WO2001092514A1 - A novel polypeptide-human interleukin-13 (il-13) receptor 11 and the polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new polypeptide-human interleukin-13 (IL- 13) receptor 11, the polynucleotide encoding said polypeptide, and a process for producing the polypeptide by recombinant DNA technology. It also discloses methods of applying the polypeptide for the treatment of various diseases, such as immune disorders, HIV infection, inflammation, tumor and hemopathy. This invention alsodiscloses antagonist against said polypeptide and thereof therapyuses. In addition, it refers to the use of said polynucleotide encoding this new human interleukin-13 (IL-13) receptor 11.

Description

A new peptide, human interleukin-13 (IL- 13), Mengxiu 11 and arranging a polynucleotide, such as antagonism:,

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ~~ Λ interleukin-13 (IL-13) receptor 11 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.

Interleukin-13 (IL-13) is a cytokine that can produce several biological activities: Induction of IgG4 and IgE conversion, even in human immature B cells (Punnonen et al., J. Immunol. 152 : 1094 (1994)); induces germline (eps i lon) transcription of IgE heavy chains and CD23 expression in normal human B cells (Punnonen et a l., Proc. Nat l. Acad. Sci. USA 90: 3730 (1993)); induce B cell proliferation in the presence of CD40L or anti-CD40 monoclonal antibodies (Cocks et al., Int. Immunol. 5: 657 (1993)). Many activities of IL-13 and IL-4 are very similar, but IL-13 does not have a growth-initiating effect in activating T cells or T cell clones (Zurawski et al., ΕΜΒΟ J. 12: 2663 (1993)) .

 Interleukin-13 (IL-13) receptor is a cell surface receptor that specifically binds IL-13 and mediates various physiological responses in various cell types. Like most cytokines, IL-13 displays specific biological activity on the surface of target cells by interacting with the IL-13 receptor. The IL-13 receptor and the IL-4 receptor have a common component, which is required for the activity of the receptor; in addition, the IL-13 receptor also contains at least one other specific binding IL-13 chain Cytokines usually contain two or three chains, and the IL-13 receptor contains three ligand-binding chains (Hi l ton et al., Proc. Nat l. Acad. Sci. 93: 497-501). Tumor cells, especially cancers such as renal cell carcinoma, in which IL-13 is overexpressed to extremely high levels. The IL-13 receptor can specifically deliver effector IL-13 to target tumor cells (especially kidney cancer cells), and binds less to healthy cells than other similar chimeric molecules, so the amount of drug used is relatively reduced.

Gene chip analysis revealed that in thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv ³ 04 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic stimulation for 1 hour L02 cell line, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and fetus In the mind, the expression profile of the polypeptide of the present invention and the expression of human interleukin-13 (IL-13) receptor The spectra are very similar, so the functions may be similar. The present invention is named human interleukin-13 (IL-13) receptor 11.

 As mentioned above, the human interleukin-13 (IL-13) receptor 11 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes. There is a continuing need to identify more human interleukin-13 (IL-13) receptor 11 proteins involved in these processes, and in particular the amino acid sequence of this protein. The isolation of new human interleukin-13 (IL-13) receptor 11 protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its code for DM. Object of the invention

 An object of the present invention is to provide an isolated novel polypeptide, human interleukin-13 (IL-13) receptor 11, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human interleukin-13 (IL-13) receptor 11.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human interleukin-13 (IL-13) receptor 11.

 Another object of the present invention is to provide a method for producing human interleukin-13 (IL-13) receptor 11.

 Another object of the present invention is to provide an antibody against the polypeptide-human interleukin-13 (IL-13) receptor 11 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human interleukin-13 (IL-13) receptor 11.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human interleukin-13 (IL-13) receptor 11. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SBQ ID NO: 2.

The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence of SBQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 The polynucleotide sequences of (c) and (a) or (b) have at least 70 ° /. Identical polynucleotides.

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 170 to 460 in SEQ ID NO: 1; and (b) a sequence having positions 1 to 3648 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human interleukin-13 (IL-13) receptor 11 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human interleukin-13 (IL-13) receptor 11 protein in vitro, comprising detecting the polypeptide or a polynucleotide encoding the same in a biological sample. A mutation in a sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of various immune diseases, HIV infection, inflammation, various tumors, blood diseases or other diseases due to human interleukin-13 (IL-13 ) Use of a medicament for a disease caused by abnormal expression of receptor 11.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human interleukin-13 (IL-13) receptor 11 and human interleukin-13 (IL-13) receptor according to the present invention. The upper graph is a graph of the expression profile of human interleukin-13 (IL-13) receptor 11, and the lower graph is the graph of the expression profile of human interleukin-13 (IL-13) receptor. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates non-starved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PA +, 11 indicates fetal liver, 12 indicates normal liver, 13 indicates thyroid, 14 indicates skin, 15 indicates fetal lung, 16 indicates lung, 17 indicates lung cancer, 18 indicates fetal spleen, 19 indicates spleen, 20 indicates prostate, and 21 indicates fetal Heart, 22 for heart, 23 for muscle, 24 for testis, 25 for fetal thymus, 26 for thymus.

 FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human interleukin-13 (IL-13) receptor 11. FIG. lKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when bound to human interleukin-13 (IL-13) receptor 11, can cause changes in the protein and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human interleukin-13 (IL-13) receptor 11.

An "antagonist" or "inhibitor" refers to a type that blocks or regulates human interleukin-13 (IL-13) receptor 11 when bound to human interleukin-13 (IL-13) receptor 11. Biological activity or immunity Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human interleukin-13 (IL-13) receptor 11.

 "Regulation" refers to a change in the function of human interleukin-13 (IL-13) receptor 11, including an increase or decrease in protein activity, a change in binding characteristics, and the influence of human interleukin-13 (IL-13). Any other biological, functional, or immunological changes in body 11.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human interleukin-13 (IL- 13) Receptor 11. Basically pure human interleukin-13 (IL-13) receptor 11 produces a single main band on a non-reducing polyacrylamide gel. Human interleukin-13 (IL- 13) The purity of the receptor 11 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program

(Lasergene sof tware package, DNASTAR, Inc., Madi son Wi s.). The MEGALIGN program can compare two or more sequences (Higg ins, D. G. and

PM Sharp (1988) Gene 73: 237-244) 0 Clus ter method by examining the distances between all pairs of each set of sequence arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues between sequence and sequence

The residues in the sequence ^ - ^ interval residues in the sequence - the sequence of residues ^X interval S

Can also Clus ter or a method well known in the art such as the Jotun Hein measuring the percentage identity between nucleic acid sequences (Hein L, (1990) Methods in enzymology 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RM sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b ')} 2 and F _V, which specifically binds human interleukin -13 (IL-13) receptor antigenic determinants 11 .

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human interleukin-13 (IL-13) receptor 11" means that human interleukin-13 (IL-13) receptor 11 is substantially free of other proteins and lipids naturally associated with it. Class, sugar or other substance. Those skilled in the art can purify human interleukin-13 (IL-) receptor 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human interleukin-13 (IL-13) receptor 11 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human interleukin-13 (IL-13) receptor 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product, or It is produced synthetically, or is produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human interleukin-13 (IL-13) receptor 11. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human interleukin-13 (IL-13) receptor 11 of the present invention . A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (Π) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3648 bases in length and its open reading frames 170-460 encode 96 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human interleukin-13 (IL-13) receptor, and it can be deduced that the human interleukin-13 (IL-13) receptor 11 has human Interleukin-13 (IL-13) receptor functions similarly.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DM can be coded or non-coded. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence. The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col 1, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human interleukin-13 (IL-13) receptor 11.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human interleukin-13 (IL-13) receptor 11 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate the mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid Or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available CDM libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human interleukin-13 (IL-13) receptor 11 The level of transcripts; (4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3G nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), the protein product of human interleukin-13 (IL-13) receptor 11 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay ( ELISA) and so on.

 A method (Sa iki, et al. Science 1985; 230: 1350-1354) for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length CDM from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human interleukin-13 (IL-13) receptor 11 coding sequence, and recombinant technology A method for producing a polypeptide according to the invention. In the present invention, a polynucleotide sequence encoding the human interleukin-13 (IL-13) receptor 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding human interleukin-13 (IL-13) receptor 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination DM technology, DM synthesis technology, in vivo recombination technology, etc. (Sarabroook, et al. Molecular Cloning, a Laboratory Manual, Cold Splash Harbor Laboratory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human interleukin-13 (IL-13) receptor 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute the polynucleotide or the recombinant vector. Genetically engineered host cells. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or Lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 _2, steps well known in the art used alternative is to use MgCl _2.. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human interleukin-13 (IL-13) receptor 11 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally speaking, there are the following steps:

 (1) The polynucleotide (or variant) encoding human human interleukin-13 (IL-13) receptor 11 of the present invention, or a recombinant expression vector containing the polynucleotide for transformation or transduction Host cell

(2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

Interleukin-13 (IL-13) is a cytokine that can produce several biological activities, such as acute inflammation response, endothelial cell effect, and fibroblast effect. In the immune response, IL-13 Can induce IgG4 and IgE conversion; can induce germline (eps i lon) transcription of IgE heavy chains and CD23 expression in normal human B cells; induce B cell proliferation in the presence of CD40L or anti-CD40 monoclonal antibodies. IL-13 and IL-4 have many similar activities, but IL-13 has no growth-initiating effect in activating T cells or T cell clones.

 The IL-13 receptor is a cell surface receptor that specifically binds to IL-13 and mediates various physiological responses in various cell types, especially in the immune response and inflammation processes. For example, in tumor cells, especially renal cell carcinoma, IL-13 is overexpressed, and the IL-13 receptor can specifically deliver effector IL-13 to target tumor cells (especially renal cancer cells), thereby exerting immune monitoring and killing effects. .

 Studies have found that interleukin-binding factor can specifically bind to some immunodeficiency virus and interleukin gene-proline-rich domains in vivo to regulate the expression of human immunodeficiency virus genes and intracellular genes .

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human interleukin-13, and both have similar biological functions. It has a variety of important functions in the body, especially regulating immune monitoring in the body, and its abnormal expression is usually related to various immune monitoring abnormalities and abnormal inflammatory response processes, such as various immune diseases, abnormal inflammation, and tumorigenesis. The occurrence of this physiopathological process is closely related.

It can be seen that the abnormal expression of the human interleukin-13 (IL-13) receptor 11 of the present invention will produce various diseases, especially various immune diseases, inflammation, and various tumors. These diseases include, but are not limited to: Immune diseases: acquired immunodeficiency syndrome, autoimmune hemolytic anemia, common variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, primary T lymphocyte immunodeficiency disease, severe combined immunodeficiency disease Wi skot t-Aldr ich syndrome, with ataxia telangiectasia, primary phagocytic immunodeficiency disease, primary complement system defect, blood transfusion reaction, transplant immune rejection, rheumatoid arthritis, Systemic lupus erythematosus, scleroderma, myasthenia gravis, bronchial asthma, aspirin asthma, allergic rhinitis, diffuse pulmonary interstitial fibrosis, urticaria, specific dermatitis: chronic active hepatitis, chronic gastritis , Chronic rhinitis, atrophic gastritis, Guillain-Barre syndrome, intracranial granulomatosis, multiple scleroderma, pancreatitis, cholecystitis, renal small Globular nephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, prostatic hyperplasia, cervicitis, various infectious inflammations, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, osteoarthritis, Dermatomyositis, Polymyositis, Addison's Disease, Graves' Disease, Intestinal Emergency Syndrome, Cerebral Spinal Cord Multiple Sclerosis Tumors of Various Tissues: Stomach Cancer, Liver Cancer, Lung Cancer, Esophageal Cancer, Breast Cancer, Leukemia , Lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymal tumor, glioblastoma, neurofibromas, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer Thymoma Nasopharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma The abnormal expression of human interleukin-13 (IL-13) receptor 11 of the present invention will also produce certain heredity, blood Sexually transmitted diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various immune diseases, inflammation, various tumors, certain heredity, blood Sexually transmitted diseases.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human interleukin-13 (IL-13) receptor 11. Agonists enhance human interleukin-13 (IL-13) receptor 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing human interleukin-13 (IL-13) receptor 11 can be combined with a labeled human interleukin-13 (IL-13) receptor 11 in the presence of a drug. to cultivate. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human interleukin-13 (IL-13) receptor 11 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human interleukin-13 (IL-13) receptor 11 can bind to human interleukin-13 (IL-13) receptor 11 and eliminate its function, or inhibit the production of the polypeptide, or The active site binding of the polypeptide prevents the polypeptide from performing a biological function.

 When screening compounds as antagonists, human interleukin-13 (IL-13) receptor 11 can be added to a bioanalytical assay, and the compounds can be used to detect human interleukin-13 (IL-13) receptor 11 and The effect of their receptor interactions to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human interleukin-13 (IL-13) receptor 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human interleukin-13 (IL-13) receptor 11 molecules should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human interleukin-13 (IL-13) receptor 11 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human interleukin-13 (IL-13) receptor 11 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response. Including but not limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to human interleukin-13 (IL-13) receptor 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), three tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. The chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Morr i son et al, PNAS , 1985, 81: 6851) 0 Ersi some production techniques of single chain antibodies ( US Pat No. 4946778) can also be used to produce single chain antibodies against human interleukin-13 (IL-13) receptor 11.

 Antibodies against human interleukin-13 (IL-13) receptor 11 can be used in immunohistochemistry to detect human interleukin-13 (IL-13) receptor 11 in biopsy specimens.

 Monoclonal antibodies that bind to human interleukin-13 (IL-13) receptor 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human interleukin-13 (IL-13) receptor 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human interleukin-13 (IL- 13) Receptor 11 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human interleukin-13 (IL-13) receptor 11. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human interleukin-13 (IL-13) receptor 11.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human interleukin-13 (IL-13) receptor 11 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human interleukin-13 (IL-13) receptor 11 detected in the test can be used to explain the importance of human interleukin-13 (IL-13) receptor 11 in various diseases and for Diagnose diseases in which human interleukin-13 (IL-13) receptor 11 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding human interleukin-13 (IL-13) receptor 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human interleukin-13 (IL-13) receptor 11. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human interleukin-13 (IL-13) receptor 11 to inhibit endogenous human interleukin-13 (IL-13) receptors. Body 11 activity. For example, a variant human interleukin-13 (IL-13) receptor 11 may be a shortened human interleukin-13 (IL-13) receptor 11 lacking a signaling domain, although it may interact with The downstream substrate binds but lacks signaling activity. therefore, The recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human interleukin-13 (IL-13) receptor 11. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human interleukin-13 (IL-13) receptor 11 to in the cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human interleukin-13 (IL-13) receptor 11 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human interleukin-13 (IL-13) receptor 11 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human interleukin-13 (IL-13) receptor 11 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation. Antisense RM, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used. Antisense MA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

 The polynucleotide encoding human interleukin-13 (IL-13) receptor 11 can be used for diagnosis of diseases related to human interleukin-13 (IL-13) receptor 11. A polynucleotide encoding human interleukin-13 (IL-13) receptor 11 can be used to detect the expression of human interleukin-13 (IL-13) receptor 11 or human interleukin- 13 (IL-13) Abnormal expression of receptor 11. For example, a DNA sequence encoding human interleukin-13 (IL-13) receptor 11 can be used to hybridize biopsy specimens to determine the expression of human interleukin-13 (IL-U) receptor 11. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are available from commercial sources. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues. Human interleukin-13 (IL-13) receptor 11 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human interleukin-13 (IL-13) receptor 11 Transcription products.

Detection of mutations in the human interleukin-13 (IL-13) receptor 11 gene can also be used to diagnose human leukocytes Interleukin-13 (IL-13) receptor 11 related diseases. Human interleukin-13 (IL-13) receptor 11 mutant forms include point mutations, translocations, deletions, and recombination compared to normal wild-type human interleukin-13 (IL-13) receptor 11 DNA sequences And any other exceptions. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendelian ian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a chromosomal region associated with a disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human interleukin-13 (IL-13) receptor 11 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human interleukin-13 (IL-13) receptor 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions described in Conditions recommended by the manufacturer.

 Example 1 Cloning of human interleukin-13 (IL-13) receptor 11

Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) raRNA 2ug poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene) to form CDM by reverse transcription. Smart cDNA cloning kit (purchased from Clontech) was used for targeted insertion. The pBSK (+) vector (Clontech) was used to transform DH5α to form a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer ( Perkin-Elmer) determined the sequences of the 5 'and 3' ends of all clones. Comparing the determined cDNA sequences with the existing public DNA sequence database (Genebank), it was found that the cDNA sequence of one of the clones 0685a01 was new DNA The two-way determination of the inserted CDM fragments contained in this clone was performed by synthesizing a series of primers. The results show that the full-length CDM contained in clone 0 ⁶ 85a01 is 3648bp (such as Seq ID N0: l (Shown), there is a 290bp open reading frame (ORF) from 170bp to 460bp, which encodes a new protein (as shown in Seq ID NO: 2). We named this clone pBS-0685a01 and the encoded protein was named human interleukin-13 (IL-13) receptor 11. Example 2 The gene encoding human interleukin-13 (IL-13) receptor 11 was cloned by RT-PCR. The total RNA of fetal brain cells was used as a template, and ol-igo-dT was used as a primer for reverse transcription reaction to synthesize cDM. After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primerl: 5,-AGGATCGCTTGAGCTCAGGAGTTG-3, (SEQ ID NO: 3)

 Primer2: 5, — ATTGTTACCCTCTTTATTCCAAAA-3, (SEQ ID NO: 4)

 Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 _{μl of} Kol, L ikmol / L Tri s-HCl pH 8.50, 1.5 mmol / L MgCl ₂ , 200 _μ ηιο 1/1 dNTP, lOpmol in a reaction volume of 50 _μ 1 Primer, 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. The DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1 to 3648bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human interleukin-13 (IL-13) receptor 11 gene expression

Total A was extracted in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70 ° / »ethanol, dried and dissolved in water. With _20μ ε RNA, containing 20mM 3- (N- morpholino) propanesulfonic acid (PH7. 0) -5mM sodium acetate -ImM EDTA-2. 2M formaldehyde 1.2 »/. Electrophoresis was performed on an agarose gel. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare ³² P-labeled DNA probes by random primers. The DNA probe used was the PCR amplified human interleukin-13 (IL-13) receptor 11 coding region sequence (170bp to 460bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ffll) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH ₂ P0 ₄ (pH 7.4)-5 x SSC-5 x Denhardt, s solution and 20 (g / ml salmon sperm DNA. After hybridization, the filter was placed in lx SSC- 0.1% SDS in 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant human interleukin-13 (IL-13) receptor 11 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed The sequence is as follows:

Primer3: 5, — CATGCTAGCATGCATTTTATGGGGAGAGAGACT -3 '(Seq ID No: 5) Primer4: 5'- CATGGATCCCTACTGCTCTGCTCTGCAGCGATC-3, (Seq ID No: 6) The 5 ′ ends of these two primers are combined with Nhel and BamHI digestion sites, respectively. , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and BamHI restriction sites correspond to the expression vector plasmid pET- ²⁸ b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. The PCR reaction was performed using the pBS-0685a01 plasmid containing the full-length target gene as a template. PCR reaction conditions were: 1 in a total volume of ₅₀ μ plasmid pBS-0685a01 containing 10pg, primer Primer- 3 and Primer-4, respectively l Opmol, Advantage polymerase Mix (Clontech Products) 1 _μ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. The amplified product and plasmid pET-28 (+) were double digested with hel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 μ _§ / ηι1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0685a01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / ml) of LB liquid medium, host strain BL21 _(P ET-0685a01) at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). A purified target protein, human interleukin-13 (IL-1 12 receptor 11) was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 11 kDa (Figure 2). The band was transferred to a PVDF membrane for use. Analysis of the N-terminal amino acid sequence by the Edams hydrolysis method revealed that the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Anti-human interleukin-13 (IL -13) Production of receptor 11 antibodies

 The following peptides specific for human interleukin-13 (IL-13) receptor 11 were synthesized using a peptide synthesizer (product of PE):

NH2-Me t-Hi s -Phe-Me tG 1 y-Arg-G 1 u-Thr-Me t-Va 1 -Phe- I le-Arg-I l e-Pro-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43. Use ½ g of the above hemocyanin polypeptide The complex plus complete Freund's adjuvant was used to immunize rabbits, and after 15 days, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with 15 _g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human interleukin-13 (IL-13) receptor 11. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary probes, and then further computer sequence analysis, including the primary probe and its source sequence region (ie SBQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5- TGCATTTTATGGGGAGAGAGACTATGGTTTTTATCAGAATC -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

 5- TGCATTTTATGGGGAGAGAGCCTATGGTTTTTATCAGAATC -3 '(SEQ ID NO: 9) For other common reagents and their preparation methods not listed in the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambruck et al., Science Press.

 Sample Preparation:

 1.Extract DM from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 ramol / L Tris-HCl, pH 7.5; 25 mraol / L NaCl; 25 blue ol / LM _g Cl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5ml per 0.1 g of the initial tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add lnil every 0.1 g of the initial tissue sample), and then follow the following phenol extraction method.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, each 1- 5x l0 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A _26Q and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20C after packaging.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5raol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

Labeling of probes 1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase, to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) After combining the collection liquids of the first peak, the ³² P-Probe (the second peak is free γ ³² P-dATP) is prepared.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-10rag pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1 ° / »SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1 / oSDS at 37 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1%, 40. Wash for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

The hybridization experiment using low-intensity membrane washing conditions, the radioactivity of the hybrid spots of the above two probes is not strong. There are obvious differences; and in the hybridization experiment using high-intensity washing conditions, the radioactive intensity of the hybrid spot of probe 1 is significantly stronger than that of the hybrid spot of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 7 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μΐη. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95. C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Recorded in the other points ¹ J burning light will agent Cy3dUTP (5-Amino-propargyl- 2'-deoxyur idine 5 '- triphate coupled to Cy3 f luorescent dye, available from Araersham Phamacia Biotech Company) niRNA labeled human tissue mixed with a fluorescent reagent Cy5dUTP (5- Amino- propargyl- 2'- deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech) to label the mRNA of specific tissues (or stimulated cell lines) in the body, and to prepare probes after purification. needle. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davi s, RW (1995) Science. 270 (20): 467-480.

 (Three) cross

 The probes from the above two tissues and the chip were respectively hybridized in a UniHyb ™ Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (1 x SSC, 0.2¾SDS) at room temperature and then used. ScanArray 3000 scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profiles of human interleukin-13 (IL-13) receptor 11 and human interleukin-13 (IL-13) receptor according to the present invention are very similar.

Claims

Rights request

1. An isolated polypeptide-human interleukin-13 (IL-13) receptor 11, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide, Analogs or derivatives.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 170-460 in SEQ ID NO: 1 or the sequence of positions 1-3648 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide described in any of claims 4-6 and a plasmid, virus or vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human interleukin-13 (IL-13) receptor 11 activity, characterized in that the method includes:

 (a) cultivating the engineered host cell as described in claim 8 under conditions that express human interleukin-13 (IL-13) receptor 11;

(b) Isolation of human interleukin-13 (IL-13) receptor 11 Peptide.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human interleukin-13 (IL-13) receptor 11.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human interleukin-13 (IL-13) receptor 11.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human interleukin-13 (IL-13) receptor 11 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, and antagonists of human interleukin-13 (IL-13) receptor 11. Agents or inhibitors; or for peptide fingerprinting.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for the production of a gene Chip or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human interleukin-13 (IL-13) receptor 11.

 18. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.