G_q stimulation depends on the known property of G_q- dependent phospholipase C to cause the activation of genes containing API elements in their promoter. A Pathdetect™ AP-1 cis-Reporting System (Stratagene, Catalogue #

219073) was utilized following the protocol set forth above with respect to the CREB reporter assay, except that the components of the calcium phosphate precipitate were 410 ng pAPl-Luc, 80 ng pCMN-receptor expression plasmid, and 20 ng CMV-SEAP.

Reference is made to Figure 17. Figure 17 represents a 61.1% increase in activity of the non-endogenous, constitutively active version of human ETBR-LP2 ("Ν358K")

(2203 relative light units) compared with that of the endogenous ETBR-LP2 (862 relative tight units). This data suggests that non-endogenous version of ETBR-LP2 receptor is constitutively active and may couple to the G protein, Gi. c. SRF-LUC Reporter Assay (G_q- associated receptors)

One method to detect G_q stimulation depends on the known property of G_q- dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter. A Pathdetect™ SRF-Luc-Reporting System (Stratagene) can be utilized to assay for G_q coupled activity in, e.g., COS7 cells. Cells are transfected with the plasmid components of the system and the indicated expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian Transfection™ Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions. Briefly, 410 ng SRF-Luc, 80 ng pCMN-receptor expression plasmid and 20 ng CMN-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples) are combined in a calcium phosphate precipitate as per the manufacturer's instructions. Half of the precipitate is equally distributed between 3 wells in a 96-well plate, kept on the cells in a serum free media for 24 hours. The last 5

hours the cells are incubated with lμM Angiotensin, where indicated. Cells are then lysed and assayed for luciferase activity using a Luclite™ Kit (Packard, Cat. # 6016911) and "Trilux 1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the manufacturer's instructions. The data can be analyzed using GraphPad Prism™ 2.0a (GraphPad Software Inc.). d. SRE Reporter Assay

A SRE-Luc Reporter (a component of Mercury Luciferase System 3, Clontech Catalogue # K2053-1) was utilized in 293 cells. Cells were transfected with the plasmid components of this system and the indicated expression plasmid encoding endogenous or non-endogenous receptor using Lipofectamine Reagent (Gibco/BRL, Catalogue #18324- 012) according to the manufacturer's instructions. Briefly, 420ng SRE-Luc, 50ng CMN (comprising the GPR37 receptor) and 30 ng CMN-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples) were combined in a cationic lipid-DΝA precipitate as per the manufacturer's instructions. The final volume was 25 μl brought up with Optimem (Vendor). This is referred to as the "template mix." The template mix was combined with the lipfectamine in a polystrene tube and was incubated for 30 minutes. During the incubation, the cells were washed

with lOOμl Optimem. After incubation, 200μl of Optimem was added to mix and 40μl-

50μl/well. The cells were left to mix overnight. The media was replaced with fresh

medium the following morning to DMEM/Phenol red free/1% FBΝS at 130μl/well. The The cells were then assayed for luciferase activity using a Luclite™ Kit (Packard, Cat. # 6016911) and "Trilux 1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the manufacturer's instructions. The data were analyzed using GraphPad Prism™ 2.0a (GraphPad Software Inc.).

Reference is made to Figure 7. In Figure 7, when comparing the non-endogenous version of GPR37 ("C543Y") with the endogenous version ("wt"), the C543Y mutation evidences about a 316% increase in cAMP production over the wt version, while the non- endogenous version "L352R" evidence about a 178% increase in production of cAMP over the wt version. This data suggests that both non-endogenous versions of GPR37, C543Y and L352R, are constitutively activated. e. E2F-Luc Reporter Assay A pE2F-Luc Reporter (a component of Mercury Luciferase System 3, Clontech Catalogue # K2053-1) was utilized in 293A cells. Cells were transfected with the plasmid components of this system and the indicated expression plasmid encoding endogenous or non-endogenous receptor using Lipofectamine Reagent (Gibco/BRL, Catalogue #18324-012) according to the manufacturer's instructions. Briefly, 400 ng ρE2F-Luc, 80 ng CMV (comprising the GPR35 receptor) and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples) were combined in a cationic lipid-DNA precipitate as per the manufacturer's instructions. Half of the precipitate was equally distributed over 3 wells in a 96-well plate, kept on the cells overnight, and replaced with fresh medium the following day. Forty-eight (48) hr after the start of the transfection, cells were treated and assayed for luciferase activity using a Luclite™ Kit (Packard, Cat. # 6016911) and "Trilux 1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the manufacturer's instructions. The data were analyzed using GraphPad Prism™ 2.0a (GraphPad Software Inc.).

Reference is made to Figure 14. Figure 14 represents about a 100% increase in activity of the non-endogenous, constitutively active version of human GPR35 (A216K) (607.13 relative light units) compared with that of the endogenous GPR35 (24.97 relative light units). This data suggests that GPR35(A216K) interacts with the transcription factor E2F to drive the expression of the luciferase protein. Such interaction with E2F, along with evidence that GPR35 is expressed in colorectal cancer cells, further suggests that GPR35 may play a role in cancer cell proliferation. Thus, based upon these data, a preferred candidate compound which impacts the GPR35 receptor would be an inverse agonist. This data suggest that an inverse agonist of GPR35 would be useful in the treatment of cancerous conditions, colorectal cancer in particular. f. Intracellular IP₃ Accumulation Assay (G_q-associated receptors) On day 1, cells comprising the receptors (endogenous and/or non-endogenous) are plated onto 24 well plates, usually lxl 0⁵ cells/well (although his number can be optimized. On day 2 cells were transfected by firstly mixing 0.25ug DNA in 50 μl serum free DMEM/well and 2 μl lipofectamine in 50 μl serum free DMEM/well. The solutions were gently mixed and incubated for 15-30 min at room temperature. Cells were then washed with 0.5 ml PBS and 400 μl of serum free media and then mixed with the transfection

media and added to the cells. The cells were incubated for 3-4 hrs at 37°C/5%CO₂ and then

the transfection media was removed and replaced with lml/well of regular growth media. On day 3 the cells are labeled with H-myo-inositol. Briefly, the media was removed and the cells are washed with 0.5 ml PBS. Then 0.5 ml inositol-free/serum free media (GIBCO BRL) were added/well with 0.25 μCi of ³H-myo-inositol/ well and the cells incubated for

16-18 hrs overnight at 37°C/5%CO₂. On Day 4 the cells are washed with 0.5 ml PBS and

0.45 ml of assay medium was added containing inositol-free/serum free media 10 μM pargyline 10 mM hthium chloride or 0.4 ml of assay medium. The cells were then

incubated for 30 min at 37°C. The cells are then washed with 0.5 ml PBS and 200 μl of

fresh/ice cold stop solution (IM KOH; 18 mM Na-borate; 3.8 mM EDTA) is added to each well. The solution was kept on ice for 5-10 min (or until cells are lysed) and then neutralized by 200 μl of fresh/ice cold neutralization solution (7.5 % HCL). The lysate was then transfened into 1.5 ml Eppendorf tubes and 1 ml of chloroform/methanol (1:2) was added/tube. The solution was vortexed for 15 sec and the upper phase was applied to a Biorad AG1-X8™ anion exchange resin (100-200 mesh). First, the resin was washed with water at 1:1.25 W/V and 0.9 ml of upper phase was loaded onto the column. The column was then washed with 10 ml of 5 mM myo-inositol and 10 ml of 5 mM Na-borate/60mM Na-formate. The inositol tris phosphates were eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate. The columns were regenerated by washing with 10 ml of 0.1 M formic acid/3M ammonium formate and rinsed twice with dd H₂O and stored at 4°C in water.

Reference is made to Figure 6. In Figure 6, 293 cells were transfected with Gq protein containing a six amino acid deletion, "Gq(del)"; Gq protein fused to a Gi protein, "Gq(del)/Gi", and non-endogenous mGluR7, T771C together with Gq(del), "T771C+Gq(del)" and T771C with Gq(del)/Gi, "T771C+Gq(del)/Gi". Inositol triphosphate was measured in the presence and absence of glutamate. Co-transfection of non- endogenous version of mGluR7 with Gq(del)/Gi evidence about a 1850 fold increase when compared to the Gq(del)/Gi in the presence of glutamate; and about a 860 fold increase compared with T771C+Gq(del)/Gi in the presence of glutamate. These data evidences that mGluR7, a Gi coupled receptor, can be activated via the Gq protein. Therefore, the Gq(del)/Gi Fusion Construct can be co-transfected with a GPCR and used to as a tool to screen for candidate compounds.

Reference is made to Figure 11. hi Figure 11, when comparing the non-endogenous version of HF1948 ("128 IF") with the endogenous version ("wt"), the 128 IF mutation evidences about a 361% increase in D?3 accumulation over the wt version. This data suggests that the non-endogenous I281F version of HF1948 is constitutively activated and is Gq-coupled.

Example 5

FUSION PROTEIN PREPARATION a. GPCR: G, Fusion Construct The design of the constitutively activated GPCR-G protein fusion construct can be

accomphshed as follows: both the 5' and 3' ends of the rat G protein G_s (long form; Itoh, H. et al., 83 PNAS 3776 (1986)) is engineered to include a Hindm (5'-AAGCTT-3') sequence thereon. Following confirmation of the corcect sequence (including the flanking Hindlll sequences), the entire sequence is shuttled into pcDNA3.1(-) ( rvitrogen, cat. no. N795-20) by subcloning using the HindHI restriction site of that vector. The correct orientation for the G_s sequence will be determined after subcloning into pcDΝA3.1(-).

The modified pcDNA3.1(-) containing the rat G_s gene at HindlH sequence is then verified;

this vector will then be available as a "universal" G_sα protein vector. The pcDNA3.1(-) vector contains a variety of well-known restriction sites upstream of the HindHI site, thus beneficially providing the ability to insert, upstream of the G_s protein, the coding sequence of an endogenous, constitutively active GPCR. This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized. In some embodiments, the important criteria is that the sequence for the GPCR be upstream and in-frame with that of the G protein.

Spacers in the restriction sites between the G protein and the GPCR are optional. The sense and anti-sense primers included the restriction sites for Xbal and EcoRN, respectively, such that spacers (attributed to the restriction sites) exist between the G protein and the GPCR.

PCR will then be utilized to secure the respective receptor sequences for fusion within the G_s universal vector disclosed above, using the following protocol for each: lOOng cDΝA for GPCR will be added to separate tubes containing 2μl of each primer (sense and anti-sense), 3μl of lOmM dNTPs, lOμl of lOXTaqPlus™ Precision buffer, lμl of

TaqPlus™ Precision polymerase (Stratagene: #600211), and 80μl of water. Reaction temperatures and cycle times for the GPCR will be as follows with cycle steps 2 through 4

were repeated 35 times: 94°C for 1 min; 94°C for 30 seconds; 62°C for 20 sec; 72°C 1 min

40sec; and 72°C 5 min. PCR products will be run on a 1% agarose gel and then purified. The purified products will be digested with Xbal and EcoRV and the desired inserts purified and ligated into the G_s universal vector at the respective restriction sites. The positive clones will be isolated following transformation and determined by restriction enzyme digestion; expression using 293 cells will be accomphshed following the protocol set forth infra. Each positive clone for GPCR- G_s Fusion Protein will be sequenced to verify correctness. g. G_q(6 amino acid deletion)/Gi Fusion Construct The design of a G_q (del)/Gi fusion construct was accomplished as follows: the N- terminal six (6) amino acids (amino acids 2 through 7), having the sequence of TLESIM

(SEQ.ID.NO.: 88) Gαq-subunit was deleted and the C-terminal five (5) amino acids, having

the sequence EYNLN (SEQ.ID.NO. :89) was replaced with the corresponding amino acids of the Gαi Protein, having the sequence DCGLF (SEQ.ID.NO.:90). This fusion construct was obtained by PCR using the following primers: 5'-gatcAAGCTTCCATGGCGTGCTGCCTGAGCGAGG-3' (SEQ.ID.NO.:91) and 5'-gatcGGATCCTTAGAACAGGCCGCAGTCCTTCAGGTTCAGCTGCAGGATGGTG-3 ' (SEQ.ID.NO.:92) and Plasmid 63313 which contains the mouse Gαq-wild type version with a hemagglutinin tag as template. Nucleotides in lower caps are included as spacers.

TaqPlus^® Precision DNA polymerase (Stratagene) was utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 95°C for 2 min; 95°C for 20 sec; 56°C for 20 sec; 72°C for 2 min; and 72°C for 7 min. The PCR product will be cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the

ABI Big Dye Terminator kit (P.E. Biosystems). Inserts from a TOPO clone containing the sequence of the fusion construct will be shuttled into the expression vector pcDNA3.1 (+) at the Hindiπ/BamHI site by a 2 step cloning process. c. Gs/Gi Fusion Protein Construct

The design of a Gs/Gi Fusion Protein Construct was accomphshed as follows: the

C-terminal five (5) amino acids of Gαs-subunit was deleted, having the sequence 5'-

QYELL-3' (SEQ.ID.NO.:93) and replaced with the corresponding amino acids of the God protein, having the sequence 5'-DCGLF-3' (SEQ.ID.NO. :94). This protein fusion construct was obtained by PCR using a 5' and 3' oligonucleotides.

TaqPlus Precision DNA polymerase (Stratagene) was utilized for the

amplification by the following cycles, with steps 2 through 4 repeated 25 times: 98°C for

2 min; 98°C for 30 sec; 60°C for 30 sec; 72°C for 2 min; and 72°C for 5 min. The PCR product was cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the ABI

Big Dye Terminator kit (P.E. Biosystems). Inserts from a TOPO clone containing the sequence of the protein fusion construct was shuttled into the expression vector pcDNA3.1(+) at the restriction site. The nuclei acid sequence for Gs/Gi Protein Fusion

Construct was then determined. See SEQ.ID.NO. :95 for the nucleic acid sequence and SEQ.ID.NO. :96 for the amino acid sequence.

Example 6

SCHWANN CELL PREPARATION

2L of neonate rat pups (Sprague Dawley) (at Post-pardum day 2-Post-pardum day 3 stage) were placed on ice to euthanize. Pups were then removed and decapitated to drain the blood. The neonates were placed, belly-down, on a dissection board and rinsed with 70% ethanol to sterilize. Using a scalpel, the skin was removed in the thigh area until the sciatic nerve was exposed (or until a thin white "string" extended from the spinal cord to the knee was visible). The nerves were placed in DMEM medium and then aspirated, followed by bringing the volume to 2.4 ml with DMEM media and adding 300uL 10X Collagenase (0.3%, Sigma Cat. #C-9891) and 300uL 10X Trypsin (0.25%, GIBCO Cat. #25095-019) for

dissociation. Nerves were then incubated at 37°C for 15 min, centrifuged for 5 min at 1,000 rpm followed by removing the media (repeated twice). 1 mL DMEM-HEPES and lmL DMEM/10% FBS were added and then transfered to a 50mL conical tube. The contents of the tube were sheared with the following gauge needles (NWR): once with 18G, twice with 21G and twice with 23 G. The contents were placed on a Falcon cell strainer and spun at a very low speed (about 1200 rpm). The total volume was brought to lOmL with DMEM/10% FBS and plated on a Poly-L-lysine treated 10cm plate (Sigma, Cat. #P-1274). Plates were then incubated overnight in 37°C humid incubator at 7% CO2. Fresh media added with 100X ARA C (lOmM, Sigma, Cat. #C-1768) and cultured for an additional 48 hours. The cells were then washed with PBS (three times) to remove the ARA C and the following were added: DMEM/10% FBS, different concentrations of Forskolin in 100% ethanol (2uM, 5uM, lOuM, 20uM and 50uM) (Calbiochem, Cat#344270), 80ug of Pituitary Extract (Sigma, #P-1167) in PBS and 0.1%BSA, followed by growing the cells for 30 hours at 37°C humidifier at 7% CO₂. The cells were then collected and the RΝA was isolated and analyzed.

Antibody selection was accomplished according to the following: the Poly-L-Lysine treated plates were first washed with IX PBS (three times), trypsinized with lmL of 0.5% trypsin-EDTA, for about 1 min and then neutralized with 9mL of DMEM-HEPES buffer and 10% FBS. Cells were centrifuged at 1200rpm for 5 min, resuspended in 3mL of

DMEM-HEPES to wash out the trypsin and spun for 5 min at 1200rpm. Cells were then resuspended in 600uL of DMEM-HEPES, leaving some media after the spin in order to have single cells. Thyl.l antibody (Monoclonal Antibody, Sigma, Cat. #P-1274) was added at a 1 : 1000 dilution.

The cells were then incubated for 20 min at 37°C, slightly agitating the tube every two minutes. 20uL of Guinea Pig complement (GIBCO, Cat. #19195-015) was thawed before using it, followed by adding the complement to the cells with the antibody to a final volume of lmL. The cells were incubated for about 20 rnin-30 min at 37°C water bath and lOmL of DMEM-HEPES was added and spun down for 5 min at 1200rpm. Cells were resuspended in 5mLs of DMEM/10% FBS and added to poly-L-lysine treated plates that contains pituitary extract and forskolin. The cells were left to recover for 24-48 hours and the immune selection procedure was repeated twice.

EXAMPLE 7 PREPARATION OF CRUSHED RAT SCIATIC NERVE

The sciatic nerves of anesthetized (iso-florene), adult (10-13 week old) Sprague-

Dawley rats were exposed at the sciatic notch. Nerve crush was produced by tightly compressing the sciatic nerve at the sciatic notch with flattened forceps twice, each time for 10 sec; this technique causes the axons to degenerate, but allows axonal regeneration. At varying times after nerve injury, the animals were euthanized by CO₂ inhalation, the distal nerve stumps were removed, and the most proximal 2-3 mm was trimmed off. For crushed nerves, the entire distal nerve was harvested. The nerves were immediately frozen in liquid nitrogen and stored at -80°C. Unlesioned sciatic nerves were obtained from animals of varying ages, from P0 (post crush) to P13. Example 8

TISSUE DISTRIBUTION OF THE DISCLOSED HUMAN GPCRs:

1. RT-PCR

RT-PCR can be applied to confirm the expression and to determine the tissue distribution of several novel human GPCRs. Oligonucleotides utihzed will be GPCR- specific and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq

DNA polymerase (Stratagene) will be utilized for the amplification in a 40μl reaction according to the manufacturer's instructions. Twenty μl of the reaction will be loaded on a

1.5% agarose gel to analyze the RT-PCR products.

2. Dot-Blot Using a commercially available human-tissue dot-blot format, endogenous GPCR was used to probe for a determination of the areas where such receptor is localized. The PCR fragments of Example 1 were used as the probe: radiolabeled probe was generated using this fragment and a Prime-It II™ Random Primer Labeling Kit (Stratagene, #300385), according to manufacturer's instructions. A human RNA Master Blot™ (Clontech, #7770-1) was hybridized with GPCR radiolabeled probe and washed under stringent conditions according manufacturer's instructions. The blot was exposed to

Kodak BioMax Autoradiography film overnight at -80°C. Table F, below, lists the

receptors and the tissues wherein expression was found. Exemplary diseases/disorders linked to the receptors are discussed in Example 6, infra. TABLE F

Northern Blot a. GPR37 RNA from Example 6 was harvested utilizing RNAzol B reagent (TelTest Inc., Cat.

#CS-104), according to manufacturer's instructions. After electrophoresis in an 1% agarose/formaldehyde gel, the RNA was transferred to a nylon membrane (Sachleicher Schull) by capillary action using 10X SSC. A ³²P-labelled GPR37 DNA probe was synthesized using a DNA fragment conesponding precisely to the 3' end of GPR37 and a High Prime labeling kit (Roche Molecular Biochemical) according to the manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat.

#8015-2) supplemented with 100 μg/ml salmon sperm DNA as follows. The membrane

containing the separated RNA samples was first incubated with ExpressHyb solution at

65°C overnight. The ³²P-labelled GPR37 DNA probe was denatured by boiling for 2

minutes, placed on ice for 5 minutes and then transferred into the ExpressHyb solution

bathing the membrane. After an overnight incubation at 65°C, the membrane was removed

from the hybridization solution and washed four times for 15 minutes each in 2XSSC/1%

SDS at 65°C, followed by two washes for 15 minutes each in 0.2XSSC/0.1% SDS at 55°C.

Excess moisture was removed from the blot by gentle shaking, after which the blot was

wrapped in plastic wrap and exposed to film overnight at -80°C.

Reference is made to Figure 9. Figure 9 evidences that GPR37 is expressed in Schwann cells, such that myelination can be maintained at 20uM Forskolin. Figure 10 evidences that GPR37 is up-regulated in crushed rat sciatic nerves, specifically seven (7) days after crushing the nerves. Such data is consistent with the data presented in Figure 9, i.e., GPR37 may play a role in the regeneration of nerves by stimulating the process of myelination in Schwann cells. GPR37 is expressed in the human central nervous system, specifically in the brain tissues. It has been further determined that GPR37 is expressed in Schwann cells. When axons (or nerves) are injured, Schwann cells act to regenerate the nerves by forming myelin sheaths around the axons, which provides "insulation" in the form of myelin sheaths. This process, known as myelination, is important in that action potentials travel at a faster rate, thereby conserving metabolic energy. Schwann cells and their precursors play an important role in influencing the survival and differentiation of other cells that make up a pheripheral nerve. In addition, GPR37 has been determined to be expressed in crushed rat sciatic nerves. Such data supports the evidence that GPR37 may play a role in regenerating nerve cells. Based on the known functions of the specific tissues to which the receptor is localized, the putative functional role of the receptor can be deduced. Thus, in the case of hyper-myelination (e.g., tumorgenesis), an inverse agonist against GPR37 is prefened, while an agonist is prefened where hypo-myelination occurs (e.g., a degenerative disease such as diabetes). b. GPR66

Total RNA from several pancreatic cell lines (e.g., HIT, ARIP, Tu6, RIN αTC,

STC, NIT, and EcR-CHO, all of which are commercially available) were isolated using TRIzol reagent (Gibco/BRL, Cat #15596-018) according to manufacturer's instructions. After electrophoreseis in a 1% agarose/formaldehyde gel, the RNA was transfened to a nylon membrane using standard protocols. A ³²P-labelled GPR66 probe was synthesized using a DNA fragment conesponding precisely to the entire coding sequence and a Prime It II Random Primer Labeling Kit (Stratagene, Cat. #300385) according to manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat.#8015-2) supplemented with lOOug/ml salmon sperm DNA as follows. The membrane containing the separated RNA samples were first incubated with ExpressHyb solution at

65°C for 1 hour. The ³²P-labeled GPR66 DNA probe was denatured by boiling for 2 min, placed on ice for 5 min and then transfened into the ExpressHyb solution bathing the membrane. After an overnight incubation at 65 °C, the membrane was removed from the

hybridization and washed four times for 15 min each in 2XSSC/1% SDS at 65°C, followed

by two washes for 15 min each in 0.1XSSC/0.5% SDS at 55°C. Excess moisture was removed from the blot by gentle shaking, after which the blot was wrapped in plastic and exposed to film overnight at -80°C.

Reference is made to Figure 13. Results of RNA blots (see, Figure 13) together with the dot-blot data, evidencing the expression of GPR66 in the pancreas, suggest that GPR66 is abundantly expressed in all islet cell lines and in ARIP cells, a pancreatic ductal cell lines. While not wishing to be bound by any theory, the expression of GPR66 in the pancreatic cell lines suggest that GPR66 may play a role in islet neogenesis. c. GPR35

Total RNA from several cancer cell lines (e.g., RIN-5AH, HEP-G2, A549, HELA, MOLT-4, HL-60 and SW480 cells, all of which are commercially available) were isolated using TRIzol reagent (Gibco BRL, Cat #15596-018) according to manufacturer's instructions. After electrophoreseis in a 1% agarose/formaldehyde gel, the RNA was transferred to a nylon membrane using standard protocols. A ³²P-labelled GPR35 probe was synthesized using a DNA fragment corresponding precisely to the entire coding sequence and a Prime It II Random Primer Labeling Kit (Stratagene, Cat. #300385) according to manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat.#8015-2) supplemented with lOOug/ml salmon sperm DNA as follows. The membrane containing the separated RNA samples were

first incubated with ExpressHyb solution at 65 °C for 1 hour. The ³²P-labeled GPR35

DNA probe was denatured by boiling for 2 min, placed on ice for 5 min and then transfereed into the ExpressHyb solution bathing the membrane. After an overnight incubation at 65 °C, the membrane was removed from the hybridization and washed four

times for 15 min each in 2XSSC/1% SDS at 65°C, followed by two washes for 15 min

each in 0.1XSSC/0.5% SDS at 55°C. Excess moisture was removed from the blot by gentle shaking, after which the blot was wrapped in plastic and exposed to film overnight at

-80°C.

Reference is made to Figure 15. Results of RNA blots (see, Figure 15) evidences that GPR35 is abundantly expressed in colorectal cancer cell line SW480. Such data suggests that GPR35 may play a role in colorectal carcinogenesis. Identification of candidate compounds, by the method discussed below, is most preferably an inverse agonist. An inverse agonist for GPR35 is intended to reduce DNA replication in an effort to inhibit cell proliferation of cancerous cells. GPR35 is expressed in large and small intestine. Numerous cancer cell lines were examined where GPR35 was determined to be expressed in the colorectal cancer cell line (e.g., HELA, MOLT-4 and SW480). This data suggests that GPR35 may play a role in colorectal carcinogenesis. Colorectal cancer is a malignancy that arises from either the colon or the rectum. Cancers of the large intestine are the second most common form of cancer found in both males and females. d. ETBR-LP2

RNA from Example 6 was harvested utilizing RNAzol B reagent (TelTest Inc., Cat. #CS-104), according to manufacturer's instructions. After electrophoresis in an 1% agarose/formaldehyde gel, the RNA was transfened to a nylon membrane (Sachleicher SchuU) by capillary action using 10X SSC. A ³²P-labelled ETBR-LP2 DNA probe was synthesized using a DNA fragment conesponding precisely to the 3' end of ETBR-LP2 and a High Prime labeling kit (Roche Molecular Biochemical) according to the manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat. #8015-2) supplemented with 100 μg/ml salmon sperm DNA as follows. The membrane containing the separated RNA samples was first incubated with ExpressHyb solution at 65°C overnight. The ³²P-labelled ETBR-LP2 DNA probe was denatured by boiling for 2 minutes, placed on ice for 5 minutes and then transfened into the ExpressHyb solution bathing the membrane. After an overnight incubation at 65°C, the membrane was removed from the hybridization solution and washed four times for 15 minutes each in 2XSSC/1% SDS at 65°C, followed by two washes for 15 minutes each in 0.2XSSC/0.1% SDS at 55°C. Excess moisture was removed from the blot by gentle shaking, after which the blot was wrapped in plastic wrap and exposed to film overnight at -80°C.

Reference is made to Figure 18. Figure 18 evidences that ETBR-LP2 is expressed in Schwann cells, such that myelination can be maintained at 20uM Forskolin. Reference is made to Figure 19. Figure 19 evidences that ETBR-LP2 is up- regulated in crushed rat sciatic nerves, specifically seven (7) days after crushing the nerves. Such data is consistent with the data presented in Figure 18, i.e., ETBR-LP2 may play a role in the regeneration of nerves by stimulating the process of myelination in Schwann cells. Based upon these data, ETBR-LP2 is expressed in Schwann cells. When axons (or nerves) are injured, Schwann cells act to regenerate the nerves by forming myelin sheaths around the axons, which provides "insulation" in the form of myelin sheaths. This process, known as myelination, is important in that action potentials travel at a faster rate, thereby conserving metabolic energy. Schwann cells and their precursors play an important role in influencing the survival and differentiation of other cells that make up a pheripheral nerve. In addition, ETBR-LP2 has been determined to be expressed in crushed rat sciatic nerves. Such data supports the evidence that ETBR-LP2 may play a role in regenerating nerve cells. Based on the known functions of the specific tissues to which the receptor is localized, the putative functional role of the receptor can be deduced. Thus, in the case of hyper- myelination (e.g., tumorgenesis), an inverse agonist against ETBR-LP2 is preferred, while an agonist is prefened where hypo-myelination occurs (e.g., a degenerative disease such as diabetes).

Diseases and disorders related to receptors located in these tissues or regions include, but are not limited to, cardiac disorders and diseases (e.g. thrombosis, myocardial infarction; atherosclerosis; cardiomyopathies); kidney disease/disorders (e.g., renal failure; renal tubular acidosis; renal glycosuria; nephrogenic diabetes insipidus; cystinuria; polycystic kidney disease); eosinophilia; leukocytosis; leukopenia; ovarian cancer; sexual dysfunction; polycystic ovarian syndrome; pancreatitis and pancreatic cancer; irritable bowel syndrome; colon cancer; Crohn's disease; ulcerative colitis; diverticulitis; Chronic Obstructive Pulmonary Disease (COPD); Cystic Fibrosis; pneumonia; pulmonary hypertension; tuberculosis and lung cancer; Parkinson's disease; movement disorders and ataxias; learning and memory disorders; eating disorders (e.g., anorexia; bulimia, etc.); obesity; cancers; thymoma; myasthenia gravis; circulatory disorders; prostate cancer; prostatitis; kidney disease/disorders(e.g., renal failure; renal tubular acidosis; renal glycosuria; nephrogenic diabetes insipidus; cystinuria; polycystic kidney disease); sensorimotor processing and arousal disorders; obsessive-compulsive disorders; testicular cancer; priapism; prostatitis; hernia; endocrine disorders; sexual dysfunction; allergies; depression; psychotic disorders; migraine; reflux; schizophrenia; ulcers; bronchospasm; epilepsy; prostatic hypertrophy; anxiety; rhinitis; angina; and glaucoma. Accordingly, the methods of the present invention may also be useful in the diagnosis and/or treatment of these and other diseases and disorders.

Example 7

Protocol: Direct Identification of Inverse Agonists and Agonists

A. [³⁵S]GTPγS Assay

Although endogenous, constitutively active GPCRs have been used for the direct identification of candidate compounds as, e.g., inverse agonists, for reasons that are not altogether understood, infra-assay variation can become exacerbated. In some embodiments a GPCR Fusion Protein, as disclosed above, is also utihzed with a non- endogenous, constitutively activated GPCR. When such a protein is used, infra-assay variation appears to be substantially stabilized, whereby an effective signal-to-noise ratio is obtained. This has the beneficial result of allowing for a more robust identification of candidate compounds. Thus, in some embodiments it is prefened that for direct identification, a GPCR Fusion Protein be used and that when utilized, the following assay protocols be utihzed.

1. Membrane Preparation Membranes comprising the constitutively active orphan GPCR Fusion Protein of interest and for use in the direct identification of candidate compounds as inverse agonists or agonists are preferably prepared as follows: a. Materials "Membrane Scrape Buffer" is comprised of 20mM HEPES and lOmM EDTA, pH 7.4; "Membrane Wash Buffer" is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4; "Binding Buffer" is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl₂, pH 7.4 b. Procedure All materials will be kept on ice throughout the procedure. Firstly, the media will be aspirated from a confluent monolayer of cells, followed by rinse with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer will be added to scrape cells; this will be followed by transfer of cellular extract into 50ml centrifuge tubes

(centrifuged at 20,000 rpm for 17 minutes at 4°C). Thereafter, the supernatant will be aspirated and the pellet will be resuspended in 30ml Membrane Wash Buffer followed by

centrifugation at 20,000 rpm for 17 minutes at 4°C. The supernatant will then be aspirated

and the pellet resuspended in Binding Buffer. The resuspended pellet will then be homogemzed using a Brinkman Polytron™ homogenizer (15-20 second bursts until the material is in suspension). This is referred to herein as "Membrane Protein". 2. Bradford Protein Assay

Following the homogenization, protein concentration of the membranes will be determined, for example, using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80°C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polytron at about 12 x 1,000 rpm for about 5-10 seconds; it was noted that for multiple preparations, the homogenizer is thoroughly cleaned between homogenization of different preparations). a. Materials Bmding Buffer (as discussed above); Bradford Dye Reagent; Bradford Protein

Standard will be utilized, following manufacturer instructions (Biorad, cat. no. 500- 0006). b. Procedure

Duplicate tubes will be prepared, one including the membrane, and one as a control "blank". Each contains 800μl Binding Buffer. Thereafter, lOμl of Bradford

Protein Standard (lmg/ml) will be added to each tube, and lOμl of membrane Protein will then be added to just one tube (not the blank). Thereafter, 200μl of Bradford Dye

Reagent will be added to each tube, followed by vortexing. After five minutes, the tubes will be re-vortexed and the material therein will be transfened to cuvettes. The cuvettes will then be read using a CECIL 3041 spectrophotometer, at wavelength 595.

3. Direct Identification Assay a. Materials

GDP Buffer consisted of 37.5 ml Binding Buffer and 2mg GDP (Sigma, cat. no. G- 7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 μM GDP (final concentration of GDP in each well was 0.1 μM GDP); each well comprising a candidate compound, has a final volume of 200μl consisting of lOOμl GDP Buffer (final concentration, 0.1 μM GDP), 50μl Membrane Protein in Binding Buffer, and 50μl

[³⁵S]GTPγS (0.6 nM) in Binding Buffer (2.5 μl [³⁵S]GTPγS per 10ml Binding Buffer). b. Procedure Candidate compounds will be preferably screened using a 96-well plate format (these can be frozen at -80°C). Membrane Protein (or membranes with expression vector excluding the GPCR Fusion Protein, as control), will be homogenized briefly until in suspension. Protein concentration will then be determined using, for example, the Bradford Protein Assay set forth above. Membrane Protein (and controls) will then be diluted to 0.25mg/ml in Binding Buffer (final assay concentration, 12.5μg well). Thereafter, 100 μl

GDP Buffer is added to each well of a Wallac Scintistrip™ (Wallac). A 5μl pin-tool will then be used to transfer 5 μl of a candidate compound into such well (i.e., 5μl in total assay volume of 200 μl is a 1 :40 ratio such that the final screening concentration of the candidate compound is lOμM). Again, to avoid contamination, after each transfer step the pin tool is rinsed in three reservoirs comprising water (IX), ethanol (IX) and water (2X) - excess liquid is shaken from the tool after each rinse and the tool is dried with paper and Kim wipes. Thereafter, 50 μl of Membrane Protein will be added to each well (a control well comprising membranes without the GPCR Fusion Protein was also utihzed), and pre-

incubated for 5-10 minutes at room temperature. Thereafter, 50 μl of [³⁵S]GTPγS (0.6 nM)

in Binding Buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, plates were covered with foil). The

assay will be stopped by spinning the plates at 4000 RPM for 15 minutes at 22°C. The plates will then be aspirated with an 8 channel manifold and sealed with plate covers. The plates will then be read on a Wallac 1450 using setting "Prot. #37" (as per manufacturer's instructions).

B. Cyclic AMP Assay

Another assay approach to directly identify candidate compound will be accomplished utihzing a cyclase-based assay. In addition to direct identification, this assay approach can be utilized as an independent approach to provide confirmation of the results from the [³⁵S]GTPγS approach as set forth above.

A modified Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) will be preferably utihzed for direct identification of candidate compounds as inverse agonists and agonists to GPCRs in accordance with the following protocol.

Transfected cells will be harvested approximately three days after transfection. Membranes will be prepared by homogenization of suspended cells in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl₂. Homogenization will be performed on ice using a Brinkman Polytron™ for approximately 10 seconds. The resulting homogenate will be centrifuged at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be resuspended in buffer containing 20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogemzed for 10 seconds, followed by centrifugation at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be stored at -80°C until utilized. On the day of direct identification screening, the membrane pellet will slowly be thawed at room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl₂, to yield a final protein concentration of 0.60mg/ml (the resuspended membranes will be placed on ice until use). cAMP standards and Detection Buffer (comprising 2 μCi of tracer [¹²⁵I cAMP (100 μl] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer will be prepared fresh for screening and contain 20mM HEPES, pH 7.4, lOmM MgCl₂, 20mM phosphocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 μM GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer will be stored on ice until utilized.

Candidate compounds identified as per above (if frozen, thawed at room temperature) will be added, preferably, to 96- well plate wells (3μl/well; 12μM final assay concentration), together with 40 μl Membrane Protein (30μg/well) and 50μl of Assay Buffer. This admixture will be incubated for 30 minutes at room temperature, with gentle shaking.

Following the incubation, lOOμl of Detection Buffer will be added to each well, followed by incubation for 2-24 hours. Plates will then be counted in a Wallac MicroBeta™ plate reader using "Prot. #31" (as per manufacturer instructions). C. Melanophore Screening Assay

A method for identifying candidate agonists or inverse agonists for a GPCR can be preformed by introducing tests cells of a pigment cell line capable of dispersing or aggregating their pigment in response to a specific stimulus and expressing an exogenous clone coding for the GCPR. A stimulant, e.g., light, sets an initial state of pigment disposition wherein the pigment is aggregated within the test cells if activation of the GPCR induces pigment dispersion. However, stimulating the cell with a stimulant to set an initial state of pigment disposition wherein the pigment is dispersed if activation of the GPCR induces pigment aggregation. The tests cells are then contacted with chemical compounds, and it is determined whether the pigment disposition in the cells changed from the initial state of pigment disposition. Dispersion of pigments cells due to the candidate compound coupling to the GPCR will appear dark on a petri dish, while aggregation of pigments cells will appear tight. Materials and methods will be followed according to the disclosure of U.S. Patent

Number 5,462,856 and U.S. Patent Number 6,051,386, each of which are incorporated by reference in its entirety.

Although a variety of expression vectors are available to those in the art, for purposes of utilization for both the endogenous and non-endogenous human GPCRs, in some embodiments it is prefened that the vector utilized be pCMV. This vector was deposited with the American Type Culture Collection (ATCC) on October 13, 1998 (10801 University Blvd., Manassas, NA 20110-2209 USA) under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. The DΝA was tested by the ATCC and determined to be viable. The ATCC has assigned the following deposit number to pCMN: ATCC #203351.

References cited throughout this patent document, including co-pending and related patent applications, unless otherwise indicated, are fully incorporated herein by reference. Modifications and extension of the disclosed inventions that are within the purview of the skilled artisan are encompassed within the above disclosure and the claims that follow.

Claims

CLAIMSWhat is claimed is:

1. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO. :2.

2. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 1.

3. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 1.

4. A host cell comprising the plasmid of claim 3.

5. A G protein-coupled receptor encoded by an amino acid sequence of

SEQ.rD.NO.:4.

6. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 5.

7. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. :3.

8. A host cell comprising the plasmid of claim 7.

9. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:6.

10. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 9.

11. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:5.

12. A host cell comprising the plasmid of claim 11.

13. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:8.

14. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 13.

15. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. :7.

16. A host cell comprising the plasmid of claim 15.

17. A G protein-coupled receptor encoded by an amino acid sequence of

SEQ.ID.NO.:10.

18. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 17 .

19. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:9.

20. A host cell comprising the plasmid of claim 19.

21. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:12.

22. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 21.

23. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 11.

24. A host cell comprising the plasmid of claim 23.

25. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:14.

26. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 25.

27. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:13.

28. A host cell comprising the plasmid of claim 27.

29. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:16.

30. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 29.

31. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. : 15.

32. A host cell comprising the plasmid of claim 31.

33. A G protein-coupled receptor encoded by an amino acid sequence of

SEQ.ID.NO.:18.

34. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 33.

35. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.: 17.

36. A host cell comprising the plasmid of claim 35.